SK304489A3 - Process for direct, targeted and reproducible genetic manipulation, bifunctional vectors, production microorganisms of bacillus strain transformed by bifunctional vector, insecticidal agent and use of bifunctional vectors - Google Patents

Abstract

The present invention describes a process which makes it possible to carry out direct and targeted genetic manipulation of Bacillus thuringiensis and the closely related B. cereus using recombinant DNA technology. The present invention also relates to the construction of plasmids and shuttle vectors and to the B. thuringiensis strains transformed therewith. Likewise described is a process for the direct cloning, expression and identification of genes in B. thuringiensis and the closely related B. cereus. <IMAGE>

Description

Area, techniques

The invention relates to the direct, targeted, reproducible genetic manipulation of Bacillus thuringiensis, as well as closely related Bacillus cereus technology using recombinant DNA, the method being based on an efficient transformation method for said Bacillus type.

Furthermore, the present invention relates to the construction of plasmids and particular types of vectors, in particular shuttle vectors, as well as strains of B. thuringiensis and / or B. cereus, which have been transformed using said plasmids.

The invention also relates to a method of incorporating and optionally expressing genes or other useful chains into Bacillus thuringiensis and / or Bacillus cereus, in particular the invention relates to a method of incorporating and expressing protoxin genes.

The invention also relates to a method of direct cloning and optionally expression and identification of new genes or other useful DNA strands in Bacillus thuringiensis and / or Bacillus cereus, thereby making it possible for the first time to set up a gene bank directly in Bacillus thuringiensis and / or Bacillus cereus and its expression.

BACKGROUND OF THE INVENTION

Bacillus thuringiensis belongs to a large group of gram-positive aerobic bacteria that form endospores. Unlike closely related B. cereus and B. anthracis species, most of the hitherto known B. thuringiensis species produce parasporally inclusive bodies during their sporulation, which are also referred to as crystalline bodies because of their crystalline structure. These crystalline bodies consist of isecticidally active crystalline protoxin proteins that produce the so-called δ-endotoxin.

These protein crystals cause B. thuringiensis toxicity to insects. However, the endotoxin exerts its isecticidal activity only after oral administration of these crystalline bodies and their dissolution in the alkaline intestinal juice of the target insect species, releasing the toxic components of the protoxin by limited proteolysis due to the action of proteases from the digestive system of the insects.

Said endotoxins from different strains of B. thuringiensis exhibit high specificity against target insect species, in particular against various individuals and larvae of the families Lepidoptera, Coleoptera and Diptera, while at the same time these toxins are characterized by high efficacy. A further advantage which plays a role in the use of B. thuringiensis δ-endotoxin is the apparent inability of the target insect species to develop resistance to said crystalline protein and, moreover, the harmlessness of said toxins when ingested by humans, other mammalian species, birds, fish or other species. insects with the exception of target species.

The insecticidal activity of B. thuringiensis protoxins has long been known. Already at the end of the 1920s, compositions containing B. thuringiensis were used as biological insecticides for the control of various diseases of crop plants caused by insects. On the discovery of B. thuringiensis var. israelensis, described in Goldberg L. and Margalit J., Mosquito News, 37, 355-358, 1977, and after the discovery of B. thuringiensis var. tenebrionis, as described by Krieg A. et al., Z. Ang. Ent. , 96, 500-508, 1983, it was possible to extend the spectrum of use to mosquito and beetle larvae.

With the introduction of genetic technology, it is possible to provide yet another extensive application for the B. thuringiensis toxin.

For example, cloning of said endotoxin in foreign production organisms, for example in E. coli, is already a routine procedure. This has led to the already known DNA sequences of a variety of δ-endotoxins and have been described, for example, in Schnepf H. E. and Whiteley H. R., Proc. Natl. Acad. Sci USA 78: 2893-2897 (1981); et al., The EMBO J. 1, 791-799, 1982; Geiser M. et al., Gene 48, 109-118, 1986; and Hauder M. et al., Gene 52, 285-290, 1987.

Most B. thuringiensis species contain multiple genes that encode an insecticidally active protein. These genes, which are expressed only in the sporulation phase, are in a large number of cases located in large portable plasmids of 30 to 150 megunits and therefore can be transferred very easily between different strains of B. thuringiensis and also between strains of B. thuringiensis and B cereus, if compatible, as described by Gonzales JM et al., Proc. Natl. Acad. Sci. USA 79: 6951-6955 (1982).

B. thuringiensis var. kurstaki belong to a group of related genes, many of which have already been cloned and their chains are also known. All these works were carried out predominantly in an E. coli cloning system.

The cloning of B. thuringiensis genes has hitherto been essentially limited to several exclusively heterologous production systems, of which the E. coli system has proven to be the most advantageous.

Recently, such reports have been reported regarding the cloning and expression of protoxin genes in other systems, for example in B. subtilis according to Klier A. et al., The EMBO J., 1, 791-799, 1982, further in Pseudomonas fluorenzens as described in Obukowicz MG et al., J. Bacteriol. , 168, 982-989, 1986, and in Saccharomyces cerevisidae, as described in European Patent Specification No. 5,962,178. 0 292 435

The cloning of E. coli takes advantage of the fact that many protoxin genes contain, in addition to conventional gram-positive promoters, a promoter similar to the promoter from E. coli. These related DNA promoter strands allow the B. thuringiensis protoxin gene to achieve expression also in heterologous systems if it is capable of recognizing the aforementioned control chain from above.

The protoxin proteins that have been expressed can then be isolated by disrupting the production cells according to known procedures and identified.

However, research has shown that in all cases, promoters similar to those of E. coli are not available in the protoxin gene, so that up to now expression in heterologous production systems can be achieved and thus only identified for certain protoxin genes, and those that meet the aforementioned promoter condition, as described by Donovan LP et al., Mol. Gen. Genet. 214: 365-372 (1988).

Cloning of genes outside the natural production organism and the use of these strains in practice as biological insecticides are associated with a number of disadvantages:

(a) expression of B. thuringiensis protoxin genes can only be achieved in certain cases

(b) there is generally only very little secretion of the foreign protein whose expression has been achieved or no secretion at all

(c) it is not always possible to ensure that the endotoxin gene is correctly inserted in heterologous production cells, which may lead to undesirable changes in the specific activity or in the whole range of toxin activity

(d) in the absence of expression at all, the rate of expression of the cloned foreign gene compared to the native strands is low.

Schnepf H. E. and Whiteley H. R., Proc. Natl. Acad. Sci. USA 78: 2893-2897 (1981) and J. Biol. Chem., 260, 6273, 1985, it is reported that the B. thuringiensis toxin cloned in E. coli constitutes only 0.5 to 1% of the total protein in the E. coli cell, whereas it is a crystalline protein in B. thuringiensis 30- 40% dry matter of sporulating culture. These large differences in the level of expression achieved are probably due to the absence of control signals specific for sporulation in a heterologous production system, another cause could be difficulty in recognizing the B. thuringiensis promoter and / or problems due to post-translational modification of the toxin molecule in the foreign cell.

(e) the range of production strains generally used for expression is not toxicologically as indifferent as B. thuringiensis or B. cereus

(f) B. thuringiensis and B. cereus constitute the natural proportion of microbial flora in the soil, usually the major proportion, which cannot be assured, of the production strains used for expression

All these problems and difficulties could be overcome if the B. thuringiensis genes could be cloned directly in a homologous production system in which the gram-positive promoters for protoxin genes could be utilized and thus expressed.

To date, however, there is no method to modify B. thuringiensis, from a commercial point of view, such an important microorganism, directly genetically, and thus to allow, for example, effective reintegration of the cloned protoxin gene into the B. thuringiensis strain.

This problem seems to be based on the fact that, to date, an efficient transformation system for B. thuringiensis or a closely related B. cereus has not been developed which would allow a high degree of transformation to be achieved and thus allow the use of the already known recombinant DNA method also for B. thuringiensis.

Until now, the methods used to obtain novel strains of B. thuringiensis with novel insecticidal properties have been based on the transfer of the plasmid with the gene coding for the protoxin by conjugation.

Successful reintegration of the cloned crystalline protein gene in B. thuringiensis has so far been described in only one case in Klier A. et al., Mol. Gen. Genet., 191, 257-262, 1983, but again, in the absence of a suitable transformation system for B. thuringiensis, the conjugation between B. subtilis and B. thuringiensis was again used to achieve transfer. Also in this case, E. coli was used as an auxiliary organism.

However, there are a number of serious disadvantages to conjugation delivery, so that these procedures are not suitable for conventional genetic modification of B. thuringiensis and B. cereus.

a) Conjugation of plasmids containing the gene coding for protoxin by conjugation can only be carried out by reaction between B. thuringiensis strains or between B. cereus and B. thuringiensis strains that are compatible with each other.

b) When transferring a plasmid by conjugation between unrelated strains, often only a low target transmission frequency can be achieved.

c) There is a possibility that the expression control of the protoxin gene or its modifications cannot be achieved.

d) There is no possibility to modify the gene used alone.

e) In the presence of multiple protoxin genes in a single strain, the expression of individual genes may be greatly reduced due to known effects.

f) Instability may occur due to possible homologous recombination of protoxin genes used.

Other transformation procedures, which are already quite commonly applicable to a variety of gram-positive organisms, have been shown to be inapplicable for both B. thuringiensis and B. cereus.

Such methods include, for example, direct transformation of bacterial protoplasts using polyethylene glycol, which can be used in a variety of Streptomyces strains according to Bibb JJ et al., Nature 247, 398-400, 1978, in B. subtilis, as described in Chang S. and Cohen SN, Molec. Gen. Genet. 168, 111-115, 1979, in B. megaterium according to Brown B. J. and Carlton B. C., J. Bacteriol. 142. 508-512, 1980, by Streptococcus lactis according to Kondo J.K. and McKay L. L., Appl. Environ. Microbiol. 48, 252-259, 1984, in S. faecalis, according to Wirth R. et al., J. Bacteriol. 165, 831-836, 1986, in Corynebacterium glutamicum according to Yoshihama M. et al., J. Bacteriol. 162, 591-597, 1985, and many other gram-positive bacteria with good results.

To use these procedures, it is necessary to first convert bacterial cells into protoplasts, i.e., it is necessary to disrupt the cell wall by the action of the appropriate enzymes.

In these direct transformation procedures, it would be desirable to achieve expression of newly introduced genetic information and regeneration of transformed protoplasts on complex solid nutrient media before sufficient transformation could be demonstrated using, for example, a selection label.

These transformation procedures then proved to be inappropriate for B. thuringiensis and related B. cereus. Due to the high lysozyme resistance of B. thuringiensis cells and the low regenerability of protoplasts to intact cell wall cells, the achievable transformation rate remains very low and poorly reproducible, as described in Alikhanian S.J. et al., J. Bacteriol. 146. 7-9, 1981, Martin P. ' A. et al., J. Bacteriol. 145, 980-983, 1981, and Fisher

Η. Á., Arch. Microbiol. 139, 231-217 (1984).

Thus, using these techniques, it is possible to incorporate very simple non-recombinant DNA plasmids into low-frequency B.thuringiensis or B. cereus cells.

The reports of the individual transformation results obtained using the above procedures consist in the development of very demanding optimization programs, which are additionally applicable to only one particular B. thuringiensis strain and are associated with high costs and at the same time, as described in Schall. D., Genubertragung zwischen Isolaten von Bacillus thuringiensis durch Protoplastentransformation und Fusion. Dissertation, Universität Tubingen, 1986. For these reasons, these processes are not suitable for commercial use on an industrial scale.

As can be deduced from a great deal of work and intensive research into the genetics of B. thuringiensis, there is a great interest in developing new methods for subjecting B. thuringiensis or a close relative of B. cereus to direct genetic modification and thereby achieving cloning of the protoxin gene in natural system. Nevertheless, the problems and difficulties mentioned above have not been satisfactorily resolved. So far, there are no suitable transformation procedures available to allow rapid, efficient and reproducible transformation of B. thuringiensis and / or B. cereus with a sufficiently high transformation frequency, nor suitable cloning vectors to allow the use of the recombinant DNA method, as commonly used for other bacterial systems, also for B. thuringiensis. The same applies to B. cereus.

SUMMARY OF THE INVENTION

It has now unexpectedly been found that all the problems and difficulties mentioned can be solved in a relatively simple manner.

SUMMARY OF THE INVENTION It is an object of the present invention to provide a novel process by which recombinant DNA can be used for the first time to perform direct, targeted and reproducible genetic manipulation of both B. thuringiensis and B. cereus. and / or B. cereus transformed using a simple high efficiency transformation procedure using recombinant DNA that would be suitable for the putative genetic manipulation of Bacillus thuringiensis and / or Bacillus cereus.

Accordingly, the present invention provides a method for the direct, targeted and reproducible genetic manipulation of Bacillus thuringiensis and / or Bacillus cereus using recombinant DNA technology by isolating suitable DNA and transforming it into Bacillus thuringiensis by means of a simple high-efficiency transformation procedure. and Bacillus cereus, wherein the transformation of Bacillus thuringiensis and / or Bacillus cereus is carried out by:

(a) prepare a cell suspension of suitable cell density in a culture medium suitable for the cultivation of Bacillus thuringiensis or Bacillus cereus cells, under aeration sufficient for their growth,

(b) the cells are separated from the medium and resuspended in an inoculation buffer suitable for subsequent electrical opening of pores,

(c) a DNA sample is added at a concentration suitable for opening the pores by electric current, preferably at a concentration between 1 μ <3 and 20 gg,

d) the mixture prepared in steps b) and c) is transferred to an electric pore opening device,

(e) the mixture is allowed to discharge the capacitor one or more times over a short period of time, generating in the short term a strong electric field at a time sufficient to transform Bacillus thuringiensis and / or Bacillus cereus cells with recombinant DNA;

f) optionally incubating the cells after opening the pores with electric current

g) the cells so treated are plated on a suitable selection medium and then plated

h) separating the transformed cells.

The invention also encompasses a direct method of cloning, expressing and identifying genes or other useful DNA sequences, in particular protoxin genes in B. thuringiensis and / or B. cereus, by

(a) cleaves the total B. thuringiensis DNA by treatment with the appropriate restriction enzymes;

(b) fragments of appropriate size are isolated from the resulting restriction enzymes,

(c) the fragments are inserted into an appropriate vector;

d) transforming B. thuringiensis and / or B. cereus cells using said vector

(e) cells containing new DNA strands are separated from the transformed cells by a suitable selection procedure and optionally isolated.

Of course, in addition to the structural genes, any other useful DNA strands, for example non-coding DNA strands, having a control function, for example, antisense DNA, may also be used in the method of the invention.

The method according to the invention opens up a large number of new possibilities which could be used both scientifically and commercially.

In this way, for example, it is possible for the first time to control the synthesis of δ-endotoxin at the genetic level, particularly in terms of sporulation.

It will now also be possible to clarify the location of the toxin molecule's regions that cause toxicity to some insect species, and to what extent these sites are associated with the specificity of this effect.

The knowledge of the molecular organization of the various toxin molecules and the genes coding for this molecule from different B. thuringiensis species is of extremely great practical importance for the targeted genetic manipulation of these genes, which is now made possible for the first time using the method of the invention.

In addition to targeted modification of the endotoxin gene itself, the novel method also enables manipulation of the DNA control strands to express these genes, thereby enhancing certain specific properties of said endotoxins, such as their specificity, their uptake and the like, and their rate and rate. production, for example by incorporating more efficient or stronger promoter chains.

By targeted mutation of selected genes or gene regions in vitro, novel variants of B. thuringiensis and / or B. cereus can be obtained in this way.

A further possibility of constructing new variants of B. thuringiensis and / or B. cereus consists in linking genes or stretches of genes derived from different strains of B. thuringiensis to obtain strains of B. thuringiensis and / or B. cereus s. extended spectrum of use. For this purpose, i. synthetic or semi-synthetic genes or gene regions may also be used to obtain novel variants of B. thuringiensis or B. cereus.

The method according to the invention, in view of the great increase in the frequency of transformations and the simplification of the process for the first time, allows the creation of a gene bank and the rapid selection of modified and novel B. thuringiensis and / or B. cereus genes.

The method of the invention for the first time conditions the direct expression of a gene bank in B. thuringiensis and / or B. cereus and also allows the identification of novel genes for B. thuringiensis protoxin using known, preferably immunological or biological procedures.

The invention also relates to a process which, for the first time, enables the genetic modification of the B. thuringiensis and / or B. cereus genome for the first time, by strongly increasing the transformation efficiency of B. thuringiensis and / or B. cereus.

In particular, the invention relates to a method for transforming B. thuringiensis and / or B. cereus by incorporating recombinant DNA, in particular plasmid and / or vector DNA, into B. thuringiensis and / or B. cereus cells using electrical pore opening.

A method of transforming B. thuringiensis and / or B. cereus using DNA strands coding for δ-endotoxin and DNA strands coding for a protein substantially having the properties corresponding to said insecticidal properties of the B. thuringiensis toxins is suitable.

The invention also relates to the expression of DNA sequences coding for said endotoxin or for a protein having at least substantially the insecticidal properties of B. thuringiensis toxins, the expression being achieved in transformed B. thuringiensis and / or B. cereus cells.

The invention also relates to a process for the production of bifunctional vectors (shuttle vectors) for use in B. thuringiensis and / or B. cereus, as well as the use of these vectors for the transformation of B. thuringiensis and / or B. cereus.

It is preferred to construct bifunctional vectors which, in addition to the B. thuringiensis and / or B. cereus cells, are capable of replicating in a variety of other heterologous systems, particularly in E. coli cells.

In particular, the invention relates to a process for the production of these bifunctional vectors for B. thuringiensis and / or B. cereus comprising a DNA strand coding for a polypeptide δ-endotoxin naturally occurring in B. thuringiensis, or at least one polypeptide that is a toxin homologous, that is, it has at least substantially the insecticidal properties of B. thuringiensis toxins. The invention also relates to the use of these vectors for the transformation of B. thuringiensis and / or B. cereus cells as well as the expression of the DNA strands in these vectors, in particular those DNA sequences coding for said B. thuringiensis endotoxin or at least one protein having the essential insecticidal properties of the B. thuringiensis toxin.

The invention also relates to the use of B. thuringiensis and / or B. cereus as a general organism for the cloning and expression of homologous, but in particular also heterologous, DNA or a combination of homologous and heterologous DNA.

The invention also relates to plasmids and bifunctional vectors themselves, their use for transformation of B. thuringiensis and / or B. cereus, as well as transformed cells of B. thuringiensis and B. cereus.

Particularly preferred for use in carrying out the method of the invention are the bifunctional vectors pXI61 (= pK61) and pXI93 (pK93) which were transformed with B. thuringiensis var. kurstaki HD1 cryB and B. cereus 569 K deposited in the public collection of cultures of the Deutschen Sammlung von Microorganisms (Braunschweig, Germany) under the Budapest Treaty no. DSM 4573 (pXI61, transformed in B. thuringiensis var. Kurstaki HD1 cryB) and no. DSM 4571 (pXI93, transformation in B. thuringiensis var. Kurstaki HD1 cryB) and no. DSM 4573 (pXI93, transformation in B. cereus 569 K).

The invention also relates to novel varieties of B. thuringiensis and B. cereus which have been transformed using a DNA strand encoding the δ-endotoxin from B. thuringiensis and expressing at least one protein having substantially the isecticidal properties of the toxin. B. thuringiensis.

Transformed B. thuringiensis and B. cereus cells and the toxins produced by these cells can be used to produce insecticidal compositions. These insecticidal compositions also form part of the invention.

The invention also relates to compositions for combating insects by means of transformed B. thuringiensis and / or B. cereus transformed cells as well as compositions comprising a cell-free crystalline endotoxin in the form of crystalline bodies such as protoxin produced by transformed B. thuringiensis cells. and / or B. cereus. The invention also relates to a method of controlling insects by said compositions.

In particular, the invention relates to a novel transformation procedure for B. thuringiensis and B. cereus. This procedure involves the incorporation of plasmid DNA into B. thuringiensis and / or B. cereus cells and, inter alia, the known method of pore opening by the action of electric current.

Until now, all experiments have been carried out by applying transformation procedures to B. thuringiensis and a close relative of B. cereus, which have been developed and successfully used in other bacterial systems, but currently, pore opening by the action of the present invention is applied electric shock and other measures can produce surprisingly good results.

These results are unexpected and surprising also because experiments with pore opening of B. thuringiensis protoplasts have been carried out before, but the transformation frequency achieved was so low that, based on these results, this procedure was considered unusable for the transformation of B. thuringiensis and he was no longer paid attention. The results are described in Shivarova N., Zeitschr. Allgem. Microbiol. 23, 595-599 (1983).

Unexpectedly, according to known experiments concerning pore opening of S. thuringiensis and / or B. cereus cells, it has now been possible to develop a transformation procedure which is ideally adapted to the physiology of B. thuringiensis and B. cereus and to achieve transformation in the 10? 10θ cells / µg DNA plasmid, usually results of 10 ⁶ to 10 ⁷ cells / µg DNA plasmid.

n

Similarly high transformation values between 10 and 10 ⁶ transformed cells per g of plasmid DNA can only be achieved by using polyethylene glycol transformation according to Schall D., Genubertragung zwischen Isolaten von Bacillus thuringiensis durch Protoplastentransformation und Fusion. Dissertation, Universität Túbingen, 1986. However, the high values of this transformation were limited to those strains of B. thuringiensis that were specifically suitable for this procedure, which was necessary to prove by time-consuming preliminary experiments, so this procedure was in practice economical and inappropriate.

In many cases, all of the above procedures were non-reproducible or poorly reproducible when repeatedly performed.

On the other hand, the process according to the invention is a transformation method which can be applied essentially to all strains of B. thuringiensis and B. cereus, which is much less time-consuming, more economical and more efficient than transformation using polyethylene glycol.

Whole, intact cells can be used in the process of the invention, so that the time-consuming conversion to protoplasts and critical for B. thuringiensis and B. cereus cells is eliminated, and subsequent regeneration on a complex nutrient medium is also avoided.

Using the polyethylene glycol process, the entire process of the individual steps takes up to one week, while in the transformation process of the invention trans16-formed cells can be obtained within a few hours, typically overnight.

Another advantage of the method of the invention is that the number of B. thuringiensis and / or B. cereus cells that can be successfully transformed per unit of time is increased.

In a traditional polyethylene glycol process, only small amounts can be applied to the plates simultaneously to prevent regeneration from inhibiting by too rapid cell growth and subsequent cell congestion, while large amounts of B. thuringiensis can be applied to the plates at the same time using pore opening. and / or B. cereus.

This allows selection of transformants even at a very low transformation frequency, which would not be possible or only possible with great time costs using the described procedures.

This implies that in a new way, the amount of DNA in the nanogram region can be obtained from a single transformation.

All of this is of particular importance when it is necessary to use a very efficient transformation system, such as using E. coli DNA, which may, given the highly expressed restriction endonuclease system in B. thuringiensis over E. coli , resulting in a reduction of the transq formation result by up to a factor of 10.

The transformation method according to the invention, which is essentially based on known technology using pore opening by the action of electric current, is characterized by the following specific steps:

(a) a suspension of cells of a suitable cell density in the culture medium suitable for the cultivation of B. thuringiensis cells with aeration sufficient for cell growth is produced;

b) separating the cells from the cell suspension and suspending them in an inoculation buffer suitable for the subsequent opening of the pores by the action of an electric current,

(c) a DNA probe is added at a concentration suitable to open the pores by electric current,

d). the material thus obtained. is transferred to electric pore opening devices,

(e) briefly discharging the capacitor one or more times with a suspension to generate a strong electric field for a short period of time sufficient to transform B. thuringiensis and / or S. cereus cells by recombinant DNA treatment;

(f) the cells thus treated shall be subjected, if appropriate, to subsequent incubation; · '

(g) the cells obtained are plated on a suitable selection medium; and

h) separating transformed cells.

In a specific preferred embodiment of the method of the invention, B. thuringiensis cells are first incubated in a suitable nutrient medium with sufficient aeration and at a suitable temperature, preferably 20 to 35 ° C, to an OD ₅₅₀ of 0.1 to 1.0. The age of cultures designed to open pores by electric current is essential for the frequency of transformation. The optical density of the cultures of 0.1 to 0.3 and particularly 0.2 is particularly preferred. However, it should be noted that a good transformation frequency can also be achieved using Bacillus cultures from another growth phase, in particular overnight cultures as shown in Figure 2.

As a rule, fresh cells or spores are used as starting material, as well as starting from deep-frozen cell material. It is preferably a cell suspension of B. thuringiensis and / or B. cereus in a suitable liquid medium, which preferably contains a fraction of the antifreeze agent.

In particular, a suitable substance of this type will be a mixture of osmotically active ingredients and dimethylsulfoxide in water or in a suitable buffer. Other suitable ingredients suitable for use herein are, for example, sugars, polyunsaturated alcohols such as glycerol, sugar alcohols, amino acids and polymers, for example polyethylene glycol.

When starting from B. thuringiensis spores, these spores are first inoculated into a suitable culture medium and incubated overnight at a suitable temperature, preferably in the range of 25 to 28 ° C with sufficient aeration. The suspension is then diluted and further processed as described above.

Any medium that induces sporulation may be used to induce B. thuringiensis sporulation. The GYS medium described by Youston A.A. and Rogoff M. H., J. Bacteriol. 100, 1229-1236 (1969).

The supply of oxygen to the culture medium is usually ensured by mixing the culture, for example on a shaker, using oscillations ranging from 50 to 300 oscillations per minute.

The spore cultivation of B. thuringiensis as well as the vegetative cells of the microorganism are carried out by any of the known methods in the process according to the invention, with liquid nutrients preferably being used for the convenience of the process.

The composition of these media can vary according to the strains of B. thuringiensis and / or B. cereus used. In general, a complex environment is used with little-defined, easy-to-use carbon and nitrogen sources as commonly used for the cultivation of Bacillus aerobic strains.

In addition, it is essential that the nutrient medium contains vitamins and the necessary metal ions, which, however, are generally present in the complex nutrient media used in sufficient concentration as constituents or impurities.

If desired, the aforementioned components may be used, for example, essential vitamins or sodium ions, potassium, copper, calcium, magnesium, ferric, ammonium, phosphorus, sulfate, chloride or carbonate and trace elements cobalt, manganese, zinc and others in the form of salts.

Suitable nitrogen sources include, in addition to yeast extracts, yeast hydrolyzates, yeast autolysates, yeast alone and, in particular, soy flour, corn flour, oat flour, edamine (enzymatically digested milk albumin), peptone, hydrolyzate of casein, corn extract and corn. However, a number of other substances may also be used, so that said designation is merely exemplary and is not intended to limit the method of the invention in any way.

The preferred concentration of said nitrogen sources is in the range of 1.0 to 20 g / l.

Particularly suitable carbon sources are glucose, lactose, sucrose, dextrose, maltose, starches, cerellose, cellulose or malt extract. The preferred concentration of these sources is in the range of 1.0 to 20 g / l.

Of course, in addition to complex nutrient media, semi-synthetic or synthetic nutrient media can also be used, provided that such media contain all of the nutrients listed in a suitable and sufficient concentration.

In addition to the preferred LB medium as used in carrying out the method of the invention, other mediums suitable for the cultivation of B. thuringiensis and / or B. cereus cells, such as SCGY medium and the like, can be used. thuringiensis is preferably medium 3 containing antibiotics. Cultivation of sporulated B cultures is performed in GYS (slanted agar) medium, the cultures are maintained at 4 ° C.

Once the cell culture has reached the desired cell density, the cells are collected by centrifugation and suspended in a suitable buffer, preferably pre-cooled with ice.

The temperature during these observations is not critical and can be varied within a relatively wide range. Preferably, the temperature is in the range of 0 to 35 ° C, even more preferably in the range of 2 to 15 ° C, particularly preferred is a temperature of 4 ° C. The incubation time of B. cereus cells before and after pore opening has little effect on the achievable transformation frequency as shown in Table 1. Too long incubation leads to a decrease in transformation frequency. An incubation time of 0.1 to 30 minutes, in particular 10 minutes, is preferred. During these processes, it has been shown that the temperature is not critical and can be freely selected over a wide range. Preferably, the temperature is in the range of 0 to 35 ° C, more preferably in the range of 2 to 15 ° C, particularly preferred is a temperature of 4 ° C. The procedure can be repeated several times. A particularly suitable buffer solution for carrying out the process of the invention is an osmotically stabilized phosphate buffer, which contains a sugar such as glucose or sucrose as a stabilizing agent, sugar alcohols such as mannitol, and the medium is adjusted to a pH of 5.0 to 8.0. Particularly preferred is a phosphate buffer of the PBS type with a pH range of 5.0 to 8.0, preferably 5.5 to 6.5, which contains sucrose as a stabilizing agent in a concentration of 0.1 to 1.0 M, preferably 0.3 to 0. 5 M, as shown in Figures 3 and 4.

The aliquot of the Bacillus cell suspension is then incubated in cuvettes or other suitable DNA probe containers at a suitable time, preferably 0.1 to 30 minutes, in particular 5 to 15 minutes, and at a suitable temperature, preferably 0 to 35 ° C, for a further more preferably at a temperature of 2 to 15 ° C, particularly preferred is a temperature of 4 ° C.

In carrying out these experiments at lower temperatures, it is appropriate to use pre-cooled cuvettes or other suitable, also pre-cooled, containers.

There is also a linear correlation between the frequency of transformation and the applied pore-opening DNA transformation, whereby the frequency of transformations increases with increasing DNA concentration, as shown in Figure 5. The preferred DNA concentration of the method of the invention is in the range of 1. ng to 20 pg. Particularly preferred is a DNA concentration in the range of 10 ng to 10 µg.

Thereafter, the material thus treated, i. S. thuringiensis and / or B. cereus, together with DNA plasmids or other suitable DNA probes, are transferred to the respective pore opening device under the action of an electric current and subjected to pore opening in the form of a short-term electric pulse.

With respect to an electrical pore opening device suitable for use in carrying out the method of the invention, various devices available from different manufacturers are available, for example, Bio Rad (Richmond, CA, USA, Gene Pulser Apparatus), Biotechnologies and Experimental Research, Ivc. , (San Diego, CA, USA, BTX Transfector 100), Promiga (Madison, WI, USA, X-Cell 2000 Electroporation System) and the like.

Of course, any other device can be used to open the pores in the process of the invention.

In addition, various forms of pulses can be used, for example so-called rectangular pulses or exponential pulses.

The latter type of pulses is more advantageous in carrying out the method according to the invention. These pulses occur when the capacitor is discharged, and these pulses are characterized by a rapid rise in voltage and then a waveform that resembles an exponential curve based on the relationship between resistance and capacitance. The RC time constant is a measure of the length of the entire exponential segment. It corresponds to the time it takes for the voltage to drop 37% from the initial voltage V _Q.

Another important parameter affecting a bacterial cell is the strength of the electric field between the cells and the ratio between the applied voltage and the distance between the electrodes.

Another important factor in this context is the time of voltage drop in the form of exponential, which depends on the design of the equipment used, for example the capacity of the condensate used, but also on other parameters such as the buffer solution composition or the cell suspension used. opening the pores under the influence of electric current.

In the course of the studies, it has been shown, for example, that when the volume of the cell suspension in which the reaction is to be performed is halved, the transformation frequency is increased by approximately a factor of 10.

Prolonging the decrease in exponential at optimal buffer composition also positively affects the frequency of transformations.

Thus, all working measures that can lead to an increase in the exponential voltage drop time and thus an increase in the frequency of transformations are advantageous in carrying out the process according to the invention.

In carrying out the method of the invention, the preferred exponential voltage drop time is in the range of 8 to 20 ms, in particular in the range of 8 to 20 ms. Especially preferred is a voltage drop time of 10 to 12 ms.

In carrying out the method of the invention, the bacterial cells are subjected to a brief discharge of the capacitor through a DNA-containing cell suspension using a very strong electric field, resulting in a short-term and reversible increase in B. thuringiensis cell permeability. The parameters are adjusted according to the invention when performing pore opening under the action of an electric current in such a way that optimal uptake of the DNA contained in a buffer in which pore opening is carried out into Bacillus cells is achieved.

The capacitance setting on the capacitor is generally in the range of 1 to 250 gF, preferably 1 to 50 µF and in particular 25 µm when carrying out the process according to the invention. The choice of starting voltage is freely selectable over a wide range and is not. too critical. Generally, the starting voltage V _Q of between 0.2 and 50 kV, in particular in the range of 0.2 to 2.5 kV, preferably predominantly in the range of 1.2 kV to 1.8 kV. The spacing of the electrodes depends inter alia on the overall dimensions of the electrical pore opening device. This distance is usually in the range of 0.1 to 1.0 cm, preferably in the range of 0.2 to 1.0 cm, a particularly preferred distance of both electrodes is 0.4 cm. From the distance of the two electrodes and the voltage on the capacitor, the electric field force acting on the cell suspension can be derived. These values are usually in the range 100 to 50,000 V / cm. A particularly preferred value of the electric field strength is 10 to 10,000 V / cm, in particular 3,000 to 4,500 V / cm.

The fine-tuning of optional parameters, such as capacity, starting voltage, electrode spacing, and the like, depends to some extent on the design of the devices used and may vary within certain limits in each case. Thus, in certain cases, these thresholds may be lowered or exceeded if this would be necessary to achieve the optimum electric field strength in carrying out said process.

The actual opening of the pores by the current can be repeated one or more times until the optimum frequency of transformations in the system used is achieved.

After the electrical opening of the pores, the Bacillus cells thus treated can advantageously be subjected to a subsequent incubation, preferably from 0.1 to 30 minutes at a temperature in the range of 0 to 35 ° C, preferably in the range of 2 to 15 ° C. Finally, the cells thus treated are diluted with a suitable culture medium and then further incubated for a suitable period of time, preferably 2 to 3 hours, with sufficient aeration and at a suitable temperature, preferably at 20 to 35 ° C.

Finally, B. thuringiensis cells are plated on solid culture media containing, as an additive, a suitable agent for selecting DNA strands newly introduced into bacterial cells. Depending on the type of DNA used, these may be, for example, antibiotic agents, dyes, and the like. Particularly preferred agents in the method of the invention for the selection of B. thuringiensis and / or B. cereus cells are antibiotics selected from the group of tetracycline, kanamycin. chloramphenicol and erythromycin.

It may also be advantageous to use chromogenic substrates such as X-gal, i. 5-Bromo-4-chloro-3-indolyl-β-D-galactoside, which can be readily determined by their specific color reactions.

In principle, any other phenotypic labeling means, as known in the art and commonly used, can also be used in the practice of the method of the invention.

At the same time, any culture medium suitable for the cultivation of B. thuringiensis cells can be used which can be solidified in a conventional manner, for example by adding agar, agarose, gelatin and the like.

In carrying out the method of the invention, the parameters which have been individually detailed for B. thuringiensis cells can also be used for B. cereus cells.

The process described above, which is used for the transformation of B. thuringiensis or B. cereus in carrying out the process according to the invention, does not remain limited, as has been the case until now, to certain certain plasmids naturally occurring in B. thuringiensis and / or B. but is applicable to all types of DNA.

Thus, for the first time, the method of the invention allows for a targeted transformation of B. thuringiensis and / or B. cereus, in which execution can be carried out in addition to homology, i. naturally occurring plasmid DNA in B. thuringiensis or a close relative of B. cereus may also use plasmid DNA of heterologous origin.

In carrying out this procedure, it may also be a plasmid DNA that is naturally present in an organism other than B. thuringiensis or a close relative of B. cereus, such as the plasmids pUBUO and pC194 from Staphylococcus aureus, described in Horinouchi S. and Weisblum B., J. Bacteriol. 150, 815-825, 1982, and Polak J. and Novick R. P., Plasmid 7, 152

162, 1982, and the plasmid pIM13 from B. subtilis described by Halvorson H.O., J. Gen. Microbiol. 120, 259

263, 1980, which are capable of replicating in B. thuringiensis and / or B. cereus, but also DNA hybrid plasmids that have been constructed by recombinant DNA technology, from a DNA homologous or heterologous plasmid or a combination of a homologous and heterologous plasmid. Said hybrid plasmid DNA is more suitable for working with recombinant DNA than for isolates of natural origin.

As an example, the plasmid pBD67 described by Gryczan T. et al., J. Bacteriol. 141, 246-253, 1980, and the plasmids pBD347, pBD348 and pUB1664 without being complete, so that the method of the invention is not to be limited in any way by the use of said plasmids.

Of particular importance for carrying out cloning experiments in different strains of B. thuringiensis or B. cereus is the use of cloning vectors already used for B. subtilis, for example pBD64.

In addition to plasmid DNA, any other DNA can be used for transformation in carrying out the method of the invention in B. thuringiensis or B. cereus. The transformed DNA can be replicated either autonomously or integrated in the chromosome. Thus, it may be, for example, a DNA vector which is not derived from a plasmid but from a phage.

The invention also relates to a method of construction of bifunctional vectors (shuttle-vectors).

Particularly suitable according to the invention are the construction and use of bifunctional plasmid type hybrid vectors which, in addition to B. thuringiensis or a closely related B. cereus, are also capable of replicating in one or more heterologous organisms and which are identifiable not only in homologous but also heterologous systems.

In the context of the invention, heterologous production organisms are meant to include all non-B. thuringiensis and B. cereus organisms which are capable of stably maintaining replication-capable DNA.

Among heterologous functional organisms, the above definitions apply to both prokaryotic and eukaryotic organisms. Examples of these prokaryotic organisms include some of the Bacillus family, for example B. subtilis or B. megaterium, the Staphylococcus family, for example S. aureus, Streptococcus for example S. faecalis, Streptomyces, for example Streptomyces spp., Pseudcmonas, e.g. Pseudomonas spp., Escherichia, e.g. E. coli, Agrobacterium, e.g. Agrobacterium tumefaciens or A. rhizogenes, Salmonella, Erwinia and the like. From the group of eukaryotic organisms, in particular, yeast and animal and plant cells may be mentioned. Again, this calculation is not complete and the invention is not to be limited in any way by this calculation. Other suitable examples from the group of prokaryotic and eukaryotic production organisms are known to those skilled in the art.

Particularly suitable for use in the present invention are B. subtilis or B. megaterium, Pseudomonas spp. and in particular E. coli from the group of prokaryotic production organisms and yeast or animal or plant cells from the group of eukaryotic production organisms.

Particularly preferred are bifunctional vectors that are capable of replicating both in B. thuringiensis and / or B. cereus and in E. coli.

The invention also encompasses the use of said bifunctional vectors for the transformation of B. thuringiensis and B. cereus.

The construction of said bifunctional vectors is carried out using recombinant DNA technology by first cleaving plasmids and / or vectors of homologous origin from B. thuringiensis and B. cereus and heterologous origin by treatment with appropriate restriction enzymes and then joining those DNA fragments containing the functions , necessary for replication in the selected production system in the presence of the respective enzymes.

As a source for the DNA of the plasmid and / or the vector of heterologous origin, any of said heterologous production organisms may be used.

The fusion of the different DNA fragments must proceed in such a way as to maintain the essential functions required for replication in the various production systems.

In addition, plasmid DNA or DNA from a vector of purely homologous origin can of course also be used for the construction of said bifunctional vectors, but at least one of the DNA fragments used from a heterologous source must allow replication in the B. thuringiensis and B homology production system. cereus.

As a source of DNA from a plasmid and / or a vector of heterologous origin, but which is capable of replicating in the B. thuringiensis and / or B. cereus production system, there may be mentioned here some representatives of the gram-positive bacteria group, selected in particular from of the family Staphylococcus, e.g. Staphylococcus aureus, Streptococcus, e.g. Streptococcus faecalis, Bacillus, e.g. Bacillus megaterium or Bacillus subtilis, Streptomyces, e.g. Streptomyces spp. and so on. In addition to these representatives of the gram-positive bacteria family as mentioned above, a number of other organisms can be used in the practice of the method of the invention, which can be readily determined by any person skilled in the art.

The invention also relates to a process for the production of bifunctional vectors suitable for the transformation of B. thuringiensis and / or B. cereus, the process being carried out by first introducing plasmid DNA of homologous and heterologous origin first.

(a) cleaved into fragments, by treatment with appropriate restriction enzymes, and then

b) the fragments which contain the essential functions necessary for replication and selection in the desired production system in the presence of appropriate enzymes are recombined in such a way as to retain the essential functions necessary for replication and selection in the various production systems.

In this way, bifunctional plasmids are produced which, in addition to the functions necessary for replication in B. thuringiensis or B. cereus, contain further DNA strands which ensure replication in at least one other heterologous production system.

In order to ensure rapid and efficient selection of bifunctional vectors in both homologous and heterologous target production systems, it is advantageous to construct vectors with specific selection markers that would be useful in both B. thuringiensis and / or B. cereus as even in heterologous production systems, that is, they would ensure rapid and uncomplicated selection in both systems. In carrying out the method according to the invention, it is particularly advantageous to use DNA strands coding for antibiotic resistance, especially DNA strands coding for antibiotic resistance from the group of kanamycin, tetracycline, chloramphenicol, erythromycin and the like.

Also preferred are genes that code for enzymes with a chromogenic substrate, for example X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside). The colonies that have been transformed can then be separated easily from the non-transformed colonies by a specific color reaction.

Other specific phenotypic genes that can be used for labeling are known to those skilled in the art and can also be used in practicing the method of the invention.

Particularly preferred within the scope of the invention is the construction of bifunctional vectors containing, in addition to DNA strands which allow replication in B. thuringiensis or B. cereus, or both, also containing DNA fragments which are required for replication in other bacterial production systems , such as B. subtilis, B. megaterium, Pseudomonas spp., E. coli, and the like.

Particularly preferred are bifunctional vectors which, on the one hand, are capable of replicating in B. thuringiensis or B. cereus, or both, and, on the other hand, are capable of replicating also in eukaryotic production systems from the group of yeast, animal and plant cells and the like.

Particularly preferred is the construction of bifunctional vectors which, in addition to the DNA strands required for the replication of these vectors in B. thuringiensis or B. cereus, or both, also contain DNA strands which allow the replication of these vectors in E. coli. .

For example, the plasmid B. cereus pBC16 as well as from E. coli may also be used as the starting plasmids for the B. thuringiensis and / or B. cereus and / or E. coli system, but these may be used only to a limited extent. coli derived plasmids pBR322 and plasmid pUC8 as described in Vieira J. and Messing J., Gene 19, 259-268 (1982).

The invention also relates to bifunctional vectors (shuttle) which, in addition to functions necessary for replication and selection in homologous and heterologous production systems, contain in addition one or more genes in a form capable of expression, or particularly useful DNA strands. The invention also relates to a method for producing such vectors by incorporating said genes or particularly useful DNA strands into said bifunctional vectors using suitable enzymes.

Using the bifunctional vectors obtained by the method of the invention as well as using the described transformation procedures, it is now possible for the first time to use DNA strands cloned outside of B. thuringiensis cells in a foreign production system to transform B. thuringiensis and / or B. cereus cells. high efficiency.

Thus, for the first time, it is possible for the first time to incorporate genes or particularly useful DNA strands, especially those having a controlling function, stably into B. thuringiensis and / or B. cereus cells and eventually to express them therein, thereby producing B. thuringiensis cells and / or B. cereus with new desirable properties.

Suitable genes which can be used in carrying out the method according to the invention are both homologous and heterologous DNA genes or sequences, as well as synthetic genes or DNA sequences, as well as combinations thereof.

DNA coding strands can be constructed exclusively from genome DNA, cDNA, or synthetic DNA. Another possibility lies in the construction of a hybrid DNA strand, a cDNA hybrid strand, a genome DNA, a synthetic DNA, or it can also be a combination of all the different types of different DNA.

In this case, the cDNA may originate from the same gene as the genome DNA, or the cDNA and genome DNA may originate from different genes. In any case, however, it is possible to obtain genome DNA and / or cDNA each separately from the same or from different genes.

Where the DNA strand contains parts that originate from more than one gene, these genes may correspond to the same organism, to a number of organisms belonging to different strains, varieties of the same strain or different strains of the same family, or may go o organisms belonging to more than one family or to a different taxonomic unit.

In order to achieve expression of said structural genes in a bacterial cell, it is first necessary to link the gene sequences of the genes in a correct manner so that they also contain functional chains for expression of the resulting structural gene in B. thuringiensis and / or B. cereus cells.

In the context of the invention, hybrid gene constructs contain, in addition to the structural gene, expression signals which include both the promoter and terminator strand and other control chains in the 3 'or 5' untranslated region.

Particularly preferred in carrying out the method of the invention is the use of natural signals for expression from B. thuringiensis and / or B. cereus or from mutants and variants of these microorganisms which are substantially homologous to the natural chain. In practicing the method of the invention, a particular DNA strand is substantially homologous to the other DNA strand if it is homologous to at least 70%, preferably at least 80%, and especially 90%, of the active strands of the entire DNA strand. In practicing the method of the invention, the term substantially homologous in the case of two different nucleotides in the coding region of the same DNA strand also means a situation in which only one so-called mutation occurs when one of these nucleotides is replaced by another.

Especially preferred is the use of sporulation-dependent B. thuringiensis promoters in the presence of which expression is dependent on the achievement of sporulation.

Particularly preferred in the transformation of B. thuringiensis e / or B. cereus is the use of DNA strands that encode one of the δ-endotoxins.

The coding region of the chimeric gene obtained by the method of the invention preferably comprises a nucleotide sequence coding for a polypeptide naturally occurring in B. thuringiensis, or even for a polypeptide which is homologous to said polypeptide at least substantially at least substantially isecticidal properties of said crystalline B. thuringiensis δ-endotoxin protein. Within the scope of the invention, a particular polypeptide has essentially properties that are. homologous to the isecticidal properties of the crystalline B. thuringiensis δ-endotoxin protein, when it has a similar spectrum of insecticidal activity against insect larvae as the crystalline protein naturally occurring in B. thuringiensis. They may be various subgroups of this microorganism, for example kurstaki, berliner, alesti, tolworthi, sotto, dendrolimus, tenebrionis and israelensis. A preferred subtype, particularly effective against Lepidoptera larvae, is the kurstaki and especially kurstaki HD1.

The code region may be one that naturally occurs in B. thuringiensis. Alternatively, the coding region may optionally contain a strand that is different from the B. thuringiensis strand, but is equivalent thereto due to the degeneracy of the genetic code.

The coding region of the chimeric gene may also be a code for a polypeptide that, while distinct from the naturally occurring crystalline protein endotoxin, but which still substantially retains the insecticidal properties of the crystalline protein. Such a code sequence is actually a variant of a naturally occurring code region. For the purposes of the invention, a variant of the natural DNA strand is a modified form of the natural strand, but which still fulfills the original function of said strand. The variant may be a mutant or a synthetic DNA strand that is substantially homologous to the natural strand. Within the scope of the invention, a particular strand is substantially homologous to the second DNA strand if at least 70%, preferably at least 80%, and particularly at least 90% of the active regions are homologous to the second DNA strand. In the case of two different nucleotides, the term is essentially homologous also in a situation where the so-called silent mutation occurs in the coding sequence after the exchange of one of these nucleotides for another.

Thus, any gene encoding the amino acid chain, having the insecticidal activity of B. thuringiensis endotoxin, and meeting all of the above requirements can be used in the practice of the method of the invention. . Particularly preferred in this regard is the use of a nucleotide sequence that is substantially homologous. at least portions or portions of the natural chain that cause the insecticidal activity and / or specificity of the crystalline B. thuringiensis protein toxin.

As a rule, the polypeptide produced by the expression of the chimeric gene has at least some immunological properties in common with the crystalline protein, since at least in part it contains the same antigenic determinants.

For this reason, the polypeptide encoded by the chimeric gene is preferably related to an endotoxin which is produced as a crystalline protein by B. thuringiensis, which produces a crystalline protein with a subunit corresponding to a protoxin of molecular weight 130,000 to 140,000. be cleaved by proteases or bases to form an insecticidal fragment having a molecular weight of 70,000.

In the construction of chimeric genes in which the coding region contains the code for fragments of protoxins or even smaller portions of protoxins, the desired insecticidal activity can nevertheless be maintained in these fragments. The protoxin, its insecticidal fragments, and portions of these fragments can be coupled to other molecules, such as polypeptides and proteins.

Coding regions suitable for use in practicing the method of the invention can be obtained from B. thuringiensis genes for crystalline toxin as described in PCT application WO 86/01536 (Whitley et al.) And U.S. Pat. 4,448,885 and 4,467,036. The preferred nucleotide sequence coding for the crystalline protein is located between nucleotides 156 and 3623 of Formula I in Figure 10, or a shorter sequence coding for an insecticidal fragment of the crystalline protein proteins, as described in Geiser M. et al., Gene 48, 109-118,

1986 and European Patent Specification no. 238 441.

The nucleotide sequence of nucleotides 156 to 3,623 in Formula I is the code for the polypeptide of the following Formula II.

Formula II

Hec Asp Asn Asn For Asn ile same time Glu Cys 10 Ile for Tyr Asn Cys Leu Ser same time for Glu 20 wall Glu Val Leu Gly Gly Glu Arg Ile Glu 30 Thr Gly Tyr Thr For Asp Ile Ser Leu 40 Ser Leu Thr C-ln Phe Leu Ser Glu Phe 50 ' wall for Gly Ala Gly Phe Leu Gly Leu 60 wall Asp ile ile Trp Gly White Phe Gly for 70 Ser gin Trp Asp Ala Phe Leu wall gin Zl.e 80 Glu gin Leu ile Asn C-1n Arg Ile Glu Glu 90 Phe Ala Arg Asn Gin Ala White Ser • ·· about Leu 100 Glu Gly Leu Ser Asn Leu Tyr gin Ile "yr 110 Ala Glu Ser Phe Arg Glu Trp Glu Ala Asp 120 for Thr Asn Pro Ala Leu Arg Glu Glu Hec 130 Arg Ile Gin Phe Asn Asp Met same time Ser Ala 140 Leu Thr Thr Ala For Leu Phe Ala wall 150 gin same time Tyr Gin Val Leu Leu Ser wall 160 Tyr wall Gin Ala Ala Asn Leu His Leu Ser 170 wall Leu Arg Asp Val Ser Val Phe Gly gin 180 Arg Trp Gly Phe Asp Ala Ala Thr Ile same time 190 Ser Arg Tyr Asn Asp Leu Thr Arg Leu Ile 200 Gly same time Tyr Thr Asp His Ala wall Arg Trp 210 Tyr same time Thr Gly. Glu Arg wall Trp Gly 220 for Asp Ser Arg Asp Patience Arg Tyr same time 230 gin Phe Arg Arg Glu Leu Thr Leu Thr wall 240 Leu Asp Val Val Ser Leu Phe for same time Tyr 250 Asp Ser Arg Thr Tyr For White Arg Thr wall 260 Ser gin Leu Thr Arg Glu White Tyr Thr same time 270 for wall Leu Glu Asn Phe Asp Gly Ser Phe 280 Arg Gly Ser Ala Gin Gly White Glu Gly Ser 290 Ile Arg Ser Pro His Leu HeC Asp Ile Leu 300

same time Ser Ile Thr Ile Tyr Thr Asp Ala His 310 Arg Gly Glu Tyr Tyr Trp Ser Gly His gin 320 Ile mec Ala Ser for wall Gly Phe Ser Gly 330 for Glu Phe Thr Phe for Leu Tyr Gly Thr 340 Hec Gly same time Ala Ala for gin gin Arg Ile 350 wall Ala gin Leu Gly gin Gly wall Tyr Arg 360 Thr Leu Ser Ser Thr Leu Tyr Arg Arg for 370 Phe same time Ile Gly Ile same time same time gin gin Leu 3S0 Se r wall Leu As G Gly Thr Glu Phe Ala Tyr 390 C-ly Thr Ser Ser same time Leu for Ser Ala wall 400 Ty r Arg Lys Ser Gly Thr wall Asp Ser Leu 410 Asp Glu Ile for for gin same time same time same time wall 420 for for Arg gin Gly Phe Ser His Arg Leu 430 Ser His wall Ser MeC Phe Arg Ser Gly Phe 440 Ser same time Ser Ser wall Ser Ile Ile Arg Ala 450 for mec Phe Ser Trp Ile His Arg Ser Ala 450 Glu Phe same time same time Ile Ile for Ser Ser Gin. 470 Ile Thr gin Ile for Leu Thr Lys Ser Thr 430 same time Leu Gly Ser Gly Thr Ser wall wall Lys 490 Gly for Gly Phe Thr Gly Gly Asp Ile Leu 500 Arg Arg Thr Ser for Gly gin Ile Ser Thr .510 Leu Arg wall same time Ile Thr Ala for Lea Ser 520 gin Arg Tyr Arg wall Arg Ile Arg Tyr Ala 530 Ser Thr Thr same time Leu gin Phe His Thr Ser 540 Ile Asp Gly Arg for Ile same time gin Gly same time 530 Phe Ser Ala Thr mec Ser Ser Gly Ser same time 5óQ Leu gin Ser Gly Ser Phe Arg Thr wall Gly 570 Phe Thr Thr for Phe same time Phe Ser same time Gly 530 Ser Ser wall Phe Thr Leu Ser Ala His wall 590 Phe same time Ser Gly same time Glu wall Tyr Ile Asp 600 Arg Ile Glu Phe wall for Ala Glu wall Thr 610 Phe Glu Ala Glu Tyr Asp Leu Glu Arg Ala 620 gin Lys Ala wall same time Glu Leu Phe Thr Ser 630 Ser same time gin Ile Gly Leu Lys Thr Asp wall 640 Thr Asp Tyr His Ile Asp gin wall Ser same time 650 Leu wall Glu Cys Leu Ser Asp Glu Phe cys 660 Leu Asp Glu Lys Lys Glu Leu Ser gin Lys 670

wall Lys His Ala Lys Arg Leu Ser Asp Glu 680 Arg same time Leu Leu Gin Asp for same time Phe Arg 690 Gly Ile same time Arg Gin Leu Asp Arg Gly Trp 700 Arg Gly Ser Thr Asp íle Thr Ile gin Gly 710 Gly Asp Asp wall Phe Lys Glu same time Tyr wall 720 Thr Leu Leu Gly Thr Phe Asp Glu Cys Tyr ⁷³⁰ for Thr i y r Leu Tyr Gin Lys Ile Asp Glu 740 Ser Lys Leu Lys Ala Tyr Thr Arg Tyr gin 7 50 Leu Arg Gly i * · * c ile Glu Asp Ser A boat Asp 760 Leu C-iu I le 'vr Leu ile Arg Tyr same time Ala 770 Lys His Glu Thr Val Asn wall for Gly Thr 780 Gly Ser Leu T r? Pro Leu Ser Ala for Ser 790 for Ile Gly Lys Cys Ala His His Ser Kis 800 His Phe Ser Leu Asp íle Asp wall Gly Cys 810 Thr Asp Leu same time C-iu Asp Leu Gly wall Trp 820 wall Σ Σβ Phe Lys Lys Thr gin As? Gly 8 30 His Ala Λ Leu Gly Asn Leu Glu Phe Leu 840 Glu Glu Lys for Leu Val Gly Glu Ala Leu 850 Ala Arg wall Lys Arg Ala Glu Lys Lys Trp Soo Arg Asp Lys Δτ-σ - - o Glu Lys Leu Glu Trp Glu 870 Thr same time Ile wall Tyr Lys Glu Ala Lys Glu 830 Ser wall Asp Ala Leu Phe wall same time Ser gin 890 Tyr Asp Arg Leu Gin Ala Asp Thr same time Ile 900 Ala Hec Ile Kis Ala Ala Asp Lys Arg wall 910 His Ser Ile Arg Glu -Ala Tyr Leu for Glu 920 Leu Ser wall Ile Pro Gly wall same time Ala Ala 930 Ile Phe Glu Glu Leu Glu Gly Arg Ile Phe 940 Thr Ala Phe Ser Leu Tyr Asp Ala Arg same time 950 wall Ile Lys same time Gly Asp Phe same time same time Gly 960 Leu Ser Cys Trp Asn Val Lys Gly His wall 970 Asp wall Glu Glu Gin A.sn same time His Arg Ser 980 wall Leu wall wall Pro Glu Trp Glu Ala Glu 990 wall Ser gin Glu Val Arg wall Cys for Gly 1000 Arg Gly Tyr Ile Leu Arg wall Thr Ala Tyr 1010 Lys Glu Gly Tyr Gly Glu Gly Cys wall Thr 1020 Ile His Glu Ile Glu Asn same time Thr Asp Glu 1030 Leu LVS Phe Ser Asn Cvs wall Glu Glu Glu 1040

wall Tyr for same time same time T'nr wall Thr Cys same time 10 50 Asp Tyr Thr Ala Thr gin Glu Glu Tyr Glu 1CSG Gly Thr Tyr Thr Ser Arg same time Arg Oly Tyr 107G Asp Gly Ala Tyr Glu W w A same time Ser Ser wall 10SC for Ala Asp Tyr Ala Ser Ala J-J Glu Glu 10 µG Lys Ala Tyr Thr Asp .. Arg Arg Asp same time 11CG for Cys Glu Ser same time Arg Gly Tyr Gly hs p 1110 Tyr Thr for Leu for Ala Gly Tyr wall Thr 1120 Lys Glu Leu Glu Tyr Phe for Glu Thr Asp 1120 Lys wall Trp Ile Glu T Gly Glu Glu. i? 4.Γ Gly Thr Phe Ile wall Asp Ser wall Glu Leu 11 = 0 Leu Leu Met Glu C-lu com SC 115 Ó

When transformed using the chimeric gene according to the invention in B. thuringiensis and / or B. cereus cells, the gene is preferably first incorporated into a vector. Particularly preferred is the incorporation of genes into the bifunctional vectors of the invention.

If said gene is not available in an amount sufficient to be incorporated into Bacillus cells, the vector may first be amplified by replication in a heterologous production cell. Bacterial or yeast cells are most suitable for gene amplification. Once sufficient gene is available, it is possible to incorporate this gene into Bacillus cells. The incorporation of the gene into B. thuringiensis or B. cereus cells may be performed in the same vector as used for replication, or another vector of the invention may be used.

Examples of bacterial production cells suitable for replication of the chimeric gene are, for example, bacteria from the family Escherichia such as E. coli, Agrobacterium such as A. tumefaciens or A. rhizogenes, further Pseudomonas such as Pseudomonas spp., Bacillus such as Bacillus megaterium or Bacillus subtilis and the like. For the first time, B. thuringiensis and / or B. cereus can also be used as production cells for carrying out the method according to the invention. A method for cloning heterologous genes in bacteria is known and has been described in U.S. Pat. 4,237,224 and 4,468,464.

Replication of genes containing the code for crystalline B. thuringiensis proteins in E. coli has been described by Wong et al., J. Biol. Chem. 258. 1960-67, 1983.

Examples of yeast production cells suitable for the electrification of genes according to the method of the invention include, in particular, yeasts of the Saccharomyces family, as disclosed in European Patent Application Ser. 238 441.

Any vector that can be incorporated into the chimeric gene and that is capable of replicating in a suitable production cell, such as bacteria or yeast, can be used to amplify the gene of the invention. This vector may be derived, for example, from a phage or plasmid. Examples of phage-derived vectors that can be used in the practice of the invention include those derived from M13- and lambda phages. Suitable vectors derived from the phage M13 include vectors M13mp18 and M13mp18. Vectors derived from lambda phage include the vectors lambdagt11, lambdagt7, and lambdaCharon4.

Among the vectors derived from plasmids and particularly preferred for bacterial replication, for example, pBR322 described by Norrander et al., Gene 26, 101-104, 1983, and Ti plasmids described by Bevan et al. Nature 304, 184-187, 1983 without limiting this embodiment of the method according to the present invention. Currently, pBR322, pUC18 and pUC19 vectors are the most preferred vectors for the amplification of bacteria genes.

For direct cloning in Bacillus thuringiensis and / or B. cereus, first, direct cloning vectors, for example pBD347, pBD348, pBD64 and pUB64, and in particular the bifunctional vectors already described in detail without limiting the invention, should be mentioned. for these vectors.

Particularly preferred within the scope of the invention are the bifunctional vectors ρΧΙ61 (= ρΚ61) and ρΧΙ93 (= ρΚ93), which after transformation into B. thuringiensis var. kurstaki HD1 cryB and / or B. cereus 569 K were deposited in the public collection of cultures of the Deutschen Sammlung von Microorganism (Braunschweig, Germany) under the Budapest Treaty under number DSM 4573 (pXI61, transformation in B. · thuringiensis var. kurstaki HD1 cryB),. DSM 4571 (pXI93, transformation in B. thuringiensis var. Kurstaki HD1 cryB) and DSM 4573 (pXI93, transformation in B. cereus 569 K).

In constructing a chimeric gene suitable for bacterial replication, a promoter chain, a 5'-untranslated strand, a coding strand, and a 3'-untranslated strand may be incorporated into the vector, or the portions may be incorporated into said vectors as a whole. Suitable vectors for use in practicing the method of the invention are those capable of replicating in producer cells. The promoter, 5 ¹ -neprenášaná region, coding region and 3 'untranslated region could thus be combined outside the vector and then incorporated into the vector. Alternatively, parts of the chimeric gene may be incorporated into the vector. In the case of a cloning vector in B. thuringiensis or B. cereus, this step may be omitted because the whole unit, which is isolated from B. thuringiensis and consists of a 5 ¹ -transferred region, a coding region and 3 ¹ -transferred region, can be quite embedded into the vector.

In addition, the vector advantageously comprises a labeling gene which develops in the production cell a property which makes it possible to recognize cells transformed with said vector. Preference is given to those labeling genes which encode antibiotic resistance. Examples of antibiotics suitable for use herein include ampicillin, chloramphenicol, erythromycin, tetracycline, hygromycin, G418, and kanamycin.

Preference is also given to marker genes which encode an enzyme with a chromogenic substrate, for example X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactoside). The transformed colonies can then be distinguished in a very simple manner according to the specific color reaction.

The incorporation or incorporation of genes into the vector can be accomplished by standard procedures, for example using recombinant DNA according to the method of Maniatis et al., Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, USA, 1982, and using homologous recombination as described by Hinnen et al., Proc. Natl. Acad. Sci. USA 75. 1929-1933, 1978.

The method using recombinant DNA is to first cleave the vector and insert the desired DNA strand between the cleaved fragments of the vector, and then combine the end of the desired DNA strand with the corresponding end of the vector.

The vector used is preferably cleaved with suitable restriction endonucleases. Suitable enzymes for this use are, for example, those that produce smooth ends, such as SmaI, HpaI and EcoRV, and such enzymes that create cohesive ends, such as EcoRI, SacI and BamHI.

The DNA strand of interest normally exists as part of a larger DNA molecule, for example a chromosome, plasmid, transposome or phage. Thus, in these cases, the desired DNA strand must be removed from the original source and optionally modified in such a way that the resulting ends can be joined to the ends of the cleaved vector. Where the ends of the DNA sequence of interest and the cleaved vector are smooth, they can be linked to each other, for example, by specific ligases such as T4 DNA ligase.

The end of the DNA strands of interest may also be linked to the cohesive end of the cleaved vector, in which case cohesive end-specific ligases may be used, but T4 DNA ligases may also be used. The ligase specific for the cohesive termini is, for example, a DNA ligase from E. coli.

The cohesive ends are preferably constructed by cleaving the DNA sequence and vector of interest with the same restriction endonuclease. In this case, the DNA sequence of interest and the cleaved vector have cohesive ends that are complementary to each other.

The cohesive termini can also be generated by binding homopolymeric termini to the ends of the desired DNA strand with a terminal deoxynucleotidyltransferase and the same termini being joined to the cleaved vector. Thereafter, the cohesive end may be formed by linking to the ends of these structures a synthetic oligonucleotide strand containing a site for a particular endonuclease (Linker) so that the strand can then be cleaved by that particular endonuclease, as described, for example, in Maniatis et al. et al., Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, USA, 1982.

Thus, for the first time, the B. thuringiensis genes, in particular the endotoxin-encoding chains outside of B. thuringiensis, can be genetically modified, the genes outside this microorganism can be cloned and then incorporated back into B. thuringiensis and / or B. cereus, where it is possible to achieve expression of these endotoxin genes in a homologous bacterial production system.

That is, it is now possible to perform targeted manipulation of the B. thuringiensis genome by first obtaining a large amount of plasmid material in a foreign cloning system and then transforming the B. thuringiensis using this material.

Of particular importance in this regard is both the possibility of modifying the δ-endotoxin gene and the expression of the control chains to direct this gene.

Of course, in addition to the chimeric genes, any other genetic construct can be incorporated into the B. thuringiensis and / or B. cereus cells by the method of the invention.

For example, it is possible, using the method of the invention, to incorporate non-coding DNA, for example antisense DNA, into the genome of B. thuringiensis and / or B. cereus cells, so that expression expresses mRNA transcription which inhibits expression of the corresponding DNA having codons in the correct sense . In this way, the expression of certain undesirable genes in B. thuringiensis and / or B. cereus can be specifically suppressed.

In addition, it is now possible to use B. thuringiensis in addition to well-defined strains of B. thuringiensis to produce improved insecticidal compositions after cloning and optionally after expression of heterologous and / or homologous genes.

In a specific and preferred embodiment of the method according to the invention it is, inter alia, possible for the first time to clone new genes, in particular new protoxin genes, directly in the natural production organism, i.e. in B. thuringiensis or B. cereus cells.

If necessary, new protoxin genes and a B. thuringiensis gene collection can also be constructed in this way.

In the first step of this procedure, the total DNA of the protoxin-producing strain of B. thuringiensis is isolated in a known manner and the DNA is broken up into individual fragments. B. thuringiensis DNA can be fragmented either mechanically, but preferably by treatment with suitable restriction enzymes. Depending on the choice of these enzymes, a partially or fully digested DNA sample can then be obtained. In the process according to the invention, it is particularly advantageous to use restriction enzymes which cleave at several sites and / or lead only to partial cleavage of B. thuringiensis DNA, for example the restriction enzyme SauIIIA, but without restricting the method according to the invention to this method. enzyme. Of course, other suitable restriction enzymes may also be used in the practice of the invention.

The restriction fragments obtained in this way can then be separated in a known manner according to their size. As a rule, centrifugation is used for this separation, for example using a sucrose gradient or electrophoresis, for example on an agarose gel or by a combination of these processes.

Those fractions that contain fragments of the correct size, i. fragments which, because of their size, may code for the protoxin, are pooled and used for the next steps of the invention.

Thereafter, the fragments thus isolated are routinely inserted into a suitable cloning vector and then incorporated by transformation according to the invention directly into B. thuringiensis and / or B. cereus, preferably into those protoxin-free strains of B. thuringiensis.

Gram-positive plasmids, such as pBC16, pUBUO, pC194, as well as the bifunctional vectors already described in detail can be used as vectors. The bifunctional vector pXI200, which will be described in more detail in Example 9.1, is particularly preferred for use in the practice of the method of the invention. Suitable vectors preferably contain DNA sequences which allow easy identification of the transformed clones containing these vectors in a group of untransformed clones. Particularly preferred are those DNA sequences which encode a specific labeling agent which, upon expression, results in properties that permit easy selection, such as antibiotic resistance. This may be, for example, resistance to ampicillin, chloramphenicol, erythromycin, tetracycline, hygromycin, G418 or kanamycin.

Particularly preferred are those marker genes which encode an enzyme with a chromogenic substrate, for example X-gal (5-bromo-4-chloro-3-indolyl-E-D-galactoside). The transformed colonies can then be easily distinguished by a specific color reaction.

Upon opening of the pores by electric current, B. thuringiensis or B. cereus cells are transferred to a selective sporulating culture medium and incubated therein until complete sporulation at a temperature of 10 to 40 ° C, preferably at a temperature of 20 to 35 ° C and in particular at 29 to 31 ° C. The sporulation broth contains, as a substance which permits selection, preferably some of said antibiotics, depending on the vector used, and, in addition, strengthening agents, for example agar, agarose, gelatin and the like.

During sporulation, sporulating cells are autolysed, which is very advantageous for subsequent selection, as there is no need to artificially disrupt cells. In the case of clones that contain the desired protoxin gene, which is expressed under the control of the natural promoter, the crystalline proteins lie freely in the environment. These crystalline proteins stored freely in the nutrient medium can then be fixed by means of membrane filters or other suitable method. Suitable membrane filters are, for example, nylon or nitrocellulose membranes, membranes of this type are commercially available.

The crystalline proteins thus fixed can easily be identified during selection.

In carrying out the method of the invention, immunological selection can preferably be performed using protoxin-specific antibodies. These procedures are known and have been described, for example, in Young R. A. et al., Proc. Natl. Acad. Sci. USA 80, 1194-1989, 1983. In the practice of the method of the invention, it is particularly preferred to use monoclonal antibodies that are capable of specifically recognizing a portion of a protein molecule. These antibodies can be used singly or in the form of mixtures. In addition, polyclonal antisera can of course also be used for immunological selection. Mixtures of monoclonal and polyclonal antibodies can also be used as well.

A method for the production of monoclonal antibodies against B. thuringiensis protoxin is known and has been described in more detail in, for example, Huber-Lukač M., Zur Interaction of delta-endotoxins of Bacillus thuringiensis with monoclonal anticorpenes and lipiden, Dissertation no. 7547, ETH Zürich, 1984 and Huber-Lukač M. et al., Infect. Immunol. 54, 228-232, 1986. These methods can also be used in the practice of the present invention.

This antibody-based immunological procedure also forms part of the method of the invention.

Furthermore, any other method of selection aimed at detecting new chains in B. thuringiensis and / or B. cereus is of course within the scope of the invention.

B. thuringiensis and / or B. cereus cells which have been transformed by the above process, as well as toxins produced by these transformed cells, are particularly useful for controlling insects, in particular for controlling Lepidoptera, Diptera and Coleoptera insects.

The invention also relates to a method of controlling insects by contacting the insects or the space in which the insects occur with

(a) B. thuringiensis or B. cereus cells, or a mixture of these cells, transformed with a DNA molecule containing a structural gene coding for a δ-endotoxin type naturally occurring in B. thuringiensis, or also a polypeptide that is substantially homologous thereto, or p

(b) cell-free crystals containing protoxin produced by transformed Bacillus cells.

The invention also relates to insecticidal compositions which contain, in addition to commonly used carriers, excipients or mixtures thereof,

(a) B. thuringiensis or B. cereus cells or a mixture of these cells transformed with a recombinant DNA molecule containing a structural gene coding for a δ-endotoxin type polypeptide naturally occurring in B. thuringiensis, or also a polypeptide that is substantially homologous thereto, or

(b) cell-free crystals containing protoxin produced by transformed Bacillus cells.

For use as insecticides, transformed microorganisms are used which contain a recombinant B. thuringiensis toxin gene, preferably transformed live or killed B. thuringiensis or B. cereus cells, as well as toxic proteins produced. these transformed cells in altered form or preferably in admixture with commonly used excipients for this use. The resulting compositions may take any conventional form, such as concentrated suspensions, spreadable pastes, ready-to-use solutions or concentrated solutions, soaked powders, soluble powders, dusts, granules or even capsules, for example using polymeric substances.

Said compositions may also be applied by conventional means such as spraying, spraying, dusting, pouring or coating depending on the purpose of use and the nature of the composition used.

Of course, insecticidal compositions may also be used which consist of transformed living or dead cells of B. thuringiensis and / or B. cereus, as well as of cell-free crystals containing protoxin produced by said transformed Bacillus cells.

These compositions, i.e. transformed live or killed Bacillus cells or mixtures of these cells with toxins produced by these transformed cells, and optionally solid or liquid excipients, can be obtained in a known manner, for example by thoroughly mixing the transformed cells and / or toxic proteins with solid carriers. and optionally with compounds that affect surface tension (wetting agents).

Of the solid carriers, for example, clays such as calcite, talcum, kaolin, montmorillonite or attapulgite are generally used for dusts or dispersed powders. For example, highly dispersed silicic acid or highly dispersed polymeric materials can be used to improve physical properties. Porous materials such as pumice, crushed stone, sepionite or bentonite, but also water-bearing materials such as calcite or sand can be used as the carrier for the granules. In addition, a variety of pre-granulated materials of inorganic or organic nature can be used, especially dolomite or even plant residues, dried and processed into particles of the desired size.

Suitable wetting agents are nonionic, cationic and / or anionic wetting agents having good dispersing and crosslinking properties. Mixtures of wetting agents may of course also be used.

Suitable anionic wetting agents are, for example, water-soluble synthetic surface-active compounds or even water-soluble soaps.

The soaps may be alkali metal or alkaline earth metal ammonium salts or ammonium salts of unsubstituted or substituted higher C 10 -C 22 aliphatic acids, for example sodium or potassium salts of oleic or stearic acid, or a mixture of aliphatic acids, for example coconut oil or hydrogenated tallow. In addition, methylaurine salts with aliphatic acids, for example, sodium salt of cis-2- (methyl-9-octadecenylamino) ethanesulfonic acid, may be used, the content of which is about 3%.

However, so-called synthetic wetting agents, in particular sulphonates or sulphates of aliphatic acids, sulphonated derivatives of benzimidazoles, alkylarylsulphonates or aliphatic alcohols, for example 2,4,7,9-tetramethyl-5-decin-4,7-diol, are also frequently used. usually about 2%.

The sulfonates or sulfates of the aliphatic acids are generally used in the form of alkali or alkaline earth metal salts or in the form of optionally substituted ammonium salts, the alkyl radical having 8 to 22 carbon atoms, the alkyl radical being also the alkyl portion of the acyl radical, e.g. o sodium or calcium salts of lignin sulphonic acid, dodecyl sulphate or mixtures of aliphatic acids and aliphatic alcohols in the form of sulphates, usually of natural origin. This group also includes the salts of sulfuric and sulfonic esters and the addition products of aliphatic alcohols with ethylene oxide. The sulfonated benzimidazole derivatives preferably contain two sulfonic acid residues and one aliphatic acid residue of 8 to 22 carbon atoms. Alkylarylsulfonates are, for example, sodium, calcium or triethanolamine salts of dodecylbenzenesulfonic acid, dibutylnaphthalenesulfonic acid, or the same salts of the condensation product of formaldehyde with naphthalenesulfonic acid.

Corresponding phosphates, for example salts of phosphoric acid esters with addition product of ethylene oxides and p-nonylphenol having a total number of 4 to 14 carbon atoms, are also suitable.

Suitable nonionic surfactants are, in particular, derivatives of polyglycol ether and aliphatic or cycloaliphatic alcohols, saturated or unsaturated aliphatic acids and alkylphenols and 3 to 30 glycol ether groups, 8 to 20 carbon atoms in the aliphatic hydrocarbon radical and 6 to 18 carbon atoms in alkylphenol.

Other suitable nonionic surfactants are the addition products of polyethylene oxide and polypropylene glycol having from 20 to 250 ethylene glycol ether groups, and the addition products of ethylenediaminopolypropylene glycol and an alkylpolypropylene glycol having from 1 to 10 carbon atoms in the alkyl chain. These substances usually contain one to five ethylene glycol units per propylene glycol unit.

Examples of nonionic wetting agents include nonylphenolpolyethoxyethanes, castor oil polyglycol ether, polypropylene and polyethylene oxide addition products, tributylphenoxypolyethoxyethanol, polyethylene glycol and octylphenoxypolyethoxyethanol. Also suitable are aliphatic acid esters of polyoxyethyl sorbitan, for example polyoxyethylene sorbiten trioleate.

The cationic wetting agents may be, in particular, quaternary ammonium salts which carry at least one alkyl radical of 8 to 22 carbon atoms as substituents on the nitrogen atom and, as further substituents of unsubstituted or halogenated lower alkyl, benzyl or lower hydroxyalkyl. The salts are usually halides, methylsulfates or ethylsulfates, for example stearyltrimethylammonium chloride or benzyldi (2-chloroethyl) ethylammonium bromide.

Wetting agents which may be used for this purpose have been described, for example, in McCutcheon's, 1986 International McCutcheon's Emulsifiers and Detergents, The Manufacturig Confections Publishing C., Glen Rock, NI, USA and Helmut Stache Tensid-Taschenbuch by Carl Hanser-Verlag, Munich. Vienna 1981.

Agrochemical compositions generally comprise 0.1 to 99%, preferably 0.1 to 95% of transformed live or dead Bacillus cells or mixtures of these cells or protein toxins produced by these transformed Bacillus cells, 99.9 to 1%, preferably 99.8 up to 5% solid or liquid excipient and 0 to 25%, preferably 0.1 to 25% wetting agent.

Concentrated formulations are usually supplied, but the user uses dilute formulations for direct use.

Said compositions may contain further additives, for example stabilizers, antifoams, viscosity regulators, binders, tackifiers, as well as fertilizers or other active substances to obtain particular effects.

Transformed living or dead Bacillus cells or mixtures of these cells, containing genes coding for recombinant B. thuringiensis toxins as well as self-protein toxins produced by said transformed Bacillus 50 cells, are well suited for controlling harmful insects. They are preferably plant pests of the order Lepidoptera, in particular of the families Pieris, Heliothis, Spodoptera and Plutella, for example Pieris brassicae, Heliothis virescens, Heliothis zea, Spodoptera littoralis and Plutella xylostella.

Other harmful insects which can be controlled by such means are, for example, insects of the order Coleoptera, of the family Chrysomelidae, for example Diabrotica undecimpunctata, D. longicornis,

D. virgitera, D. undecimpunctata howardi, Aglastica alni, Leptinotarsa decemlineata, as well as Diptera insects such as Anopheles sergentii, Uranatenia unguiculata, Culex univitanus, Aedes aegypti, Culex pipiens and the like.

The amount in which the Bacillus cells and / or the toxin produced by these cells are used depends on the conditions, for example, the weather, the type of soil, the stages of plant growth and the time of application.

Overview of the drawings

The invention will now be described in more detail with reference to the accompanying drawings.

Figure 1 shows the transformation of E. coli HB 101 using plasmid pBR322 (a) and ^X B. thuringiensis HD cryB with a plasmid pBC16 (·). (Δ means the number of surviving ^X HD1 cryB cells).

Figure 2 shows the effect of the age of culture ^{X of} B. thuringiensis HD1 cryB on the frequency of transformation being performed.

Figure 3 shows the effect of pH in PBS buffer on transformation frequency.

Figure 4 shows the effect of sucrose concentration in PBS buffer on the frequency of transformation being performed.

Figure 5 shows the relationship between the number of transformed cells and the amount of DNA used for transformation.

6 is a simplified representation of a restriction enzyme site map in the bifunctional vector? XIS1. The shaded region refers to the strand from the Gram-positive plasmid pBC16, the remainder comes from the Gram-positive plasmid pUC8.

Figure 7 shows a simplified map of the restriction enzyme sites in the plasmid ^ ρΧΙΘΞ. The shaded regions indicate a structural gem protoxin (Pfeil, Kurhdl) and non-coding chain for the 5 'end and the 3 ¹ -zakončení. The remaining unhatched part comes from the vector ΧρΧΙβΙ.

Figure 8 shows electrophoresis of B. thuringiensis HD1 cryB, B. cereus 569 K sporulating culture ^X extracts and their derivatives on an SDS polyacrylamide gel (with sodium dodecyl sulphate). (1: ^X HD1 cryB (pXI93), 2: ^X HD1 cryB (pXI61), 3: HD1 cryB ^X, 4: HD1, LBG B-4449, 5: ^X B. cereus 569 K (pXI93), 6: 596 K .

(a) stained with Coomasie dye, M: molecular weight of standard, MG: molecular weight in units, arrow: position of protoxin with a molecular weight of 130 000 units.

b) Western blot using the same gel and polyclonal antibody to crystalline K-1 protein from B. thuringiensis HD1.

The presence of positive bands using a labeled goat protein antibody is also shown. The arrow shows the position of the protoxin with a molecular weight of 130,000 units, the other bands show the protoxin degradation products.

Figure 9 shows transformation of B. subtilis LBG B-4468 using pBC16 plasmid DNA and electrical pore opening as optimal for B. thuringiensis. (o: number of transformants / gg plasmid DNA, · means number of live bacteria / ml).

Figure 10 shows the nucleotide sequence whose region flanked by nucleotides 156 to 3623 encodes a polypeptide of formula II.

note:

^x The pK label was used in the priority document for the plasmid, and the pXI label was already used for further international applications.

Also, the designation of asporogenic mutants of B. thuringiensis HD1 has been changed from the original designation cryS to cryB in the exemplary embodiments.

DETAILED DESCRIPTION OF THE INVENTION

Examples of compositions containing B. thuringiensis material

In the following examples, Bacillus cells refer to B. thuringiensis and / or B. cereus cells which contain the recombinant B. thuringiensis gene of the invention. The percentages given are always percentages by weight.

F1. granules

a)

Bacillus cells and / or protein toxin produced by them 5% kaolin 94% highly dispersed silica 1% atapulgite

b)

10%

The Bacillus cells and / or the protein toxin produced by these cells are first suspended in methylene chloride, then sprayed onto the carrier and sprayed on. the solvent was evaporated in vacuo.

F2. sprinkle

Bacillus cells and / or the protein toxin produced therefrom highly dispersed silicic acid

a)

(b) talc

97?

kaolin

90?

The composition, which can be used as a dusting agent, is obtained by thoroughly mixing the carrier material with Bacillus cells and / or toxin.

F3. Powder for spraying Bacillus cells and / or protein toxin produced by them

25?

b)

50?

75 ^with sodium lignosulfonate sodium lauryl sulfate sodium diisopropylnaphthalenesulfonate

10 ok octylphenolpolyethylene glycol ether (7-8 moles ethylene oxide) highly dispersed silica 5% 10% 10% kaolin 62% 27%

The Bacillus cells and / or the protein toxin produced by them are mixed carefully and thoroughly with the other ingredients, and the resulting mixture is then ground in a suitable mill.

In this way, a powder is obtained which can be diluted with water to a suspension of any desired concentration.

F4. Extruded granulate

Bacillus cells and / or protein toxin produced by them 10% sodium lignin sulphate 2% carboxymethylcellulose 1% kaolin 87%

The Bacillus cells and / or the protein toxin produced by them are mixed with the excipients, ground thoroughly and then moistened with water. The resulting mixture is then pressed and the resulting granulate is dried in a stream of air.

F5. Encapsulated granules

Bacillus cells and / or protein toxin produced by them 3% polyethylene glycol 3% kaolin

94 ·

The Bacillus cells and / or the protein toxin produced by them are homogeneously mixed in. and the mixture is uniformly applied to the kaolin moistened with polyethylene glycol. In this way a dust-free granulate is obtained.

F6. Concentrated suspension

Bacillus cells and / or protein toxin produced by them 40% ethylene glycol 10% nonylphenolpolyethylene glycol (15 moles of ethylene oxide) 6% alkylbenzenesulfonic acid salt y

with tethanolamine 3% carboxymethylcellulose 1% silicone oil in the form of 75% emulsion 0.1% water 39% ^x Alkyl is preferably linear and contains 10 to 14 carbon atoms, for example n-dodecylbenzenesulfonic acid with triethylamine

14, in particular 12 to an acid salt

The Bacillus cells and / or the protein toxin produced by them are thoroughly mixed with the other ingredients. In this way, a concentrated suspension is obtained, from which a suspension of any desired concentration can be obtained by dilution with water.

The following examples illustrate the invention. First, the general procedures used in the Examples section will be described.

General procedures using recombinant DNA

Since many of the processes used in carrying out the process of the invention are well known, the generally applicable processes will be briefly explained below, so that it is not always necessary to explain them again in specific embodiments. Unless explicitly stated otherwise, all these procedures are set forth in Maniatis et al., Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, USA, 1982.

A. Restriction endonuclease digestion

Typically, the DNA content of the reaction mixture in a buffer solution supplied from New England Biolabs, Beverly, MA is 50-500 gg / ml. For each microgram of DNA, 2-5 units of restriction endonuclease are added and the reaction mixture is incubated at the manufacturer's recommended temperature for 1 to 3 hours. The reaction is stopped by heating the mixture at 65 ° C for 10 minutes or extracted with phenol to which the DNA is precipitated with ethanol. This procedure is described on pages 104-106 of the said Maniatis publication.

B. DNA polymerase treatment to achieve smooth ends up to 500 gg / ml DNA as fragments is added to buffer (New England Biolabs). the deoxynucleotide triphosphates run for 30 minutes at

This buffer contains all four at a concentration of 0.2 mM. Reaction at 15 ° C and then terminate by heating to 65 ° C for 10 minutes. In the case of fragments which, after cleavage with a restriction endonuclease, are formed in the reaction mixture and contain a 5'-end after cleavage, for example with EcoRI and BamHI, i.e. the cohesive end, for example a Klenow DNA polymerase fragment or a large fragment of this enzyme is used. In the case of fragments obtained by enzymes using a 3 ^1- cohesive tail, such as the PstI and SacI enzymes, T4-DNA polymerase is used. The use of both of these enzymes is described on pages 113-121 of the said Maniatis publication.

C. Agarose gel electrophoresis and purification of DNA fragments from the gel

The agarose gel electrophoresis is carried out in a horizontal apparatus as described on pages 150-163 of said Maniatis. publications. The buffer used corresponds to the tri-borate buffer used in the publication. The DNA fragments are stained with 0.5 µg / ml ethidium bromide, this dye may be available in gel or buffer during electrophoresis, or may be added after electrophoresis. The DNA can then be visualized by using ultraviolet light of greater wavelength. If the fragments are not to be separated from the gel, agarose which solidifies at a lower temperature (Sigma Chemicals, St. Louis, Missouri) is used. After electrophoresis, the desired fragment can be excised, placed in a plastic tube, heated to 65 ° C for 15 minutes, then extracted three times with phenol and precipitated twice with ethanol. This procedure is somewhat changed compared to the procedure shown on page 170 of the Maniatis publication.

Alternatively, DNA can be isolated from an agarose gel using Geneclean Kits (Bio 101 Inc., La Jolla, CA).

D. Removal of 5'-terminal phosphates from DNA fragments

During cloning of the plasmid, phosphatase treatment of the vector reduces the recircularization of the vector as shown on page 13 of the Maniatis publication. After digestion of the DNA with the appropriate restriction endonuclease, one unit of alkaline phosphatase from the calf intestine (Boehringer-Mannheim, Mannheim) is added. The DNA was incubated at 37 ° C for one hour, then extracted twice with phenol and precipitated with ethanol.

E. Linking of DNA fragments

For fragments with a complementary cohesive end, approximately 100 ng of each of these fragments is incubated from a 20-40 μΐ reaction mixture with approximately 0.2 units of T4 DNA ligase (New England Biolabs) in the manufacturer's recommended buffer. . Incubation takes 1 to 20 hours at 15 ° C. If non-cohesive tail fragments are to be pooled, they are incubated as described above, but in this case the amount of T4 DNA ligase in the mixture needs to be increased to 2-4 units.

F. Transformation of DNA in E. coli

The strain E. coli HB101 was used for most experiments. DNA was incorporated into E. coli cells using a procedure using calcium chloride as an adjuvant as described on pages 250 to 251 of the said Maniatis publication.

G. Selection of E. coli for the presence of plasmids

After transformation, the obtained E. coli colonies were observed due to the presence of the desired plasmids obtained by rapid plasmid isolation. Two applicable procedures are disclosed on pages 366 to 369 of the said Maniatis publication.

H. Large-scale isolation of plasmid DNA

The procedure for large-scale isolation of plasmid from E. coli is described on pages 88-94 of the Maniatis publication.

Buffer media and solutions

Environment LB g / i

Tryptone Yeast Sodium Chloride Extract

Environment # 3 containing antibiotic (Difc.o Laboratories) g / i beef extract 1.5 yeast extract 1.5 peptone 5 glucose 1 sodium chloride 3.5 potassium hydrogen phosphate 3.68. Potassium dihydrogen phosphate 1.32

SCGY environment g / i amino acid casein 1 yeast extract 0.1 glucose 5 potassium hydrogen phosphate 14 potassium dihydrogen phosphate 6 sodium citrate 1 ammonium sulfate 2 magnesium sulfate. 7 H ₂ 0 0.2

GYS Environment (Youston A.A. and Rogoff M.H.

J. Bacteriol. 100, 1229-1236 (1969) g / i glucose 1 yeast extract 2 ammonium sulfate 2 potassium hydrogen phosphate 0.5 magnesium sulfate. 7 H ₂ 0 0,2 calcium chloride. 2H ₂ O 0.08 manganese sulfate. H ₂ 0 0.05

Prior to autoclaving, the pH of this medium was adjusted to 7.3.

PBS-Sucrose Magnesium Chloride Phosphate Buffer pH 6.0

TBST buffer mM

400 mM

Tween 19 ^x

Tris / HCl ^x (pH 8.0)

NaCl (in bidistilled water)

0.05 g / 100 ml 10

150 ^x Tween 20 polyetoxysorbitan laurate ^x Tris / HCl α, α, α-tris (hydroxymethyl) methylamine hydrochloride

The internal designation pK, as indicated for the plasmids in the priority document, was replaced in the application by the officially recognized designation pXI.

Also, the designation for asporogenic B. thuringiensis HD1 mutants was changed from cryS according to priority document to conventional cryB.

Example 1

Transformation of B. thuringiensis by electrical pore opening

Example 1.1 ml of LB medium containing 10 g / l Trypton, 5 g / l yeast extract and 5 g / l sodium chloride were inoculated with spores of B. thuringiensis var. kurstaki HDlcryB, a plasmid-free variant described by Stahly D. P. et al., Biochem. Biophys. Res. Comm. 84, 591-588 (1978).

The mixture was then incubated overnight at 27 ° C in a shaker at 50 oscillations per minute. Then, the culture of B. thuringiensis is diluted to 100-400 ml of LB medium and grown at 30 ° C on a shaker at 250 rpm until an optical density of ₅ g ₀ 0.2 is reached.

Then, the cells are collected by centrifugation and suspended in 1/40 volume of cold PBS buffer containing 400 mM sucrose, 1 mM magnesium chloride and 7 mM phosphate buffer pH 6.0. Centrifugation and suspension of B. thuringiensis cells in PBS are repeated once more.

The treated cells can then be directly subjected to electrical pore opening or, after addition of 20 g / 100 ml glycerol, can be stored at -20 to -70 ° C until use.

Then 800 μΐ of the cooled cells are transferred to a pre-cooled cuvette, and then 0.2 μg of the pBC16 plasmid DNA described by Bernhard K. et al., J. Bacteriol. 133, 897-903, 1978, the DNA content of the sample is thus 20 µg / ml, and the resulting mixture is incubated for 10 minutes at 4 ° C.

Using deep-frozen cell material, cells are first thawed on ice or at room temperature. Further processing takes place as with fresh cell material.

The cuvette is then placed in an electric current pore opening device and a 0.1 to 2.5 kV capacitor is discharged through the suspension.

The capacitor used had a capacity of 25 μΕ, the distance between the cells and the electrode was 0.4 cm, the electric field had high starting values of 0.25 to 6.25 kV / cm. The decrease in the exponential curve was in the range of 10 to 12 ms.

For example, the Gene Pulser Apparatus, 165-2075 (Bio Rad, 1414 Harbor Way South, Richmond, CA, 94804, USA) may be used for the above-described electrical pore opening experiments.

It will be understood that any other suitable device may be used in the practice of the present invention.

After an additional 10-minute incubation at 4 ° C, the cell suspension is diluted by adding 1.2 mL of LB medium and then incubated for 2 hours at 30 ° C on a shaker at 250 rpm.

Finally, appropriate dilutions are applied to the plates using LB agar, i.e. LB medium, strengthened by the addition of 15 g / l agar. This medium also contains the respective antibiotic as an additive for the selection of the newly obtained plasmid. The plasmid pBC16 is tetracycline, which is usually added to the culture medium at a concentration of 20 mg / l.

Figure 1 shows the dependence of the baseline voltage at a given distance between the capacitor plates and the transformation frequency achieved for the plasmid pBC16 and the B. thuringiensis HD1cryB strain.

Expression of the embedded DNA can be demonstrated by the acquired resistance to tetracycline. Two hours after transformation of B. thuringiensis by incorporation of plasmid pBC16, complete phenotypic expression of the newly introduced tetracycline resistance can be observed, as shown in Table 2.

Example 1.2

Transformation of B. thuringiensis cells is carried out in the same manner as in Example 1.1 except that the cell suspension volume in this case is 400 μΐ when performing the electrical pore opening.

By this measure, the frequency of transformation can be increased tenfold.

Example 2

Transformation of B. thuringiensis HD1cryB by a variety of different plasmids

Most experiments were performed with the plasmid pBC16, which is a naturally occurring plasmid from B. cereus. In addition, other naturally occurring plasmids, such as the plasmid pUBUO disclosed in Polak J. and Novick RP, Plasmid 7_, 152-162, the plasmid pC194 described in Horinouchi S., can be successfully used in B. thuringiensis cells and Weisblum B., J. Bacteriol. 150, 815-825, 1982, or the plasmid pIM13 described by Mahler, J. and Halvorson, H.O., J. Gen. Microbiol. 120, 259-263, 1980, as summarized in Table 3.

Also, variants of these plasmids that are more suitable for working with recombinant DNA than natural isolates can be used by the method of the invention to transform B. thuringiensis, an HDlcryB strain, such as the B. subtilis cloning vector pBD64 described in Gryczan. T. et al., J. Bacteriol. 164. 246-253, 1980 as well as the plasmids pBD347, pBD348 and pUB1664, which are listed in Table 3. These plasmids are commercially available (Dr. W. Schurter, CIBA-GEIGY AG., Basel).

The transformation results shown in Table 3 clearly demonstrate that, regardless of the plasmid DNA used, the transformation frequency can be achieved by the method of the invention, which is in S at 7, with the only exception being in the 10 to 10 region.

Example 3

Construction of a bifunctional vector for B. thuringiensis

Previously known bifunctional vectors for B. coli and B. subtilis, for example pHV33, described in Primrose, S. B., Ehrlich, S. D., Plasmid 6, 193-201, 1981, for strain B.

thuringiensis HD1cryB does not fit as shown in Table 3.

To construct an effective bifunctional vector, a large fragment of pBC16 digested with EcoRI by T4 DNA ligase was deposited at the same enzyme digestion site in plasmid pUC8 as described in Vieira J. and Messing J., Gene 19, 259-268, 1982. Then, this construct is used to transform E. coli cells. The correct construction, verified by restriction enzyme analysis, was designated pXI 62.

The distal multivalent region in the plasmid pUC8 at the EcoRI site is then removed. By partial digestion with this enzyme, plasmid pXI 62 is linearized. The cohesive end, after digestion with the said enzyme, is filled with Klenow polymerase fragment and the strands recombined with T4 DNA ligase. After transformation of E. coli, the correct construction is separated by restriction enzyme analysis and designated pXI 61. Figure 6 shows a restriction enzyme treatment map that is capable of cleaving said plasmid at only one site.

This construct can be directly used for transformation of B. thuringiensis HD1cryB according to Example 1.

Due to the existence of strong restriction barriers in B. thuringiensis strains, the transformation efficiency in this case using pXI61 from E. coli is lower than using plasmid DNA originating from the B. thuringiensis HD1cryB strain, as shown in Table 3. Nevertheless, the plasmid pX161 can be considered very suitable for cloning experiments in B. thuringiensis.

Example 4

Introduction of the cervical δ-endotoxin gene into B. thuringiensis and B. cereus strains.

The DNA strand used in the method of the invention for insertion and expression in B. thuringiensis and / or B. cereus and which encodes the δ-endotoxin corticosteroid protein derived from plasmid pK36, which was deposited on March 4, 1986, internationally Deutschen Sammlung von Mikroorganismen, Germany, according to the Treaty of Budapest for the international recognition of deposited micro-organisms for patent purposes under DSM 3668.

A detailed description of a method for the identification and isolation of δ-endotoxin genes as well as the construction of the plasmid pK36 are known and have been described in more detail in European Patent Publication No. 2001/035 / EC. 238 441.

The plasmid pK36 DNA was completely digested using PstI and BamHI, and the 4.3 kb fragment containing the δ-endotoxin gene of formula I was isolated on an agarose gel. This fragment is then inserted into plasmid pX161, which is first digested with the same endonucleases and then treated with alkaline phosphatase from the calf stomach. Following transformation with E. coli HB 101, the correct construct, designated pXI93, was isolated after restriction enzyme analysis. Figure 7 is a map of the action of the restriction enzymes in this plasmid.

Plasmid pXI93 can be inserted into the B. thuringiensis HD1cryB strain in two different ways.

(a) B. thuringiensis cells can be directly transformed with the isolated plasmid pXI93 from E. coli as described in Example 1.

b) Plasmid pXI93 was first transformed in B. subtilis cells by the method of Chang and Cohen, Molec. Gen. Genet 168. 111-115, 1979. Those containing the complete and intact DNA of plasmid pXI93 are isolated from transformants and used according to Example 1 for transformation of B. thuringiensis HDlcryB.

Using both methods, transformants are obtained which contain the intact plasmid pX193, as can be demonstrated by restriction enzyme analysis.

Example 5

Demonstration of δ-endotoxin gene expression in B. thuringiensis

Sporulating cultures of B. thuringiensis HD1cryB (pXI61) and HD1cryB (pXI93) were compared in a phase contrast microscope at 400T magnification. Only the strain containing plasmid pX193 was able to detect typical bipyramidal protein crystals. Extracts from these cultures were separated by electrophoresis on an SDS-polyacrylamide gel. Only in the case of the strain containing plasmid pXI93, a protein with a molecular weight of 130,000 corresponding to said δ-endotoxin, as shown in Figure 8a, could be detected in the gel.

By Western blot analysis, as shown in Figure 8b, this 13,000,000 molecular weight protein, as well as some degradation products thereof, specifically react with polyclonal antibodies that had been previously prepared against a crystalline protein from B. thuringiensis var. kurstaki HD1 according to the method of Huber-Lukac H., Dissertation, Eidgenossische Technische Hochschule. Zurich, Switzerland, no. 7050, 1982. A detailed description of this procedure can also be found in European Patent Application Ser. 238 441. In the plasmid pXI93, upstream of the toxin coding region is a 156 base pair region containing said sporulation-dependent promoter, as described by Wong H. C. et al., J. Biol. Chem. 258. 1960-1967, 1983. This chain is sufficient for high expression of the δ-endotoxin gene in B. thuringiensis HDlcryB and B. cereus 569 K.

Example 6

Toxicity determination of recombinant strain B. thuringiensis HDlcryB (pXI93)

B. thuringiensis HD1cryB and HD1cryB strains (pXI93) were grown at 25 ° C in GYS sporulation broth. After complete sporulation, controlled by phase contrast microscopy, spores and, if present, protoxin crystals were isolated by centrifugation and spray-dried. The obtained powder was added at varying concentrations to the L-1 larvae feed of Heliothis virescens. Larvae mortality was determined after six days.

As expected, the HD1cryB strain, which does not have a protoxin gene, is not toxic to Heliothis virescens, but the strain containing plasmid pXI93 causes dose-dependent H. virescens death, as shown in Table 4. Thus, it is apparent that recombinant strains obtained by pore opening under the action of electric current can be used as biological insecticidal compositions.

Example 7

Pore opening in various strains of B. thuringiensis and other strains of Bacillus.

The transformation used for B. thuringiensis HD1cryB can also be applied to a variety of other strains.

All strains of B. thuringiensis var. kurstaki can be transformed in this way easily and with high efficiency, as shown in Table 5.

By using a laboratory strain of B. cereus, a very efficient transformation can also be achieved. The same applies to other B. thuringiensis varieties tested, namely var. israelensis a.var. thuringiensis. On the other hand, the transformation efficiency for B. subtilis using pore opening by electric current is quite low.

However, with the polyethylene glycol method in B. subtilis protoplasts, transformation efficiency of up to 4 x 10 6 / µg plasmid DNA can be achieved.

The low transformation efficiency in B. subtilis using pore opening by electrical current is not related to the use of incorrect parameters, such as inappropriate voltage or excessive electrical pulses, as seen in Figures 68 to 9.

Example 8

Transformation of B. thuringiensis HD1cryB using the S-galactosidase gene.

8.1. Installation of the BamHI restriction enzyme site immediately before the first codon of the B. thuringiensis protoxin AUG gene

Before it is possible to link the β-galactosidase gene from plasmid piWiTh5 (Dr. M. Geiser, CIBA-GEIGY AG., Basel, Switzerland) to the promoter of the B. thuringiensis cervical δ-endotoxin gene, it is necessary to modify the DNA strand is located in the immediate vicinity of the AUG start codon of the protoxin gene.

This modification can be accomplished by oligonucleotide-mediated mutagenesis using single chain phage M13mp8 containing a 1.8 kb fragment after digestion with the HincII enzyme and the HindIII gene for the δ-endotoxin, which also contains the 5'-region of the toxin gene.

First, 3 µg of plasmid pK36 (Example 4) was digested with the restriction enzymes HindIII and HincII. The resulting fragment was purified by agarose gel electrophoresis and then isolated from the gel.

At the same time, 100 ng of M13mp8 RF DNA (Biolab, Tozer Road, Beverly MA, 01915, USA) was digested with the restriction enzymes SmaI and HindIII, and after phenol treatment, the material was then precipitated by addition of ethanol. The phage DNA thus treated is then mixed with 200 ng of a pre-isolated protoxin fragment and ligated with T4 DNA ligase.

After transfection with E. coli JM103, six white plaques are obtained, which are analyzed by restriction enzyme treatment.

The isolate containing, in the correct order, the β-galactosidase gene and the promoter of said δ-endotoxin gene from B. thuringiensis was designated M13mp8 / Hinc-Hind.

Using a DNA synthesis device. (APPLIED BIOSYSTEM DNA SYNTHESIZER) an oligonucleotide with the following sequence (5 ') GTTCGGATTGGGATCCATAAG (3') is synthesized

This synthetic oligonucleotide is complementary to the M13mp8 / Hinc-Hind region from position 153 to position 173 of the δ-endotoxin gene of formula I. However, the oligonucleotide sequence is different at positions 162 and 163 from Formula I, thereby creating a restriction enzyme site BamHI. In general, this mutagenesis is described in Zoller J.M. and Smith N., Nucl. Acids. Res. 10, 6587, 1982. Approximately 5 gg of M13mp8 / Hinc-Hind phage DNA is mixed with 0.3 gg of phosphorylated oligonucleotides with a total volume of 40 μΐ. The resulting mixture was heated to 65 ° C for 15 minutes, then cooled first to 50 ° C and then completely to 4 ° C. Buffer, nucleotide triphosphates, ATP, T4 DNA ligase and a large DNA polymerase fragment are then added and the mixture is incubated overnight at 15 ° C as described by Zoller and Smith. After agarose gel electrophoresis, double-stranded circular DNA is purified and incorporated by transfection into E. coli JM103. A strain may also be used

E. coli JM107.

The resulting strand is tested for the presence of a strand capable of hybridizing to a P-labeled oligonucleotide. Isolated phages are then analyzed by restriction endonuclease treatment.

The phage that contains the correct construct and thus the BamHI site immediately before the first codon of the AUG protoxin gene was designated M13mp8 // Hinc-Hind / Bam.

8.2 Linking the β-galactosidase gene to the δ-endotoxin promoter

8.2.1

The δ-endotoxin gene promoter is deposited on the M13mp8 // Hinc-Hind / Bam fragment after digestion with EcoRI / BamHI, the fragment contains 162 base pairs. The phage RF DNA is digested with the restriction enzyme BamHI. The 5 'end of the strand is removed by bean nuclease treatment (Biolabs). as specified by the manufacturer. This DNA was then digested with EcoRI and po. An agarose gel electrophoresis yields a 162 base pair fragment.

The β-galactosidase gene is isolated from the plasmid piWiThS. The DNA of this plasmid is first digested at a single site by treatment with the enzyme HindIII. 3 -zakončenie ¹ is filled with the Klenow fragment of DNA polymerase, as described on page 113-114 of said publication Maniatisovej a modified DNA was digested with restriction enzyme SalI. The DNA fragment containing the β-galactosidase gene is isolated by agarose gel electrophoresis.

The pXI61 vector described in Example 3 was digested with the restriction enzymes EcoRI and SalI, and the two previously isolated fragments were incorporated into the pXI61 vector.

After pore transformation of E. coli HB101 or JM107 strains with this mixture, the desired cell clones are determined by restriction enzyme analysis and selected for their β-galactosidase type activity using the chromogenic substrate X-gal (5-bromo-4-chloro-3- indolyl-β-D-galactoside). The clone containing the correct genetic construct was designated pXI80.

8.2.2

Alternatively, the 162 base pair EcoRI / BamHI fragment containing the δ-endotoxin promoter can be isolated by digesting with M13rnp8 // Hinc-Hind / Bam with EcoRI and BamHI, and then separating the fragments from each other. gel electrophoresis.

The β-galactosidase gene is also isolated from the plasmid piWiTh5, as described in Example 8.1. The plasmid DNA was digested with BamHI and BglII and the large fragment was isolated after agarose gel electrophoresis.

The pHY300 PLK vector (PHY-001, Toyobo Co., Ltd., 2-8 Milk Hama 2-Chome, Kita-ku, Osaka, 530, Japan), which is commercially available as described in Example 9.1, is cleaved by treatment with restriction enzymes EcoRI and BglII. The two pre-isolated fragments are then inserted into the pHY300 PLK vector.

The resulting mixture was then used to transform E. coli JM107 (Bethesda Research Laboratories (BRL), 411N, Stonestreet Avenue, Rockville, MD 20850, USA). The clone having β-galactosidase activity was further analyzed by restriction enzyme digestion. The clone that contained the correct genetic construct was designated pXU01.

8.3 Transformation of B. subtilis and B. thuringiensis with plasmids pXI80 and pXU01

The plasmid DNAs of pXI80 and pXUO1 were first used for transformation in B. subtilis protoplasts according to the method of Chang S. and Cohen S. N., Molec. Gen. Genet. 168. 111-115, 1979.

The correct clone was selected, which was isolated by a standard procedure, and then used to transform B. thuringiensis HD1 cryB cells with an electric current as described in the pore opening procedure of Example 1.

Transformed B. thuringiensis cells are plated on GYS agar plates (sporulation medium) containing X-gal as an additive.

Correctly transformed clones stain blue during sporulation.

On the other hand, the B. thuringiensis HD1 cryB strain transformed with the pX161 vector remains white under these conditions.

Restriction enzyme analysis shows that intact plasmid pXI80 or pXU01 can be found in properly transformed B. thuringiensis cell clones.

8.4 Sputula-dependent β-galactosidase gene under the control of a promoter

B. thuringiensis HD1 cryB cells containing plasmid pXUO1 are grown in said GYS medium. At various times during the growth phase (both during vegetative growth and during sporulation) the β-galactosidase assay is performed according to Miller JH, Experiments in Molecular Genetics, Cold Spring Harbor Laboratory, 1972, experiments 48 and 49th

The only difference from the previous step lies in the use of X-gal as a chromogenic substrate in the simultaneous measurement of the color hydrolysis product, which is formed in the cells after approximately one hour.

Cells are then harvested by centrifugation and measured. is the optical density of the supernatant at 650 nm (650θ ^ θ).

It has been shown that the optical density increases in dependence on the sporulation. On the other hand, cells of untransformed B. thuringiensis strains are unable to hydrolyze the chromogenic substrate X-gal.

Example 9

Creation of a B. thuringiensis gene bank

9.1 Construction of pXI200

Plasmid pXI200 is a derivative of plasmid pXI300 PLK which is commercially available (PHY-001, Toyobo Co., Ltd., 2 - 8).

2-Chome, Kita-ku, Osaka, 530 Japan). The plasmid pHY300 PLK, the construction of which has been described in European patent specification no. No. 162,725, contains both the ampicillin (amp ^R ) resistance gene and the tetracycline resistance gene.

Plasmid pHY300 PLK was completely digested with BglI and Pvul. The resulting restriction fragments are then separated by agarose gel electrophoresis. The 4.4 kb fragment was isolated from the agarose gel, purified and finally re-ligated with T4 DNA ligase.

The resulting mixture was used for transformation in E. coli HB101. After incubation of transformed cells'. coli HB101 at 37 ° C on selective L-agar containing 20 gg / ml tetracycline, tetracycline-resistant transformants (Tc ^r ) are isolated. A plasmid lacking the site of action of the PstI enzyme in the ampicillin resistance gene as well as a 0.3 kb fragment was isolated from an ampicillin-sensitive clone at 100 gg / ml (Αρθ). This plasmid was designated pXI200.

9.2 Cloning of the protoxin gene from Bacillus thuringiensis var. kurstaki HD1 in B. thuringiensis HD1 cryB.

gg of total DNA from B. thuringiensis var. kurstaki HD1 is completely cleaved by incubation with the restriction enzymes PstI and HpaI. The restriction fragments thus obtained are transferred to a continuous sucrose gradient (5 to 23 g / 100 ml) and subjected to centrifugation and hence separation according to their size, collecting fractions of 500 g each. Centrifugation is carried out in a TST 41 rotor (Kotron) at a maximum of 2.4 x 10 µg for a total of 16 hours at 15 ° C. 50 g portions are then removed to determine the size of the fragments on an agarose gel containing 0.8 g / 100 ml of agarose in Tris-acetate buffer or Tris-borate buffer each containing EDTA as described in the Maniatis publication. Those fractions containing fragments of 3-6 kb are pooled and concentrated to a volume of 10 g with ethanol precipitation.

The gg of the pXI200 bifunctional vector described in Example 9.1 was completely digested with the restriction enzymes PstI and SmaI. The 5'-phosphate groups of the resulting restriction fragments are then removed by treatment with alkaline phosphatase from the calf intestine.

0.2 to 0.3 µg of pre-isolated DNA from the HD1 strain is then mixed with 0.5 µg of pXI200 vector DNA and then incubated with the addition of 0.1 unit of T4 DNA ligase overnight at 14 ° C. One so-called white unit of T4 DNA ligase corresponds to an enzymatic activity that is sufficient to convert 1 nM [ ³² P] from pyrophosphate at 37 ° C over 20 minutes to a Norit absorbable material. The resulting mixture is then directly used to electrically open the pores while transforming the B. thuringiensis HD1 cryB cells as described in Example 1. After transforming the B. thuringiensis cells by opening the pores under electric current, the cells are then transferred to selective sporulation agar, which as the selection composition contains 20 Mg / ml tetracycline, and then the material is incubated at 30 ° C until complete sporulation.

9.3. Production of monoclonal antibodies against protoxin type B. thuringiensis protein

Production of monoclonal antibodies against δ-endotoxin from B. thuringiensis var. kurstaki HD1 is carried out according to the method of Huber-Lukač M., Zur Interaktion des delta-Endotoxins of Bacillus thuringiensis with monoclonal antikorpen and lipiden, Dissertation no. 7547, ETH Zürich, 1984 and Huber-Lukač M. et al., Infect. Immunol. 54, 228-232 (1986).

The hybridoma cells used to generate antibodies are Sp2 / 0-Ag myeloma cell fusion products described by Shulman et al., Nature 276, 269, 1978 and deposited with the American Type Culture Collection, in Rockville, Maryland, USA and the spleen lymphocytes of BALB / c mice that had been immunized with δ-endotoxin from a B. thuringiensis var. kurstaki HD1.

In this way, monoclonal antibodies that are specific to B. thuringiensis δ-endotoxin can be obtained. Particularly preferred are those monoclonal antibodies that specifically bind to the epitope of the N-terminal half of the protein protoxin (e.g., antibody 54.1 from Huber-Lukac et al., 1986) or to the epitope of a stable portion of the protein active against Lepidoptera in the C-terminal half ( for example, antibody 83.16 of the same publication).

However, other monoclonal or polyclonal antibodies may also be used for the immunological observation described in Example 9.4 below.

9.4 Immunological tests

The monoclonal antibodies obtained according to Example 9.3 or any other suitable monoclonal antibody may be used for immunological observation according to this example.

First, free-crystalline proteins bind to the transfer membrane (e.g. Pall Biodyne Transfer-Membran or Pall Ultrafine Filtration Corporation, Glen Cove, NY) after sporulation of B. thuringiensis cells, which membrane is then stored for approximately 5 minutes on the plate. The filter is then washed for 5 minutes with TBST buffer containing 0.05 g / 10 ml Tween 20, 10 mM tris / HCl pH 8.0 and 150 mM sodium chloride in bidistilled water, and then incubated for 15 to 30 minutes to block. non-specific binding in TBST buffer mixture with the addition of 1 g / 100 ml skimmed milk.

The filter thus prepared is then incubated overnight with protoxin-specific antibodies (a mixture of antibodies 54.1 and 83.16 of Huber-Lukac et al., 1986). Unbound antibodies are removed by washing this filter three times with TBST buffer, washing for 5-10 minutes. To detect antibody-bound protoxin, the filter is incubated with another antibody. This secondary antibody is, for example, an alkaline phosphatase-labeled mouse protein antibody, for example, a conjugate of goat anti-mouse76 mu IgG (H + L) with an alkaline phosphatase (Bio-Rad, Catalog No. 170-6520). After 30 minutes of incubation, unbound antibody is removed from the filter as well as the first antibody by washing the filter three times for 5 to 10 minutes each with TBST buffer. Finally, the filter is incubated with a substrate mixture consisting of NBT (tetrazolium chloride p-nitro-blue) and BCIP (5-bromo-4-chloro-3-indolylphosphate-p-toluidine salt). The enzymatic reaction is performed according to the manufacturer's recommendations (Bio-Rad, 1414 Harbor Way South, Richmond CA, 94804, USA).

Positive, i. protoxin-containing clones are very easy to recognize because of their violet color. This staining is due to the enzymatic reaction of alkaline phosphatase with said substrate mixture. The transformation, as described in Example 9.2, results in 800 to 1000 transformants. Of this amount, the two colonies contain a clearly positive signal in said enzymatic reaction.

Plasmid DNA was isolated from positive clones in which the expression of the protoxin gene could be detected by the enzymatic reaction described. By restriction enzyme analysis. and by comparison with known maps of the sites of action of these enzymes, the cloned protoxin genes could be further characterized and finally identified.

Both clones contained a 43 kb recombinant plasmid. The following restriction enzyme digestions with HindIII, PvuII, EcoRI and XbaI permit gene identification by comparison with restriction enzyme site maps in the B. thuringiensis var. Endotoxin gene. kurstaki HD1. Both are the kuhrdl gene, also known as the 5.3 kb protoxin gene, and described in Geiser M. et al., Gene, 8, 109-118, 1986.

This gene, cloned directly in B. thuringiensis and identified immunologically, hybridizes to a 1847 base pair BamHI / HindIII fragment from the 5.3 kb plasmid gene of pK36 according to Geiser et al., 1986: In performing SDS / PAGE, both clones have both clones typical bands common to the protoxin having a molecular weight of 130,000 units also react specifically with the monoclonal antibodies of Example 9.4 using the Western blot method of Towbin H. et al., Proc. Natl. Acad. Sci. USA 76: 4350-4354, 1979.

Table 1

Effect of incubation time at 4 ° C before and after pore opening by B. thuringiensis HD1 cryB using 0.2 μ $ pBC16 sample 12345678 preincubation * (min) 0

10 20

20

Subsequent incubation ^{* xx} (min) 20 20

20

10 20

Frequency of transformations (transformants / microgram

Plasmid DNA) 2.6 2.1 χ10 ^δ x10 ⁶

2.2 χ10 ^δ

2.3 2.5 x ^{10 6} x ^{10 6}

1.9 χ10 ^δ

3.3 χ10 ^δ

1.7 χ10 0 ^{δ x} incubation at 4 ° C between DNA addition and pore opening ^xx incubation at 4 ° C between pore opening and start of expression

Table 2

Expression of tetracycline resistance of plasmid pBC16 after transformation of B. thuringiensis HD1 cryB. This strain was transformed from pBC16 plasmid DNA by pore opening according to the method of the invention. After various incubation times in LB medium at 30 ° C, transformed cells were selected on LB agar containing 20 gg / ml tetracycline.

Expression time resistance to tetracycline (H) frequency transformations, transformants / / pg DNA count live cell 0.5 0 4 x 10 ⁸ 1 1.6 x 10 ⁶ 10 ⁹ 2 8.8 x 10 ⁶ 1.4 x 10 ⁹ 3 8 x 10 ⁶ 1.6 x 10 ⁹

Table 3

Transformation of B. thuringiensis HD1 cryB by various plasmids plasmid origin of resistance marking ^ · gram-negative gram-positive frequency of transformations ²

naturally occurring plasmids

pBC16 B. cereus tc 1.9 x 10 ⁶ pub Staphylococcus aureus Km, Ble 3.3 x 10 ⁶ pC194 S. aureus cm 6 x 10 ⁶ pIM13 B. subtilis km 1.8 x 10 ⁵ modified plasmids / vectors on cloning pBD64 pUBUO replicon Km, Cm 5 x 10 ⁶ pBD347 pIM13 replicon cm 2.9 x 10 ⁵ pBD348 pIM13 replicon Em, Cm 1.1 x 10 ⁵ pUB1664 pUBUO replicon - Cm, Em 3.5 x 10 ⁴

bifunctional shuttle vectors pHV33 pBR322 / pC194 Amp, Tc Cm <50 ^x pK61 pUC8 / pBC16 Amp Tc 2.8 x 10 ⁴

Tc: tetracycline, Km: kanamycin, Ble: Bleomycin,

Cm: chloramphenicol, Em: erythromycin

The plasmid DNA is from B. thuringiensis HD1 cryB, except in cases designated by ^x , where it is from B. subtilis LBG4468

Table 4

B. thuringiensis HD1 cryB and HD1 cryB (pXI 93) bioassay against Heliothis virescens. Sporulated cultures, i.e. spores and optionally spray-dried protoxin crystals, were added to the L-1 Heliothis virescens larvae.

Concentrations of protoxin spores and crystals (Mg / g feed)

H. virescens death in%

HD1 CryB HD1 CryB (pXI93)

200

100

12.5

Table 5

Transformable strains of B. thuringiensis, B. cereus and B. subtilis. All strains were transformed with plasmid pBC16 by a pore opening procedure under the influence of an electric current strain transformation frequency

B. thuringiensis var. kurstaki HD1 cryB 1 HD1 dipel 0.25 HD1-9 0.9 HD73 0.1 HD191 0.5 B. thuringiensis var. thuringiensis HD 2-D6-4 13.8 B. thuringiensis var. israelensis LBG B-4444 2.6 B. cereus 569 K 7.5 B. subtilis LBG B-4468 0.00

Relative values based on transformation frequency var. kurstaki HD1 cryB equal to 1.

Storage of microorganisms

Of each of the microorganisms used in the process of the present invention, there were. deposited culture in the internationally recognized collection of cultures Deutschen Sammlug von Microorganisms, Braunschweig, Germany, according to the requirements of the Budapest Treaty for the storage of microorganisms for patent purposes. The same collection is issued to confirm the life of the stored samples.

The designation of plasmids pK in the priority document was changed to the recognized designation pXI in applications later filed abroad.

Also, the designation of the asporogenic mutant B. thuringiensis HD1 used in the Examples has been changed from the original designation cryS to the recognized designation cryB.

Stowage of micro-organisms The micro-organism shall not store the date of issue of the durability certificate

HB 101 (pK36)

(E. coli HB101 transf. DSM 3667 07/03/1986 DNA of plasmid pK36) 03/04/1986 ^X HD1 cryS (B. thuringiensis var. Kurstaki HD1 cryS) 04/05/1988 DSM 4574 04/05/1988 ^X HD1 cryS ( ^x pK 61) B. thuringiensis HD1 cryfi transf. DNA ^x pK93 04/05/1988 DSM 4572 4.5,1988 ^X HD1 cryS ( ^x pK 93) B. thuringiensis HD1 cry6 transf. DNA ^ 1 (93 04/05/1988 DSM 4571 04/05/1988 569 K {Bacillus cereus 569 K) 04/05/1988 DSM 4575 04/05/1988 569 K ( ^x pK 93) (B. cereus 569 K, transfected DNA ^ 1 (93) 04/05/1988 DSM 4573 04/05/1988

T / AWfyM

Claims (91)

PATENT CLAIMS A method of direct, targeted and reproducible genetic manipulation of Bacillus thuringiensis and / or Bacillus cereus using recombinant DNA technology, characterized in that suitable DNA is isolated and transformed into Bacillus thuringiensis and / or Bacillus cereus by means of a simple transformation procedure, wherein the transformation of Bacillus thuringiensis and / or Bacillus cereus is carried out in such a way that: (a) prepare a cell suspension of suitable cell density in a culture medium suitable for the cultivation of Bacillus thuringiensis or Bacillus cereus cells, with sufficient aeration for their growth, b) cells are separated from the medium and resuspended in inoculation buffer suitable for subsequent electrical opening of pores c) adding a DNA sample at a concentration suitable for opening the pores by electric current, preferably at a concentration ranging from 1 µg to 2 µg, d) the mixture prepared in steps b) and c) is transferred to an electric pore opening device, (e) the capacitor is discharged for a short time one or more times, generating a strong electric field for a short period of time sufficient to transform Bacillus thuringiensis and / or Bacillus cereus cells with recombinant DNA; (f) the cells are further incubated, if appropriate, after the pores have been opened by electric current, g) the cells so treated are plated on a suitable selection medium and then plated h) separating the transformed cells. Method according to claim 1, characterized in that spores of Bacillus thuringiensis are used to prepare the cell suspension according to claim 1, paragraph a). Method according to claim 1, characterized in that deep-frozen Bacillus thuringiensis and / or Bacillus cereus cells are used for the preparation of the cells according to claim 1 (a). Method according to claim 1, characterized in that Bacillus thuringiensis or Bacillus cereus cells are used for culturing the cells. (a) a complex nutrient medium containing a readily usable carbon and nitrogen source, as normally used for the cultivation of Bacillus aerobic strains; and, where appropriate, the vitamins and necessary metal ions, or fully synthetic or semi-synthetic nutrients, environment ktoobsahuj e b -] _) complex or a defined source of carbon and nitrogen, which can be easily used, or a combination of these sources, and b ₂₎ essential vitamins and metal ions. Method according to claim 1, characterized in that a suspension of Bacillus cells having an optical density in the range of 0.1 to 1.0 is prepared. The method according to claim 1, characterized in that an osmotically stabilized phosphate buffer is used as the electrolyte pore opening. Method according to claim 6, characterized in that the phosphate buffer contains sugars or sugar alcohols as a stabilizing agent. Process according to Claim 7, characterized in that sucrose is used as a stabilizing agent in a concentration of M3 of 1-1.0 M. Process according to claim 6, characterized in that a phosphate buffer with a pH of 5.0 to 8.0 is used. Method according to claim 1, characterized in that the Bacillus cells are incubated before, during or after pore opening under the action of an electric current at a temperature ranging from 0 ° C to 35 ° C. Method according to claim 1, characterized in that the Bacillus cells are incubated before, during or after pore opening under the action of an electric current at a temperature ranging from 2 ° C to 15 ° C. Method according to claim 1, characterized in that Bacillus cells are incubated before, during or after pore opening under an electric current at a temperature in the range of 2 ° C to 15 ° C and a DNA vector is used as the DNA sample. Method according to claim 1, characterized in that during the opening of the pores by electric current, bacterial cells are exposed in the cell suspension containing DNA for a short time to a capacitor discharge, generating a very strong electric field in the short term, thereby increasing the permeability of Bacillus thuringiensis or Bacillus cereus to the extent that the DNA present in the suspension is incorporated into Bacillus cells. Method according to claim 13, characterized in that an electric field with an intensity of 100 V / cm to 10 000 V / cm is created when the pores are opened by the action of an electric current. Method according to claim 13, characterized in that the electric field intensity values are from 100 V / cm to 50 000 V / cm. 16. The method of claim 1, wherein the decrease in exponential, which expresses the course of the pulse through which Bacillus cells are processed in suspension, ranges from 2 to 50 ms. 17. The method of claim 1, wherein the cells, after opening the pores under electric current and after a suitable time of subsequent incubation, are plated onto solid culture media containing the additive suitable for allowing selection of transformed Bacillus cells. Method according to claim 17, characterized in that an antibiotic selected from the group consisting of tetracycline, kanamycin, chloramphenicol and erythromycin is used as an additive suitable for enabling the selection of Bacillus thuringiensis and optionally Bacillus cereus. Method according to claim 17, characterized in that a chromogenic substrate is used as an additive suitable for allowing the selection of Bacillus thuringiensis and optionally Bacillus cereus. 20. The method of claim 1, wherein the recombinant DNA used to transform Bacillus thuringiensis and optionally Bacillus cereus is of homologous or heterogeneous origin, or is a combination of homologous and heterologous DNA. 21. The method of claim 1, wherein the recombinant DNA used for transformation comprises one or more structural genes as well as control sequences in the 3 ' and 5 regions that are functional in Bacillus thuringiensis or in Bacillus cereus or both. of these microorganisms, wherein the control sequences are operably linked to the structural gene or structural genes and thereby ensure expression of the structural gene or structural genes in Bacillus thuringiensis or in Bacillus cereus, or both. 22. The method of claim 21, wherein the expression signals are naturally occurring in Bacillus thuringiensis or Bacillus cereus or both, or are mutants and variants of these natural expression signals that are substantially native to the sequence. homologous. The method of claim 22, wherein the expression signals comprise a sporulation-dependent promoter from Bacillus thuringiensis. 24. The method of claim 1, wherein the structural gene encodes an δ-endotoxin polypeptide that naturally occurs in Bacillus thuringiensis or a polypeptide that is substantially homologous thereto, that is, it is at least substantially insecticidal. properties of the crystalline δ-endotoxin polypeptide from Bacillus thuringiensis. The method of claim 24, wherein the DNA sequence encoding the δ-endotoxin is homologous to substantially at least a portion or portions of the natural sequence encoding the δ-endotoxin that is or is causing the insecticidal effect. 26. The method of claim 25, wherein the polypeptide is substantially homologous to an δ-endotoxin polypeptide from suitable Bacillus thuringiensis subgroups selected from B. kurstaki, B. berliner, B. alesti, B. sotto , B. tolworthi, B. dendrolimus, B. tenebrionis, and B. israelensis. 27. The method of claim 25, wherein the DNA sequence encoding the δ-endotoxin is a DNA fragment from Bacillus thuringiensis var. kurstaki HD1, located between nucleotides 156 and 3623 of the sequence depicted in Figure 10, or any shorter DNA fragment that still encodes a polypeptide with insecticidal properties. The method of claim 20, wherein the DNA vector is a DNA vector. 29. The method of claim 28, wherein the DNA vector is a plasmid DNA. Method according to claim 28, characterized in that a DNA vector which is derived from the phage DNA is used. Method according to claim 20, characterized in that bifunctional vectors which, in addition to Bacillus thuringiensis or a closely related Bacillus cereus or both, are capable of replicating in one or more other heterologous production organisms are used as recombinant DNA, and which are identifiable in both homologous and heterologous production systems. Process according to claim 31, characterized in that they are used as heterologous production organisms (a) prokaryotic organisms selected from the family Bacillus, Staphylococcus, Treptococcus, Streptomyces, Pseudomonas, Escherichia, Agrobacterium, Salmonella, Erwinia, etc. or (b) eukaryotic organisms, selected from the group consisting of yeast, animal and plant cells, etc. 33. The method of claim 32, wherein the heterologous production organism is E. coli. 34. The method of claim 21, wherein the method is: a) isolate structural genes, (b) optionally, the isolated genes are operably linked to expression sequences that are functional in Bacillus thuringiensis or Bacillus cereus (c) the genetic constructs of paragraph (b) are transformed into Bacillus thuringiensis or Bacillus cereus cells using appropriate vectors; and d) optionally expressing the corresponding gene product and optionally isolating the product. 35. The method of claim 34, wherein the gene is a protoxin gene from Bacillus thuringiensis. 36. The method of claim 34, wherein expression sequences comprising a sporulation-dependent promoter from Bacillus thuringiensis are used. The method of claim 34, wherein the vector is used for direct cloning. by A method according to claim 34, characterized in that bifunctional so-called Shuttle vectors are used. 39. The method of claim 34, wherein, instead of genes, otherwise useful DNA sequences are inserted into the Bacillus cells and cloned there. 40. The method of claim 21, wherein the method is: (a) digest all of the Bacillus thuringiensis DNA by treatment with appropriate restriction enzymes; b) fragments of appropriate size are isolated from the resulting restriction fragments (c) the fragments are inserted into an appropriate vector; d) Bacillus thuringiensis and Bacillus cereus cells, respectively, are transformed with the vector e) isolating new DNA sequences from the transformants by a suitable screening method. 41. The method of claim 40, wherein the novel gene is a protoxin gene. The method of claim 40, wherein direct cloning vectors are used. 43. The method according to claim 40, characterized in that bifunctional, so-called bifunctional, &quot; Shuttle vectors. 44; Method according to claim 40, characterized in that an immunological sorting method is used to select new DNA sequences. The method of claim 31, wherein Bacillus thuringiensis var. Kurstaki HD1 cryB is transformed using the bifunctional vector pXI61 (pK61) deposited under DSM number 4572. 46. The method of claim 31, wherein Bacillus thuringiensis var. kurstaki HD1 cryB transforms with the bifunctional vector pXI93 (pK93) deposited under DSM 4571. 47. The method of claim 31, wherein Bacillus cereus 569K is transformed using the bifunctional vector pXI93 (pK93) deposited under DSM number 4573. 48. Bifunctional vectors which, in addition to B. thuringiensis or a closely related B. cereus or both, are capable of replicating in one or more other heterologous production organisms and which are identifiable in both homologous and heterologous production systems . 49. The bifunctional vectors of claim 49, wherein the heterologous production organisms are (a) prokaryotic organisms selected from the group consisting of Bacillus, Staphylococcus, Streptococcus, Streptomyces, Pseudomonas, Escherichia, Agrobacterium, Salmonella, Erwinia and the like, or b) eukaryotic organisms selected from the group consisting of yeast, animal and plant cells and the like. 50. The bifunctional vectors of claim 49, wherein the heterologous producer organism is E. coli. 51. The bifunctional vectors of claim 48, which consist of a DNA plasmid of homologous or heterologous origin that encodes at least partially the functions required for replication and selection in B. thuringiensis or a closely related B cereus or both, and also in at least one or more other heterologous production organisms. 52. The bifunctional vectors of claim 48, which consist of a plasmid DNA of pure heterologous origin. 53. The bifunctional vectors of any of claims 51 and 52, wherein: (a) a DNA homologous plasmid is DNA which is naturally present in, or substantially homologous to, B. thuringiensis or B. cereus, or both, or b) DNA heterologous plasmid is DNA naturally occurring in b1) prokaryotic organisms selected from the group consisting of Bacillus, Staphylococcus, Streptococcus, Streptomyces, Pseudomonas, Escherichia, Agrobacterium, Salmonella, Erwinia and the like, or b _{2 e} ) organisms selected from the group consisting of yeast, animal and plant cells, and the like, or DNA that is substantially homologous to said DNA. 54. The bifunctional vectors of claim 53, wherein the heterologous plasmid DNA is DNA that is naturally present in E. coli or substantially homologous DNA. 55. The bifunctional vectors of claim 48, which comprise one or more genes in the form. capable of expressing or other useful DNA sequences, in addition to functions essential for replication and selection in homologous and heterologous production systems. 56. The bifunctional vectors of claim 55, wherein said genes or other useful DNA sequences are of homologous or heterologous or synthetic origin, or optionally are a combination of said genes or said sequences. 57. The bifunctional vectors of claim 55, wherein said genes consist of one or more structural genes and, in the 3 ' and 5 ' regions, also of control chains functional in B. thuringiensis or B. cereus or both. organisms, wherein the chains are operably linked to the structural gene or structural genes to provide expression of the structural gene or structural genes in B. thuringiensis or B. cereus, or both. 58. The bifunctional vectors of claim 57, wherein said control chains are expression signals comprising a promoter strand, a terminator strand, and another control strand at the 3 'and 5' untranslated regions. 59. The bifunctional vectors of claim 58, wherein the expression signals are naturally occurring in B. thuringiensis or B. cereus, or both, or are mutants and variants of these natural expression signals that are with a natural sequence substantially homologous. 60. The bifunctional vectors of claim 59, wherein the expression signals comprise a sporulation-dependent promoter from B. thuringiensis. 61. The bifunctional vectors of claim 57, wherein said structural gene encodes a δ-endotoxin polypeptide that naturally occurs in B. thuringiensis or a polypeptide that is substantially homologous thereto, which means that it has at least substantially toxic properties of the crystalline B. thuringiensis δ-endotoxin polypeptide. 62. The bifunctional vectors of claim 57, wherein said structural gene is a DNA sequence that encodes a naturally occurring δ-endotoxin in B. thuringiensis, or a variant of a natural DNA sequence that is at least the corresponding natural sequence. essentially homologous. 63. The bifunctional vectors of claim 61, wherein said polypeptide is substantially homologous to a δ-endotoxin polypeptide of a suitable subgroup of B. thuringiensis, selected from the group consisting of kurstaki, berliner, alesti, sotto, tolworthi, dendrolimus, tenebrionis. and israelensis. 64. The bifunctional vectors of claim 62, wherein the δ-endotoxin DNA coding sequence is homologous to substantially at least part or parts of the natural δ-endptoxin coding sequence causing the insecticidal effect. 65. The bifunctional vectors of claim 61, wherein the δ-endotoxin DNA encoding sequence is a DNA fragment from B. thuringiensis var. kurstaki HD1, located between nucleotides 156 to 3623 in the sequence depicted in Figure 10, or a shorter DNA fragment that still encodes a polypeptide with insecticidal properties. 66. The bifunctional vector pXI61 (pK61), transformed into B. thuringiensis var. kurstaki HD1 cryB (DSM 4572). 67. The bifunctional vector pXI93 (pK93) transformed into B, thuringiensis var. kurstaki HD1 cryB (DSM 4571) and B. cereus 569 K (DSM 4573). 68. A production cell comprising the bifunctional vector of any one of claims 48 to 67. 69, characterized 69. The production cell of claim 68, which is a microorganism. 70. The production cell of claim 69, wherein said cell is a bacterium. 71. The production cell of claim 41, wherein said cell is E. coli. 72nd s a The production cell of claim 69, wherein said cell is B. thuringiensis or B.cereus. úCa 73. The producer cell of claim 68, wherein said producer cell is a eukaryotic cell selected from the group consisting of yeast, and resin and plant cells. 74. B. thuringiensis transformed using a bifunctional vector according to any one of claims 48 to 67. 75. B. thuringiensis using a bifunctional number under DSM 4572. 76. B. thuringiensis using a bifunctional number under DSM 4572. 77. B. thuringiensis using a bifunctional number under DSM 4571. var. kurstaki HD1 cryB transformed with pXI61 (kP61) vector, which was deposited var. kurstaki HD1 cryB transformed with the vector pXI93 (kP93), which was deposited var. kurstaki HD1 cryB transformed vector pXI93 (kP93), which was saved 78. B. cereus transformed using a bifunctional vector according to any one of claims 48 to 67. 79. B. cereus 569 K transformed using the bifunctional vector pXI93 (pK93) deposited under DSM number 4573. 80. Insecticidal by knowing the compositions or carriers hu is a composition characterized by commonly used carriers, dispersing and dispersing agents comprising B. thuringiensis or B.cereus cells or a mixture of these Bacillus cells transformed with a recombinant DNA molecule containing a structural gene, which encodes a δ-endotoxin polypeptide naturally occurring in B. thuringiensis, or a polypeptide substantially homologous thereto, or b) cell-free crystalline preparations containing protoxin produced by transformed Baccilus cells. 81. An insecticidal composition according to claim 80, characterized in that, in addition to commonly used carriers, dispersants or carriers and dispersants, it comprises insecticidal mixtures consisting of transformed, living or dead cells of B. thuringiensis and / or B.cereus according to paragraph a), as well as from cells without crystalline preparations containing a protoxin produced by the transformed Bacillus cells according to paragraph b). 82. An insecticidal composition comprising a) B. thuringiensis or B.cereus cells or a mixture thereof transformed with a bifunctional vector according to claims 48 to 67, or b) a cell-free crystalline composition containing protoxin produced by transformed Bacillus cells, together with commonly used carriers or dispersants or mixtures thereof. 83. An insecticidal composition according to claim 82, comprising insecticidal mixtures consisting of transformed living or dead cells of B. thuringiensis and / or BCereus according to paragraph a), and of cell-free crystalline compositions containing protoxin produced by the transformed cells. Bacillus according to paragraph b) together with commonly used carriers or dispersants or mixtures thereof. Use of the bifunctional vectors according to any one of claims 48 to 67 for the transformation of B. thuringiensis or B. cereus or both. Use according to claim 84 for the transformation of B. thuringiensis var. kurstaki HD1 cryB 86. Use of a) B. thuringiensis or B.cereus cells or a mixture of these cells transformed with a recombinant DNA molecule comprising a structural gene that encodes a δ-endotoxin polypeptide that naturally occurs in B. thuringiensis, or a polypeptide substantially thereof. or b) a cell-free crystalline composition comprising a protoxin produced by transformed Baccilus insect control cells. Use according to claim 86, wherein the insecticidal composition comprises transformed living or dead B. thuringiensis and / or B. cereus cells according to paragraph a) and such cell-free protoxin-containing crystalline compositions produced according to paragraph b) by transformed Baccilus cells. Use of a) B. thuringiensis or B. cereus cells or a mixture thereof transformed with a bifunctional vector according to any one of claims 48 to 67 optionally comprising a structural gene encoding a δ-endotoxin polypeptide naturally occurring in B. thuringiensis or a polypeptide. which is substantially homologous thereto; or b) a cell-free crystalline protoxin-containing composition produced by transformed Baccilus insect control cells. 89. The use of claim 88, wherein the insecticidal composition comprises transformed living or dead B. thuringiensis and / or B. cerus cells according to paragraph a) or a cell-free crystalline composition comprising protoxin produced according to paragraph b) by transformed Baccilus cells. Use according to any one of claims 86 to 89, wherein the insects are of the order Lapidoptera, Diptera or Coleoptera. • 91st Use according to claim 90, wherein the insect is of the order Lepidoptera.