AU638208B2 - Bacillus thuringiensis transformation - Google Patents

Description

638208 S F Ref: 95078 FORM COMMONWEALTH OF AUSTRALIA PATENTS ACT 1952 COMPLETE SPECIFICATION

(ORIGINAL)

FOR OFFICE USE: Class Int Class Complete Specification Lodged: Accepted: Published: Priority: Related Art: Name and Address of Applicant: Address for Service: Ciba-Geigy AG Klybeckstrasse 141 4002 Basle

SWITZERLAND

Spruson Ferguson, Patent Attorneys Level 33 St Martins Tower, 31 Market Street Sydney, New South Wales, 2000, Australia Complete Specification for the invention entitled: Bacillus Thuringiensis Transformation The following statement is a full description of this invention, including the best method of performing it known to me/us 5845/3 1 5-17038/1-3/= Bacillus thuringiensis transformation Abstract of the Disclosure The present invention describes a process that for the first time renders possible a direct and targeted genetic manipulation of Bacillus thuringiensis and the closely related B. cereus using recombinant DNA technology.

The present invention also relates to the construction of plasmids and "shuttle" vectors and to the B. thuringiensis strains that have been transformed therewith.

Also described is a process for the direct cloning, expression and identification of genes in B. thuringiensis and in the closely related B. cereus.

*e o e 0

S

SeS S 0 0 1A- 5-17038/1-3/= Bacillus thuringiensis transformation The present invention describes a process that for the first time renders possible a direct and targeted genetic manipulation of Bacillus thuringiensis and the closely related B. cereus using recombinant DNA technology, based on an efficient transformation process for the said Bacillus species.

The present invention furthermore relates to the construction of plasmids and "shuttle" vectors and to the B. thuringiensis and/or B. cereus S" strains that have been transformed therewith.

The present invention also relates to a process for inserting and, if desired, expressing genes or other useful DNA sequences in Bacillus thuringiensis and/or Bacillus cereus, but especially to a process for inserting and expressing protoxin genes.

The present invention also includes a process for the direct cloning and, if desired, expression and identification of novel genes or other useful

S.

DNA sequences in Bacillus thuringiensis and/or Bacillus cereus, as a result of which it is possible for the first time to establish gene banks directly in Bacillus thuringiensis and/or Bacillus cereus and to express them therein.

S

Bacillus thuringiensis belongs to the large group of gram-positive, aerobic, endospore-forming bacteria. Unlike the very closely related species of Bacillus, B. cereus and B. anthracis, the majority of the hitherto known B. thuringiensis species produce in the course of their sporulation a parasporal inclusion body which, on account of its crystalline structure, is generally referred to also as a crystalline body. This crystalline body is composed of insecticidally active crystalline protoxin proteins, the so-called 6-endotoxin.

-2- These protein crystals are responsible for the toxicity to insects of B. thuringiensis. The 6-endotoxin does not exhibit its insecticidal activity until after oral intake of the crystalline body, when the latter is dissolved in the alkaline intestinal juice of the target insects and the actual toxic component is released from the protoxin as a result of limited proteolysis caused by the action of proteases from the digestive tract of the insects.

The 6-endotoxins of the various B. thuringiensis strains are distinguished by high specificity with respect to certain target insects, especially with respect to various Lepidoptera, Coleoptera and Diptera larvae, and by their high degree of activity. Further advantages in using 6-endotoxins of B. thuringiensis reside in the obvious difficulty that the target insects have in developing resistance to the crystalline protein and in the fact that the toxins are harmless to humans, other mammals, birds, fish and insects, with the exception of the above-mentioned target ir.sects.

The insecticidal potential of B. thuringiensis protoxins was recognised very early on. Since the end of the twenties B. thuringiensis preparations have been used as bioinsecticides for controlling various diseases caused by insects in cultivated plants. With the discovery of B. thuringiensis var. israelensis by 1)Goldberg and Margalit (1977) and 2) B. thuringiensis var. tenebrionis by Krieg et al. (1983) it was possible for the range of use of B. thuringiensis to be extended even to So, mosquito and beetle larvae.

With the introduction of genetic engineering and the new possibilities resulting from it, the field of B. thuringiensis toxins has received a fresh impetus.

For example, the cloning of 6-endotoxin genes in foreign host organisms, such as, for example, in E. coli, is already routine. The result of this, meanwhile, has been that the DNA sequences of a whole series of 3genes are now known (for example 3Schnepf H.E. and Whiteley 1981; 4Klier A. et al., 1982; 5)Geiser M. et al., 1986; 6 Haider M.Z. et al., 1987).

Most of the B. thuringiensis species contain several genes that code for an insecticidally active protein. These genes, which are expressed only during the sporulation phase, are in the majority of cases located on large transferable plasmids (30 150 Md) and can therefore very easily be interchanged between the various B. thuringiensis strains and between B. thuringiensis and B. cereus, provided these are compatible )Gonzalez J.M. et al., 1982).

The protoxin genes of B. thuringiensis var. kurstaki belong to a family of related genes, various of which have already been cloned and sequenced. This work has been carried out especially in an E. coli *0 s.e* cloning system.

The cloning of B. thuringiensis genes has thus so far essentially been limited to some few and exclusively heterologous host systems, of which the E. coli system is the best researched and understood.

99 In the meantime, however, reports have also been published on the successful cloning and expression of protoxin genes in other host systems, such as, for example, in B. subtilis Klier et al., 1982), s 8) S Pseudomonas fluorescens Obukowicz M.G. et al., 1986), and Saccharomyces cerevisiae (EP 0 238 441). The insertion and expression of the 6-endotoxin gene in plant host cells has also been successful S (EP 0292 435).

S

In cloning in E. coli, advantage is taken of the fact that some protoxin genes happen to contain, in addition to gram-positive promoters, also an E. coli-like promoter. These promoter-like DNA sequences make it possible for the B. thuringiensis protoxin genes to be expressed also in heterologous host systems, provided these are capable of recognising the above-mentioned control sequences.

-4 After breaking open the host cells, the expressed protoxin proteins can then be isolated and identified using known methods.

It has since been demonstrated, however, that E. coli-like promoters are not present in all protoxin genes Donovan et al., 1988), and consequently so far only very specific protoxin genes that meet the above-mentioned prerequisites can be expressed and thus identified in heterologous .ost systems, The cloning of genes outside the natural host organism and the use of these strains as bioinsecticides in practice is thus associated with a number of disadvantages, some of which are serious: a) Expression of B. thuringiensis protoxin genes from the native expression sequences is possible only in certain cases.

S b) Generally there is no, or only a slight, secretion of expressed a S foreign proteins.

C

B

c) Correct folding of the 6-endotoxins is not always guaranteed in the reducing medium of heterologous host cells, and this could result in an undesirable change in the specific activity or in the host range of the toxins.

ow d) If expression occurs at all, the expression rates of the cloned foreign genes among the native expression sequences are mostly only low.

3);10) S)Schnepf and Whitley (1981; 1985) estimate that the B. thuringiensis •toxin cloned in E. coli constitutes only 0.5 to 1 of the total cell protein of E. coli, whereas the crystalline protein in B. thuringiensis amounts to between 30 and 40 of the dry weight of sporulating cultures. These considerable discrepancies between the expression rates may possibly be attributed to the lack of sporulation-specific control signals in the heterologous host systems and to difficulties in the recognition of the B. thuringiensis promoters and/or to problems in the post-translational modification of the toxin molecule by the foreign host.

e) Many of the host strains generally used for expression are toxicologically not as harmless as B. thuringiensis and B. cereus.

f) B. thuringiensis and B. cereus form a natural major component of microbial soil flora, which is not true of most of the host strains generally used for expression.

The problems and difficulties mentioned above could be overcome if the said B. thuringiensis genes could be cloned directly in the homologous host system where it is possible to use the natural gram-positive promoters of the protoxin genes for the expression.

As yet, however, there is no process that would make B. thuringiensis, this very important bacterium from the commercial point of view, amenable to direct genetic modification, and that would consequently render possible, for example, efficient reinsertion of a cloned protoxin gene into a B. thuringiensis strain.

The reason for this can be regarded, in particular, as being the fact that the development of an efficient transformation system for B. thuringiensis and the closely related B. cereus that would ensure adequately high transformation rates and consequently render possible the application also to B. thuringiensis of established rDNA techniques has not as yet been successful.

The processes used so far to produce new B. thuringiensis strains having novel insecticidal properties are based chiefly on transfer by conjugation of plasmid-encoded protoxin genes.

Successful reinsertion of a cloned B. thuringiensis crystalline protein gene into B. thuringiensis has to date been described only in one case )Klier A. et al., 1983), but in that case too, owing to the lack of a suitable transformation system for B. thuringiensis, it was necessary to resort to transfer by conjugatiun between E. sibtilis and B. thuringiensis. Furthermore, in this process described by Klier et al.

E. coli is used as intermediate host.

6- The processes of transfer by conjugation, however, have a whole series of serious disadvantages that makes them appear unsuitable for routine use for the genetic modification of B. thuringiensis and/or B. cereus.

a) The transfer of plasmid-encoded protoxin genes by conjugation is possible only between B. thuringiensis strains and between B. cereus and B. thuringiensis strains that are compatible with one another.

b) With transfer of plasmids by conjugation between more distant strains, often only a low transfer frequency is achieved.

c) There is no possible way of regulating or modifying the expression of the protoxin genes.

d) There is no possible way of modifying the gene itself.

S* e) If several protoxin genes are present in one strain the expression of individual genes may be greatly reduced as a result of the so-called gene-dosage effect.

f) Instabilities may arise as a result of a possible homologous recombination of related protoxin genes.

Alternative transformation processes, which have since been used routinely for many gram-positive organisms, have proved unsuitable both for B. thuringiensis and for B. cereus.

One of the above-mentioned processes is, for example, the direct transformation of bacterial protoplasts by means of polyethylene glycol treatment, which has been used successfully in the case of many Streptomyces strains 12 Bibb J.J. et al., 1978) and in the case of B. subtilis 13)Chang S. and Cohen 1979), B. megaterium (4)Brown B.J. and Carlton 1980), Streptococcus lactis J.K. and McKay 1984), S. faecalis 1 6 )Wirth R. et al.), Corynebacterium glutamicum 17)Yoshihama M. et al., 1985) and numerous other gram-positive bacteria.

7- To use this process, the bacterial cells must first of all be converted to protoplasts, that is to say the cell walls are digested using lytic enzymes.

Another prerequisite for the success of this direct transformation process is the expression of the newly introduced genetic information and the regeneration of the transformed protoplasts on complex solid media before successful transformation can be detected, for example using a selectable marker.

This transformation process has proved unsuitable for B. thuringiensis and the closely related B. cereus. As a result of the high resistance of B. thuringiensis cells to lysozyme and the very poor regenerability of S the protoplasts to intact cell wall-containing cells, the rates of transformation achievable remain low and difficult to reproduce 18) 19) Alikhanian S.J. et al., 1981; Martin P.A. et al., 1981; 2 Fischer H-M et al., 1984).

*0 we 6 With this process it is possible therefore, at the most, for very simple plasmids, which are unsuitable for work with recombinant DNA, to be inserted at a low frequency into B. thuringiensis or B. cereus cells.

*4 Individual reports on satisfactory rates of transformation that it has I been possible to achieve using the afore-described process rely on the formulation of very complex optimising programmes, but these programmes are always applicable specifically to one particular B. thuringiensis strain only and involve high expenditure in terms of time and money S 21) Schall 1986). Such processes are therefore unsuitable for routine

C

application on an industrial scale.

As the intensive research work in the field of B. thuringiensis genetics demonstrates, there is substantial interest in developing new processes that would make B. thuringiensis or the closely related B. cereus amenable to direct genetic modification and would thus, for example, -8render possible the cloning of protoxin genes in the natural host system.

Despite this research there are still no satisfactory solutions to the existing difficulties and problems.

Suitable transformation processes that render possible a rapid, efficient and reproducible transformation of B. thuringiensis and/or B. cereus with an adequately high transformation frequency are not available currently, and neither are suitable cloning vectors that permit the application also to B. thuringiensis of the recombinant DNA techniques already established for other bacterial host systems. The same is true for B. cereus.

This object has now surprisingly been achieved within the scope of the present invention by the use of simple process steps, some of which are .ee. known.

*The present invention thus relates to a novel process, based on recombinant DNA technology, that for the first time renders possible a direct, specifically controlled and reproducible genetic manipulation of B. thuringiensis and of B. cereus by transforming Bacillus thuringiensis and/or Bacillus cereus with high efficiency by means of a simple transformation process using a recombinant DNA that is suitable for the said genetic manipulation of Bacillus thuringiensis and/or Bacillas cereus.

S* The present invention furthermore relates to a process for inserting, cloning and expressing genes or other useful DNA sequences, but especially protoxin genes, in B. thuringiensis and/or B. cereus, which 0 comprises: a) isolating the said genes or DNA; b) if desired operably joining the isolated genes or DNA to expression sequences that are capable of functioning in Bacillus thuringiensis and/or B. cereus; c) introducing the genetic constructs from section b) into Bacillus thuringiensis and/or B. cereus cells by transformation using suitable vectors; and d) if desired expressing a corresponding gene product and, if desired, isolating it.

-9- The present invention also includes a direct piocess for cloning, expressing and identifying genes or other useful DNA sequences, but especially protoxin genes, in B. thuringiensis and/or B. cereus, which comprises: a) digesting the total DNA of Bacillus thuringiensis using suitable restriction enzymes; b) isolating from the resulting restriction fragments those of suitable size; c) inserting the said fragments into a suitable vector; d) transforming Bacillus thuringiensis and/or B. cereus cells with the said vector; and e) locating novel DNA sequences using suitable screening methods and, if desired, isolating them from the transformants.

6 Apart from structural genes it is obviously also possible for any other useful DNA sequences to be used in the process according to the invention, such as, for example, non-coding DNA sequences that have a regulatory function, such as, for example, "anti-sense DNA".

The process of the invention thus opens up a large number of new possibilities that are of extraordinary interest from both scientific and commercial points of view.

For example, it is now possible for the first time to obtain infor- tion on a genetic level about the regulation of 6-endotoxin synthesis, especially in respect of sporulation.

Also, it should now be possible to clarify at which position of the toxin molecule the region(s) responsible for the toxicity to insects is (are) located, and to what extent this (these) is (are) also associated with the host specificity.

10 Knowledge of the molecular organisation of the various toxin molecules and of the toxin genes coding for these molec a from the various species of B. thuringiensis is of extraordinary practical interest for a controlled genetic manipulation of those genes, which is now possible for the first time using the process of the invention.

In addition to a controlled modification of the 6-endotoxin genes themselves, the novel process of the invention permits also the manipulation of the regulatory DNA sequences controlling the expression of those genes, as a result of which the specific properties of the 6-endotoxins, such as, for example, their host specificity, their resorption behaviour inter alia, can be modified in a specifically controlled manner, and the production rates of the 6-endotoxins can be increased, for example by the insertion of stronger and more efficient promoter sequences.

By specifically controlled mutation of selected genes or subgenes in I vitro it is thus possible to obtain new B. thuringiensis and/or B. cereus variants.

Another possible way of constructing novel B. thuringiensis and/or B. cereus variants comprises splicing together genes or portions of genes that originate from different B. thuringiensis sources, resulting in B. thuringiensis and/or B. cereus strains with a broader spectrum of use.

o' It is also possible for synthetically or semi-synthetically produced toxin genes to be used in this manner for constructing new B. thuringiensis and/or B. cereus varieties.

In addition, the process according to the invention renders possible for the first time, as a result of the pronounced increase in the transformation frequency and the simplicity of the process, the establishment of gene banks and the rapid screening of modified and new genes in B. thuringiensis and/or B. cereus.

11 In particular, the process of the invention now for the first time renders possible direct expression of gene banks in B. thuringiensis and/or B. cereus and the identification of new protoxin genes in B. thuringiensis using known, preferably immunological or biological processes.

The subject of the present invention is accordingly a process, based on a pronounced increase in the efficiency of B. thuringiensis/B. cereus transformation compared with known processes, that for the first time renders possible a direct genetic modification of the B. thuringiensis and/or B. cereus genome.

In particular, the present invention relates to a process for the transformation of B. thuringiensis and/or B. cereus by inserting recombinant DNA, especially plasmid and/or vector DNA, into B. thuringiensis and/or B. cereus cells by means of electroporation.

a q Preferred is a process for the transformation of B. thuringiensis and/or e s. B. cereus with DNA sequences coding for 6-endotoxin and DNA sequences coding for a protein that has substantially the insect-toxic properties of the said B. thuringiensis toxins.

t n The present invention also relates to the expression of DNA sequences that code for an 6-endotoxin, or for a protein that at least has substantially the insect-toxic properties of the B. thuringiensis toxin, in transformed B. thuringiensis and/or B. cereus cells.

The present invention also includes a process for the production of Sbifunctional vectors, so-called "shuttle" vectors, for B. thuringiensis and/or B. cereus, and the use of the said "shuttle" vectors for the transformation of B. thuringiensis and/or B. cereus cells.

Preferred is the construction of bifunctional vectors that in addition to replicating in B. thuringiensis and/or B. cereus also replicate in one or more other heterologous host systems, but especially in E. coli cells.

12 The present invention relates especially to a process for the production of "shuttle" vectors for B. thuringiensis and/or B. cereus that contain a DNA sequence coding for a 6-endotoxin polypeptide that occurs naturally in B. thuringiensis, or at least a polypeptide that is substantially homologous therewith, that is to say that at least has substantially the insect-toxic properties of the B. thuringiensis toxin. The present invention also includes the use of these "shuttle" vectors for the transformation of B. thuringiensis and/or B. cereus cells and the expression of the DNA sequences present on the said "shuttle" vectors, especially those DNA sequences that code for a 6-endotoxin of B. thuringiensis or at least for a protein that has substantially the insect-toxic properties of the B. thuringiensis toxins.

The present invention also includes the use of B. thuringiensis and/or B. cereus as general host organisms for cloning and expressing homologous 4 and especially also heterologous DNA, or a combination of homologous and heterologous DNA.

0. This invention also relates to the above more closely characterised S plasmids and "shuttle" vectors themselves, to the use thereof for the transformation of B. thuringiensis and/or B. cereus, and to B. thuringiensis and B. cereus cells that have been transformed with S14 them.

L 98 S' Especially preferred within the scope of this invention are the bifunctional ("shuttle") vectors pXI61 (=pK61) and pXI93 (=pK93) which, introduced by transformation into B. thuringiensis var. kurstaki HDlcryB and into B. cereus 569K, have been deposited at the "Deutsche Sammlung von Mikroorganismen" (Braunschweig, Federal Republic of Germany), recognised as an International Depository, in accordance with the Budapest Treaty under the number DS (pXI61, introduced by transformation into B. thuringiensis var. kurstaki HDlcryB) and DSH 4571 (pX193, introduced by transformation into B. thuringiensis var. kurstaki HDlcryB) and DSM 4573 (pXI93, introduced by transformation into B. cereus 569K).

13 The present invention relates especially to novel B.thuringiensis and B.cereus varieties that have been transformed with a DNA sequence that codes for a delta-endotoxin of B.thuringiensis and that can be expressed, or transformed with a DNA sequence coding for at least one protein that has substantially the toxic properties of the B.thuringiensis toxins.

The transformed B.thuringiensis and B.cereus cells and the toxins produced by them can be used for the preparation of insecticidal compositions, to which the present invention also relates.

The invention also relates to methods of, and to compositions for, controlling insects using the above more closely characterised transformed B.thuringiensis and/or B.cereus cells or a cell-free crystalline body-(delta-endotoxin) preparation containing protoxins produced by the said transformed Bacillus cells.

According to a first embodiment of this invention, there is provided a process for inserting and cloning DNA sequences in gram positive bacteria selected from the group consisting of Bacillus thuringiensis and 3acilluscereus, comprising: isolating the DNA to be introduced; cloning the thus isolated DNA in a cloning vector that is capable of replicating in a bacterial host cell selected from the group consisting of Bacillus thuringiensis and Bacillus cereus cells in a heterologous cloning system; directly introducing the thus cloned vector DNA into the said 25 bacterial cell via electroporation at a transformation rate sufficient to overcome the restriction barrier present in the said bacterial cells; and cultivating the thus transformed bacterial cells and isolating the thus cloned vector DNA.

According to a second embodiment of this invention, there is 30 provided a process for inserting, cloning and expressing DNA sequences in gram positive bacteria selected from the group consisting of Bacillus thuringiensis and Bacilluscereus, comprising: isolating the DNA to be introduced and optionally ligating the thus isolated DNA with expression sequences that are capable of 4 functioning in bacterial cells selected from the group consisting of Bacillus thuringiensis and Bacillus cereus cells; cloning the thus isolated DNA in a cloning vector that is capable of replicating in a bacterial host cell selected from the group consisting of Bacillus thuringiensis and Bacillus cereus cells in a

S%.

*.00* .000 .0 0 -Q ,RA M/926Z 13A heterologous cloning system; directly introducing the thus cloned vector DNA into the said bacterial cell via electroporation at a transformation rate sufficient to overcome the restriction barrier present in the said bacterial cells; and cultivating the thus transformed bacterial cells and isolating the thus cloned vector DNA and the expressed gene product.

According to a third embodiment of this invention, there is provided a bifunctional vector to be used in a process according to the first or second embodiments that, apart from being capable of replicating in bacterial cells selected from the group consisting of B.thuringiensis and B.cereus cells, are capable of replicating in at least one other heterologous host organism and that is identifiable in both the homologous and the heterologous host system and that comprises under the control of expression sequences that are capable of functioning in bacterial cells selected from the group consisting of Bacillusthuringiensis and Bacilluscereus cells a structural gene encoding a delta-endotoxin polypeptide that occurs naturally in B.thuringiensis, or for a polypeptide that has substantial structural homologies therewith and has still substantially the toxicity properties of the said crystalline delta-endotoxin polypeptide.

According to a fourth embodiment of this invention, there is provided the bifunctional vector pX193 (pK93) introduced into B.thuringiensis var. kurstaki HDlcryB (DSM 4571) and B.cereus 569K (DSM 4573).

25 According to a fifth embodiment of this invention, there is provided a bacterial host cell selected from the group consisting of B.thuringiensis and B.cereus cells prepared by a method as described in the first or second embodiments comprising a bifunctional vector according to the third embodiment.

30 According to a sixth embodiment of this invention, there is provided a method of controlling insects which comprises treating insects or their habitat with a bacterial host cell according to the fifth embodiment, or with a mixture thereof; or alternatively with a cell-free crystal-body preparation according to a protoxin that is produced by a bacterial host cell according to the fifth embodiment. According to a seventh embodiment of this invention, there is u1) provided a composition for controlling insects, comprising: /926Z ^MM/926Z a a a a a. a

P

KNTO'

13B a bacterial host cell according to the fifth embodiment, or a mixture thereof; or alternatively a cell-free crystal-body preparation containing a protoxin that is produced by a bacterial host cell according to the fifth embodiment, together with carriers, dispersing agents or carriers and dispersing agents conventionally employed.

According to an eighth embodiment of this invention, there is provided a process for the identification of new delta-endotoxin encoding genes in Bacillusthuringiensis, which process comprises digesting the total DNA of Bacillus thuringiensis using suitable restriction enzymes; isolating from the resulting restriction fragments those of suitable size; inserting the said fragments into a suitable vector; constructing a genomic DNA library by transforming Bacillus thuringiensis host cells with the said vector using a process according to the first embodiment; screening the thus obtainable DNA library for new delta-endotoxin encoding genes.

The following is a brief description of the Figures: Figure 1: Transformation of E.coli HB 101 with pBR322 and dhuringiensis DHlcryB with pBC6(- A number of surviving *HDlcryB cells).

Figure 2: Influence of the age of a thuringiensis HDlcryB culture on the transformation frequency.

Figure 3: Influence of the pH value of the PBS buffer solution on the transformation frequency.

Figure.4: Influence of the saccharose concentration of the PBS 30 buffer solution on the transformation frequency.

Figure 5: Interdependence of the number of transformants and the

S

amount of DNA used per transformation.

14 Figure 6: Simplified restriction map of the "shuttle" vector *pXI61. The shaded region characterises the sequences originating from the gram-positive pBC16, the remainder originating from the gram-negative plasmid pUC8.

Figure 7: Simplified restriction map of *pXI93. The shaded region characterises the protoxin structural gene (arrow, Kurhdl) and the 5' and 3' non-coding sequences. The remaining unshaded part originates from the "shuttle" vector *pXI61.

Figure 8: SDS (sodium dodecyl sulfate)/polyacrylamide gel electrophoresis of extracts of sporulating cultures of thuringiensis HDlcryB, B. cereus 569K and their derivatives. *HDlcryB (pXI93), 2: *HDlcryB (pXI61), 3: *HDlcryB, 4: HD1, LEG B-4449, 5: cereus 569K (pXI93), 6: 569K]

S

a) Comassie-dyed, M: molecular weight standard, MW: molecular weight (Dalton), arrow: position of the 130,000 Dalton protoxin.

S b) Western blot of the same gel, to which there have been added S polyclonal antibodies to the K-I crystalline protein of B. thuringiensis HD1.

Positive bands were found with the aid of labelled anti-goat antibodies.

Arrow: position of the 130,000 Dalton protoxin. Other bands: degradation products of the protoxin.

Figure 9: Transformation of B. subtilis LBG B-4468 with pBC16 plasmid DNA using the electroporation process optimised for B. thuringiensis.

transformants/pg plasmid DNA; number of living bacteria/ml) S* The internal reference pK selected for the nomenclature of the plasmids in the priority document has been replaced for the Auslandsfassung (foreign filing text) by the officially recognised designation pXI.

Also, the names for the asporogenic B. thuringiensis HD1 mutants used in the Embodiment Examples have been changed from cryB to cryB.

15 An essential aspect of the present invention concerns a novel transformation process for B. thuringiensis and B. cereus based on the insertion of plasmid DNA into B. thuringiensis and/or B. cereus cells using electroporation technology, which is known per se.

All attempts up to the time of the present invention to apply the transformation processes already established for other bacterial host systems to B. thuringiensis and the closely related B. cereus having been frustrated, it is now possible within the scope of this invention to achieve surprising success using electroporation technology and accompanying steps.

This success must also be considered surprising and unexpected, especially since electroporation tests with B. thuringiensis protoplasts were 22) carried out at an earlier date by a Soviet group Shivarova N. et al., 1983), but the transformation frequencies achieved were so low that this process was subsequently regarded as unusable for B. thuringiensis om** transformation and consequently received no further attention.

S

S

Building upon investigations into the process parameters critical for an electroporation of B. thuringiensis and/or B. cereus cells, it has now surprisingly been possible to develop a transformation process that is S ideally adapted to the requirements of B. thuringiensis and B. cereus and results in transformation rates ranging from 106 to 108 cells/pg of plasmid DNA, but especially from 106 to 107 cells/jg of plasmid DNA.

Roughly equally high transformation rates with values from 102 to a maximum of 106 transformants/pg of plasmid DNA could hitherto be achieved S only with the PEG (polyethylene glycol) transformation process described 21) by Schall (1986). High transformation rates remained restricted, however, to those B. thuringiensis strains for which the PEG process was specifically adapted in very time-consuming optimisation studies, which makes this process appear unsuitable for practical use.

Furthermore, the reproducibility of that process in practice is in many cases non-existent or poor.

16 In contrast, the process of the present invention is a transformation process that in principle is applicable to all B. thuringiensis and B. cereus strains, and that is less time-consuming, more rational and consequently more efficient than the traditional PEG transformation process.

For example, in the process of the invention it is rossible to use. for example, whole intact cells, thus dispensing with 'se time-consuming production of protoplasts critical for B. thuringiensis and B. cereus and with the subsequent regeneration on complex nutrient media.

Furthermore, when using the PEG process, carrying out che necessary process steps can take up to a week, whereas with the transformation process of the invention the transformed cells can be obtained within a few hours (as a rule overnight).

Another advantage of the process of the invention concerns the number of B. thuringiensis and/or B. cereus cells that can be transformed per unit of time.

*S

Whereas in the traditional PEG process only small aliquots can be plated out simultaneously in order to avoid inhibition of the regeneration as a result of the growth of the cells being too dense, when using the electroporation technique large amounts of B. thuringiensis and/or B. cereus cells can be plated out simultaneously.

*oo* This renders possible the detection of transformants even at very low transformation frequencies, which with the afore-described processes is not possible or is possible only with considerable expenditure.

Furthermore, amounts of DNA in the nanogram range are sufficient to obtain at least some transformants.

17 This is especially important if a very efficient transformation system is necessary, such as, for example, when using DNA material from E. coli, which on account of a strongly pronounced restriction system in B. thuringiensis cells can lead to a reduction of the transformation frequencies by a factor of 10 3 compared with B. thuringiensis DNA.

The transformation process of the invention, which is based essentially on electroporation technology known per se, is characterised by the following specific process steps: a) Preparation of a cell suspension of suitable cell density in a culture medium suitable for growing B. thuringiensis cells and with aeration adequate for the growth of che cells; S b) separation of the cells from the cell suspension and resuspension in an inoculation buffer suitable for the subsequent electroporation; c) addition of a DNA sample in a concentration suitable for the electroporation; *0* d) introduction of the batch described under points b) and c) into an electroporation apparatus; e) one or more brief discharges of a capacitor across the cell suspension for the short term-production of high electric field strengths for a period that is adequate for transformation of B. thuringiensis and/or B. cereus cells with recombinant DNA; f) optional reincubation of the electroporated cells; s g) plating out of the electroporated cells onto a suitable selection medium; and h) selection of the transformed cells.

In a specific embodiment of the process of the invention that is preferred within the scope of the invention, the B. thuringiensis cells are first of all incubated in a suitable nutrient medium with adequate 18 aeration and at a suitable temperature, preferably of from 200C to until an optical density (ODsso) of from 0.1 to 1.0 is achieved. The age of the Bacillus cultures provided for the electroporation has a distinct effect on the transformation frequency. An optically density of the Bacillus cultures of from 0.1 to 0.3, but especially of 0.2, is therefore especially preferred. Attention is, however, drawn to the fact that it is also possible to achieve good transformation frequencies with Bacillus cultures from other growth phases, especially with overnight cultures (see Figure 2).

Generally, fresh cells or spores are used as starting material, but it is also equally possible to use deep-frozen cell material. The cell material is preferably cell suspensions of B. thuringiensis and/or B. cereus cells in suitable liquid media to which, advantageously, a certain amount of an "antifreeze solution" has been added.

0 Suitable antifreeze solutions are especially mixtures of osmotically active components and DMSO in water or a suitable buffer solution. Other suitable components that can be used in antifreeze solutions include sugars, polyhydric alcohols, such as, for example, glycerol, sugar alcohols, amino acids and polymers, such as, for example, polyethylene 1 glycol.

6t If B. thuringiensis spores are used as starting material, they are first of all inoculated in a suitable medium and incubated overnight at a suitable temperature, preferably of from 25 0 C to 28 0 C, and with adequate aeration. This batch is then diluted and further treated in the manner described above.

To induce sporulation in B. thuringiensis it is possible to use any medium that causes such a sporulation. Within the scope of this invention 23) a GYS medium according to Yousten A.A. and Rogoff (1969) is preferred.

Oxygen is usually introduced into the culture medium by moving the culture, for example using a shaker, speeds of rotation of from revs/min to 300 revs/min being preferred.

19 B. thuringiensis spores and vegetative microorganism cells are cultured within the scope of the present invention according to known generally customary processes, liquid nutrient media preferably being used for reasons of practicability.

The composition of the nutrient media may vary slightly depending on the strain of B. thuringiensis or B. cereus used. Generally, complex media with loosely defined, readily assimilable carbon and nitrogen sources are preferred, like those customarily used for culturing aerobic Bacillus species.

In addition, vitamins and essential metal ions are necessary, but these are usually contained in an adequate concentration as constituents or impurities in the complex nutrient media used.

If desired, the said constituents, such as, for example, essential vitamins and also 2+ 2+ 2+ 3+ NH 3- 2vitamins and also Na K CU Ca Mg e NH, P4 04 2- Cl CO 3 ions and the trace elements cobalt and manganese, zinc, etc., can be added in the form of their salts.

In addition to yeast extracts, yeast hydrolysates, yeast autolysates and yeast cells, especially suitable nitrogen sources are in particular soya meal, maize meal, oatmeal, edamine (enzymatically digested lactalbumin), peptone, casein hydrolysate, corn steep liquors and meat extracts, without the subject of the invention being in any way limited by this list of examples.

C* SThe preferred concentration of the mentioned N-sources is from g/1 to 20 g/1.

Suitable C-sources are especially glucose, lactose, sucrose, dextrose, maltose, starch, cerelose, cellulose and malt extract. The preferred concentration range is from 1.0 g/l to 20 g/l.

20 Apart from complex nutrient media it is obviously also possible to use semi- or fully-synthetic media that contain the above-described nutrients in a suitable concentration.

Apart from the LB medium preferably used within the scope of the present invention it is also possible to use any other culture medium suitable for culturing B. thuringiensis and/or B. cereus, such as, for example, Antibiotic Medium 3, SCGY medium, etc.. Sporulated B. thuringiensis cultures are preferably stored on GYS media (inclined agar) at a temperature of 4°C.

After the cell culture has reached the desired cell density, the cells are harvested by means of centrifugation and suspended in a suitable buffer solution that has preferably been cooled beforehand with ice.

In the course of the investigations, the temperature proved not to be critical and is therefore freely selectable within a broad range. A temperature range of from 0°C to 35 0 C, preferably from 20C to 15 0 C and more especially a temperature of 4°C, is preferred. The incubation period of the Bacillus cells before and after electroporation has only a slight effect on the transformation frequency attainable (see Table Only an excessively long incubation results in a decrease in the transformation 0* frequency. An incubation period of from 0.1 to 30 minutes, especially of minutes, is preferred. In the course of the investigations, the temperature proved not to be critical and is therefore freely selectable within a broad range. A temperature range of from 0°C to 350C, preferably from 2°C to 15 0 C and more especially a temperature of 4°C, is preferred.

This operation can be repeated one or more times. Buffer solutions that are especially suitable within the scope of this invention are osmotically stabilised phosphate buffers that contain as stabilising agent sugars such as, for example, glucose or saccharose, or sugar alcohols, such ae, for example, mannitol, and have pH values set to from to 8.0. More especially preferred are phosphate buffers of the PBS type having a pH value of from 5.0 to 8.0, preferably of from 5.5 to that contain saccharose as stabilising agent in a concentration of from 0.1M to 1.OM, but preferably of from 0.3M to 0.5M (see Figures 3 and 4).

21 Aliquots of the suspended Bacillus cells are then transferred into cuvettes or any other suitable vessels and incubated together with a DNA sample for a suitable period, preferably for a period of from 0.1 to 30 minutes, but especially of from 5 to 15 minutes, and at a suitable temperature, preferably at a temperature of from 0°C to 35 0

C,

but especially at a temperature of from 20C to 150C and more especially at a temperature of When e-erating at low temperatures it is advantageous to use cuvettes that have already been precooled, or any other suitable precooled vessels.

Over a wide range there is a linear relationship between the number of transformed cells and the DNA concentration used for the electroporation, a the number of transformed cells increasing as the DNA concentration increases (see Figure The DNA concentration preferred within the scope of this invention is in a range of from 1 ng to 20 pg. A DNA concentration of from 10 ng to 2 pg is especially preferred.

Subsequently the entire batch containing B. thuringiensis and/or B. cereus cells and plasmid DNA or another suitable DNA sample is introduced into an electroporation apparatus and subjected to electroporation, that is to say is briefly exposed to an electric pulse.

4* Electroporation apparatus suitable for use in the process of the invention is already available from a variety of manufacturers, such as, for example, from Bio Rad (Richmond, CA, USA; "Gene Pulser Apparatus"), Biotochnologies and Experimental Research Inc. (San Diego, CA, USA; S "BTX Transfector 100"), Promega (Madison, WI, USA; "X-Cell 2000 Electroporation System"), etc..

It is obviously also possible to use any other suitable apparatus in the process of the invention.

Various pulse forms can be used, for example rectangular pulses or alternatively exponentially decaying pulses.

22 The latter are preferred within the scope of this invention. They are produced by the discharging of a capacitor and are characterised by an initially very rapid increase in voltage and by a subsequent exponential decaying phase as a fanction of resistance and capacitance. The time constant RC provides a measure of the length of the exponential decay time. It corresponds to the time necessary for the voltage to decay to 37 of the initial voltage (V One parameter decisive in influencing the bacterial cell concerns the strength of the electric field acting on the cells, which is calculated from the ratio of the voltage applied to the distance between the electrode plates.

Also of great importance in this connection is the exponential decay time, which depends on the configuration of the apparatus used (for example the capacitance of the capacitor) and on other parameters, such as, for example, the composition of the buffer solution or the volume of cell suspension provided for the electroporation.

In the course of the investigations it has been demonstrated, for example, that reducing by half the volume of the cell suspension provided for the electroporation results in an increase in the transformation frequency by a factor of b A prolongation of the exponential decay time by way of an optimisation of the buffer solution used also results in a distinct increase in the transformation frequency.

S

All measures that result in a prolongation of the exponential decay time and consequently in an increase in the transformation frequency are therefore preferred within the scope of this invention.

The decay time preferred within the scope of the process of the invention is from approximately 2 ms to approximately 50 ms, but especially from approximately 8 ms to approximately 20 ms. Most especially preferred is an exponential decay time of from approximately 10 ms to approximately 12 ms.

23 Within the scope of the present invention, the bacterial cells are acted upon for short periods by very high electric field strengths by means of brief discharge(s) of a capacitor across the DNA-containing cell suspension; as a result of this, the permeability of the B. thuringiensis cells is briefly and reversibly increased. The electroporation parameters are so coordinated with each other in the course of the process of the invention that optimum absorption into the Bacillus cells of the DNA located in the electroporation buffer is ensured.

The capacitance setting of the capacitor within the scope of this invention is advantageously from 1 pF to 250 pF, but especially from 1 pF to 50 pF and more especially is 25 p1. The choice of the initial voltage is not critical, and is therefore freely selectable, within wide ranges.

o**O An initial voltage V of from 0.2 kV to 50 kV, but especially of from 0.2 kV to 2.5 kV and more especially of from 1.2 kV to 1.8 kV, is preferred. The distance between the electrode plates depends, inter alia, a, on the size of the electroporation appFratus. It is advantageously from 0.1 cm to 1.0 cm, preferably from 0.2 cm to 1.0 cm, and more especially is 0.4 cm. The field strength values that act on the cell suspension result from the distance between the electrode plates and the initial voltage set in the capacitor. These values are advantageously in a range of from 100 V/cm to 50,000 V/cm. Field strengths of from 100 V/cm to 10,000 V/cm, but particularly of from 3,000 V/cm to 4,500 V/cm, are especially preferred.

The fine coordi .ation of the freely selectable parameters, such as, for example, capacitance, initial voltage, distance between plates etc., Sdepends to a certain extent on the architecture of the apparatus used and can therefore vary from case to case within certain limits. In certain cases, therefore, it is possible to exceed or fall below the limiting values indicated, should this be necessary in order to achieve optimum field strengths.

The actual electroporation operation can be repeated one or more times until the optimum transformation frequency for the system in question has been achieved.

24 Following the electroporation, the treated Bacillus cells can advantageously be reincubated, preferably for a period of from 0.1 to 30 minutes, at a temperature of from 0°C to 35 0 C, preferably from 2°C to 15 0 C. The electroporated cells are then diluted with a suitable medium and incubated again for a suitable period, preferably from 2 to 3 hours, with adequate aeration and at a suitable temperature, preferably of from 20 0

C

to 35 0

C.

The B. thuringiensis cells are then plated out onto solid media that contain as an additive an agent suitable for selecting the new DNA sequences introduced into the bacterial cell. Depending on the nature of the DNA used, the said agent may be, for example, an antibiotically active compound or a dye, inter alia. Antibiotics selected from the group consisting of tetracycline, kanamycin, chloramphenicol and erythromycin o are especially preferred within the scope of this invention for the selection of Bacillus thuringiensis and/or B. cereus cells.

Also preferred are chrorogenic substrates, such as, for example, X-gal (5-bromo-4-chloro-3-indolyl-B-D-galactoside), which can be detected by way of a specific colour reaction.

Other phenotypic markers are known to the skilled person and can also be used within the scope of this invention.

It is possible to use any nutrient medium suitable for culturing B. thuringiensis cells, to which one of the conventionally employed solidifying media, such as, for example, agar, agarose, gelatin, etc., is added.

The process parameters described hereinbefore in detail for B. thuringiensis are applicable in the same manner to B. cereus cells.

Unlike the processes hitherto available in the prior art, the process of the invention for the transformation of B. thuringiensis and B. cereus described hereinbefore is not limited to the use of specific natural 25 plasmids occurring in B. thuringiensis and/or B. cereus but is applicable to all types of DNA.

It is accordingly now possible for the first time to transform B. thuringiensis and/or B. cereus in a controlled manner, it being possible to use apart from homologous plasmid DNA, that is to say plasmid DNA occurring naturally in B. thuringiensis or the closely related B. cereus, also plasmid DNA of heterologous origin.

This may be either plasmid DNA that occurs naturally in an organism other than B. thuringiensis or the closely related B. cereus, such as, for example, plasmids pUB110 and pC194 from Staphylococcus aureus 24)Horinouchi S. and Weisblum 1982; 25)Polak J. and Novick R.P., 1982) and plasmid pIM13 from B. subtilis (26)Mahler J. and Halvorson 1980), which are capable of replicating in B. thuringiensis and/or B. cereus, or hybrid plasmid DNA constructed by recombinant DNA technology from homologous plasmid DNA or from heterologous plasmid DNA or alternatively from a combination of homologous and heterologous plasmid DNA. The last-mentioned hybrid plasmid DNA is better suited for work with recombinant DNA than the natural isolates.

0 There may be mentioned by way of example here, without the subject of the present application in any way being limited, the plasmids pBD64 27)Gryczan T. et al., 1980), pBD347, pBD348 and pUB1664.

*S

The cloning vectors already established for B. subtilis, such as, for example, pBD64, may be of particular importance for carrying out the cloning experiments in various B. thuringiensis and B. cereus strains.

Apart from plasmid DNA, it is now possible within the scope of the present invention to introduce any other DNA into B. thuringiensis and B. cereus by transformation. The transformed DNA can replicate'either autonomously or integrated in the chromosome. It may be, for example, a vector DNA derived not from a plasmid but from a phage.

The present invention also relates to the construction of bifunctional vectors ("shuttle" vectors).

26 Especially preferred within the scope of this invention is the construction and use of bifunctional (hybrid) plasmid vectors, so-called "shuttle" vectors, that are capable of replicating in one or in several heterologous host organisms apart from in B. thiringiensis or the closely related B. cereus, and that are identifiable both in homologous and in heterologous host systems.

Heterologous host organisms are to be understood within the scope of this invention as all those organisms that do not belong to the B. thuringiensis/B. cereus group and that are capable of maintaining in a stable condition a self-replicating DNA.

According to the above definition it is therefore possible for both S prokaryotic and eukaryotic organisms to function as heterologous host organisms. At this point there may be mentioned by way of example, as representatives from the prokaryotic host organism group, individual examples from the genera Bacillus, such as, for example, B. subtilis or B. megaterium, Staphylococcus, such as, for example, S. aureus, Streptococcus, such as, for example. Streptococcus faecalis, Streptomyces, such as, for example Streptomyces spp., Pseudomonas, such as, for example, Pseudomonas spp., Escherichia, such as, for example, S E. coli, Agrobacterium, such as, for example, A. tumefaciens or A. rhizogenes, Salmonella, Erwinia, etc. From the eukaryotic host group there may be mentioned especially yeasts and animal and plant cells. This list of examples is not final and is not intended to limit the subject of the present invention in any way. Other suitable representatives from the prokaryotic and eukaryotic host organism groups are known to the skilled person.

Especially preferred within the scope of this invention are B. subtilis or B. megaterium, Pseudomonas spp., and especially E. coli from the group of prokaryotic hosts as well as yeasts and animal or plant cells from the group of eukaryotic hosts.

27 More especially preferred are bifunctional vectors that are capable of replicating in both B. thuringiensis and/or B. cereus cells as well as in E. coli.

The present invention also includes the use of the said bifunctional vectors for the transformation of B. thuringiensis and B. cereus.

"Shuttle" vectors are constructed using recombinant DNA technology, plasmid and/or vector DNA of homologorv thuringiensis, B. cereus) or heterologous origin initially being cleaved using suitable restriction enzymes and then those DNA fragments containing the functions essential for replication in the respective desired host system being joined to one another again in the presence of suitable enzymes.

0 The afore-mentioned heterologous host organisms can act as a source of plasmid- and/or vector DNA of heterologous origin.

o, The joining of the various DNA fragments must be effected in such a manner that the functions essential for replication in the different host systems are retained.

1 In addition, obviously also plasmid DNA and/or vector DNA of purely heterologous origin can be used for the construction of "shuttle" vectors, but at least one of the heterologous fusion partners must contain regions of DNA that render possible a replication in homologous B. thuringiensis/B. cereus host systems.

o As a source of plasmid DNA and/or vector DNA of heterologous origin that is nevertheless capable of replicating in a B. thuringiensis/B. cereus host system there may be mentioned at this point, by way of example, a few representatives from the group of gram-positive bacteria, selected from the group consisting of the genera Staphylococcus, sach as, for example, Staphylococcus aureus, Streptococcus, such as, for example, Streptococcus faecalis, Bacillus, such as, for example, Bacillus megaterium or B. subtilis, Streptomyces, such as, for example, Streptomyces spp., etc. In addition to the representatives from the group of gram-positive bacteria listed here by way of example, there is a whole 28 series of other organisms known to the skilled person that can be used in the process of the invention.

The present invention thus accordingly also relates to a process for the production of bifunctional vectors that are suitable for transforming B. thuringiensis and/or B. cereus which comprises a) first of all breaking down plasmid DNA of homologous or heterologous origin into fragments using suitable restriction enzymes and b) then joining to one another again, in the presence of suitable enzymes, those fragments containing the functions essential for replication and selection in the respective desired host system, this being effected in such a manner that the functions essential for replication and selection in the various host systems are retained.

me..

In this manner bifunctional plasmids are obtained that contain, in addition to the functions necessary for replication in B. thuringiensis or B. cereus, further DNA sequences that ensure replication in at least one other heterologous host system.

To ensure rapid end efficient selection of the bifunctional vectors in both homologous and heterologous host system(s) it is advantageous to provide the said vectors with specific selectable markers that can be used in B. thuringiensis and/or B. cereus as well as in heterologous host system(s), that is to say that render possible a rapid and uncomplicated selection. Especially preferred within the scope of this invention is the use of DNA sequences coding for antibiotic resistances, especially DNA sequences that code for resistance to antibiotics selected from the group consisting of kanamycin, tetracycline, chloramphenicol, erythromycin etc..

Also preferred are genes that code for enzymes with a chromogenic substrate, such as for example, X-gal (5-bromo-4-chloro-3-indolyl-B-D-galactoside). The transformed colonies can then be detected very easily by way of a specific colour reaction.

Other phenotypic marker genes are known to the skilled person and can also be used within the scope of this invention.

29 Especially preferred within the scope of this invention is the construction of "shuttle" vectors that, in addition to DNA sequences that permit replication in B. thuringiensis or B. cereus or in both host systems, also contain regions of DNA that are necessary for replication in other bacterial host systems, such as, for example, in B. subtilis, B. megaterium, Pseudomonas spp., E. coli, etc..

Also preferred are "shuttle" vectors that replicate on the one hand either in B. thuringiensis or B. cereus or in both, and on the other hand in eukaryotic host systems selected from the group consisting of yeast, animal and plant cells, etc..

,0#0 More especially preferred is the construction of "shuttle" vectors that, in addition to DNA sequences that are necessary for replication of the *said vectors in B. thuringiensis or B. cereus or in both systems, also contain DNA sequences that render possible replication of the said "shuttle" vectors in E. coli.

SS* Examples of such starting plasmids for the construction of "shuttle" vectors for the B. thuringiqnsis-B. cereus/E. coli system, which must not, however, be regarded as in any way limiting, are the B. cereus *plasmid pBC16, and the plasmid pUC8 derived from the E. coli plasmid "28) pBR322 28Vieira J. and Messing 1982).

*3 The present invention also relates to bifunctional ("shuttle") vectors that, in addition to the functions essential for replication and selection in homologous and heterologous host systems, also contain one .oe.t or more genes in expressible form or other useful DNA sequences. This invention also includes processes for the production of these vectors, which comprise inserting the said genes or other useful DNA sequences into these bifunctional vectors with the aid of suitable enzymes.

Using the "shuttle" vectors of the invention and the afore-described transformation process it is thus now possible for the first time to introduce into B. thuringiensis and/or B. cereus cells by transformation, 30 with a high degree of efficiency, DNA sequences that have been cloned outside B. thuringiensis cells in a foreign host system.

Accordingly it is now possible for the first time for genes or other useful DNA sequences, especially also those having a regulatory function, to be introduced in a stable manner into B. thuringiensis and B. cereus cells and, if desired, expressed therein, as a result of which B. thuringiensis and B. cereus cells with novel and desirable properties are obtained.

Both homologous and heterologous gene(s) or DNA and synthetic gene(s) or DNA according to the definition given within the scope of the present invention, as well as combinations of the said DNAs, can be used as genes in the process of the invention.

*4 4 *4 o The coding DNA sequence can be constructed exclusively from genomic DNA, from cDNA or from synthetic DNA. Another possibility is the construction of a hybrid DNA sequence consisting of both cDNA and of genomic DNA and/or synthetic DNA, or alternatively a combination of those DNAs.

In that case, the cDNA may originate from the same gene as the genomic DNA, or alternatively both the cDNA and the genomic DNA may originate from different genes. In any case, however, both the genomic DNA and/or 1* the cDNA may each be prepared individually from the same or from .1 different genes.

If the DNA sequence contains parts of more than one gene, these genes may originate from one and the same organism, from several organisms that belong to different strains, or to varieties of the same kind or different species of the same genus, or from organisms that belong to more than one genus of the same or of another taxonomic unit.

In order to ensure the expression of the said structural genes in the bacterial cell, the coding gene sequences must first of all be operably joined to expression sequences capable of functioning in B. thuringiensis and/or B. cereus cells.

31 The hybrid gene constructs of the present invention thus contain, in addition to the structural gene(s), expression signals that include both promoter and terminator sequences as well as other regulatory sequences of 3' and 5' untranslated regions.

Especially preferred within the scope of this invention are the natural expression signals of B. thuringiensis and/or B. cereus themselves and mutants and variants thereof that are substantially homologous with the natural sequence. Within the scope of this invention, one DNA sequence is substantially homologous with a second DNA sequence when at least 70 preferably at least 80 but especially at least 90 7, of the active regions of the DNA sequence are homologous. According to the present definition of the expression "substantially homologous", two different nucleotides in a DNA sequence of a coding region are regarded as *9 homologous if the exchange of the one nucleotide for the other is a silent mutation.

a Most especially preferred is the use of sporulation-dependent promoters of B. thuringiensis that ensure expression as a function of the S* sporulation.

Especially preferred for the transformation of B. thuringiensis or SB. cereus within the scope of this invention is the use of DNA sequences that code for a 6-endotoxin.

a.

set 9 The coding region of the chimaeric gene of the invention preferably contains a nucleotide sequence coding for a polypeptide that occurs naturally in B. thuringiensis or, alternatively, for a polypeptide that Sis substantially homologous therewith, that is to say that at least has substantially the toxicity properties of a crystalline 6-endotoxin protein of B. thuringiensis. Within the scope of the present invention, by definition a polypeptide has substantially the toxicity properties of the crystalline 6-endotoxin protein of B. thuringiensis if it has an insecticidal activity against a similar spectrum of insect larvae to that of the crystalline protein of a sub-species of B. thuringiensis. Some suitable sub-species are, for example, those selected from the group 32 consisting of kurstaki, berliner, alesti, tolworthi, sotto, dendrolimus, tenebrionis and israelensis. The preferred subspecies for Lepidoptera larvae is kurstaki and, especially, kurstaki HDI.

The coding region may thus be a region that occurs naturally in B. thuringiensis. Altenatively, the coding region can if desired also contain a sequence that is different from the sequence in B. thuringiensis but that is equivalent to it on account of the degeneration in the genetic code.

The coding region of the chimaeric gene can also code for a polypeptide that is different from a naturally occurring crystalline 6-endotoxin protein but that still has substantially the insect-toxicity properties of the crystalline protein. Such a coding sequence will normally be a

'S

so* variant of a natural coding region. A "variant" of a natural DNA sequence within the scope of this invention should, by definition, be understood as a modified form of a natural sequence that, however, still fulfils the a-.

same function. The variant may be a mutant or a synthetic DNA sequence and is substantially homologous with the corresponding natural sequence.

Within the scope of this invention a DNA sequence is substantially homologous with a second DNA sequence when at least 70 preferably at least 80 but especially at least 90 of the active regions of the SDNA sequence are homologous. According to the present definition of the expression "substantially homologous", two different nucleotides in a DNA sequence of a coding region are regarded as homologous if the exchange of one nucleotide for the other is a silent mutation.

Within the scope of the present invention, it is accordingly possible to use any chimaeric gene coding for an amino acid sequence that has the insecticidal properties of a B. thuringiensis 6-endotoxin and that meets the disclosed and claimed requirements. Especially preferred is the use of a nucleotide sequence that is substantially homologous at least with the part or the parts of the natural sequence that is (are) responsible for the insecticidal activity and/or the host specificity of the B. thuringiensis toxin.

33 The polypeptide expressed by the chimaeric gene as a rule also has at least some immunological properties in common with a natural crystalline protein, because it has at least some of the same antigenic determinants.

Accordingly, the polypeptide that is encoded by the said chimaeric gene is preferably structurally related to the 6-endotoxin of the crystalline protein produced by B. thuringiensis. B. thuringiensis produces a crystalline protein with a subunit that corresponds to a protoxin having a molecular weight (MW) of approximately from 130,000 to 140,000. This subunit can be cleaved by proteases or by alkali into insecticidal fragments having a MW of 70,000 and possibly even less.

For the construction of chimaeric genes in which the coding region includes such fragments of the protoxin or even smaller parts, fragmenting the coding region can be continued for as long as the fragments or parts of those fragments still have the necessary insecticidal activity. The protoxin, insecticidal fragments of the protoxin and insecticidal parts of those fragments can be joined to other molecules, such as polypeptides and proteins.

S* Coding regions suitable for use within the scope of the process of the invention can be obtained from genes of B. thuringiensis that code for the crystalline toxin gene (Whiteley et al., PCT application W086/01536 and US Patents 4 448 885 and 4 467 036). A preferred nucleotide sequence that codes for a crystalline protein is located between nucleotides 156 and 3623 in formula I or is a shorter sequence that codes for an 5) insecticidal fragment of such a crystalline protein reiser et al., 1986 and EP 238 441).

Formel I 20 30 40 50 GTTAACACCC TGGGTCAAAA ATTGATATTT AGTAAAATTA GTTGCACTTT GTGCATTTTT 80 90 100 110 120 TCATAAGATG AGTCATATGT TTTAAATTGT AGTAATGAAA AACAGTATTA TATCATAATG 34 1-30

AATTGGTATC

190

AATGCATTCC

250

TAGAAACTGG

310

AATTTGTTCC

370 31 CC C "CTCA 140 150 TTAATAAAAG AGATGGAGGT 160 170 180 AACTTATGGA TAACAATCCG AACATCAATG 200

TTATAATTGT

260

TTACACCCCA

320

CGGTGCTGGA

380

ATGGGACGCA

210

TTAAGTAACC

270

ATCGATATTT

330

TTGTGTTAG

390

TTOTTGTAC

220 CTGAAkTAGA 280

CCTTGTCGCT

340

GACTAGTTGA

400

AAATTGAACA

230

AGTATTAGGT

290

AACGCAATTT

350

TATAATATGG

410

GTTAATTAAC

240

GGAGAAAGAA

300

CTTTTGAGTG

360

GGAATTTTTG

420

CAAAGAATAG

OCS*

S

e.g.

CO S S S

CS

e.g.

S.

5 0

C

SO S S

S

S

S C 50 0

S.

S S *0

SC

S

SOS 0 esgO 0 0 SB C

S

OSSOO*

0 430

AAGAATTCGC

490

TTTACGCAGA

550

AGATGCGTAT

610

CAGTTCAAAA

440

TAGGAACCAA

500 ATQT7TTAGA 560

TCAATTCAAT

620

TTATCAAGTT

450

GCCATTTCTA

510

GAGTGGGAAG

460

GATTAGAAGG

520

CAGATCCTAC

470

ACTAAGCAAT

530

TAATCCAGCA

480

CTTTATCAAA

540

TTAAGAGAAG

600

CCTCTTTTTG

660

AATTTACATT

570

GACATGAACA

630

CCTCTTTTAT

690

TCAGTGTTTG

750

TTAACTAGGC

580 GTG CCCTTAC 640

CAGTATATGT

700

GACAAAGGTG

590

AACCGCTATT

650

TCAAGCTGCA

670

TATCAGTT

730

TCAATAGTCG

680

GAGAGATGIT

740

TTATAATGAT

710

GGGATTTGAT

720

GCCGCGACTA

TTATTGGCAA CTATACAGAT CATGCTGTAC GCTGGTACAA TACGGGATTA GAGCGTGTAT GGGGACCGGA TTCTAGAGAT TGGATAAGAT 35 850 860 870 880 890 900 ATAATCAATT TAGAAGAGAA 'TAACACTAA CTGTATTAGA TATCGTTTCT CTATTTCCGA 910 920 ACTATGATAG TAGAACGTAT 970 980 CAAACCCAGT 930

CCAATTCGAA

990

TTTGATGGTA

940 950 CAGTTTCCCA ATTAACAAGA 960

GAAATTTATA

1020

GGCATAGAAG

1030

GAAGTATTAG

1090

CTCATAGAGG

1150

CGGGGCCAGA

1210

GTATTGTTGC

1270

GACCTTTTAA

1040

GAGTCCACAT

1100

AGAATATTAT

1160

ATTCACTTTT

1220

TCAACTAGGT

1280

TATAGGGATA

1050

TTGATGGATA

1110

TGGTCAGGGC

1170

CCGCTATATG

1230

CAGGGCGTGT

1290

AATAATCAAC

1000

GTTTTCGAGG

1060

TACTTAACAG

1120

ATCAAATAAT

1180

GAACTATGGG

1240

ATAGAACATT

1300

AACTATCTGT

1010

CTCGGCTCAG

1070

TATAACCATC

1130

GGCTTCTCCT

1190

AAATGCAGCT

1250

ATCGTCCACT

1310

TCTTGACGGQ

1080

TATACGGATG

1140

GTAGGGTTTT

1200

CCACAACAAC

1260

TTATATAG.LA

1320

ACAGAATTTG

WOOS

S

OSS@

0* S 0e 0Se*

S

6S S S 0 .4 5* 4 6 5 S 6 6

OW

4 S S

S.

S@

S S

S

56.4 5 S 46 4 1330

CTTATGGAAC

1340

CTCCTCAAAT

1350 TTGC CAT CC G 1360

CTGTATACAG

1370 1380 AAAAAGCGGA ACGGTAGATT 1430 1440 TAGGCAAGGA TTTAGTCATC 1390 1400 1410 1420 CGCTGGATGA AATACCGCCA CAGAATAACA ACGTGCCACC 1450 1460 1470 1480 1490 1500 1:90: GATTAAGCCA TGTTTCAATG TTTCGTTCAG GCTTTAGTAA TAGTAGTGTA AGTATAATAA 1510 1520 1530 1540 1550 1560 GAGCTCCTAT GTTCTCTTGG ATACATCGTA GTGCTGAATT TAATAATATA ATTCCTTCAT 36 1570 1580 1590 1600 1610 1620 CACAAATTAC ACAAATACCT TTAACAAAAT CTACTAATCT TGGCTCTGGA ACTTCTGTCG 1630 1640 1650 1660 1670 TTAAAGGACC AGGATTTACA GGAGGAGATA TTCTTCGAAG AACTTCACCT 1690

CAACCTTAAG

1750

ACGCTTCTAC

1810

GGAATTTTTC

1700

AGTAAATATT

1760

CACAAATTTA

1820

AGCAACTATG

1710

ACTGCACCAT

1770

CAATTCCATA

1830

AGTAGTGGGA

1720 1730 TATCACAAAG ATATCGGGTA 1680

GGCCAGATTT

1740

AGAATTCGCT

1800

ATTAATCAGG

1860

TTTAGGACTG

1780

CATCAATTGA

1840

GTAATTTACA

1790

CGGAAGACCT

1850

GTCCGGAAGC

4**e S. 9*

S.

S

S.

S S

S

9* 55 S S

S

ge..

6

S.

Si S. S 0g 4 55 S S 555 5 1870

TAGGTTTTAC

1 930

ATUTCTTCAA

1990

TAACCTTTGA

2050

CTTCTTCCAA

2110

CCAATTTAGT

1880 TACT CCGTTT 1940

TTCAGGCAAT

2000

GGCAGAATAT

1890

AACTTTTCAA

1950

GAAGTTTATA

2010

GATTTAGAAA

1900

ATGGATCAAG

1960

TAGATCGAAT

2020

GAGCACAAAA

1910

TGTATTTACG

1970

TGAATTTGTT

2030

GGCGGTGAAT

1920

TTAAGTGCTC

1980

CCGGCAGAAG

2040

GAGCTGTTTA

2060

TCAAATCGGG

2120

TGAGTGTTTA

2180

ACATGCGAAG

2070

TTAAAAACAG

2130

TCTGATGAAX

2080

ATGTGACGGA

2140

TTTGTCTGGA

2090

TTATCATATT

2150

TGAAAAAAAA

2100

GATCAAGTAT

2160

GAATTGTCCG

5*55 S S 5. 5

S

2170

AGAAAGTCAA

2230

TTAGAGGGAT

2190 2200 2210 2220 CGACTTAGTG ATGAGCGGAA TTTACTTCAA GATCCAAACT 2240 2250 2260 2270 CAATAGACAA CTAGACCGTG GCTGGAGAGG AAGTACGGAT 2280

ATTACCATCC

37 2290 2300 2310 2320 2330 2340 AAGGAGGCGA TGACGTATTC AAAGAGAATT ACGTTACGCT ATTGGGTACC TTTGATGAGT 2350 2360 2370 2380 2390 GCTATCCAAC GTATTTATAT CAAAAAATAG ATGAGTCGAA ATTAAAAGCC 2400

TATACCCGTT

.00.

00* e .00.

see 0 2410

ACCAATTAAG

2470

ATGCCAAACA

2530

CAAGTCCAAT

2590

GATGTACAGA

2650 ATG G CCAT GC 2710

CACTAGCTCG

2770

GGGAAACAAA

2830

CTCAATATGA

2890

GCGTTCATAG

2950 2420 kGGGTATATC 2480

CGAAACAGTA

2540

CGGAAAATGT

2600

CTTAAATGAG

2660

AAGACTAGGA

2720

TGTGAAAAGA

2780

TATTGTTTAT

2840

TAGATTACAA

2900

CATTCGAGAA

2960 2430 3

AAGATAGTC

2490

AATGTGCCAG

2550

GCCCATCATT

2610

GACTTAGGTG

2670

AATCTAGAAT

2730

GCGGAGAAAA

2790

AAAGAGGCAA

2850

GCGGATACCA

2440

AAGACTTAGA

2500

GTACGGGTTC

2560 CCCA CATTT 2620

TATGGGTGAT

2680

TTCTCGAAGA

2740

AATGGAGAGA

2800

AAGAATCTGT

2860

ACATCGCGAT

2450

%ATCTATTTA

2510 CTAT G G CC 2570

CTCCTTGGAC

2630

ATTCAAGATT

2690

GAAACCATTA

2750

CAAACGTGAA

2810

AGATGCITTA

2870

GATTCATGCG

2460

ATTCGCTACA

2520

CTTTCAGCCC

2580

ATTGATGTTG

2640

AAGACGCAAG

2700

GTAGGAGAAG

2760

AAATTGGAAT

2820

TTTGTAAACT

2880

GCAGATAAAC

S. 55 S S SS S 2910 2920 2930 2940 TGTGATTCCG GGTGTCAATG GCTTATCTGC CTGAGCTGTC 2970 2980 2990 3000 CGGCTATTTT TGAAGAATTA GAAGGGCGTA TTTTCACTGC ATTCTCCCTA TATGATGCGA 38 3010 3020 3030 3040 3050 3060 GAAATGTCAT TAAAAATGGT GATTTTAATA ATGGCTTATC CTGCTGGAAC GTGAAAGGGC 3070

ATGTAGATGT

3130

CAGAAGTGTC

3190

CGTACAAGGA

3250

ACGAACTGAA

3310

GTAATGATTA

3370

GATATGACGG

3430

AAGAAAAAGC

34 9C

GGGATTACAC

355(

CCGATAAGG'

3080

AGAAGAACAPL

3090

AACAACCACC

3100

GTTCGGTCCT

3110 3120 TGTTGTTCCG GAATGGGAAG .00.

0 've00 w0 0 se 0 3140

ACAAGAAGTT

3200

GGGATATGGA

3260

GTTTAGCAAC

3320

TACTGCGACT

3380

AGCCTATGAA

3440

ATATACAGAT

3500

ACCACTACCA

3560 C' ATGGATTGAG 3150

CGTGTCTGTC

3210

GAAGGTTGCG

3270

TGTGTAGAAG

3330

CAAGAAGAAT

3390

AGCAATTCTT

3450

GGACGAAGAG

3510

GCTGGCTATG

3570

ATCGGAGAAA

3160

CGGGTCGTGG

3220

TAACCATTICA

3280

AGGAAGTATA

3340

ATGAGGGTAC

3400

CTGTACCAGC

3460

ACAATCCTTG

3520

TGACAAAAGA

3580

LCGGAAGGAAC

3170 CTATATC CT 3230

TGAGATGGAG

3290

TCCAAACAAC

3350

GTACACTTCT

3410

TGATTATGCA

3470

IGAATCTAAC

3530

ATTAGAGTAC

3590

ATICAGGG

3180

CGTGTCACAG

3240

AACAATACAG

3300

ACGGTAACGT

3360

CGTAATCGAG

3420

TCAGCCTATG

3480

AGAGGATATG

3540

IICCCAGAAA

3600

GACAGCGTGG

coos 3610

AATTACITCT

3670 3620

TATGGAGGAA

3680 3630 3640 3650 3660 TAATATATGC TTTATAAIGT AAGGTGTGCA AATAAAGAAT 3690 3700 3710 3720 GATTACTGAC ITGTATTGAC AGATAAATAA GGAAATTTTT AIATGAAIAA AAAACGGGCA 39 3730 3740 3750 TCACTCTTAA AAGAATGATG TCCGTTTTTT 3760 3770 3780 GTATGATTTA ACGAGTGATA TTTAAATGTT 3790

TTTTTTGCGA

3850

CACTACCCCC

3910

ATTTTTTATG

3970

TCATTTAACC

3800

AGGCTTTACT

3860

AAGTGTCAAA

3920

AATCTTTCAA

3980

CCTTCTCTTT

3810

TAACGGGGTA

3870

AAACGTTATT

3930

TTCAAGATGA

3990

TGGAAGAACT

3820

CCGCCACATG

3880

CTTTCTAAAA

3940

ATTACAACTA

4000

CGCTAAAGAA

3830 3840 CCCATCAACT TAAGAATTTG 3890

AGCTAGCTAG

3950

TTTTCTGAAG

4010

TTAGGTTTTG

3900

AAAGGATGAC

3960

AGCTGTATCG

4020

TAAAAAGAAA

got* to 0 9 0 so.

4030

ACGAAAGTTT

4090

GAGTGATTCT

4150

CCAGAAGGAC

4210

TCTGCATTAT

4040

TCAGGAAATG

4100

CTCGTTCGAC

4160

TCAATAAACG

4220

GGAAAAGTAA

4050

AATTAGCTAC

4110

TATGCAGTCA

4170

CTTTGATAAA

4060

CATATGTATC

4120

ATTACACGCC

4180

AAAGCGGTTG

4070

TGGGGCAGTC

4130

GCCACAGCAC

4190

AATTTTTGAA

4080

AACGTACAGC

4140

TCTTATGAGT

4200

ATATATTTTT

4230

ACTTTGTAAA

4290

TTTAGATGCG

4240

ACATCAGCCA

4250

TTTCAAGTGC

4260

AGCACTCACG

4270 4280 4300 4310 4320 TATTTTCAAC GAATCCGTAT ACGATTTTCC AAGTACCGAA ACATTTAGCA S00 4330 4340 4350 4360 CAAACTGCAG CATGTATATC CTGGGTCAGG TGGTTGTGCA The coding region defined by nucleotides 156 to 3623 of formula I codes for a polypeptide of form~ula II.

40 Formal II Met Asp Asn Asn Pro Asn Ile Asn Glu Gys Ile Pro Tyr Asn Cys Leu Ser Asn Pro Giu Val Giu Val Leu Gly Gly Giu Arg Ile Giu Thr Gly Tyr Thr Pro Ile Asp Ile Ser Leu Ser Leu Thr Gin Phe Leu Leu Ser Giu Phe Vai Pro Giy Ala Gly ?he Val Leu Gly Lau Val Asp Ile Ile Trp Gly Ile Phe Gly Pro Ser Gin Trp Asp Ala Phe Leu Val Gin Ile Giu Gin Le Ile Asn Gin Arg Ile Gin Gin Phe Ala Arg Asn Gin Ala Ile Ser Arg Leu 100 Giu Giy Leu Ser Asn Leu Tyr Gin Ile Tyr 110 Ala Gin Ser Phe Arg Gin Trp Giu Ala Asp 120 Pro Thr Asn Pro Ala Leu ArgGin Gin Met 130 Arg Ile Gin Phe Asn Asp Met Asn Ser Ala 140 Leu Thr Thr Ala Ile Pro Len Phe Ala Val 150 Gin Asn Tyr Gin Val Pro Len Len Ser Val 160 Tyr Vai Gin Ala Ala Asn Len His Leu Ser 170 99 Val Leu Arg Asp Vai Ser Val Phe Gly Gin 180 Arg Trp Gly Phe Asp Ala Ala Thr Ile Asn 190 Ser Arg Tyr Asn Asp Len Ihr Arg Len Ile 200 Gly Asn Tyr Thr Asp his Ala Val Arg Trp 210 Tyr Asn Thr Gly Len Giu Arg Val Trp Giy 220 Pro Asp Ser Arg Asp Trp Ile Arg Tyr Asn 230 Gin Phe Arg Arg Gin Len Thr Len Thr Vai 240 Len Asp Ile Val Ser Len Phe Pro Asn Tyr 250 00* Asp Ser Arg Thr Tyr Pro Ile Arg Thr Val 260 Ser Gin Len Thr Arg Gi Ile Tyr Thr Asn 270 Pro Vai Len Gin Asn Phe Asp Gly Ser Phe 280 Arg Giy Ser Ala Gin Gly Ile Gin Gly Ser 290 Ile Arg Ser Pro His Len Met Asp Ile Len 300 Asn Ser Ile Thr Ile Tyr Thr Asp Ala His 310 Arg Gly Gin Tyr Tyr Trp Set Gly His Gin 320 Ile Met Ala Ser Pro Val Gly The Set Gly 330 Pro Gin Phe Thr The Pro Len Tyr Gly Thr 340 Met Giy Asn Ala Ala Pro Gin Gin Arg Ile 350 41 Val A] Thr L( Phe A~ Ser V~ Gly TI Tyr A Asp G Pro P Ser H Ser A Pro M Giu P Ile T Asn L Gly P Arg *ee Leu I/ goo* oSer Ilec Ce **'Phe The Ser Ce..

**,.Arg Phe erg La al.

rg lu ro is sn et 'he hr e u ~rg ~rg ~rg ksp Ser Gir Thi Sei As~ 114 Gli Ly As~ As Va As Ly As Ii Gl Gin Ser Ile Leu Ser Lys Ile Arg Vai Se r Phe Asn Gin Giy Gly Thr Val Tyr Thr Gly Ala Ser Tbi Val i Sei e G1 u.A s A n G~I p Ty 1. Gi' p Gi s Hi n Le .e As .y Se Leu Gly Ser Thr Gly Ile Asp Gly Ser Asn Ser Gly Pro Pro Gin Gly Ser Met Ser Val Ser Trp As Ile Ile Pro Ser Giy Phe Thr Ser Prc Asn Ile Arg Val Asn Let Arg Pr Thr Mle Gly Se: Pro Ph Phe Tb' :Gly As' j Phe Va a Giu Ty a Val As Ile Gi r His Il Cys Le Lys Ly s Ala Ly Leu G] Arg GI *t Thr A Gin Gly Vai Tyr Arg Leu Tyr Arg Arg Pro Asn Asn Gin Gin Leu Thr Glu Phe Ala Tyr Leu Pro Ser Ala Vai Thr Vai Asp Set Leu Gin Asn Asn Asn Val Phe Set His Arg Leu Phe Arg Ser Gly Phe Set Ile Ile Atg Aia Ile His Arg Set Ala Ile Pro Ser Ser Gin Leu Thr Lys Set Thr Thr Ser Val Val Lys Gly Gly Asp Ile Leu Gly Gin Ile Ser Thr Thr Aia Pro Leu Ser Arg Ile Arg Tyr Ala Gin Phe His Thr Ser Ile Asn Gin Gly Asn Set Set Giy Set Asn Phe Arg Thr Val Gly Asn Phe Set Asn Gly Leu Set Ala His Val Giu Val Tyr Ile Asp L Pro Ala Giu Val Thr Asp Leu Giu Arg Ala n Giu Leu Phe Thr Set y Leu Lys h1 e Asp Gin Val Ser Asn u Set Asp Glu Phe Cys s Giu Leu Set Giu Lys s Arg Leu Set Asp Giu n Asp Pro Asn Phe Arg n Leu Asp Arg Giy Trp p Ile Thr Ile Gin Giy 360 370 380 390 400 410 420 430 440 450 460 470 480 490 500 510 520 530 540 550 560 570 580 590 600 610 620 630 640 650 660 670 680 690 700 710 Giy Asp Asp Val Phe Lys Giu Asn Tyr Val 42 Thr Leu Len Gly Thr Phe Asp Giu Cys Tyr 730 Pro Ihr Tyr Leu Tyr Gin Lys Ile Asp Glu 740 Ser Lys Len Lys Ala Tyr Thr Arg Tyr Gin 750 Leu Arg Gly Tyr Ile Giu Asp Set Gin Asp 760 Len Gin Ile Tyr Le Ile Arg Tyr Asn Ala 770 Lys His Glu Thr Val Asn Val Pro Gly Thr 780 Gly Ser Leu Trp Pro Len Set Ala Pro Set 790 Pro Ile Gly Lys Cys Ala His His Set His 800 His Phe Set Leu Asp Ile Asp Val Gly Cys 810 Thr Asp Len Asn Gin Asp Len Giy Val Trp 820 Vai Ile Phe Lys Ile Lys Thr Gin Asp Giy 830 His Ala Arg Len Giy Asn Len Gin Phe Len 840 Gin Giu Lys Pro Leu Val Gly Giu Ala Len 850 Ala Arg Val Lys Arg Ala Giu Lys Lys Trp 860 Arg Asp Lys Arg Glu Lys Len Gin Trp Gin 870 Thr Asn Ile Val Tyr Lys Giu Ala Lys Gin 880 486,Set Val Asp Ala Len Phe Val Asn Set Gin 890 .:Tyr Asp Arg Len Gin Ala Asp Thr Asn Ile 900 Ala Met Ile His Ala Ala Asp Lys Arg Val 910 .9.'His Set Ile Arg Giu Ala Tyr Len Pro Giu 920 .Len Set Vai Ile Pro Gly Val Asn Ala Ala 930 I le Phe Gin Gin Len Gin Gly Atg Ile Phe 940 Thr Aia Phe Set Len Tyr Asp Ala Arg Asn 950 Val Ile Lys Asn Gly Asp Phe Asn Asn Gly 960 S:Len Set Cys Trp Asn Val Lys Gly His Val 970 S..Asp Val Gin Gin Gin Asn Asn His Arg Set 980 Val Len Vai Val Pro Gin Trp Gin Ala Gin 990 Val Ser Gin Gin Val Atg Val Cys Pro Gly 1000 Arg Gly Tyr Ile Len Arg Val Thr Ala Tyr 1010 Lys Gin Gly Tyr Gly Gin Gly Cys Val rhr 1020 I.:le His Gin Ile Gin Asn Asn Thr Asp Gin 1030 Len Lys Phe Set Asn Cys Val Gin Gin Gin 1040 Val Tyr Pro Asn Asn Thr Val Thr Cys Asn 1050 Asp Tyr Thr Ala Thr Gin Gin Gin Tyr Gin 1060 Gly Thr Tyr Thr Set Arg Asn Arg Giy Tyr 1070 Asp Giy Ala Tyr Gin Set Asn Set Set Val 1080 Pro Ala Asp Tyr Ala Set Ala Tyr Gin Gin 09 1090 43 Lys Ala Tyr Thr Asp Gly Arg Arg Asp Asn 1100 Pro Cys Glu Ser Asn Arg Gly Tyr Gly Asp 1110 Tyr Thr Pro Leu Pro Ala Gly Tyr Val Thr 1120 Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp 1130 Lys Val Trp Ile Glu lie Gly Glu Thr Glu 1140 Gly Thr Phe Ile Val Asp Ser Val Glu Leu 1150 Leu Leu Met Glu Glu End 1156 In order to introduce a chimaeric gene into B. thuringiensis or B. cereus cells by transformation using the process of the invention, the gene is preferably first of all inserted into a vector. The insertion is especially preferably into a bifunctional vector of the invention.

If the corresponding gene is not available in an amount sufficient for the insertion into the Bacillus cells, the vector can first of all be amplified by replication in a heterologous host cell. Bacterial cells or yeast cells are best suited for the amplification of genes. When a S sufficient amount of the gene is available it is inserted into the Bacillus cells. The insertion of the gene into B. thuringiensis or SB. cereus cells can be carried out with the same vector as was used for the replication, or with a different vector. The bifunctional vectors of the invention are especially suitable.

A few examples of bacterial host cells that are suitable for replication S of the chimaeric gene include bacteria selected from the genera Escherichia, such as E. coli, Agrobacterium, such as A. tumefaciens or A. rhizogenes, Pseudomonas, such as Pseudomonas spp., Bacillus, such as ic B. megaterium or B. subtilis, etc.. As a result of the transformation process of the invention it is now possible for the first time, within the scope of this invention, also to use B. thuringiensis and B. cereus themselves as host cells. Processes for cloning heterologous genes in bacteria are described in US Patents 4 237 224 and 4 468 464.

B

The replication of genes in E. coli that code for the crystalline protein of thringiensis is described by 29)Wong et al. (1983).

of B. thuringiensis is described by Wong et al. (1983).

44 Some examples of yeast host cells that are suitable for the replication of the genes of the invention include those selected from the genus Saccharomyces (European Patent Application EP 0 238 441).

Any vector into which the chimaeric gene can be inserted and which is replicated in a suitable host cell, such as in bacteria or yeast, can be used for the amplification of the genes of the invention. The vector may be derived, for example, from a phage or from a plasmid. Examples of vectors that are derived from phages and that can be used within the scope of this invention are vectors derived from M13- and from X-phages.

Some suitable vectors derived from M13 phages include M13mpl8 and ml3mpl9. Some suitable vectors derived from X-phages include Xgtil, Xgt7 and XCharon4.

Of the vectors that are derived from plasmids and are especially suitable for replication in bacteria, there may be mentioned here by way of example pBR322 3Bolivar et al., 1977), pUC18 and pUC19 31) 32) Norrander et al., 1983) and Ti-plasmids 3Bevan et al., 1983), without the subject of the invention bein'g in any way limited thereby.

-On Preferred vectors for the amplification of genes in bacteria are pBR322, S pUC18 and pUC19.

ai 9 S* 9 Without any limitation being implied, especially direct cloning vectors, such as, for example, pBD347, pBD348, pBD64 and pUB1664, and especially "shuttle" vectors, which have already been described in detail hereinbefore, may be mentioned for cloning directly in B. thuringiensis and/or B. cereus.

Especially preferred within the scope of this invention are the bifunctional ("shuttle") vectors pXI61 (=pK61) and pXI93 (=pK93) which, introduced by transformation into B. thuringiensis var. kurstaki HDlcryB and B. cereus 569K, have been deposited at the "Deutsche Sammlung von I1 Mikroorganismen" (Braunschweig, Federal Republic of Germany), recognised as an International Depository, in accordance with the requirements of the Budapest Treaty under the number DSM 4573 (pXI61, introduced by transformation into B. thuringiensis var. kurstaki HDlcryB) and DSM 4571 45 (pXI93, introduced by transformation into B. thuringiensis var. kurst.'& HDlcryB) and DSM 4573 (pXI93, introduced by transformation into B. cereus 569K).

In order to construct a chimaeric gene suitable for replication in bacteria, a promoter sequence, a 5' untranslated sequence, a coding sequence and a 3' untranslated sequence are inserted into a vector or are assembled in the correct sequence in one of the afore-described vectors.

Suitable vectors according to the invention are those that are capable of being replicated in the host call.

The promoter, the 5' untranslated region, the coding region and the 3' untranslated region can, if desired, first of all be combined in one unit outside the vector and then inserted into the vector. Alternatively, parts of the chimaeric gene can also be inserted into the vector individually.

In the case of B. thuringiensis and B. cereus cloning vectors this o: process step can be omitted since the entire unit isolated from B. thuringiensis, consisting of a 5' untranslated region, the coding region and a 3' untranslated region, can be inserted into the vector.

The vector furthermore preferably also contains a marker gene which confers on the host cell a property by which it is possible to recognise the cells transformed with the vector. Marker genes that code for an antibiotic resistance are preferred. Some examples of suitable o* antibiotics are ampicillin, chloramphenicol, erythromycin, tetracycline, hygromycin, G 418 and kanamycin.

0 Also preferred are marker genes that code for enzymes having a chromogenic substrate, such as, for example, X-gal (5-bromo-4-chloro-3-indolyl-2-D-galactoside). The transformed colonies can then be detected very easily by way of a specific colour reaction.

46 The insertion of the gene into, or the assembly of the gene in, the vector is carried out by way of standard processes, for example using 33) recombinant DNA )Maniatis et al., 1982) and using homologous 34) recombination 4)Hinnen et al., 1978).

The recombinant DNA technology processes are based on the vector first of all being cleaved and the desired DNA sequence being inserted between the cleaved portions of the vector; the ends of the desired DNA sequence are then joined to the corresponding ends of the vector.

The vector is preferably cleaved with suitable restriction endonucleases.

Suitable restriction endonucleases are, for example, those that form blunt ends, such as Sma I, Hpa I and Eco RV, as well as those that form cohesive ends, such as Eco RI, Sac I and Bam HI.

e* The desired DNA sequence normally exists as a region of a larger DNA molecule, such as a chromosome, a plasmid, a transposon or a phage. The desired DNA sequence is in these cases excised from its original source and, if desired, so modified that its ends can be joined to those of the cleaved vector. If the ends of the desired DNA sequence and of the cleaved vector are blunt ends, then they can, for example, be joined to one another with ligases specific for blunt ends, such as T4 DNA ligase.

The ends of the desired DNA sequence can also be joined in the form of cohesive ends to the ends of the cleaved vector, in which case a ligase specific for cohesive ends, which may also be T4 DNA ligase, is used.

Another suitable ligase specific for cohesive ends is, for example, the E. coli DNA ligase.

Cohesive ends are advantageously formed by cleaving the desired DNA sequence and the vector with the same restriction endonuclease, in which case the desired DNA sequence and the cleaved vector have cohesive ends that are complementary to each other.

The cohesive ends can also be constructed by adding complementary homopolymer tails to the ends of the desired DNA sequence and of the cleaved vector with the aid of terminal deoxynucleotidyl transferase.

47 Alternatively, cohesive ends can be produced by adding a synthetic oligonucleotide sequence that is recognised by a particular restriction endonuclease and is known as a linker, and cleaving the sequence with the 33) endonuclease (see, for example, Maniatis et al., 1982).

It is thus now possible for the first time, within the scope of this invention, genetically to modify B. thuringiensis genes, and especially 6-endotoxin-encoding DNA sequences, outside B. thuringiensis, to clone those genes and then to return them into B. thuringiensis and/or B. cereus cells, where the said 5-endotoxin genes can be expressed (in a homologous bacterial host system).

This means that it is now possible also for the genome of B. thuringiensis to be manipulated genetically in a specifically controlled manner by first of all generating large amounts of plasmid *6* material in a foreign cloning system and then introducing this into B. thuringiensis by transformation.

The possibility of modifying the 6-endotoxin genes and the control S, sequences regulating the expression of those genes is of particular S interest here.

Apart from chimaeric genes, it is obviously also possible for any other chimaeric genetic construct to be inserted into Bacillus thuringiensis and/or Bacillus cereus cells using the process of the invention.

It is thus, for example, conceivable, using the process of the invention, to insert non-coding "anti-sense" DNA into the genome of a Bacillus thuringiensis and/or Bacillus cereus cell, so that in the course of the Sexpression of the said "aLLi-sense" DNA a mRNA is transcribed that inhibits the expression of the corresponding "sense" DNA. In this manner it is possible to inhibit in a specifically controlled manner the expression in Bacillus thuringiensis and/or Bacillus cereus of certain undesired genes.

48 Furthermore, apart from the preparation of improved, well-defined B. thuringiensis strains for the preparation of improved bioinsecticides, it is now also possible to use B. thuringiensis as a general host for cloning and, if desired, expressing heterologous and/or homologous genes.

In a specific and preferred embodiment of the process of the invention it is furthermore now possible for the first time to clone new genes, and especially new protoxin genes, directly in the natural host, that is to say in B. thuringiensis or B. cereus.

In the search for new protoxin genes, first of all a gene library of B. thuringiensis is created.

In a first process step, the total DNA of a protoxin-producing B. thuringiensis strain is isolated by processes that are known per se and then broken down into individual fragments. The B. thuringiensis DNA 1 can be fragmented either mechanically, for example by the action of shearing forces, or, preferably, by digestion with suitable restriction enzymes. Digestion of the DNA sample is partial or complete, depending on the choice of enzymes. Within the scope of this invention, the use of restriction enzymes that contain quaternary recognition sites and/or result in a partial digestion of the B. thuringiensis DNA are especially S preferred, such as, for example, the restriction enzyme Sau IIIA, but this preference does not imply any limitation. Obviously, it is also 0 so possible to use any other suitable restriction enzyme in the process of the invention.

The restriction fragments obtained in the afore-described manner are then separated according to size by processes known per se. Size-dependent separation of DNA fragments is usually effected by centrifuging t: processes, such as, for example, saccharose gradient centrifugation, or by electrophoretic processes, such as agarose gel electrophoresis, or by a combination of those processes.

Those fractions containing fragments of the correct size, that is to say fragments that on account of their size are capable of coding for a protoxin, are pooled and used for the next process steps.

49 The previously isolated fragments are first of all inserted into suitable cloning vectors using standard processes, and then inserted directly into Bacillus thuringiensis or B. cereus, but preferably into protoxin-free strains of Bacillus thuringiensis, using the transformation process of the invention.

The vectors used may be either gram-positive plasmids, such as, for example, pBC16, pUB110, pC194, or the "shuttle" vectors described in detail hereinbefore. The shuttle vector pXI200, which is described in detail hereinafter (see Example is especially preferred within the scope of this invention. Suitable vectors preferably contain DNA sequences that ensure easy identification of the transformed vector-containing clones from among the immense number of untransformed clones. Especially preferred are DNA sequences coding for a specific marker that on expression results in an easily selectable feature, such as, for example an antibiotic resistance. There may be mentioned by way of example here a resistance to ampicillin, chloramphenicol, erythromycin, tetracycline, hygromycin, G418 or kanamycin.

S'

Also preferred are marker genes that code for enzymes having a chromogenic substrate, such as, for example, X-gal (5-bromo-4-chloro-3-indolyl-B-D-galactoside). The transformed colonies can then be detected very easily by way of a specific colour reaction.

t After electroporation the treated Bacillus thuringiensis or B. cereus c lls are transferred to a selective sporulation medium and are incubated until sporulation is complete at a temperature of from 10 0 C to 40 0

C,

preferably from 20 0 C to 35°C, and more especially at a temperature of from 29 0 C to 31 0 C. The sporulation medium contains as selective substance preferably one of the above-mentioned antibiotics, depending on the vector used, and a suitable solidifying agent, such as, for example, agar, agarose, gelatin etc..

In the course of sporulation, autolysis of the sporulating cells occurs, which is advantageous in industrial scale processing for the subsequent screening since breaking open the cells artificially is dispensed with.

50 In clones that contain the desired protoxin gene and are expressed under the control of their natural promoter, the crystalline proteins formed are freely accessible in the medium. These crystalline proteins which exist freely in the medium can then be immobilised, for example with the aid of membrane filters or by other suitable measures. Suitable membrane filters are, for example, nylon or nitrocellulose membr.-es. Membranes of this kind are freely available on the market.

The crystalline proteins immobilised in this manner can then be located and identified very simply in a suitable screening process.

Immunological screening using protoxin-specific antibodies is preferred within the scope of this invention. Immunological screening processes are 35) known and are described in detail, for example, in 5Young et al., 1983.

The use of monoclonal antibodies that recognise quite specifically a particular region of the protein molecule is especially preferred within the scope of the process of the invention. These antibodies can be used either on their own or in the form of a mixture. It is, of course, also possible, however, to use polyclonal antisera for the immunological screening. Mixtures based on monoclonal and polyclonal antibodies are S* also possible.

Processes for the production of monoclonal antibodies to Bacillus thuringiensis protoxin proteins are known and are described in detail, *36) 37) for example, in Huber-Luka$ (1984) and in 3Huber-Luka6 et al, (1986). These processes can also be used in the present case.

The immunological screening process based on antibodies is part of the present invention.

0 It is obviously also possible within the scope of this invention to use other suitable screening processes for locating novel DNA sequences in B. thuringiensis and/or B. cereus.

51 Bacillus thuringiensis and B. cereus cells that have been transformed using the afore-described process, and the toxins produced by these transformed Bacillus cells, are excellently suitable for controlling insects, but especially for controlling insects of the orders Lepidoptera, Diptera and Coleoptera.

The present invention accordingly also relates to a method of controlling insects which comprises treating insects or the locus thereof a) with B. thuringiensis or B. cereus cells, or with a mixture of the two, that have been transformed with a recombinant DNA molecule containing a structural gene that codes for a 6-endotoxin polypeptide occurring naturally in B. thuringiensis or for a polypeptide essentially homologous therewith; or alternatively b) with a cell-free crystalline body preparation containing a protoxin that is produced by the said transformed Bacillus cells.

The present invention also includes insecticidal compositions that, in addition to the conventionally employed carriers, dispersants or carriers and dispersants, contain *I a) B. thuringiensis or B. cereus cells, or a mixture of the two, that have been transformed with a recombinant DNA molecule containing a structural gene that codes for a 6-endotoxin polypeptide occurring naturally in B. thuringiensis or for a polypeptide essentially homologous therewith; or alternatively 0* b) a cell-free crystalline body preparation containing a protoxin that is produced by the said transformed Bacillus cells.

For use as insecticides, the transformed microorganisms containing the recombinant B. thuringiensis toxin gene, preferably transformed living or dead B. thuringiensis or B. cereus cells, including; mixtures of living and dead B. thuringiensis and B. cereus cells, as well as the toxin proteins produced by the said transformed cells, are used in unmodified form or, preferably, together with adjuvants customarily employed in the art of formulation, and are formulated in a manner known per se, for example into suspension concentrates, coatable pastes, directly sprayable or dilutable solutions, wettable powders, soluble powders, dusts, granulates, and also encapsulations in, for example, polymer substances.

52 As with the nature of the compositions, the methods of application, such as spraying, atomising, dusting, scattering, coating or pouring, are chosen in accordance with the intended objectives and the prevailing circumstances.

Furthermore it is obviously also possible to use insecticidal mixtures consisting of transformed living or dead B. thuringiensis and/or B. cereus cells and cell-free crystalline body preparations containing a protoxin produced by the said transformed Bacillus cells.

The formulations, that is to say the compositionz or preparations containing the transformed living or dead Bacillus cells or mixtures thereof and also the toxin proteins produced by the said transformed Bacillus cells and, where appropriate, solid or liquid adjuvants, are prepared in known manner, for example by intimately mixing the transformed cells and/or toxin proteins with solid carriers and, where Sappropriate, surface-active compounds (surfactants).

The solid carriers used e.g. for dusts and dispersible powders, are normally natural mineral fillers such as calcite, talcum, kaolin, montmorillonite or attapulgite. In order to improve the physical properties it is also possible to add highly dispersed silicic acid or highly dispersed absorbent polymers. Suitable granulated adsorptive *0 carriers are porous types, for example pumice, broken brick, sepiolite or bentonite; and suitable nonsorbent carriers are, for example, calcite or sand. In addition, a great number of pregranulated materials of inorganic or organic nature can be used, e.g. especially dolomite or pulverised plant residues.

Suitable surface-active compounds are non-ionic, cationic and/or anionic surfactants having good dispersing and wetting properties. The term "surfactants" will also be understood as comprising mixtures of surfactants.

Both so-called water-soluble soaps and also water-soluble synthetic surface-active compounds are suitable anionic surfactants.

53 Suitable soaps are the alkali metal salts, alkaline earth metal salts or unsubstituted or substituted ammonium salts of higher fatty acids (Clo-C 22 e.g. the sodium or potassium salts of oleic or stearic acid or of natural fatty acid mixtures which can be obtained e.g. from coconut oil or tallow oil. Mention may also be made of fatty acid methyltaurin salts, such as, for example, the sodium salt of cis-2-(methyl-9-octadecenylamino)-ethanesulfonic acid (content in formulations preferably approximately 3 More frequently, however, so-called synthetic surfactants are used, especially fatty sulfonates, fatty sulfates, sulfonated benzimidazole derivatives or alkylarylsulfonates or fatty alcohols, such as, for example, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (content in formulations preferably approximately 2 The fatty sulfonates or sulfates are usually in the form of alkali metal salts, alkaline earth metal salts or unsubstituted or substituted S ammonium salts and contain a Cs-C22alkyl radical which also includes the alkyl moiety of acyl radicals, e.g. the sodium or calcium salt of lignosulfonic acid, of dodecylsulfate or of a mixture of fatty alcohol sulfates obtained from natural fatty acids. These compounds also comprise the salts of sulfated and sulfonated fatty alcohol/ethylene oxide *e S* adducts. The sulfonated benzimidazole derivatives preferably contain 2 sulfonic acid groups and one fatty acid radical containing 8 to 22 carbon atoms. Examples of alkylarylsulfonates are the sodium, calcium or triethanolamine salts of dodecylbenzenesulfonic acid, dibutylnaphthalenesulfonic acid, or of a condensate of naphthalenesulfonic acid and formaldehyde.

0 Also suitable are corresponding phosphates, e.g. salts of the phosphoric acid ester of an adduct of p-nonylphenol with 4 to 14 moles of ethylene oxide.

54 Non-ionic surfactants are preferably polyglycol ether derivatives of aliphatic or cycloaliphatic alcohols, saturated or unsaturated fatty acids and alkylphenols, said derivatives containing 3 to 30 glycol ether groups and 8 to 20 carbon atoms in the (aliphatic) hydrocarbon moiety and 6 to 18 carbon atoms in the alkyl moiety of the alkylphenols.

Further suitable non-ionic surfactants are the water-soluble adducts of polyethylene oxide with polypropylene glycol, ethylenediaminopolypropylene glycol and alkylpolypropylene glycol containing 1 to 10 carbon atoms in the alkyl chain, which adducts contain 20 to 250 ethylene glycol ether groups and 10 to 100 propylene glycol ether groups. These compounds usually contain 1 to 5 ethylene glycol units per propylene glycol unit.

Examples of non-ionic surfactants are nonylphenolpolyethoxyethanols, castor oil polyglycol ethers, polypropylene/polyethylene oxide adducts, tributylphenoxypolyethoxyethanol, polyethylene glycol and octylphenoxypolyethoxyethanol. Fatty acid esters of polyoxyethylene sorbitan, e.g.

polyoxyethylene sorbitan trioleate, are also suitable non-ionic surfactants.

*9 9 Cationic surfactants are preferably quaternary ammonium salts which contain, as N-substituent, at least one C8-C22alkyl radical and, as further substituents, unsubstituted or halogenated lower alkyl, benzyl or u* S hydroxy-lower alkyl radicals. The salts are preferably in the furm of halides, methylsulfates or ethylsulfates, e.g. stearyltrimethylammonium chloride or benzyldi(2-chloroethyl)ethylammonium bromide.

be The surfactants customarily employed in the art of formulation are described, inter alia, in the following publications: 38) 1986 International McCutcheon's Emulsifiers Detergents, The Manufacturing Confectioner Publishing Co., Glen Rock, NJ, USA; Helmut Stache "Tensid-Taschenbuch" Carl Hanser-Verlag Munich/Vienna 1981.

55 The agrochemical compositions usually contain 0.1 to 99 preferably 0.1 to 95 of the transformed living or dead Bacillus cells or mixtures thereof or of the toxin proteins produced by the said transformed Bacillus cells, 99.9 to 1 preferably 99.8 to 5 of a solid or liquid adjuvant, and 0 to 25 preferably 0.1 to 25 of a surfactant.

Whereas commercial products will preferably be formulated as concentrates, the end user will normally employ dilute formulations.

The compositions may also contain further auxiliaries such as stabilisers, antifoams, viscosity regulators, binders, tackifiers as well as fertilisers or other active ingredients for obtaining special effects.

The transformed living or dead Bacillus cells or mixtures thereof containing the recombinant B. thuringiensis toxin genes, as well as the 0*16 ow toxin proteins produced by the said transformed Bacillus cells, are excellently suitable for controlling insect pests. Plant-destructive L insects of the order Lepidoptera should preferably be mentioned here, especially those of the genera Pieris, Heliothis, Spodoptera and Plutella, such as, for example, Pieris brassicae, Heliothis virescens, S Heliothis zea, Spodoptera littoralis and Plutella xylostella.

Other insect pests that can be controlled by the afore-described I t, insecticidal preparations are, for example, beetles of the order Coleoptera, especially those of the Chrysomelidae family, such as, for S* example, Diabrotica undecimpunctata, D. longicornis, D. virgifera, D. undecimpunctata howardi, Agelastica alni, Leptinotarsa decemlineata etc., as well as insects of the order Diptera, such as, for example, Anopheles sergentii, Uranatenia ungticulata, Culex univittatus, Aedes aegypti, Culex pipiens, etc..

S

The amounts in which the Bacillus cells or the toxin proteins produced by them are used depends on the respective conditions, such as, for example, the weather conditions, the soil conditions, the plant growth and the time of application.

56 Formulation Examples for material containing B. thuringiensis toxin In the following Formulation Examples the term "Bacillus cells" is used to mean those B. thuringiensis and/or B. cereus cells containing a recombinant B. thuringiensis gene of the invention. (The figures given are percentages by weight throughout).

Fl. Granulates a) b) Bacillus cells and/or toxin protein produced by these cells 5 10 kaolin 94 highly dispersed silicic acid 1 attapulgite 90 The Bacillus cells and/or toxin protein produced by these cells are first of all suspended in methylene chloride, then the suspension is sprayed onto the carrier, and the suspending agent is subsequently evaporated off 9* in vacuo.

C

1 F2. Dusts a) b) 9* fe S* e Bacillus cells and/or toxin protein produced by these cells 2 5 highly dispersed silicic acid 1 5 talcum 97 e* kaolin 90 Ready-for-use dusts are obtained by intimately mixing the carriers with the Bacillus cells and/or with toxin protein produced by these cells.

F3. Wettable powders a) b) c) Bacillus cells and/or toxin protein produced by these cells 25 50 75 sodium lignosulfonate 5 5 sodium laurylsulfate 3 5 sJdium diisopropylnaphthalenesulfonate 6 10 57 octylphenol polyethylene glycol ether (7-8 moles of ethylene oxide) 2 highly dispersed silicic acid 5 10 10 kaolin 62 27 The Bacillus cells and/or toxin protein produced by these cells are carefully mixed with the adjuvants and the resulting mixture is then thoroughly ground in a suitable mill, affording wettable powders, which can be diluted with water to give suspensions of the desired concentration.

F4. Extruder granulates Bacillus cells and/or toxin protein produced by these cells 10 sodium lignosulfonate 2 carboxymethylcellulose 1 kaolin 87 The Bacillus cells and/or toxin protein produced by these cells are mixed

S

with the adjuvants, carefully ground, and the mixture is subsequently o a moistened with water. The mixture is extruded and then dried in a stream of air.

Coated granulate Bacillus cells and/or toxin protein produced by these cells 3 polyethylene glycol 200 3 0* kaolin 94 The homogeneously mixed Bacillus cells and/or toxin protein produced by these cells are uniformly applied, in a mixer, to the kaolin moistened with the polyethylene glycol. Non-disty coated granulates are obtained in this manner.

58 F6. Suspension concentrate Bacillus cells and/or toxin protein produced by these cells 40 ethylene glycol 10 nonylphenol polyethylene glycol moles of ethylene oxide) 6 alkylbenzenesulfonic acid triethanolamine salt* 3 carboxymethylcellulose 1 silicone oil in the form of a aqueous emulsion 0.1 water 39 *Alkyl is preferably linear alkyl having from 10 to 14, especially from 12 to 14, carbon atoms, such as, for example, n-dodecylbenzenesulfonic acid triethanolamine salt.

The homogeneously mixed Bacillus cells and/or toxin protein produced by thse cells are intimately mixed with the adjuvants, giving a suspension concentrate from which suspensions of any desired concentration can be o obtained by dilution with water.

Examples General recombinant DNA techniques Since many of the recombinant DNA techniques used in this invention are routine for the skilled person, a brief description of the techniques generally used is given in the following so that these general details need not be given in the Embodiment Examples themselves. Unless expressly S indicated otherwise, all of these methods are described in the reference work by 33) iatis et al, 1982.

work by Maniatis et al., 1982.

59 A. Cleaving with restriction endonucleases The reaction mixture will typically contain about 50 pg/ml to 500 pg/ml DNA in the buffer solution recommended by the manufacturer, New England Biolabs, Beverly, MA.. From 2 to 5 units of restriction endonuclease are added for every pg of DNA ard the reaction mixture is incubated at the temperature recommended by the manufacturer for from one to three hours.

The reaction is stopped by heating at 65°C for 10 minutes or by extraction with phenol, followed by precipitation of the DNA with ethanol. This 33) technique is also described on pages 104 to 106 of the 33)Maniatis et al.

reference work.

B. Treatment of the DNA with polymerase to produce blunt ends pg/ml to 500 pg/ml DNA fragments are added to a reaction mixture in the buffer recommended by the manufacturer, New England Biolabs. The reaction mixture contains all four deoxynucleotide triphosphates in concentrations of 0.2 mM. An appropriate DNA polymerase is added and the reaction is carried out for 30 minutes at 15 0 C and is then stopped by heating for 10 minutes at 65 0 C. For fragments obtained by cleaving with restriction endonucleases that produce 5' cohesive ends, such as Eco RI

S

and Bam HI, the large fragment, or Klenow fragment, of DNA polymerase is used. For fragments obtained using endonucleases that produce 3' cohesive ends, such as Pst I and Sac I, T4 DNA polymerase is used. The use of these two enzymes is described on pages 113 to 121 of the 33) 33 Maniatis et al. reference work.

o C. Agarose gel electrophoresis and cleaning DNA fragments to remove gel contaminants o** SAgarose gel electrophoresis is carried out in a horizontal apparatus as 33) S described on pages 150 to 163 of the Maniatis et al. reference work.

The buffer used corresponds to the Tris-borate buffer or Tris-acetate described therein. The DNA fragments are stained with 0.5 pg/ml ethidium bromide which either is present in the gel or tank buffer during electrophoresis or is not added until after electrophoresis, as desired. The DNA is made visible by illumination with long-wave ultra-violet light. If the 60 fragments are to be separated from the gel, an agarose that gels at low temperature, obtainable from Sigma Chemical, St. Louis, Missouri, is used. After electrophoresis, the desired fragment is excised, placed in a small plastics tube, heated at 65°C for about 15 minutes, extracted three times with phenol and precipitated twice with ethanol. This method has been changed slightly compared with the method described by 33) 3 Maniatis et al. on page 170.

Alternatively, the DNA can be isolated from the agarose gel with the aid of the 'Geneclean Kit' (Bio 101 Inc., La Jolla, CA, USA).

D. Removal of 5' terminal phosphates from DNA fragments During the plasmid cloning steps, treatment of the plasmid vector with phosphatase reduces the recircularisation of the vector (discussed on page 13 of the )Maniatis et al. reference work). After cleaving the DNA geeg with the appropriate restriction endonuclease, one unit of calf intestinal alkaline phosphatase, which can be obtained from Boehringer-Mannheim, Mannheim, is added. The DNA is incubated for one Shour at 37 0 C and then extracted twice with phenol and precipitated with Sethanol.

U

E. Joining of DNA fragments ee.

*e If fragments having complementary cohesive ends are to be joined to one S another, about 100 ng of each fragment are incubated in a reaction mixture of from 20 pl to 40 pl with about 0.2 unit of T4 DNA ligase from New England Biolabs in the buffer reco/imended by the manufacturer. The incubation is carried out for from 1 to 20 hours at 15°C. If DNA fragments having blunt ends are to be joined, they are incubated as described above except that the amount of T4 DNA ligase is increased to from 2 to 4 units.

61 F. Transformation of DNA in E. coli E. coli strain HB101 is used for most experiments. DNA is introduced into 33) E. coli using the calcium chloride process described by 3Maniatis et al., pages 250 to 251.

G. Screening of E. coli for plasmids After transformation, the resulting colonies of E. coli are examined for the presence of the desired plasmid by a rapid plasmid isolation process.

Two commonly used processes are described on pages 366 to 369 of the 33) M3aniatis et al. reference work.

H. Large-scale isolation of plasmid DNA Processes for the large-scale isolation of plasmids from E. coli are described on pages 88 to 94 of the 33)Maniatiset al. reference work.

described on pages 88 to 94 of the Maniatis et al. reference work.

@ago

C

goes 000 0 000 0 0 00 OCO.

C

S. 4 1 666 C C8

C

S.C.

*0 C S 000 C

SC..

C

Media and LB medium Buffer Solutions r/1l L J tryptone yeast extract NaC1 Antibiotic medium No. 3 (Difco bovine meat extract yeast extract peptone glucose NaCl

K

2 HPO0 KH2P04 Laboratories) [g/l] 1 3.68 1.32 62 SCGY medium [g/1] casamino acids I yeast extract 0.1 glucose

K

2

HPO

4 14 KH2 PO4 6 Na3-citrate 1 (NH4) 2 SO4 2 MgSOir- 7 1120 0.2 GYS medium 2)Yousten Rogoff, 1969) [g/11 glucose 1 yeast extract 2 go** *0 (NH4) 2 SO4 2

*K

2 11F0 4 bMgSO4 7 Hi 2 0 0.2 .*oCaClz 2 H 2 0 0.08 nS04. H20 0.05 so pH1 adjusted to 7.3 before autoclaving.

*PBS buffer [mHI saccharose 406 MgC1 2 1 phosphate buffer, pH 6.0 7 soS S .0 0 63 TEST buffer [mM] Tween 20* 0.05 (w/v) Tris/HCl* (pH 8.0) NaCl 150 *Tween 20: polyethoxysorbitan laurate *Tris/HC1: a,a,T-Tris(hydroxymethyl)methylaminohydrochloride The internal reference pK chosen for designating the plasmids in the Priority Document has been replaced in the Auslandsfassung (foreign filing text) by the officially recognised reference pXI.

Also, the designation for the asporogenic B. thuringiensis HDI mutants used in the Embodiment Examples has been changed from cryB to cryB.

Example 1: Transformation of B. thuringiensis using electroporation Example 1.1: 10 ml of an LB medium (tryptone 10 g/l, yeast extract 5 g/l, NaCI 5 g/l) are inoculated with spores of B. thuringiensis var. kurstaki 39) HDlcryB Stahly D.P. et al., 1978), a plasmid-free variant of B. thuringiensis var. kurstaki HD1.

This batch is incubated overnight at a temperature of 27°C using a rotary

S**

e. shaker at 50 revs/min. Subsequently the B. thuringiensis culture is diluted 100-fold in from 100 ml to 400 ml of LB medium, and further cultured at a temperature of 30 0 C using a rotary shaker at 250 revs/min until an optici density (ODsso) of 0.2 is reached.

The cells are harvested by centrifugation and suspended in 1/40 volume of San ice-cooled PBS buffer (400 mM saccharose, 1 mM MgCl 2 7 mM phosphate buffer pH Centrifugation and subsequent suspension of the harvested B. thuringiensis cells in PBS buffer is repeated once more.

The cells pretreated in this manner can be electroporated either directly, or alternatively after the addition of glycerin to the buffer 64 solution [20 and are stored at from -20 0 C to -70°C, and used at a later point in time.

800 pl aliquots of the ice-cooled cells are then transferred into 40) precooled cuvettes, 0.2 pg pBC16 plasmid DNA 40)Bernberd K. et al., 1978) (20 pg/ml) is subsequently added, and the entire batch is incubated at 4 0 C for 10 minutes.

If deep-frozen cell material is used, a suitable aliquot of frozen cells is first thawed in ice or at room temperature. The further treatment is analogous to the procedure used for fresh cell material.

The cuvette is then introduced into an electroporation apparatus and the B. thuringiensis cells present in the suspension are electroporated by the action of voltages of from 0.1 kV to 2.5 kV from a single discharge of a capacitor.

The capacitor used has a capacitance of 25 pF and the distance between the electrodes in the cuvette is 0.4 cm, which, when discharge occurs results, depending on the setting, in an exponentially decreasing field strength with initial peak values of from 0.25 kV/cm to 6.25 kV/cm. The exponential decay time lies in the range of from 10 ms to 12 ms.

An electroporation apparatus from the firm Bio Rad ("Gene Pulser e Apparatus", #165-2075, Bio Rad, 1414 Harbour Way South, Richmond, CA 94804, USA), for example, can be used for the described electroporation experiments.

It is obviously also possible to use any other suitable apparatus in the process of the invention.

e* C After a further 10 minutes' incubation at 40C, the cell suspension is diluted with 1.2 ml of LB medium, and incubated for 2 hours at a temperature of 300C using a rotary shaker at 250 revs/min.

Suitable dilutions are then plated out onto LB agar (LB medium solidified with agar, 15 which contains as an additive an antibiotic suitable 65 for the selection of the newly obtained plasmid. In the case of pBC16 this is tetracycline, which is added to the medium in a concentration of mg/l.

The transformation frequencies achieved for B. thuringiensis HDlcryB and pBC16 as a function of the initial voltage applied for a given distance between plates are reproduced in Figure 1.

The expression of the inserted DNA can be detected by way of the tetracycline resistance that occurs. As soon as 2 hours after the introduction by transformation of pBC16 into B. thuringiensis a complete phenotypic expression of the newly introduced tetracycline resistance occurs (see Table 2).

Example 1.2: The transformation of B. thuringiensis cells is carried out in exactly the same manner as that described in Example 1.1, except that 000 the volume of the cell suspension provided for the electroporation is in this case 400 pl.

The transformation frequency can be increased by a factor of 10 by this measure.

Example 2: Transformation of B. thuringiensis HDlcryB with a number of different plasmids Most of the tests are carried out with plasmid pBC16, a naturally occurring plasmid of B. cereus. In addition, however, other naturally occurring plasmids can also be successfully inserted into B. thuringiensis cells, such as, for example, pUB110 Polack J. and Novik 1982), pC194( 24 )Horinouchi S. and Weisblum 1982) and pI~l 26) pIM13 (26Mahler I. and Halvorson H.O. 1980) (see Table 3).

Also, variants of these plasmids that are better suited than the natural isolates for work with recombinant DNA can be introduced by transformation into the B. thuringiensis strain HDlcryB using the process of the invention, such as, for example, the B. subtilis cloning vector pBD64 27 )Gryczan T. et al., 1980) and plasmids pBD347, pBD348 and pUB1664 (see 66 Table 3; plasmids pBD347, pBD348 and pUB1664 can be obtained from Dr. W. Schurter, CIBA-GEIGY AG, Basle).

The transformation results in Table 3 show clearly that using the transformation process of the invention, transformation frequencies are achieved that, with one exception, are all in the range of from 5 to 107, irrespective of the plasmid DNA used.

Example 3: Construction of a "shuttle" vector for Bacillus thuringiensis Existing bifunctional vectors for E. coli and B. subtilis, such as, for 41) example, pHV33 41)Primrose S.B. and Ehrlich Plasmid, 6: 193-201, 1981) are not suitable for B. thuringiensis HDlcryB (see Table 3).

For the construction of a potent bifunctional vector, first of all the large Eco RI fragment of pBC16 is inserted with the aid of T4 DNA ligase into the Eco RI site of plasmid pUC8 Vieira J. and Messing J. 1982).

E. coli cells are then transformed with this construct. A construct recognised as correct by restriction analysis is designated pXI62.

The removal of the Eco RI cleavage site situated distally from the pUC8 S polylinker region then follows. pXI62 is linearised by a partial Eco RI S* digestion. The cohesive Eco RI ends are made up with Klenow polymerase and joined together again with T4 DNA ligase. After introdu-tion into E. coli by transformation, a construct recognised as correct by restric- S tion analysis is selected and designated pXI61. A map of pXI61 with the cleavage sites of restriction enzymes that cleave pXI61 only once, is shown in Figure 6.

This construct can be introduced directly into B. thuringiensis HDlcryB using the transformation process described in Example 1.

On account of the strong restriction barriers in B. thuringiensis strains, the transformation rates are lower when using pXI61 DNA originating from E. coli than when using plasmid DNA originating from B. thuringiensis HDlcryB (see Table Nevertheless pXI61 proves to be very suitable for carrying out cloning experiments in B. thuringiensis.

67 Example 4: Insertion of the Kurhdl delta-endotoxin gene into strains of B. thuringiensis and B. cereus The DNA sequence coding for a Kurhdl delta-endotoxin protein used within the scope of this invention for insertion and expression in B. thuringiensis and B. cereus originates from plasmid pK36, which was deposited on 4th March 1986 under the Deposit Number DSM 3668 in accordance with the requirements of the Budapest Treaty for the International Recognition of the Deposit of Microorganisms for the Purposes of Patenting, at the Deutsche Sammlung von Mikroorganismen, Federal Republic of Germany, which is recognised as an International Depository.

A detailed description of the process for identifying and isolating the 6-endotoxin genes and for the construction of plasmid pK36 is contained in European Patent Application EP 0 238 441 and is a part of the present invention in the form of a reference.

pK36 plasmid DNA is completely digested with the restriction enzymes Pst I and Bam HI and the 4.3 Kb fragment, which contains the Kurhdl delta-endotoxin gene (cf. formula is isolated from an agarose gel.

This fragment is then inserted into pXI61, which has previously been digested with Pst I and Bam HI and treated with alkaline phosphatase S from calf's stomach. After the transformation of E. coli HB101, a construct recognised as correct by restriction analysis is isolated and designated pXI93. A restriction map of pXI93 is reproduced in Figure 7.

o* pXI93 can be introduced into B. thuringiensis HDlcryB in 2 different ways.

a) B. thuringiensis cells are transformed directly with a pXI93 isolate of E. coli using the transformation process of the invention described in Example 1.

b) pXI93 is first of all introduced into B. subtilis cells by transformation, as described by Chang and Cohen, 1979. The complete and intact pXI93 plasmid DNA contained in a transformant is isolated and then introduced into B. thuringiensis HDlcryB by transformation using the electroporation process described in Example 1.

68 Both methods result in transformants that contain the intact pXI93 plasmid, which can be demonstrated by restriction analysis.

Example 5: Evidence of the expression of the delta-endotoxin gene in B. thuringiensis Sporulating cultures of B. thuringiensis HD1cryB, HDlcryB (pXI61), HDlcryB (pXI93) and HD1 are compared under a phase contrast microscope at a magnification of 400. The typical bipyrimidal protein crystals can be detected only in the strain containing pXI93 and in HD1. Extracts from the same cultures are separated electrophoretically on an SDS polyacrylamide gel. A protein band of 130,000 Dalton, which corresponds to the Kurhdl gene product, could be detected on the gel only for the strain containing plasmid pXI93 and in HD1 (Figure 8a).

In a Western blot analysis (Figure 8b), this 130,000 Dalton protein and its degradation products react specifically with polyclonal antibodies @9 that have been prepared previously against crystalline protein of B. thuringiensis var. kurstaki HD1 in accordance with the process 42) S described by 4Hubpr-LukaH., 1982. A detailed description of this process can be found in European Patent Application EP 238 441, which is a part of this invention in the form of a reference. Located on plasmid pXI93, upstream of the toxin-encoding region, is a 156 Bp DNA region, which contains the afore-described sporulation-dependent tandem promoter 29) Wong H.C. et al., 1983). This sequence is adequate for a high expression of the delta-endotoxin gene in B. thuringiensis HDlcryB and B. cereus 569K.

Example 6: Evidence of the toxicity of recombinant B. thuringiensis So HDlcryB (pXI93) B. thuringiensis HDlcryB and HDlcryB (pXI93) are cultured at 25 0 C in sporulation medium (GYS medium). When sporulation is complete, which is checked using P phase contrast microscope, spores and (if present) protoxin crystals are harvested by centrifugation and spray-dried. The resulting powder is admixed in various concentrations with the food of L-1 larvae of Heliothis virescens (tobacco budworm). The mortality of the larvae is ascertained after six days.

69 As expected, the protoxin gene-free strain HDlcryB is non-toxic to Heliothis virescens, whilst the strain transformed with plasmid pXI93 causes a dosage-dependent mortality of H. virescens (Table This demonstrates that recombinant strains produced by the electroporation process can actually be used as bioinsecticides.

Example 7: Electroporation of various B. thuringiensis and B. spec.

strains The transformation protocol for B. thuringiensis HDlcryB described under Example 1 can also be applied to other strains.

All tested strains of B. thuringiensis var. kurstaki can be very simply and efficiently transformed by this process (Table Excellent transformation frequencies can also be achieved with a laboratory strain of B. cereus. The same applies also to other tested B. thuringiensis varieties (var. israelensis, var. kurstaki). By contrast, transformation of B. subtilis by the electroporation process is v ery poor.

Using the protoplast-dependent PEG method for B. subtilis, on the other hand, transformation rates of 4 x 106/pg plasmid DNA were achieved.

S S The low transformation rates of B. subtilis obtained using the electro- 0 poration technique are not associated with incorrectly selected parameters, such as, for example, an unsuitable voltage, or with a high mortality rate caused by electric pulses, as can be seen from Figure 9.

0e Example 8: Transformation of B. thuringiensis HDlcryB with the B-galactosidase gene 8.1. Insertion of a Bam HI restriction cleavage site directly before the first AUG codon of the B. thuringiensis protoxin gene Before the B-galactosidase gene from the plasmid piWiTh5 (obtainable from Dr. M. Geiser, CIBA-GEIGY AG, Basle, Switzerland) can be joined to the 70 promoter of the Kurhdl 6-endotoxin gene of B. thuringiensis, the DNA sequence of the protoxin gene located in the region of the AUG start codon must first be modified.

This modification is carried out by oligonucleotide-directed mutagenesis, using the single-stranded phage M13mp8, which contains the 1.8 Hinc II-Hind III fragment, of the 6-endotoxin gene containing the 5' region of that gene.

First of all 3 jg of plasmid pK36 (cf. Example 4) are digested with the restriction enzymes Hind III and Hinc II. The resulting 1,8 kb fragment is purified by agarose gel electrophoresis and then isolated from the gel.

In parallel with this, 100 ng of M13mp8 RF phage DNA (Biolab, Tozer Road, Beverly MA, 01915, USA or any other manufacturer) are digested with the restriction enzymes Sma I and Hind III, treated with phenol, and precipitated by the addition of ethanol. The phage DNA treated in this manner is then mixed with 200 ng of the previously isolated protoxin fragment S and joined thereto by the addition of T4 DNA ligase.

S

After the transfection of E. coli J103, 6 white plaques are selected and o analysed by restriction mapping.

An isolate in which the join between the B-galactosidase gene and the promoter of the Kurhdl 6-endotoxin gene of B. thuringiensis has been carried out correctly is selected and designated M13mp8/Hinc-ind.

An oligonucleotide with the following sequence is synthesized using a DNA S synthesizing apparatus ("APPLIED BIOSYSTEM DNA SYNTHESIZER"):

S

GTTCGGATTGGGATCCATAAG This synthetic oligonucleotide is complementary to the M13mp8/Hinc-Hind DNA in a region that extends from position 153 to position 173 of the Kurdhl 6-endotoxin gene (cf. formula The oligonucleotide sequence reproduced above has a "mismatch" in positions 162 and 163, however, 71 compared with the sequence reproduced in formula I, so that the formation of a Bam HI restriction cleavage site is necessary. The general procedure for the mutagenesis is described by J. M. Zoller and M. Smith 4 3 J.M. Zoller and M. Smith; 19). Approximately 5 pg of single-stranded M13mpl8/Hinc-Hind phage DNA is mixed with 0.3 pg of phosphorylated oligonucleotides in a total volume of 40 pl. This mixture is heated for minutes at 65 0 C, cooled first to 500C and then, gradually, to 4 0

C.

Buffer, nucleotide triphosphates, ATP, T4 DNA ligase and the large fragment of DNA polymerase are then added and the batch is incubated overnight at 15 0 C in the manner described 43 J.M. Zoller and M. Smith).

After agarose gel electrophoresis, circular double-stranded DNA is purified and inserted into E. coli strain JM103 by transfection. As an alternative, the E. coli strain JM107 can be used.

The resulting plaques are examined for sequences that hybridize with 32 P-labelled oligonucleotide; the phages are examined by DNA restriction S* endonuclease analysis.

A phage that contains a correct construct in which a Bam HI cleavage site is located directly before the first AUG codon of the protoxin gene is

S

designated M13mp8/Hinc-Hind/Bam.

8.2. Joining the f-galactosidase gene to the 6-endotoxin promoter 8.2.1: The 6-endotoxin promoter is on a 162 Bp Eco RI/Bam HI fragment of the M13mp8/Hinc-Hind/Bam phage DNA. RF phage DNA is digested with restriction enzyme Bam HI. The projections resulting at the 5' ends are removed by treatment with "Mung Bean" nuclease (Biolabs) in accordance with the manufacturer's instructions. Subsequently, the DNA is digested with the restriction endonuclease Eco RI and, after carrying out agarose gel electrophoresis, the 162 Bp fragment is isolated from the agarose gel.

The B-galactosidase gene is isolated from plasmid piWiTh5. piWiTh5 DNA is first of all cleaved at the single Hind III cleavage site. The 3' recessed ends are made up using the Klenow fragment of DNA polymerase (cf.

33 Maniatis et al., 1983, page 113-114) and the modified DNA is then 72 digested with the restriction enzyme Sal I. The DNA fragment containing the B-galactosidase gene is isolated by agarose gel electrophoresis.

The vector pXI61 (cf. Example 3) is digested with the restriction enzymes Eco RI and Sal I and the two previously isolated fragments are inserted into the vector pXI61.

After transformation of this ligation mixture in the E. coli strain HB101 or JM107, the correctly joined clones are selected by restriction analysis and by their 8-galactosidase activity with respect to the chromogenic substrate X-gal (5-bromo-4-chloro-3-indolyl-B-D-galactoside).

A clone containing a correct genetic construct is designated 8.2.2: In an alternative embodiment, the 162 Bp Eco RI/Bam HI fragment containing the 6-endotoxin promoter is isolated by cleavage of M13mp8/Hinc-Hind/Bam with Eco RI and Bam HI, followed by separation by gel electrophoresis.

The B-galactosidase gene is isolated from plasmid piWiTh5 in this instance too (cf. Example In this case, the plasmid DNA is 9* digested with the restriction enzymes Bam HI and Bgl II and the large fragment is eluted from the agarose gel after gel electrophoresis.

we..

The vector pHY300 PLK (#PHY-001; Toyobo Co., Ltd., 2-8 Dojima Hama 2-Chome, Kita-ku, Osaka, 530 Japan), which can be obtained commercially S (cf. Example is digested with the restriction enzymes Eco RI and Bgl II. The two previously isolated fragments are then inserted into the vector pHY300 PLK.

The entire ligation mixture is then introduced by transformation into the S E. coli strain JM107 (Bethesda Research Laboratories (BRL), 411 N, Stonestreet Avenue, Rockville, MD 20850, USA). A clone having a B-galactosidase activity is further analysed by restriction digestions. A clone containing a correct genetic construct is designated pXIl01.

73 8.3. Introduction by transformation into B. subtilis and B. thuringiensis of plasmid pXI80 or pXI101 or pXIl01 plasmid DNA is first of all introduced into B. subtilis protoplasts by transformation according to a known test protocol des- 13) cribed by Chang and Cohen 13)Chang and Cohen, 1979).

A correct clone is selected, the DNA to be transformed is isolated by standard processes and introduced by transformation into B. thuringiensis HDlcryB cells by way of electroporation (cf. Example 1).

The transformed B. thuringiensis cells are plated out onto GYS agar (sporulation medium), which contains X-gal as an additive.

Correctly transformed clones turn blue when sporulation commences.

A B. thuringiensis HDlcryB strain transformed by the pXI61 vector, on the other hand, remains white under the same conditions.

e Restriction analysis shows that with correctly transformed clones, an intact pXI80 or pXIl01 plasmid is present in the B. thuringiensis cells.

S

8.4. B-galactosidase gene under the control of a sporulation-dependent promoter a. a B. thuringiensis HD1cryB cells containing plasmid pXI80 or pXIl01 are cultured on GYS medium in the manner described hereinbefore. At intervals during the growth phase (both during the vegetative growth phase and during the sporulation phase) a 6-galactosidase assay is carried out in 44) accordance with the test protocol described by J.H. Miller ("Experiments in Molecular Genetics", Cold Spring Harbor Laboratory, 1972, Experiment 48 and 49).

The individual differences from the above-mentioned test protocol concern the use of X-gal as chromogenic substrate and the measurement of the coloured hydrolysis product, which is formed by the cells after approximately 1 hour.

74 The cells are then removed by centrifugation, and the optical density of the supernatant is ascertained at a wavelength of 650 nm (OD6ss).

An increase in the optical density as a function of sporulation is observed. The non-transformed B. thuringiensis cells, on the other hand, cannot hydrolyse the chromogenic substrate X-gal.

Example 9: Creation of gene banks in Bacillus thuringiensis 9.1. Construction of pXI200 Plasmid pXI200 is a derivative of plasmid pHY300 PLK, which can be obtained commercially from Toyobo Co., Ltd. (#PHY-001; Toyobo Co., Ltd., 2-8 Dojima Hama 2-Chome, Kita-ku, Osaka, 530 Japan). Plasmid pHY300, the construction of which is described in European Patent Application EP 162 725, contains both an ampicillin (amp

R

and a tetracycline (tetr

R

0 resistance gene.

Plasmid pHY300 PLK is completely digested with Bgl I and Pvu I. The resulting restriction fragments are then separated by agarose gel electrophoresis. The 4.4 Kb fragment is isolated from the agarose gel, purified and then religated with T4 DNA ligase.

The whole ligation batch is introduced by transformation into E. coli HB101. After incubation of the transformed E. coli HB101 cells at 37 0 C on a selective L-agar containing 20 pg/ml tetracycline, the tetracyclineresistant (Tcr) transformants are selected. It is then possible to isolate from an ampicillin-sensitive (Aps) clone (100 pg/ml ampicillin) a plasmid that has lost the Pst I cleavage site in the Apr gene together with the 0.3 Kb Pvu I/Bgl I fragment. This plasmid is designated pXI200.

9.2 Cloning protoxin genes of Bacillus thuringiensis var. kurstaki HD1 in Bacillus thuringiensis HDlcryB The total DNA (50 pg) of Bacillus thuringiensis var kurstaki HD1 is completely digested by incubation with the restriction enzymes Pst 1 and Hpa 1. The restriction fragments so obtained are transferred to a continuous saccharose gradient [5 23 where they are separated according to size by density gradient centrifugation and 75 collected in 500 pl fractions. The centrifugation is carried out in a TST 41-rotor (Kontron Ausschwingrotor) at a temperature of 15 0 C at max 2.4 x 10 5 g for a rer-.od of 16 hours. Subsequently, in order to determine the fragment si!e aliquots, each of 50 il, are transferred to an agarose gel [0.8 agarose in Tris acetate EDTA or Tris borate 33) EDTA; see Maniatis et al., 1982]. Those fractions containing fragments between 3 Kb and 6 Kb are pooled and concentrated to a volume of 10 pi by ethanol precipitation.

pg of the "shuttle" vector pXI200 described in Example 9.1 are digested with the restriction enzymes Pst 1 and Sma 1. The 5' phosphate groups of the resulting restriction fragments are then removed by treatment with calf intestinal alkaline phosphatase. 0.2 pg to 0.3 pg of the previously isolated HD1 DNA is then mixed with 0.5 yg of the pXI200 vector DNA and incubated overnight at 14°C with the addition of 0.1 U of T4 DNA ligase (so-called "Weiss Units"; one unit of T4 DNA ligase corresponds to an enzymatic activity sufficient to convert 1 nM [32P] from pyrophosphate at a temperature of 37 0 C and within a period of 20 minutes into a Noritabsorbable material). The entire ligation batch is then introduced by transformation directly into Bacillus thuringiensis HDlcryB cells by S means of electroporation (cf. Example The electroporated B. thuringiensis cells are then plated out onto a selective sporulation agar containing 20 pg/ml of tetracycline as selecting agent, and incubated at a temperature of 25 0 C until sporulation is complete.

9.3. Manufacture of monoclonal antibodies to B. thuringiensis protoxin protein The manufacture of monoclonal antibodies to 6-endotoxin of Bacillus thuringiensis var. kurstaki HD1 is carried out analogously to the 36) 37) Sdescription in Huber-Luka (1984) and in Huber-Lukacet al., (1986).

The hybridoma cells used for the antibody manufacture are fusion products 45) of Sp2/0-Ag myeloma cells (described in 4Shulman et al., 1978; can be obtained at the "American Type Culture Collection" in Rockville, Maryland, USA) and splenocytes of Balb/c mice that have previously been immunised with 6-endotoxin of B. thuringiensis var. kurstaki HD1.

76 In this manner it is possible to obtain monoclonal antibodies that are directed specifically against the 6-endotoxin of B. thuringiensis.

Especially preferred are monoclonal antibodies that either bind specifically to an epitope in the N-terminal half of the protoxin protein (for example antibody 54.1 of the Huber-Lukac et al., 1986 reference), or recognise an epitope in the part of the protein constant in Lepidopteraactive protoxins, the C-terminal half (for example antibody 83.16 of the Huber-Lukac et al., 1986 reference).

It is, however, also entirely possible for other monoclonal or also polyclonal antibodies to be used for the subsequent immunological screening (cf. Example 9.4).

9.4. Immunological Screening 000e The monoclonal antibodies produced in accordance with Example 9.3, or *f other suitable monoclonal antibodies, are used for the immunological screening.

First of all, the crystalline proteins present in free form after the 0 sporulation of the B. thuringiensis cells are bound by means of transfer membranes (for example Pall Biodyne transfer membrane; Pall Ultrafine Filtration Corporation, Glen Cove, by applying the filter membranes 0S 0 to the plates for a period of approximately 5 minutes. The filters are subsequently washed for 5 minutes with TBST buffer [0.05 (w/v) Tween 20, 10 mM Tris/HCl (pH 150 mM NaCI in bidist. H20] and then, AS< in order to block non-specific binding, incubated in a mixture of TEST buffer and 1 skimmed milk for from 15 to 30 minutes.

The filters prepared in this manner are then incubated overnight with the protoxin-specific antibodies [antibody mixture of 54.1 and 83.16 37) 3Huber-Lukac et al., (1986)]. The unbound antibodies are removed by washing the filter three times with TBST buffer for from 5 to 10 minutes each time. To detect the antibody-bound protoxin the filters are incubated with a further antibody. The secondary antibody used is an anti-mouse antibody labelled with alkaline phosphatase, which can be obtained commercially, for example, from Bio-Rad [Katalog #170-6520, 77 goat's anti-mouse IgG(H+L)-alkaline phosphatase conjugate]. After an incubation period of 30 minutes the unbound secondary antibodies are removed in the manner described above by washing the filters with TBST buffer three times (for from 5 to 10 minutes each time). The filters are then incubated with a substrate mixture consisting of NBT ['p-nitro blue tetrazolium chloride; nitro-blue tetrazolium chloride] and BCIP [5-bromo-4-chloro-3-indolylphosphate-p-toluidine salt]. The enzymatic reaction is carried out in accordance with the manufacturer's instructions (Bio-Rad; 1414 Harbour Way South, Richmond CA, 94804, USA].

Positive, that is to say protoxin-containing clones, can be recognised very easily by their violet colouring. This occurs as a result of the enzymatic reaction of the alkaline phosphatase with the afore-mentioned substrate mixture. Between 800 and 1000 transformants result from the transformation described in Example 9.2 with the ligation batch indicated in that Example. Of these transformants 2 colonies exhibit clearly positive signals in the above-described enzyme reaction.

Plasmid DNA is isolated from positive clones in which expression of the protoxin gene could be detected by way of the described enzyme reaction.

The cloned protoxin genes can be further characterised and ultimately identified by restriction analysis and comparison with known restriction 7 maps.

Both clones contain a recombinant plasmid with an insert of 4.3 Kb. The subsequent restriction digestions with Hind III, Pvu II, Eco RI and Xba I permit identification of the gene on the insert by comparison with the known restriction maps of the endotoxin genes of B. thuringiensis var. kurstaki HD1. In both cases the gene is the Kurhdl gene, which is also known as the 5.3 Kb protoxin gene and is described in S et al., 1986, This gene, cloned directly in B. thuringiensis and identified by immunological screening, furthermore hybridises with a 1847 Bp Bam HI/Hind III fragment of the 5.3 Kb gene in plasmid pK36 (5)Geiser et al., 1986). In 78 the SDS/PAGE, both clones exhibit a band of 130,000 Dalton typical of the protoxin, which in a Western blot 4)Towbin et al., 1979) react specifically with the afore-described (see Example 9.4) monoclonal. antibodies.

Tables Table 1: Influence of the incubation time at 4 0

C,

electroporation, on the transformation frequency.

HDlcryB was transformed using the electroporation pBC16.per batch.

before and after B. thuringiensis process with 0.2 jig 0*6S C S 0@ S 5e

S@

S.

S

SO~ S S. 5 S

S

C S S SS S 0* S S

PS

*5 *0 S S S 0* &SS* S.

Example 1 11 2 3 4 5 6 7 8 prein cubatio n* (minutes) 0 5 10 20 20 20 20 subsequent incubation (minutes) 20 20 20 20 0 5 10 Transformation frequency (Trans.formants (jig Plasmid DNA) 2.6x106 2.1x10 6 2.2x101 2.3x101 2.5x106 1.9x106 3.3x10 6 1.7x10 6 Incubation at 4'C between the addition of DNA and electroporation Incubation at 4'C between electroporation and the beginning of the expression period 79 Table 2: Expression of the tetracycline resistance of pBC16 after introduction into B. thuringiensis HDlcryB by transformation B. thuringiensis I~cryB was transformed with pBC16 plasmid DNA using the electroporation protocol according to the invention.

After various incubation periods in LB medium at 30 0 C, the transformed cells are selected by plating out onto LB agar containing 20 Vig/ml tetracycline.

Tine taken to express Transformation Nlumber of living tetracycline resis- frequency (Trans- cells tance-(hours) formantsf/igDNA) 0 4 x 10 8 1 1.6 x 106 109 2 8.8 x 106 1.4 x 109 3 8 X 10 6 1.6 x 10 9 eon* none

S@

*0 a 80 Table 3: Transformation of the B. thuringiensis, strain HDIcryB with various plasmids Pa smidI Or gi gram resait ne I gram positive~ Transformation 2 frequency ~6e 0O S 9* .5 50 5 *5 55 5 0

U

S**

9 0@ SS S 50 S 0 0* *5 So..

S.

*5 S ~h S naturally occuring plasmids pBC16 B. cereus Tc 1.9 x 106 plJB11Q Staphylococcus Kin, Ble 3.3 x 101* aureus pC194 S. aureus Cm 6 x 106* ph'! 13 B. subtilis EM 1.8 x 105 modified plasmidslcloning vectors pBD64 IpUIBU replicon -Kin, Cm 5 x 106 pBD347 pIM13 replicon, -CM 2.9 x 105 pBD348 pIM13 repli-' con, -Em, Cm 1.1 X 105 pUB1664 pUB1lO replicon, -Cm, Em 3.5 x 104 "1shuttle" vectors pl'AT33 pBR322IpCI94, Amp Tc C 1<50* pK61 pUC8/ pBC16, Ampj 1: Tc: tetracycline; Kin: kanamycin; Ble: bleomycin; Cm: chioramphenicol; Em: erythromycin 2: All plasmid DNA originates from B. thuringiensis HDlcryB with the exception of isolated from B. subtilis LBG4468.

Table 4: Biotest of B. thuringiensis liDicryB and HD1cryB (pX193) against lieliothis virescens.

Spray-dried sporulated cultures (spores and (if present) protoxin crystals) are admixed, in the amounts indicated, with the fooC' of L-1 larvae of 1-eliothis virescens.

81 Concentration of Mortality of H. virescens spores and protoxin caused by: crystals (ig/g food) HD1 cryB HD1 cryB (pXI93) 200 0 57 100 0 43 3 27 0 12.5 0 0 Table 5: Transformability of strains of B. thuringiensis, B. cereus and B. subtilis. All strains were transformed with plasmid pBC16 in accordance with the electroporation process described under Example 1 1 Strain Transformation frequency B. thuringiensis var. kurstaki HDlcryB 1 HD1 dipel 0.25 HD1-9 0.9 HD 73 0.1 HD 191 B. thuringiensis var. thuringiensis HD 2-D6-4 13.8 B. thuringiensis var. israelensis SLBG B-4444 2.6 B. cereus 569 K S B. subtilis LBG B-4468 0.0002 relative values based on the transformation frequency, defined as 1, 0 achieved with B. thuringiensis var. kurstaki HDlcryB.

Deposit of Microorganisms A culture of each of the microorganisms listed in the following that are used within the scope of the present invention has been deposited at the "Deutsche Sammlung von Mikroorganismen", recognised as an International Depository, in Braunschweig, Federal Republic of Germany, in accordance with the requirements of the Budapest Treaty for the International 82 Recognition of the Deposit of Microorganisms for the Purposes of Patenting. A declaration concerning the viability of the deposited samples has been issued by the said International Depository.

Deposit of Micoorganisms Microorganisms I Deposit Date Deposit Number Date of the viability certificate ace* a 40 W a 0 00 0005

S.

p S*

S.

5 0* HB 101 (pK36) 4. March 1986 DSM 3668 7. March 1986 coli HB101 transformed with pK36 plasmid DNA) *HD1 cryB 4. May 1988 DSM 4574 4. May 1988 (Bacillus thuringiensis var.

kurstaki HD1 cryB *HD1 cryB (*pK 61) 4. May 1988 DSM 4572 4. May 1988 thuringiensis HDI cryB transformed with *pK61 plasmid DNA) *HD1 cryB (*pK 93) 4. May 1988 DSM 4571 4. May 1988 thuringiensis HD1 cryB transformed with *r(93 plasmid DNA) 569 K 4. May 1988 DSM 4575 4. May 1988 (Bacillus cereus 569 K) 569 K (*pK 93) cereus 569 K transformed with *pK93 plasmid DNA) 4. May 1988 DSM 4573 4. May 1988 5055 S. a a 6 The internal reference pK selected for the designation of the plasmids in the Priority Document has been replaced for the Auslandsfassung (foreign filing text) by the officially recognised designation pXI.

Also, the designation for the asporogenic B. thuringiensis HD1 mutants used in the Embodiment Examples has been changed from cryB to cryB.

83 Literature references 1. Goldberg L. and Margalit Mosquito News, 37: 355-358, 1977 2. Krieg A. et al., Z. Ang. Ent., 96: 500-508, 1983 3. Schnepf, H.E. and Whiteley Proc. Natl. Acad. Sci., USA, 78: 2893-2897, 1981 4. Klier A. et al., The ZMBO 1: 791-799, 1982 Geiser M. et al., Gene, 48: 109-118, 1986 6. Haider M.Z. et al., Gene, 52: 285-290, 1987 7. Gonzalez J.M. et al., Proc. Natl. Acad. Sci. USA, 79: 6951-6955, 1982 8. Obukowicz M.G. et al., J. Bacteriol., 168: 982-989, 1986 9. Donovan L.P. et al., Mol. Gen. Genet., 214: 365-372, 1988 Schnepf H.E. and Whitely J. Biol. Chem., 260: 6273, 1985 11. Klier A. et al., Mol. Gen. Genet., 191: 257-262, 1983 *12. Bibb J.J. et al., Nature, 274: 398-400, 1978 :13. Chang S. and Cohen Molec. Gen. Genet., 168: 111-115, 1979 14. Brown B.J. and Carlton J. Bacteriol., 142: 508-512, 1980 eae 15. Kondo J.K. and McKay Appi. Environ. Microbiol., 48: 252-259, 1984 *16. Wirth R. et al., J. bacteriol., 165: 831-836, 1986 17. Yoshihama M. et al., J. Bacteriol., 162: 591-597, 1985 18. Alikhanian S.f. et al., J. Bacteriol., 146, 7-9, 1981 *19. Martin P.A. et al., J. Bacteriol., 145: 980-983, 1981 Fischer 1-LM., Arch. Hicrobiol., 139: 213-217, 1984 so 21. Schall GenUbertragung zwischen Isolaten von Bacillus.

.4 thuringiensis durch Protoplastentransformation und -fusion (Gene transfer between isolates of Bacillus thuringiensis by protoplast transformation an~d fusion). Dissertation, University of Tilbingen, 1986.

22. Shivarova Zeitschr. Ailgem. Mikrobiol., 23: 595-599, 1983 23. Youston A.A. and Rogoff J. Bacteriol., 100: 1229-1236, 1969 24. Horinouchi and Weisblum J. Bacteriol., 150: 815-825, 1982 Polak J. and Novick Plasmid, 7: 152-162, 1982 26. Mahler J. and H-alvorson J. Gen. Microbiol., 120: 259-2639 1980 27. u.ryczan T. et al., J. Bacteriol., 141: 246-253, 1980 28. Vieira J. and Messing Gene, 19: 259-268, 1982 29. Wong et al., J. Biol. Chem., 258: 1960-1967, 1983 84 Bolivar et al., Gene 2: 95-113, 1977 31. Norrander et al., Gene, 26: 101-104, 1983 32. Bevan et al., Nature, 304: 184-187, 1983 33. Maniatis et al., Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, USA, 1982 34. Hinnen et al., Proc. Natl. Acad. Sci., USA, 75: 1929-1933, 1978 Young R.A. et al., Proc. Natl. Acad. Sci., USA, 80: 1194-1198, 1983 36. Huber-Lucac Dissertation No. 7547 "Zur Interaktion des deltaendotoxins von Bacillus thuringiensis mit monoklonalen Antik'rpern und Lipiden" (on the interaction of the delta-endotoxin of Bacillus thuringiensis with monoclonal antibodies and lipids), ETH Zurich, 1984 37. Huber-Lucac M. et al., Infect. Immunol., 54: 228-232, 1986 38. McCutcheon's, 1986 International McCutcheon's Emulsifiers Detergents, The Manufacturing Confections Publishing Co., Glen Rock, NJ,

USA.

39. Stahly D.P. et al., Biochem. Biophys. Res. Comm., 84: 581-588, 1978 Bernhard K. et al., J. Bacteriol., 133: 897-903, 1978 41. Primrose Ehrlich Plasmid 6: 193-201, 1981 42. Huber-Luka6H., Dissertation, Eidgen8ssische Technische Hochschule, ZUrich, Switzerland, No. 7050, 1982 43. Zoller J.M. and Smith Nucl. Acids Res., 10: 6487, 1982 44. Miller Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, 1972 Shulman et al., Nature, 276: 269, 1978 46. Towbin H. et al., Proc. Natl. Acad. Sci., USA, 76: 4350-4354, 1979 Patent Literature EP 162 725 6 0 EP 238 441 WO 86/01536 US-P 4 448 885 US-P 4 447 036 US-P 4 237 224 US-P 4 468 464

Claims (20)

1. A process for inserting and cloning DNA sequences in gram positive bacteria selected from the group consisting of Bccillus thuringiensis and Bacilluscereus, comprising: isolating the DNA to be introduced; cloning the thus isolated DNA in a cloning vector that is capable of replicating in a bacterial host cell selected from the group consisting of Bacillus thuringiensis and Bacillus cereus cells in a heterologous cloning system; directly introducing the thus cloned vector DNA into the said bacterial cell via electroporation at a transformation rate sufficient to overcome the restriction barrier present in the said bacterial cells; and cultivating the thus transformed bacterial cells and isolating the thus cloned vector DNA.

2. A process for inserting, cloning and expressing DNA sequences in gram positive bacteria selected from the group consisting of Bacillus thuringiensis and Bacilluscereus, comprising: isolating the DNA to be introduced and optionally ligating the thus isolated DNA with expression sequences that are capable of functioning in bacterial cells selected from the group consisting of Bacillus thuringiensis and Bacillus cereus cell s; cloning the thus isolated DNA in a cloning vector that is capable of replicating in a bacterial host cell selected from the group .consisting of Bacillus thuringiensis and Bacillus cereus cells in a 25 heterologous cloning system; directly introducing the thus cloned vector DNA into the said bacterial cell via electroporation at a transformation rate sufficient to overcome the restriction barrier present in the said bacterial cells; and cultivating the thus transformed bacterial cells and isolating the thus cloned vector DNA and the expressed gene product. A process according to claim 2, wherein said transforming comprises: preparing a suspension of host cells in an aerated medium sufficient to allow for growth of the cells; separating the grown cells from the cell suspension and resuspending the grown cells in an inoculation buffer; adding a DNA sample comprising the cloned DNA in a QAL.j concentration suitable for the electroporation to the buffer; 86 introducing the batch of step into an electroporation apparatus; subjecting the thus introduced batch to at least one capacitor discharge to produce a high electric field strength that is sufficient to render the bacterial cell wall permeable to the DNA to be introduced, for a period of time sufficient to transform the bacterial host cells with the recombinant DNA; selecting the thus transformed bacterial host cells.

4. A process according to claim 3, which comprises using B. thuringiensis spores as starting material for the preparation of the cell suspension of step A process according to claim 3, which comprises using thawed bacterial cells, which cells have previously been deep-frozen, as starting material for the preparation of the cell suspension of step

6. A process according to claim 3, wherein the culture medium of step comprises complex nutrient media with readily assimilable carbon and nitrogen sources that are conventionally employed for culturing aerobic Bacillus species; or fully synthetic or semi-synthetic nutrient media that contain (bl) a complex or alternatively a defined readily assimilable carbon and nitrogen source or a combination of the two and also (b 2 essential vitamins and metal ions.

7. A process according to claim 3, wherein in step the said 25 Bacillus cells are grown until an optical density [OD 55d of from 0.1 to 1.0 is achieved.

8. A process according to claim 3, wherein the inoculation buffer of step is a phosphate buffer that has been osmotically stabilized by addition of at least one osmotic stabilizing agent.

9. A process according to claim 8, wherein the said phosphate buffer contains sugars or sugar alcohols as an osmotic stabilizing agent. -10. A process according to claim 9, wherein the said stabilizing agent is saccharose, which is present in a concentration of from 0.1 M to 1.0 M.

11. A process according to claim 8, wherein the said phosphate buffer has .a pH value of from pH 5.0 to pH

12. -y'process according to claim 3, wherein the incubation of the 5 bacterial cells is carried out at a temperature of from 0°C to 'y before, during and after electroporation. '926Z 87

13. A process according to claim 12, wherein the incubation of the bacterial cells is carried out at a temperature of from 2 0 C to before, during and after electroporation.

14. A process according to claim 3, wherein the concentration of the added DNA sample is from 1 ng to 201 g. A process according to claim 3, wherein the field strength are from 3000 V/cm to 4500 V/cm.

16. A process according to claim 3, wherein the exponential decay time of the pulse acting on the bacterial cell suspension lies within a range of from 2 ms to 50 ms.

17. A process according to claim 3, wherein selection of the transformed bacterial host cells comprises plating out the electroporated cells, after a suitable subsequent incubation phase, onto solid media containing an additive suitable for the selection of the transformed bacterial cells.

18. A process according to claim 17, wherein the said additive is an antibiotic suitable for the selection B. thuringiensis or B.cereus or both, selected from the group consisting of tetracycline, kanamycin, chloramphenicol, erythromycin.

19. A process according to claim 18, wherein the said additive is a chromogenic substrate suitable for the selection of B.thuringiensis or B.cereus or both.

20. A process according to any one of claims 1 or 2, wherein the DNA to be introduced into the said bacterial host cell is a recombinant 25 DNA which is of homologous or heterologous origin or is a combination of homologous and heterologous DNA.

21. A process according to claim 20, wherein the said recombinant DNA contains one or more structural genes and 3' and 5' flanking regulatory sequences that are capable of functioning in the said bacterial host cells, which sequences are operably linked to the structural gene(s) and thus ensure the expression of the said structural *i I gene(s) in said bacterial host cells. S.22. A process according to claim 21, wherein the said structural gene codes for a-d-endotoxin polypeptide occurring naturally in B. thuringiensis, or for a polypeptide that has substantial structural homologies .therewith and has still substantially the toxicity properties of the said ibrystalline 6-endotoxin polypeptide. 88

23. A process according to claim 22, wherein the said 6-endotoxin- encoding DNA sequence is substantially homologous with at least the part or parts of the natural 6-endotoxin-encoding sequence that is (are) responsible for the insecticidal activity.

24. A process according to claim 22, wherein the said polypeptide is substantially homologous with a -endotoxin polypeptide of a suitable sub-species of B.thuringiensis, selected from the group consisting of kurstaki, berliner, alesti, sotto, tolworthi, dendrolimus, tenebrionis and israelensis. A process according to'claim 22, wherein the said 6-endotoxin- encoding DNA sequence is a DNA fragment of B.thuringiensis var. kurstaki HD1 located between nucleotides 156 and 3623 in formula I, or is any shorter DNA fragment that still codes for a polypeptide having insect-toxic properties: r r r r r r io' /926Z 89 Formula I GTTAACACCC GTGCATTTTT AACAGTATTA 160 AACTTATGGA 210 TTAAGTAACC 260 TTACACCCCA 310 AATTTGTTCC 360 GGAATTTTTG 20 TGGGTCAAAA 70 TCATAAGATG 120 TATCATAATG 170 TAACAATCCG 220 CTGAAGTAGA 270 ATCGATATT' 320 CGGTGCTGGA 370 GTCCCTCTCA 30 ATTGATATTT 80 AGTCATATGT 130 AATTGGTATC 180 AACATCAATG 230 AGTATTAGGT 280 CCTTGTCGCT 330 TTTGTGTTAG 380 ATGGGACGCA 40 AGTAAAATTA 90 TTTAAATTGT 140 TTAATAAAAG 190 AATGCATTCC 240 GGAGAAAGAA 290 AACGCAATTT GTTGCACTTT 100 AGTAATGAAA 150 AGATGGAGGT 200 TTATAATTGT 250 TAGAAACTGG 300 CTTTTGAGTG *0s* V. 9 I 9* 9 9 9 S S 9 9 S. S 9* 9. S 9* S I S 9 S*I 340 GACTAGTTGA 390 TTTCTTGTAC 440 TAGGAACCAA 490 TTTACGCAGA 350 TATAATATGG 400 AAATTGAACA 450 GCCATTTCTA 500 ATCTTTTAGA 410 GTTAATTAAC 460 GATTAGAAGG 510 GAGTGGGAAG 420 CAAAGAATAG 470 ACTAAGCAAT 430 AAGAATTCGC 480 CTTTATCAAA 520 530 540 550 CAGATCCTAC TAATCCAGCA TTAAGAGAAG AGATGCGTAT 560 TCAATTCAAT 610 CAGTTCAAAA 660 AAT TTACATT 710 GGGATTTGAT 760 TTATTGGCAA 570 GACATGAACA 620 TTATCAAGTT 670 TATCAGTTTT 720 GCCGCGACTA 770 CTATACAGAT 580 GTGCCCTTAC 630 CCTCTTTTAT 680 GAGAGATGTT 730 TCAATAGTCG 780 CATGCTGTAC 590 AACCGCTATT 640 CAGTATATGT 690 TCAGTGTTTG 740 TTATAATGAT 790 GCTGGTACAA 600 CCTCTTTTTG 650 TCAAGCTGCA 700 GACAAAGGTG 750 TTAACTAGGC 800 TACGGGATTA S 9* 6~ 9 9 9 .9 -9 9 9 S 9 09 9. 9. Se 9 9 te C 999 810 GAGCGTGTAT 860 TAGAAGAGA 910 AC TAT GATAG 960 GAAATTTATA 820 GGGCACCGGA 870 TTAACACTAA 920 TAGAACGTAT 970 CAAACCCAGT 830 TTCTACGAGAT 880 CTGTATTAGA 930 CCAATTCGAA 980 ATTAGAAAAT 840 TGGATAAGAT 890 TATCGTTTCT 940 CAGTTTCCCA 990 TTTGP.TGGTA 850 ATAATCAATT 900 CTATTTCCGA 950 ATTAACAAGA 1000 GTTTTCGAGG 1010 CTCGGCTCAG 1060 TACT TAACAG 1110 TGGTCAGGGC 1020 GGCATAGAAG 1070 TATAACCATC 1120 ATCAAATAAT 1030 GAAGTAT TAG 1080 TATACGGATG 1130 GGCTTCTCCT 1040 1050 GAGTCCACAT TTGATGGATA 1090 1100 CTCATAGAGG AGAATAT TAT 1140 1150 GTAGGGTTTT CGGGGCCAGA -91- 1160 ATTCACTTTT 1210 GTATTGTTGC 1260 TTATATAGAA 1310 TCTTGACGGG 1360 CTGTATACAG 1410 CAGAATAACA 1460 TGTTTCAATG 1510 GAGCTCCTAT 1560 AT T CCTT CAT 1170 CCGCTATATG 1220 TLCAACTAGGT 1270 GACCTTTTAA 1320 ACAGAATTTG 1370 AAAAAGCGGA 1420 ACGTGCCACC 1470 TTTCGTTCAG 1520 GTTCTCTTGG 1570 CACAAATTAC 1180 GAACTATGGG. 1230 CAGGGCGTGT 1280 TATAGGGATA 1330 CTTATGGAAC 1380 ACGGTAGATT 1430 TAGGCAAGGA 1480 GCTTTAGTAA 1530 ATACATCGTA 1580 ACAAATACCT -0 AAATGCAGCT 1240 ATAGAACATT 1290 AATAA.TCAAC 1340 CTCCTCAAAT 1390 CGCTGGATGA 1440 TT TAG TCAT C 1490 TAGTAGTGTA 1540 GTGCTGAATT 1590 TTAACAAAAT 1200 CCACAACAAC 1250 ATCGTCCACT 1300 AACTATCTGT 1350 TTGCCATCCG 1400 AATACCGCCA 1450 GATTAAGCCA 1500 AGTATAATAA 1550 TAATAATATA 1600 CTACTAATCT 0 lS 4

6066. '06, S :00*S 0 0 0 :6. 0 s 1610 TGGCTCTGGA 1660 TTCTTCGAAG 1620 ACT TCTGTCG 1630 TTAAAGGACC 1640 AGGATTTACA 1690 CAACCTTAAG 1670 1680 1650 GGAGGAGATA 1700 AGTAAATATT 1750 ACGCTTCTAC AACTTCACCT GGCCAGATTT 1710 -CTGCACCAT c C 1720 1-130 1740 TATCACAAAG ATATCGGGTA AGAATTCGCT -92- 17 60 CACAAATTTA 1810 GGAATTTTTC 1860 TTTAGGACTG 1910 TGTATTTACG 1960 TAGATCGAAT 2010 GATTTAGAAA 2060 TCAAATCGGG 2110 CCAATTTAGT 2160 GAATTGTCCG 2210 TTTACTTCAA 2260 GCTGGAGAGG S. .5 S S S S. S S. S S S S S. S 1770 CAATTCCATA 1820 AGCAACTATG 1870 TAGGTTTTAC 1920 TTAAGTGCTC 1970 TGAATTTGTT 2020 GAGCACAAAA 2070 TTAAAAACAG 2120 TGAGTGTTTA 2170 AGAAAGTCAA 2220 GATCCAAACT 2270 AALGTACGGAT 2320 ACGTTACGCT 1780 CATCAATTGA 1830 AkGTAGTGGGA 1880 TACTCCGTTT 1930 ATGTCTTCAA 1980 CCGGCAGAAG 2030 GGCGGTGAAT 2080 ATGTGACGGA 2130 TCTGATGAAT 148 0 ACATGCGPAG 2230 TTAGAGGGAT 2280 ATTACCATCC 2330 ATTGGGTACC 1790 CGGAAGACCT 1840 GTAATTTACA 1890 AACTTTTCAA 1940 TTCAGGCAAT 1990 TAACCTTTGA 2040 GAGCTGTTTA 2090 TTATCATATT 2140 TTTGTCTGGA 2190 CGACTTAGTG 2240 CAATAGACAA 2290 AAGGAGGCGA 2340 TTTGATGAGT 1800 ATTAATCAGG 1850 GTCCGGAAGC 1900 ATGGATCAAG 1950 GAAGTTTATA 2000 GGCAGAATAT 2050 CTTCTTCCAA 2100 GATCAAGTAT 2150 TGAAAAAAAA 2200 ATGAGCGGAA 2250 CTAGACCGTG 2300 TGACGTATTC 2350 GCTATCCAAC 2310 AAAGAGAATT 0 S-A/ o 93 2380 2360 2370 2390 2400 GTATTTATAT CAAAAAATAG ATGAGTCGAA ATTAAAAGCC TATACCCGTT 2410 ACCAATTAAG 2460 ATTCGCTACA 2510 CTTATGGCCG 2560 CCCATCATTT 2610 GACTTAGGTG 2660 AAGACTAGGA 2710 CACTAGCTCG 2760 AAATTGGAAT 2810 AGATGCTTTA 2860 ACATCGCGArT 2420 AGGGTATATC 2470 ATGCCAAACA 2520 CTTTCAGCCC 2570 CTCCTTGGAC 2620 TATGGGTGAT 2670 AATCTAGAAT 2720 TGTGAAAAGA 2770 GGGAA~ACAA 2820 TTTGTAAACT 2870 GATTCATGCG 2430 GAAGATAGTC 2480 CGAAACAGTA 2530 CAAGTCCAAT 2580 ATTGATGTTG 2630 ATTCAAGATT 2680 TTCTCGAAGA 2730 GCGGAGAAAA 2780 TATTGTTTAT 2830 CT CAATAT GA 2880 GCAGATAAAC 2440 AAGACTTAGA. 2490 AATGTGCCAG 2540 CGGAAAATGT 2590 GATGTACAGA 21640 AAGACGCAAG 2690 GAAACCATTA 2740 AATGGAGAGA 2790 AAAGAGGCAA 2840 TAGATTACAA 2890 GCGTTCATAG 2450 AATCTATTTA 2500 GTACGGGTTC 2550 GCCCATCATT 2600 CT TAAAT GAG 2650 ATGGCCATGC 2700 GTAGGAGAAG 2750 CAAACGTGAA 2800 AAGAATCTGT 2850 GCGGATACCA 2900 CATTCGAGAA q. S S S S S S 55 S SS S S S.. 2910 2920 2930 2940 2950 GCTTATCTGC CTGAGCTGTC TGTGATTCCG GGTGTCAATG CGGCTATTTT -94- 2960 TGAAGAATTA 3010 GAAATGTCAT 3060 GTGAAAGGGC 3110 TGTTGTTCCG 3160 CGGGTCGTGG 3210 GAAGGTTGCG 3260 GTTTAGCAAC 3310 GTAATGATTA 3360 CGTAATCGAG 3410 TGATTATGCA 3460 ACAATCCTTG 2970 GAAGGGCGTA 3020 TAAAAATGGT 3070 ATGTAGATGT 3120 GAATGGGAAG 3170 CTATATCCTT 3220 TAACCATTCA 3270 TGTGTAGAAG 3320 TACTGCGACT 3370 GATATGACGG 3420 TCAGCCTATG 3470 TGAATCTAAC 2980 TTTTCACTGC 3030 GATTTTAATA 3080 AGAAGAACAA 3130 CAGAAGTGTC 3180 CGTGTCACAG 3230 TGAGATCGAG 3280 AGGAAGTATA 3330 CAAGAAGAAT 3380 AGCCTATGAA 3430 AAGAAAAAGC 3480 AGAGGATATG 2990 ATTCTCCCTA 3040 AT GGCT TAT C 3090 AACAACCACC 3140 ACAAGAAGTT 3190 CGTACAAGGA 3240 AACAATACAG 3290 TCCAAACAAC 3340 ATGAGGGTAC 3390 AGCAATTCTT 3440 ATATACAGAT 3490 GGGATTACAC 3000 TATGATGCGA 3050 CTGCTGGAAC 3100 GTTCGGTCCT 3150 CGTGTCTGTC 3200 GGGATATGGA 3250 ACGAACTGAA 3300 ACGGTAACGT 3350 GTACACTTCT 3400 CTGTACCAGC 3450 GGACGAAGAG 3500 ACCACTACCA S S S. S S S. S S. S S S S 3510 GCTGGCTATG 3520 3530 3540 3550 TGACAAAAGA ATTAGAGTAC TTCCCAGAAA CCGATAAkGGT 3560 ATGGATTGAG 3610 AATTACTTCT 3660 AATAAAGAAT 3710 ATATGAATAA 3760 GTATGATTTA 3810 TAACGGGGTA 3570 ATCGGAGAA 3620 TATGGAGGAA 3670 GATTACTGAC 3720 AAAACGGGCA 3770 ACGAGTGATA 3820 CCGCCACATG 3580 3590 CGGAAGGAAC ATTCATCGTG 3630 TAATATATGC 3680 TTGTATTGAC 3730 TCACTCTTAA 3780 TTTAAATGTT 3830 CCCATCAACT 3640 TTTATAATGT 3690 AGATAAATAA 3740 AAGAA.TGATG 3790 TTTTTTGCGA 3840 TAAGAATTTG 3600 GACAGCGTGG 3650 AAGGTGTGCA 3700 GGAAATTTTT 3750 TCCGTTTTTT 3800 AGGCTTTACT 3850 CACTACCCCC ft. ft... ft. ft ft. ft ft ft ft ft ft. ft ft ft i ft. ft 'ft ft. 3860 AAGTGTCAAA 3910 ATTTTTTATG 3960 AGCTGTATCG 4010 TTAGGTTTTG 4060 CATATGTATC 3870 AAACGTTATT .3920 AATCTTTCAA 3970 TCATTTAACC 4020 TAAAAAGAA\ 4070 TGGGGCAGTC 3880 CTTTCTAAAA 3930 TTCAAGATGA 3980 CCTTCTCTTT 4030 ACGAAAGTTT 3890 AGCTAGCTAG 3940 ATTACAACTA 3990 TGGAAGAACT 4040 3900 AAAGGATGAC 3950 T TTTCTGAAG 4000 CGCTAAAGAA 4050 TCAGGAAATG AATTAGCTAC 4080 AACGTACAGC 4130 GCCACAGCAC 4090 GAGTGATTCT 4100 CTCGTTCGAC 4110 4120 4140 4150 TCTTATGAGT CCAGAAGGAC NT 0~ 96 4160 4170 4180 4190 4200 TCAATAAACG CTTTGATAAA AAAGCGGTTG AATTTTTGAA ATATATTTTT 4210 4220 4230 4240 4250 TCTGCATTAT GGAAAAGTAA ACTTTGTAAA ACATCAGCCA TTTCAAGTGC 4260 4270 4280 4290 4300 AGCACTCACG TATTTTCAAC GAATCCGTAT TTTAGATGCG ACGATTTTCC 4310 4320 4330 4340 4350 AAGTACCGAA ACATTTAGCA CATGTATATC CTGGGTCAGG TGGTTGTGCA 4360 CAAACTGCAG 26. A process according to any one of claims 1 or 2, wherein the cloning vector used in step is a bifunctional vector that apart from being capable of replicating in bacterial cells selected from the group consisting of B.thuringiensis and B.cereus cells is capable of replicating at least in one other heterologous host organism, and that is identifiable in both the homologous and the heterologous host system. 27. A process according to claim 26, wherein the said heterologous host organisms are prokaryotic organisms selected from the group consisting of the genera Bacillus, Staphylococcus, Streptococcus, Streptomyces, Pseudomonas, Escherichia, Agrobacterium, Salmonella, and Erwinia or eukaryotic organisms selected from the group consisting of yeast, animal and plant cells. 28. A process according to claim 27, wherein the said heterologous host organism is E.coli. 29. A bifunctional vector when used in a process according to any one of claims 1 or 2 that, apart from being capable of replicating in t bacterial cells selected from the group consisting of B thuringiensis and B.cereus cells, are capable of replicating in at least one other heterologous host organisms and that is identifiable in both the homologous.and the heterologous host system and that comprises under the r control of expression sequences that are capable of functioning in ai acterlal cells selected from the group consisting of Bacillusthuringiensis 2 2 0 and Bacilluscereus cells a structural gene encoding a 6-endotoxin LMM/926Z 97 polypeptide that occurs naturally in B.thuringiensis, or for a polypeptide that has substantial structural homologies therewith and has still substantially the toxicity properties of the said crystalline 6-endotoxin Dolypeptide. 30. A bifunctional vector according to claim 29, wherein the said expression sequences include a sporulation-dependent promoter of B. thuringiensis. 31. A bifunctional vector according to claim 29, wherein the said a-endotoxin-encoding DNA sequence is substantially homologous with at least the part or parts of the natural 6-endotoxin-encoding sequence that is (are) responsible for the insecticidal activity. 32. A bifunctional vector according to claim 29, wherein the said polypeptide is substantially homologous with a S-endotoxin polypeptide of a suitable sub-species of B.thuringiensis, selected from the group cons i sti ng of kurstaki, berliner, alesti, sotto, tolworthi, dendrolimus, tenebrionis and israelensis. 33. A bifunctional vector according to claim 29, wherein the said 6-endotoxin-encoding DNA sequence is a DNA fragment of B.thuringiensis var. kurstaki HD1 located between nucleotides 156 and 3623 in formula I, or is any shorter DNA fragment that still codes for a polypeptide having insect-toxic properties: Formula I 20 30 40 GTTAACACCC TGGGTCAAAA ATTGATATTT AGTAAAATTA GTTGCACTTT 70 80 90 100 GTGCATTTTT TCATAAGATG AGTCATATGT TTTAAATTGT AGTAATGAAA 110 120 130 140 150 SAACAGTATTA TATCATAATG AATTGGTATC TTAATAAAAG AGATGGAGGT 160 170 180 190 200 AACTTATGGA TAAdAATCCG AACATCAATG AATGCATTCC TTATAATTGT -98- 210 TTAAGTAACC 260 TTACACCCCA 310 AATTTGTTCC 360 CGAATTTTTG 410 GTTAATTAAC 460 GATTAGAAGG 510 GAGTGGGAAG 560 TCAATTCAAT 610 CAGTTCAAAA 660 AATTTACATT 710 GGGATTTGAT 760 1' TATTGGCAA 220 CTGAAGTAGA 270 ATCGATATTT 320 CGGTGCTGGA 370 GTCCCTCTCA 420 CAAAGAATAG 470 ACTAAGCAAT 520 CAGATCCTAC 570 GACATGAACA 620 TTATCAAGTT 670 TATCIACTTTT 720 GCCGCGACTA 770 CTATACAGAT 230 AGTATTAGGT 280 CCTTGTCGCT 330 TTTGTGTTAG 380 ATGGGACGCA 430 AAGAATTCGC 480 CTTTATCAA 530 TAATCCAGCA 580 GTGCCCTTAC 630 CCTCTTTTAT 680 GAGAGATGTT 730 TCAATAGTC(, 780 CATGCTGTAC 240 GGAGAAAGAA 290 AACGCAATTT 340 GACTAGTTGA 390 TTTCTTGTAC 440 TAGGAACCAA 490 TTTACGCAGA 540 TTAAGAGAAG 590 AACCGCTATT 640 CAGTATATGT 690 TCAGTGTTTG 740 T TATAATGAT 790 GCTGGTACAA 250 TAGAAACTGG 300 CTTTTGAGTG 350 TATAATATG 400 AAATTGAACA 450 GCCATTTCTA 500 ATCTTTTAGA 550 AGATGCGTAT 600 CCTCTTTTTG 650 TCAAGCTGCA 700 GACAAA'GGTG 750 TTAACTAGGC 800 TACGGGATTA 9 9* 9 9 9 99 810 820 830 GAGCGTGTAT GGGGACCGGA TTCTAGAGAT 840 850 TGGATAAGAT ATAATCAATT 890 900 TATCCTTTCrT* ATTTCCGA 860 TAGAAGAGAA 910 ACTATGATAG 960 GAAATTTATA 1010 CTCGGCTCAG 1060 TACT TAACAG 1110 TGGTCAGGGC 1160 ATTCACTTTT 1210 GTATTGTTGC 870 TTAACACTAA 920 TAGAACGTAT 970 CAAACCCAGT 1020 GGCATAGAAG 1070 TAT.AAC CAT C 1120 ATCAAATAAT 1170 CCGCTATATG 1220 TCAACTAGGT 880 CTGTATTAGA 930 CCAATTCGAA 980 ATTAGAAAAT 1030 GAAGTATTAG 1080 TATACGGATG 1130 GGCTTCTCCT 1180 GAACTATGGG 940 950 CAGTTTCCCA ATTAACAAjGA 990 TTTGATGGTA 1040 GAGTCCACAT 1090 CTCATAGAGG 1140 GTAGGGTTTT 1190 AAATGCAGCT a a a. a i a. a a a a 1000 GTTTTCGAGG 1050 TTGATGGATA 1100 AGAATAT TAT 1150 CGGGGCCAGA 1200 CCACAACAAC 1250 ATCGTCCACT 1300 AAC TAT CT CT 1230 1240 CAGGGCGTGT ATAGAACATT 1260 1270 1280 1290 TTATATAGAk GACCTTTTAA TATAGGGATA AATAATCAAC 1310 1320 1330 1340 1350 TCTTGACGGG ACAGAAkTTTG CTTATGGAAZ CTCCTCAAAT TTGCCATCCG 1360 1370 1380 1390 1400 11 1 GTATACAG AAAAAGCGGA ACGGTAGATT CGCTGGATGA AATACCGCCA 'VN- 04 -100- 1410 CAGAATAACA 1460 TGTTTCAATG 1510 GAGCTCCTAT 1560 AT TCC T TCAT 1610 TGGCTCTGGA 1660 TTCTTCGAAG 1710 ACTGCACCAT 1760 CACAAATTTA 1810 GGAATTTTTC 1860 TTTAGGACTG 1420 ACGTGCCACC 1470 TTTCGTTCAG 1520 GTTCTCTTGG 1570 CACAAJATTAC 1620 ACT TCTGTCG 1670 AACTTCACCT 1720 TAT CACAAAG 1770 CAATTCCATA 1430 TAGGCAAGGA 1480 GCTTTAGTAA 1530 ATACATCGTA 1580 ACAAATACCT 1630 TTAAAGGACC 1680 GGCCAGATTT 1730 ATATCGGGTA 1780 CATCAATTGA 1440 TT TAG TCAT C 1490 TAGTAGTGTA 1540 GTGCTGAATT 1590 TTAACAAAAT 1640 AGGATTTACA 1690 CAACCTTAAG 1740 AGAATTCGCT 1790 CGGAAGACCT 1450 GATTAAGCCA 1500 AGTATAATAA 1550 TAATAATA'rA 1600 CTACTAATCT 1650 GGAGGAGATA 1700 AGTAAATATT 1750 ACGCTTCTAC 1800 ATTAATCAGG S. S SS S. S 5 5 S S 5 S. 55 S S S S S S 5* S S 4 1820 AGCAACTATG 1870 TAGGTTT TAC 1920 TTAAGTGCTC 1830 AGTAGTGGGA 1880 TACTCCGTT 1840 1850 GTAATTTACA GTCCGGAAGC 1890 AACTTTTCAA 1900 ATGGATCAAG 1910 TGTATTTACG 1930 1940 1950 ATGTCTTCAA TTCAGGCAAT GAAGTTTATA 1960 1970 1980 1990 2000 TAGATCGAAT TGAATTTGTT CCGGCAGAAG TAACCTTTGA GGCAGAATAT 101 2010 GATTTAGAAA 2060 TCAAATCGGG 2110 CC.UkTTTAGT 2160 GAATTGTCCG 2210 TTTACTTCAA 2260 GCTGGAGAGG 2310 AAAGAGAATT 2360 C TATTATAT 2020 2030 GAGCACAAAA GGCGGTGAAT 2070 2080 TTAAAAACAG ATGTGACGGA 2040O GAGCTGTTTA 2090 TTATCATATT 2050 CTTCTTCCAA 2100 GATCAAGTAT 2120 T GAG TGCT TTA 2170 AGAAAGTCAA 2220 GATCCAZ\ACT 2270 AAGTACGGAT 2320 ACGTTACGCT 2370 CAAAAAATAG 2130 TCTGATGAAT 2180 ACATGCGAAG 2 23 0 TTAGAGGGAT 2280 AT TACCATCC 2330 ATTGGGTACC- 2380 ATGAGTCGAA 2140 TTTGTCTGGA 2190 CGACTTAGTG 2240 CAATAGACAA 2290 AAGGAGGCGA 2340 TTTGATGAGT 2390 ATTAAAAGCC 2150 TGAAAAAA;A 2200 ATGAGCGGAA 2250 CTAGACCGTG 2300 TGACGTATTC 2350 GCTATCCAAC 2400 TATACCCGTT e 2410 ACCAATTAAG 2460 ATTCGCTACA 2510 CTTATGGCCG 2420 AGGGTATATC 2470 ATGCCAAACA 2520 CTTTCAGCCC 2570 CTCCTTGGAC 2430 GAAGATAGTC 2480 CGAAACAGTA 2530 CAAGTCCAAT 2580 ATTGATGTTG 2440 AAGACTTAGA 2490 AATGTGCCAG 2540 CGGAAAATGT 2590 GATGTACAGA 2450 AATCThTTTA 2500 GTACGGGTTC 2550 GCCCATCATT 2600 CTTAAATGAG RA 2560 TCATTT T 0' -102- 2610 GACT TAG GTG 2620 2630 TATGGGTGAT ATTCAAGATT 2640 AAGACGCAAG 2660 AAGACTAGGA 2710 CACTAGCTCG 2760 AAATTGGAAT 2810 AGATGCTTTA 2860 ACATCGCGAT 2910 GCT TATCTGC 2960 TGAAGAAT TA 3010 GAAATGTCAT 3060 GTGAAAGGGC 3110 TGTTGTTCCG C C C C. C C C* 4* C C C i.e 2670 AATCTAGAAT 2720 TGTGAAAAGA 2770 GGGAAACAAA 2820 TT TGTAAACT 2870 GATTCATGCG 2920 CTGAGCTGTC 2970 GAAGGGCGTA 3020 TAAAAATGGT 3070 ATGTAGATGT 3120 GAATGGGAAG 3170 CTATATCCTT 2680 TTCTCGAAGA 2730 GCGGAGAAAA 2780 TATTGTTTAT 2830 CT CAATAT GA 2880 GCAGATAAAC 2930 TGTGATTCCG 2980 TTTTCACTGC 3030 GATTTTA7ATA 2690 GAAACCATTA 2740 AATGGAGAGA 2790 AA.AGAGGCAA 2840 TAGATTACAA 2890 GCGTTCATAG 2940 GGTGTCAATG 2990 P TTCTCCCTA 3040 ATGGCTTATC 2650 ATGGCCATGC 2700 GTAGGAGAAG 2750 CAAACGTGAA 2800 AAGAATCTGT 2850 GCGGATACCA 2900 CATTCGAGAA 2950 CGGCTATTTT 3000 TATGATGCGA 3050 CTGCTGGAAC 3100 GTTCGGTCCT 3080 3090 AGAAGAACkAA AACAACCACC 3130 3140 CAGAAGTGTC ACAAGAAGTT 3180 3190 CGTGTCACAG CGTACAAGGA 3150 CGTGTCTGTC 3200 GGGATATGGA 3160 -103- 322.0 GAAGGTTGCG 3260 GTTTAGCAAC 3310 GTAATGATTA 3360 CGTAATCGI.G 3410 TGATTATGCA 3460 ACAATCCTTG 3510 GCTGGCTATG 3560 ATGGATTGAG 3220 TAACCATTCA 3270 TGTGTAGAAG 3320 TACTGCGACT 3370 GATATGACGG 3420 TCAGCCTATG 3470 TGAATCTAAC 3520 TGACAAAAGA 3570 ATCGGAGAAA 3230 3240 TGAGATCGAG AACAATACAG 3250 ACGAACTGAA 3280 AGGAAGTATA 3330 CAAGAAGAAT 3380 AGCCTATGAA 3430 AAGAAAAAGC 3480 AGAGGATATG 3530 ATTAGAGTAC 3580 CGGAAGGAAC 3290 TCCAAACAAC ATGAGGG7',J- 3390 AGCAATTCTT 3440 ATATACAGAT 3490 GGGATTACAC 3540 TTCCCAGAAA 3590 ATTCATCGTG 3300 ACGGTAACGT 3350 cITACACT TOT 3400 CTGTACCAGC 3450 GGACGAAGAG 3500 ACCACTACCA 3550 CCGATAAGGT 3600 GACAGCGTGG S S. 55 S. S Sq 55 S S S. S S S S S S. 55 S S S. S. S S S S 3610 AATTACTTCT 3660 AATAAAGAAT 3710 ATATGAATAA 3620 TATGGAGGAA 3670 GATTACTGAC 3720 AAAACGGGCA 3770 ACGAGTGATA 3630 TAATATATGC 3680 TTGTATTGAC 3730 TCACTCTTAA 3780 TTTAAATGTT 3640 TTTATAATGT 3690 AGATAAATAA 3740 AAGAATGATG 3650 AAGGTGTGCA 3700 GGAAATTTTT 3750 TCCGTTTTTT 3760 3790 3800 TTTTTTGCGA AGGCTTTACT 104 3810 TAACGGGGTA 3860 AAGTGTCAAA 3310 ATTTTTTATG 3960 AGCTGTATCG 4010 TTAGGTTTTG 4060 CATATGTATC 4110 TATGCAGTCA 4160 TCAATAAACG 3820 CCGCCACATG 3870 AAACGTTATT 3920 AATCTTTCAA 3970 TCATTTAACC 4020 TAAAAAGAAA 4070 TGGGGCAGTC 4120 ATTACACGCC 4170 CTTTGATAAA 3830 CCCATCAACT 3880 CTTTCTAAAA 3930 TTCAAGATGA 3980 CCTTCTCTTT 4030 ACGAAAGTTT 4080 AACGTACAGC 4130 GCCZACAGCAC 4180 AAAGCGGTTG 3840 TAAGAATTTG 3890 AGCTAGCTAG 3940 ATTACAACTA 3990 TGGAAGAACT 4040 TCAGGAALATG 4090 GAGTGATTCP 4140 TCTTATGAGT 4190 AATTTTTGAA 3850 CACTACCCCC 3900 AAAGGATGAC 3950 TTTTCTGAkG 4000 CGCTAAAGAA 4050 AATTAGCTAC 4100 CTCGTTCGAC 4150 CCAGAAGGAC 4200 ATATATTTTT 4. 4 4 04 *4 44 4 4 4* 4 .4 .4 4 4. 4 4 4 4 4 4.. 4210 TCTGCATTAT 4260 AGCACTCACG 4310 AAGTACCGAA 4220 GGAAAAGTAA 4270 TATTTTCAAC 4230 ACTTTGTAAA 4280 GAATCCGTAT 4240 ACATCAGCCA 4290 TTTAGATGCG 4250 TTTCAAGTGC 4300 ACGATTTTCC 4320 4330 4340 4350 ACATTTAGCA CATGTATATC CTGGGTCAGG TGGTTGTGCA 4360 105 34. The bifunctional vector pX193 (pK93) introduced into B. thuringiensis var. kurstaki HDlcryB (DSM 4571) and B. cereus 569K (DSM 4573). A bacterial host cell selected from the group consisting of B. thuringiensis and B.cereus cells prepared by a method as described in any one of claims 1 or 2 comprising a bifunctional vector according to any one of claims 29 to 33. 36. B.thuringiensis var. kurstaki HDlcryB according to claim transformed with the bifunctional vector pX193 (pK93) and deposited under the number DSM 4571. 37. B, cereus 569K according to claim 35, transformed with the bifunctional vector pX193 (pK93) and deposited under the number DSM 4573. 38. A method of controlling insects which comprises treating insects or their habitat with a bacterial host cell according to claim 35, or with a mixture thereof, or alternatively with a cell-free crystall-body preparation containing a protoxin that is produced by a bacterial host cell according to claim 39. A method according to claim 38, wherein the insects are insects of the orders Lepidoptera,Diptera or Coleoptera. A method according to claim 39, wherein the insects are insects of the order Lepidoptera. 41. A composition for controlling insects, comprising a bacterial host cell according to claim 35, or a mixture thereof, or alternatively a cell-free crystall-body preparation containing a protoxin that is produced by a bacterial host cell according to claim together with carriers, dispersing agents or carriers and dispersing agents conventionally employed. 42. A process according to claim 1, wherein the DNA of step (a) is obtainable by digesting total DNA of a bacterial donor selected from the group consisting of Bacillus thuringiensis and B. cereus. 43. A process for the identification of new &-endotoxin encoding genes in Bacillus thuringiensis, which process comprises digesting the total DNA of Bacillusthuringiensis using suitable restriction enzymes; isolating from the resulting restriction fragments those of Z suitable size; 106 inserting the said fragments into a suitable vector; constructing a genoumic DNA library by transforming Bacillus thuringiensis host cells with the said vector using a process according to claim 1; screening the thus obtainable DNA library for new 6-endotoxin encoding genes. 44. A process according to claim 43, wherein a bifunctional vector is used. A process according to claim 43, wherein an immunological screening process is used to locate new a-endotoxin encoding genes. 46. A process for inserting and cloning DNA sequences in gram positive bacteria selected from the group consisting of Bacillus thuringiensis and Bacilluscereus, which method is substantially as hereinbefore described with reference to any one of Examples 1 to 4 or 7 to 9. 47. A process for inserting, cloning and expressing DNA sequences in gram positive bacteria selected from the group consisting of Bacillus thuringiensis and Bacilluscereus, which method is substantially as hereinbefore described with reference to any one of Examples 6, 8 or 9. 48. A bifunctional vector for inserting and cloning, or inserting, cloning and expressing, DNA sequences in gram positive bacteria selected from Bacillus tHuringiensis or Bacillus cereus, which vector is substantially as hereinbefore described with reference to any one of Examples 3, 4 or 8. 49. A bifunctional vector for inserting and cloning, or inserting, cloning and expressing, DNA sequences in gram positive bacteria selected from Bacillus thuringiensis or Bacilluscereus, which vector is suLatantially as hereinbefore described with reference to Figure 6 or Figure 7. 50. A process for preparing a bifunctional vector for inserting and cloning, or inserting, cloning and expressing, DNA sequences in gram positive bacteria selected from Bacillus thuringiensis or Bacillus cereus, Swhich process is substantially as hereinbefore described with reference to any one of Examples 3, 4 or 8. 51. A bacterial host cell selected from B. thuringiensis or B.cereus cells prepared by a process as described in claim 46 or claim 48 comprlslng.,a bifunctional vector according to claim 48. N LMM/926Z 107 52. A composition for controlling insects, comprising a) a bacterial host cell according to claim 51, or a mixture thereof; or alternatively b) a cell-free crystal-body preparation containing a protoxin that is produced by a bacterial host cell according to claim 51, together with carriers, dispersing agents or carriers and dispersing agents conventionally employed. DATED this SECOND day of APRIL 1993 Ciba-Geigy AG Patent Attorneys for the Applicant SPRUSON FERGUSON o O *OI