FR2804962A1 - Compound capable of modulating interaction between the PTB1 domain of FE65 protein and hnRNPL and/or FEBP1 protein, useful to treat neurological disorders including Alzheimer's disease - Google Patents

Abstract

A compound capable of at least partially modulating interactions between hnRNPL (undefined) and/or FEBP1 (undefined) proteins or their homologues and the PTB1 domain of FE65, is new. Independent claims are also included for the following: (i) a 337 amino acid sequence (I) fully defined in the specification or its derivative or fragment; (ii) a polypeptide (II) derived from a 349 amino acid sequence fully defined in the specification having a non-functional effector region; (iii) a nucleic acid encoding the above polypeptides; (iv) a nucleic acid capable of hybridizing with the above nucleic acid or its complement; (v) a vector comprising one of the above nucleic acids; (vi) a disarmed recombinant virus comprising one of the above nucleic acids; (vii) an antibody or its fragment directed against the above polypeptide; (viii) a non-peptide or naturally not exclusively peptide compound susceptible for modulating interaction between hnRNPL and/or FEBP1 proteins or their homologues and the PTB1 domain of FE65; (ix) selecting or characterizing active molecules, comprising selecting for molecules capable of binding to sequence I or II or their fragments; and (x) producing the above peptide compound, comprising culturing a cell containing the above nucleic acid or vector under expression conditions, and recovering the peptide compound product. ACTIVITY : Nootropic; neuroprotective. No supporting data is given. MECHANISM OF ACTION : Modulating protein-protein interactions, particularly to prevent formation of amyloid plaques.

Description

<Desc / Clms Page number 1>

PARTNERS OF THE PTB DOMAIN OF FE65, PREPARATION AND
USES
Alzheimer's disease (AD) is a neurodegenerative disease that affects a large proportion of the elderly population. This disease is clinically characterized by loss of cognitive function, and neuropathologically by the presence in the brain of intracellular neurofibrillary deposits and extracellular deposits of the amyloid-forming amyloid (3-amyloid) peptide (Yankner, The amyloid plaques are predominantly composed of 40 or 42 amino acid Ass peptides that are generated by a proteolytic process of the peptide / 3-amyloid precursor protein (APP) (Golde et al., 1992) Extracellular deposits. of Ap are specific to AD.They represent the early and invariable characteristic of all forms of AD, including familial forms.The familial forms of the disease appear relatively early (between 40 and 60 years) and are due to mutations in the APP gene and in the genes for presenilin-1 (PSI) and presenilin-2 (PS2) .The mutations in these three genes s induce changes in proteolysis of APP, leading to overproduction of Ap and early onset of pathology and symptoms that are similar to sporadic forms of AD.

 Internalization of the membrane APP is a necessary step in the proteolysis process of APP (Koo and Squazzo, 1994) which depends on its cytoplasmic domain. Indeed, the deletion of this region of the protein or the presence of point mutations in the Tyr-Glu-Asn-Pro-Thr-Tyr sequence in the cytoplasmic domain of the APP, induces a significant decrease in the production of the O-amyloid peptide (Perez et al., 1999). Several proteins have been identified as interacting with the cytoplasmic domain of APP, which could therefore participate in the regulation of the proteolytic process of APP and thus in the production of the peptide (3-amyloid. FE65 and XI which interact with the Tyr-Glu-Asn-Pro-Thr-Tyr sequence of the cytoplasmic domain of APP (Borg et al., 1996, 1998; Bressler et al., 1996; Duilio et al.,

<Desc / Clms Page number 2>

 1998; Fiore et al., 1995; Guénette et al., 1996; McLoughlin and Miller, 1996; Mercken et al., 1998; Tanahashi and Tabira, 1999a, 1999b and 1999c). The FE65 protein family consists of three members called FE65, COFE65 / FE65L1 and FE65L2. The X11 protein family also consists of three members called XI la, XI lp and XI ly. These two families of proteins have opposite effects on the regulation of the production of the peptide (3-amyloid) We have shown, as well as another laboratory, that the over-expression of FE65 induces an increase in the production of the Ap peptide ( Mercken et al., 1998, Sabo et al., 1999), whereas the overexpression of XI 1 induces a decrease in Ass peptide production (Borg et al., 1998, Sastre et al., 1998).

 Analysis of the primary structure of FE65 indicates that this protein is likely to play the role of adapter. Indeed, FE65 contains three protein domains involved in protein-protein interactions: a WW domain in the amino-terminal half and two PTB domains (PhosphoTyrosine Binding domain), called PTB1 and PTB2, in the carboxy-terminal half. The deletion construct has shown that the PTB2 domain of FE65 is involved in the interaction with the cytoplasmic domain of APP. The WW domain interacts with at least five proteins, two of which have been identified as the Mena (Mammalian homologue of Enabled) protein (Ermekova et al., 1997). In addition, the PTB domain of FE65 interacts with the transcription factor CP2 / LSF / LBP (Zambrano et al., 1997) and with the LRP receptor (LDL receptor-related protein) (Trommsdorff et al., 1998). The role of these proteins in the physiological function of FE65 is not known to date.

 The elucidation of the exact role of the FE65 protein in the production process of the peptide (3-amyloid) is therefore a major issue for the understanding and therapeutic approach of Alzheimer's disease and more generally of neurodegenerative diseases.

<Desc / Clms Page number 3>

 The present invention resides in the identification of partners of the FE65 protein, interacting with this protein under physiological conditions. These partners represent new pharmacological targets for the manufacture or search of compounds capable of modulating the activity of FE65, in particular its activity on the production of the peptide (3-amyloid) .These proteins, the antibodies, the corresponding nucleic acids as well as the specific probes or primers can also be used for the detection or assaying of proteins in biological samples, including nerve tissue samples.These proteins or nucleic acids are also useful in therapeutic approaches, to modulate the activity of FE65, as well as any compound according to the invention capable of modulating the interaction between FE65 and the polypeptides of the invention.

 The present invention results more particularly from the demonstration by the Applicant of two human proteins interacting with the PTB domain 1 of FE65 (shown in the sequence SEQ ID N: 1 and 2). Thus, the present invention shows that the central region of the hnRNPL protein interacts with the PTB domain of FE65. It also describes the identification of a novel protein, called FEBP1 (FE65 Binding PTB1domain protein), capable of interacting with the PTB domain 1 of FE65.

 The present invention also results from the identification and characterization of particular regions of the above hnRNPL and FEBP1 proteins involved in the modulation of FE65 protein function. The demonstration of the existence of these proteins and regions involved in their function makes it possible in particular to prepare new compounds and / or compositions that can be used as pharmaceutical agents and to develop industrial methods for screening such compounds.

 A first subject of the invention therefore relates to compounds capable of modulating, at least partially, the interaction of the hnRNPL and / or FEBP proteins (or their homologues) with the PTBI domain of FE65 or of interfering with this interaction.

<Desc / Clms Page number 4>

 The interference of a compound according to the invention can be manifested in different aspects. The compound of the invention can slow down, inhibit or stimulate, at least partially, the interaction between a hnRNPL and / or FEBP1 protein (or homologues thereof) and the PTB1 domain of FE65. It is preferentially compounds capable of modulating this interaction in vitro, for example in a double-hybrid system or in any acellular system for detecting an interaction between two polypeptides. The compounds according to the invention are preferably compounds capable of at least partially modulating this interaction, preferably of increasing or inhibiting this interaction by at least 20%, more preferably at least 50%, compared to a control in absence of the compound.

 Within the meaning of the present invention, the denomination of the proteins hnRNPL and FEBP1 covers the proteins themselves as well as all their homologous forms. By homologous form is meant all proteins equivalent to the protein in question, of diverse cell origin and in particular derived from cells of human origin, or other organisms, and having an activity of the same type.

Such homologs also include naturally occurring variants of the indicated proteins, including polymorphic or splice variants. Homologous proteins (or polypeptides) can be obtained for example by hybridization experiments between the nucleic acids encoding. Within the meaning of the invention, it suffices that a sequence of this type has a significant identity percentage to lead to physiological behavior comparable to those of the hnRNPL and / or FEBP1 proteins as claimed.

 According to a particular mode of implementation, the compounds of the invention are capable of binding at the level of the interaction domain between the hnRNPL and / or FEBP proteins and the PTB domain of FE65.

 The compounds according to the present invention may be of varied nature and origin. In particular, they may be compounds of peptide, nucleic (i.e., comprising a base sequence, in particular a DNA or RNA molecule), lipidic, saccharide, antibody, etc. type. and, more generally, any organic or inorganic molecule.

<Desc / Clms Page number 5>

 According to a first variant, the compounds of the invention are of peptide nature. The term peptide refers to any molecule comprising a chain of amino acids, such as for example a peptide, a polypeptide, a protein, an antibody (or fragment or antibody derivative), where appropriate modified or combined with other compounds or chemical groups. In this regard, the term peptide more specifically denotes a molecule comprising a sequence of at most 50 amino acids, more preferably not more than 40 amino acids. A polypeptide preferably comprises from 50 to 500 amino acids, or more. A protein is a polypeptide corresponding to a natural molecule.

 According to a first preferred embodiment, the peptide compounds of the invention comprise a part of the peptide sequence of the hnRNPL protein and / or the FEBP1 protein and / or their derivatives. It is more particularly a part of the sequence of the hnRNPL protein and / or of the FEBP1 protein, said proteins being characterized respectively in that they comprise the sequences SEQ ID N 7 and SEQ ID N 9.

 Peptide compounds according to the invention are more preferably compounds comprising a region whose sequence corresponds to all or a functional part of the interaction site of the hnRNPL protein and / or the FEBPI protein with the PTB domain of FE65. Such compounds, in particular peptides, are competitors of hnRNPL and / or FEBP1 and are capable of modulating at least partially the interaction between the hnRNPL protein and / or the FEBP1 protein (and / or homologous forms) and the PTB1 domain of FE65. They are more preferably peptide compounds comprising residues 1 to 349 of the sequence SEQ ID N: 7 or residues 1 to 337 of the sequence SEQ ID N: 9. As indicated in the examples, these sequences comprise a part of less of the central region of the hnRNPL proteins (residues 116 to 464) and FEBP 1, and are able to specifically interact with the PTB1 domain of FE65, and not with the PTB2 domain of FE65.

<Desc / Clms Page number 6>

 In a specific mode of implementation, the compound is a fragment of the sequence SEQ ID N: 7, of at least 5 amino acids, preferably at least 9 amino acids, comprising the sequence Asn-Pro-Ile-Tyr ( residues 55-58).

 According to another preferred embodiment, the peptide compounds of the invention are compounds derived from the hnRNPL protein or from the FEBP1 protein (and / or homologous forms) carrying an effector region rendered non-functional. Such peptide compounds can be obtained by deletion, mutation or disruption of this effector region at least on the hnRNPL protein and / or the FEBP1 protein and / or homologous forms. Such modifications may be made, for example, by in vitro mutagenesis, introduction of additional elements or synthetic sequences, or deletions or substitutions of the original elements. These polypeptides therefore have the ability to bind the FE65 protein, but can not induce a functional signal, at least of the same order as the native proteins.

 According to a specific embodiment, it is a polypeptide comprising the sequence SEQ ID N: 7 or SEQ ID N: 9, and carrying a mutation at least in the effector region.

 According to a specific embodiment, it is a polypeptide comprising the sequence SEQ ID N: 7 or SEQ ID N: 9, and carrying a deletion at least in the effector region.

 According to a specific embodiment, it is a polypeptide comprising the sequence SEQ ID N: 7 or SEQ ID N: 9, and carrying an insertion at least in the effector region.

 Another particular object of the invention resides in the FEBP1 protein, or any fragment or derivative thereof. It is more particularly any polypeptide comprising the sequence SEQ ID N: 9 or a derivative or fragment thereof, even more preferably any polypeptide comprising at least 10 consecutive residues of the sequence SEQ ID N: 9 or a derivative of it, even more

<Desc / Clms Page number 7>

 preferably comprising at least the residues involved in the binding to the PTB domain 1 of FE65.

 Another subject of the invention resides in a polypeptide comprising the sequence SEQ ID N: 7.

 The term "derivative" refers more particularly to the meaning of the present invention any sequence differing from the sequence in question because of a degeneracy of the genetic code, obtained by one or more modifications of a genetic and / or chemical nature, as well as any peptide coded by a sequence hybridizing with nucleic sequences SEQ ID N: 6 or 8 or fragments thereof, and having the ability to interfere at the level of the interaction between the hnRNPL protein and / or the FEBP1 protein, and / or the one of their counterparts, and the PTB1 domain of FE65. By modification of genetic and / or chemical nature, it can be understood any mutation, substitution, deletion, addition and / or modification of one or more residues. The term "derivative" also includes the sequences homologous to the sequence in question, originating from other cellular sources and in particular from cells of human origin, or from other organisms, and having an activity of the same type. Such homologous sequences can be obtained by hybridization experiments. Hybridizations can be carried out from nucleic acid libraries, using as a probe the native sequence or a fragment thereof, under variable conditions of hybridization (Sambrook et al., Cf. General Techniques of Molecular Biology) . Moreover, the term fragment or part refers to any portion of the molecule considered, comprising at least 5 consecutive residues, preferably at least 9 consecutive residues, more preferably at least 15 consecutive residues.

 Such derivatives or fragments can be generated for different purposes, such as in particular that of increasing their therapeutic efficacy or reducing their side effects, or that of conferring on them new pharmacokinetic and / or biological properties.

 When a derivative or fragment as defined above is produced, its biological activity on the binding of the hnRNPL protein and / or the FEBP1 protein, and / or

<Desc / Clms Page number 8>

 homologous forms at their binding site on the PTB 1 domain of FE65 can be evidenced. Any technique known to those skilled in the art can obviously be used for this purpose, as explained in the experimental section (double-hybrid, column immobilization, acellular system, cellular system, etc.).

 In general, the compounds of the invention may be any fragment of the HnRNPL or FEBP proteins or peptide compounds indicated above.

Such fragments can be generated in different ways. In particular, they can be synthesized chemically, on the basis of the sequences given in the present application, using the peptide synthesizers known to those skilled in the art. They can also be synthesized genetically, by expression in a cellular host of a nucleotide sequence coding for the desired peptide.

In this case, the nucleotide sequence can be prepared chemically using an oligonucleotide synthesizer, based on the peptide sequence given in the present application and the genetic code. The nucleotide sequence may also be prepared from the sequences given in the present application, by enzymatic cleavage, ligation, cloning, etc., according to the techniques known to those skilled in the art, or by screening DNA libraries with probes. elaborated from these sequences.

 Other peptides according to the invention are the peptides capable of competing with the peptides defined above for the interaction with their cellular target. Such peptides can be synthesized in particular on the basis of the sequence of the peptide in question, and their ability to compete with the peptides defined above can be determined.

 According to another particular embodiment, the compounds of the invention are antibodies or fragments or derivatives of antibodies. Thus, another object of the invention resides in polyclonal or monoclonal antibodies or antibody fragments directed against a peptide compound or a protein as defined

<Desc / Clms Page number 9>

 above. Such antibodies can be generated by methods known to those skilled in the art. In particular, these antibodies can be prepared by immunizing an animal against a peptide of the invention, by taking blood, and isolating the antibodies. These antibodies can also be generated by preparing hybridomas according to the techniques known to those skilled in the art.

 More preferably, the antibodies or antibody fragments of the invention have the capacity to modulate at least partially the interaction of the peptide compounds defined above or hnRNPL and / or FEBP1 proteins with the PTB domain of FE65, and can be used to modulate the activity of FE65.

 Moreover, these antibodies can also be used to detect and / or assay the expression of the claimed peptides in biological samples, and thus to provide information on their activation state.

 The antibody fragments or derivatives are, for example, Fab, Fab'2 fragments, single-chain antibodies (ScFv), etc. These include any fragment or derivative that retains the antigenic specificity of the antibodies from which they are derived.

 The antibodies according to the invention are more preferably capable of binding the hnRNPL and / or FEBP proteins respectively comprising the sequence SEQ ID N: 7 or 9, in particular the region of these proteins involved in the interaction with FE65. These antibodies (or fragments or derivatives) are more preferably capable of binding an epitope present in the sequence between residues 1 and 349 of SEQ ID N: 7 or between residues 1 and 337 of SEQ ID No. 6.

 The invention also relates to non-peptide or non-exclusively peptide compounds, capable of interfering at the level of the aforementioned interaction, and their use as a pharmaceutical agent. It is indeed possible, from the active protein motifs described in the present application, to produce molecules that modulate the activity of hnRNPL and / or FEBP1 proteins that are not exclusively peptidic and compatible with a pharmaceutical use, in particular by duplicating the motifs. active peptides with a non-peptide structure or non-exclusively peptide.

<Desc / Clms Page number 10>

 The present invention also relates to any nucleic acid encoding a peptide compound according to the invention. It may be in particular a sequence comprising all or part of the sequences presented in SEQ ID N: 6 and SEQ ID N: 8 or their derivatives. By derivative sequence is meant in the sense of the present invention any sequence hybridizing with the sequences shown in SEQ ID N: 6 and SEQ ID N: 8, or with a fragment thereof, coding for a peptide according to the invention , as well as the sequences resulting from these by degeneracy of the genetic code. The different nucleotide sequences of the invention may be of artificial origin or not. It can be genomic sequences, cDNA, RNA, hybrid sequences or synthetic or semi-synthetic sequences. These sequences can be obtained either by screening of DNA libraries (cDNA library, genomic DNA library) or by chemical synthesis, or by mixed methods including the chemical or enzymatic modification of sequences obtained by screening libraries. The hybridization mentioned above is preferably carried out under high stringency conditions, and especially at a temperature of 50 ° C. for 1 hour in a solution containing 8.823 g / l of trisodium citrate-2H 2 O, 17.532 g / l of sodium chloride and 1% of sodium dodecyl sulphate, or under the conditions described by Sambrook et al (1989, pages 9.52-9.55).

 A particular nucleic acid for the purposes of the invention codes for a polypeptide comprising the sequence SEQ ID N: 9 or a fragment or derivative thereof, in particular for the human FEBP1 protein. It is advantageously a nucleic acid comprising the nucleic acid sequence SEQ ID N: 8.

 The nucleic acids according to the invention can be used for the production of the peptide compounds of the invention. The present application therefore also relates to a process for preparing a peptide compound according to which a cell containing a nucleic acid according to the invention is cultured under conditions of expression of said nucleic acid and the peptide compound produced is recovered.

In this case, the coding part for said polypeptide is generally placed under the

<Desc / Clms Page number 11>

 signal control allowing its expression in a cellular host. The choice of these signals (promoters, terminators, secretory leader sequence, etc.) may vary depending on the cellular host used. Moreover, the nucleic acids of the invention may be part of a vector that may be autonomously replicating or integrative.

More particularly, autonomously replicating vectors can be prepared using autonomously replicating sequences in the chosen host. Regarding the integrative vectors, these can be prepared for example by using sequences homologous to certain regions of the host genome, allowing, by homologous recombination, the integration of the vector. It may be a vector of plasmidic, episomal, chromosomal, viral type, etc.

 The cellular hosts which can be used for the production of the peptides of the invention by the recombinant route are both eukaryotic and prokaryotic hosts. Suitable eukaryotic hosts include animal cells, yeasts, or fungi. In particular, in the case of yeasts, mention may be made of the yeasts of the genus Saccharomyces, Kluyveromyces, Pichia, Schwanniomyces, or Hansenula.

In the case of animal cells, COS, CHO, C127 and PC12 cells may be mentioned.

Among the fungi, more particularly Aspergillus ssp. or Trichoderma ssp. As prokaryotic hosts, it is preferred to use the following bacteria, E. coli, Bacillus, or Streptomyces.

 The nucleic acids according to the invention can also be used for producing antisense oligonucleotides or genetic antisense that can be used as pharmaceutical or diagnostic agents. The antisense sequences are small oligonucleotides, complementary to the coding strand of a given gene, and therefore are capable of specifically hybridizing with the transcribed mRNA, inhibiting its translation into protein. The invention thus relates to the antisense sequences capable of at least partially inhibiting the interaction of the hnRNPL and / or FEBP proteins on the PTB domain of FE65. Such sequences may consist of all or part of the nucleotide sequences defined above. These are generally sequences or fragments of complementary sequences of coding sequences for

<Desc / Clms Page number 12>

 peptides interacting with the PTB1 domain of FE65. Such oligonucleotides can be obtained by fragmentation, or chemical synthesis, etc.

 The nucleic sequences can also be used in the context of therapies for the transfer and in vivo expression of antisense sequences or peptides capable of modulating the interaction of hnRNPL and / or FEBP1 proteins with the PTB domain of FE65. In this regard, the sequences can be incorporated into viral or non-viral vectors, allowing their administration in vivo (Kahn, A. et al., 1991). As viral vectors according to the invention may be mentioned especially adenovirus-type vectors, retrovirus, adenovirus associated virus (AAV) or herpes virus. The present application also relates to defective recombinant viruses comprising a nucleic acid encoding a (poly) peptide according to the invention.

 The invention also allows the production of nucleotide probes, synthetic or not, capable of hybridizing with the nucleic acids defined above or with their complementary strand. Such probes can be used in vitro as a diagnostic tool, for the detection of the expression or overexpression of the hnRNPL and / or FEBP1 proteins, or for the detection of genetic abnormalities (bad splicing, polymorphisms, point mutations, etc.). These probes can also be used for the detection and isolation of homologous nucleic acid sequences coding for peptides as defined above, from other cellular sources and preferably from cells of human origin. The probes of the invention generally comprise at least 10 bases, and they may for example comprise up to all of one of the aforementioned sequences or their complementary strand. Preferably, these probes are marked prior to their use. For this, various techniques known to those skilled in the art can be employed (radioactive labeling, fluorescent, enzymatic, chemical, etc.).

 The subject of the invention is also any pharmaceutical composition comprising as active ingredient at least one compound as defined above, in particular a peptide compound.

<Desc / Clms Page number 13>

 It relates in particular to any pharmaceutical composition comprising as active ingredient at least one antibody and / or an antibody fragment as defined above, as well as any pharmaceutical composition comprising as active principle at least one nucleic acid or a vector such as defined above.

 It also relates to any pharmaceutical composition comprising as active ingredient a chemical molecule capable of increasing or decreasing the interaction between the proteins hnRNPL and / or FEBP1 and the FE65 protein.

 Moreover, it also relates to pharmaceutical compositions in which the peptides, antibodies, chemical molecules and nucleotide sequences defined above are associated with one another or with other active ingredients.

 The pharmaceutical compositions according to the invention can be used to modulate the activity of hnRNPL and / or FEBP1 proteins and thereby modify the function of APP, its intracellular transport, its maturation and its conversion to peptide (3-amyloid. More particularly, these pharmaceutical compositions are intended to modulate the interaction between the hnRNPL or FEBP 1 proteins and the FE65 protein, more preferably pharmaceutical compositions intended for the treatment of neurodegenerative diseases such as Alzheimer's disease. The compositions (or compounds) of the invention are more particularly intended to inhibit, at least partially, the interaction between the FE65 protein and the hnRNPL and / or FEBP 1 protein.

 The subject of the invention is also the use of the molecules described above for modulating the activity of the FE65 protein or the typing of neurodegenerative diseases. In particular, the invention relates to the use of these molecules to modulate at least partially the activity of the PTB domain of FE65.

 The invention also relates to a method for screening or characterizing molecules that are active on the function of the FE65 protein, comprising the selection of molecules capable of binding the sequence SEQ ID N: 7 or the sequence SEQ ID N: 9, or a fragment (or derivative) thereof. The method advantageously comprises contacting, in vitro, the test molecule or molecules with a polypeptide comprising the sequence SEQ ID N: 7 or the sequence SEQ ID N: 9, or

<Desc / Clms Page number 14>

 a fragment (or derivative) thereof, and the selection of molecules capable of binding the sequence SEQ ID N: 7 (in particular the region between residues 1 and 349) or the sequence SEQ ID N: 9 (in particular the region between residues 1 and 337).

The molecules tested may be of a varied nature (peptide, nucleic acid, lipid, sugar, etc., or mixtures of such molecules, for example combinatorial libraries, etc.). As indicated above, the molecules thus identified can be used to modulate the activity of the FE65 protein, and represent potential therapeutic agents for the treatment of neurodegenerative pathologies.

 Other advantages of the present invention will appear on reading the examples which follow. These should be considered as illustrations and not limiting.

MATERIALS AND TECHNIQUES IMPLEMENTED
1) Yeast strains used:
Strain L40 of the genus S.cerevisiae (Mata, his3D200, trp1901, leu2-3,112, ade2, LYS2 :: (lexAop) 4-HIS3, URA3 :: (lexAop) 8-LacZ, GAL4, GAL80) was used. as a screening tool of the brain fusion bank by the Two Hybrids system. This strain makes it possible to demonstrate protein-protein interaction when one of the protein partners is fused to the LexA protein (Vojtek et al., 1993). It was grown on the following culture medium:
Minimum YNB medium: -Yeast Nitrogen Base (without amino acids) (6.7g / l) (Difco) - Glucose (20g / l) (Merck)
This medium can be made solid by adding 20 g / l of agar (Difco).

 To allow the growth of auxotrophic yeasts on this medium, it is necessary to add the amino acids or nitrogen bases, for which they

<Desc / Clms Page number 15>

 are dependent at 50mg / ml. 100 μg / ml of ampicillin are added to the medium in order to avoid bacterial contaminations.

2) Bacterium strains used:
The strain Escherichia coli TG1, of genotype supE, hsdA5, thi, (lac-proAB), F '[trans D36 pro A + B + lacIq lacZAM15], was used for the construction of plasmids, and for the amplification and isolation of plasmids. It was grown on the following medium:
Medium LB: - NaCL (5g / l) (Sigma) - Bactotryptone (10g / l) (Difco) - Yeast Extract (5g / l) (Difco)
This medium can be made solid by adding 20 g / l of agar (Difco).

 Ampicillin, at 100 μg / ml, was used to select the bacteria that received the carrier plasmids as a marker for the resistance gene to this antibiotic.

3) Plasmids used:
The vector pGADIO, provided by Clontech, allows yeast expression of fusion proteins between the transactivator domain of GAL4 and a cDNA-encoded protein from a brain library.

 The vector pLex9 (pBTM116) (Bartel et al., 1993) allows the expression in yeast of fusion proteins with the LexA protein.

 The vector pGAD424, (Clontech), allows the expression in yeast of fusion proteins with the transactivator domain of GAL4. pLex-FE65PTBI, plasmid pLex9 which contains the sequence coding for the PTB domain of the FE65 protein (amino acids 395 to 543). This plasmid was used for the screening of protein partners of the PTB1 domain of FE65.

<Desc / Clms Page number 16>

 pLex-FE65PTB2, plasmid pLex9 which contains the sequence coding for the PTB2 domain of the FE65 protein (amino acids 565 to 698) known to interact with the cytoplasmic region of the APP (amyloid P-peptide precursor). This plasmid was used to test the interaction specificity of the hnRNPL and FEBP1 proteins with the PTB domains of FE65. pLex-HaRasVall2, plasmid pLex9 which contains the coding sequence for the Val 12-mutated HaRas protein known to interact with the mammalian Raf protein (Vojtek et al., 1993). This plasmid was used to test the interaction specificity of the hnRNPL and FEBP1 proteins with FE65. pGAD-Raf, plasmid pGAD424 which contains the coding sequence for the Raf protein (Vojtek et al., 1993). This plasmid was used to test the interaction specificity of hnRNPL and FEBP1 proteins with FE65. pGAD-App, plasmid pGADIO which contains the coding sequence for the cytoplasmic domain of the APP protein known to interact with the PTB2 domain of FE65 (Mercken et al., 1998). This plasmid was used to test the interaction specificity of the hnRNPL and FEBP1 proteins with FE65.

4) Synthetic oligonucleotides used:
The oligonucleotides are synthesized on the Applied System ABI 394-08 apparatus. They are removed from the synthesis matrix by ammonia and precipitated twice with 10 volumes of n-butanol and then taken up in water. Quantification is performed by measuring the optical density.

SEQ ID NO: 3 CTTCCCGGGTCCCCCACGGAATACCAAC
SEQ ID N 4: GGGGTCGACGGCATTACGCCGTTCGGC
These oligonucleotides made it possible to obtain the PCR fragment corresponding to the PTB domain of FE65 (represented on the sequence SEQ ID No. 1), introducing the Xmal and SalI sites at the (underlined) ends.

<Desc / Clms Page number 17>

SEQ ID NO: 5: CCACTACAATGGATGATG
This oligonucleotide (GAL4TA) was used to sequence the inserts contained in the plasmids of the library Two Brain cDNA hybrids.

5) Preparation of the plasmidic DNAs
The preparations in small quantity and in large quantity of plasmid DNA were carried out according to the protocols recommended by the manufacturer Quiagen DNA purification kits: - Quiaprep Spin Miniprep kit, ref: 27106 - Quiaprep Plasmid Maxiprep kit, ref: 12163 .

6) Enzymatic Amplification of DNA by PCR (Polymerase Chain Reaction)
The PCR reactions are performed in a final volume of Yes in the presence of the DNA template, dNTP (0.2mM), PCR buffer (10mM Tris-HCL pH 8.5, 1mM MgCl2, 5mM KCl 0.01% gelatin), 0.5 μg each of oligonucleotides and 2.5 IU Amp Taq DNA polymerase (Perkin Elmer) with or without formamide (5%). The mixture is covered with 2 drops of paraffin oil to limit the evaporation of the sample. The apparatus used is Appligene's "Crocodile II".

 We used a denaturation temperature of the matrix of 90 C, a hybridization temperature of 50 C and a temperature of elongation by the enzyme at 72 C.

7) The ligatures
All ligation reactions are performed at + 14 ° C overnight in a final volume of 10 l in the presence of 100 to 200 ng of vector, 0.5 to 2 μg of insert, 40 IU of enzyme T4 DNA ligase (Biolabs) and a ligation buffer (50 mM Tris-HCl pH 7.8, 10 mM MgCl 2, 10 mM, 1 mM).

<Desc / Clms Page number 18>

8) Transformation of bacteria:
The transformation of the bacteria by a plasmid is carried out according to the following protocol: The entire ligation volume (100 μl) is used to transform the competent TG1-competent bacteria by the method of Chung et al. (1988).

9) Separation and extraction of DNAs:
The separation and extraction of the DNA fragments are carried out according to Sambrook et al. (1989).

10) Fluorescent sequencing of plasmid DNAs
The sequencing technique used is derived from the method of Sanger et al., (1977) and adapted for fluorescence sequencing and developed by Applied Biosystems. The protocol used is that described by the designers of the system (Perkin Elmer).

11) Preparation of plasmids from the brain bank
This preparation was performed according to the recommendations of the supplier (Clontech #).

12) Transformation of the yeast by a plasmid
The yeasts are made competent by LiAC / PEG treatment according to the method described by Gietz et al. (1995).

 In the particular case of the transformation of the yeast by the brain cDNA library, 250 ml is used at 107 cells / ml of a culture, in a minimum medium YNB + His + Lys + Ade + Leu, yeast containing plasmid pLex-FE65PTB1. Yeasts made competent, according to the protocol cited above, are transformed by

<Desc / Clms Page number 19>

 30 g of cDNA from the brain bank. After the transformation steps, the yeasts are cultured in 250ml YNB + His + Lys + Ade + Leu at 28 ° C. for 16 hours and then harvested by centrifugation to be spread on a YNB + Lys + Ade medium and incubated for 3 days at 28 ° C. C. Determination of transformation efficiency and amplification rate was performed according to the Clontech protocol.

13) Extraction of yeast (genomic and plasmid) DNA
3 ml of a culture of yeast incubated 16h at 30 C are centrifuged and taken up in 200ul of a lysis buffer (1M Sorbitol, KH2PO4 / 0.1M K2HPO4 pH7.4, zymolyase 12.5 mg / ml) and incubated lh at 37 C. The lysate is then treated according to the protocol recommended by the Quiagen manufacturer of the DNA purification kit, Quiaprep Spin Miniprep kit, ref: 27106.

14) Activity test of ss-galactosidase
A nitrocellulose sheet is previously deposited on the petri dish containing the individualized yeast clones. This sheet is then dipped in liquid nitrogen for 30 seconds to burst the yeasts and thereby release the 13-galactosidase activity. After thawing, the nitrocellulose sheet is deposited, colonies upwards, in another Petri dish containing Whatman paper previously soaked with 1.5 ml of PBS solution (60mM Na2HPO4, 40mM NaH2PO4, 10mM KCl, 1mM MgSO4, pH7) containing 15 μl of X-Gal (5bromo-4-chloro-3-indoyl-ss-D-galactoside) at 40 mg / ml of N, N-dimethylformamide.

The box is then placed in an oven at 37 C. The test is positive when the colonies turn blue on the membrane after 6 hours.

 EXAMPLE 1 CONSTRUCTION OF A VECTOR FOR THE EXPRESSION OF A FUSION PROTEIN BETWEEN THE PTB DOMAIN OF FE65 AND THE LEXA PROTEIN

<Desc / Clms Page number 20>

Screening a library using the Double Hybrid system requires that the PTB domain of FE65 (FE65PTB1) be fused to the LexA protein. The expression of this fusion protein is carried out thanks to the vector pLex9, in which was introduced, in the same reading frame as the sequence corresponding to the LexA protein, the sequence coding for the PTB1 domain of FE65 (SEQ ID N 1 -2).

 The 448 bp DNA fragment corresponding to amino acids 395 to 543 of human FE65 protein (SEQ ID N: 2) was obtained by PCR from oligonucleotides SEQ ID N 3 and SEQ ID N 4 which also allowed us to introduce the Xmal and SalI sites at the ends of the sequence. The PCR fragment was introduced between the XmaI and SalI sites of the plex9 plasmid cloning multisite downstream of the sequence corresponding to LexA to give the vector pLex-FE65PTB1.

 The construct was verified by DNA sequencing. This check enabled us to show that this fragment did not show mutations generated during the PCR reaction and that it was fused in the same open reading phase as that of the fragment corresponding to LexA.

EXAMPLE 2: TECHNICAL SCREENING OF THE TWO HYBRIDS OF A BRAIN cDNA FUSION BANK
We used the Double-Hybrid method (Fields and Song, 1989). Screening of a fusion library makes it possible to identify clones producing proteins fused to the transactivator domain of GAL4 that can interact with the PTB domain of FE65. This interaction makes it possible to reconstitute a transactivator which will be capable of inducing the expression of the His3 and LacZ reporter genes in the L40 strain. To perform this screening we chose a fusion library made from human brain cDNA (Clontech).

 When screening it is necessary to preserve the probability that each plasmid independent of the fusion library is present in at least one yeast at the same time as the plasmid pLex-FE65PTB 1. To preserve this probability it is

<Desc / Clms Page number 21>

 important to have a good efficiency of transformation of the yeast. For this we chose a yeast transformation protocol giving an efficiency of 105 transformed cells per g of DNA. In addition, as cotransformation of yeast by two different plasmids reduces this efficiency, we preferred to use a yeast previously transformed with plasmid pLex-FE65PTB1. This strain L40-FE65PTB1 of His-, Lys-, Ade-Leu- phenotype was transformed with 30 g of plasmid DNA from the fusion library. This amount of DNA allowed us to obtain, after estimation, 2.8 106 transformed cells, which corresponds to a number slightly greater than the number of independent plasmids constituted by the library. From this result we can think that almost all the plasmids of the bank was used to transform the yeasts. The selection of transformed cells, capable of reconstituting a functional GAL4 transactivator, was made on a YNB + Lys + Ade medium.

 At the end of this selection, 97 clones with a His + phenotype were obtained.

On these transformants, an β-galactosidase activity test was carried out in order to determine the number of clones expressing the other reporter gene, LacZ. Of the 97 clones obtained, 27 had the His + double phenotype, ssGal +, thus showing that they express proteins that can interact with the PTB domain of FE65.

EXAMPLE 3: BRAIN BANK PLASMIDS FROM SELECTED YEAST CLONES
In order to identify the proteins that can interact with the PTB 1 domain of FE65, we extracted the plasmids from the fusion library contained in the selected yeasts during the Double-Hybrid Screening. In order to be able to obtain a large quantity of this isolation, it first requires a transformation of E. coli by DNA extract positive yeast strains. Since the plasmid of the library contained in this extract is a yeast / E. coli shuttle plasmid, it can easily replicate in the bacterium.

<Desc / Clms Page number 22>

 The plasmid DNAs of the bacterial colonies obtained after transformation with yeast DNA extracts were analyzed by restriction enzyme digestion and separation of the agarose gel DNA fragments.

We obtained 6 different restriction profiles on the 23 clones analyzed, 2 of which were strongly represented. These results showed that at least 6 different plasmids were isolated during this screening, we were particularly interested in the DNA fragment from the cDNA library contained in the two most represented plasmids (8 and 4 times ).

EXAMPLE 4: SEQUENCE OF INSERTS OF PLASMIDS IDENTIFIED
Sequencing was carried out on the 2 most represented plasmids from the oligonucleotide GAL4TA (SEQ ID No. 5) complementary to the GAL4TA region in the vicinity of the insertion site of the brain cDNA library, at 52 bps of the EcoRI site.

 The comparison of the sequence of the first plasmid selected with the sequences contained in the GENBank and EMBL (European Molecular Biology Lab) databases has shown that the sequence of the cDNA present in this first plasmid has more than 99% identity at Nucleotide level with the human gene encoding the hnRNPL protein having accession number: NP ~ 001524 / g4557645. The sequence of this gene that we cloned by the Two Hybrid system starts at nucleotide 346 corresponding to the 116th amino acid and ends at nucleotide 1392 corresponding to the 464th amino acid located at 58 amino acids of the end of the protein hnRNPL (SEQ ID N : 6 and 7). This result shows that the interaction domain of hnRNPL with the human FE65 protein is contained in the central region of hnRNPL. This region contains an NPXY type sequence which is known to be the consensus site for binding PTB domains (Borg et al., 1996). The sequence of hnRNPL (SEQ ID N 6-7) that we cloned differs from the published sequence (Pinol-Roma et al, 1989) by the substitution of a Guanine in

<Desc / Clms Page number 23>

 Thymidine at position 748 leading to the change of a glycine to cysteine at the 250th amino acid of the sequence SEQ ID N: 6, corresponding to nucleotide 1093 and amino acid 365 of the entire hnRNPL protein.

 The comparison of the sequence of the second selected plasmid with the sequences contained in the GENBank and EMBL (European Molecular Biology Lab) databases showed that the sequence of the cDNA contained in this plasmid shows no significant homology with the sequences contained in these databanks. This sequence (SEQ ID N 8-9) of 1275 nucleotides has a stop codon at position 1012 and encodes a peptide of 337 amino acids. The protein corresponding to this sequence was named FEBP1 for FE65 Binding PTB1 domain protein.

EXAMPLE 5: ANALYSIS OF THE SPECIFICITY OF INTERACTION BETWEEN THE PTB DOMAINS OF FE65 AND THE hnRNPL AND FEBP PROTEINS
In order to determine the specificity of the interaction between the PTB 1 and PTB 2 domains of the human FE65 protein and the hnRNPL and FEBP1 proteins, we performed an interaction test by the Two Hybrids method using the plasmid pLex-FE65PTB2 coding for the PTB2 domain of FE65 fused to the LexA protein, in place of the pLex-FE65PTB1 plasmid. The absence of interaction between the PTB2 domain and these two proteins would make it possible to mount a specificity of interaction with the PTB1 domain of FE65.

 To carry out this test we transformed the L40 strain by the isolated plasmids during the screening of the cerebral cDNA library and by the plasmid pLex-FE65PTB2.

Interaction specificity controls were also performed by transforming this strain with different plasmids as shown in Table 1. A test of ssGal activity on the cells transformed by the different plasmids was carried out in order to detect a protein-protein interaction. protein. The set of plasmid combinations, and therefore interactions, tested in the Double-Hybrid system are reported in the

<Desc / Clms Page number 24>

 Table N 1. The plasmid combinations and the corresponding vector type (pLex or pGAD) are indicated in the "Plasmid Combination" columns. The + and - signs in the "Interaction" column correspond to the ssGal test results and respectively indicate the detection or non-detection of protein-protein interaction.

 According to the result of the test (see Table N 1), only the yeasts transformed with the two plasmids isolated from the brain cDNA library and with the plasmid pLexFE65PTB had a pGal + activity, showing that among the two PTB domains of FE65, only the PTB domain interacts with the central part of hnRNPL or the FEBP1 protein fragment. The PTB1 domain of FE65 appears to interact specifically with hnRNPL and FEBP1 since we were unable to show interactions with the protein. HaRasVa112 or the C-terminal domain of APP by the technique of Two Hybrids.

<Desc / Clms Page number 25>

BIBLIOGRAPHIC REFERENCES
Bartel, PL, C.-T. Dog, R. Stenglanz and S. Fields. 1993 DA Hartley Ed, Oxford University Press: 153.

 Borg, J.-P., J. Ooi, E. Levy and B. Margolis. 1996. The Phosphotyrosine Interaction Domains of XI 1 and FE65 Bind to Distinct Sites on the YENPTY Motif ofAmyloid Precursor Protein. Mol. Cell. Biol. 16: 6229-6241.

 Borg, J.-P., Y. Yang, M. From Taddeo-Borg, B. Margolis and R. S. Turner.

1998. The XI Protein Slows Cellular Amyloid Precursor Protein Processing and Assum Reduces Ass42 and Secretion. J. Biol. Chem. 273: 14761-14766.

 Bressler, S.L., D. Gray, B.L.Sopher, Q. Hu, M.G. Hearn, D.G. Pham, M. B. Dinulos, K.I. Fukuchi, S. Sisodia, A. Miller, C. M. Disteche and G. M.

Martin. 1996. cDNA cloning and chromosome mapping of the human Fe65 gene: interaction of the conserved cytoplasmic domains of the human P-amyloid precursor protein and its homologues with the mouse Fe65 protein. Hmm. Mol. Broom. 5: 1589-1598.

 Chung, C. T., E. L. Suzann, and R. H. Miller. 1989. One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution. Proc. Natl. Acad. Sci. USA, 86: 2172-2175.

 Duilio, A., R. Faraonio, G. Minopoli, N. Zambrano and T. Russo. 1998.

Fe65L2: a new member of the Fe65 protein family interacting with the intracellular domain of the Alzheimer's ss-amyloid precursor protein. Biochem. J. 330: 513-519.

 Ermekova, K. S., N. Zambrano, H. Linn, G. Minopoli, F. Gertler, T. Russo and M. Sudol. 1997. The WW Domain of Neural Protein FE65 Interacts with Proline-rich Reasons in Mena, the Homologous Mammalian of Drosophila Enabled. J. Biol. Chem.

272: 32869-32877.

Fields, S. and 0. Song. 1989. A novel genetic system to detect protein-protein interactions. Nature. 340: 245-246
Fiore, F., N. Zambrano, G. Minopoli, V. Donini, A. Duilio, and T. Russo.

1995. The Regions of the Homologous Feet Protein to Phosphotyrosine Interaction / Phosphotyrosine Binding Domain of Shc Bind the Intracellular Domain of the Alzheimer's Amyloid Precursor Protein. J. Biol. Chem. 270: 30853-30856.

 Gietz, R.D., R.H. Schiestl, A.R. Willems, R.A. Woods. 1995 Studies on the transformation of intact cells by LiAC / SS-DNA / PEG procedure. Yeast, 11: 355-360.

<Desc / Clms Page number 26>

 Golde, T. E., S. Estus, L. H. Younkin, D. J. Selkoe, and S. G. Younkin. 1992.

Of the amyloid precursor protein to potential amyloidogenic derivatives.

Science 255: 728-730.

 Guenette, S.Y., J. Chen, P.D. Jondro and R.E. Tanzi. 1996. Association of a novel human FE65-like protein with the cytoplasmic domain of the b-amyloid precursor protein. Proc. Natl. Acad. Sci. U.S.A. 93: 10832-10837.

 Guenette, S.Y., J. Chen, A. Ferland, C. Haass, A. Capell and R. E. Tanzi. 1999.

HFE65L Influences Amyloid Precursor Protein Maturation and Secretion. J.

Neurochem. 73: 985-993.

Koo, EH, and SL Squazzo. 1994. Evidence that production and release of amyloid beta-protein involves the endocytic pathway. J. Biol. Chem. 269: 17386-
17389.

 Kahn, A. 1991 Gene therapy: hopes and limits. Medicine and Sciences. 7: 705-714.

 McLoughlin, D. M. and C. C. J. Miller. 1996. The intracellular cytoplasmic domain of the Alzheimer's disease amyloid precursor proteins in the yeast two-hybrid system. FEBS Lett. 397: 197-200.Mercken, L., M. Bock, J. Ménager, X. Franco, M.-F. Paul, L. Pradier and A.

Fournier. 1998. FE65 and COFE65: Two proteins interacting with the cytoplasmic domain of APP. Neurobiol. Aging 19: S37.

 Perez, R. G., S. Soriano, J. D. Hayes, B. Ostaszewski, W. Xia, D.J. Selkoe, X.

Chen, G. B. Stokin, and E. H. Koo. 1999. Mutagenesis identified new signal for betaamyloid precursor protein endocytosis, turnover, and the generation of secreted fragments, including Abeta42. J. Biol. Chem. 274: 18851-18856.Pinol-Roma, S., M.S. Swanson, J.G. Gall, and G. Dreyfuss. 1989. A novel heterogeneous nuclear RNP protein with a unique distribution on nascent transcripts.

J. Cell Biol. 109: 2575-2587.

 Sabo, S. L., L. M. Lanier, A. F. Ikin, O. Khorkova, S. Sahasrabudhe, P.

Greengard and J. D. Buxbaum. 1999. Regulation of the P-Amyloid Secretion by FE65, an Amyloid Protein Precursor-binding Protein. J. Biol. Chem. 274: 7952-7957.

 Sambrook, J., F. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning, A laboratory manual. Second Edition, Volume I, II, III. Cold Spring Harbor Laboratory Press.

<Desc / Clms Page number 27>

 Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with Chain Terminating Inhibitors. Proc. Natl. Acad. Sci. USA, 74: 5463-5467.

 Sastre, M., R.S. Tumer, and E. Levy. 1998. X11 Interaction with Amyloid Precursor Protein Modulates Its Cellular Stabilization and Reduces Amyloid ssProtein Secretion. J. Biol. Chem. 273: 22351-22357.

 Tanahashi, H. and T. Tabira. 1999a. XI IL2, a new member of the XI 1 protein family, interacts with Alzheimer's beta-amyloid precursor protein. Biochem. Biophys.

Res. Common. 255: 663-667.

 Tanahashi, H., and T. Tabira. 1999b. Genome Structure and Chromosomal Mapping of the Gene for Fe65L2 Interacting with Alzheimer's ss-Amyloid Precursor Protein. Biochem. Biophys. Res. Common. 258: 385-389.

 Tanahashi, H., and T. Tabira. 1999c. Molecular cloning of human Fe65L2 and its interaction with the Alzheimer's beta-amyloid precursor protein. Neurosc. Lett.

261: 143-146.

 Trommsdorff, M., J.-P. Borg, B. Margolis and J. Herz. Interaction of Cytosolic Adapter Proteins with Neuronal Apolipoprotein E Receptors and the Amyloid Precursor Protein. J. Biol. Chem. 273: 33556-33560.

Vojtek, AB, SM Hollenberg, and JACooper. 1993. Mammalian Ras interacts directly with the serine / threonine kinase Raf. Cell 74: 205-214
Zambrano, N., JD Buxbaum, G. Minopoli, F. Fiore, P. De Candia, S. De Renzis, R. Faraonio, S. Sabo, J. Cheetham, M. Sudol and T. Russo. 1997. Interaction of the Phosphotyrosine Interaction / Phosphotyrosine Binding-related Domains of Fe65 with Wild-type and Mutant Alzheimer's P-Amyloid Precursor Proteins. J. Biol.

Chem. 272: 6399-6405.

 Yankner, B.A. 1996. Mechanisms of neuronal degeneration in Alzheimer's disease. Neuron 16: 921-932.

<Desc / Clms Page number 28>

<Tb>
<Tb>

TABLE <SEP> N 1
<tb> COMBINATION <SEP> FROM <SEP> PLASMIDS <SEP> INTERACTION
<tb> pLex <SEP> pGAD
<tb> FE65PTB1 <SEP> hnRNPL <SEP> +
<tb> FE65PTB1 <SEP> FEBP1 <SEP> +
<tb> FE65PTB1 <SEP> APPFE65PTB <SEP> RafFE65PTB2 <SEP> hnRNPL <SEP> FE65PTB2 <SEP> FEBP1 <SEP> FE65PTB2 <SEP> APP <SEP> +
<tb> FE65PTB2 <SEP> RafHaRasVall2 <SEP> hnRNPL <SEP> HaRasVa112 <SEP> FEBP1 <SEP> HaRasVal <SEP> 12 <SEP> APPHaRasVal12 <SEP> Raf <SEP> +
<Tb>

Claims (18)

SEQUENCE LIST <110> Aventis Pharma SA <120> Partners of PTB1 domain of FE65, preparation and uses <130> PRJ99058 - RPR <140> <141> <160> 9 <170> PatentIn Ver. 2.1 <210> 1 <211> 447 <212> DNA <213> Homo sapiens <220> <221> CDS <222> (1) .. (447) <400> 1 ccc cca cgg aat acc aac cca ggg atc aag tgt ttc gcc gtg tcc gc 48 Pro Pro Arg Asn Thr Asn Pro Gly Lys Island Cys Phe Ala Val Arg Ser 1 5 10 15 cta ggc tgg gta gag atg acc gag gag gag ctg gcc this gga cgc agc 96 Leu Gly Trp Val Glu Met Thr Glu Glu Glu Leu Ala Pro Gly Arg Ser 20 25 30 agt gtg gca gtc aac tgc atc cgt cag ctc tct tac cac aaa aac 144 Ser Val Ala Val Asn Asn Cys Arg Arg Gln Leu Ser Tyr His Lys Asn 35 40 45 aac ctg cat gac ccc atg tct ggg ggc tgg ggg gaa gga aag gat ctg 192 Asn Leu His Asp Pro Met Ser Gly Gly Trp Gly Glu Gly Lys Asp Leu 50 55 60 cta ctg cag ctg gag gag gag aca cta aag cta gtg gag cca cag agc 240 Leu Leu Gln Leu Glu Glu Thr Asp Leu Leu Leu Val Glu Pro Gln Ser 65 70 75 80 cag gca ctg ctg cac gcc caa ccc atc atc agc atc cgc gtg tgg ggc 288 Gln Ala Leu Leu His Ala Gln Pro Island Ile Ser Ile Arg Val Trp Gly <Desc / Clms Page number 30> 85 90 95 gtc ggg ggg gac agt gga agg gac ttt gcc tac gta gct cgt gat aag 336 Val Gly Arg Asp Ser Gly Arg Asp Phe Ala Tyr Val Ala Arg Asp Lys 100 105 110 ctg ac cag atg ctc aag tgc cac gtg ttt cgc tgt gag gca this gcc 384 Leu Thr Gln Met Leu Lys Cys His Val Phe Arg Cys Glu Ala Pro Ala 115 120 125 aag atc gcc acc agc ctg cat gag atc tgc tct aag atc atg gcc 432 Lys Asn Ile Ala Thr Ser Leu His Glu Ile Cys Ser Lys Ile Met Ala 130 135 140 gaa cgg cgt aat gcc 447 Glu Arg Arg Asn Ala 145 <210> 2 <211> 149 <212> PRT <213> Homo sapiens <400> 2 Pro Pro Arg Asn Thr Asn Pro Gly Ile Lys Cys Phe Ala Val Arg Ser 1 5 10 15 Leu Gly Trp Val Glu Met Thr Glu Glu Glu Leu Ala Pro Gly Arg Ser 20 25 30 Ser Val Ala Val Asn Asn Cys Island Arg Gln Leu Ser Tyr His Lys Asn 35 40 45 Asn Leu His Asp Pro Met Ser Gly Gly Trp Gly Glu Gly Lys Asp Leu 50 55 60 Leu Leu Gln Leu Glu Glu Asp Leu Leu Leu Val Glu Pro Gln Ser 65 70 75 80 Gln Ala Leu Leu His Ala Gln Pro Ile Ile Ser Isle Arg Val Trp Gly 85 90 95 Val Gly Arg Asp Asp Gly Arg Asp Phe Ala Tyr Val Ala Arg Asp Lys 100 105 110 Leu Thr Gln Met Leu Lys Cys His Val Phe Arg Cys Glu Ala Pro Ala 115 120 125 <Desc / Clms Page number 31>  Lys Asn Ile AlaThr Ser Leu His Glu Island Cys Ser Lys Ile Met Ala 130 135 140 Glu Arg Arg Asn Ala 145 <210> 3 <211> 28 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: Oligonucleotide <400> 3 cttcccgggt cccccacgga ataccaac 28 <210> <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Description of the Artificial Sequence: Oligonucleotide <400> 4 ggggtcgacg gcattacgcc gttcggc 27 <210> 5 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Description of the artificial sequence: Oligonucleotide <400> 5 ccactacaat ggatgatg 18