NZ229191A

NZ229191A - Genetic manipulation of b.thuringiensis and b.cereus vectors and insecticidal composition

Info

Publication number: NZ229191A
Application number: NZ229191A
Authority: NZ
Inventors: Walter Schurter; Martin Geiser; Daniele Mathe
Original assignee: Ciba Geigy Ag
Priority date: 1988-05-20
Filing date: 1989-05-18
Publication date: 1992-04-28
Also published as: SK304489A3; PT90595A; AU3502089A; JPH02119780A; HU213302B; IE62833B1; FI892359A0; GB8911435D0; AR244805A1; KR900018374A; IL90334A0; PL279555A1; SK280300B6; KR0133924B1; PT90595B; KR19990011604A; DE58909762D1; EP0342633B1; AU638208B2; EP0342633A3

Description

<div class="application article clearfix" id="description"> 210:31 ,. ,2.0 • o.-e>8 , : ..^r..7.5rj.j..2-rfT.)■ •'• • r..j j Cornr*'—> «!',.o::,fl;:2lion Fi!cJ: ..!.'SI C'fiss: (5) CJ.Z*./^vU.Oy..7n A O. J.CM. U.3.1&.X. | : 58 mm [ ioi'Cc*?!on *• -**'«?: | ' • ■ X Patents Form No. 5 NEW ZEALAND PATENTS ACT 195 3 COMPLETE SPECIFICATION 3ACILLUS TfiURIMGIiMSIS TRANSFORMATION %/We , CIBA—GEIOY AG/ A Swiss Cocporac ion, of Xlybeckstrassa 141, 4002 3asle, ' ■ fV>>v. V '' -h \ SWIT2ERLAND /' °\ ''r •■>... -I * , . . r . J . "• •>•;/•/ hereby declare the invention, tor which ^/ve pray that a patent may be granted to ^/us, and the method oy which it is to be performed, to be particularly described in and by the following statement: (followed by page la) - la- 5-17033/1-3/= 3acillus thuringiensis transformation The present invention describes a process that for the first time renders possible a direct and targeted genetic manipulation of 3acillus thuringiensis and the closely related 3. cereus using recombinant DMA technology, based on an efficient transformation process for the said 3acillus species. The present invention furthermore relates to the construction of plasmids and "shuttle" vectors and to the 3. thuringiensis and/or 3. cereus strains that "nave been transformed therewith. The present invention also relates to a process for inserting and, if desired, expressing genes or other useful DNA sequences in 3acillus thuringiensis and/or 3acillus ;ereus, but especially to a process for inserting and expressing protoxin genes. The present invention also includes a process for the direct cloning and, if desired, expression and identification of novel genes or other useful DNA sequences in 3acillus thuringiensis and/or 3acillus cereus, as a result of which it is possible for the first time to establish gene banks directly in 3acillus thuringiensis and/or 3acillus cereus and to express them therein. 3acillus thuringiensis belongs to the large group of gram-positive, aerobic, endospore-forming bacteria. Unlike the very closely related species of 3acillus, 3. cereus and 3. anthracis, the majority of the hitherto known 3. thuringiensis species produce in the course of their sporulation a parasporal inclusion body which, on account of its crystalline structure, is generally referred to also as a crystalline body. This crystalline body is composed of insecticiaally active crystalline protoxin proteins, the so-called o-endotoxin. (folLwoed by pace 2) These protein crystals are responsible for the toxicity to insects of B. thuringiensis. The 5-endotoxin does not exhibit its msecticidal activity until after oral intake of the crystalline body, when the latter is dissolved in the alkaline intestinal juice of the target insects and the actual toxic component is released from the protoxin as a result of limited proteolysis caused by the action of proteases from the digestive tract of the insects. The <5-endotoxins of the various 3. thuringiensis strains are distinguished by high specificity with respect to certain target insects, especially with respect to various Lepidoptera. Coleoptera and Diptera larvae, and by their high degree of activity. Further advantages in using 6-endotoxins of 3. thuringiensis reside in the obvious difficulty that the target insects have in developing resistance to the crystalline protein and in the fact that the toxins are harmless to humans, other mammals, birds, fish and insects, with the exception of the above-mentioned target insect s. The insecticidal potential of B. thuringiensis protoxins was recognised very early on. Since the end of the twenties 3. thuringiensis preparations have been used as bioinsecticides for controlling various diseases caused by insects in cultivated plants. With the discovery of 1) 3. thuringiensis var. israelensis by " Goldberg and Hargalit (1977) and 2) 3. thuringiensis var. tenebrionis by " \rieg et al. (1983) it was possible for the range of use of 3. thuringiensis to be extended even to mosquito and beetle larvae. With the introduction of genetic engineering and the new possibilities resulting from it, the field of 3. thuringiensis toxins has received a fresh impetus. For example, the cloning of o-endotoxin genes in foreign host organisms, such as, for example, in Z. coli, is already routine. The result of this, meanwhile, has been that the DNA sequences of a whole series of - 3 - 2^_2 o-enciocoxin genes are now known Whiteiey H.R., 1931; ^Klier A. ^Haider M.Z. e: al., 1937). Most of the 3- thuringiensis species contain several genes that code for an insecticidally active protein. These genes, which are expressed only during the sporulacion phase, are in the majority of cases located on large transferable plasmids (30 - 150 Md) and can therefore very easily be interchanged between the various 3. thuringiensis strains and between 3. thuringiensis and ft. cereus, provided these are compatible ( ^Gonzale: J..H. et al., 1932). The protoxin genes of 3. thuringiensis var. kurstaki belong to a family of related genes, various of which have already been cloned and sequenced. This work has been carried out especially in an Z. co1i cloning system. The cloning of 3. thuringiensis genes has thus so far essencially limited to some few and exclusively heterologous host systems, of the Z ■ co li system is the best researched and understood. In the meantime, however, reports have also been published on the successful cloning and expression of protoxin genes in other hose U) systems, such as, for example, m 3. subtilis ( Klier et al., 1982), 3) Pseudomonas fluorescens ( Obukowic; M.G. et al., 1986), and Saccharomvces cerevisiae (Z? 0 2 38 i^l). The insertion and expression of the 5-endotoxin gene in plant host cells has also been successful 1 (Z? 0292 435) . ' f ' 9 Of c In cloning in Z. coll. advantage is taken of the racc that some protoxi,^ genes happen to contain, in addition to gram-positive promoters, also an x Z. coli-like promoter. These promoter-like DNA sequences make it possible for the 3. thuringiensis protoxin genes to be expressed also in heterologous host systems, provided these are capable of recognising the above-mentioned control sequences. 3) ffor example Sc'nnepf H.E. and et al., 1982; '^Geiser M. et al., 1936; been which 191 Afcer breaking open che hose cells, che expressed procoxm proceins can chen be isolaced and idencified using known mechocs. Ic has since been demons c raced, however, chac £■ coli-like promocers are 9) noc presenc in all procoxm genes ( Donovan ec al., 1933), and consequencly so far only very specific protoxin genes chat meet che above-mencioned prerequisices can be expressed and chus idencified in hecerologous hose systems. The cloning of genes outside che natural hose organism and che use of chese strains as bioinseccicides in praccice is chus associated uich a number of disadvancages , some of which are serious: a) Expression of 3. churingiensis procoxin genes from che nacive expression sequences is possible only in cercain cases. b) Generally c'nere is no, or only a slighc, secretion of expressed foreign proceins. c) Correcc folding of the 6-endocoxins is noc always guaranteed in che reducing medium of heterologous hose cells, and chis could result: m an undesirable change in che specific accivicv or in che hose range of che toxins. d) If expression occurs at all. che expression rates of che cloned foreign genes among che nacive expression sequences are moscly only low. 3),10)schnepf and Whitley (1981; 1985) escimace chac che 3. churingiensis Coxin cloned in E ■ coil conscicutes only 0.5 % Co 1 o of che cocal cell procein of E ■ coIi. whereas che cryscalline procein in 3. churingiensis amouncs co between 30 '"o and ^0 % of che dry weight of sporulacing cultures. These considerable discrepancies becween the expression rates y . may possibly be attributed to the lack of sporulation-specific control ' '■ • signals in the hecerologous hose syscems and Co difficulcies in che recognicion of che 3. churingiensis promocers and/or Co problems in che post-e ranslacional modificacion of e'ne coxin molecule by che foreign host. '• / • »r *• ' » r 1* A - r i ■/ A 2 L j j. 01 e) Many of che nose scrams generally used for expression are toxicologically noc as harmless as 3. churingiensis and 3• cereus. f) 3. churingiensis and 3. cereus form a nacural major component of microbial soil flora, which is noc crue of mosc of che hose scrains generally used for expression. The problems and difficulties mentioned above could be overcome if che said 3. thuringiensis genes could be cloned directly in the homologous host system where ic is possible to use che nacural gram-posicive promoters of the protoxin genes for che expression. As yet, however, c'nere is no process that would make 3. churingiensis. this very important bacterium from the commercial point of view, amenable to direct genetic modification, and that would consequently render possible, for example, efficient reinsertion of a cloned protoxin gene into a 3. thuringiensis strain. The reason for this can be regarded, in particular, as being che fact chac che development of an efficienc transformation system for 3. thuringiensis and the closely related 3. cereus chac would ensure adequacely high cransformacion rates and consequently render possible the application also to 3. thuringiensis of established rDNA techniques has noc as yec been successful. The processes used so far Co produce new 3. churingiensis scrains having Successful reinsertion of a cloned 3. churingiensis cryscalline procein suicable cransformacion syscem tor 3. churingiensis. ic was necessary to resort to transfer by conjugation between 3. subcilis and 3. churingiensis. Furthermore, in this process described by \lier et al. E. coli is used as intermediate host. novel inseccicidal properties are based chiefly on transfer by conjugation of plasmid-encoded protoxin genes. gene into 3. churingiensis has co dace been described only in one case (^^Klier A. ec al., 1 983), but in that case too, owing to the lack of a - 5 - 2l O ' The processes of transfer by conjugation, however, 'nave a whole series of serious disadvantages that makes them appear unsuitable for routine use for che genetic modification ot 3. thuringiensis and/or 3. cereus. a) The cransfer of plasmid-encoded protoxin genes by conjugation is possible only between 3. thuringiensis scrains and between 3. cereus and B. churingiensis scrains that are compatible wich one another. b) Vith transfer of plasmids by conjugation between more distant scrains, often only a low transfer frequency is achieved. c) There is no possible way of regulating or modifying che expression of che procoxin genes. d) There is no possible way of modifying che gene itself. e) If several protoxin genes are presenc in one strain che expression of individual genes may be greatly reduced as a result of che so-called gene-dosage effect. f) Instabilities may arise as a result of a possible homologous recombination of related procoxin genes. Alcernacive transformation processes, which have since been used routinely for many gram-positive organisms, nave proved unsuitable boch for 3. churingiensis and for 3. cereus. One of che above-mentioned processes is, for example, che direcc cransformacion of baccerxai protoplasts by means of polvechylene glycol treatment, which has been used successfully in che case of many 12). Streocomyces strains (* 3ibb J.J. ec al., 1978) and in the case of 3. subtilis ( J Chang S. and Cohen S.N., 1979), 3. megacerium I u ) ( 3rown 3.J. and Carlton 3.C., 1980), Screpcococcus lactis (^^Kondo J.K. and McKay L.L., 198^0, S. faecalis ( ° Virch R. ec al.) , Co rynebac cerium glucamicum ^Yos'ninama M. ec al. , 1985) and numerous ocher gram-positive bacteria. - ; . 2l.„: To use chis process, che bacterial ceils nus: first of ail be converted to protoplasts, chac is co say che cell walls are digested using lytic enzymes. Another prerequisite for the success of this direct transformation process is che expression of che newly introduced genetic information and che regeneration of the transformed protoplasts on complex solid media before successful transformation can be dececced, for example using a seleccable marker. This cransformacion process has proved unsuicable for 3- thuringiensis and the closely related 3. cereus. As a result of the high resistance of B. thuringiensis cells to iysosyme and che very poor regenerability of che protoplasts co incact cell wall-containing ceils, che races of cransformacion achievable remain low and difficulc Co reproduce 131 1 9) ( Allkhanian S.J. ec al., 1981; * Ma rein ?.A. et al., 1931; 20) Fischer H-M et al., 193^). With chis process ic is possible cherefore, at the most, for very simple plasmids, which are unsuitable for work with recombinant D.N'A, to be inserted at a low frequency into 3. churingiensis or 3. cereus cells. Individual reporcs on satisfactory rates of transformation that it has been possible Co achieve using che afore-described process rely on che formuiacion of very complex optimising programmes, but these programmes are always applicable specifically Co one particular 3. thuringiensis strain only and involve high expenditure in terms of time and money 21) (~ Schall D., 1935). Such processes are therefore unsuitable for routine aDolication on an industrial scale. As the intensive research work in the field of 3. thuringiensis genetics demonstrates, there is subscantial interest in developing new processes that would make 3. churingiensis or the closely related 3- cereus - amenable to direct genecic modification and would chus, for example, t ' ' L. .. i I.... render possible the cloning of procoxin genes in che nacural hose syscem. Despice chis research chere are still no satisfactory solutions co che existing difficulties and problems. Suitable cransformacion processes chac render possible a rapid, efficient and reproducible cransformacion of 3. thuringiensis and/or 3. cereus w1ch an adequately high transformation frequency are not available currently, and neither are suitable cloning vectors that permit the application also to 3. thuringiensis of the recombinant DNA techniques already established for other bacterial host systems. The same is true tor 3■ cereus. This object has now surprisingly been achieved wichin che scope of che presenc invention by the use of simple process steps, some of which are known. The present invention thus relates co a novel process, based on recombinanc DNA cechnology, chat for the first time renders possible a direct, specifically controlled and reproducible genetic manipulation of 3. thuringiensis and of 3. cereus by transforming 3acillus churingiensis and/or 3acillus cereus wich high efficiency by means of a simple transformation process using a recombinant DNA thac is suitable for the said genetic manipulation of Bacillus thuringiensis and/or 3acillus cereus. The presenc invention furthermore relates to a process for inserting, cloning and expressing genes or ocher useful DNA sequences, but especially procoxin genes, in 3. thuringiensis and/or B. ce reu s, which comprises: a) isolating the said genes or DNA; b) if desired operably joining the isolated genes or DNA to expression sequences that are capable of functioning in 3acillus thuringiensis and/or 3. cereus; f c) introducing the genetic constructs from section b) into 3acillus churingiensis and/or 3. cereus cells by transformation using suitable vectors; and d) if desired expressing a corresponding gene product and, if desired, isolating it. - 9 - The present invencion also includes a direcc process for cloning, expressing and identifying genes or ocher useful DNA sequences, buc especially procoxin genes, in 3. churingiensis and/or 3 ■ ce reu s. ■-•hich comprises: a) digescing che cotal DNA of 3ac11lu s churingiensis using suicable restriction eniyines; b) isolating from che resulting rescriction fragments chose of suitable size; c) inserting che said fragments into a suicable veccor; d) transforming Bacillus thuringiensis and/or 3- cereus cells with the said vector; and e) locating novel DNA sequences using suitable screening methods and, if desired, isolating them from che transformancs. Apart from structural genes ic is obviously also possible for any ocher useful DNA sequences co be used in che process according co the invention, such as, for example, non-coding DN'A sequences chat have a regulatory function, such as, for example, "anti-sense DNA". The process of che invention thus opens up a large number of new possibilities that are of extraordinary incerest from both scientific and commercial points of view. For example, it is now possible for che first time to obtain information on a genetic level about the regulation of i-endocoxin synthesis, especially in respect of sporulation. Also, it should now be possible to clarify at which position of the toxin molecule the region(s) responsible for the toxicity to insects is (are) located, and to what extent chis (these) is (are) also associated with the host specificity. r f . - 10 - Knowledge of che molecular organisation of che various coxin molecules and of che coxin genes coding for chase molecules from che various species of 3- churingiensis is of extraordinary practical interest for a controlled genetic manipulation of those genes, which is now possible for the first time using che process of che invention. In addition Co a concrolled modificacion of che o-endoCoxin genes themselves, the novel process of the invention permics also che manipulation of che regulacory DNA sequences controlling the expression of chose genes, as a result of which the specific properties of the o-endotoxins, such as, for example, their host specificity, their resorption behaviour inter alia, can be modified in a specifically concrolled manner, and the production rates of the 5-endotoxins can be increased, for example by the insertion of stronger and more efficient promoter sequences. 3y specifically controlled mutation of selected genes or subgenes in vitro it is thus possible to obtain new 3. thuringiensis and/o r 3. cereus variants. Another possible way of constructing novel 3. thuringiensis and/or 3. cereus variants comprises splicing together genes or portions of genes Chat originate from differenc 3. thuringiensis sources, resulcing in 3. thuringiensis and/or 3. cereus scrains wich a broader speccrum of use. Ic is also possible for synchecicaliy or semi-synchecically produced Coxin genes Co be used in chis manner for conscruccing new B- thuringiensis and/or 3. cereus varieties. In addicion, che process according co the invention renders possible for the firsc cime, as a result of the pronounced increase in the cransformacion frequency and the simplicity of the process, the establishment of gene banks and the rapid screening of modified and new genes in 3. churingiensis and/or 3. cereus. - 11 - O' (J kJ In particular, che process of che invencion now for che firsc ::me renders possible direct expression of gene banks in 3. churingiensis and/or 3. cereus and che idencificacion of new procoxin genes in B. churingiensis using known, preferably immu noIo gic a I or biological processes. The subject: of che presenc invencion is accordingly a process, based on a pronounced increase in che efficiency of 3. churingiensis/3• cereus Cransformacion compared with known processes, chac for che firsc cime renders possible a direct generic modification of che 3. churingiensis and/or 3. cereus genome. In particular, che presenc invencion relates to a process for the transformation of 3- thuringiensis and/or 3. cereus by inserting recombinant DN'A, especially piasrnid and/or vector DNA, inco 3. thuringiensis and/or 3. cereus ceils by means of eleccroporacion. Preferred is a process for che cransformacion of 3. churingiensis and/or B. cereus wich DNA sequences coding for 5-endocoxin and DN'A sequences coding for a protein chac has subscancially che insecc-coxic propercies of the said 3. churingiensis toxins. The presenc invention also relates to the expression of DNA sequences chac code for an 5-endocoxin, or for a procein chac ac lease has substantially che insecc-coxic propercies of che 3. churingiensis toxin, in transformed 3. churingiensis and/or 3. cereus cells. The present invention also includes a process for the production of bifunctional vectors, so-called "shuttle" vectors, for 3. thuringiensis and/or 3. cereus . and che use of the said "shuccie" veccors for che cransformacion of 3- churingiensis and/or 3. cereus ceils. Preferred is the conscruccion of bifuncCional vectors chac in addicion to replicating in 3. churingiensis and/or 3. cereus also replicace in one or more other heterologous host systems, but especially in Z. coli cells. ^*s f. oi ~ ! ni ^Wt/ JL. v/ -L The presenc invention relates especially co a process for che production of "shuttle" vectors for 3. thuringiensis anc/or 3. cereus that contain a DN'A sequence coding for a 6 -enco toxin polypeptide chac occurs naturally in 3. thuringiensis. or at least a polypeptide that is substantially homologous therewith, that is to say that ac least has substantially the insect-toxic properties of the 3. thuringiensis toxin. The presenc invention also includes the use of these "shuttle" vectors for the transformation of 3. thuringiensis and/or 3. cereus cells and the expression of che DNA sequences presenc on the said "s'nuccle" vectors, especially those DNA sequences chat code tor a 5-endotoxin of 3. thuringiensis or at least for a procein thac has subscancially the insecc-coxic properties of che 3. thuringiensis toxins. The present invention also includes the use of 3. thuringiensis and/or 3. cereus as general host organisms for cloning and expressing homologous and especially also heterologous DN'A, or a combination of homologous and heterologous DN'A. This invention also relates to the above more closely characterised plasmids and "shuttle" vectors themselves, to the use thereof for the cransformacion of 3. churingiensis and/or 3. cereus, and to 3. churingiensis and 3. cereus cells thac have been transformed with them. Especially preferred within the scope of this invention are the bifunctional ("s'nuccle") veccors pXIol (=pK51) and pXl93 (=pK93) which, incroduced by transformation inco 3. thuringiensis var. kurstaki HDlcry3 and inco 3. cereus 559K. have been deposited at the "DeuCsche Sammlung von Mikroorganismen" (3raunschweig, Federal Republic of Germany), recognised as an Incernacional Deposicory, in accordance with che 3udapesc Treacy under che number DSM 4573 (pXlSl, incroduced by cransformacion inco 3. churingiensis var. kurscaki HDlcry3) and DSM 4571 (pXl93, incroduced by transformation inco 3. churingiensis var. kurscaki HDlcry3) and DSM 4573 (pXI93, incroduced by cransformacion inco 3. cereus /"S I 3 - The presenc invention relates especially co novel 3. churingiensis and 3. cereus varieties chac nave been transformed *-ich a DNA sequence thac codes for a 5-endocoxin of 3. churingiensis and chac can be expressed, or transformed vi ch a DNA sequence coding for ac lease one procein chat has substantially the toxic propercies of che 3. churingiensis coxins. The cransformed 3. thuringiensis and B. cereus cells and the toxins produced by them can be used for che preparacion of insecticidal compositions, to which che presenc invention also relates. The invent ion also relates co me chods of, and to compositions for, controlling inseccs using che above more closely c'naracCerised transformed 3. churingiensis and/or 3. cereus cells or a cell-free crystalline body-( 5-endo coxin) preparacion concaining proCoxins produced by the said cransformed 3aclllus cells. The following is a brief descripcion of che Figures: Figure 1: Transformation of £. coli H3 101 wich pBR322 (o) and *B. thurineiensis HDicry3 wich p3C16C *) (^number of surviving *HDlcryB cells). Figure 2: Influence of che age of a *3. churingiensis HDlcryB culture on the transformacion frequency. Figure 3: Influence of che p'ri value of che ?3S buffer solution on the transformation frequency. Figure 4: Influence of che saccharose concentration of the P3S buffer solution on the transformation frequency. Figure 5: Interdependence of che number of transformants and the amount of DNA used per transformacion. f 1 - \u - 91 Figure 5: Simplified restriction map of che "shuttle" vector *pX!51. The shaded region characterises the sequences originating from the gram-positive p3Clo, the remainder originating from the gram-negative plasmid pliC3. Figure 7: Simplified restriction map of *pXI93. The shaded region characterises the protoxin structural gene (arrow, Kur'ndl) and the 5' and 3' non-coding sequences. The remaining unshaded part originates from the "shuttle" vector "*pXI51. Figure 3: SDS (sodium dodecyl sulfate)/polyacrylamide gel electrophoresis of extracts of sporulating cultures of *3- thuringiensis HDlcry3, 3. cereus 569K and their derivatives. [1: *HDlcryB (pXl93), 2: *HDlcry3 (pXIol), 3: *HDlcry3, 4: HD1. L3G 3-4449, 5: *3. cereus 569K (pXI93), 5: 569K] a) Comassie-dved. M: molecular weight standard, MV: molecular weight (Dalton), arrow: position of the 130,000 Dalton protoxin. b) Western blot of the sane gel, to which there have been added polyclonal antibodies to the K-l crystalline protein of 3. thuringiensis HD1 . Positive bands were found with che aid of labelled anti-goat antibodies. Arrow: position of the 130,000 Dalton protoxin. Other bands: degradation products of the protoxin. Figure 9: Transformacion of 3. subcilis L3G 3-4463 with pBCIS plasmid DNA using the electroporation process optimised for 3. thuringiensis. (o: transformants/vig plasmid DNA; •: number of living bacteria/ml) * The internal reference pK selected for the nomenclature of the plasmids in the priority document has been replaced for the Auslandsfassung (foreign filing text) by the officially recognised designation pXI. Also, the names for the the Embodiment Examples asporogenic 3. thuringiensis HD1 mutants used in have been changed from cryij Co cry3. ; /ps£(>v pi ■ i - , - 15 - rx i • , U O JL An essential aspect of che presenc invencion concerns a novel cransformacion process for 3. churingiensis and 3■ cereus based on che insercion of plasmid D.VA inco 3 ■ chu r mgiens i s and / or 3. cereus cells using e lec C ropo ra t ion technology, which is knovn per se. All attempts up co che Cime of che present invencion to apply che transformacion processes already escablished for ocher bacterial host syscems Co 3. churingiensis and che closely relaced 3. cereus naving been fruscrated, ic is nou possible vichin che scope ot chis invencion co achieve surprising success using eleccroporacion cec'nnology and accompanying seeps. This success muse also be considered surprising and unexpecCed, especially since eleccroporacion cescs •-•ich 3. churingiensis procoolascs were ■ 2!! J carried ouc ac an earlier dace by a Soviec group (" ~ S'nivarova N. ec al., 1 933), but che cransformacion frequencies achieved were so low chac chis process was subsequencly regarded as unusable for 3. churingiensis cransformacion and consequently received no furcher attention. Building upon mvescigacions inco che process parameters cricical for an eleccroporacion of 3. churingiensis and/or 3. cereus cells, ic has now surprisingly been possible co develop a cranscormacion process chac is ideally adapCed co che requiremencs of 3. churingiensis and 3. cereus and results in cransformacion races ranging from 10s co 10s cells/;_ig of plasmid DNA, buc especially from 105 co 10' cells/jig of plasmid DNA. Roughly equally high transformation races wich values from 10: co a maximum of 105 cransfo rmancs/;ig of plasmid DN'A could hicherco be achieved only with che PEG (polyechvlene glycol) cransformacion process described 7 1) by " Schall (1986). High cransformacion races remained rescricced, however, co chose 3. churingiensis strains for which che PEG process was specifically adapced in very cime-consuming opcimisacion scudies, which makes this process appear unsuicable for practical use. Furthermore, che reproducibilicy of chac process in practice is in many cases non-exiscenc or poor. f • ' - 16 - O' " 'nJ tV In concrasc, che process of che presenc invention is a cransformacion process chac in principle is applicable co all 3. churingiensis and 3 ■ cereus scrains, and chac is less c ime-consuming, more rational and consequencly mo re efficienc chan che cradicional PEG cransformacion process. For example, in che process of che invencion ic is possible co use. for example, whole incacc ceils, chus dispensing wich che time-consuming production of procoplascs cricical for 3. churingiensis and 3. cereus and wich che subsequenc regeneracion on complex nucrient media. Furchermore, when using che PEG process, carrying ouC che necessary process seeps can cake up Co a week, whereas wich che transformation process of the invencion the transformed cells can be obtained within a few hours (as a rule overnight). Anocher advancage of che process of che invencion concerns the number of B. churingiensis and/or 3. cereus cells chac can be cransformed per unic o f time. VThereas in the traditional PEG process only small aliquocs can be plated out simultaneously in order to avoid inhibition of the regeneration as a result of the growth of the cells being too dense, when using the electroporation technique large amounts of 3. thuringiensis and/or 3. cereus cells can be placed out simultaneously. This renders possible che decection of cransformancs even ac very low transformacion frequencies, which wich che afore-described processes is noc possible or is possible only with considerable expenditure. Furthermore, amounts of DNA in the nanogram range are sufficient to obtain at least some transformancs. o -I/- p > s . ni This is especial!/ important if a very efficient transformation system is necessary, such as, for example, '-hen using DN'A material from Z. co 11. which on account of a strongly pronounced restriction system m 3. thuringiensis ceils can lead to a reduction of the transformation frequencies by a factor of iO3 compared with 3. thuringiensis DN'A. The transformation process of the invention, which is based essentially on electroporation technology known per se, is characterised by the following specific process steps: a) Preparation of a cell suspension of suitable cell density in a culture medium suitable for growing 3. thuringiensis cells and with aeration adequate for the growth of the cells; b) separation of the cells from the cell suspension and resuspension in an inoculation buffer suitable for the subsequent electroporation; c) addition of a DNA sample in a concentration suitable for the electroporation; d) introduction of the batch described under points b) and c) into an eleccroporacion apparatus; e) one or more brief discharges of a capacitor across che cell suspension for the short term-production of nigh electric field strengths for a period that is adequate for transformacion of 3. thuringiensis and/or 3. cereus cells with recombinant DNA; t f) optional reincubation of the electroporated cells; g) placing out of the electroporated cells onco a suitable selection medium; and h) selection of the transformed cells. In a specific embodiment of the process of the invention thac is preferred within the scope of the invention, che 3. thuringiensis cells are firsc of all incubaced in a suitable nucrienc medium wich adequace f - 13 - _ 2lZi01 aeration and at a suitable temperature, preferably of from 203C to 35°C, until an optical density (ODs*;) of from 0.1 to 1.0 is achieved. The age of the 3acillus cultures provided for the electroporation has a distinct "v effect on che transformation frequency. An optically density of the Bacillus cultures of from 0.1 to 0.3, but especially of 0.2, is therefore especially preferred. Attention is, however, drawn to the fact that it is also possible to achieve good transformation frequencies with 3acillus cultures from other growth phases, especially with overnight cultures (see Figure 2). Generally, fresh cells or spores are used as starting material, but it is also equally possible to use deep-frozen cell material. The cell material is preferably cell suspensions of B. thuringiensis and/or 3. cereus cells in suitable liquid media to which, advantageously. a certain amount of an "antifreeze solution" has been added. Suitable antifreeze solutions are especially mixtures of osmocically active components and DMSO in water or a suitable buffer solution. Other suitable components that can be used in antifreeze solutions include sugars, polyhydric alcohols, such as, for example, glycerol, sugar alcohols, amino acids and polymers, such as, for example, polyethylene glycol. If 3. thuringiensis spores are used as starting material, they are first of all inoculated in a suitable medium and incubated overnight at a suitable temperature, preferably of from 25°C to 28°C, and with adequate ■! aeration. This batch is then diluted and further treated in the manner described above. To induce sporulacion in 3. thuringiensis ic is possible to use any medium that causes such a sporulacion. Within the scope of this invention a GYS medi* preferred. 23) a GYS medium according to Yousten A.A. and Rogoff M.H., (1969) \ Oxygen is usually introduced into the culture medium bv moving the culture, for example using a shaker, speeds of rotation of from 50 revs/min co 300 revs/min being preferred. B. churingiensis spores and vegetative microorganism ceils are cultured within che scope of che presenc invention according Co known generally cuscomary processes, liquid nutrient media preferably being used for reasons of practicability. The composicion of che nutrient media may vary slightly depending on che strain of 3. thuringiensis or 3. cereus used. Generally, complex media with loosely defined, readily assimilable carbon (C-) and nitrogen (N-) sources are preferred, like those customarily used for culturing aerobic Bacillus species. In addition, vitamins and essential metal ions are necessary, but these are usually contained in an adequate concentration as constituents or impurities in the complex nutrient media used. If desired, the said constituents, such as, for example, essential + 2- 2* 2-t- 3* 0 3- 2- vicamins and also .Va , K , CU , Ca , Mg , Fe , N'Hu , ?0u , SOi. 2- C1 , COj" ions and the trace elements cobalt and manganese, cinc, etc., can be added in the form of their salts. In addition to yeast extracts, yeasc hvdrolysaces, yeast autolysates and yeast cells, especially suicable nitrogen sources are in particular soya meal, maize meal, oatmeal, edamme (enzymacicallv digested lactalbumin) , peptone, casein hydrolysate, corn steep liquors and meat extracts, without the subject of che invention being in any way limited by chis list of examples. The preferred concentration of the mentioned N-sources is from 1.0 g/1 co 20 g/1. Suitable C-sources are especially glucose, lactose, sucrose, dextrose, maltose, starch, cerelose, cellulose and malt extract. The preferred concentration range is from 1.0 g/1 to 20 g/1. - 20 - 91 Aparc from complex nutrient media ic is obviously also possible co use semi- or fu1ly-synthetic media chac concain che above-described nutrients in a suicable concencracion. Aparc from che L3 medium preferably used vi chin che scope of che presenc invencion ic is also possible co use any ocher culcure medium suicable for culcuring B. churingiensis and/or 3- cereus. such as, for example, Ancibiotic Medium 3, SCGY medium, ecc. . Soorulated 3. churingiensis cultures are preferably scored on GYS media (inclined agar) at a cemperacure of i°C. Afcer che cell culcure has reached che desired cell density, che cells are harvesced by means of cencnfugacion and suspended in a suicable buffer solution thac has preferably been cooled befo re'nand •-•i ch ice. In che course of che investigations, the cemperacure proved noc co be critical and is cherefore freely seleccable •-•ichin a broad range. A cemperacure range of from 0°C to 35°C. preferably from 2 °C to 1 5 3C and more especially a temperature of ^°C, is preferred. The incubation period of che Bacillus cells before and afcer eleccroporacion has only a slighc effecc on the transformation frequency accainable (see Table 1). Only an excessively long incubation results in a decrease in che transformation frequency. An incubation period of from 0.1 co 30 minuces. especially of 10 minuces, is preferred. In the course of che invescigacions, che temperature proved noc Co be critical and is cherefore freely seleccable within a broad range. A cemperacure range of from 0°C to 35°C, preferably from 2°C co 15°C and more especially a temperature of 4°C, is preferred. This oDeration can be reoeated one or more times. 3urter solutions chat;' '• ' / are esoeciallv suicable vichin cne scope or chis invention are ' ' ..." -v» osmocically stabilised phosphace buffers chac concain as scabilising / p r- u - ^ w' 9 9 / agenc sugars such as, ror example, glucose or saccnarose, or sugar • // ■ / alcohols, such as. for example, mannicol, and have pH values sec co from-/*,/ 5.0 Co 3.0. More especially preferred are phosphace buffers of che PBS cype having a pH value of from 5.0 to 8.0, preferably of from 5.5 to 5.5, thac concain saccharose as scabilising agenc in a concencracion of from 0.1M co 1.0M, buc preferably of from 0.3M to 0.5M (see Figures 3 and ^). f 2i,Gi91 - 21 - Aliquocs of che suspended Bacillus cells are c'nen transferred :aco cuvecces or any ocher suicable vessels and incubaced cogec'ner '-ich a DNA sample for a suicable period, preferably for a period of from 0.1 co 30 minuces, buc especially of from 5 co 15 minuces, and ac a suicable cemperacure, preferably ac a cemperacure of from 0°C co 35°C, buc especially ac a cemperacure of from 2°C co 15°C and more especially ac a cemperacure of -°C. When operacing ac low cemperaCures ic is advancageous Co use cuvecces Chac have already been precooled, or any ocher suicable precooled vessels . Over a --ide range chere is a linear relacionship between che number of cransformed cells and che DNA concencracion used for che eleccroporacion, che number of cransformed cells increasing as che DNA concencracion increases (see Figure 5). The DNA concencracion preferred vichin che scope of chis invencion is m a range of from 1 ng Co 20 pg. A DNA concencracion of from 10 ng co 2 pg is especially preferred. Subsequencly che encire bacch containing 3. churingiensis and/or 3. cereus cells and plasmid DNA or anocher suicable DNA sample is incroduced inco an eleccroporacion apoaracus and subjecced Co eleccroporacion, chac is co say is briefly exposed Co an electric pu_lse. Eleccroporacion apoaracus suicable for use in the process of che ... invencion is already available from a variecy of manufacturers, such as,' for example, from 3io Rad (Richmond, CA, USA; "Gene Pulser Apparacus")', 3iocochnologies and Experimencal Research Inc. (San Diego, CA, USA; "3TX Transfeccor 100"), Promega (Madison, VI, USA; "X-Cell 2000 Eleccroporacion Syscem"), ecc.. Ic is obviously also possible co use any ocher suicable apparacus in che process of che invencion. Various pulse forms can be used, for example rectangular pulses or alternatively exponentially decaying pulses. 22 9 1 - 22 - The latter are preferred within the scope of this invention. They are produced by the discharging of a capacitor and are characterised by an initially very rapid increase in voltage and by a subsequent exponential decaying phase as a function of resistance and capacitance. The time constant RC provides a measure of the length of the exponential decay time. It corresponds to the time necessary for the voltage to decay to 37 % of the initial voltage (V ). o One parameter decisive in influencing the bacterial cell concerns the strength of the electric field acting on the cells, which is calculated from the ratio of the voltage applied to the distance between the electrode plates. Also of great importance in this connection is the exponential decay time, which depends on the configuration of the apparatus used (for example the capacitance of the capacitor) and on other parameters, such as, for example, the composition of the buffer solution or the volume of cell suspension provided for the electroporation. In the course of the investigations it has been demonstrated, for example, that reducing by half the volume of the cell suspension provided for the electroporation results in an increase in the transformation frequency by a factor of 10. A prolongation of the exponential decay time by way of an optimisation of the buffer solution used also results in a distinct increase in the transformation frequency. All measures that result in a prolongation of the exponential decay time and consequently in an increase in the transformation frequency are therefore preferred within the scope of this invention. The decay time preferred within the scope of the process of the invention is from approximately 2 ms to approximately 50 ms, but especially from approximately 8 ms to approximately 20 ms. Most especially preferred is an exponential decay time of from approximately 10 ms to approximately 12 ms. - 23 - O' ' : J>- Wichin che scope of che presenc invencion. che bacterial cells ace acced upon for shore periods by very high electric field strengths by means of brief discharge(s) of a capacitor across che DN'A-containing cell suspension; as a result of chis, the permeability or the 3. thuringiensis cells is briefly and reversibly increased. The eleccroporacion parameters are so coordinated with each ocher in the course of the process of che invencion thac optimum absorpcion inco che Bacillus cells of the DNA located in the eleccroporacion buffer is ensured. The capacicance setting of the capacitor within the scope of chis invention is advantageously from 1 pF to 2 50 pF, but especially from 1 pF co 50 pr and more especially is 25 pF. The choice of che initial voltage is not critical, and is therefore freely selectable, within wide ranges. An inicial volcage V of from 0.2 kV to 50 kV, but especially of from 0.2 kV co 2.5 kV and more especially of from 1.2 kV to 1.3 kV, is preferred. The distance becween the electrode plates depends, inter alia, on the size of che electroporation apparatus. It is advantageously from 0.1 cm to 1.0 cm, preferably from 0.2 cm to 1.0 cm, and more especially is O.i cm. The field strength values that act on the cell suspension resulc from the distance between the electrode plates and che initial volcage sec in the capacitor. These values are advantageously in a range of from 100 V/cm co 50,000 V/cm. Field screngchs of from 100 V/cm to 10,000 V/cm, buc particularly of from 3,000 V/cm to - ,500 V/cm, are especially preferred. / " t.. The fine coordination of the freely seleccable parameters, such as, for example, capacitance, initial voltage, distance becween places ecc., depends co a certain extent on che archiceccure of the apparacus used and can cherefore vary from case Co case within certain limits. In certain cases, therefore, it is possible to exceed or fall below the limiting values indicated, should this be necessary in order co achieve optimum field screngchs. The actual electroporation operation can be repeated one or more times uncil che opcimum cransformacion frequency for che syscem in quescion has been achieved- Following che eleccroporacion. che treated 3acillus ceils can advantage-ously be reincubaced, preferably for a period of from 0.1 co 30 minuces. ac a cemperacure of from 0°C co 3 5 3 C , preferably from 2°C co 15°C. The eleccroporaced cells are Chen diluted with a suicable medium and incubated again for a suicable period, preferably from 2 co 3 hours, wich adequace aeracion and ac a suicable cemperacure, preferably of from 20°C co 35°C. The 3. churingiensis cells are chen placed out onco solid media chac concain as an additive an agenc suicable for seleccing che new DNA sequences incroduced inco che baccerial cell. Depending on che nacure of che DNA used, che said agenc may be, for example, an ancibiocicaily active compound or a dye, inter alia. Ancibiocics selecced from che group consiscing of tetracycline, kanamycm, chloramphenicol and ervchromycin are especially preferred within the scope of chis invention for che selection of 3acillus churingiensis and/or 3. cereus cells. Also preferred are chromogenic subscraces, such as, for example. X-gal ( 5-b romo-^-chlo ro-3-mdo ly 1-3-D-galac cos ids) . which can be dececced by way of a specific colour reaction. Ocher phenotypic markers are known to the skilled person and can also be used wichin che scope of this invention. Ic is possible co use any nutrient medium suitable for culcuring 3. thuringiensis cells, Co which one of che conventionally employed solidifying media, such as, for example, agar, agarose, gelatin, etc., is added. The process parameters described hereinbefore in detail for 3. churingiensis are applicable in che same manner to .3. cereus cells. Unlike the processes hitherto available in the prior art, che process of the invention for the cransformacion of 3. thuringiensis and 3. cereus described hereinbefore is noc limited to the use of specific nacural 2^01 plasmids occurring in 3. churingiensis and/or 3. cereus but is applicable co all cypes of DN'A. Ic is accordingly nou possible for che firsc cine co transform 3. thuringiensis and/or 3 ■ ce reus in a concrolled manner, ic being possible Co use aparc from homologous plasmid DN'A, chac is co say plasmid DNA occurring nacurally in 3- churingiensis or che closely relaced B. cereus, also plasmid D.VA of hecerologous origin. This may be eicher plasmid DN'A chac occurs nacurally in an organism ocher Chan 3. churingiensis or che closely relaced 3• cereus. such as, for example, plasmids pUBllO and pC19^ from Staphylococcus aureus ~>k) ~>5) (" Horinouchi S. and Weisblum 3. , 1982; ~ Polak J. and Novick R.P. , 26) 1932) and plasmid pIM13 from 3. subcilis (*" Mahler J. and Halvorson H.O., 1980). which are capable of replicating in .3. churingiensis and/or 3. cereus. or hybrid plasmid DNA conscrucced by recombinant DNA technology from homologous plasmid DN'A or from hecerologous plasmid DNA or a 1Cernacively from a combination of homologous and hecerologous plasmid DN'A. The lasc-mencioned hybrid plasmid DNA is beccer suiced for work wich recombinanc DNA chan che nacural isolaces. There may be mencioned by --ay of example here, without che subjecc of che presenc application in any way being limited, che plasmids pBD64 ("'^Gryczan T. et al., 1 930), p3D3-:'7, pBD3^3 and pU3l66&. The cloning vectors already established for 3. subcilis, such as, for example, p3D6^, .nay be of particular importance for carrying ouc che cloning experiments in various 3. thuringiensis and 3. cereus strains. c \ '•'A ' ,90<:r ^ Apart from plasmid DNA, it is now possible within che scope of the -i y'J present invencion to introduce any ocher DNA inco 3. thuringiensis and 3. cereus bv transformation. The cransformed DNA can replicac^ eicher autonomously or integrated in che chromosome. It may be, for example, a vector DNA derived noc from a plasmid buc from a phage. The presenc invencion also relaces co che conscruction of bifunctional vectors ("shuttle" vectors). rvM) f - 26 - 2^ii91 Especially preferred within che scope of chis invention is che construction and use of bifunccional (hybrid) plasmid vectors, so-called "shuttle" vectors, that are capable of replicating in one or in several heterologous host organisms apart from in 3. thuringiensis or che closely related 3. cereus. and that are identifiable both in homologous and in heterologous host systems. Hecerologous host organisms are to be understood within the scope of chis invencion as all those organisms chat do noc belong to the 3. churingiensis/3. cereus group and that are capable of maintaining in a stable condicion a self-replicacing DNA. According co che above definition it is therefore possible for both prokaryotic and eukaryocic organisms to function as hecerologous host organisms. Ac chis point chere may be mentioned by way of example, as represencatives from che prokaryocic hose organism group, individual examples from che genera 3acillus, such as, for example, 3. subcilis or 3. megacerium, Scaphvlococcus, such as, for example, S. aureus. Screpcococcus. such as, for example, Screpcococcus faecalis, Screpcomvces. such as, for example Strepcomvces spp. , Pseudomonas. such as, for example, Pseudomonas spo., Escherichia, such as, for example, I. coli. Agrobaccerium, such as, for example, A. cumefaciens or A. rhizogenes. Salmonella, Er'-'inia, ecc. From che eukaryocic hose group there may be mentioned especially yeasts and animal and plane cells. This list of examples is noc final and is noc intended to limit the subject of the presenc invention m any way. Ocher suicable represencacives from che prokaryocic and eukaryocic hose organism groups are known Co che skilled ^ ,,,u^ person. \ Especially preferred wichin che scope of chis invencion are 3. subcilis or 3. megacerium. Pseudomonas spp., and especially E. coli from che group of prokaryocic hosts as well as yeasts and animal or plant cells from the" . group of eukaryotic hoses. OI - More especially preferred are bifunccional vectors chac are capable of replicating in boch 3. churingiensis and/or 3 ■ cereus cells as •-•ell as in E. coli. The presenc invention also includes che use of che said bifunccional vectors for the transformation of 3. churingiensis and 3. cereus. "Shuttle" vectors are constructed using recombinant DN'A technology, plasmid and/or vector DNA of homologous (3- thuringiensis. 3. cereus) or heterologous origin initially being cleaved using suitable restriction enzymes and chen chose DN'A fragments containing che functions essential for replication in che respective desired host system being joined to one another again in the presence of suitable enzymes. The afore-mencioned hecerologous host organisms can acc as a source of plasmid- and/or veccor DNA of hecerologous origin. The joining of che various DNA fragmencs must be effecCed in such a manner thac the funccions essential for replication in che differenc hose systems are recained. In addicion, obviously also plasmid DN'A and/or vector DNA of purely heterologous origin can be used for che conscruccion of "shuttle" vectors, buc ac lease one of che heterologous fusion partners must contain regions of DNA that render possible a replication in homologous 3. thuringiensis/3. cereus host systems. As a source of plasmid DNA and/or vector DNA of heterologous origin chac is nevertheless capable of replicating in a 3. thuringiensis/3, cereus hose system there may be mentioned at this poinc, by way of example, a few representatives from the group of gram-positive bacteria, selected from the group consisting of che genera Staphylococcus. such as, for example, Scao'nvlococcus aureus, Screpcococcus, such as, for example, 1 * _ i | Screpcococcus faecalis. 3acillus. such as, for example, 3acillus fnegacerium or 3. subcilis. Sccepcomyces. such as, for example, Screpcomvees spp.. ecc. In addition co che represencacives from che group of gram-positive bacceria listed here by way of example, chere is a whole - 23 - o1 ~ n -i series of ocher organises known co che skilled person chac can be used in che process of che invencion. The presenc invencion chus accordingly also relaces Co a process for che produccion of bifunccional vectors chac are suicable for cransforming 3. churingiensis and/or 3. cereus which comprises a) firsc of all breaking down plasmid DNA of homologous or hecerologous origin inco fragmencs using suicable rescriccion enzymes and b) chen joining Co one another again, in che presence of suicable enzymes, chose fragmencs concaining che funccions essential for replicacion and seleccion in che respeccive desired hose syscem, chis being effecced in such a manner chac che funccions essencial for replicacion and seleccion in che various hose syscesis are recained. In chis manner bifunccional plasmids are obcained chac concain, in addicion Co che funccions necessary for replication in 3. churingiensis or 3. ce reu s, furcher DNA sequences chac ensure replication in ac lease one ocher hecerologous hose syscem. To ensure rapid and efficienc seleccion of che bifunccional veccors in boch homologous and hecerologous hose svscem(s) ic is advancageous Co provide che said veccors wich specific seleccable markers chac can be used in 3. churingiensis and/or 3. cereus as well as in hecerologous hose syscem(s). chac is Co say chac render possible a rapid and uncomplicaced seleccion. Especially preferred wichin che scope of chis invencion is che use of DNA sequences coding for ancibiocic resiscances, especially DNA sequences chac code for resiseance Co ancibiocics selected from che group consisting of kanamycin. cecracydine. chloramphenicol, erythromycin ecc. . Also preferred are genes chac code for enzymes wich a chromogenic subscrace, such as for example, X-gal ( 5-bromo-i-chloro-3-indoly1-fl-D-galaccoside). The cransformed colonies can chen be dececced very easily by uay of a specific colour reaccion. Ocher p'nenocypic marker genes are known co che skilled person and can also be used wichin che scope of chis invencion. - 29 - 2^i01 Especially preferred v::h:n che scope of chis invencion is che conscruccion of "shuccle" veccors chac. m addicion co DN'A sequences chac permic replicacion in B. churingiensis or 3■ cereus or in boch hose sysceras, also concain regions of DN'A chac are necessary for replicacion in ocher baccerial hose systems, such as, for example, in 3■ subcilis, 3. menacerium. Pseudomonas spp., Z ■ coli, ecc.. Also preferred are "shuccle" veccors chac replicace on che one hand eicher in B. churingiensis or 3. cereus or in boch, and on che ocher hand —M—■>! .1 I— !!■■■■ ~ in eukaryocic hose syscems selecced from che group consiscing ol yeasc, animal and plane cells, ecc.. More especially preferred is che conscruccion of "shuccle" veccors chac, in addicion co DNA sequences chac are necessary for replicacion of che said veccors in 3. churingiensis or 3. cereus or in boch syscems. also concain DNA sequences chac render possible replicacion of che said "shuccle" veccors in E. coli■ Examples of such scarcing plasmids for che conscruccion of "shuccle" vectors for che 3. churingiensis-3. cereus/Z. coli syscem, which muse noc. however, be regarded as in any way limicing, are che 3. cereus plasmid pBC16, and che plasmid pL'C8 derived from che E. coli plasmid p3R322 (""^Vieira J. and Messing J., 1932). The presenc invencion also relaces Co bifunccional ("shuccle") veccors chac, in addicion co che funccions essential for replicacion and selection in homologous and hecerologous host systems, also concain one or more genes in expressible form or ocher useful DNA sequences. This invencion also includes processes for che produccion of chese veccors, which comprise insercing che said genes or ocher useful DNA sequences inco chese bifunccional veccors wich che aid of suicable enzymes. " .■ \ Using che "shuccle" veccors of che invencion and the afore-described/' c;> , cransformacion orocess it is chus now possible for che firsc cime co- ^5'/ / introduce inco 3. churingiensis and/or 3. cereus cells by trans ro rmacion T k 2~Ci01 wich a high degree of efficiency. DMA sequences chac have been cloned oucside 3. thuringiensis cells in a foreign hose syscem. Accordingly ic is now possible for che firsc cir^e for genes or ocher useful DN'A sequences, especially also chose having a regulacory function, Co be incroduced in a stable manner inco 3. churingiensis and 3■ cereus cells and, if desired, expressed cherein, as a resulc of which B. thuringiensis and 3■ cereus cells wich novel and desirable propercies are obcained. Boch homologous and heterologous gene(s) or DN'A and synchecic gene(s) or DNA according co the definition given within che scope of che presenc invencion, as well as combinations of che said DNAs, can be used as genes in che process of che invencion. The coding DN'A sequence can be conscrucced exclusively from genomic DNA, from cDN'A or from synchecic DN'A. Anocher possibilicy is che conscruccion of a hybrid DN'A sequence consisting of boch cDN'A and of genomic DNA and/or synchecic DNA, or alcernacively a combination of chose DNAs. In chat case, che cDNA may onginace from the same gene as the genomic DNA, or alcernacively boch che cDN'A and che genomic DNA may originace from differenc genes. In any case, however, boch che genomic DNA and/or che cDNA may each be prepared individually from che same or from differenc genes. If the DNA sequence contains parts of more than one gene, chese genes may originate from one and the same organism, from several organisms chac belong co differenc scrains, or Co variecies of che same kind or differenc species of che same genus, or from organisms chat belong to more than one genus of che same or of another taxonomic unit. In order Co ensure che expression of che said scruccural genes in che bacterial cell, che coding gene sequences muse firsc of all be operably joined Co expression sequences capable of funccioning in 3. churingiensis and/or 3. cereus cells. ,o 30 - - 31 - 1 The hybrid gene constructs of the presenc invencion chus concain, in addition to che structural gene(s), expression signals cha: include boch promoter and cerninacor sequences as -ell as ocher regulatory sequences of 3' and 5' untranslated regions. \ Especially preferred within the scope of this invention are the nacural expression signals of 3. thuringiensis and/or 3. cereus themselves and mucancs and variancs chereof chac are substantially homologous with che natural sequence. Within the scope of this invention, one DN'A sequence is substantially homologous with a second DN'A sequence when at least 70 %, preferably at least 50 %. but especially ac lease 90 %, of che accive regions of che DN'A sequence are homologous. According co the presenc definicion of che expression "subscancially homologous", Cwo differenc nucleocides in a DN'A sequence of a coding region are regarded as homologous if che exchange of che one nucleocide for the ocher is a silenc mucacion. Mosc especially preferred is the use of sporulacion-dependenc promocers of 3. churingiensis chat ensure expression as a function of the sporulation. Especially preferred for the transformacion of 3. thuringiensis or 3. cereus within the scope of this invencion is che use of DNA sequences chac code for a a-endotoxin. The coding region of che chimaeric gene of che invencion preferably concains a nucleocide sequence coding for a polypepcide chac occurs nacurally in 3. churingiensis or, alternatively, for a polypepcide chac is subscancially homologous cherewith, chac is Co say chac ac lease has subscancially che coxicicy properties of a crystalline o-endocoxin procein of 3. churingiensis. Within the scope of the presenc invention, by definicion a polypepcide has subscancially che coxicicy propercies of che crystalline 5-endocoxin procein of 3. thuringiensis if ic has an insecticidal accivicy againsc a similar spectrum of insect larvae co chac of che crystalline procein of a sub-species of 3. churingiensis. Some suicable sub-soecies are, for example, chose selected from che group / 9 /V • - L !9[)f tj ,*» '/ ./ • f- . V r- ' - 32 - rj v JL .01 consisting of kurscaki, berliner, alesti, tolworthi, so::o, der.drolimus, Cenebrionis and israelensis. The preferred subspecies for Lepidoptera larvae is kurscaki and, especially, kurscaki HDl. The coding region may chus be a region chac occurs nacurally in B. churingiensis. Alcenaci'-ely, che coding region can if desired also concain a sequence chac is differenc from che sequence in 3. churingiensis buc chac is equivalent Co ic on accounc of che degeneracion in che genecic code. The coding region of che chimaeric gene can also code tor a polypepcide chac is differenc from a nacurally occurring cryscalline 6-endotoxin procein buc chac scill has subscancially che insecc-coxicicy propercies of che cryscalline procein. Such a coding sequence '-ill normally be a varianc of a nacural coding region. A "varianc" of a nacural DNA sequence within che scope of chis invention should, by definicion, be unde rs cood as a modified form of a natural sequence chac, however, scill fulfils che same funccion. The varianc may be a mucanc or a synchecic DN'A sequence and is subscancially homologous with che corresponding nacural sequence. Within che scope of chis invencion a DNA sequence is subscancially homologous with a second DN'A sequence when ac lease 70 %, preferably ac lease 30 buc especially ac lease 90 %, of che accive regions of che DNA sequence are homologous. According co che presenc definicion of che expression "subscancially homologous", cwo differenc nucleocides in a DNA sequence of a coding region are regarded as homologous if che exchange of one nucleocide for the other is a silenc mucacion. Within che scope of che presenc invencion, ic is accordingly possible Co use any chimaeric gene coding for an amino acid sequence chat has che inseccicidal propercies of a 3. churingiensis o-endocoxin and chac meecs the disclosed and claimed requirements. Especially preferred is the use of a nucleotide sequence thac is subscancially homologous ac lease with che part or che pa res of Che nacural sequence chac is (are) responsible for che inseccicidal accivity and/or che "nose specificicy of che 3. churingiensis coxin. . A C.A ■ .. ; ? t"! >. —• '■ y Ulr oil - 33 - C' • The polypepcide expressed by che chiaaeric gene as a rule also has an lease some immunological propercies in common '-ich a nacural cryscalline procein, because ic has ac lease some of che sane ancigenic decerninancs Accordingly, che polypepcide chac is encoded by che said chimaeric gene is preferably scruccurally relaced co che 4-endoCoxin of che cryscalline procein produced by 3- churingiensis. 3. churingiensis produces a cryscalline procein •-•ich a subunic chac corresponds eo a procoxin having a molecular ueighc (M*«) of approximacely from 1 30,000 eo 1^0,000. This subunic can be cleaved by proeeases or by alkali inco inseccicidal fragmencs having a MVT of 70,000 and possibly even less. For che conscruccion of chimaeric genes in '--hich che coding region includes such fragmencs of che procoxin or even smaller pares, fragmencing che coding region can be continued for as long as ehe fragmencs or pares of chose fragmencs seill have ehe necessary inseccicidal accivicy. The procoxin, inseccicidal fragmencs of che procoxin ana inseccicidal pares of chose fragmencs can be joined Co oehec molecules, such as polypcpcides and proceins. Coding regions suitable for use vichin che scope of che process of che invencion can be obcained from genes of 3. churingiensis chac code for che cryscalline coxin gene ('-"hiceley ec al. , ?CT applicacion VO86/01536 and US Pacencs ^ **3 335 and & ^67 036). A preferred nucleocide sequence chac codes for a cryscalline proeein is locaced becueen nucleocides 156 and 3623 in formula I or is a shoreer sequence chac codes for an inseccicidal fragmenc of such a cryscalline procein ("^Geiser ec al., 1986 and E? 238 i^l). Formel I 10 20 30 i0 50 60 GxiAACACCC TGGG aCAAAA AiTGA-Aiii AGiAAAAxTA GIIGCACLTI GTGCATTTTT 70 30 TCAiAAGAiG AGTCATAiGT 90 iii AAA11G x 100 110 120 AGTAATGAAA AACAGTATTA TATCATAATG - 34 - 229191 130 HO 150 160 170 180 AATTGGTATC TTAATAAAAG AGATGGAGGT AACTTATGGA TAACAATCCG AACATCAATG 190 200 210 220 230 240 AATGCATTCC TTATAATTGT TTAAGTAACC CTGAAGTAGA AGTATTAGGT GGAGAAAGAA 250 260 270 280 290 300 TAGAAACTGG TTACACCCCA ATCGATATTT CCTTGTCGCT AACGCAATTT CTTTTGAGTG 310 320 330 340 350 360 .vTTTGTTCC CGGTGCTGGA TTTGTGTTAG GACTAGTTGA TATAATATGG GGAATTTTTG 370 380 390 400 410 420 XCTCTCA ATGGGACGCA TTTCTTGTAC AAATTGAACA GTTAATTAAC CAAAGAATAG 4 440 450 460 470 480 AAGAATTC-C TAGGAACCAA GCCATTTCTA GATTAGAAGG ACTAAGCAAT CTTTATCAAA 490 500 510 520 530 540 TTTACGCAGA ATCTTTTAGA GAGTGGGAAG CAGATCCTAC TAATCCAGCA TTAAGAGAAG 550 560 570 580 590 600 AGATGCGTAT TCAATTCAAT GACATGAACA GTGCCCTTAC AACCGCTATT CCTCTTTTTG 610 620 630 640 650 660 CAGTTCAAAA TTATCAAGTT CCTCTTTTAT CAGTATATGT TCAAGCTGCA AATTTACATT 670 680 690 700 710 720 TATCAGTTTT GAGAGATGTT TCAGTGTTTG GACAAAGGTG GGGATTTGAT GCCGCGACTA 730 740 750 760 770 780 TCAATAGTCG TTATAATGAT TTAACTAGGC TTATTGGCAA CTATACAGAT CATGCTGTAC 790 800 810 820 830 840 GCTGGTACAA TACGGGATTA GAGCGTGTAT GGGGACCGGA TTCTAGAGAT TGGATAAGAT -J VI n A 22 9 i 35 - 850 860 870 880 890 900 ATAATCAATT TAGAAGAGAA TTAACACTAA CTGTATTAGA TATCGTTTCT CTATTTCCGA 910 920 930 940 950 960 ACTATGATAG TAGAACGTAT CCAATTCGAA CAGTTTCCCA ATTAACAAGA GAAATTTATA 970 980 990 1000 1010 1020 CAAACCCAGT ATTAGAAAAT TTTGATGGTA GTTTTCGAGG CTCGGCTCAG GGCATAGAAG 1030 1040 1050 1060 1070 1080 GAAGTATTAG GAGTCCACAT TTGATGGATA TACTTAACAG TAT.AACCATC TATACGGATG 1090 1100 1110 1120 1130 1140 CTCATAGAGG AGAATATTAT TGGTCAGGGC ATCAAATAAT GGCTTCTCCT GTAGGGTTTT 1150 1160 1170 1180 1190 1200 CGGGGCCAGA ATTCACTTTT CCGCTATATG GAACTATGGG AAATGCAGCT CCACAACAAC 1210 1220 1230 1240 1250 1260 GTATTGTTGC TCAACTAGGT CAGGGCGTGT ATAGAACATT ATCGTCCACT TTATATAGAA 1270 12S0 1290 1300 1310 1320 GACCTTTTAA TATAGGGATA AATAATCAAC AACTATCTGT TCTTGACGGG ACAGAATTTG 1330 1340 1350 1360 1370 1380 CTTATGGAAC CTCCTCAAAT TTGCCATCCG CTGTATACAG AAAAAGCGGA ACGGTAGATT 1390 1400 1410 1420 1430 1440 CGCTGGATGA AATACCGCCA CAGAATAACA ACGTGCCACC TAGGCAAGGA TTTAGTCATC 1450 1460 1470 1480 1490 1500 GATTAAGCCA TGTTTC/UTG TTTCGTTCAG GCTTTAGTAA TAGTAGTGTA AGTATAATAA 1510 1520 1530 1540 1550 1560 GAGCTCCTAT GTTCTCTTGG ATACATCGTA GTGCTGAATT TAATAATATA ATTCCTTCAT 36 - oo n < \ 22 9 1570 1580 1590 1600 1610 1620 CACAAATTAC ACAAATACCT TTAACAAAAT CTACTAATCT TGGCTCTGGA ACTTCTGTCG 1630 1640 1650 1660 1670 1680 TTAAAGGACC AGGATTTACA GGAGGAGATA TTCTTCGAAG AACTTCACCT GGCCAGATTT 1690 1700 1710 1720 1730 1740 CAACCTTAAG AGTAAATATT ACTGCACCAT TATCACAAAG ATATCGGGTA AGAATTCGCT 1750 1760 1770 1780 1790 1800 ACGCTTCTAC CACAAATTTA CAATTCCATA CATCAATTGA CGGAAGACCT ATTAATCAGG 1810 1820 1830 1840 1850 1860 GGAATTTTTC AGCAACTATG AGTAGTGGGA GTAATTTACA GTCCGGAAGC TTTAGGACTG 1870 1SS0 1890 1900 1910 1920 TAGGTTTTAC TACTCCGTTT AACTTTTCAA ATGGATCAAG TGTATTTACG TTAAGTGCTC 1930 1940 1950 1960 1970 1980 ATGTCTTCAA TTCAGGCAAT GAAGTTTATA TAGATCGAAT TGAATTTGTT CCGGCAGAAG 1990 2000 2010 2020 2030 2040 TAACCTTTGA GGCAGAATAT GATTTAGAAA GAGCACAAAA GGCGGTGAAT GAGCTGTTTA 2050 2060 2070 2080 2090 2100 CTTCTTCCAA TCAAATCGGG TTAAAAACAG ATGTGACGGA TTATCATATT GATCAAGTAT 2110 2120 2130 2140 2150 2160 CCAATTTAGT TGAGTGTTTA TCTGATGAAT TTTGTCTGGA TGAAAAAAAA GAATTGTCCG 2170 2180 2190 2200 2210 2220 AGAAAGTCAA ACATGCGAAG CGACTTAGTG ATGAGCGGAA TTTACTTCAA GATCCAAACT 2230 2240 2250 2260 2270 2280 TTAGAGGGAT CAATAGACAA CTAGACCGTG GCTGGAGAGG AAGTACGGAT ATTACCATCC - 37 - 22 9 1 n o 2290 2300 2310 2320 2330 2340 AAGGAGGCGA TGACGTATTC AAAGAGAATT ACGTTACGCT ATTGGGTACC TTTGATGAGT 2350 2360 2370 2380 2390 2400 GCTATCCAAC GTATTTATAT CAAAAAATAG ATGAGTCGAA ATTAAAAGCC TATACCCGTT 2410 2420 2430 2440 2450 2460 ACCAATTAAG AGGGTATATC GAAGATAGTC AAGACTTAGA AATCTATTTA ATTCGCTACA 2470 2480 2490 2500 2510 2520 ATGCCAAACA CGAAACAGTA AATGTGCCAG GTACGGGTTC CTTATGGCCG CTTTCAGCCC 2530 2540 2550 2560 2570 2580 CAAGTCCAAT CGGAAAATGT GCCCATCATT CCCATCATTT CTCCTTGGAC ATTGATGTTG 2590 2600 2610 2620 2630 2640 GATGTACAGA CTTAAATGAG GACTTAGGTG TATGGGTGAT ATTCAAGATT AAGACGCAAG 2650 2660 2670 2680 2690 2700 ATGGCCATGC AAGACTAGGA AATCTAGAAT TTCTCGAAGA GAAACCATTA GTAGGAGAAG 2710 2720 2730 2740 2750 2760 CACTAGCTCG TGTGAAAAGA GCGGAGAAAA AATGGAGAGA CAAACGTGAA AAATTGGAAT 2770 2780 2790 2S00 2810 2820 GGGAAACAAA TATTGTTTAT AAAGAGGCAA AAG.AATCTGT AGATGCTTTA TTTGTAAACT 2830 2840 2850 2860 2870 2880 CTCAATATGA TAGATTACAA GCGGATACCA ACATCGCGAT GATTCATGCG GCAGATAAAC 2890 2900 2910 2920 2930 2940 GCGTTCATAG CATTCGAGAA GCTTATCTGC CTGAGCTGTC TGTGATTCCG GGTGTC.AATG 2950 2960 2970 2980 2990 3000 CGGCTATTTT TGAAGAATTA GAAGGGCGTA TTTTCACTGC ATTCTCCCTA TATGATGCGA - 38 - 22 9 1 3010 3020 3030 3040 3050 3060 GAAATGTCAT TAAAAATGGT GATTTTAATA ATGGCTTATC CTGCTGGAAC GTGAAAGGGC 3070 3080 3090 3100 3110 3120 ATGTAGATGT AGAAGAACAA AACAACCACC GTTCGGTCCT TGTTGTTCCG GAATGGGAAG 3130 3140 3150 3160 3170 31S0 CAGAAGTGTC ACAAGAAGTT CGTGTCTGTC CGGGTCGTGG CTATATCCTT CGTGTCACAG 3190 3200 3210 3220 3230 3240 CGTACAAGGA GGGATATGGA GAAGGTTGCG TAACCATTCA TGAGATCGAG AACAATACAG 3250 3260 3270 3280 3290 3300 ACGAACTGAA GTTTAGCAAC TGTGTAGAAG AGGAAGTATA TCCAAACAAC ACGGTAACGT 3310 3320 3330 3340 3350 3360 GTAATGATTA TACTCCGACT CAAGAAGAAT ATGAGGGTAC GTACACTTCT CGTAATCGAG 3370 3380 3390 3400 3410 3420 GATATGACGG AGCCTATGAA AGCAATTCTT CTGTACCAGC TGATTATGCA TCAGCCTATG 3430 3440 3450 3460 3470 3480 AAGAAAAAGC ATATACAGAT GGACGAAGAG AC/UTCCTTG TGAATCTAAC AGAGGATATG 3490 3500 3510 3520 3530 3540 GGGATTACAC ACCACTACCA GCTGGCTATG TGACAAAAGA ATTAGAGTAC TTCCCAGAAA 3550 3560 3570 3580 3590 3600 CCGATAAGGT ATGGATTGAG ATCGGAGAAA CGGAAGGAAC ATTCATCGTG GACAGCGTGG 3610 3620 3630 3640 3650 3660 AATTACTTCT TATGGAGGAA TAATATATGC TTTATAATGT AAGGTGTGCA AATAAAGAAT 3670 3680 3690 3700 3710 3720 GATTACTGAC TTGTATTGAC AGATAAATAA GGAAATTTTT ATATGAATAA AAAACGGGCA o - 39 - 22 9 1 9 3730 3740 3750 3760 3770 3780 TCACTCTTAA AAGAATGATG TCCGTTTTTT CTATGATTTA ACGAGTGATA TTTAAATGTT 3790 3800 3810 3820 3830 3840 TTTTTTGCGA AGGCTTTACT TAACGCGGTA CCGCCACATG CCCATCAACT TAAGAATTTG 3850 3860 3S70 3880 3890 3900 CACTACCCCC AAGTGTCAAA AAACGTTATT CTTTCTAAAA AGCTAGCTAG AAAGGATGAC 3910 3920 3930 3940 3950 3960 ATTTTTTATG AATCTTTCAA TTCAAGATGA ATTACAACTA TTTTCTGAAG AGCTGTATCG 3970 3980 3990 4000 4010 4020 TCATTTAACC CCTTCTCTTT TGGAAGAACT CGCTAAAGAA TTAGGTTTTG TAAAAAGAAA 4030 4040 4050 4060 4070 4080 ACGAAAGTTT TCAGGAAATG AATTAGCTAC CATATGTATC TGGGGCAGTC AACGTACAGC 4090 4100 4110 4120 4130 4140 GAGTGATTCT CTCGTTCGAC TATGCAGTCA ATTACACGCC CCCACAGCAC TCTTATGAGT 4150 4160 4170 4180 4190 4200 CCAGAAGGAC TCAATAAACG CTTTGATAAA AAAGCGGTTG AATTTTTGAA ATATATTTTT 4210 4220 4230 4240 4250 4260 TCTGCATTAT GGAAAAGTAA ACTTTGTAAA ACATCAGCCA TTTC/UGTGC ACCACTCACG 4270 4280 4290 4300 4310 4320 TATTTTCAAC GAATCCGTAT TTTAGATGCG ACGATTTTCC AAGTACCGAA ACATTTAGCA 4330 4340 4350 4360 CATGTATATC CTGGGTCAGG TGGTTGTGCA CAAACTGCAG The coding region defined by nucleotides 156 to 3623 of formula I codes for a polypeptide of formula II. - 40 - 22 9 1 9 1 Formel II Met Asp Asn Asn Pro Asn I le Asn Glu Cy s 10 lie Pro Tyr Asn Cy s Leu Ser Asn Pro Glu 20 Val Glu Val Leu Gly Gly Glu Arg He Glu 30 Thr Gly Tyr Thr Pro lie Asp lie Se r Leu 40 Ser Leu Thr Gin Phe Leu Leu Ser Glu Phe 50 Val Pro Gly Ala Gly Phe Val Leu Gly Leu 60 Val Asp lie lie Trp Gly lie Phe Gly Pro 70 Ser Gin Trp Asp Ala Phe Leu Val Gin lie 80 Glu Gin Leu lie Asn Gin Arg lie Glu Glu 90 Phe Ala Arg Asn Gin Ala lie Ser Arg Leu 100 Glu Gly Leu Ser Asn Leu Tyr Gin He Tyr 110 Ala Glu Ser Phe Arg Glu Trp Glu Ala Asp 120 Pro Thr Asn Pro Ala Leu Arg Glu Glu Met 1 30 Arg lie Gin Phe Asn Asp Met Asn Se r Ala 140 Leu Thr Thr Ala lie Pro Leu Phe Ala Val 150 Gin Asn Tyr Gin Val Pro Leu Leu Ser Val 160 Tyr Val Gin Ala Ala Asn Leu His Leu Scr 170 Val Leu Arg Asp Val Ser Val Ptie Gly Gin 180 Arg Trp Gly Phe Asp Ala Ala Thr lie Asn 190 Se r Arg Tyr Asn Asp Leu Thr Arg Leu lie 200 Gly Asn Tyr Thr Asp His Ala Val Arg Trp 210 Tyr Asn Thr Gly Leu Glu Arg Val Trp Gly 220 Pro Asp Ser Arg Asp Trp lie Arg Tyr Asn 2 30 Gin Phe Arg Arg Glu Leu Thr Leu Thr Val 240 Leu Asp lie Val Ser Leu Phe Pro Asn Tyr 2 50 Asp Ser Arg Thr Tyr Pro lie Arg Thr Val 260 Ser Gin Leu Thr Arg Glu He Tyr Thr Asn 270 Pro Val Leu Glu Asn Phe Asp Gly Ser Phe 280 Arg Gly Ser Ala Gin Gly lie Glu Gly Ser 290 He Arg Ser Pro His Leu Met Asp lie Leu 300 Asn Ser lie Thr lie Tyr Thr Asp Ala His 310 Arg Gly Glu Tyr Tyr Trp Ser Gly His Gin 320 lie Met Ala Ser Pro Val Gly Phe Ser Gly 330 Pro Glu Phe Thr Phe Pro Leu Tyr Gly Thr 340 Met Gly Asn Ala Ala Pro Gin Gin Arg lie 350 - 41 - Val Ala Gin Leu Gly Gin Gly Val Tyr Arg 360 Thr Leu Ser Ser Thr Leu Tyr Arg Arg Pro 370 Phe Asn lie Gly lie Asn Asn Gin Gin Leu 380 Ser Val Leu Asp Gly Thr G lu Phe Ala Tyr 390 Gly Thr Scr Se r Asn Leu Pro Ser Ala Val 400 Tyr Arg Lys Ser Gly Thr Val Asp Ser Leu 410 Asp Glu lie Pro Pro Gin Asn Asn Asn Val 420 Pro Pro Arg Gin Gly Phe Ser His Arg Leu 4 30 Ser His Val Se r Me t Phe Arg Ser Gly Phe 440 Ser Asn Ser Se r Val Se r He lie Arg Ala 4 50 Pro Met Phe Ser Trp He His Arg Ser Ala 460 Glu Phe Asn Asn lie lie Pro Ser Ser Gin 470 lie Thr Gin lie Pro Leu Thr Lys Ser Thr 480 Asn Leu Gly Ser Gly Thr Ser Val Val Lys 490 Gly Pro Gly Phe Thr Gly Gly Asp lie Leu 500 Arg Arg Thr Ser Pro Gly Gin I le Se r Thr 510 Leu Arg Val Asn lie Thr Ala Pro Leu Ser 520 Gin Arg Tyr Arg Va 1 Arg lie Arg Tyr Ala 530 Se r Thr Thr Asn Leu Gin Phe His Thr Ser 540 He Asp Gly Arg Pro He Asn G In Gly Asn 550 Phe Ser Ala Thr Met Ser Ser Gly Ser Asn 560 Leu Gin Ser Gly Ser Phe Arg Thr Val Gly 570 Phe Thr Thr Pro Phe Asn Phe Ser Asn Gly 580 Ser Ser Val Phe Thr Leu Ser Ala His Val 590 Phe Asn Ser Gly Asn Glu Val Tyr He Asp 600 Arg lie Glu Phe Val Pro Ala Glu Val Thr 610 Phe Glu Ala Glu Tyr Asp Leu Glu Arg Ala 620 Gin Lys Ala Val Asn Glu Leu Phe Thr Ser 630 Ser Asn Gin He Gly Leu Lys Thr Asp Val 640 Thr Asp Tyr His He Asp Gin Val Ser Asn 650 Leu Val Glu Cys Leu Ser Asp Glu Phe Cys 660 Leu Asp Glu Lys Lys Glu Leu Ser Glu Lys 670 Val Lys His Ala Lys Arg Leu Ser Asp Glu 680 Arg Asn Leu Leu Gin Asp Pro Asn Phe Arg 690 Gly lie Asn Arg Gin Leu Asp Arg Gly Trp 700 Arg Gly Ser Thr Asp lie Thr lie Gin Gly 710 Gly Asp Asp Val Phe Lys Glu Asn Tyr Val 720 - 42 - 22 Thr Leu Leu Gly Thr Phe Asp Glu Cys Tyr 7 30 Pro Thr Tyr Leu Tyr Gin Lys He Asp Glu 740 Ser Lys Leu Lys Ala Tyr Thr Arg Tyr Gin 7 50 Leu Arg Gly Tyr He Glu Asp Ser Gin Asp 760 Leu Glu lie Tyr Leu He Arg Tyr Asn Ala 770 Lys His Glu Thr Val Asn Val Pro Gly Thr 780 Gly Ser Leu Trp Pro Leu Ser Ala Pro Ser 790 Pro lie Gly Lys Cys Ala His His Ser His 800 His Phe Ser Leu Asp He Asp Val Gly Cys 810 Thr Asp Leu Asn Glu Asp Leu Gly Val Trp 820 Val lie Phe Lys He Lys Thr Gin Asp Gly 8 30 His Ala Arg Leu Gly Asn Leu Glu Phe Leu 840 Glu Glu Lys Pro Leu Val Gly Glu Ala Leu 850 Ala Arg Val Lys Arg Ala Glu Lys Lys Trp 860 Arg Asp Lys Arg Glu Lys Leu Glu Trp Glu 870 Thr Asn He Val Tyr Lys Glu Ala Lys Glu 880 Ser Val Asp Ala Leu Phe Val Asn Ser Gin 890 Tyr Asp Arg Leu Gin Ala Asp Thr Asn He 900 Ala Met lie His Ala Ala Asp Lys Arg Val 910 His Ser lie Arg Glu Ala Tyr Leu Pro Glu 920 Leu Ser Val He Pro Gly Val Asn Ala Ala 9 30 lie Phe Glu Glu Leu Glu Gly Arg lie Phe 940 Thr Ala Phe Ser Leu Tyr Asp Ala Arg Asn 950 Val lie Lys Asn Gly Asp Phe Asn Asn Gly 960 Leu Ser Cys Trp Asn Val Lys Gly His Val 970 Asp Val Glu Glu Gin Asn Asn His Arg Ser 980 Val Leu Val Val Pro Glu Trp Glu Ala Glu 990 Val Ser Gin Glu Val Arg Val Cys Pro Gly 1000 Arg Gly Tyr He Leu Arg Val Thr Ala Tyr 1010 Lys Glu Gly Tyr Gly Glu Gly Cys Val Thr 1020 lie His Glu He Glu Asn Asn Thr Asp Glu 1030 Leu Lys Phe Ser Asn Cys Val Glu Glu Glu 1040 Val Tyr Pro Asn Asn Thr Val Thr Cys Asn 1050 Asp Tyr Thr Ala Thr Gin Glu Glu Tyr Glu 1060 Gly Thr Tyr Thr Ser Arg Asn Arg Gly Tyr 1070 Asp Gly Ala Tyr Glu Ser Asn Ser Ser Val 1080 Pro Ala Asp Tyr Ala Ser Ala Tyr Glu Glu 1090 S^SiOl Lys Ala Tyr Thr Asp Gly Arg Arg Asp s n 1 100 Pro Cys Glu Ser Asn Arg Gly Tyr Gly Asp 11 10 Tyr Thr Pro Leu Pro Ala Gly T y r Va 1 Thr 1 120 Lys Glu Leu Glu Tyr Phe Pro Glu Thr Asp 1 1 30 Lys Val Trp lie Glu lie Gly Glu Th r Glu 1 140 Gly Th r Phe lie Val Asp Ser Val Glu Leu 11 50 Leu Leu Met Glu Glu End 1156 In order Co introduce a chimaeric gene into 3. thuringiensis or 3. cereus cells by transformation using the process of che invention, che gene is preferably firsc of all inserced into a veccor. The insertion is especially preferably inco a bifunccional veccor of che invention. If che corresponding gene is not available in an amount sufficient for the insertion into the 3acillus cells, the veccor can firsc of all be ainplified by replication in a hecerologous hose cell. 3accerial cells or yeast cells are best suited for che amplification of genes. When a sufficient amount of che gene is available ic is inserced into the 3acillus cells. The insertion of che gene inco 3. churingiensis or 3. cereus cells can be carried ouc wich che same veccor as was used for che replicacion, or with a differenc veccor. The bifunccional veccors of che invencion are especially suicable. A few examples of bacterial hose cells c'nac are suitable for replicacion of the chimaeric gene include bacteria selecced from che genera Escherichia, such as E. coli, Agrobacteriurn. such as A. tumefaciens or A. rhizogenes, Pseudocionas, such as Pseudomonas spp. , 3acillus, such as 3. megaterium or 3. subcilis, etc.. As a result of the cransformacion process of che invencion it is now possible for the firsc cime, wichin ' r. F .y che scooe of chis invencion, also co use 3. churingiensis and 3. cereus '' 0\V themselves as host cells. Processes ror cloning heterologous genes in /.--j '1 r bacteria are described in US Patents 4 237 224 and 4 463 464. ■, -'i / The replication of genes in E. coli that code for the crystalline procein 29) of 3. churingiensis is described by Wong et al. (1983). '■$/ - - Some examples of yeas: host cells chac are suicable for che replicacion of che genes of che invencion include chose selected from che genus Saccharonvces (European Pacenc Applicacion E? 0 233 --1 ). Any veccor inco which che chimaeric gene can be inserced and which is replicaced in a suicable hose cell, such as m bacceria or /ease , can be used for che ampiificacion of che genes of che invencion. The vector may be derived, for example, from a phage or from a plasmid. Examples of veccors chac are derived from phages and chac can be used wichm the scope of this invention are vectors derived from Ml 3- and rrom \-phages. Some suitable vectors derived from Hi 3 phages include Ml3mpl3 and m!3mpl9. Some suicable veccors derived from X-p'nages include \gcll, \gt7 and \Charon4. Of che veccors that are derived from plasmids and are especially suitable for replicacion in bacceria, chere may be mentioned here by way of example p3R322 (^^3olivar ec al., 1 9 7 7), pUCl3 and pUCl9 31) 32) ( * Norrander ec al., 1933) and Ti-plasmids ( ~ 3evan ec al., 1933), without "he subject of che invention being in any way limited thereby. Preferred vectors for che amplification of genes in bacteria are pBR322, pUC13 and pUC19. Without any limitation being implied, especially direct cloning vectors, such as, for example, p3D347, p3D343, p3D64 and pU31664, and especially "shuttle" vectors, which have already been described in detail hereinbefore, may be mentioned for cloning directly in 3. thuringiensis and/or 3. cereus. Especially preferred within the scope of this invention are the bifuncClonal ("shuttle") vectors pXI 5 1 (=pKS1) and pXI93 (=pK9 3) which, introduced by cransformacion inco 3. churingiensis var. kurscaki HDlcryB and 3. cereus 569!C. have been deposited at the "Deutsche Sammlung von Mikroorganismen" (3raunschweig, Federal Republic of Germany), recognised as an International Depository, in accordance wich the requirements of the 3udapest Treaty under the number DSM 4573 (pXIol, introduced by transformation into 3. thuringiensis var. kurstaki HDlcry3) and DSM 4-571 . o - i5 - (p.\'I93, incroduced by cransformacion inco 3. churingiensis var. kurscaki HDlcry3) and DSM 4573 (pXl93, incroduced by cransformacion inco 3. cereus 569K). In order Co conscrucc a chimaeric gene suicable for replicacion in bacceria, a promocer sequence, a 5' uncranslaced sequence, a coding sequence and a 3' uncranslaced sequence are inserced inco a veccor or are assembled in che correcc sequence in one of che afore-described veccors. Suicable veccors according co che invencion are chose chac are capable of being replicaced in che hose cell. The promocer, che 5' uncranslaced region, che coding region and che 3' uncranslaced region can, if desired, firsc of all be combined in one unic oucside che veccor and chen inserced inco che veccor. Alcernacively, pares of che chimaeric gene can also be inserced inco che veccor individually. In che case of 3. churingiensis and 3. cereus cloning veccors chis process seep can be omicced since che entire unic isolaced from 3. churingiensis, consiscing of a 5' uncranslaced region, che coding region and a 3' uncranslaced region, can be inserced inco che veccor. The veccor furchermore preferably also concams a marker gene which confers on che hose cell a propercy by -hich ic is possible co recognise che cells cransformed uich che veccor. Marker genes chac code for an ancibiocic resiscance are preferred. Some examples of suicable ancibiocics are ampicillin, chloramphenicol, erychromycin, cecracvcline, hygromycin, G 413 and kanamycin. Also preferred are marker genes chac code for enzymes having a chromogenic subscrace. such as, for example, X-gal ( 5-bromo-4-chloro-3-indolyl-'3-D—galaccosiae) . The cransformed colonies can chen be dececced very easily by way of a specific colour reaction. ■•v / P Cf: Po ^ \ ■<1 •n O. >/ f V / - o - 229191 Trie insertion of che gene inco, or the assembly of che gene in, che veccor is carried out by •-•ay of standard processes, for example using recombinant DNA (^^Maniatis ec al., 1 932) and using homologous recombination (^^Hinnen et al., 1973). The recombinant DN'A technology processes are based on the vector first of all being cleaved and the desired DNA sequence being inserted between the cleaved portions of the veccor: the ends of che desired DNA sequence are then joined Co che corresponding ends of the vector. The vector is preferably cleaved wich suitable restriction endonucleases. Suicable restriction endonucleases are, for example, those chac form blunc ends, such as Sma I, Hpa I and Zco RV, as well as chose chat form cohesive ends, such as Zco RI, Sac I and Bam HI. The desired DNA sequence normally exists as a region of a larger DNA molecule, such as a chromosome, a plasmid, a transposon or a phage. The desired DNA sequence is in these cases excised from ics original source and, if desired, so moditied that its ends can be joined to those of the cleaved vector. If the ends of the desired DNA sequence and of the cleaved vector are blunc ends, chen they can, for example, be joined to one another with ligases specific for blunt ends, such as T4 DNA ligase. The ends of the desired DNA sequence can also be joined in che form of cohesive ends to the ends of the cleaved vector, in which case a ligase specific for cohesive ends, which may also be T4 DNA ligase, is used. Anocher suitable ligase specific for cohesive ends is, for example, the Z. coll DNA ligase. Cohesive ends are advantageously formed by cleaving the desired DNA sequence and the vector with che same restriction endonuclease, in which case the desired DNA sequence and the cleaved vector have cohesive ends chac are complemencary co each other. The cohesive ends can also be conscrucced by adding complemencary homopolymer cails to the ends of che desired DNA sequence and of the cleaved vector with the aid of terminal deoxynucleocidyl transferase. Alcernacively, cohesive ends can be produced by adding a synchecic oligonucleocide sequence chac is recognised by a particular rescriccion endonuclease and is known as a linker, and cleaving che sequence --ich che Ic is chus now possible for che firsc cime, vichin che scope of chis invencion, genecically co modify ,3. churingiensis genes, and especially o-endotoxin-encodmg DN'A sequences , outside 3. thuringiensis, co clone chose genes and chen co recurn them inco 3. churingiensis and/or 3. cereus cells . where che said o-endotoxm genes can be expressed (in a homologous bacterial host syscem). This means that ic is no--- possible also for the genome of 3. thuringiensis to be manipulated genecically in a specifically controlled manner by first of all generating large amounts of plasmid material in a foreign cloning system and then introducing this into 3. thuringiensis by transformacion. The possibility of modifying che o-endotoxm genes and the control sequences regulacing the expression of those genes is of particular interest here. Apart from chimaeric genes, it is obviously also possible for any other chimaeric genetic construct to be inserted inco 3acillus churingiensis and/or 3acillus cereus cells using che process of the invention. It is thus, for example, conceivable, using the process of che invention, to insert non-coding "anci-sense" DNA inco che genome of a 3acillus churingiensis and/or 3acillus cereus cell, so chac in che course of the expression of the said "anti-sense" DNA a mRNA is transcribed chat inhibits che expression of che corresponding "sense" DNA. In chis manner it is possible to inhibit in a specifically controlled manner the exoression in 3acillus thuringiensis and/or 3acillus cereus of certain ^ t a undesired genes. endonuclease (see. for example, Maniatis et al., 1932). P I if r: r - LB - 2*yi31 Furthermore, apart: from che preparacion of improved, '-elI-defined 3. churingiensis scrains for che preparacion of improved bioinseccicides, ic is now also possible Co use 3. thuringiensis as a general nose for cloning and, if desired, expressing hecerologous and/or homologous genes. In a specific and preferred embodiment of che process of che invencion ic is furthermore noc possible for che firsc cime co clone ne'-' genes, and especially new procoxin genes, direccly in che nacural hose, chac is Co say in 3. churingiensis or 3. cereus. In che search for new procoxin genes, firsc of all a gene library of 3. churingiensis is creaced. In a firsc process seep, che cocal DNA of a procoxir.-producing 3. churingiensis scrain is isolaced by processes chac are known per se and chen broken down inco individual fragmencs. The 3- churingiensis DNA can be fragmented eicher mechanically, for example by che accion of shearing forces, or, preferably, by digescion wich suicable resericeion enzymes. Digescion of che DN'A sample is partial or complece, depending on che choice of enzymes. »'ichin the scope of this invention, che use of resericeion enzyrnes chat contain quaternary recognition sites and/or result in a partial digescion of che 3. churingiensis DNA are especially preferred, such as, for example, che rescriceion enzyme Sau IIIA, buc chis preference does noc imply any limicacion. Obviously, it is also possible to use any other suitable restriction enzyme in the process of the invention. The restriction fragments obcained in the afore-described manner are chen separated according to sue by processes known pe r se. Size-dependent separation of DNA fragments is usually effected by centrifuging processes, such as, for example, saccharose gradient cencrifugation, or by e lec t ropho re cic processes, such as agarose gel electrophoresis, or by a combination of those processes. Those fractions containing fragments of the correct size, thac is fragments that on account of their size are capable of coding for protoxin, are pooled and used for the next process steps. :o say ; /O", 49 - 2lj±01 The previously isolated fragments are firsc of all inserted into suitable cloning vectors using standard processes, and then inserted directly into 3acillus thuringiensis or 3. cereus. but preferably into procoxin-free scrains of 3acill<js thuringiensis. using che transformation process of che invention. The veccors used may be either gram-positive plasmids, such as, for example, p3C16, pU31I0, pC194, or the "shuttle" vectors described in detail hereinbefore. The shuttle vector pXl2Q0, which is described in detail hereinafter (see Example 9.1), is especially preferred within the scope of this invention. Suitable vectors preferably concain DNA sequences chat ensure easy identification of the transformed vector-containing clones from among the immense number of untrans:ormed clones. Especially preferred are DNA sequences coding for a specific marker that on expression results in an easily selectable feature, such as, for example an antibiotic resistance. There may be mentioned by way of example here a resistance to ampicillin, c'nlo ramphenico 1, e"/chromycin, tetracycline, hygromycin, G413 or kanamycin. Also preferred are marker genes chac code for enzymes having a chromogenic substrate, such as, for example, X-gal (5-bromo-4-chloro-3-indolyl-Q-D-galactoside). The transformed colonies can chen be detected very easily by way of a specific colour reaction. Afcer electroporation the treated 3acillus thuringiensis or 3. cereus cells a re transferred to a selective sporulacion medium and are incubaced uncil sporulacion is complece ac a temperature of from 10aC co 40°C, preferably from 20°C co 35°C, and more especially at a cemperacure of from 29°C co 31°C. The sporulacion medium concains as selective substance preferably one of the a'oove-mencioned ancibiocics, depending on che veccor used, and a suicable solidifying agenc, such as, for example, agar, agarose, gelacin ecc.. In che course of sporulacion, autolysis of che sporulacing ceils occurs, which is advancageous in industrial scale processing for the subsequent screening since breaking open the ceils art is dispensed wich. V"*1 C / I. \ / - 50 - 2^i0: In clones chac contain che desired procoxin gene and are expressed under che concrol of their nacural promocer, che cryscalline proceins formed are freely accessible in che medium. These cryscalline proceins which exist freely m che medium can chen be immobilised, for example with che aid of membrane filcers or by ocher suicable measures. Suitable membrane filcers are, for example, nylon or nicrocellulose membranes. Membranes of chis kind are freely available on che markec. The crystalline proceins immobilised in chis manner can chen be located and idencified very simply in a suicable screening process. Immunological screening using procoxin-specific ancibodies is preferred within che scope of chis invencion. Immunological screening processes are known and are described in detail, for example, in "^^Young ec al., 1983. The use of monoclonal antibodies that recognise quite specirically a particular region of che protein molecule is especially preferred vichin the scope of the process of the invention. These ancibodies can be used either on their own or in the form of a mixture. Ic is, of course, also possible, however, co use polyclonal ancisera for the immunological screening. Mixtures based on monoclonal and polyclonal antibodies are also possible. Processes for the production of monoclonal antibodies co 3acillus churingiensis procoxin proceins are known and are described in detail, for example, in ^ ^ Hu'oe r-Lu kac (1934) and in Hube r-Lukac et al, (1986). These processes can also be used in the present case. The immunological screening process based on antibodies is pare or che presenc invention. It is obviously also possible within the scope or this invention--.to use other suitable screening processes for locating novel DNA sequences in 3. thuringiensis and/or 3. cereus. I! f 9 <•< . i * ; / ,t. - i. Jr - ? - 51 - 3acillus churingiensis and 3. coreus cells that have been transformed using the afore-described process, and the toxins produced by these transformed 3ac illus cells, are excellently suitable for controlling insects, but especially for controlling insects of the orders Lepidootera. Dipcera and Coleopcera. The present invention accordingly also relates to a method of controlling insects •-•hich comprises treating insects or the locus thereof a) i t h 3. thuringiensis or 3. cereus cells, or with a mixture of the C-*o, thac have been transformed -ith a recombinant DNA molecule containing a scructural gene that codes for a o-endotoxin polypeptide occurring naturally in 3. thuringiensis or for a polypeptide essentially homologous therevich; or alcernacively b) •-ith a cell-free cryscalline body preparacion containing a protoxin that is produced by the said transformed 3acillus cells. The present invencion also includes inseccicidal compositions that, in addition to the conventionally employed carriers, dispersants or carriers and dispersants, contain a) 3. thuringiensis or 3. cereus cells, or a mixture of the f-o, that have been cransformed vich a recombinanc DNA molecule containing a scruccural gene chac codes for a 6-endocoxin polypepcide occurring naturally in 3. thuringiensis or for a polypeptide essentially homologous therewith; or alcernacively b) a cell-free cryscalline body preparacion containing a protoxin thac is produced by the said transformed 3acillus cells. For use as insecticides, the transformed microorganisms containing the recombinanc 3. churingiensis toxin gene, preferably cransformed living or dead 3. thuringiensis or 3. cereus cells, including mixtures of living 3nd dead 3. thuringiensis and 3. cereus cells, as veil as che toxin proteins produced by the said transformed cells, are used in unmodified form or, preferably, together wich adjuvants customarily employed in che arc of formulation, and are formulaced in a manner known per se, for example inco suspension concencraces, coatable pastes, directly sprayable or dilucable solutions, weccable pouders, soluble powders, dusts, granulates, and also encapsulations in, for example, polymer substances. As wich che nature of che composicions, che methods of appiicacion, such as spraying, atomising, dusting, scattering, coating or pouring, are chosen in accordance with the intended objectives and the prevailing circumstances. Furthermo re it is obviously also possible to use inseccicidal mixtures consisting of transformed living or dead 3. thuringiensis and/or 3. cereus cells and cell-free crystalline body preparations concaining a procoxin produced by the said transformed 3acillus cells. The formulations, that is to say the compositions or preparations concaining the transformed living or dead 3ac1llus cells or mixtures thereof and also the toxin proteins produced by the said transformed 3a c i11 u s cells and, where appropriate, solid or liquid adjuvancs, are prepa red in known manner, for example by intimately mixing the transformed cells and/or toxin proteins with solid carriers and, where appropriate, surface-active compounds (surfactants). The solid carriers used e.g. for dusts and dispersible powders, are normally natural mineral fillers such as calcite, talcum, kaolin, moncmorillonite or attapulgite. In order co improve the physical properties it is also possible to add highly dispersed silicic acid or highly dispersed absorbent polymers. Suitable granulated adsorptive carriers are porous types, for example pumice, broken brick, sepiolice or benconite; and suitable nonsorbenc carriers are, for example, calcice or sand. In addicion, a greac number of pregranulaced macerials of inorganic or organic nature can be used, e.g. especially dolomice or pulverised plane residues. Suitable surface-active compounds are non-ionic, cationic and/or anionic surfactants having good dispersing and wetting properties. The term "surfactants" will also be understood as comprising mixtures of surf ac tant s. 3oth so-called water-soluble soaps and also water-soluble synchecic surface-active compounds are suicable anionic surfactants. - 53 - 22 9 1 Suitable soaps are the alkali metal salts, alkaline earth metal sails or unsubstituted or substituted ammonium salts of higher fatty acids (Cio-Ciz), e.g. the sodium or potassium salts of oleic or stearic acid or of natural fatty acid mixtures which can be obtained e.g. from coconut oil or tallow oil. Mention may also be made of fatty acid methyltaurin salts, such as, for example, the sodium salt of cis-2-(methyl-9-octa-decenylamino)-ethanesulfonic acid (content in formulations preferably approximately 3 %). More frequently, however, so-called synthetic surfactants are used, especially fatty sulfonates, fatty sulfates, sulfonated benzimidazole derivatives or alkylarylsulfonates or fatty alcohols, such as, for example, 2,4,7,9-tetramethyl-5-decyne-4,7-diol (content in formulations preferably approximately 2 %). The fatty sulfonates or sulfates are usually in the form of alkali metal salts, alkaline earth metal salts or unsubstituted or substituted ammonium salts and contain a Ce-C;zaikyi radical which also includes the alkyl moiety of acyl radicals, e.g. the sodium or calcium salt of lignosulfonic ncid, of dodecylsulfate or of a mixture of fatty alcohol sulfates obtained from natural fatty acids. These compounds also comprise the salts of sulfated and sulfonated fatty alcohol/ethylene oxide adducts. The sulfonated benzimidazole derivatives preferably contain 2 sulfonic acid groups and one fatty acid radical containing 8 to 22 carbon atoms. Examples of alkylarylsulfonates are the sodium, calcium or triethanolamine salts of dodecylbenzenesuIfonic acid, di-butylnaphthalenesulfonic acid, or of a condensate of naphthalenesulfonic acid and formaldehyde. Also suitable are corresponding phosphates, e.g. salts of the phosphoric acid ester of an adduct of p-nonylphenol with 4 to 14 moles of ethylene oxide. - 54 - 22 9 1 Non-ionic surfactants are preferably polyglycol ether derivatives of aliphatic or cycloaliphatic alcohols, saturated or unsaturated fatty acids and alkylphenols, said derivatives containing 3 to 30 glycol ether groups and 8 to 20 carbon atoms in the (aliphatic) hydrocarbon moiety and 6 to 18 carbon atoms in the alkyl moiety of the alkylphenols. Further suitable non-ionic surfactants are the water-soluble adducts of polyethylene oxide with polypropylene glycol, ethylenediaminopoly-propylene glycol and alkylpolypropylene glycol containing 1 to 10 carbon atoms in the alkyl chain, which adduces contain 20 to 250 ethylene glycol ether groups and 10 to 100 propylene glycol ether groups. These compounds usually contain 1 to 5 ethylene glycol units per propylene glycol unit. Examples of non-ionic surfactants are nonylphenolpolyethoxvethanols, castor oil polyglycol ethers, polypropylene/polyethylene oxide adducts, tributylphenoxypolyethoxyethanol, polyethylene glycol and octylphenoxy-polyethoxyethanol. Fatty acid esters of polyoxyethylene sorbitan, e.g. polyoxyethylene sorbitan trioleate, are also suitable non-ionic surfactants. Cationic surfactants are preferably quaternary ammonium salts which contain, as N-substituent, at least one Ce-Cjjalkyl radical and, as further substituents, unsubstituted or halogenated lower alkyl, benzyl or hydroxy-lover alkyl radicals. The salts are preferably in the form of halides, methylsulfates or ethylsulfates, e.g. stearyltrimethylammonium chloride or benzyldi(2-chloroethyl)ethylammonium bromide. The surfactants customarily employed in the art of formulation are described, inter alia, in the following publications: 1986 International McCutcheon's Emulsifiers & Detergents, The Manufacturing Confectioner Publishing Co., Glen Rock, NJ, USA; Helmut Stache "Tensid-Taschenbuch" Carl Hanser-Verlag Munich/Vienna 1981. - 55 - The agrochemical compositions usually contain 0.1 to 99 %, prererably 0.1 co 95 %, of the transformed living or dead 3acillus cells or mixtures thereof or of the toxin proceins produced by the said transformed Bacillus cells. 99.9 co 1 %, preferably 99.3 co 5 %, of a solid or liquid adjuvant, and 0 to 25 %, preferably 0.1 to 25 %, of a surfactant. Whereas commercial products will preferably be formulated as concentrates, the end user will normally employ dilute formulations. The compositions may also concain further auxiliaries such as stabilisers, antifoams, viscosity regulators, binders, cackifiers as well as fertilisers or other active ingredients for obtaining special ettects. The cransformed living or dead Bacillus cells or mixtures thereof containing the recombinant 3. thuringiensis toxin genes, as well as the toxin proteins produced by the said transformed 3acillus cells, are excellently suicable for controlling insect pests. Plant-destructive insects of the order Leoidoptera should preferably be mentioned here, especially chose of the genera Piens ■ Heliothis . Spodoptera and Plute11a. such as. for example, Pieris brassicae. Heliothis virescens, Heliothis ;ea, Spodoptera littoralis and Plutella xylostella. Other insect pests that can be controlled by the afore-described inseccicidal preparations are. for example, beetles of the order Coleoptera, especially those of the Chrysomelidae family, such as, for example, Diabrotica undecimpunctata. D. longicornis , D. virgitera, D. undecimpunctata howardi, Agelastica alni, Leptmotarsa decemlineata etc., as well as insects of "he order Dipcera, such as, for example. Anopheles sergencii, Uranatenia unguiculata. Culex univittatus. Aedes aegypci, Culex pipiens. etc.. The amounts in which the 3acillus cells or the toxin proteins produced by them are used depends on the respective conditions, such as, tor example, the weather conditions, the soil conditions, the plant growth and the time of application. - 56 9' v ' 6 O JL Formulation Examples for macenal concaining 3. churingiensis coxin In che following Formuiacion Examples che Cera "3ac illus cells" is used Co mean chose 3. churingiensis and/or 3. cereus cells concaining a recombinanc 3. churingiensis gene of che invencion. (The figures given are percencages by weighc throughout). Fl. Granulaces a) b) Bacillus cells and/or coxin protein produced by chese cells 5% 10 kaolin 9^ % - highly dispersed silicic acid 1 % - atcapulgice - 90 The 3acillus cells and/or coxin procein produced by chese cells are firsc of all suspended in mechylene chloride, chen che suspension is sprayed onco che carrier, and che suspending agenc is subsequencly evaporaced orf in vacuo. F2. Du s c s a) b) Bacillus cells and/or coxin procein produced by chese cells 2 % 5 % hig'nlydispersedsilicicacid 1% 5% Calcum 97 % - kaolin - 90 % Ready-for-use dusts are obcained by incimacely mixing the carriers vich che 3acillus cells and/or with coxin procein produced by chese cells. F3. Wet cable powders 3acillus cells and/or toxin procein produced by chese ceils sodium lignosulfonace sodium laurylsulface sodium diisopropvInapnchalene-sulfonace a) 25 b) 50 % c) 75 % 10 - 57 - 91 occylphenol polyechylene glycol echer (7-3 moles of ethylene oxide) highly dispersed silicic acid kao1 in 2 % 10 % 27 % 10 % The 3acillus cells and/or coxin procein produced by chese cells are carefully nixed wich che adjuvancs and che resulting mixture is chen choroughly ground in a suicable mill, affording weccable powders, which can be diluced wich water co give suspensions of che desired concencracion. Fi. Extruder granulates Bacillus ceils and/or coxin procein produced by chese cells 10 % sodium lignosulfonace 2 % carboxymechylcellulose 1 % kaolin 37 % The 3ac illus cells and/or coxin procein produced by these cells are mixed wich che adjuvancs, carefully ground, and che mixcure is subsecuencly moistened wich water. The mixture is extruded and then dried in a scream of air. F5. Coaced granulate 3aclllus cells and/or toxin protein produced by these cells 3 % polyechylene glycol 200 3 % The homogeneously mixed 3acillus cells and/or coxin procein produced by chese cells are uniformly applied, in a mixer, Co che kaolin moiscened wich che polyechylene glycol. Non-duscy coaced granulaces are obcained in chis manner. kaolin 91* 5/ '' >,i r - 53 - 2^JiDl F6. Suspension concentrate 40 % 10 % 6 % 3 % 1 % 0.1 % 39 % *Alkyi is preferably linear alkyl having from 10 co 14, especially from 12 Co 14, carbon acorns, such as, for example, n-dodecylbenzenesulfonic acid triethanolamine sale. The homogeneously mixed 3acillus ceils and/or coxin procein produced by chese cells are intimately mixed '-ich che adjuvancs, giving a suspension concencrace from which suspensions of any desired concencracion can be obcained by dilucion wich wacer. Examples General recombinanc DNA techniques Since many of che recombinanc DN'A cechniques used in chis invention are roucine for che skilled person, a brief description of che cechniques gene rally used is given in the following so that these general details need not be given in che Embodiment Examples themselves. Unless expressly indicated otherwise, ail of chese methods are described in the reference., work by Maniatis ec al., 1982. 3acillus. cells and /or coxin procein produced by chese cells echylene glycol nonylp'nenol polyechylene glycol (15 moles of echylene oxide) alkylbeneenesulfonic acid criechanolamine sale* carboxymechylcellulose silicone oil in che form of a 75 % aqueous emulsion water 7 22 9 1 - 59 - A. Cleaving with restriction endonucleases The reaction mixture will typically contain about 50 jjg/ml to 500 pg/ml DNA in the buffer solution recommended by the manufacturer. New England Biolabs, Beverly, MA.. From 2 to 5 units of restriction endonuclease are added for every pg of DNA and the reaction mixture is incubated at the temperature recommended by the manufacturer for from one to three hours. The reaction is stopped by heating at 65°C for 10 minutes or by extraction with phenol, followed by precipitation of the DNA with ethanol. This 33) technique is also described on pages 10^ to 106 of the Maniatis et al. reference work. B. Treatment of the DNA with polymerase to produce blunt ends 50 yg/ml to 500 pg/ml DNA fragments are added to a reaction mixture in the buffer recommended by the manufacturer, New England Biolabs. The reaction mixture contains all four deoxynucleotide triphosphates in concentrations of 0.2 mM. An appropriate DNA polymerase is added and the reaction is carried out for 30 minutes at 15°C and is then stopped by heating for 10 minutes at 65°C. For fragments obtained by cleaving with restriction endonucleases that produce 5' cohesive ends, such as Eco RI and Bam HI, the large fragment, or Klenow fragment, of DNA polymerase is used. For fragments obtained using endonucleases that produce 3' cohesive ends, such as Pst I and Sac I, T^ DN'A polymerase is used. The use of these two enzymes is described on pages 113 to 121 of the 33) Maniatis et al. reference work. C. Agarose gel electrophoresis and cleaning DNA fragments to remove gel contaminants Agarose gel electrophoresis is carried out in a horizontal apparatus as 33) described on pages 150 to 163 of the Maniatis et al. reference work. The buffer used corresponds to the Tris-borate buffer or Tris-acetate described therein. The DNA fragments are stained with 0.5 pg/ml ethidium bromide which either is present in the gel or tank buffer during electrophoresis or is not added until after electrophoresis, as desired. The DNA is made visible by illumination with long-wave ultra-violet light. If the N 22 9 1 9 1 60 fragmencs are co bo separated from the gel, an agarose that gels at low temperature, obtainable from Sigma Chemical, St. Louis, Missouri, is used. After electrophoresis, the desired fragment is excised, placed in a small plastics tube, heated at 65°C for about 15 minutes, extracted three times with phenol and precipitated twice with ethanol. This method has been changed slightly compared with the method described by 33) Maniatis et al. on page 170. Alternatively, the DNA can be isolated from the agarose gel with the aid of the 'Ceneclean Kit' (Bio 101 Inc., La Jolla, CA, USA). D. Removal of 5' terminal phosphates from DNA fragments During the plasmid cloning steps, treatment of the plasmid vector with phosphatase reduces the recircularisation of the vector (discussed on 33) page 13 of the Maniatis et al. reference work). After cleaving the DNA with che appropriate restriction endonuclease, one unit of calf intestinal alkaline phosphatase, which can be obtained from Boehringer-Mannheim, Mannheim, is added. The DNA is incubated for one hour at 37°C and then extracted twice with phenol and precipitated with ethanol. E. Joining of DNA fragments If fragments having complementary cohesive ends are to be joined to one another, about 100 ng of each fragment are incubated in a reaction mixture of from 20 pi to AO pi with about 0.2 unit of T4 DNA ligase from New England Biolabs in the buffer recommended by the manufacturer. The incubation is carried out for from 1 to 20 hours at 15°C. If DNA fragments having blunt ends are to be joined, they are incubated as described above except that the amount of T4 DNA ligase is increased to from 2 to A units. - 61 - 2^91 F. Transformacion of DNA in E• coli £■ coli sC rain H3101 is used for aiost experimencs. DN'A is incroduced inco 33) E. coli using che calcium chloride process described by Maniatis ec al., pages 250 co 251 . G. Screening of £ - coli for plasmids Afcer cransformacion, che resulcing colonies of Z. coli are examined for che presence of che desired plasmid by a rapid plasmid isolacion process. Tuo commonly used processes are described on pages 366 co 369 of che 33) Maniacis ec al. reference work. H. Large-scale isolacion of plasmid DNA Processes for che large-scale isolacion of plasmids from E- coli are 33) described on pages 33 co 9A of che Maniacis ec al. reference work. Media and 3uffer Solucions L3 medium [g/l! crypcone 10 veasc excracc 5 NaCl 5 Ancibiocic medium No. 3 (Difco Laboratories) t g/1 J bovine meac excracc 1.5 yeasc excracc 1.5 // \ ^ ^ \ - c \ pepcone 3 - .g,- glucose 1 'i ^9/) £ —I) NaCl 3.5 H?0u 3.63 ' f v r- KH ; ?01. 1.32 - 62 - 22 SCGY medium casamino acids yeast extract glucose K2HPOU KH 2 POi. Na3-citrate (NHu)zSOu MgSOi. • 7 H20 22) GYS medium ( Yousten & Rogoff, 1969) [g/1] glucose 1 yeast extract 2 (NH<.)2SOu 2 K2 HPOi, 0.5 MgSCU • 7 H20 0.2 CaCl2 • 2 H20 0.08 MnSOi. • H20 0.05 pH adjusted to 7.3 before autoclaving. PBS buffer [mM] saccharose 400 MgCl2 1 phosphate buffer, pH 6.0 7 [g/1] 1 0.1 5 14 6 1 2 0.2 63 O iO 23191 T3ST buffer U-M] T'-'een 20* Tns/HCl* (pri 3.0) NaCl 0.05 7/ 1 (v/v) 10 150 *Tveen 20: polyethoxysorbitan laurate *T ris/HCl: ct, ot, a-Tris( hy droxy me t hy 1) me chy la mino h yd ro chloride The internal reference prC c ho sen for designating the plasmids in che Priority Document has been replaced in the Auslandsfassung (foreign filing text) by the officially recognised reference pXI. Also, the designation for the asporogenic 3. thurineiensis HD1 mutants used in the Embodiment Examples has been changed from cryQ co cry3. Example 1 : Transformation of 3- thuringiensis using electro po ration Example 1■I: 10 ml of an L3 medium (trypcone 10 g/1, yeast extract 5 g/1, N'aCl 5 g/1) are inoculated vith spores of 3. thuringiensis var. kurscaki 39) HDlcry3 ( Scahly D.?. et al., 1973), a plasmid-free variant of 3. thuringiensis var. kurscaki HD1. This batch is incubated overnight at a temperature of 27°C using a rotary shaker at 50 revs/min. Subsequently the 3. thuringiensis culcure is diluted 100-fold m from 100 ml to -00 ml of L3 medium, and further cultured at a temperature of 30°C using a rotary shaker at 2 50 revs/min uncil an optical density (OD533) of 0.2 is reached. The cells are harvested by centrifugation and suspended in 1/40 volume of an ice-cooled ?3S buffer (400 mM saccharose. 1 m.H MgCl;, 7 mM phosphate buffer pH 5.0). Centrifugation and subsequent suspension of the harvested 3. thuringiensis cells in ?3S buffer is repeated once more. The cells precreated in this manner can be electroporated either directly, or alternatively after the addition of glycerin to the buffer J - 6^ - 2^191 solution [20 % (v/v)], and are scored ac from -20°C co -70°C, and used ac a lacer poinc in cine. 300 pi aliquocs of che ice-cooled cells are chen cransferred inco precooled cuvecces. 0.2 pg pBClo plasmid DNA ( *^3ernhard K. ec al., 1973) (20 )jg/ml) is subsequencly added, and che encire bacch is incubaced ac i°C for 10 minuces. If deep-frozen cell macerial is used, a suicable aliquoc of frozen cells is firsc chawed in ice or ac room cemperacure. The furcher creacmenc is analogous Co che procedure used for fresh cell ma ce rial. The cuvecce is chen incroduced inco an eleccroporacion apparacus and che B. churingiensis cells presenc in che suspension are electroporated by che action of volcages of from 0.1 kV co 2.5 kV from a single discharge of a capacitor. The capacicor used has a capacitance of 25 pF and che discance becveen che electrodes in che cuvetce is 0.^ cm, which, when discharge occurs resulcs, depending on che setting, in an exponencially decreasing field strength with inicial peak values of from 0.25 kV/cm to 5.25 kV/cm. The exponential decay cime lies in che range of from 10 ms to 12 ms. An eleccroporacion apparatus from the firm 3io Rad ("Gene Pulser Apparatus", '/1S5-2075, 3io Rad, l&l^ Harbour Way South. Richmond, CA 9^30&, USA), for example, can be used for the described eleccroporacion experimencs. Ic is obviouslv also possible co use anv other suitable apoaracus in che^"^ ~\ L f-t /"*" /■ process of the invention. ■'A t ['I After a further 10 minutes' incubacion ac ^°C, che cell suspension is'!' ' >'9/ '-jj diluced with 1.2 ml of L3 medium, and incubaced for 2 hours at a r _ ,, temperature of 30°C using a rotary shaker at 250 revs/min. \ ■ .j Suitable dilucions are chen placed ouc onco LB agar (LB medium solidified wich agar. 15 g/1), which contains as an addicive an ancibiocic suicable o -65- 2^0101 for che seleccion of che newly obcained plasmid. In che case of p3Cio chis is tetracycline, which is added co che medium in a concencracion of 20 mg/i. K The cransformacion frequencies achieved for 3. churingiensis HDlcry3 and p3C16 as a funccion of che initial voltage applied for a given distance between places are reproduced in Figure 1. The expression of che inserced DNA can be dececced by way of che tecra-cycline resiscance chac occurs. As soon as 2 hours afcer che incroauccion by cransformacion of p3C16 inco 3. thuringiensis a complece phenocypic expression of che newly incroduced tecracycline resistance occurs (see Table 2). Example 1.2: The cransformacion of 3. thuringiensis cells is carried ouc in exactly che same manner as chac described in Example 1.1, except chac che volume of che cell suspension provided for che eleccroporacion is in chis case ^00 pi. The cransformacion frequency can be increased by a faccor of 10 by chis measure. Example 2: Transformacion of 3. churingiensis HDlcrv3 wich a number of differenc plasmids Hose of che cescs are carried ouc with plasmid p3C16, a nacurally occurring plasmid of 3. cereus. In addition, however, ocher nacurally occurring plasmids can also be successfully inserced inco 25) 3. churingiensis cells, such as. :or example, pUBllO ( Polack J. and ~>L) Novik R.?. , 1 982) , pC19& (" Horinouchi S. and Veisblum 3. , 1982) and pIHl3 ("^'.Hahler I- and Halvorson H.O. 1980) (see Table 3). Also, variants of chese plasmids chac are becter suiced than che natural'' isolaces for uork with recombinanc DNA can be incroduced by cransformacion inco che 3- churingiensis scrain HDlcry3 using che process of , E N che invencion, such as, for example, che 3. subcilis cloning vector pBDo-^ y (~ Grvctan T ec ai - , 1980) and plasmids p3D3i~. p3D3-3 and pUB^o^ (see,' 1 ^ - i 1, f - 66 - 2^i31 Table 3; plasmids pBD3«7, pBD3^3 and pU3166- can be obtained from Dr. V. Schurter, CI3A-GEIGY AG, Basle). The cransformacion results in Table 3 show clearly chat using che cransformacion process of che invention, cransformacion frequencies are achieved chac. with one excepcion, are all in che range of from 10* co 10; , irrespective of che plasmid DN'A used. Example 3: Conscruccion of a "shuccle" veccor for 3acillus churingiensis Existing bifunccional vectors for E. coli and 3. subcilis. such as, for i-1 ) example, pHV33 ( Primrose S.3. and Ehrlich S.D., Plasmid, 6: 193-201, 1981) are not suitable for 3. thuringiensis HDlcry3 (see Table 3). For the construction of a potent bifunccional veccor, firsc of all che large Eco RI fragment of pBCio is inserted with the aid of T^ DN'A ligase ">3) into the Eco RI site of plasmid pUC3 (" Vieira J. and Messing J. 1982). £. coli cells are then transformed '-ith chis construct. A construct recognised as correct by restriction analysis is designated pXl52. The removal of che Eco RI cleavage site situated distally from the pL'C3 polylinker region then follows. pXIo2 is linearised by a partial Eco RI digescion. The cohesive Eco RI ends are made up •-•ich Klenow polymerase and joined cogecher again with T A DNA ligase. After introduction into E. coli by transformation, a construct recognised as correct by restriction analysis is selected and designated pXl61. A map of pXI6i with che cleavage sites of restriction entymes chac cleave pXiSl only once, is shown in Figure 6. This construct can be incroduced directly into 3. thuringiensis HDlcryB using the transformation process described in Example 1. On account of the strong restriction barriers in 3. thuringiensis strains, the transformacion rates are lower when using pXISl DNA originating from E■ coli than when using plasmid DNA originating from B. thuringiensis HDlcry3 (see Table 3). Nevertheless pXISl proves to be very suitable for carrying out cloning experiments in 3. thuringiensis. Example A: Insertion of che Kurhdl delca-endocoxin gene inco strains of B. thuringiensis and 3. cereus The DN'A sequence coding for a Kurhdl del ta-endo toxin protein used within che scope of this invencion for insertion and expression in 3. churingiensis and 3. cereus originates from plasmid pK3o, which was deposited on Ath March 1935 under the Deposit Number DSM 3653 in accordance with che requirements of che 3udapesc Treaty for the International Recognition of the Deposit of Microorganisms for the Purposes of Patenting, ac che Deutsche Sammlung von Mikroorganismen, Federal Republic of Germany, which is recognised as an Incernacional Deposicory. A derailed description of the process for identifying and isolaCing che 6-endocoxin genes and for the construction of plasmid pK36 is contained in European Pacenc Application E? 0 233 Ail and is a pare of the presenc invencion in the form of a reference. pK36 plasmid DN'A is completely digested with the rescriccion enzymes Psc I and 3am HI and che A.3 Kb fragment, which concains the Kurhdl delca-endotoxin gene (cf. formula I), is isolated trom an agarose gel. This fragmenc is then inserted into pXIol, which has previously been digested with Pst I and 3am HI and treaced with alkaline phosphacase from calf's stomach. After the transformacion of E. coli H31Q1. a conscruct recognised as correct by restriction analysis is isolated and designated pXI93. A restriction map of pXl93 is reproduced in Figure 7. pXI93 can be introduced into 3. thuringiensis HDlcryB in 2 differenc ways . a) 3. thuringiensis cells are cransformed direcclv with a pXI93 isolace of E. coli using che transformation process of the invention described in Example 1. b) pXl93 is firsc of all incroduced inco 3. subcilis cells by Cransformacion, as described by Chang and Cohen, 1979. The complete and'intacC pXI93 plasmid DNA concained in a cransformanc is isolaced and then incroduced inco 3. churingiensis HDlcry3 by cransformacion using che eleccroporacion process described in Example 1. - 63 - 2L»±91 3och methods result in cransfornancs that contain che intact pXI93 plasmid, which can be demonstrated by restriction analysis. Example 5: Evidence of the expression of the de1ta-enaotoxin gene in 3. thuringiensis Sporulating cultures of 3. thuringiensis HDlcry3, HDlcry3 (pXIol), HDlcry3 (pX!93) and HD1 are compared under a phase contrast microscope at a magnification of A00. The typical bipyrimidal procein crystals can be detected only in the strain containing pXI93 and in HD1. Extracts from che same cultures are separated electrophoretically on an SDS poly-acrylamide gel. A protein band of 130,000 Dalton, which corresponds to che Kurhdl gene product, could be detected on che gel only for the strain containing plasmid pXl93 and m HDl (Figure 3a). In a «'escern bloc analysis (Figure 3b), chis 1 30,000 Dalton procein and ics degradacion products react specifically with polyclonal antibodies that have been prepared previously against crystalline protein of 3. thuringiensis var. kurscaki HDl in accordance with the process —Z7) described by Huber-LukacH., 1932. A detailed description or this process can be found in European Patent Application E? 238 which is a part of this invention in the form of a reference. Located on plasmid pXl93, upstream of the coxin-encoding region, is a 156 3d DNA region, which concains che afore-described spo rulac ion-dependenc candem promocer 29) ( Wong H.C. ec al., 1933). This sequence is adequace tor a high expression of che delta-endocoxin gene in 3. thuringiensis HDlcryB and B. cereus 569K. Example 5: Evidence of the toxicity of recombinanc 3. churingiensis HDlcry3 (oXI93) 3. churingiensis HDlcry3 and HDlcry3 (pXl93) are culcured ac 25°C in sporulacion medium (GYS medium). When sporulacion is complece, which is checked using a phase concrasc microscope, spores and (if presenc) procoxin cryscals are harvesced by cencrifugacion and sprav-dned. The resulting powder is admixed in various concencracions wich che food of L-1 larvae of Heliochis virescens (cobacco budworm) . The morcalicy of .-che-'p ? J- ' A' larvae is ascertained after six days. . y fo111 r.J ?/■/ L/p g - 69 - P k <J Kj O As expecced, che procoxin gene-free scrain HDlcry3 is non-coxic co Heliochis virescens. vhilsc che scrain transformed '-ich plasma pXI93 causes a dosage-dependent morcalicy of H. virescens (Table A). This denonscraces chac recombinanc scrains produced by che eleccroporacion process can accually be used as bioinseccicides. Example 7: Eleccroporacion of various 3- churingiensis and 3. saec. scrains The cransformacion prococol for 3. churingiensis HDlcry3 described under Example 1 can also be applied Co ocher scrains. All cesced scrains of 3. churingiensis var. kurscaki can be very simply and efficiently transformed by chis process (Table 5). Excellent cransformacion frequencies can also be achieved wich a laboratory scrain of 3. cereus. The same applies also co ocher cesced 3. churingiensis variecies (var. israelensis. var. kurscaki). 3y concrasc, cransformacion of 3. subcilis by the eleccroporacion process is very poor. Using che procoplasc-dependenc PEG mechod for 3. subcilis. on che other hand, cransformacion races of A x 105/pg plasmid DNA were achieved. The low cransformacion races of 3. subtilis obtained using the eleccroporacion technique are not associated with incorrectly selected para-meters, such as, for example, an unsuitable voltage, or with a high morcalicy race caused by electric pulses, as can be seen from Figure 9. Example 3: Transformation of 3. churingiensis HDlcrv3 with che 13-galacco — sidase gene 3.1. Insertion of a 3am HI restriction cleavage sice direcclv before che firsc AUG codon of che 3. churingiensis orocoxin gene 3efore che G-gaiaccosiaase gene from che plasmid pi«iTh5 (obtainable from Dr. M. Geiser, CI3A-GEIGY AG, 3asle, Switzerland) can be joined co che • promocer of che Kurhdl 5-endocoxin gene of 3. churingiensis. che DN'A sequence of che procoxin gene iocaced in che region of che Al'G scarc codon muse firsc be modified. This modificacion is carried out by o1igonucleoCide-directed mutagenesis using che single-stranded phage Ml3mp3 , which concains che 1.3 k3 Hinc II-Hind III fragmenc, of che 5-endocoxin gene concaining che 5' region or chac gene. Firsc of all 3 pg of plasmid pK36 (cf. Example A) are digesced wich che resericeion enzymes Hind III and Hinc II. The resulcing 1.3 kb fragmenc is purified by agarose gel eleccrophores is and Chen isolated from che gel. In parallel wich chis, 100 ng of Ml 3mp3 RF phage DN'A (3iolab, To:er Road, Beverly MA, 01915, USA or any ocher manufacturer) are digesced wich che rescriccion enzymes Sma I and Hind III, created wich phenol, and preci-picaced by che addicion of ethanol. The phage DNA treated in this manner is then mixed with 200 ng of che previously isolaced procoxin fragmenc and joined chereco by che addicion of TA DNA ligase. Afcer che cransfection of E■ coli JM103. 6 white plaques are selected and analysed by restriction mapping. An isolate in which the join between the G-galactosidase gene and the promocer of che Kurhdl 5-endocoxin gene of 3. ehur--rtg-gn<;-'-; has been carried ouc correctly is selected and designated Ml3mp3/Hinc-Hind. An oligonucleotide wich che following sequence is synchesited using a DNA synchesicing apparacus ("APPLIED 3I0SYSTEM DNA SYNTHESIZER"): (5 ' ) GTTCGGATTGGGATCCATAAG (3 ' ) This synchecic oligonucleocide is complemencary Co che Ml3mp3/Hinc-Hind DNA in a region that extends from position 153 co position 173 of che Kurdhl 5-endocoxin gene (cf. formula I). The oligonucleocide sequence reproduced above has a "mismacch" in posicions 152 and 153, however. - 71 - compared wich che sequence reproduced in formula I, so chac che formacion of a 3am HI resericeion cleavage sice is necessary- The general procedure for ehe mucagenesis is described by J. M. Zoiler and M. Smi ch 43) ( J.M. Zoiler and M. Smich; 19). Approximately 5 pg of single-seranded Ml 3mpl3/Hinc-Hind phage DN'A is mixed wich 0.3 pg of phosphorylaced oligonucleocides in a cocal volume of ^0 pi. This mixture is heaced for 5 minuces ac 65°C, cooled firsc Co 503C and chen, gradually, Co i°C. Buffer, nucleocide crip'nosphaces, AT?, T^ DNA ligase and che large fragmenc of DNA polymerase are chen added and che bacch is incubaced 43) overnighc ac 15°C in che manner described ( J.M. Zoiler and M. Smich) . Afcer agarose gel eleccrophoresis, circular double-scranded DNA is purified and inserced inco E. coli scrain JM103 by Cransfeccion. As an 3lcernacive, che E. coli scrain JM107 can be used. The resuIcing plaques are examined for sequences chac hybridize wich 3:?-Iabelied oligonucleocide; che phages are examined by DNA rescriccion endonuclease analysis. A phage chac concains a correct conscrucc in which a 3am HI cleavage sice is locaced direccly before che firsc AUG codon of ehe procoxin gene is designaced Ml3mp3/Hinc-Hind/3am. 3.2. Joining che fl-galaccosidase gene co che 6-endoCoxin oromoter 3.2.1: The 5-endocoxin promocer is on a 162 3p Eco RI/3am HI fragmenc of che Ml 3mp3/Hinc-Hmd/3am phage DNA. RF phage DNA is digesced wich rescriccion enzyme 3am HI. The projeceions resulcing ac che 5' ends are removed by creacmenc wich "Mung 3ean" nuclease (3iolabs) in accordance wich che manufaccurer 1 s ins c rue c ions . Subsequencly, che DNA is digesced wich che rescriccion endonuclease Zco RI and, afcer carrying ouc agarose o% gel eleccrophoresis, che 1 62 3d fragmenc is isolaced from cne agarose14' } -n gel. r) The fl-galaceosidase gene is isolaced from plasmid piWiTh5. pi^'iThS DNA is '• firsc of all cleaved ac che single Hind III cleavage sice. The 3' recessed ends are made up using che \lenow fragmenc of DNA polymerase (cf. 33) Maniacis ec al., 1983, oage 113-11^) and che modiried DNA is chen , . 2^121 digesced wich che rescriccion enzyme Sal I. The DN'A fragmenc concaining che Q-galaccosidase gene is isolaced by agarose gel eleccrophoresis. The veccor pXl61 (cf. Example 3) is digesced with che rescriccion enzymes Eco RI and Sal I and che c-o previously isolaced fragmencs are inserced inco che veccor pXl61. Afcer cransformacion of chis ligacion mixcure in che E. coli scrain H3101 or JM107, che correcclv joined clones are selecced by rescriccion analysis and by cheir Q-galaccosidase accivicy wich respecc co che chromogenic subscrace X-gal (5-bromo-i-chloro-3-indolyl-Q-D-galaccoside). A clone concaining a correcc genecic conscrucc is designaced pXI30. 8.2.2: In an alcernacive embodimenc, che 162 3p Eco RI/3am HI fragmenc concaining che 6-endocoxin promocer is isolaced by cleavage of Hi3mp3iHinc-Hind/3am wich Eco RI and Bam HI, followed by separacion by gel eleccrophoresis. The Q-galac cosidase gene is isolaced from plasmid piWiThS in chis inscance coo (cf. Example 3.1.). In chis case, che plasmid DN'A is digesced wich che rescriccion enzymes 3am HI and Bgl II and che large fragmenc is eluced from che agarose gel afcer gel eleccrophoresis. The veccor pHY300 PLK O/PHY-OOl; Toyobo Co., Led., 2-3 Dojima Hama 2-Chome, Kica-ku, Osaka, 530 Japan), which can be obcained commercially (cf. Example 9.1). is digesced wich che rescriccion enzymes Eco RI and 3gl II. The cwo previously isolaced fragmencs are chen inserced inco Che veccor pHY300 ?LK. The encire ligacion mixcure is chen incroduced by cransformacion inco Che E. coli scrain JH107 (3ec'nesda Research Laboracories (3RL), ^11 N, Sconescreec Avenue. Rockville, MD 20850, USA). A clone having a S-galac-cosidase accivicy is furcher analysed by rescriccion digescions. A clone concaining a correcc genecic conscrucc is designaced pXIlOl. r ri v KS . - 73 - 8.3. Introduction bv cransformacion inco 3. subcilis and 3. churingiensis of olasraid dXI3Q or pXIIQI pXI30 or dXIIOI plasmid DN'A is firsc of all incroduced inco 3- subcilis procoplascs by cransforroacion according co a known cesc prococol des- 13) cribed by Chang and Cohen (* Chang and Cohen, 1979). A correcc clone is selecced, che DNA Co be cransformed is isolaced by scandard processes and incroduced by cransformacion inco 3. churingiensis HDlcry3 cells by way of eleccroporacion (cf. Example 1). The Cransformed 3. churingiensis cells are placed ouc onco GYS agar (sporulacion medium), which concains X-gal as an addicive. Correccly Cransformed clones Curn blue when sporulacion commences. A 3. churingiensis HDlcryB strain cransformed by che pXIol veccor, on che ocher hand, remains white under che same condicions. Rescriccion analysis shows chac with correccly transformed clones, an intacc pXI30 or pXIlOl plasmid is presenc in che 3. churingiensis cells. 3. ^. fl-galaccosidase gene under che concrol of a soo rulac ion-deoenden c promo cer 3. churingiensis HDlcrvS cells concaining plasmid pXI30 or pXIlOl are culcured on GYS medium in che manner described hereinbefore. Ac incervals during che growth phase (boch during che vegecacive growth phase and during che sporulacion phase) a 3-galaccosidase assay is carried ouc in 44) accordance wich che test prococol described by J.H. Miller ("Experi-mencs in Molecular Genecics", Cold Spring Harbor Laboracory. 1972, Experimenc ^3 and ^9). The individual differences from che above-mencioned cesc prococol concern Che use of X-gal as chromogenic subscrace and che measuremenc of che coloured hydrolysis producc, which is formed by che cells afcer approximately 1 hour. ... / '■ /''■V \\ ^ ^ DfcC)99| j The cells are Chen removed by cencrifugacion, and che opcical densicy of che supernacanc is ascercained ac a wavelengch of 650 nm (OD;so). An increase in che opcical densicy as a funccion of sporulacion is observed. The non-cransformed 3- churingiensis ceils, on che ocher hand, cannoc nydrolyse che chromogenic subscrace X-gal. Example 9: Creacion of gene banks in 3acillus churingiensis 9.1. Conscruccion of dXI200 Plasmid pXl200 is a derivacive of plasmid pHY300 ?LK, which can be obcained commercially from Toyobo Co. , Led. (vPHY-OOl; Toyobo Co., Led. , 2-3 Dojima Hama 2-Chome, Kica-ku, Osaka, 530 Japan). Plasmid pHY300, che conscruccion of which is described in European Pacenc Applicacion R R E? 162 725, concains boch an ampicillin (amp*) and a cecracycline :ecr") resiscance gene. Plasmid pHY300 PLK is cotnplecely digesced •-•ich 3gl I and Pvu I. The resulcing rescriccion fragmencs are chen separaced by agarose gel eleccrophoresis. The Kb fragmenc is isolaced from che agarose gel, purified and chen religaced wich T- DNA ligase. The whole ligacion bacch is incroduced by cransformacion inco E. coli HB101. Afcer incu'oacion of che cransformed E. coli H3101 ceils ac 37°C on a seleccive L-agar concaining 20 pg/'ml cecracycline, che eecracycline-resiscanc (Tcr) cransformancs are selecced. Ic is chen possible co isolace from an ampicillin-sensicive (Aps) clone (100 pg/ml ampicillin) a plasmid chac has lose che Psc I cleavage sice in ehe Apr gene cogecher wich che 0.3 Kb ?vu I/3gl I fragmenc. This plasmid is designaced dXI200. 9.2 Cloning procoxin genes of 3acillus churingiensis var. kurscaki HDl in 3acillus churingiensis HDlcrvB The cocal DNA (50 pg) of 3acillus churingiensis var kurscaki HDl is complecelv digesced by incubacion vieh che rescriccion enzymes Psc 1 and Hpa 1. The rescriccion fragmencs so obcained are cransferred Co a concinuous saccharose gradienc [5 % (w/v) - 23 % (w/v)j where chey are separaced according co sice by densicy gradienc cencrifugacion and o -75- 2~Z±01 collected in 500 pi fractions. The cencrifugacion is carried ouc in a TST il-rocor (Koncron Aussendingrocor) ac a cemperacure of 153C ac max 2.- x IO5 g for a period of 16 hours. Subsequencly, in order co decermine che fragmenc size aliquocs, each of 50 pi, are cransferred co an agarose gel 1.0.3 % (•-•/v) agarose in Tris acecace EDTA or Tris borace 33) EDTA; see Maniacis ec al., 1932]. Those fraccions concaining fragmencs becueen 3 Kb and 6 Kb are pooled and concencraced co a volume of 10 pi by echanol precipicacion. 5 pg of che "shuccle" veccor pX!200 described in Example 9.1 are digesced wich che rescriccion enzymes Psc 1 and Sma 1. The 5' phosphace groups of che resulcing rescriccion fragmencs are chen removed by creacmenc wich calf incescinal alkaline phosphacase. 0.2 pg co 0.3 pg of che previously isolaced HDl DN'A is chen mixed wich 0.5 pg of che pXI200 veccor DNA and incubaced overnighc ac l^'C •-•ich che addicion of 0.1 U of T^ DNA ligase (so-called "Weiss Unics"; one unic of T^ DNA ligase corresponds co an enzymatic accivicy sufficienc co converc 1 nM [32?] from pvrophosphace ac a cemperacu re of 37°C and vichin a period of 20 minuces inco a Noric-absorbable macenal) . The encire ligacion bacch is chen incroduced by cransformacion direccly inco 3aciilus churingiensis HDlcry3 cells by means of eleccroporacion (cf. Example 1). The eleccroporaced 3. churingiensis ceils are chen placed ouc onco a seleccive sporulacion agar concaining 20 pg/mi of cecracycline as seleccing agenc, and incubaced ac a cemperacure of 25aC unci! sporulacion is complece. 9.3. Manufacture of monoclonal ancibodies Co 3. churingiensis orocoxin orocein The manufacCure of monoclonal ancibodies Co 5-endocoxin of 3acillus ' 1 ^ ''' ' churingiensis var. kurscaki HDl is carried ouc analogously co C'ne <; 1 36) 37) '**' yv ~ descriocion in Huber-Lukac (1984.) and in Huber-Lukacec ai. , v ""AX ( 1986). The hybridoma ceils used for che ancibody manufacture are fusion produces 45) of Sp2/0-Ag myeloma cells (described in Shuiman ec al., 1978: can be obcained ac che "American Type Culcure Colleccion" m Rockville, Maryland, USA) and splenocyces of 3aib/c mice chac have previously been immunised wich 5-endocoxin of 3. churingiensis var. kurscaki HDl. O. 799/ 7, . V / , - 76 - In chis manner ic is possible co obcain monoclonal ancibodies chac are direcced specifically againsc che o-endocoxin of 3. churingiensis. Especially preferred are monoclonal ancibodies chac eicher bind specifically Co an epicope in che S-cerminal half of che procoxin procein (for example ancibody 5^.1 of che Huber-Lukac ec al., 1936 reference), or recognise an epicope in che pare of che procein conscanc in Lepidopcera-accive protoxins, che C-cerminal half (for example ancibody 33.16 of che Huber-Lukac ec al., 1986 reference). Ic is, however, also encirely possible for ocher monoclonal or also polyclonal ancibodies eo be used for che subsequenc immunological screening (cf. Example 9.i). 9.^. Immunological Screening The monoclonal ancibodies produced in ocher suicable monoclonal ancibodies, sc reening. accordance wich Example 9.3, or are used for che immunological Firsc of all, che crysealline proceins presenc in free form afcer che sporulacion of che 3. churingiensis cells are bound by means of cransfer membranes (for example Pall 3iodyne cransfer membrane; Pall Ulcrafine Filcracion Corporacion, Glen Cove, N.Y.) by applying che filcer membranes to che places for a period of approximacely 5 minuces. The filcers are subsequencly washed for 5 minuces wich T3ST buffer 10.05 % (w/v) Tveen 20, 10 mM Tris/HCl (pH 3.0), 150 mM NaCl m bidist. H:0] and Chen, in order co block non-specific binding, incubaced in a mixture of T3ST buffer and 1 % (w/v) skimmed milk for from 15 Co 30 minuces. The filcers prepared in chis manner are chen incubaced ove rnig'n c wich che procoxin-specific ancibodies [ancibody mixcure of 5^.1 and 33.16 ("^'^Huber-Lukac ec al., ( 1 936)]. The unbound ancibodies are removed by washing che filcer chree cimes wich T3ST buffer for from 5 to 10 minuces each cime. To dececc che ancibody-bound procoxin che filcers are in- cu'oaced wich a further ancibody. The secondary ancibody used is an /•<, ^ anci-mouse antibody labelled with alkaline phosphatase, which can be--/ obcained commercially, for exaraole, from 3io-Rad [Kacalog ••/1 70-6 520 t 9 D E C ' ;'J> 9 L -.r r** r- , * . V / \-\i O • • , *JI Jl goat's anci-mouse IgG(H*L)-alkaline phosphacase conjugate]. Afcer an incubation period of 30 minutes the unbound secondary ancibodies are removed in the manner described above by washing Che lilters with TBST buffer three times (for from 5 co iO minuces each cime). The filcers are then incubated '-ich a subscrace mixcure consisting of N3T ['p-nicro blue tetratolium chloride; nicro-blue cecrazolium chloride] and 3CI? [5-bromo-^-chioro-3-indolylphosphace-p-coluidine sale]. The enzymatic reaction is carried out in accordance wich che manufacturer's instructions [3io-Rad; 1-1^ Harbour «ay Souc'n, Richmond CA, 9^304, USA]. Positive, thac is to say procoxin-concaining clones, can be recognised very easily by cheir violec colouring. This occurs as a result of the entyniacic reaction of the alkaline phosphatase with che afore-mentioned substrate mixture. 3ecween 300 and 1000 cransformancs result from the transformacion described in Example 9.2 wich the ligacion batch indicated in that Example. Of these transfor-ants 2 colonies exhibit clearly positive signals in che above-described enzyme reaction. Plasmid DNA is isolated from positive clones in which expression of che procoxin gene could be dececced by way of che described enzyme reaction. The cloned protoxin genes can be furcher characterised and ultimately identified by restriction analysis and comparison with known restriction maps . 3oth clones contain a recombinant plasmid with an insert of ^. 3 Kb. The subsequent restriction digestions with Hind III, ?vu II, Eco RI and Xba I permit identification of the gene on the insert by comparison with the known rescriccion maps of che endocoxin genes of B. thuringiensis var. kurscaki HDl. In both cases the gene is the Kurhdl gene, which is also known as the 5.3 Kb procoxin gene and is described in ^Geiser ec al-, 1 986. This gene, cloned directly in 3. churingiensis and identified by immunological screening, furthermore hybridises with a 13^7 3d 3ara Hi/Hind III fragment of the 5.3 Kb gene in plasmid pK36 (^Geiser et al., 1936). In - 73 - 91 che SDS/PAGE, boch clones exhibic a band of 130,000 Dalcon cypical of che ' o) procoxin, •-•hich in a -ejcern bloc ( Towbin ec al., 1 979) reacc specifically wich che afore-described (see Example 9.-) monoclonal ancibodies. Tables Table 1: Influence of che incubacion cime ac -3C, before and afcer eleccroporacion, on che cransformacion frequency. 3. churingiensis HDlcry3 was cransformed using che eleccroporacion process wich 0.2 pg pBClo per bacch. Example 1 1 2 1 3 u 5 6 7 3 preincu-bacion * (minu Ces) 0 5 10 20 20 20 20 20 subsequenc incubacion ** (minuces) 20 20 20 20 0 5 10 20 Transformacion frequency (Trans- forrnancs /pg Plasmid DNA) 2.5x10' 2.IxlO6 2.2x10s 2.3x10& 2. 5x105 1.9x10* 3.3xl06 1.7x10s ** Incubacion ac ~°C bec-een che addicion of DN'A and eleccroporacion Incubacion ac ^°C beeween eleccroporacion and che beginning of che express ion period - 79 - 2^x91 Table 2: Expression of che cecracycline resisCance of pBClS afcer incroduccion inco 3. churingiensis HD1cry3 by cransformacion 3. churingiensis HDlcry3 was cransformed --ich p3Cl5 plasmid DN'A ^ "v using che eleccroporacion prococol according co che invencion. Afcer various incubacion periods in L3 medium ac 30°C. che cransformed cells are selecced by placing ouc onco L3 agar concaining 20 pg/ml cecracycline. Time caken co express Cecracycline resis-Cance (hours) Transformacion frequency (Trans-formancs/pgDS'A) Number of living cells 0.5 0 4 x 10* 1 1.6 x !06 10' 2 3.3 x 10& 1.4 x 109 3 CO X O 1.6 x 10' •"i *■$) - 30 - r11 - o Table 3: Transformacion of "he 3. churingiensis scrain HDlcry3 with various plasmids 1 Plasmid Origin resistance narse: gran negativej gran posiciv* naturally occuring plasmids Transrormation frequency p2C 1 6 3. cereus - Tc 1.9 x 10* pU3110 Scaohvlococcus Km, 31e 3.3 x 106 * aureus - pC194 S . aureus - Cm 6 x 10'* p IM1 3 3. subcilis - Em 1.3 x 10s modified plasmids/cloning vectors p3D64 pUBllO 5 x 106 replicon - Km, Cm p3D347 pIMl3 repli con, - Cm 2.9 x 10* p3D343 pIMl3 repli 1.1 x 10* con , - Em, Cm pU3l5oi pU3l!0 repli con , - Cm, Em 3.5 x 10" "shuccle" veccors pHV33 ■ p3R322/pCl9i. Am p, Tc Cm < 50* pKo 1 pUCS / p3C16, Amp Tc 2.3 x 10" 1: Tc: cecracycline: Km: kanamycin; 31e: bleomycin; Cm: chloramphenicol; Em: erychromycin 2: All plasmid DNA originaces from 3. thuringiensis KDlcry3 with che exception of * isolaced from 3. subtilis L3Gi-63. Table 4; 3iotest of 3. churingiensis HDlcrv3 and HDlcrv3 (pXl93) against Heliochis virescens. Spray-dried sporulaced cultures (spores and (if presenc) procoxin crystals) are admixed, in che amounts indicated, with the food of L-1 larvae of Heliothis virescens. n - 31 - £^01 Concencracion of spores and procoxin crystals (pg/g food) Morcalicy (%) of caused by: H. virescens HDl cry3 HDl cry3 (pX19 3) 200 0 57 100 0 43 50 3 27 25 0 10 12.5 0 0 Table 5: Transformabilicy of scrains of 3. churingiensis, 3. cereus and B. subcilis. All scrains were transformed wich plasmid pBCl5 m accordance wich che eleccroporacion process described under Example 1 Scrain 1 Trans Co rmac ion f requency 1 0, .25 0. , g 0. . 1 0, . 5 13. 3 2, 6 B. churingiensis var. icur s caxi 3. HDlcryB HDl dipel HDl -9 HD 7 3 HD 191 :huringiensis vai :huringiensis HD 2-D6-4 3. churingiensis •a r israelensis 3. L3G 'Z-UUUU ce reus 569 subcilis L3G 3-4463 / . D 0.0002 ^relative values based on che cransformacion frequency, defined as 1, achieved wich 3. churingiensis var. kurscaki HDlcryB. i ' i Deoosic of Microorganisms A culcure of each of che microorganisms lisced in che following chac are used wichin che scope of che presenc invencion has been deposicad ac che "Deucsche Sammlung von Mikroorganismen", recognised as an Incernacional Depository, in 3raunschweig , Federal Republic of Germany, in accordance with che requiremencs of che Budapesc Treacy for che Incernacional Recognition of che Deposit of Microorganisms for the Purposes of Patenting. A declaration concerning the viability of che deposited samples has been issued by the said International Depository. Deposit of Micoorganisms Lcroo rgam sms Depo sit Da t e Deposit Number Dace of che viabili cy certificate H3 101 (P:<35) (E. coli H3101 cransformed wich pK36 plasmid DNA) 4. March 1936 DSM 3663 7. March 1936 *HD1 cryS 4. May 1933 DSM 4 5 74 4. May 19 33 (3acillus chu ringiensis var. kurscaki HDl crv3 *HD1 cry3 (*pK 51) (3. churingiensis HDl cry3 transformed vith "*p!<61 plasmid DNA) Mav 19 38 DSM 45 72 4. Mav 1983 *HD1 cry3 (+pK 9 3) (3. churingiensis HDl cryS transformed with *pK93 plasmid DNA) 4. Mav 1933 DSM 4571 4. May 1933 569 :< (3acillus cereus 569 K) .. Mav 1933 DSM 457 5 4. May 1933 569 K (*PK 93) (3. cereus 569 K cransformed wich *pK9 3 plasmid DNA) 4. Mav 1933 DSM 4573 4. May 1983 The incernal reference pK selecced for the designation of che plasmids in che Prioricy DocumenC has been replaced for che Auslandsfassung (foreign filing cexc ) by che officially recognised designation pXI. Also, che designacion for che asporogenic 3. churingiensis HDl mucancs used in che Embodiment Examples has been changed ::om cryfl Co cry3. 83 Literature references 1. Goldberg L. and Margalit J., Mosquito N'e--s, 37 : 355-353, 1 97 7 2. Krieg A. et al., Z. Ang. Int., 96: 500-508, 1983 3. Sc'nnepf, H.E. and '-"hiteley H.R. , Proc. N'acl. Acad. Sci. , USA, 73: 2393-2397, 1981 4. Kiier A. et ai.. The IMBO J., 1: 791-799, 1932 5. Geiser M. et al., Gene, 43: 109-113, 1986 6. Haider M.Z. et al., Gene, 52: 235-290, 1987 7. Gonzalez J.M. et al., Proc. N'atl. Acad. Sci. USA, 79 : 6951-6955, 1982 8. Obukouicz M.G. et al., J. 3acteriol., 163: 932-939, 1936 9. Donovan L.P. et al., Mol. Gen. Genet., 214: 365-372, 1988 10. Schnepf H.E. and Vhitely H.R., J. 3iol. Chem., 260: 5273, 1935 11. Xlier A. et al.. Mol. Gen. Genet., 191: 257-262, 1933 12. 3ibb J.J. et al.. Nature, 274: 393-400, 1973 13. Chang S. and Cohen S.N., Molec. Gen. Genet., 153: 111-115, 1979 14. 3roun 3.J. and Carlton 3.C., J. 3acteriol., 142: 508-512, 1980 15. Kondo J.K. and McKay L.L., Appl. Environ. Microbiol., 43; 252-259, 1934 16. Wirt'n R. et al., J. bacterid. , 155: 331-336, 1986 17. Yoshihama M. et al., J. 3acteriol., 162: 591-597, 1985 18. Alikhanian S.J. et al., J. 3acteriol., 146, 7-9, 1981 19. Martin ?.A. et al., J. 3acteriol., 145: 980-933, 1981 20. Fischer H.M., Arch. Microbiol., 139: 213-217, 1984 21. Schall D., Genubertragung zvischen Isolaten von 3acillus thuringiensis durch Protoplastentransfornation und -fusion (Gene Cransfer be tween isolates of 3aclllus thuringiensis by protoplast cransformacion and fusion). Dissercation, University of Tubingen, 1936. 22. S'nivarova N. , Zeicschr. Allgem. Mikrobiol., 23: 595-599, 1933 23. Youston A.A. and Rogoff M.H., J. 3acteriol., 100: 1229-1236, 1969 24. Horinouchi S., and -eisblum 3., J. 3acteriol., 150: 315-825, 1982 25. Poiak J. and Novick R.P., Plasmid, 7: 152-152, 1982 26. Mahler J. and Halvorson H.O., J. Gen. Microbiol., 120: 259-253, 1980 27. Gryczan T. ec al., J. 3acceriol., 141: 246-253, 1980 28. Vieira J. and Messing J., Gene, 19: 259-263, 1982 29. Wong ec al., J. 3iol. Chem. , 253: 1960-1967, 1 983 •' - 34 - 229191 30. Bolivar ec al., Gene 2: 95-113, 1977 31. N'orrander ec al.. Gene, 25: 101-104, 1933 32. Bevan ec al., Nacure, 304: 1 34-1 37, 1 933 33. Maniacis ec al., Molecular Cloning. A Laboracory Manual, Cold Spring Harbor Laboracory, Cold Spring Harbor, USA, 1932 34. Hinnen ec al. , Proc. N'acl. Acad. Sci. , USA, 75: 1 929-1933, 1 973 35. Young R.A. ec al., Proc. Nad. Acad. Sci., USA, 30: 1194-1198, 1933 36. Huber-Lucac M., Dissercacion Mo. 7547 "Zur Incerakcion des delca-endocoxins von Bacillus churingiensis mic monoklonalen Ancikorpern und Lipiden" (on che inceraccion of che delca-endocoxin of 3ac-i 1 Ttis churingiensis wich monoclonal ancibodies and lipids), ETH Zurich, 1934 37. Huber-Lucac M. ec al., Infecc. Immunol., 54: 223-232, 1986 33. McCuccheon's, 1936 Incernacional McCuccheon's Emulsifiers & Decer-gencs. The Manufaccuring Confeccions Publishing Co., Glen Rock, NJ, USA. 39. Sca'nly D.P. ec al., 3iochem. 3iophys. Res. Comm., 34: 531-533, 1978 40. 3ernhard K. ec al., J. 3acceriol., 133: 897-903, 1978 41. Primrose S.3., Zhrlich S.D., Plasmid 0: 193-201, 1981 42. Huber-LukacH., Dissercacion, Eidgenossische Technische Hochschule, Zurich, Switzerland, No. 7050, 1982 43. Zoiler J.M. and Smich M-, Nucl. Acids Res., 10: 6437, 1982 44. Miller J.H., Experimencs in Molecular Genecics, Cold Spring Harbor Laboracory, 19 72 45. Shulman ec al., Nacure, 276: 269, 1973 46. Towbin H. ec al., Proc. Nad. Acad. Sci., USA, 76: 4350-4354, 1979 Patent Liceracure E? 162 725 E? 238 441 WO 36/01536 US-? 4 443 385 US-? 4 447 036 US-P 4 237 224 US—P 4 463 464 </div>

Claims

1. - 85 - WHAT WE CLAIM IS:- 1. A method for inserting and cloning DNA sequences in gram positive bacteria selected from the group consisting of Bacillus thuringiensis and Bacillus cereus, comprising: (a) isolating DNA from a suitable source; (bj cloning the thus isolated DNA in a cloning vector that is capable of replicating in a bacterial host cell selected from the group consisting of Bacillus thuringiensis and Bacillus cereus cells in a heterologous cloning system; (c) directly and efficiently introducing the thus cloned vector DNA into the said bacterial ceil by electroporation, with a transforration rate that allows overcorrinc the restriction present in the said bacterial cells and thus efficiently clordnc the introduced D^A; and (e) cultivatinc the thus transformed bacterial cells and isolatinc the thus cloned vector DNA.

2. A method for inserting, cloning and expressing DNA sequences in gram positive bacteria selected from the group consisting of Bacillus thuringiensis and Bacillus cereus, comprising: (a) isolating DNA from a suitable source and ligating the thus isolated DNA with expression sequences that are capable of functioning in bacterial cells selected from the group consisting of Bacillus thuringiensis and/or Bacillus cereus cells; (b) cloning the thus isolated DNA in a cloning vector that is capable of replicating in a bacterial host cell selected from the group consisting of Bacillus thuringiensis and Bacillus cereus cells in a heterologous cioning system; (c) direcdy and efficientiv introducing the thus cloned vector DNA into the said bacterial cell bv electroporation, with a transformation rate that allows overcominc the restriction present in the said bacterial cells and thus efriciently cloninc and expressing the introduced DNA; and (e) cultivating the thus transformed bacterial cells and isolating the thus cloned vector DNA -ajid the expressed gene product. < W } 5FEB1992' ■I t 3\- A process accordin2 to claim 1 or claiin 2, wherein said transforrnino comprises --■•ail. o C; * c - S6 - a) preparing a suspension of host ceLls in an aerated medium sufficient to allow for all growth of the cells: b) separating the grown cells from the cell suspension and resuspending the grown cells in an inoculation buffer, c) adding a DNA sample comprising the cloned DNA in a concentration suitable for the electroporation to the buffer, d) introducing the batch of step c) into an electroporation apparatus; e) subjecting the thus introduced batch to at least one capacitor discharge to produce a high electric field strength that is sufficient to render the bacterial cell wall permeable to the DNA to be introduced, for a period of time sufficient to transform the bacterial host cells with the recombinant DNA; and h) selecting the thus transformed bacterial host cells. 4. A process according to claim 3, which comprises using B. thuringiensis spores as starting material for the preparation of the cell suspension of step (a). 5. A process according to claim 3, which comprises using thawed bacterial cells, which cells have previously been deep-frozen, as starting material for the preparation of the cell suspension of step (a). 6. A process according to claim 3, wherein the culture medium of step (a) comprises a) complex nutrient media with readily assimilable carbon and nitrogen sources that are conventionally employed forculturing aerobic Bacillus species; or b) fully synthetic or semi-synthetic nutrient media that contain bj) a complex or alternatively a defined readily assimilable carbon and nitrogen source or a combination of the two and also b2) essential vitamins and metal ions. 7. A process according to claim 3, wherein in step a) the said Bacillus cells are grown until an optical density [OD550J of from 0.1 to 1.0 is achieved. 8. A process according to claim 3, wherein the inoculation buffer of step b) is a phosphate buffer that has been osmotically stabilized by addition of at least one osmotic stabilizing agent. - 87 - 3 • A process according to claim 3 , wherein the said phosphate buffer contains sugars or sugar alcohols as an osmotic stabilizing agent, 10. A process according to claim 9, wherein the said stabilizing agent is saccharose, which is present in a concentration of from 0.1 M to 1.0 M. 11. A process according to claim 5, wherein the said phosphate buffer has a pH value of from pH 5.0 to pH 8.0. 12. A process according to claim 3, wherein the incubation of the bacterial cells is carried out at a temperature of from 0°C to 35°C before, during and after electroporation. 13. A process according to claim 12, wherein the incubation of the bacterial cells is carried out at a temperature of from 2°C to 15°C before, during and after electroporation. 14. A process according to claim 3, wherein the concentration of the added DNA sample is from 1 ng to 20 |!g. 15. A process according to claim 3, wherein the field strength is from 3000 V/cm to 4500 V/cm. 16. A process according to claim 3, wherein the exponential decay time of the pulse acting on the bacterial cell suspension lies within a range of from 2 ms to 50 ms. 17. A process according to claim 3., wherein selection of the transformed bacterial host cells comprises plating out the electroporated cells, after a suitable subsequent incubation phase, onto solid media containing an additive suitable for the selection of the transformed bacterial cells. IS. A process according to claim -wherein the said additive is an antibiotic suitable for the selection B. thuringiensis or B. cereus or both, selected from the group consisting of tetracycline, kanamycin, chloramphenicol, and erythromycin. 19. A process according to claim 18' wherein the said additive is a chromogenic substrate suitable for the selection of B. thuringiensis or B. cereus or both. o l* - 2 MAR W92 ^ p Q 1 < c. ; i / •"N. - 88 - 20. A process according tc either of claims 1 or 2, wherein the DNA to be introduced into the said bacterial host cell is a recombinant DNA which is of homologous or heterologous origin or is a combination of homologous and heterologous DNA. 21. A process according to claim 2C, wherein the said recombinant DNA contains one or more structural genes and 3' and 5' flanking regulatory sequences that are capable of functioning in the said bacterial host cells, which sequences are operably linked to the structural gene(s) and thus ensure the expression of the said structural gene(s) in said bacterial host cells. 22. A process according to claim 21, wherein the said structural gene codes for a S-endotoxin polypeptide occurring naturally in B. thuringiensis. or for a polypeptide that has substantial structural homologies therewith and has still substantially the toxicity properties of the said crystalline 5-endotoxin polypeptide. 23. A process according to claim 22, wherein the said o-endoioxin-encoding DNA sequence is substantially homologous with at least the pan or parts of the natural 5-endoioxin-encoding sequence that is (are) responsible for the insecticidal activity. 24. A process according to claim 22, wherein the said polypeptide is substantially homologous with a 5-endotoxin polypeptide of a suitable sub-species of B. thuringiensis. selected from the group consisting of kurstaki. bcrlincr, alesti. sotto, tolworthi, dendrolimus, tencbrionis and israclensis. 25. A process according to claim 22, wherein the said o-endotoxin-encoding DNA sequence is a DNA fragment of B. thuringiensis var. kurstaki HDl located between nucleotides 156 and 3623 in formula I, or is any shorter DNA fragment that still codes for a polypeptide having insect-toxic properties: ' / "s feb 19ft ' -89- Formula I 10 20 30 40 50 GTTAACACCC TGGGTCAAAA ATTGATATTT AGTAAAATTA GTTGCACTTT 60 70 80 90 100 GTGCATTTTT TCATAAGATG AGTCATATGT TTTAAATTGT AGTAATGAAA 110 120 130 140 150 AACAGTATTA TATCATAATG AATTGGTATC TTAATAAAAG AGATGGAGGT 160 170 180 190 200 AACTTATGGA TAACAATCCG AACATCAATG AATGCATTCC TTATAATTGT 210 220 230 240 250 TTAAGTAACC CTGAAGTAGA AGTATTAGGT GGAGAAAGAA TAGAAACTGG 260 270 280 290 300 TTACACCCCA ATCGATATTT CCTTGTCGCT AACGCAATTT CTTTTGAGTG 310 320 330 340 350 AATTTGTTCC CGGTGCTGGA TTTGTGTTAG GACTAGTTGA TATAATATGG 360 370 380 390 400 GGAATTTTTG GTCCCTCTCA ATGGGACGCA TTTCTTGTAC AAATTGAACA 410 420 430 440 450 GTTAATTAAC CAAAGAATAG AAGAATTCGC TAGGAACCAA GCCATTTCTA 460 470 480 490 500 GATTAGAAGG ACTAAGCAAT CTTTATCAAA TTTACGCAGA ATCTTTTAGA 510 520 530 GAGTGGGAAG CAGATCCTAC TAATCCAGCA 540 550 TTAAGAGAAG AGATGCGTAT -90- 560 570 580 590 600 TCAATTCAAT GACATGAACA GTGCCCTTAC AACCGCTATT CCTCTTTTTG 610 620 630 640 650 CAGTTCAAAA TTATCAAGTT CCTCTTTTAT CAGTATATGT TCAAGCTGCA 660 670 680 690 700 AATTTACATT TATCAGTTTT GAGAGATGTT TCAGTGTTTG GACAAAGGTG 710 720 730 740 750 GGGATTTGAT GCCGCGACTA TCAATAGTCG TTATAATGAT TTAACTAGGC 760 770 780 790 800 TTATTGGCAA CTATACAGAT CATGCTGTAC GCTGGTACAA TACGGGATTA 810 820 830 840 850 GAGCGTGTAT GGGGACCGGA TTCTAGAGAT TGGATAAGAT ATAATCAATT 860 870 880 890 900 TAGAAGAGAA TTAACACTAA CTGTATTAGA TATCGTTTCT CTATTTCCGA 910 920 930 940 950 ACTATGATAG TAGAACGTAT CCAATTCGAA CAGTTTCCCA ATTAACAAGA 960 970 980 990 1000 GAAATTTATA CAAACCCAGT ATTAGAAAAT TTTGATGGTA GTTTTCGAGG 1010 1020 1030 1040 1050 CTCGGCTCAG GGCATAGAAG GAAGTATTAG GAGTCCACAT TTGATGGATA 1060 1070 1080 1090 1100 TACTTAACAG TATAACCATC TATACGGATG CTCATAGAGG AGAATATTAT 1110 1120 1130 1140 1150 TGGTCAGGGC ATCAAATAAT GGCTTCTCCT GTAGGGTTTT CGGGGCCAGA 2 kj 2' X -91 - 1160 1170 1180 1190 1200 ATTCACTTTT CCGCTATATG GAACTATGGG AAATGCAGCT CCACAACAAC 1210 1220 1230 1240 1250 GTATTGTTGC TCAACTAGGT CAGGGCGTGT ATAGAACATT ATCGTCCACT 1260 1270 1280 1290 1300 TTATATAGAA GACCTTTTAA TATAGGGATA AATAATCAAC AACTATCTGT 1310 1320 1330 1340 1350 TCTTGACGGG ACAGAATTTG CTTATGGAAC CTCCTCAAAT TTGCCATCCG 1360 1370 1380 1390 1400 CTGTATACAG AAAAAGCGGA ACGGTAGATT CGCTGGATGA AATACCGCCA 1410 1420 1430 1440 1450 CAGAATAACA ACGTGCCACC TAGGCAAGGA TTTAGTCATC GATTAAGCCA 1460 1470 1480 1490 1500 TGTTTCAATG TTTCGTTCAG GCTTTAGTAA TAGTAGTGTA AGTATAATAA 1510 1520 1530 1540 1550 GAGCTCCTAT GTTCTCTTGG ATACATCGTA GTGCTGAATT TAATAATATA 1560 1570 1580 1590 1600 ATTCCTTCAT CACAAATTAC ACAAATACCT TTAACAAAAT CTACTAATCT 1610 1620 1630 1640 1650 TGGCTCTGGA ACTTCTGTCG TTAAAGGACC AGGATTTACA GGAGGAGATA 1660 1670 1680 1690 1700 TTCTTCGAAG AACTTCACCT GGCCAGATTT CAACCTTAAG AGTAAATATT 1710 1720 1730 1740 1750 ACTGCACCAT TATCACAAAG ATATCGGGTA AGAATTCGCT ACGCTTCTAC £ N P% , ■A* f 9 DP / ~s 92 1760 1770 1760 1190 1800 CACAAATTTA CAATTCCATA CATCAATTGA CGGAAGACCT ATTAATCAGG 1810 1820 1830 1840 1850 GGAATTTTTC AGCAACTATG AGTAGTGGGA GTAATTTACA GTCCGGAAGC 1860 1870 1880 1890 1900 TTTAGGACTG TAGGTTTTAC TACTCCGTTT AACTTTTCAA ATGGATCAAG 1910 1920 1930 1940 1950 TGTATTTACG TTAAGTGCTC ATGTCTTCAA TTCAGGCAAT GAAGTTTATA 1960 1970 19S0 1990 2000 TAGATCGAAT TGAATTTGTT CCGGCAGAAG TAACCTTTGA GGCAGAATAT 2010 2020 2030 2040 2050 GATTTAGAAA GAGCACAAAA GGCGGTGAAT GAGCTGTTTA CTTCTTCCAA 2060 2070 2080 2090 2100 TCAAATCGGG TTAAAAACAG ATGTGACGGA TTATCATATT GATCAAGTAT 2110 2120 2130 2140 2150 _ CCAATTTAGT TGAGTGTTTA TCTGATGAAT TTTGTCTGGA TGAAAAAAAA 2160 2170 2180 2190 2200 GAATTGTCCG AGAAAGTCAA ACATGCGAAG CGACTTAGTG ATGAGCGGAA 2210 2220 2230 2240 2250 TTTACTTCAA GATCCAAACT TTAGAGGGAT CAATAGACAA CTAGACCGTG 2260 2270 2280 2290 2300 GCTGGAGAGG AAGTACGGAT ATTACCATCC AAGGAGGCGA TGACGTATTC 2310 AAAGAGAAT T 2320 2330 2340 2350 ACGTTACGCT ATTGGGTACC TTTGATGAGT GCTATCCAAC 2360 2370 2380 2390 2400 GTATTTATAT CAAAAAATAG ATGAGTCGAA ATTAAAAGCC TATACCCGTT 2410 2420 2430 2440 2450 ACCAATTAAG AGGGTATATC GAAGATAGTC AAGACTTAGA AATCTATTTA 2460 2470 2480 2490 2500 ATTCGCTACA ATGCCAAACA CGAAACAGTA AATGTGCCAG GTACGGGTTC 2510 2520 2530 2540 2550 CTTATGGCCG CTTTCAGCCC CAAGTCCAAT CGGAAAATGT GCCCATCATT 2560 2570 2580 2590 2600 CCCATCATTT CTCCTTGGAC ATTGATGTTG GATGTACAGA CTTAAATGAG 2610 2620 2630 2640 2650 GACTTAGGTG TATGGGTGAT ATTCAAGATT AAGACGCAAG ATGGCCATGC 2660 2670 2680 2690 2700 AAGACTAGGA AATCTAGAAT TTCTCGAAGA GAAACCATTA GTAGGAGAAG 2710 2720 2730 2740 2750 CACTAGCTCG TGTGAAAAGA GCGGAGAAAA AATGGAGAGA CAAACGTGAA 2760 2770 2780 2790 2800 AAATTGGAAT GGGAAACAAA TATTGTTTAT AAAGAGGCAA AAGAATCTGT 2810 2820 2830 2840 2850 AGATGCTTTA TTTGTAAACT CTCAATATGA TAGATTACAA GCGGATACCA 2860 2870 2880 2890 2900 ACATCGCGAT GATTCATGCG GCAGATAAAC GCGTTCATAG CATTCGAGAA 2910 2920 2930 2940 2950 GCTTATCTGC CTGAGCTGTC TGTGATTCCG GGTGTCAATG CGGCTATTTT -94- 2960 2970 2980 2990 3000 TGAAGAATTA GAAGGGCGTA TTTTCACTGC ATTCTCCCTA TATGATGCGA 3010 3020 3030 3040 3050 GAAATGTCAT TAAAAATGGT GATTTTAATA ATGGCTTATC CTGCTGGAAC 3060 3070 3080 3090 3100 GTGAAAGGGC ATGTAGATGT AGAAGAACAA AACAACCACC GTTCGGTCCT 3110 3120 3130 3140 3150 TGTTGTTCCG GAATGGGAAG CAGAAGTGTC ACAAGAAGTT CGTGTCTGTC 3160 3170 3180 3190 3200 CGGGTCGTGG CTATATCCTT CGTGTCACAG CGTACAAGGA GGGATATGGA 3210 3220 3230 3240 3250 GAAGGTTGCG TAACCATTCA TGAGATCGAG AACAATACAG ACGAACTGAA 3260 3270 3280 3290 3300 GTTTAGCAAC TGTGTAGAAG AGGAAGTATA TCCAAACAAC ACGGTAACGT 3310 3320 3330 3340 3350 GTAATGATTA TACTGCGACT CA^GAAGAAT ATGAGGGTAC GTACACTTCT 3360 3370 3380 3390 3400 CGTAATCGAG GATATGACGG AGCCTATGAA AGCAATTCTT CTGTACCAGC 3410 3420 3430 3440 3450 TGATTATGCA TCAGCCTATG AAGAAAAAGC ATATACAGAT GGACGAAGAG 3460 3470 3480 3490 3500 ACAATCCTTG TGAATCTAAC AGAGGATATG GGGATTACAC ACCACTACCA 3510 3520 3530 3540 3550 GCTGGCTATG TGACAAAAGA ATTAGAGTAC TTCCCAGAAA CCGATAAGGT - 95 - 3560 3570 3530 3590 3600 ATGGATTGAG ATCGGAGAAA CGGAAGGAAC ATTCATCGTG GACAGCGTGG 3610 3620 3630 3640 3650 AATTACTTCT TATGGAGGAA TAATATATGC TTTATAATGT AAGGTGTGCA 3660 3670 3680 3690 3700 AATAAAGAAT GATTACTGAC TTGTATTGAC AGATAAATAA GGAAATTTTT 3710 3720 3730 3740 3750 ATATGAATAA AAAACGGGCA TCACTCTTAA AAGAATGATG TCCGTTTTTT 3760 3770 3780 3790 3800 GTATGATTTA ACGAGTGATA TTTAAATGTT TTTTTTGCGA AGGCTTTACT 3810 3820 3830 3840 3850 TAACGGGGTA CCGCCACATG CCCATCAACT TAAGAATTTG CACTACCCCC 3860 3870 3880 3890 3900 AAGTGTCAAA AAACGTTATT CTTTCTAAAA AGCTAGCTAG AAAGGATGAC 3910 3920 3930 3940 3950 ATTTTTTATG AATCTTTCAA TTCAAGATGA ATTACAACTA TTTTCTGAAG 3960 3970 3980 3990 4000 AGCTGTATCG TCATTTAACC CCTTCTCTTT TGGAAGAACT CGCTAAAGAA 4010 4020 4030 4040 4050 TTAGGTTTTG TAAAAAGAAA ACGAAAGTTT TCAGGAAATG AATTAGCTAC 4060 4070 4080 4090 4100 CATATGTATC TGGGGCAGTC AACGTACAGC GAGTGATTCT CTCGTTCGAC 4110 4120 4130 4140 4150 TATGCAGTCA ATTACACGCC GCCACAGCAC TCTTATGAGT CCAGAAGGAC ') IO ' C 1 / ^ > i y I -96- 4160 4170 4180 4190 4200 TCAATAAACG CTTTGATAAA AAAGCGGTTG AATTTTTGAA ATATATTTTT 4210 4220 4230 4240 4250 TCTGCATTAT GGAAAAGTAA ACTTTGTAAA ACATCAGCCA TTTCAAGTGC 4260 AGCACTCACG 4310 AAGTACCGAA 4360 CAAACTGCAG 26. A process according to either of claims 1 or 2 wherein the cloning vector used in step (b) is a bifunctional vector that apart from being capable of replicating in bacteria] cells selected from the group consisting of B. thuringiensis and B. cereus cells is capable of replicating at least in one other heterologous host organism, and that is identifiable in both the homologous and the heterologous host system. 27. A process according to claim 26, wherein the said heterologous host organisms are a) prokaryotic organisms selected from the group consisting of the genera Bacillus, Staphylococcus, Streptococcus, Streptomyces, Pseudomonas, Escherichia, Agrobacterium, Salmonella, and Erwinia or b) eukaryotic organisms selected from the group consisting of yeast, animal and plant cells. 28. A process according to claim 27,wherein the said heterologous host organism is E. coli. 29. A bifunctional vector to be used in a process according to ei-ther of claims 1 or 2 that, apart from being capable of replicating in bacterial cells selected from the group consisting of B. thuringiensis and B. cereus cells, is capable of replicating in at least one other heterologous host.organisms and that is identifiable in both the homologous and the heterologous host system and that comprises under the control of expression sequences 4270 4280 4290 4300 TATTTTCAAC GAATCCGTAT TTTAGATGCG ACGATTTTCC 4320 4330 4340 4350 ACATTTAGCA CATGTATATC CTGGGTCAGG TGGTTGTGCAji e. - 2 MAR 1992 2' 9 1 '> l - 97 - thai arc capable of functioning in bacterial cells selected from the group consisting of Bacillus thuringiensis and Bacillus ccrcus cells a structural gene encoding a 5-endotoxin polypeptide that occurs naturally in B. thuringiensis, or for a polypeptide that has substantial structural homologies therewith and has still substantially the toxicity properties of the said crystalline 5-endotoxin polypeptide. 30. A bifunctional vector according to claim 29, wherein the said expression sequences include a sporulation-dependent promoter of B. thuringiensis. 31. A bifunctional vector according to claim 29, therein the said o-endotoxin-encoding DNA sequence is substantially homologous with at least the part or parts of the natural 5-endotoxin-encoding sequence that is (are) responsible for the insecticidal activity. 32. A bifunctional vector according to claim 29, wherein the said polypeptide is substantially homologous with a S-endotoxin polypeptide of a suitable sub-species of B. thuringiensis, selected from the group consisting of kurstaki. berliner, alesti. sotio, tolworthi, dendrolimus, tencbrionis and israclensis. 33. A bifunctional vector according to claim 29, wherein the said o-endotoxin-encoding DNA sequence is a DNA fragment of B. thuringiensis var. kurstaki HDl located between nucleotides 156 and 3623 in formula 1. oris any shorter DNA fragment that still codes for a polypeptide having insect-toxic properties: Formula 1 10 20 30 40 50 GTTAACACCC TGGGTCAAAA ATTGATATTT AGTAAAATTA GTTGCACTTT 60 70 80 90 100 ■^ ^ f GTGCATTTTT TCATAAGATG AGTCATATGT TTTAAATTGT AGTAATGAAA 110 120 130 14 0 150 AACAGTATTA TATCATAATG AATTGGTATC TTAATAAAAG AGATGGAGGT ■1 : r - 5 ~EB1992 160 170 180 190 200 AACTTATGGA TAACAATCCG AACATCAATG AATGCATTCC TTATAATTGT ^^ 9 X -98 - 210 220 230 240 250 TTAAGTAACC CTGAAGTAGA AGTATTAGGT GGAGAAAGAA TAGAAACTGG 260 270 280 290 300 TTACACCCCA ATCGATATTT CCTTGTCGCT AACGCAATTT CTTTTGAGTG 310 320 330 340 350 AATTTGTTCC CGGTGCTGGA TTTGTGTTAG GACTAGTTGA TATAATATGG 360 370 380 390 400 GGAATTTTTG GTCCCTCTCA ATGGGACGCA TTTCTTGTAC AAATTGAACA 410 420 430 440 450 GTTAATTAAC CAAAGAATAG AAGAATTCGC TAGGAACCAA GCCATTTCTA 460 470 480 490 500 GATTAGAAGG ACTAAGCAAT CTTTATCAAA TTTACGCAGA ATCTTTTAGA 510 520 530 540 550 GAGTGGGAAG CAGATCCTAC TAATCCAGCA TTAAGAGAAG AGATGCGTAT 560 570 580 590 600 TCAATTCAAT GACATGAACA GTGCCCTTAC AACCGCTATT CCTCTTTTTG 610 620 630 640 CAGTTCAAAA TTATCAAGTT CCTCTTTTAT CAGTATATGT TCAAGCTGC& * r, _ » 9 DEL J99/ 660 670 680 690 700 AATTTACATT TATCAGTTTT GAGAGATGTT TCAGTGTTTG GACAAAGGTG 710 720 730 740 750 GGGATTTGAT GCCGCGACTA TCAATAGTCG TTATAATGAT TTAACTAGGC 760 770 780 790 800 TTATTGGCAA CTATACAGAT CATGCTGTAC GCTGGTACAA TACGGGATTA 2 ^ <j jl9JL 99 - 810 820 830 840 850 GAGCGTGTAT GGGGACCGGA TTCTAGAGAT TGGATAAGAT ATAATCAATT 860 870 880 890 900 TAGAAGAGAA TTAACACTAA CTGTATTAGA TATCGTTTCT CTATTTCCGA 910 920 930 940 950 ACTATGATAG TAGAACGTAT CCAATTCGAA CAGTTTCCCA ATTAACAAGA 960 970 980 990 1000 GAAATTTATA CAAACCCAGT ATTAGAAAAT TTTGATGGTA GTTTTCGAGG 1010 1020 1030 1040 1050 CTCGGCTCAG GGCATAGAAG GAAGTATTAG GAGTCCACAT TTGATGGATA 1060 1070 1080 1090 1100 TACTTAACAG TATAACCATC TATACGGATG CTCATAGAGG AGAATATTAT 1110 1120 1130 1140 1150 TGGTCAGGGC ATCAAATAAT GGCTTCTCCT GTAGGGTTTT CGGGGCCAGA 1160 1170 1180 1190 1200 ATTCACTTTT CCGCTATATG GAACTATGGG AAATGCAGCT CCACAACAAC 1210 1220 1230 1240 1250 GTATTGTTGC TCAACTAGGT CAGGGCGTGT ATAGAACATT ATCGTCCACT 1260 1270 1280 1290 1300 TTATATAGAA GACCTTTTAA TATAGGGATA AATAATCAAC AACTATCTGT 1310 1320 1330 1340 1350 TCTTGACGGG ACAGAATTTG CTTATGGAAC CTCCTCAAAT TTGCCATCCG ""'^3 ,v ✓ \\ 'fj 1360 1370 1380 1390 1400 ^ VMS <2 \ l9h*. £ CTGTATACAG AAAAAGCGGA ACGGTAGATT CGCTGGATGA AATACCGCCA'- /y1)e >> yrH - 100- 1410 1420 1430 1440 1450 CAGAATAACA ACGTGCCACC TAGGCAAGGA TTTAGTCATC GATTAAGCCA 1460 1470 1480 1490 1500 TGTTTCAATG TTTCGTTCAG GCTTTAGTAA TAGTAGTGTA AGTATAATAA 1510 1520 1530 1540 1550 GAGCTCCTAT GTTCTCTTGG ATACATCGTA GTGCTGAATT TAATAATATA 1560 1570 1580 1590 1600 ATTCCTTCAT CACAAATTAC ACAAATACCT TTAACAAAAT CTACTAATCT 1610 1620 1630 1640 1650 TGGCTCTGGA ACTTCTGTCG TTAAAGGACC AGGATTTACA GGAGGAGATA 1660 1670 1680 1690 1700 TTCTTCGAAG AACTTCACCT GGCCAGATTT CAACCTTAAG AGTAAATATT 1710 1720 1730 1740 1750 ACTGCACCAT TATCACAAAG ATATCGGGTA AGAATTCGCT ACGCTTCTAC 1760 1770 1780 1790 1800 CACAAATTTA CAATTCCATA CATCAATTGA CGGAAGACCT ATTAATCAGG 1810 1820 1830 1840 1850 GGAATTTTTC AGCAACTATG AGTAGTGGGA GTAATTTACA GTCCGGAAGC 1860 1870 1880 1890 1900 TTTAGGACTG TAGGTTTTAC TACTCCGTTT AACTTTTCAA ATGGATCAAG 1910 1920 1930 1940 1950 TGTATTTACG TTAAGTGCTC ATGTCTTCAA TTCAGGCAAT GAAGTTTATA 1960 1970 1980 1990 2000 TAGATCGAAT TGAATTTGTT CCGGCAGAAG TAACCTTTGA GGCAGAATAT - 101 - 2010 2020 2030 2040 2050 GATTTAGAAA GAGCACAAAA GGCGGTGAAT GAGCTGTTTA CTTCTTCCAA 2060 2070 2080 2090 2100 TCAAATCGGG TTAAAAACAG ATGTGACGGA TTATCATATT GATCAAGTAT 2110 2120 2130 2140 2150 CCAATTTAGT TGAGTGTTTA TCTGATGAAT TTTGTCTGGA TGAAAAAAAA 2160 2170 2180 2190 2200 GAATTGTCCG AGAAAGTCAA ACATGCGAAG CGACTTAGTG ATGAGCGGAA 2210 2220 2230 2240 2250 TTTACTTCAA GATCCAAACT TTAGAGGGAT CAATAGACAA CTAGACCGTG 2260 2270 2280 2290 2300 GCTGGAGAGG AAGTACGGAT ATTACCATCC AAGGAGGCGA TGACGTATTC 2310 2320 2330 2340 2350 AAAGAGAATT ACGTTACGCT ATTGGGTACC TTTGATGAGT GCTATCCAAC 2360 2370 2380 2390 2400 GTATTTATAT CAAAAAATAG ATGAGTCGAA ATTAAAAGCC TATACCCGTT 2410 2420 2430 2440 2450 ACCAATTAAG AGGGTATATC GAAGATAGTC AAGACTTAGA AATCTATTTA 2460 2470 2480 2490 2500 ATTCGCTACA ATGCCAAACA CGAAACAGTA AATGTGCCAG GTACGGGTTC 2510 2520 2530 2540 2550 CTTATGGCCG CTTTCAGCCC CAAGTCCAAT CGGAAAATGT GCCCATCATT 2560 2570 2580 2590 2600 CCCATCATTT CTCCTTGGAC ATTGATGTTG GATGTACAGA CTTAAATGAG 2LJ191 - 102 - 2610 2620 2630 2640 2650 GACTTAGGTG TATGGGTGAT ATTCAAGATT AAGACGCAAG ATGGCCATGC 2660 2670 2680 2690 2700 AAGACTAGGA AATCTAGAAT TTCTCGAAGA GAAACCATTA GTAGGAGAAG 2710 2720 2730 2740 2750 CACTAGCTCG TGTGAAAAGA GCGGAGAAAA AATGGAGAGA CAAACGTGAA 2760 2770 2780 2790 2800 AAATTGGAAT GGGAAACAAA TATTGTTTAT AAAGAGGCAA AAGAATCTGT 2810 2820 2830 2840 2850 AGATGCTTTA TTTGTAAACT CTCAATATGA TAGATTACAA GCGGATACCA 2860 2870 2880 2890 2900 ACATCGCGAT GATTCATGCG GCAGATAAAC GCGTTCATAG CATTCGAGAA 2910 2920 2930 2940 2950 GCTTATCTGC CTGAGCTGTC TGTGATTCCG GGTGTCAATG CGGCTATTTT 2960 2970 2980 2990 3000 TGAAGAATTA GAAGGGCGTA TTTTCACTGC ATTCTCCCTA TATGATGCGA t - 3010 3020 3030 3040 3050 k f £ a/ >> GAAATGTCAT TAAAAATGGT GATTTTAATA ATGGCTTATC CTGCTGGAAC ^ ' '' ;s yV c 3060 3070 3080 3090 3100 i\ ' ^ £ GTGAAAGGGC ATGTAGATGT AGAAGAACAA AACAACCACC GTTCGGTCCT ^ // 3110 3120 3130 3140 3150 TGTTGTTCCG GAATGGGAAG CAGAAGTGTC ACAAGAAGTT CGTGTCTGTC ...J 3160 3170 CGGGTCGTGG CTATATCCTT 3180 CGTGTCACAG 3190 3200 CGTACAAGGA GGGATATGGA 229191 - 103 - 3210 3220 3230 3240 3250 GAAGGTTGCG TAACCATTCA TGAGATCGAG AACAATACAG ACGAACTGAA 3260 3270 3280 3290 3300 GTTTAGCAAC TGTGTAGAAG AGGAAGTATA TCCAAACAAC ACGGTAACGT 3310 3320 3330 3340 3350 GTAATGATTA TACTGCGACT CAAGAAGAAT ATGAGGGTAC GTACACTTCT 3360 3370 3380 3390 3400 CGTAATCGAG GATATGACGG AGCCTATGAA AGCAATTCTT CTGTACCAGC 3410 3420 3430 3440 3450 TGATTATGCA TCAGCCTATG AAGAAAAAGC ATATACAGAT GGACGAAGAG 3460 3470 3480 3490 3500 ACAATCCTTG TGAATCTAAC AGAGGATATG GGGATTACAC ACCACTACCA 3510 3520 GCTGGCTATG TGACAAAAGA 3560 3570 ATGGATTGAG ATCGGAGAAA 3530 3540 3550 ATTAGAGTAC TTCCCAGAAA CCGATAAGGT 3580 3590 3600 CGGAAGGAAC ATTCATCGTG GACAGCGTGG 3610 3620 3630 3640 3650 AATTACTTCT TATGGAGGAA TAATATATGC TTTATAATGT AAGGTGTGCA * 3660 3670 3680 3690 3700 AATAAAGAAT GATTACTGAC TTGTATTGAC AGATAAATAA GGAAATTTTT 3710 3720 3730 3740 3750 -v ATATGAATAA AAAACGGGCA TCACTCTTAA AAGAATGATG TCCGTTTTTT * <>„ 0 ■■ r F | V ^ * // ! \ * i 3760 3770 3780 3790 3800 GTATGATTTA ACGAGTGATA TTTAAATGTT TTTTTTGCGA AGGCTTTACT , , -\-■ :: • -J ?291 - 104 - 3810 3820 3830 3840 3850 TAACGGGGTA CCGCCACATG CCCATCAACT TAAGAATTTG CACTACCCCC 3860 3870 3880 3890 3900 AAGTGTCAAA AAACGTTATT CTTTCTAAAA AGCTAGCTAG AAAGGATGAC 3910 3920 3930 3940 3950 ATTTTTTATG AATCTTTCAA TTCAAGATGA ATTACAACTA TTTTCTGAAG 3960 3970 3980 3990 4000 AGCTGTATCG TCATTTAACC CCTTCTCTTT TGGAAGAACT CGCTAAAGAA 4010 4020 4030 4040 4050 TTAGGTTTTG TAAAAAGAAA ACGAAAGTTT TCAGGAAATG AATTAGCTAC 4060 4070 4080 4090 4100 CATATGTATC TGGGGCAGTC AACGTACAGC GAGTGATTCT CTCGTTCGAC 4110 4120 4130 4140 4150 TATGCAGTCA ATTACACGCC GCCACAGCAC TCTTATGAGT CCAGAAGGAC 4160 4170 4180 4190 4200 TCAATAAACG CTTTGATAAA AAAGCGGTTG AATTTTTGAA ATATATTTTT 4210 4220 4230 4240 4250 TCTGCATTAT GGAAAAGTAA ACTTTGTAAA ACATCAGCCA TTTCAAGTGC 4260 4270 4280 4290 4300 AGCACTCACG TATTTTCAAC GAATCCGTAT TTTAGATGCG ACGATTTTCC 4310 4320 4330 4340 4350 AAGTACCGAA ACATTTAGCA CATGTATATC CTGGGTCAGG TGGTTGTGCA . 4360 - 105 - • The bifunctional vector pXI93 (,pK93) introduced into B. thuringiensis var. kurstaki HDlcryB (DSM 4571) and B. cereus 569K (DSM 4573). 35. A bactenal host cell selected from the group consisting of B. thuringiensis and B. cereus cells prepared by a method as described in o? the1* of claims 1 or 2 conrorisinc bifunctional vector according to any one of claims 2^-33. 36. B. thuringiensis var. kurstaki HDlcryB according to claim 35. transformed with the bifunctional vector pXI93 (pK93) and deposited under the number DSM 4571. 37. B. cereus 569K according to claim 35, transformed with the bifunctional vector pXI93 (pK93) and deposited under the number DSM 4573. 38. A method of controlling insects which comprises treating insects or their habitat a) with a bacterial host cell according to claim 35, or with a mixture thereof; or alternatively b) with a cell-free crvstall-body preparation containing a protoxin that is produced by a bacterial host cell according to claim 35. 39. A method according to claim 38, wherein the insects are insects of the orders Lepidoptera, Diptera or Coleoptera. 40. A method according to claim 39, wherein the insects are insects of the order Lepidoptera. 41. A composition for controlling insects, comprising a) a bacterial host cell according to claim 35, or a mixture thereof; or alternatively b) a cell-free crystall-bodv preparation containing a protoxin that is produced by a bacterial host cell according to claim 35, together with carriers, dispersing agents or carriers and dispersing agents conventionally employed. 42. method according to claim 1, wherein the DNA of step a) is obtainable by digesting total DNA of a bactenal donor selected from the group consisting of Bacillus "il; thuringiensis and B. cereus. CI3A,—X3ZIGY AG