FR2808535A1 - New nucleic acid encoding human myoneurin, useful for diagnosis, prognosis and treatment of cancer and neurological diseases, comprises a polynucleotide encoding the human myoneurin protein - Google Patents

Abstract

Purified nucleic acid (I) comprising at least part of the sequence encoding human myoneurin (II) having BTB/POZ domains and zinc fingers, where (I) is a 2835 base pair sequence (S1), or a sequence with at least 70% homology to (S1), is new. Independent claims are also included for the following: (1) transcripts (III) generated from (I); (2) a diagnostic reagent for differential detection of complete or partial human sequences comprising (1) or its fragments, or an alternative myoneurin sequence of 2719 bp (64); (3) rapid, differential detection of myoneurin in its normal or pathogenic variants, by hybridization and/or amplification; (4) detecting (III); (5) translation products (peptides) (IV) encoded by (I); (6) antibodies (Ab) directed against (IV); (7) differential immunological detection of normal or pathological myoneurin sequences; and (8) a hybrid nucleic acid containing (I) combined with sequences or motifs having anomalous structural characteristics.

Description

<Desc / Clms Page number 1>

 The present invention relates to new nucleic acid sequences and new protein sequences deduced from human origin.

 The invention also relates to the detection and / or use of said nucleic acid sequences and of said corresponding protein sequences, in the context of applications linked to development, in particular muscle.

 The invention also relates to the detection and / or use of said nucleic acid sequences and of said corresponding protein sequences, in the context of diagnostic, prophylactic, prognostic and therapeutic applications, in particular for pathologies affecting development, in particular in the case of cancers, in particular in pathologies affecting the skeletal muscle and the heart muscle.

 The invention also relates to obtaining double-stranded and single-stranded antisense nucleic probes, corresponding recombinant molecules and associated antibodies.

 The factors which make it possible to modulate, inhibit or activate, the expression of one or more genes belong to different families of proteins which have the expected characteristics for this type of molecules which are both engaged in the recognition of nucleic sequences, by through protein-nucleic acid interactions and in interactions with other protein factors through protein-protein interactions.

 Among the domains of protein-nucleic acid interactions, a family of molecules is identified having one or more zinc dactyl domains (Rhodes, D and Klug, A.

 (1993) Sci. Am. 268: and 62-65), whose genes could represent up to one percent of mammalian genes. These proteins are commonly involved in the regulation of gene expression (Coleman, JE (1992), Annu. Rev. Biochem. 61: as transcription factors or in signal transduction processes. Each dactyl zinc domain is generally composed of about thirty amino acids which form a tetrahedral coordination with a zinc atom. The zinc binding site is composed of four ligands formed by the side chain of a cysteine, a histidine, or occasionally of an aspartic acid or of a glutamic acid. The fixing of zinc makes it possible to ensure a constrained structure roughly taking the shape of a finger, which thus defines a unit of interaction, in particular with nucleic acids. zinc cocksfoot are classified according to the number and position of residues involved in the coordination of zinc atoms, for example the zinc cocksfoot domains having two cysteines and two

<Desc / Clms Page number 2>

 histidines for the coordination of zinc, belong to a family listed under several names: zinc finger factors of C2-H2 type, or zinc finger of Krüppel type, because initially identified in the family of factor of Krüppel type or TFIIIA (Miller , J. et al., (1985) EMBO J. 4: 1609-1614). These domains have, apart from amino acids coordinated with zinc, invariant amino acids which are often hydrophobic, which constitute an element of protein interaction, while variable amino acids make it possible to modulate the specificities of interactions with other molecules or particular nucleic sequences. . The zinc cocksfoot domains are more generally associated in tandem and the bonding patterns which connect them together, sometimes have a strong conservation, like the canonical binding domain of the Krüppel type. The combination of amino acid sequences within dactyl domains associated with the variable number and arrangement of these different dactyl domains makes it possible to establish the specificity of the interactions. These dactyl domains can interact with the nucleic sequences, double or single strand or hetero-duplex (Shi, Y. et al. (1995) Science, 268: alone or in combination with other domains.

 The specificity and functionality of the regulatory factors for gene expression involves the association of dactyl motifs with a protein-protein interaction domain which makes it possible to develop hetero or homodimeric protein complexes. Additional domains can also be identified, for example nuclear localization sites promoting transport to the nucleus, for example motifs modulating the stability of the protein (PEST domains) or of its transcript. All of these structural characteristics make it possible to confer both specificity of protein and nucleic interactions as well as functional and spatio-temporal specificity.

 The discovery of polynucleotides coding for new zinc dactyl proteins and the factors themselves, provides new means of investigation into the processes of cellular regulation, for example during normal and pathological development. The discovery of new factors in BTB / POZ domains and dactyl domains fulfills the conditions required to search for other factors belonging to the same family and to establish new diagnoses or initiate new therapeutic maneuvers useful for the treatment of pathologies and / or prognosis.

 Before describing the nucleotide sequences, deduced protein sequences and methods, it is understood that this invention is not limited to particular methodologies, protocols, cell or tissue types, vectors, reagents, insofar as those -this may be subject to variations.

<Desc / Clms Page number 3>

 It is also well understood that the terminology used here corresponds to a particular example, without the desire to reduce the scope of the present invention which is only limited by the content of the claims.

 It may be noted that the use of the singular, such as "le", "la", "un" or "une" undue of plural and / or general reality, unless the contrary is formally specified. For example, "the vector" or "the host cell" relates to all of the possible vectors or all of the host cells or else the reference to an antibody refers to the set of equivalent antibodies produced according to the state of art.

 Unless otherwise specified, all techniques and scientific terms used have the same meaning as the meaning commonly used by users of these techniques. Any methods similar or equivalent to those described or their developments can be used in practice to test the present invention.

The term "nucleic acid sequence" here refers to an oligonucleotide, a polynucleotide, a DNA or an RNA of genomic or synthetic origin, either single-stranded or double-stranded and representing either the sense sequence or the anti sequence -sense and either a fragment or a portion of said sequence. Likewise, the term "amino acid sequence" or similar terms such as "peptide", "polypeptide" or "protein" refer to fragments or portions of said deduced sequence of natural or synthetic origin.

Myoneurin, as used herein refers to amino acid sequences, and by extension the corresponding nucleic sequences.

 The invention is based on the discovery of a purified nucleic acid sequence, characterized in that it comprises all or part of a sequence coding for one or more transcripts, which codes for a protein containing domains presenting the consensus zinc finger transcription factors and factors with a BTB / POZ domain, corresponding to SEQ ID NO: 1 or to a sequence having a level of homology with said sequence SEQ ID NO: 1 greater than or equal to 70%.

 By homologous sequence is meant both a sequence which has complete or partial identity with the sequence SEQ ID NO: 1 above, as well as a sequence which has partial similarity with said sequence SEQ ID NO: 1, such as for example SEQ ID NO: 64.

 According to an advantageous embodiment of said fragment, it has both motifs corresponding to a BTB / POZ domain and a domain corresponding to dactyl motifs of the Krüppel type and arranged in tandem, or to a sequence having a higher level of homology or equal to 70% with all or part of said sequence SEQ ID NO: 1.

<Desc / Clms Page number 4>

 Said fragments constitute a new sequence called Myoneurin; fragments according to the present invention have: a 5 ′ non-coding region of 1761 nt (SEQ ID NO: 2). The regions common to SEQ ID NO: 1 and SEQ ID NO: 2 are underlined.

- a long open reading frame of 1830 nt (positions 137 nt - 1967 nt on the sequence ID NO: 1) coding for a protein of unprecedented sequence of 610 amino acids (SEQ
ID NO: 52 and Figure 3). The initiation codon of the deduced protein fulfills the criteria expected from a translation initiation site (Kozak, M. (1991) J. Biol. Chem. 266: 19870).

Within this protein sequence there is found an N-terminal domain exhibiting the consensus of a BTB / POZ domain (Bardwell, VJ and Treisman, R. (1994) Genes Dev. 8: 1664-1677- Zollman et al. (1994) Proc. Natl. Acad. Sci. USA 91: 10721), known to present functions of hetero or homodimeric protein interactions and which are found associated with zinc dactyl domains in transcription or regulation of gene expression. A domain composed of 8 zinc dactyl motifs associated in tandem which present the consensus sequence of dactyl motifs belonging to the family of Krüppel-type transcription factors (Rosenberg, UB et al. (1986) Nature, 319,336-339) or C2- H2 is identified in the same reading frame. The zinc dactyl motifs are joined by 6 amino acid binding motifs known as His-Cys link, which are also of the Kriippel type. The region between amino acids 112 and 302, has 2 basic amino acid sequences, 174KKSSQTKKKKKATNSPK190 and 257KRKRGK262, analogous to nuclear localization sites encountered in factors regulating gene expression. These different motifs are characteristic of a transcription or regulation factor for gene expression.

 - a 3 'non-coding region included both in SEQ ID NO: 1 and in SEQ ID NO: 3. SEQ ID NO: 3 extends by 1045 nt SEQ ID NO: 1. The noncoding 3 ′ region contains three polyadenylation signal sites, including a polyadenylation signal located at nucleotide 2041 of SEQ ID NO: 1 and which is used by the transcript corresponding to clone 1 (FIG. 1). The regions common to SEQ ID NO: 1 and SEQ ID NO: 3 are underlined.

 The present invention encompasses the sequences belonging to Myoneurin as defined above (presence of the sequence SEQ ID NO: 1 or associated such as SEQ ID NO: 2 and / or SEQ ID NO: 3, or of a homologous sequence such as SEQ ID N0: 64; it also includes the reverse nucleic sequences complementary to the preceding ones as well as the fragments originating from the coding regions of the preceding sequences corresponding to a sliding frame greater than or equal to 14 nucleotides or their complementary sequences.

<Desc / Clms Page number 5>

 These different fragments can advantageously be used as primers or probes.

- MN5R: S'GGTGCTCACAGTGGTGCGAATACTGCAT3' (SEQ ID NO: 5) - MZ3S: 5'GGCATTcrrCTcrTAATGCTATGCTATr3' (SEQ ID NO: 6) - ZATG7: 5'ATCAAGGGTAAAATTCCATTCTGA3' (SEQ ID NO: 7) - ZTGA9: S'ATGATATCTTAGCAATTCCAATATT3' (SEQ ID NO: 8) - YTS86: S'CACATTGGCITGGCCITGGAATA3' (SEQ ID NO: 9) - KZR4: 5'çATGAATcTrGAGATrGOEAGAA3' (SEQ ID NO: 10) - 6855: 5'CCGGTGGAAACrGCrGCATGT3' (SEQ ID NO: 11) - 5BZ3: 5'AACACTTCTACCACcnTcrc#3' (SEQ ID NO: 12) - STY68: 5'GGTATTCCAAGGCCAAGCCAAT3' (SEQ ID NO: 13) - 6Z63: 5'TTCCrTGCTATATCTGTGG\ATT3' (SEQ ID NO: 14) - ZRP35: 5'ACACATCAATAAGrGACGGTGAA3' (SEQ ID NO: 15) - PEZ35: 5'ccAAcTGTAcc-TcAGmccAAG3' (SEQ ID NO: 16) - ZDE53: 5'GGCTGAGTCTGAACGGATCC3' (SEQ ID NO: 17) - EDZ35: 5'CGACGCTCAGTCTCCAGG3' (SEQ ID NO: 18)

- GBZ35: S'TGGTGGACATGGGACTGAC1TA3' (SEQ ID NO: 19) - TA55Z: S'GCATCCCAGACTTCrGTCACCAG3' (SEQ ID NO: 20) - 193GBZ: S'GCCAATCAAACAGCATGGTGATA3' (SEQ ID NO: 21) - GBZI 83-.5'cTwTATcATrcrAAcAcrcATA3' (SEQ ID NO: 22) - RPBZ4: 5'GGTGCTCACAGTGGTGCGAATA3' (SEQ ID NO: 23)

- HZNC: S'CCTCfGTTACTCCTGTTATCGA3' (SEQ ID NO: 24) - ZPR3: S'CGCrAACGCCCCrrGTrrAGGATTTGCC3' (SEQ ID NO: 25) - ZD27: 5'GGAGGCCAGCACATTOcrATGAGcrrT3' (SEQ ID NO: 26) - ZH5: S'CCATCAGCCITCACCI'GACTCTGATCAA3' (SEQ ID NO: 27) - ZFl: S'GCAACITACAGTTTGCAACTTCr3' (SEQ ID NO: 28) - ZF2: 5'CTGGTAAGGTGCATATATTCATA3' (SEQ ID NO: 29) - ZF3: 5'GAGAGAAATCAGAAGTATCTACA3' (SEQ ID NO: 30) - ZF4: 5'AATAGAGAAATAGCACAATTCTT3' (SEQ ID NO: 31) - ZF5: 5'CGTAAGGTTTGACTCCTTTATGT3' (SEQ ID NO: 32) - ZF6: 5'GGAAGGCATTTGCTGTCTCTAG3' (SEQ ID NO: 33) - ZF7: 5'CCGTTTCACTGTAACATGTGC3' (SEQ ID NO: 34)
Amorces génomiques humaines Among these fragments, the following fragments may preferably be cited:
Human primers: - EXOR: 5'CGAGAATGAGTGATAAGAGA3 '(SEQ ID NO: 4)

- MN5R: S'GGTGCTCACAGTGGTGCGAATACTGCAT3 '(SEQ ID NO: 5) - MZ3S: 5'GGCATTcrrCTcrTAATGCTATGCTATr3' (SEQ ID NO: 6) - ZATG7: 5'ATCAAGGGTAAAATTCCATTCTGA3 '(SEQ IDATATT: 7) SEQ ID NO: 8) - YTS86: S'CACATTGGCITGGCCITGGAATA3 '(SEQ ID NO: 9) - KZR4: 5'çATGAATcTrGAGATrGOEAGAA3' (SEQ ID NO: 10) - 6855: 5'CCGGTGGAAACrGCrGCATGT3 '(SEQ ID NO3) : 5'AACACTTCTACCACcnTcrc # 3 '(SEQ ID NO: 12) - STY68: 5'GGTATTCCAAGGCCAAGCCAAT3' (SEQ ID NO: 13) - 6Z63: 5'TTCCrTGCTATATCTGTGG \ ATT3 '(SEQ ID NO: 14) - ZRPACAGA: 5'A '(SEQ ID NO: 15) - PEZ35: 5'ccAAcTGTAcc-TcAGmccAAG3' (SEQ ID NO: 16) - ZDE53: 5'GGCTGAGTCTGAACGGATCC3 '(SEQ ID NO: 17) - EDZ35: 5'CGACGCTCAGTCTCCAGG3' (SEQ ID NO: 18)

- GBZ35: S'TGGTGGACATGGGACTGAC1TA3 '(SEQ ID NO: 19) - TA55Z: S'GCATCCCAGACTTCrGTCACCAG3' (SEQ ID NO: 20) - 193GBZ: S'GCCAATCAAACAGCATGGTGATA3 '(SEQ ID NO: 21) - GBZIrcAtcAtAcAtAc. '(SEQ ID NO: 22) - RPBZ4: 5'GGTGCTCACAGTGGTGCGAATA3' (SEQ ID NO: 23)

- HZNC: S'CCTCfGTTACTCCTGTTATCGA3 '(SEQ ID NO: 24) - ZPR3: S'CGCrAACGCCCCrrGTrrAGGATTTGCC3' (SEQ ID NO: 25) - ZD27: 5'GGAGGCCAGCACATTOcrATGAGcrrT3 '(SEQ IDCAGACCGCCRAC3:) '(SEQ ID NO: 27) - ZFl: S'GCAACITACAGTTTGCAACTTCr3' (SEQ ID NO: 28) - ZF2: 5'CTGGTAAGGTGCATATATTCATA3 '(SEQ ID NO: 29) - ZF3: 5'GAGAGAAATCAGAAGTATCTACA3' (SEQ ID NO:) - ZF4: 5'AATAGAGAAATAGCACAATTCTT3 '(SEQ ID NO: 31) - ZF5: 5'CGTAAGGTTTGACTCCTTTATGT3' (SEQ ID NO: 32) - ZF6: 5'GGAAGGCATTTGCTGTCTCTAG3 '(SEQ ID NO: 33) - ZFTGTAC: SEQ ID NO: 34)
Human genomic primers

<Desc / Clms Page number 6>

- IEM3: 5'C'TTTATTTACTAACAGGAAGCATAGTG3' (SEQ ID NO: 40) - EIM4: 5'CGAAAACATACAGGTAAGTTGACAGGGA3' (SEQ ID NO: 41) - IEM4: 5'TTTTATTTTCCATCTAGGTGAAAAACCA3' (SEQ ID NO: 42) - EIMS: 5'TTTCGGTCCCATACAGGTCTGTGTTT3' (SEQ ID NO: 43) - IEM5: 5'CAGGAGAAAGACCATTTATCTGCG3' (SEQ ID NO: 44) - EIM6: 5'AAAACAAAAGTCCATTCTGGTAAA3' (SEQ ID NO: 45) - IEM6: 5'TTCTAGGTGCAGATAAAACTCTAG3' (SEQ ID NO: 46)
Amorces murines: - 27 MZ: 5'GGCAAGCACATTCCTATGCGCCTT3' (SEQ ID NO: 47) - MOZ-5: 5'GTTTCCCTTGGGCGGCTACG3' (SEQ ID NO : -METMO: 5'ATCAAGGGTGAAATCCCATTCTGC3' (SEQ ID NO: 49)

- ZR/2856: S'GCtITGAATCITGAGGTTGC1'AGAAG3' (SEQ ID NO: 50) - ZS 119: 5'TCTGCGAGGACGGCCTAGCAA3' (SEQ ID NO: 51)
Tous les oligonucléotides sont conçus pour pouvoir générer une amorce sens et une amorce anti-sens par un décalage de la séquence de l'amorce de référence de 1 à 9 nucléotides vers le côté 5' ou vers le côté 3': la modification de la séquence de l'amorce peut entraîner une modification de la taille de l'amorce. Les amorces choisies peuvent être optimisées selon les cas par un raccourcissement ou un allongement portant sur 1 à 9 nucléotides vers le côté 5' et/ou vers le côté 3'. - EIMl: 5'CTITAAATCTTGACAGGTAAAGTACACACA3 '(SEQ ID NO: 35) - IEM1: 5'TTTCCTTGCAGTTGGAATGTTA3' (SEQ ID NO: 36) - EIM2: 5'AAGAACTCATACAGGTGAGACGGGTGTG3 '(SEQ ID NO: 37) - IEM2: 5'TTGTTCCnTAGGTGAGAAGCCAT3 ( SEQ ID NO: 38) - EIM3: 5'AAGATTCATGCAAGGTAAAAAACCAAAT3 '(SEQ ID NO: 39)

- IEM3: 5'C'TTTATTTACTAACAGGAAGCATAGTG3 '(SEQ ID NO: 40) - EIM4: 5'CGAAAACATACAGGTAAGTTGACAGGGA3' (SEQ ID NO: 41) - IEM4: 5'TTTTATTTTCCATCTAGGTGAAAAACCA3 '(SEQ IDTTTTTTTTG: '(SEQ ID NO: 43) - IEM5: 5'CAGGAGAAAGACCATTTATCTGCG3' (SEQ ID NO: 44) - EIM6: 5'AAAACAAAAGTCCATTCTGGTAAA3 '(SEQ ID NO: 45) - IEM6: 5'TTCTAGGTGCAGATAAAACTCTAG3' (SEQ ID NO: 46)
Murine primers: - 27 MZ: 5'GGCAAGCACATTCCTATGCGCCTT3 '(SEQ ID NO: 47) - MOZ-5: 5'GTTTCCCTTGGGCGGCTACG3' (SEQ ID NO: -METMO: 5'ATCAAGGGTGAAATCCCATTCTGC3 '(SEQ ID NO: 49)

- ZR / 2856: S'GCtITGAATCITGAGGTTGC1'AGAAG3 '(SEQ ID NO: 50) - ZS 119: 5'TCTGCGAGGACGGCCTAGCAA3' (SEQ ID NO: 51)
All the oligonucleotides are designed to be able to generate a sense primer and an antisense primer by shifting the sequence of the reference primer from 1 to 9 nucleotides towards the 5 ′ side or towards the 3 ′ side: the modification of the primer sequence can cause the primer size to change. The primers chosen can be optimized depending on the case by shortening or lengthening from 1 to 9 nucleotides towards the 5 'side and / or towards the 3' side.

 Preferably, hybridization, cloning, subcloning, detection, preparation, purification and analysis of nucleic acids, peptides or proteins, as well as in situ hybridization and immunohistochemistry are carried out under the conditions described in the following works, or in the references they cite - Current Protocols in Molecular Biology. Eds. F.M Ausubel, R. Brent & R. E Kingston et al. Green Publishing associates and Wiley Interscience.

 - Molecular Cloning: a laboratory manual. Eds. J. Sambrook, E. F. Fritsch & T. Maniatis. Cold Spring Harbor Laboratory Press. Cold Spring Harbor.

 - Manipulating the Mouse Embryo. A laboratory manual. Eds. B. Hogan, R. Beddington, F. Constantini, E. Lacy. 2nd edition. Cold Spring Harbor Laboratory Press.

Cold Spring Harbor. 1994.

<Desc / Clms Page number 7>

- The Practical Approach series. Eds. D. Rickwood & BD Ames. IRL
Press and Oxford University Press. In particular, antibodies 1 &II; DNA cloning I, II, III;
Nucleic acid and protein sequence analysis; Nucleic acid hybridization; Nucleic acid sequencing; Oligonucleotide synthesis; purification applications; purification methods; Protein sequencing; and translation; electrophoresis of nucleic acids; Gels electrophoresis of proteins; Genome analysis; HPLC of macromolecules; genetic diseases; Microcomputing in biology; neurobiology; testing;
Essential molecular biology 1 & II.

 - PCR Protocols. A guide to Methods and Applications. Eds. M. A. Innis, D. H. Gelfand, J. J. Sninsky, T. J. White. Academy Press, Inc., San Diego, California.

 - The DIG System User's Guide for Filter Hybridization. Boehringer Mannheim.

 - Nonradioactive in situ Hybridization. Application Manual. Second edition. Boehringer Mannheim.

 - Proteome research: frontiers in functional genomics. Eds M.R.

Wilkins & al. Springer.

 Polypeptide sequences generated by these transcripts can therefore be potentially produced (SEQ ID NO: 52-63 and Figures 2-4) and biological functions can therefore be envisaged; example of protein-protein interactions with transcription factors via the BTB / POZ domain, or interactions with nucleic acids via dactyl domains. Differences in the sequences observed and possible modifications of normal or pathological expression would be able to modify the function.

 However, the sequences according to the present invention differ from the sequences with BTB / POZ domains or with dactyl domains previously described in that these sequences, according to the invention are significantly different according to the criteria defined above and according to certain specific characteristics, for example the intermediate region between the BTB / POZ domain and the dactyl motifs.

 In the context of application to pathologies, the molecules of the Myoneurin family, such as for example the alternative form SEQ ID N0: 64, could be associated for example, with pathologies affecting the tissues in which Myoneurin is expressed, for example, skeletal muscle, testis, ovary, heart, placenta, thymus, colon, leukocytes, prostate, brain, intestine, pancreas, kidney, lung and spleen . Their action could relate to the declaration, the aggravation of a pathology, the modification of the activation calendar or the pattern of expression of certain genes, or

<Desc / Clms Page number 8>

 protection against the disease, or participation or contribution to the restoration of an altered structure.

 In the context of application to neuromuscular pathologies (such as, for example, dystrophies, polymyositis, rhabdomyosarcomas, muscle damage), it can be noted that myoneurin is overexpressed after an injury (such as, for example, denervation), or alteration or damage to the peripheral innervation or the skeletal muscle itself (such as nervous or muscle crushing). The overexpression in the muscle fiber is observed both at the level of the sarcoplasm, but also at the level of all the nuclei (such as, for example, the sub-synaptic nuclei, the nuclei of the satellite cells, the nuclei of the myotendinous junction, the spindle nuclei). Myoneurin is expressed in the marrow, in particular at the level of the motor neurons and their extensions; myoneurin is also expressed at the level of the nerves, in particular at the level of the Schwann cell and the axon; myoneurin could therefore play a role in the regulation of certain genes associated with the neuromuscular system. It is remarkable to note that a return to the initial state is observed after restoration of the tissue, for example when the lesion has been repaired.

 In this regard, it can be noted that myoneurin is expressed at the level of key regions of the muscle, such as for example the neuromuscular junction, the myotendinous junction, the satellite cells, the spindle region. The structures according to the invention are capable of regulating the expression of synaptic genes, for example during innervation or even normal or pathological re-innervation processes. It is remarkable to note that the abrupt factor which belongs to the family of proteins with BTB and dactyl domains, controls the specificity of muscular connections in Drosophila (Hu S. et. Coll. (1995) Genes Dev. 9: 2936-2948 ).

 Likewise, the ability to activate quiescent satellite cells, for example by means of early activation markers, could play a role in the regeneration of muscle fiber, for example by modulating the proliferation or differentiation of cells. satellites, or the fusion of satellite cells into multinucleated myotubes, then their maturation in order to replace the damaged fiber, or modify the muscular structure.

 Similarly, the expression of myoneurin at the level of the nuclei of the myotendinous junction, which constitutes a region of very active muscle renewal, in particular of elongation of the myotubes and of the muscle fiber, would be able to promote a regenerative process, especially during ligament or tendon tearing. In this regard, it is remarkable to note that the Broad-complex factor, which belongs to the family of proteins with BTB and dactyl domains, plays an essential role in the regulation of

<Desc / Clms Page number 9>

 attachment of the Drosophila thoracic muscles (Sandstrom, D. J. et al. (1997) Dev. Biol. 181: 168-185). In general, Myoneurin or truncated or partial or related forms could be involved in pathologies affecting the satellite cells, such as for example Steinert's disease, which is characterized by the immaturity of the satellite cells.

 Likewise, Myoneurin is expressed in the region of the neuromuscular spindle. In this regard, it can be noted that the sequences described according to the invention are expressed in a region crucial for the sensorimotor regulation responsible for the sensations of movement and position of the body. In general, Myoneurin or truncated or partial or related forms could be involved in pathologies affecting the spindle, such as for example dystonia.

 The detection made possible of domains belonging to myoneurin suggests possible applications both at the level of prophylaxis, prognosis and diagnosis; for example immunological or gene amplification approaches making it possible to compare normal individuals serving as referrals with patients, would be able to promote screening, improve early detection of the declaration of the disease and / or monitor the evolution of a pathology in patients who may present a susceptibility or who have declared the disease, or in individuals considered normal, on the classic anatomo-pathological criteria, or the current clinical criteria.

 Similarly, the action of Myoneurin on some of its target genes, in a normal or conditional mode, would be able to promote a process of cell or tissue regeneration and ultimately functional restoration.

 Likewise, and advantageously, the detection of Myoneurin would be able to constitute a test for early evaluation of the effectiveness of a treatment.

 The subject of the invention is also the transcripts generated from the aforementioned sequences as well as those possibly presenting modifications with the reference sequences described in the invention when they are expressed in certain patients.

 Advantageously, the modification of the expression of Myoneurin would be able to influence the structure and the muscular mass.

 The specific nucleic and immunological probes, as defined in the present invention are capable of promoting the identification and the detection of abnormally expressed patterns in the context of pathologies associated with cell or tissue development, foremost of which pathologies affecting the sphere neuromuscular.

 Therapeutic maneuvers can be envisaged by using certain of the nucleic sequences contained in the Myoneurin gene and the sequences of the

<Desc / Clms Page number 10>

 same family, such as for example SEQ ID NO: 64, or deduced polypeptide structures or by the use of peptides or proteins, or specific antibodies.

 The subject of the present invention is also hybrid nucleic acid sequences, characterized in that they comprise sequences or motifs belonging to Myoneurin or of elements belonging to the Myoneurin family, with similar motifs present in analogous factors; such hybrid sequences are probably capable of acquiring new potentials, in particular at the level of cellular or tissue targeting, of interaction with new molecules, in particular of transcription factors or hormone receptors, or even of interacting with new target nucleic sequences and therefore new genes. Such hybrid sequences are likely to be able to trigger, or aggravate a pathological process, or on the contrary to promote protection or partial remission or total and final healing.

 The present invention also relates to a diagnostic reagent for the differential detection of complete or partial nucleic acid sequences of Myoneurin, having motifs selected from the sequences SEQ ID NO: 1 and / or SEQ ID NO: 2 and / or SEQ ID NO: 3, characterized in that it is selected from the group consisting of the sequences SEQ ID NO: 1- 51, the nucleic sequences complementary to the preceding sequences, by the nucleotide fragments capable of defining or identifying the sequences SEQ ID NO: 1 and / or SEQ ID NO: 2 and / or SEQ ID NO: 3 and any flanking or overlapping sequence as well as by the fragments from the coding regions of the sequences SEQ ID NO: 52-63, corresponding to a sliding frame greater than or equal to 14 nucleotides or their complementary sequences, optionally labeled with an appropriate marker.

 The sequences of the nucleic, ribonucleic or oligonucleotide probes used will be chosen from the regions defined by the sequences SEQ ID NO: 1 and / or SEQ ID NO: 2 and / or SEQ ID NO: 3 or their flanking regions and / or any sequence normally or pathologically inserted or deleted, for example by alternative splicing; for example SEQ ID NO: 64. For example, the priming oligonucleotides will be chosen from the regions defined by the sequences SEQ ID NO: 1 and / or SEQ ID NO: 2 and / or SEQ ID NO: 3, as well as from all adjacent sequences (upstream or downstream) or inserted capable to allow specific amplification.

 Among the suitable markers, mention may be made of radioactive isotopes, enzymes, fluorochromes, chemical markers (biotin), haptens (digoxygenin) and antibodies or analogs of appropriate bases.

 Preferably:

<Desc / Clms Page number 11>

 - said reagent is selected from the sequences SEQ ID NO: 4-51 and is suitable for use as a primer.

 - Said reagent is selected from the following sequences: a fragment amplified by the pair of primers SEQ ID NO: 20 and SEQ ID NO: 26 (primers TA55Z and ZD27). a fragment amplified by the pair of primers SEQ ID NO: 7 and SEQ ID NO: 9 (primers ZATG7 and YTS86) and is suitable for use as a probe. a fragment amplified by the pair of primers SEQ ID NO: 29 and SEQ ID NO: 31 (primers ZF2 and ZF4) and is suitable for use as a probe. a 0.75 kb EcoRI-Styl restriction fragment (probe a in FIG. 1) belonging to the 5 ′ region of SEQ ID: 1 and is suitable for use as a probe. a 0.8 kb EcoRI-Styl restriction fragment (probe b of FIG. 1) belonging to the central region of SEQ ID: 1 and is suitable for use as a probe. a 0.45 kb Dral-EcoRI restriction fragment (probe c of FIG. 1) belonging to the 3 ′ region of SEQ ID: 1 and is suitable for use as a probe.

 The subject of the present invention is also a method for rapid and differential detection of the nucleic acid sequences of Myoneurin and / or of their normal or pathological variants, by gene hybridization and / or amplification, carried out from a biological sample, which method is characterized in that it comprises: (a) a step in which a biological sample to be analyzed is brought into contact with at least one probe as defined above and (b) a step in which it is detected by any suitable means , the product (s) resulting from the nucleotide sequence-probe interaction.

 In accordance with said process, it can include: * prior to step (a):. a step of extracting the nucleic acid to be detected, and. at least one gene amplification cycle and * after step (b):. a step of comparing the nucleic acid sequences obtained in said biological sample with the nucleic acid sequences according to the invention by any suitable means and in particular by sequencing, Southem-blot, restriction cleavage, SSCP (Single-Stranded Conformational Polymorphism or any other method allowing '' identify an insertion or a deletion or a simple mutation between the different sequences compared.

<Desc / Clms Page number 12>

 In accordance with the invention, the Myoneurin sequences according to the invention are thus compared to the nucleic sequences present in the biological sample to be analyzed and allow the detection of homologous sequences of patients suffering from pathologies, likely to involve a modification of their genome.

 Advantageously, said gene comparisons are carried out using genomic DNA obtained from control individuals and from patients.

 A classical gene amplification by PCR carried out using 5 ′ and 3 ′ antisense primers framing or comprising the area to be studied.

 Also advantageously, the sequences of the nucleic, ribonucleic and oligonucleotide probes used are chosen from the regions of the Myoneurin gene or its flanking regions: for example the oligonucleotide primers for Myoneurine will be chosen from SEQ ID NO: 1, as well as in any adjacent sequence (upstream or downstream), such as for example SEQ ID NO: 2 and / or SEQ ID NO: 3, capable of allowing a specific amplification, as specified above. They are preferably selected from the group consisting of: an EcoRI-Styl restriction fragment of 0.75 kb (probe a in FIG. 1) belonging to the 5 ′ region of SEQ ID: 1 and is suitable for use as a probe. a 0.8 kb EcoRI-Styl restriction fragment (probe b of FIG. 1) belonging to the central region of SEQ ID: 1 and is suitable for use as a probe. a 0.45 kb Dral-EcoRI restriction fragment (probe c of FIG. 1) belonging to the 3 ′ region of SEQ ID: 1 and is suitable for use as a probe.

 The gene amplification step is notably carried out using one of the following gene amplification techniques: Qss-replicase, PCR (Polymerase Chain Reaction), LCR (Ligase Chain Reaction) ...

 The present invention also relates to a method for detecting transcripts, as defined above, characterized in that it comprises: - the removal of messenger RNAs from control tissues and tissues taken from patients and - qualitative and / or quantitative analysis of said mRNAs, by in situ hybridization, by dot-blot, Northem-blot, RNAse mapping or RT-PCR, using a diagnostic reagent as defined above.

 The present invention also relates to translation products, characterized in that they are coded by a nucleotide sequence as defined above.

<Desc / Clms Page number 13>

 The present invention also relates to a peptide, characterized in that it is capable of being expressed using a nucleotide sequence selected from the group consisting of the sequences SEQ ID NO: 1-3 and 64, such as defined above.

 Said peptide also includes derived peptides comprising between 5 and 610 amino acids (SEQ ID NO: 52-63 and their fragments of at least 5 amino acids).

 Said peptides are translated from the nucleic sequences as defined above, according to the combinations offered by the use of the different possible reading frames.

 According to an advantageous embodiment of said peptides, they are in particular selected from the sequences SEQ ID NO: 52-63.

 According to another advantageous embodiment of said peptides, they are obtained from the nucleic sequences as defined above, in which at least one nonsense codon can be replaced by a codon coding for one of the following amino acids: Phe (F), Leu (L), Ser (S), Tyr (Y), Cys (C), Trp (W), Gin (Q), Arg (R), Lys (K), Glu (E) or Gly (G). According to another advantageous embodiment of said peptides, they are obtained from the nucleic sequences as defined above, in which an amino acid can be replaced by a homologous amino acid, according to the conventional rules recalled below: (K ) or Arg (R), Asp (D) or Glu (E) or Asn (N) or Gln (Q), Ala (A) or Gly (G), Ile (I) or Leu (L) or Val (V ), Thr (T) or Ser (S), Phe (F) or Tyr (Y) or Try (W).

 The invention thus encompasses the deduced peptides or the deduced proteins corresponding to all or part of the nucleic sequences described in the invention, and possibly exhibiting modifications with the reference sequences described in the invention, when they are expressed in certain patients. . In particular, the invention encompasses the complete or partial sequences obtained according to the 3 sense reading frames and the 3 reverse and complementary reading frames.

 Advantageously, the Myoneurin according to the invention has: - an N-terminal domain from the family of protein-protein interaction domains of BTB / POZ type. This type of domain has the characteristic of being able to allow hetero or homodimeric interactions, in particular when it belongs to a transcription factor.

 - two putative nuclear localization sites, identified in two peptide sequences starting at amino acids 174 (KKSSQTKKKKKATNSPK) and 257 (KRKRGK). These sites could be responsible for the nuclear localization of myoneurin (Nigg, E. A. et al (1991) Cell, 66,15-22),.

<Desc / Clms Page number 14>

 - six PEST type sites, which are found in many regulatory proteins. These sites would ensure specific degradation of Myoneurin.

 - 4 "S / T-P" motifs, located on either side of the dactyl domains. The S / T-P domains are preferably represented in the gene regulatory proteins.

 - 8 zinc dactyl type domains of the family of Krüppel type factors, as well as so-called H-C binding sites, which ensure the link between the dactyl domains, and which also belong to the family of Krüppel type factors.

 Said peptides or proteins may advantageously have the structural characteristics required to allow interaction with nucleic acids and / or peptides or proteins, and consequently be able to interact with genes or regulatory factors modulating the expression of said genes.

 Said peptides or proteins can advantageously have biological properties.

 The protein products generated by the nucleic sequences SEQ ID NO: 1-3 or produced in parallel can advantageously be characterized by micrometrics for analysis and quantification of the peptides and proteins: HPLC / FPLC or equivalent, capillary electrophoresis or equivalent, techniques of microsequencing (Edman method or equivalent, mass spectrometry or equivalent ...).

 The subject of the invention is also antibodies directed against one or more of the peptides described above and their use for the implementation of a method of detection in vitro, in particular differential for the presence of such a sequence in an individual.

 Said antibodies are advantageously polyclonal or monoclonal antibodies obtained by an immunological reaction of a human organism, mammals, birds or other species with respect to proteins, as defined above.

 The subject of the present invention is a method of differential immunological screening for Myoneurin and members of its normal or pathological family, characterized in that it comprises bringing a biological sample into contact with an antibody according to the invention, the reading of the result being revealed by an appropriate means, in particular EIA (Enzyme ImmunoAssay), ELISA (Enzyme-Linked Immuno Sorbent Assay), RIA (Radio-ImmunoAssay), fluorescence.

 By way of illustration, such an in vitro diagnostic method according to the invention comprises bringing a biological sample taken from a patient into contact with antibodies according to the invention and detection using any suitable method. ,

<Desc / Clms Page number 15>

 in particular with the aid of labeled anti-immunoglobulins, immunological complexes formed between the proteins produced normally or pathologically and the antibodies.

 Monoclonal or polyclonal antibodies, produced from antigens corresponding to synthetic peptides, recombinant polypeptide or proteins, make it possible to follow the expression of peptides or proteins produced normally or pathologically. The analysis is preferably carried out by ELISA, or equivalent, Westernblot or equivalent, or by immunohistochemistry.

 The present invention also relates to a method of identifying and detecting patterns belonging to Myoneurin or to its family, abnormally expressed in the context of pathologies associated with development, in particular in the case of cancer, in particular in terms of the neuromuscular sphere, first among which the synapse, the satellite cells, the myotendinous junction, or the spindle region characterized in that it includes the comparative analysis of the sequences extracted from a biological sample with the sequences according to the invention .

 The present invention also relates to the application of the nucleic acid sequences or protein sequences according to the invention to the diagnosis, to the prognosis, to the evaluation of genetic susceptibility, to any therapeutic action, to all human diseases induced, innate or acquired. , in particular those with cancerous components, in particular those associated with the synapse, satellite cells, spindle, or myotendinous junction, associated syndromes in which all or part of the nucleic sequences according to the invention and related forms intervene.

 The subject of the present invention is also the use of nucleic acid sequences for the preparation of compositions intended for gene therapy or for gene modifications, for example for repairing purposes in the medical field, or for veterinary and / or agro-food use, characterized in that they comprise nucleic acid sequences or motifs according to the invention.

 The subject of the present invention is also hybrid nucleic acid sequences, characterized in that they comprise nucleic acid sequences or motifs according to the invention, combined with similar sequences belonging to other factors, for example BTB / POZ domains or zinc cocksfoot.

 In addition to the foregoing provisions, the invention also comprises other provisions, which will emerge from the description which follows, which refers to examples of implementation of the process which is the subject of the present invention, as well as to the accompanying drawings, wherein :

<Desc / Clms Page number 16>

 - Figure 1. Strategy for cloning human Myoneurin. The rectangles correspond to the open reading frames. The arrows indicate the position and the orientation of the oligonucleotides used for the determination of the 5 ′ end of the transcript of Myoneurin. The hatched box corresponds to the BTB / POZ domain. The box with dotted lines with 8 zinc dactyl domains. (A) 17 indicates the existence of a polyadenylated end for clone 1. The restriction sites indicated on clone 1, D for Dral, S for Styl, X for Xhol, correspond to the restriction sites used to generate the probes nucleic a, b and c.

 - Figure 2. Nucleotide and protein sequence deduced from the transcript coding for the complete protein structure of Myoneurin. The coding regions are in capital letters. Position 1 corresponds to the methionine associated with the translation initiation codon. Three nonsense codons located upstream of the coding region and in the same reading frame, as well as the polyadenylation signal sites located in the 3 'noncoding region, are underlined. An asterisk specifies a polyadenylation site actually used in clone 1.

 - Figure 3. Alignment of the BTB / POZ domain of Myoneurin with the corresponding domains identified in other factors with BTB / POZ domains. GenBank accession numbers are listed. Identical amino acids are in black boxes. Homologous amino acids identified in more than 50% of the aligned sequences are in gray boxes. A black triangle indicates supernumerary sequences.

 - Figure 4. Alignment of the 8 zinc dactyl domains of Myoneurin.

The black boxes specify the invariant amino acids. The gray boxes indicate the homologous amino acids.

 - Figure 5. Northern of different human tissues: (1), brain (2), placenta (3), lung (4), liver (5), skeletal muscle (6), kidney (7), pancreas (8), spleen (9), thymus (10), prostate (11), testicle (12), ovary (13), intestine (14), colon (15), leukocytes (16). 3 g of polyadenylated RNA are deposited in each well. Hybridization is carried out using the a probe (Figure 1).

 - Figure 6. Characterization of the intron-exon junctions of the Myoneurin gene. Regions belonging to exons are in upper case, and introns are in lower case. The introns are indicated by dotted lines and their size is specified.

 - Figure 7. Comparison of the protein sequences of human (H) and murine (M) Myoneurins. Identical amino acids are indicated by 2 points and homologous amino acids are indicated by a point.

<Desc / Clms Page number 17>

 It should be understood, however, that these examples are given solely by way of illustration of the subject of the invention, of which they do not in any way constitute a limitation.

 EXAMPLE 1: cDNA clones coding for SEQ ID NO: 1.

 A polyclonal antibody obtained from rabbits and directed against a protein fraction of human seminal plasma retained on a heparin column was used to screen an expression bank of human testicular cDNA cloned in phage # gt11. Conventional immunological detection protocols were used (Huynh, TV et al. (1985). Two clones were isolated. Clone 1 has a short non-coding 3 'end with a 111 nt polyadenylated tail, taking into account the polyadenylated end Clone 2 has a non-coding 3 'end of 870 nt. Clone 3 was obtained after screening a human testicular cDNA library cloned in # gt10, using a nucleotide probe 750 bp covering the 5 'end of clone 1 and labeled with digoxigenin (according to the classic Boehringer-Mannheim protocol) .The 5' end of the transcript was determined by PCR from the cDNA library # gt11. oligonucleotide primer specific for # gt11 (Rgtll: TTGACACCAGACCAACTGGTAATG) is used in combination with the external primer 3 'HZ33, then a second amplification is carried out secondarily, in the context of a nested PCR, using the internal primer ZD27: cDNA clones 1,2 and 3, as well as the PCR amplification products, were sequenced manually using the T7-DNA polymerase Sequenase II kit (Amersham Pharmacia Biotech Inc.) or using an ABI automatic sequencer 377 and the DYEnamic ET sequencing kit (Amersham Pharmacia Biotech Inc.). The cloning strategy is shown in Figure 1.

The superimposition of the different nucleotide sequences made it possible to reconstitute a nucleic sequence (Figure 2) coding for a new human transcript (SEQ ID NO: 1).

This nucleic sequence presents a unique and long open reading frame of 1830 nt which codes for an unprecedented complete deduced protein sequence of 610 amino acids (SEQ ID NO: 52), whose apparent molecular mass is evaluated at 68 kDa.

 An analysis of the deduced protein sequence highlights in the Cterminal region, a characteristic motif, known as zinc finger, involving 2 cysteines and 2 histidines. This C2H2 motif is repeated 8 times in tandem (SEQ ID NO: 54-62). The consensus motif determined for the dactyl domains of human myoneurin is compared with the consensus sequence of type factors, TFIIIA and Krüppel: (Myoneurin) Y / FXC-X2 - C-X3-F-X5-L-X2-H- X3 - H-XS-6

<Desc / Clms Page number 18>

 (Krüppel) Y / FXC-X2-4-C-X3-F-X5-L-X2-H-X3-4-H-X5 We can note that: - the dactyl domains are separated by 7 patterns called "HC links ", specific to nuclear factors of Krüppel type (Rosenberg, UB et al. (1986) Nature, 319, 336-339).

We can count 4 strictly consensual motifs with the binding sequence of Krüppel type T / SGEKPYE / K, - the N-terminal end of the protein (SEQ ID NO: 53) presents a perfect consensus with the N-terminal region of proteins regulators. This new motif called the BTB / POZ domain is structured around several invariant amino acids which are characteristic of the family:
D (11-13 x) A / GH (3 x) L (3 x) S (32-36 x) Y (20 x) L EXAMPLE 2. Obtaining nucleic and ribonucleic probes coding for SEQ ID NO 1.

 The restriction or PCR fragments obtained are respectively subcloned into the plasmids pGEM-4Z or pGEM-T (Promega) having, on either side of their polycloning site, the promoter sequences for the RNA polymerases SP6 and T7.

 The skill method used is electroporation. The plasmid and the PCR fragment are hybridized in a ratio of 50 ng of vector per 100 ng of fragment to be subcloned. Incubation takes place overnight at 22 ° C., in the ligation buffer (66 mM TrisHCI pH 7.5.5 mM MgCl2, 1 mM dithioerythritol, 1mM ATP) in the presence of 1 u. of T4 DNA ligase then is stopped by denaturation for 10 minutes at 65 C. At the same time, the strain of E. coli JM 109 is seeded overnight at 37 ° C. in LB medium. This preculture is diluted to 1/500 and placed at 37 C up to an OD600 equal to 1. For the rest of the procedure, the cells will always be kept cold. After 5 minutes centrifugation at 3500g at 4 ° C, the cell pellet is resuspended in 1/4 vol. ultra-pure ice water. This step is repeated 5 to 6 times. Then the pellet is resuspended in 1/4000 vol. water; sterile glycerol are added allowing the preservation of the electrocompetent cells, in aliquots of 10 l at -20 C. To 50 l of electrocompetent cells is added 1 l of the ligation; everything is subjected to an electrical discharge of 12.5 kV / cm, applied for 5.8 ms. The cells are rapidly resuspended in SOC medium, incubated for 1 hour at 37 ° C., then spread, in the presence of 2% X-Gal in dimethylformamide, and 10 mM of IPTG, on a LB-agar plate supplemented with agar. ampicillin (100 g / ml). After a night at 37 ° C., the potentially recombinant white clones are subcultured in an orderly fashion on an LB / ampicillin box and in parallel on a nylon filter deposited on an LB / ampicillin box.

<Desc / Clms Page number 19>

These two dishes are incubated overnight at 37 C. The recombinant clones are then identified by hybridization with a nucleic probe according to SEQ ID NO: 1, labeled with digoxygenin.

 The recombinant clones are cultured in 50 ml of LB / ampicillin medium (100 g / ml) with stirring overnight at 37 C. After centrifugation at 3500 g for 15 minutes at 4 C, the bacterial pellet is taken up in 4 ml of P1 buffer (50 mM Tris-HCl, 10 mM EDTA, 400 g / ml RNase A, pH 8) and 4 ml of P2 buffer (200 mM NaOH, 1% SDS). The mixture is incubated at room temperature for 5 minutes. After adding 4ml of P3 buffer (2.55M potassium acetate, pH 4.8) the mixture is centrifuged at 12000g for 30 minutes at 4 C. The supernatant is applied to a Qiagen-type 100 column, pre-balanced with 2ml of QBT buffer (750 mM NaCl, 50 mM MOPS, 15% ethanol, pH 7), the column is washed with twice 4 ml of QC buffer (1M NaCl, 50 mM MOPS, 15% ethanol, pH 7) and the DNA is eluted with 2 ml of QF buffer (1.2M NaCl, 50mM MOPS, 15% ethanol, pH 8). The DNA is precipitated with 0.8 vol. of isopropanol, and centrifuged at 12000g at 4 C for 30 minutes. The pellet is washed with ice-cold 70% ethanol, then the plasmid DNA is taken up in 2 times 150 l of TE buffer.

 Ribonucleic probes are used as specific probes, in particular for the detection of transcripts expressed by analogous sequences (SEQ ID NO: 2-3) or corresponding to the (SEQ ID NO: 1) according to the invention.

 EXAMPLE 3: of the expression of the transcripts coding for SEQ ID NO: 1.

 The preparation of RNA is carried out according to the classic technique of Chomczynski and Sacchi or its variants (RNeasy, Qiagen). The separation of the mRNAs by electrophoresis and their transfer to a nylon membrane are carried out according to conventional techniques (Cf.

Maniatis).

 The hybridization of the Northerns is carried out from Northerns normalized with respect to -actin. The nucleic acid probes used come from the EcoRI-Styl, Styl-Dral, and Dral-EcoRI restriction fragments, of clone 1 (probes a, b, c in FIG. 1) and subcloned in pGEM-4Z. The probes are labeled by the random labeling technique (method called random-priming in the presence of dATP and dCTP labeled with P32). The labeling buffer is a solution containing 5X SSPE saline, 2X Denhardt, 0.5% SDS, and 100 mg / ml salmon milt DNA. After a hybridization carried out for 18 hours at 42 ° C., in the presence of the probes labeled with 2.106 cpmlml, the filters are washed for 2 times 15 min. at room temperature, with a solution

<Desc / Clms Page number 20>

 2X SSC, 0.5% SDS. Then, 4 washes of 15 min. at 50 C are carried out in a solution of 0.1X SSC, 0.1% SDS, then exposed for 72 hours at -70 C, for autoradiography in the presence of a Hyperfilm-MP (Amersham Pharmacia Biotech). Analysis of normal adult human tissue (heart, brain, colon, liver, intestine, leukocytes, skeletal muscle, pancreas, placenta, ovary, lung, prostate, spleen, kidney, testicle and thymus), shows strong expression of mRNAs in muscle level (Figure 5), hence the name myoneurin given to this new molecule (Figure 2).

 Transcripts coding for myoneurin are also observed in the testis, ovary, heart, placenta and thymus. A more limited expression is detected in the colon, peripheral blood, prostate, intestine, pancreas, kidney, lung and spleen. Three transcripts of 5000, 3200 and 2500 nucleotides are specifically recognized at high stringency, except at the level of the thymus where a 7 kb transcript is observed. The relative representation of the three mRNAs varies according to the tissue studied. The transcript of 2500 nucleotides is mainly expressed in the muscle and the testis, while the transcripts are fairly represented in the ovary. The specificity of the signals observed and of the probes used was highlighted by the similar results obtained with the 3 types of probes covering the different regions of myoneurin, including that corresponding to the cocksfoot domains (Figure 1; a, b, c) .

EXAMPLE 4: intronic regions, intron-exon junctions, and 5 'and 3' regions flanking the myoneurin gene.

 A human genomic library of the EMBL3-SP6 / T7 type (Clontech) is screened using the nucleic probes a and c described above (FIG. 1) and according to the conventional technique for screening phage libraries using nucleic probes labeled with digoxygenin-11-dUTP and according to the supplier's instructions (Boehringer Mannheim). Of the 3 isolated genomic clones, one of them, the genomic clone HMG9, the size of which is evaluated at 16 kb, hybridizes both probes a and c. The phage DNA of HMG9, purified by conventional techniques (Maniatis), is digested with EcoRI in order to isolate the internal genomic regions, then redigested by Xhol in order to isolate the flanking regions of the clone. The fragments obtained are subcloned into the pUC vectors 18 and 19 and sequenced according to the Sanger technique using relay oligonucleotide primers.

 The size of the introns is determined, by Southern, and / or PCR and / or sequencing.

The intron-exon junctions and the size of the introns are shown in Figure 6.

 The flanking regions (SEQ ID NO: 2) and (SEQ ID NO: 3) correspond respectively to the 5 'and 3' flanking ends of the myoneurin gene and overlap the

<Desc / Clms Page number 21>

 SEQ ID NO: 1. Note the presence of an intron fully identified in SEQ ID NO: 2 and located between the 2 exonic regions present in SEQ ID NO: 1.

EXAMPLE 5 Biosynthesis of myoneurin by genetic engineering.

 The Dral / HindIII restriction fragment from the Dral / Xhol construct was subcloned at the Smal / HindIII site in the expression vector pQE-30 (Qiagen). This construction, called DX, which codes for the 86-235 region of myoneurin is propagated in the E. coli M15 strain, containing the plasmid pREP4. Overexpression is obtained in the presence of IPTG. The hybrid protein has an N-terminal end composed of 6 histidines which promote purification by affinity chromatography on a column of chelated nickel (Ni-NTA agarose) following the indications of the supplier (Qiagen). The chimeric protein obtained has the following structure: MRGSHHHHHHGSACELGTPN ....... L DLQACKL.

The protein region of 150 amino acids of myoneurin is represented by dotted lines flanked by motifs coding for the N- and C-terminal amino acids, which are underlined. The amino acids in italics correspond to the vector. In the same way the SacI-EcoRV restriction fragment is subcloned into the expression vector pQE-30 cut by the restriction enzymes Sac 1 and Sma I. The peptide, called SE, thus obtained, is biosynthesized by genetic engineering , and advantageously covers the C-terminal region of myoneurin.

 EXAMPLE 6: polyclonal antibodies and analysis by Western blot.

 Advantageously, the chimeric proteins DX, on the one hand, and SE, on the other hand, described above are injected into 2 rabbits, according to conventional immunization protocols. The chimeric protein DX, which corresponds to the region covered by amino acids 86 to 235 of myoneurin, was chosen for its high specificity, since it only has a few amino acids belonging to the N-terminal domain BTB / POZ, and is found totally devoid of dactyl motifs. The non-immunogenic character of the supernumerary sequences is checked on a Western blot, using a serum obtained after an immunization carried out from a polypeptide synthesized in the same expression vector and according to the same reading frame. , but lacking the supernumerary region corresponding to myoneurin.

 The tissue samples which are analyzed by Western blotting are homogenized in the extraction buffer (Tris-HCl 20 mM pH 7.5, NaCl 150 mM, EDTA 0.5 mM, 0.2% Triton-X100) to which is added extemporaneously 500 g / ml of DNAase and 1/20 of the LAP20 antiprotease cocktail. Homogenization is carried out in ice using a glass-glass potter, then the homogenate is centrifuged at 100,000 rpm for 6 min. at 4 C.

<Desc / Clms Page number 22>

The concentration of the sample is evaluated by the Bradford technique or its equivalent (Pierce BCA technique). The equivalent of 100 g of protein is deposited on an acrylamide-SDS gel produced according to the Laemmli technique. The content of the gel is then transferred to a nitrocellulose membrane by the semi-dry electro-transfer technique. The membrane is saturated with a blocking solution containing 2% milk powder in TBS. Incubation of the membrane in the presence of antiserum or antibodies diluted with
1/1000 in incubation buffer (0.2% Triton, 1% milk powder in TBS) is carried out for 1 night at 4 ° C. or 90 min. at room temperature After 3 washes of 20 min. in 0.02% tween-20 in TBS, then 30 min. in TBS, the membrane is incubated in the presence of a secondary anti-rabbit antibody conjugated to peroxidase and diluted to 1/2000 in a 0.1% TBS-gelatin buffer. After 1 wash of 15 min. in 0.02% TBS-tween20 and 4 washes of 5 min. in TBS, the membrane is revealed by the ECL technique (Amersham Pharmacia Biotech).

 The 2 antisera obtained in rabbits, directed against the chimeric polypeptides DX and SE, and analyzed by Western blot on skeletal muscle, according to the technique described above, show the presence of a specific band of apparent molecular mass equivalent to 68 kDa and corresponding to the expected deducted size. The apparent molecular mass of 68 kDa was verified on protein extracts of human skeletal muscle, and on extracts of mouse skeletal muscle.

 EXAMPLE 7: of a homologous form of Myoneurin in mice.

 The sequence of the murine form of myoneurin is established by the sequence by a strategy of gene amplification from a cDNA library synthesized so as to allow the identification of the 5 'and 3' ends of the transcripts (Marathon Ready cDNA, Clontech) of a 17-day mouse embryo. According to the protocol described by Clontech, the cDNA library uses adapters attached to the two ends of the double-stranded cDNAs synthesized from the mRNA sample, in order to amplify by PCR the two 5 'and 3' ends of the transcript. In a first PCR, the nucleotide primer API (Clontech), corresponding to the adapter used for the synthesis of cDNAs, is used in combination with an antisense primer KZR4 (5'CATGAATCTTGAGATTGCTAGAA3 ') of human myoneurin, in order to determine the 5 'end of the transcript. The PCR is carried out over 40 cycles, with a hybridization step at 57 C for 1 min., Then a 3 'extension at 72 C and finally a denaturation of 1 min. at 94 C. The PCR fragment obtained is sequenced and its 5 'end makes it possible to design the murine primer MOZ-5 (5'GTTTCCCTTGGGCGGCTACG3'), In the same way and under the same experimental conditions described above, a

<Desc / Clms Page number 23>

 PCR is carried out with the sense primer of human origin STY (5'GGTATTCCAAGGCCAAGCCAAT3 ') and the antisense primer of murine origin ZS119 (5'TCTGCGAGGACGGCCTAGCAA3'), which has been identified in a murine (? Accession) sequence at GenBank: AA 119157). Finally, a final PCR based on the primers MOZ-5 and ZR2856 is carried out under conditions comparable to those described above, with the difference that the hybridization temperature is 62 C. The PCRs were duplicated using as polymerase, either DyNazyme II DNApolymerase (Finnzymes OY, Finland), or Taq DNApolymerase (Appligene-Oncor, Illkirch, France). The PCR products are subcloned into the vector pGEM-T, before sequencing with an ABI 377 automatic sequencer and using the DYEnamic ET sequencing kit (Amersham Pharmacia Biotech Inc.).

 The nucleic acid sequences obtained, using either of the DNA polymerases, are identical. A comparison at the nucleic level of the human and murine forms of myoneurin shows a homology of 88% and which can rise to 95% if the amino acid sequences are compared (SEQ ID NO: 63 and FIG. 7).

EXAMPLE 8 Immunohistochemical analysis of the expression of myoneurin.

 An immunohistochemical study was carried out on unfixed cryostat sections of 6 m of gastrocnemius muscle of adult mice (strain 129 ReJ). The tissues are frozen in isopentane. The sections are directly incubated for one hour at room temperature with an antiserum directed against myoneurin and diluted 1/100 in PBS containing 3% bovine serum albumin and or an antibody directed against merosine, also diluted 1/100. in PBS containing 3% bovine serum albumin. The sections are washed in PBS, containing 0.1% Tween-20, then incubated for one hour at room temperature, either with a secondary antibody coupled to peroxidase and diluted to 1/400, or incubated with α- bungarotoxin-rhodamine (Molecular Probes, Eugene, OR, USA) and diluted 1/10000 in PBS containing 3% bovine serum albumin. The washing is carried out in PBS containing 0.1% Tween-20. The primary and-myoneurin and anti-merosine antibodies are mixed for double labeling; single marking carried out on consecutive sections, allows the validity of the results obtained with double marking to be verified. The sections are mounted in the presence of Mowiol-glycerol and observed on a Zeiss Axiophot fluorescence microscope. The specificity of the immunofluorescent signal is verified by substituting the antibodies or the immunsera with non-immune IgGs. Staining with Hoechst's reagent is carried out according to conventional techniques and only 5 min before mounting the section.

<Desc / Clms Page number 24>

 Triple labeling using the specific Hoechst nucleus reagent, an antibody directed against myoneurin and rhodamine α-bungarotoxin, makes it possible to localize myoneurin at the level of the sub-synaptic nuclei of the neuromuscular junction. Labeling is observed in the satellite cells and in the peripheral nuclei of the myotendinous junction.

 EXAMPLE 9 Myoneurin during ontogenesis.

 RT-PCR analysis of the mRNA from skeletal muscle of human embryos, by specific amplification of the 3 'non-coding region and of the coding region located 5' of the cocksfoot motif, respectively using the amplimers ZF2-ZF4 and ZF3-ZF5.

37 PCR cycles are carried out, with hybridization conditions of 52 ° C. for 1 min., And extension and denaturation conditions of 1 min. at respective temperatures of 72 C and 94 C. The specificity of the amplification was verified by Southem, with the corresponding nucleic probes. Transcripts coding for myoneurin have been identified on human embryos from 13 weeks of gestation.

 Embryonic development was followed in mice at stages E 10, E 12, E 14, E 18 in the hind limbs and in the gastrocnemius in adults.

Until E 14, no labeling is detected, myoneurin appears at E 16 at the neuromuscular junction, which is verified by partial co-localization with labeling of the rhodamine acetylcholine receptor. Localization is amplified at the neuromuscular junction from E 18. At birth and in adults, labeling persists at the peripheral synapse with labeling confined to the level of the adjacent sub-synaptic nucleus identified by alpha-bungarotoxin. rhodamine and Hoechst's reagent, specific for nuclear labeling.

EXAMPLE 10 Myoneurin in Experimental Pathologies
An immunohistochemical and in situ hybridization study makes it possible to follow the expression of myoneurin during pathological processes. An immunohistochemical study was carried out on unfixed cryostat sections of 6 m of gastrocnemius muscle of adult mice (strain 129 ReJ) subjected to denervation. The technique used is similar to that described above.

 An in situ hybridization study is carried out on cryostatic sections of 12 m, fixed directly for 15 min. in PBS (pH 7.4) containing 4% of paraformaldehyde, then washed in PBS, then progressively dehydrated with increasing concentrations of ethanol. The sense and antisense ribonucleoditic probes are

<Desc / Clms Page number 25>

 labeled in the presence of dUTP digoxygenin by means of SP6 or T7 RNA polymerases, according to the conditions described by the supplier (Boehringer). The sections are pre-treated by passing through the microwave, then pre-hybridized for 1 hour at 42 ° C. in 100 l of the pre-hybridization solution (4XSSC, 2X Denhardt, 50% formamide, 1 g / ml of DNA salmon milt, and 1 dd, g / ml yeast tRNA). Hybridization is carried out overnight at 42 ° C. in a chamber sealed in 50 μl of pre-hybridization buffer and the sense or antisense probe marked with digoxygenin (10 ng / ml). The sections are washed at room temperature with 2X SSC (3 times 20 min.), Then washed 2 times 15 min. at 60 C by a 0.4X SSC washing solution, 40% formamide, 2 times quickly in 2X SSC at room temperature and finally 2 times 30 min. in 0.1X SSC at 60 C. The labeling is detected according to the supplier's protocol (Boehringer) using the Fab fragment of sheep anti-digoxygenin conjugated with alkaline phosphatase and in the presence of X-phosphate substrates and NBT.

 Analysis by electron microscopy is carried out on cryostatic sections of muscle prefixed in Sorensen phosphate buffer (pH 7.4) containing 3% formaldehyde and 0.05% glutaraldehyde. The sections are post-fixed in acetone for 90 sec., Then rinsed in the washing solution and treated with the blocking solution according to the protocol of the manufacturer of the Auroprobe One immunogold and silver staining kit (Amersham). The sections are incubated for 12 hours at 4 ° C. with the primary antibody diluted 1/50 in the washing solution, then incubated for 1 hour with the secondary antibody conjugated with colloidal gold particles (Auroprobe One, Amersham) and diluted in the same buffer. The samples are then treated with the IntenSE silver staining reagent according to the supplier's protocol. The sections are then post-fixed in Sorensen's phosphate buffer (pH 7.4) containing 2.5% of glutaraldehyde and treated with 2% osmium tetroxide, then dehydrated and inserted into Epon. The ultrafine sections are then stained with uranyl acetate and lead citrate and observed on a Philipps 410 electron microscope.

 After 5 days of denervation, there is clearly an overexpression of myoneurin in the muscle nuclei, satellite cells, sub-synaptic nuclei, but also in the sarcoplasm of the muscle fiber and the spindle myofibrils. The study carried out by electron microscopy, using colloidal gold particles, shows an expression in chromatin regions where intense gene activity reigns at the border of the euchromatin and heterochromatin regions, in particular at the level of perinuclear regions, which confirms the regulatory potential of this factor

<Desc / Clms Page number 26>

 nuclear. In addition, an overexpression is observed in the spindle: this is one of the rare examples highlighting an overexpression of a muscular factor in a region crucial for sensorimotor regulation. Analysis by in situ hybridization reveals a sudden increase in the quantity of transcripts after denervation, in particular at the level of the sarcoplasm. In addition, all the identified nuclei are labeled both at the peri-nuclear and intra-nuclear level, contrary to what can be observed on the intact muscle control.

 A similar study was carried out to determine the expression of myoneurin during a denervation / reinervation process. The animals are anesthetized and then subjected to crushing of the sciatic nerve with fine forceps. Three days after the partial alteration of the sciatic nerve by crushing, the effective retraction of the nerve is verified by a lack of immunological reactivity vis-à-vis an antibody specific for neurofilaments. Three days after the injury, the myoneurin immunological detection protocol described above is used. Myoneurin overexpression is observed in the nucleus, and in the sarcoplasm. A gradual return to normal occurs after restoration of the innervation on the 15th day.

 A study was carried out after treatment with botulinum toxin, which mimics a process of regeneration and induced synaptogenesis. The muscular paralysis is carried out on Swiss-Webster NMRI mice, by a single injection (0.55 pg of botulinum toxin-A) in the anterolateral region of the left hind limb of an adult mouse (weight 22-25 g). Complete paralysis of the EDL muscle (extendor digitorum longus) appears within 18 hours of the injection, using a standard electrophysiological technique to assess muscle activity. The EDL muscle is removed 25 days and 135 days after the injection of the toxin. An immunohistochemical analysis comparable to that described above, shows initially and until the 25th day an increasing nuclear expression of myoneurin, followed by an overexpression both nuclear and sarcoplasmic until the 70th day. On the 135th day, which corresponds to the stage of functional recovery, nuclear labeling is no longer observed, only residual cytoplasmic labeling persists, the last trace of myoneurin activation.

EXAMPLE 11 Expression of Myoneurin in Human Myopathology
An immunohistochemical analysis similar to that described above was performed on a biopsy taken from a patient with inflammatory polymyositis. Although the section shows the muscular structure of a normal muscle, it is observed that, unlike what can be observed on a normal muscle, the perinuclear region and the cytoplasm of certain muscle fibers are intensely marked, whereas these fibers have the

<Desc / Clms Page number 27>

 anatomopathological morphology of a normal fiber. This very early observation could allow the diagnosis of the pathology to be made well before the appearance of the first tissue alterations.

Bibliography: - Bardwell, V. J., and Treisman, R. 1994. The POZ domain: A conserved protein-protein interaction motif. Genes & Dev. 8.1664-1677.

 - Coleman J.E. 1992. Zinc proteins: storage proteins, transcription factors, and replication proteins. Annu Rev Biochem. 61.897-946.

- Hu, S., Fambrough, D.,. Atashi, J. R., Goodman, C. S., and Crews, S. T. 1995. The Drosophila abrupt gene encodes a BTB-zinc finger regulatory protein that controls the specificity of neuromuscular connections. Genes & Dev. 9.2936-2948.

- Huynh T. V., Young R. A., and Davies R. W. 1985. In: "DNA cloning. A practical approach". Flight. 1 (Glover D.M., ed) 49-78, IRL Press, Oxford.

- Kozak, M. (1991). Structural features in eukaryotic mRNAs that modulate the initiation of translation. J. Biol. Chem. 266.19867-19870.

- Knipple D. C., Seifert E., Rosenberg U. B., Preiss A., Jackle H.1985. Spatial and temporal patterns of Kruppel gene expression in early Drosophila embryos. Nature 317.40-44.

 - Miller J., McLachlan A. D, Klug A, 1985. Repetitive zinc-binding domains in the protein transcription factor IIIA from Xenopus oocytes. EMBO J. 4,1609-1614.

 - Nigg E.A., Baeuerle P. A., Luhrmann R., 1991. Nuclear import-export: in search of signais and mechanisms. Cell 66, 15-22.

- Rhodes D. and Klug A. 1993. Zinc fingers. Sci Am. 268.56-59.62-65.

 - Rosenberg U. B. et al., 1986. Structural homology of the product of the Drosophila Krüppel gene with Xenopus transcription factor IIIA. Nature, 319.336-339.

- Sandstrom, D. J., Bayer, C. A., Fristrom, J. W., and Restifo, L. L. 1997. BroadComplex transcription factors regulate thoracic muscle attachment in Drosophila. Dev. Biol.

181, 168-185.

- Sanger F., Nicklen S., and Coulson R. 1980. Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J Mol. Biol. 143.161-178.

- Shy Y. and Berg J. M. 1995. Specific DNA-RNA hybrid binding by zinc finger proteins.

Science, 268, 282-284.

 As is apparent from the above, the invention is in no way limited to those of the modes of implementation, embodiment and application which have just been described in a more explicit manner; on the contrary, it embraces all the variants which may come to the mind of the technician in the matter, without departing from the framework, or the scope, of the present invention.

Claims (21)

1) Purified nucleic acid fragment, characterized in that it comprises all or part of a sequence coding for a sequence of human Myoneurin, which has BTB / POZ and dactyl zinc domains, corresponding to the sequence SEQ ID NO : 1 or to a sequence having a level of homology with said sequence SEQ ID NO: 1 greater than or equal to 70%.  2) Nucleic acid fragment, characterized in that it comprises a segment of a sequence according to claim 1 and in particular the sequence SEQ ID NO: 2-3 and 64, the complementary nucleic sequences and the reverse sequences complementary to the sequences as well as the fragments originating from the coding regions of the preceding sequences corresponding to a sliding frame greater than or equal to 14 nucleotides or their complementary sequences.  3) Transcripts, characterized in that they are generated from the sequences according to any one of claims 1 and 2.  4) Diagnostic reagent for the differential detection of complete or partial human nucleic acid sequences, presenting motifs, selected from the sequences SEQ ID NO: 1-3 and / or SEQ ID NO: 64, characterized in that it is selected from the group consisting of the sequences SEQ ID NO: 1-51, the complementary nucleic sequences and the reverse sequences complementary to the preceding sequences, by the nucleotide fragments which hybridize to the sequences SEQ ID NO: 1-3 and / or SEQ ID NO : 64, and any flanking or overlapping sequence as well as by the fragments originating from the coding regions of the sequences SEQ ID NO: 1-3 and / or SEQ ID NO: 64, corresponding to a sliding frame greater than or equal to 14 nucleotides or their complementary sequences, possibly marked with an appropriate marker.  5) Reagent according to claim 4, characterized in that it is selected from the sequences SEQ ID NO: 4-51 and in that it is suitable for use as a primer.  6) Reagent according to claim 4, characterized in that it is selected from the following sequences: a fragment amplified by the pair of primers SEQ ID NO: 20 and SEQ ID NO: 26 (primers TA55Z and ZD27) and is suitable to be used as a probe. a fragment amplified by the pair of primers SEQ ID NO: 7 and SEQ ID NO: 9 (primers ZATG7 and YTS86) and is suitable for use as a probe. a fragment amplified by the pair of primers SEQ ID NO: 29 and SEQ ID NO: 31 (primers ZF2 and ZF4) and is suitable for use as a probe. <Desc / Clms Page number 29>  7) Method for rapid and differential detection of the Myoneurin nucleic sequences of their normal or pathological variants, by hybridization and / or gene amplification, carried out from a biological sample, which method is characterized in that it comprises: (a ) a step in which a biological sample to be analyzed is brought into contact with at least one probe selected from the sequences SEQ ID NO: 1-51 and SEQ ID NO: 64, or as defined according to claim 6 and ( b) a step in which the product or products resulting from the nucleotide sequence-probe interaction are detected by any appropriate means.  8) Detection method according to claim 7, characterized in that it comprises: * prior to step (a):. a step of extracting the nucleic acid to be detected, and. at least one gene amplification cycle implemented using # at least one reagent according to any one of claims 4 and 5 * after step (b):. a step of comparing the nucleic acid sequences obtained in said biological sample with the human myoneurin sequences according to any one of claims 1 and 2, by any appropriate means and in particular by sequencing, Southem-blot, restriction cleavage, SSCP or any other method for identifying an insertion or a deletion or even a simple mutation between the different sequences compared.  9) Method for detecting transcripts according to claim 3, characterized in that it comprises: - the removal of messenger RNAs from control tissues and tissues taken from patients and - the qualitative and / or quantitative analysis of said mRNAs, by in situ hybridization, by dot-blot, Northem-blot, RNAse mapping or RT-PCR, using a diagnostic reagent according to any one of claims 4 to 6.  10) Translation products, characterized in that they are coded by a nucleotide sequence according to any one of claims 1 to 2.  11) Peptide, characterized in that it is expressed using a nucleotide sequence selected from the group consisting of the sequences SEQ ID NO: 1-3 and 64 according to any one of claims 1 to 2, according to the combinations offered by the use of the different possible reading frames.  12) Peptide according to claim 11, characterized in that it includes the derived peptides comprising between 5 and 610 amino acids. <Desc / Clms Page number 30>  13) Peptide according to claim 11or claim 12, characterized in that it is selected from the sequences SEQ ID NO: 53-63.  14) Peptide according to any one of Claims 11 to 13, characterized in that it is obtained from the nucleic sequences according to any one of Claims 1 to 2, in which at least one nonsense codon can be replaced by a codon coding for one of the following amino acids: (F), Leu (L), Ser (S), Tyr (Y), Cys (C), Trp (W), Gln (Q), Arg (R) , Lys (K), Glu (E) or Gly (G).  15) Peptide according to any one of Claims 11 to 14, characterized in that it is obtained from the nucleic sequences according to any one of Claims 1 to 2, in which an amino acid can be replaced by an amino acid homologous, according to the classic rules recalled below: (K) or Arg (R), Asp (D) or Glu (E) or Asn (N) or Gln (Q), Ala (A) or Gly (G), Ile (I) or Leu (L) or Val (V), Thr (T) or Ser (S), Phe (F) or Tyr (Y) or Try (W).  16) Antibody, characterized in that it is directed against one or more of the peptides according to any one of claims 11 to 15.  17) A method of differential immunological screening of normal or pathological Myoneurin sequences, characterized in that it comprises bringing a biological sample into contact with an antibody according to claim 16, the reading of the result being revealed by an appropriate means, including EIA, ELISA, RIA, fluorescence.  18) Method for identifying and detecting a Myoneurin motif chosen from any one of the sequences SEQ ID NO: 1-3, and / or SEQ ID NO: 64, and / or SEQ ID NO: 52-63 , abnormally expressed in the context of pathologies associated with cell or tissue development, first among which pathologies associated with cancer or affecting the neuromuscular sphere, characterized in that it includes the comparative analysis of the sequences extracted from a biological sample with the sequences according to any one of claims 7,8, 9 and 17.  19) Use of sequences according to any one of claims 1 to 3 or 10 to 15 for preparing a composition intended for the diagnosis, prognosis, evaluation of genetic susceptibility, to all human diseases induced, innate or acquired in particular those with cancerous components, or affecting the neuromuscular sphere in which all or part of the sequences according to any one of claims 1 to 3 and related forms intervenes.  20) Hybrid nucleic acid sequences, characterized in that they comprise sequences or motifs according to any one of claims 1 to 3, <Desc / Clms Page number 31>  combined with sequences or patterns having similar structural characteristics.  21) Use of sequences, characterized in that they comprise nucleic acid sequences or motifs according to any one of claims 1 to 3, for the preparation of compositions intended for gene therapy or for gene modifications, for example for reparative purposes in the medical field, or for veterinary and / or food use.