WO2002079471A2

WO2002079471A2 - Cholinesterase-anchoring protein, corresponding nucleic acids and their use for preparing medicines

Info

Publication number: WO2002079471A2
Application number: PCT/FR2002/001064
Authority: WO
Inventors: Eric Krejci; Jean Massoulie; Anselme Perrier
Original assignee: Centre National De La Recherche Scientifique
Priority date: 2001-04-02
Filing date: 2002-03-27
Publication date: 2002-10-10
Also published as: AU2002308032A1; WO2002079471A3; FR2822831A1

Abstract

The invention concerns a protein characterised in that it comprises or consists of: the sequence SEQ ID NO: 2 representing the original anchoring human protein at the surface of cell membranes of cholinesterases, or any sequence derived from the sequence SEQ ID NO: 2 or from a fragment defined below, in particular by substitution, suppression or addition of one or several amino acids, provided that it enables membrane anchorage of cholinesterases, or any sequence homologous of the sequence SEQ ID NO: 2 or a fragment defined below, having preferably a homology of at least about 70 %, and in particular 85 %, with the sequence SEQ ID NO: 2, provided that it enables membrane anchorage of cholinesterases, or any fragment of one of the sequences defined above, provided that it enables membrane anchorage of cholinesterases.

Description

NOVEL CHOLINESTERASE ANCHORING PROTEIN, CORRESPONDING NUCLEIC ACIDS AND THEIR APPLICATION TO THE PREPARATION OF MEDICINES

The invention relates to a novel cholinesterase anchor protein and the corresponding nucleic acids. The invention also relates to their application to the preparation of medicaments.

Acetylcholinesterase is an enzyme which effectively allows the hydrolysis of the neurotransmitter acetylcholine and which thus controls the level and the duration of stimulation of various acetylcholine receptors. This function is confirmed in particular by the observation of the numerous consequences of the modulation of AChE activity. Thus, inhibition of AChE causes drastic effects, ranging from local necrosis of neuromuscular junctions to respiratory paralysis and death. On the other hand, many treatments for pathologies such as myasthenia gravis or Alzheimer's disease target the activity of AChE by prescribing inhibitors of AChE.

Butyrylcholinesterase (BChE) is another cholinesterase that is strongly expressed in the muscles. The complete absence of BChE is not harmful to humans. However, it is known that BChE participates in the hydrolysis of acetylcholine in the muscles and in the brain.

In the mammalian brain, AChE exists mainly in three molecular forms: monomers, dimers and tetramers. This enzyme is integrated into cellular structures, for example at the level of cholinergic synapses, thanks to its association with anchoring proteins. We already know the existence of an anchoring protein, namely the collagen ColQ, whose association with AChE produces asymmetric forms localized in the basal laminae of neuromuscular junctions, where these asymmetric forms play a preponderant physiological role. .

The monomers and dimers of AChE are essentially intracellular and represent the precursors of tetramers. These tetramers are anchored to the surface of neurons by their association with a specific hydrophobic protein and represent the mature and physiologically active form of brain AChE. Indeed, it is well established that the main molecular form of AChE in the brains of adult mammals is a tetramer linked to cell membranes; the proportion of this form increases during development compared to monomers and dimers, and reaches more than 80% of the total activity in adults (Muller et al., 1985; Fernandez et al., 1996). Furthermore, this molecular form also exists in the muscles, where it seems to play a specific role, which is still poorly understood: indeed, muscle exercise specifically controls the level of this form of enzyme in fast muscles without significantly affecting the others. molecular forms, including asymmetric forms (Gisiger et al., 1994). Furthermore, although the existence of a membrane anchor has been known for several years and fragments of peptide sequences have already been determined, previous attempts at cloning to identify the nucleotide and protein sequence have failed essentially for the three main reasons following: a) this protein is not abundantly expressed, b) it contains a proline-rich region which is very difficult to cross for reverse transcriptase, c) several peptide sequences have been determined, corresponding to two distinct proteins. Inhibition of AChE is the basis of the therapies used for the treatment of myasthenia gravis and Alzheimer's disease, with the aim of increasing the level of acetylcholine, with the aim of restoring the effectiveness of cholinergic transmission at the neuromuscular level in the first case, at the level of the central nervous system in the second case. These therapies use inhibitors which act without discrimination on all the molecular forms of the enzyme, with their only limitation their accessibility, in particular the passage of the blood-brain barrier with regard to the central nervous system. We also observe that the anti-cholinesterase therapy of myasthenia gravis can lose its effectiveness over time, and that in the case of Alzheimer's disease, a very significant proportion of patients (around 20%) do not get any. benefit (Giacobini, 2000).

Currently, treatments for Alzheimer's disease are only symptomatic treatments and can cause unwanted side effects. In Regarding myasthenia gravis, current treatments are also not very effective.

The object of the invention is to provide a new protein, isolated in mice and in humans, and the corresponding DNA and RNA sequences. The object of the invention is also the use of this protein in the implementation of a method for screening for compounds which inhibit the membrane anchoring of AChE.

Another object of the invention is the development of medicaments, in particular intended for the treatment of Alzheimer's disease, by inhibiting the membrane anchoring of AChE.

The invention relates to a protein characterized in that it comprises or consists of:

the sequence SEQ ID NO: 2 representing the protein of human origin anchoring to the surface of the cell membranes of cholinesterases, in particular of acetylcholinesterase AChE or of butyrylcholinesterase BChE,

- or any sequence derived from the sequence SEQ ID NO: 2 or from a fragment defined below, in particular by substitution, deletion or addition of one or more amino acids, provided that it allows the membrane anchoring of cholinesterases , in particular AChE or BChE, - or any sequence homologous to the sequence SEQ ID NO: 2 or of a fragment defined below, preferably having a homology of at least about 70%, and in particular 85 %, with the sequence SEQ ID NO: 2, provided that it allows the membrane anchoring of cholinesterases, in particular AChE or BChE, - or any fragment of one of the sequences defined above, subject that it allows the anchoring of chohnesterases, in particular AChE or BChE, in particular any fragment consisting of at least approximately 6 amino acids, in particular of at least approximately 40 contiguous amino acids in the sequence SEQ ID NO: 2. The sequence SEQ ID NO: 2 is a new prote ine isolated in humans, named PRiMA-h. This protein is a membrane anchoring protein for AChE and it also allows the membrane anchoring for BChE.

This protein has several functional areas:

- a signal peptide allowing the protein to be engaged in the secretory pathway,

an extracellular domain containing the proline-rich domain (PRAD), an N-glycosylation site and two potential O-glycosylation sites,

- a transmembrane hydrophobic segment,

- a cytoplasmic C-terminal region containing two potential phosphorylation sites.

The proline-rich domain is in particular necessary for forming the AChE tetramers from four AChE molecules.

The transmembrane domain makes it possible in particular to attach AChE to the surface of neurons. The C-terminal region probably plays a role in the precise positioning of the enzyme in the nervous system.

In order to verify that the protein mentioned above allows the membrane anchoring of a cholinesterase, in particular the test is carried out as described in the Materials and Methods section, paragraph F. This test makes it possible to verify that the coexpression of the PRiMA protein and AChE or BChE results in the production of amphiphilic tetramers detected by analysis of the sedimentation of molecular forms of cholinesterases into sucrose gradients.

This test also makes it possible to verify that the presence of AChE can be detected, for example by labeling with fasciculin, or the presence of BChE, for example by labeling with anti-BChE antibodies or by the Kamovsky method.

(Kamovsky et al., 1964), on the surface of cells coexpressing the PRiMA protein and AChE or BChE.

According to an advantageous embodiment, the protein of the invention is a protein homologous to the sequence SEQ ID NO: 2 as defined above, characterized in that it corresponds to the sequence SEQ ID NO: 4 representing the protein of murine origin anchoring to the surface of cell membranes of cholinesterases, in particular AChE or BChE. The sequence SEQ ID NO: 4 is a new protein isolated in mice, named PRiMA-s.

The invention relates to protein fragments characterized in that they are chosen from the following: - the fragments of the sequence SEQ ID NO: 2 represented by the sequences

SEQ LD NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ LD NO: 16, SEQ ID NO: 18 and SEQ D NO: 20,

- the fragments of the sequence SEQ ID NO: 4 represented by the sequences SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 , SEQ ID NO: 34 and SEQ ID NO: 36,

the fragment of the anchoring protein on the surface of the cell membranes of rat AChE homologous to the sequence SEQ ID NO: 2, said fragment corresponding to the sequence SEQ ID NO: 37.

The sequence SEQ ID NO: 6 is a fragment of the new human PRiMA protein, delimited from the amino acid at position 36 to the amino acid at position 88, and corresponds to the proline-rich domain (PRAD) of the human protein.

The sequence SEQ ID NO: 8 is a fragment of the new human PRiMA protein, delimited from the amino acid at position 89 to the amino acid at position 113, and corresponds to the hydrophobic transmembrane segment of the human protein. The sequence SEQ ID NO: 10 is a fragment of the new human PRiMA protein, delimited from the amino acid at position 114 to the amino acid at position 153, and corresponds to the cytoplasmic domain of the human protein.

The sequence SEQ ID NO: 12 is a fragment of the new human PRiMA protein, delimited from the amino acid at position 36 to the amino acid at position 113, and corresponds to the set formed by the PRAD domain and the transmembrane segment of human protein.

The sequence SEQ ID NO: 14 is a fragment of the new human PRiMA protein, delimited from the amino acid at position 89 to the amino acid at position 153, and corresponds to the set formed by the transmembrane segment and the cytoplasmic domain of human protein.

The sequence SEQ ID NO: 16 is a fragment of the new human PRiMA protein, delimited from the amino acid at position 36 to the amino acid at position 153, and corresponds to the set formed by the PRAD domain, the transmembrane segment and the cytoplasmic domain of the human protein.

The sequence SEQ ID NO: 18 is a fragment of the new human PRiMA protein, delimited from the amino acid in position 1 to the amino acid in position 88, and corresponds to the set formed by the signal peptide and the PRAD domain of human protein. ^l

The sequence SEQ ID NO: 20 is a fragment of the new human PRiMA protein, delimited from the amino acid in position 1 to the amino acid in position 113, and corresponds to the set formed by the signal peptide, the PRAD domain and the transmembrane segment of human protein.

The sequence SEQ ID NO: 22 is a fragment of the new murine PRiMA protein, delimited from the amino acid at position 36 to the amino acid at position 88, and corresponds to the PRAD domain of the murine protein.

The sequence SEQ ID NO: 24 is a fragment of the new murine PRiMA protein, delimited from the amino acid at position 89 to the amino acid at position 113, and corresponds to the hydrophobic transmembrane segment of the murine protein.

The sequence SEQ ID NO: 26 is a fragment of the new murine PRiMA protein, delimited from the amino acid at position 114 to the amino acid at position 153, and corresponds to the cytoplasmic domain of the murine protein. The sequence SEQ ID NO: 28 is a fragment of the new murine PRiMA protein, dehmity from the amino acid at position 36 to the amino acid at position 113, and corresponds to the whole formed by the proline-rich domain PRAD and the transmembrane segment of the murine protein. ,

The sequence SEQ ID NO: 30 is a fragment of the new murine PRiMA protein, delimited from the amino acid at position 89 to the amino acid at position 153, and corresponds to the set formed by the transmembrane segment and the cytoplasmic domain murine protein.

The sequence SEQ ID NO: 32 is a fragment of the new murine PRiMA protein, delimited from the amino acid at position 36 to the amino acid at position 153, and corresponds to the set formed by the PRAD domain, the transmembrane segment and the cytoplasmic domain of the murine protein. The sequence SEQ ID NO: 34 is a fragment of the new murine PRiMA protein, delimited from the amino acid in position 1 to the amino acid in position 88, and corresponds to the set formed by the signal peptide and the PRAD domain murine protein. The sequence SEQ ID NO: 36 is a fragment of the new murine PRiMA protein, dehmity from the amino acid in position 1 to the amino acid in position 113, and corresponds to the whole formed by the signal peptide, the PRAD domain and the transmembrane segment of the murine protein.

The sequence SEQ ID NO: 37 is a fragment of the new rat PRiMA protein, delimited from the amino acid in position 1 to the amino acid in position 35.

The present invention also relates to a protein as defined above, characterized in that it comprises or consists of the sequence SEQ ID NO: 39, representing a protein derived from the sequence SEQ ID NO: 2, and in that '' it allows the membrane anchoring of cholinesterases, in particular acetylcholinesterase AChE or butyrylcholinesterase BChE.

The sequence SEQ ID NO: 39 is a new variant, isolated in humans, of the human PRiMA protein, represented by the sequence SEQ ID NO: 2.

The present invention also relates to a protein as defined above, characterized in that it comprises or consists of the sequence SEQ ID NO: 42, representing a protein derived from the sequence SEQ ID NO: 4, and in that '' it allows the membrane anchoring of cholinesterases, in particular acetylcholinesterase AChE or butyrylcholinesterase BChE.

The sequence SEQ ID NO: 42 is a new variant, isolated in mice, of the mouse PRiMA protein, represented by the sequence SEQ ID NO: 4. The invention relates to a nucleotide sequence coding for a protein as defined above above.

In particular, the invention relates to a nucleotide sequence as defined above, characterized in that it comprises or consists of:

- the nucleotide sequence SEQ ID NO: 1 coding for SEQ ID NO: 2, - or any nucleotide sequence derived, by degeneration of the genetic code, from the sequence SEQ ID NO: 1, and coding for a protein represented by SEQ ID NO: 2 - or any nucleotide sequence derived, in particular by substitution, deletion or addition of one or more nucleotides, of the sequence SEQ ID NO: 1 coding for a protein derived from SEQ ID NO: 2, as defined above,

- or any nucleotide sequence homologous to SEQ ID NO: 1, preferably having a homology of at least about 70%, with the sequence SEQ ID NO: 1 coding for a protein homologous to SEQ ID NO: 2, as defined above -above,

- or any fragment of the nucleotide sequence SEQ ID NO: 1 or of the nucleotide sequences defined above, said fragment preferably consisting of at least about 20 contiguous nucleotides in said sequence, - or any nucleotide sequence complementary to the sequences or fragments above,

- or any nucleotide sequence capable of hybridizing under stringent conditions with the complementary sequence of one of the sequences or of one of the abovementioned fragments. The sequence SEQ ID NO: 1 is a new nucleic acid sequence, identified in humans, coding for the new human PRiMA protein, represented by the sequence SEQ ID NO: 2.

The expression "hybridize under stringent conditions" corresponds in particular to a hybridization buffer such as "Expresshyb Hybridation solution" (Clontech), at a hybridization temperature greater than or equal to 42 ° C., as well as to a medium of washing such as 0.1 X SSC buffer (15 mM NaCl; 1.5 mM sodium citrate pH = 7) and at a washing temperature greater than or equal to 42 ° C.

An advantageous nucleic acid fragment is a nucleic acid fragment as defined above, coding for one of the protein fragments having the sequence SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 , SEQ ID NO: 12, SEQ ID NO: 14, SEQ

ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24,

SEQ ID NO: 26, SEQ LD NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID

NO: 34, SEQ ID NO: 36 and SEQ ID NO: 37.

These protein fragments have been defined previously and allow to take into account the degeneracy of the genetic code. The protein fragments SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ LD NO: 18 and SEQ ID NO: 20 are fragments of the new human protein.

The protein fragments SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34 and SEQ ID

NO: 36 are fragments of the new murine protein.

The protein fragment SEQ ID NO: 37 is a fragment of the new rat protein.

The invention also relates to nucleic acid fragments chosen from the following:

- the sequences SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, and SEQ ID NO: 19, coding respectively for the sequences SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, and SEQ ID NO: 20, ”

- the sequences SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, and SEQ ID NO: 35, coding respectively for the sequences SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, and SEQ ID NO: 36.

The sequence SEQ ID NO: 5 delimited from the nucleotide in position (106) to the nucleotide in position (264), is a nucleotide sequence, identified in humans, and coding for the protein fragment, represented by the sequence SEQ ID NO: 6.

The sequence SEQ ID NO: 7 delimited from the nucleotide in position (265) to the nucleotide in position (339), is a nucleotide sequence, identified in humans, and coding for the protein fragment, represented by the sequence SEQ ID NO: 8.

The sequence SEQ ID NO: 9 delimited from the nucleotide in position (340) to the nucleotide in position (459), is a nucleotide sequence, identified in humans, and coding for the protein fragment, represented by the sequence SEQ ID NO: 10. The sequence SEQ ID NO: 11 dehmited from the nucleotide in position (106) to the nucleotide in position (339), is a nucleotide sequence, identified in humans, and coding for the protein fragment, represented by the sequence SEQ ID NO: 12. The sequence SEQ ID NO: 13 delimited from the nucleotide in position (265) to the nucleotide in position (459), is a nucleotide sequence, identified in humans, and coding for the protein fragment, represented by the sequence SEQ ID NO: 14.

The sequence SEQ ID NO: 15 delimited from the nucleotide in position (106) to the nucleotide in position (459), is a nucleotide sequence, identified in humans, and coding for the protein fragment, represented by the sequence SEQ ID NO: 16.

The sequence SEQ ID NO: 17 delimited from the nucleotide in position (1) to the nucleotide in position (264), is a nucleotide sequence, identified in humans, and coding for the protein fragment, represented by the sequence SEQ ID NO: 18. The sequence SEQ ID NO: 19 delimited from the nucleotide in position (1) to the nucleotide in position (339), is a nucleotide sequence, identified in humans, and coding for the protein fragment, represented by the sequence SEQ ID NO: 20.

The sequence SEQ ID NO: 21 delimited from the nucleotide in position (106) to the nucleotide in position (264), is a nucleotide sequence, identified in mice, and coding for the protein fragment, represented by the sequence SEQ ID NO: 22 .

The sequence SEQ ID NO: 23 delimited from the nucleotide in position (265) to the nucleotide in position (339), is a nucleotide sequence, identified in mice, and coding for the protein fragment, represented by the sequence SEQ ID NO: 24 .

The sequence SEQ ID NO: 25 delimited from the nucleotide in position (340) to the nucleotide in position (459), is a nucleotide sequence, identified in mice, and coding for the protein fragment, represented by the sequence SEQ ID NO: 26 .

The sequence SEQ ID NO: 27 delimited from the nucleotide in position (106) to the nucleotide in position (339), is a nucleotide sequence, identified in mice, and coding for the protein fragment, represented by the sequence SEQ ID NO: 28 The sequence SEQ ID NO: 29 delimited from the nucleotide in position (265) to the nucleotide in position (459), is a nucleotide sequence, identified in mice, and coding for the protein fragment, represented by the sequence SEQ ID NO: 30.

The sequence SEQ H) NO: 31 delimited from the nucleotide in position (106) to the nucleotide in position (459), is a nucleotide sequence, identified in mice, and coding for the protein fragment, represented by the sequence SEQ ID NO: 32. The sequence SEQ ID NO: 33 delimited from the nucleotide in position (1) to the nucleotide in position (264), is a nucleotide sequence, identified in mice, and coding for the protein fragment, represented by the sequence SEQ ID NO: 34 .

The sequence SEQ ID NO: 35 delimited from the nucleotide in position (1) to the nucleotide in position (339), is a nucleotide sequence, identified in mice, and coding for the protein fragment, represented by the sequence SEQ ID NO: 36 .

The present invention also relates to a nucleotide sequence as defined above, characterized in that it comprises or consists of the nucleotide sequence SEQ ID NO: 38, coding for SEQ LD NO: 39. The nucleotide sequence SEQ ID NO: 38 is a new nucleic acid sequence, identified in humans, coding for the new variant, represented by the sequence SEQ ID NO: 39, of the human PRiMA protein, represented by the sequence SEQ ID NO: 2. This new sequence comprises non-coding parts and a coding part, delimited from the nucleotide in position (103) to the nucleotide in position (472).

The present invention also relates to a nucleotide sequence as defined above, characterized in that it comprises or consists of the nucleotide sequence SEQ ID NO: 40, coding for SEQ ID NO: 39.

The nucleotide sequence SEQ ID NO: 40 is a new nucleic acid sequence, identified in humans, coding for the new variant, represented by the sequence SEQ ID NO: 39, of the human PRiMA protein, represented by the sequence

SEQ ID NO: 2. This new nucleotide sequence corresponds to the coding part of the sequence SEQ ID NO: 38. ₍

The present invention relates to a nucleotide sequence as defined above, characterized in that it comprises or consists of the nucleotide sequence SEQ ID NO: 41, coding for SEQ ID NO: 42.

The nucleotide sequence SEQ ID NO: 41 is a new nucleic acid sequence, identified in mice, coding for the new variant, represented by the sequence SEQ LD NO: 42, of the mouse PRiMA protein, represented by the sequence SEQ LD NO: 4. This new sequence comprises non-coding parts and a coding part, delimited from the nucleotide in position (104) to the nucleotide in position (475). The present invention also relates to a nucleotide sequence as defined above, characterized in that it comprises or consists of the nucleotide sequence SEQ LD NO: 43, coding for SEQ LD NO: 42.

The nucleotide sequence SEQ LD NO: 43 is a new nucleic acid sequence, identified in mice, coding for the new variant, represented by the sequence SEQ LD NO: 42, of the mouse PRiMA protein, represented by the sequence

SEQ LD NO: 4. This new nucleotide sequence corresponds to the coding part of the sequence SEQ LD NO: 41.

The table below summarizes all the proteins, protein fragments and the corresponding nucleotide sequences, according to the invention, and to which are assigned sequence numbers.

37 rat PRiMA fragment 1-35 The invention also relates to a recombinant vector, in particular plasmid, cosmid, phage or virus DNA, containing a nucleotide sequence as defined above.

An advantageous vector of the invention is a recombinant vector as defined above, containing the elements necessary for the expression in a host cell of the polypeptides encoded by the nucleic acids as defined above, inserted into said vector.

According to an advantageous embodiment of the invention, the recombinant vector defined above in particular contains a promoter recognized by the RNA polymerase of the host cell, in particular an inducible promoter and optionally a transcription, termination sequence, and optionally a signal and / or anchor sequence.

According to another advantageous embodiment of the invention, the recombinant vector, as defined above, contains the elements which allow the expression of a nucleotide sequence, as defined above, as a mature protein or fusion protein.

The invention also relates to a host cell, chosen in particular from bacteria, viruses and eukaryotic cells, in particular yeasts, fungi, plant, insect or vertebrate cells, said host cell being transformed, in particular to using a recombinant vector as defined above. According to an advantageous embodiment of the invention, the host cell as defined above contains the regulatory elements allowing the expression of the nucleotide sequence as defined above.

The invention also relates to the product of the expression of a nucleic acid expressed by a transformed host cell, as defined above. The invention also relates to antisense oligonucleotides or antisense messenger RNA derived from the nucleotide sequences as defined above.

The invention relates to an antibody characterized in that it is specifically directed against a protein as defined above.

We are not limited to polyclonal antibodies; the invention also relates to any monoclonal antibody produced by any hybridoma capable of being formed according to conventional methods from, a. part, of spleen cells of animals, in particular of mouse or rat, the cells of animai being immunized against the protein of the invention, and on the other hand, cells of a myeloma cell line, said hybridoma being capable of being chosen according to the capacity of the cell line to produce monoclonal antibodies recognizing the protein used beforehand for immunization animals. The invention relates to a pharmaceutical composition characterized in that it comprises an antisense oligonucleotide as defined above, in combination with an acceptable pharmaceutical vehicle.

The invention also relates to a pharmaceutical composition characterized in that it comprises an antibody as defined above, in association with an acceptable pharmaceutical vehicle.

The invention also relates to the use of antisense oligonucleotides as defined above, or of antibodies as defined above, for the preparation of medicaments intended for the treatment of pathologies linked to a decrease in the level of AChE in the body, in particular of diseases linked to cholinergic transmission at the level of the cells of the central nervous system, in particular in the case of Alzheimer's disease, or to the treatment of diseases linked to cholinergic transmission at the neuromuscular level, in particular myasthenia gravis and more particularly myasthenia gravis.

The invention also relates to the use of antisense oligonucleotides as defined above, or of antibodies as defined above, for the preparation of medicaments intended for the treatment of pathologies linked to a decrease in the level of butyrylcholinesterase in the organism, in particular pathologies linked to cholinergic transmission, such as Alzheimer's disease ₍ or myasthenia gravis.

The invention relates to the use of cells selected from those producing AChE and a protein as defined above, for the implementation of a method for screening for compounds specifically inhibiting AChE as present in the invention. cell surface, or compounds inhibiting the anchoring of AChE membranes, said compounds being capable of being able to be used for the preparation of medicaments intended for the treatment of pathologies as defined above. The invention also relates to the use of cells selected from those producing BChE and a protein as defined above, for the implementation of a method for screening for compounds specifically inhibiting BChE such as present on the cell surface, or of compounds inhibiting the membrane anchoring of BChE, said compounds being capable of being able to be used for the preparation of medicaments intended for the treatment of pathologies as defined above.

The invention also relates to the use as defined above, of cells chosen from:

- those whose genome codes without prior transformation for AChE and a protein as defined above,

- those as defined above, the genome of which encodes without prior transformation for AChE, and which have been transformed by a nucleotide sequence coding for a protein as defined above,

- those whose genome codes without prior transformation for a protein as defined above, and having been transformed by a nucleotide sequence coding for an AChE, ^a

- Cells as defined above, having been transformed by a gene coding for AChE and by a nucleotide sequence coding for a protein as defined above.

An advantageous embodiment of the invention relates to the use as defined above of cells such as neuroblastomas N18TG2 (Lazar et al., 1980).

The invention also relates to the use as defined above, of cells chosen from:

- those whose genome codes without prior transformation for BChE and a protein as defined above,

- those as defined above, the genome of which encodes without prior transformation for BChE, and having been transformed by a nucleotide sequence coding for a protein as defined above,

- those whose genome codes without prior transformation for a protein as defined above, and which have been transformed by a nucleotide sequence coding for BChE,

- Cells as defined above, having been transformed by a gene coding for BChE and by a nucleotide sequence coding for a protein as defined above. The invention also relates to a method for screening compounds specifically inhibiting AChE as present on the cell surface, or compounds inhibiting the membrane anchoring of AChE, said compounds being capable of being able to be used for the preparation drugs intended for the treatment of pathologies as defined above, and which comprises the following stages:

- placing cells as defined above with the compound tested,

- Detection of the possible decrease in the activity of AChE on the surface of the cells compared to the activity of AChE on the surface of control cells which have not been placed in the presence of the test compound.

The principle of such a screening method is to use a cellular system producing on the surface AChE anchored by the PRiMA protein. This surface activity of the AChE enzyme outside of cells can be measured by different histochemical or coorimetric methods, for example: Kamovsky histochemical method

(Kamovsky et al., 1964), Ellman's colorimetric method (Ellman et al, 1961) on non-permeabilized cells. This activity can also be measured using labeled fasciculin (Peng et al., 1999), anti-AChE antibodies (Marsh et al., 1984) or anti-PRiMA antibodies. The screen then consists in applying to the cells the compound tested for its activity inhibiting the membrane anchoring of AChE and in observing a possible decrease in the activity of membrane AChE.

The invention also relates to a method for screening compounds specifically inhibiting BChE as present on the cell surface, or compounds inhibiting the membrane anchoring of BChE, said compounds being capable of being able to be used for the preparation of medicaments intended for the treatment of pathologies as defined above, and which comprises the following stages:

- placing cells as defined above with the compound tested, - detecting the possible decrease in the activity of BChE on the surface of the cells compared to the activity of BChE on the surface of cells controls not having been placed in the presence of the test compound. The possible decrease in the activity of AChE or BChE on the surface of the cells is detectable by the observation of a decrease in activity measured by the techniques presented above. For example, the Ellman method (Elhnan et al., 1961), applied to a sample of non-permeabilized cells in suspension, makes it possible to directly obtain a measurement of the total amount of AChE activity or of the

BChE is present on the cell surface before and after treatment with the test compound. ⁽ⁱ -

The techniques for detecting the decrease in activity of BChE are identical to those of AChE, except for fasciculin. Indeed, this technique only applies to AChE. The techniques of Ellman (Elhnan et al., 1961) and of

Kamovsky (Kamovsky et al., 1964) apply to both types of cholinesterases. AChE is therefore distinguished from BChE by the use of specific inhibitors of one or other of the enzymes. Regarding antibodies, antibodies specific to AChE and BChE respectively must be used. The invention also relates to a screening method for searching for ligands of a purified PRiMA protein.

The invention also relates to a screening method for searching for ligands of the complex formed between the PRiMA protein and the AChE tetramer.

DESCRIPTION OF THE FIGURES

Figure 1 represents the partial genomic map of human chromosome 14, with the positions of BAC ("bacterial artificial chromosome I": bacterial artificial chromosome) AL132642 and AL157858 (reverse orientation) in the region coding for the protein PRiMA. It also represents the structure of exons and introns of the gene

PRiMA: the five exons are represented to scale by white rectangles (non-coding region) and gray rectangles (coding region). The ATG translation initiation codon and the stop codon are also indicated. Polyadenylation sites are indicated by stars.

Figure 2a corresponds to the use of the fluorescent protein EGFP as a transfection control. In Figure 2b, non-permeabilized N18TG2 cells were labeled with fasciculin coupled with rhodamine. Figures 2a and 2b correspond to transfected N18TG2 cells expressing ACnEr without the PRiMA protein.

Figure 2c shows the sedimentation profile of AChE activity in extracts of transfected N18TG2 cells which express AChE _τ without PRiMA. The different molecular forms are represented schematically above each peak: the AChE subunits are represented by white circles and PRiMA by a gray rectangle. The AChE activity has been represented in arbitrary units as a function of the sedimentation coefficient (S).

FIG. 3 represents the coexpression of a T-type AChE subunit (AChE _τ is a variant of splicing of AChE transcripts; it is the main variant present in the muscles and the central nervous system adult mammals). This coexpression allows the formation of AChE tetramers and their anchoring at the level of cell membranes, in undifferentiated NI 8TG2 neuroblastomas.

Figure 3a corresponds to the use of the fluorescent protein EGFP as a transfection control and in Figure 3b, the non-permeabilized N18TG2 cells were stained with fasciculin coupled to rhodamine. Figures 3a and 3b correspond to transfected N18TG2 cells expressing _τ AChE with the PRiMA protein. AChE is visualized on the cell surface only when it is coexpressed with the PRiMA protein. Figure 3c shows the sedimentation profile of AChE activity in extracts of transfected N18TG2 cells which express AChE _τ with PRiMA. The different molecular fprmes are represented schematically above each peak: the AChE subunits are represented by white circles and PRiMA by a gray rectangle. Cotransfection with PRiMA results in the production of amphiphilic AChE tetramers. The AChE activity has been represented in arbitrary units as a function of the sedimentation coefficient (S).

Figures 4a, 4b and 4c concern the expression of a PRiMA construct labeled with an epitope (Flag-PRiMA) in undifferentiated N18TG2 cells. "Flag" corresponds to an epitope of DYKDE sequence. Figure 4a shows the visualization of Flag-PRiMA on cells not permeabilized with anti-Flag M1 antibodies. Figures 4b and 4c correspond to cells coexpressing AChE _τ and Flag-PRiMA labeled respectively with Ml antibodies (Figure 4b) and fasciculin coupled to rhodamine (Figure 4c), revealing the presence of both PRiMA and AChE co-located on the cell surface.

The arrows indicate the transfected cells expressing both AChE and the Flag-PRiMA construct.

Figure 5 corresponds to the schematic representation of the different regions of PRiMA: the N-terminal signal peptide; the extracellular domain containing five cysteines (C), the proline-rich motif and N- and O-glycosilation- sites; the transmembrane region and the C-terminal cytoplasmic domain containing a cysteine at the limit of the transmembrane region and serines representing potential sites of phosphorylation.

Figures 6a, 6b and 6c relate to the suppression of the proline-rich motif, which suppresses the interaction between PRiMA and AChE but not the anchoring of AChE to the surface of the cells. FIGS. 6a and 6b relate to the visualization of transfected non-permeabilized N18TG2 cells with, as control, respectively EGFP and fasciculin coupled with rhodamine, in order to identify the transfected cells. The cells expressing _τ AChE and the Flag-PRiMA ΔPRAD construct do not exhibit AChE on their surface. Figure 6c shows that Flag-PRiMA ΔPRAD is present on the surface of the transfected cells, as can be seen with the anti-Flag Ml antibodies. The arrows indicate cells expressing AChE and the Flag-PRiMA ΔPRAD construct.

FIG. 7a represents the sedimentation profile of the cellular extracts of N18TG2 cells expressing _τ AChE and PRiMA ΔPRAD. FIG. 7b represents the sedimentation profile of the cellular extracts of N18TG2 cells expressing BChE alone (black circles) or with PRiMA (white squares). FIG. 7c represents the sedimentation profile of the cellular extracts of N18TG2 cells expressing mutated rAChEr not containing the C-terminal cysteine (C572S in numbering standard, defined in relation to torpedo AChE) with PRiMA. The structures of the different oligomers are indicated schematically for each compound: the AChE subunits are represented by white circles, the BChE subunits are represented by gray circles and PRiMA is represented by a gray rectangle. These profiles show that PRiMA induces the formation of amphiphilic tetramers of AChE, even without the C-terminal cysteine, as well as the formation of amphiphilic tetramers of BChE, but that PRiMA ΔPRAD does not allow it. In Figures 26a, 26b and 26c, the activity of AChE is represented in arbitrary units as a function of the sedimentation coefficient (S).

FIG. 8 corresponds to the analysis by RNA transfer (Northern Blot) of PRiMA transcripts in, mouse tissues. The different columns correspond to

2 μg of mRNA from the heart, brain, spleen, lungs, liver, skeletal muscles, kidneys and testes, hybridized with a probe labeled with ³² P, corresponding to the coding sequence of PRiMA.

FIGS. 9a and 9b represent the sedimentation profiles of AChE in tissue extracts originating respectively from the mouse brain and from the skeletal muscle, extracts in which the linked molecular forms of PRiMA were deleted using an antiserum directed against PRiMA (curve with white squares) or, as a control, with pre-immune serum (curve with black circles).

FIGS. 9c and 9d represent the sedimentation profiles of BChE in tissue extracts originating respectively from the brain ₍ from mouse and from skeletal muscle, extracts in which the linked molecular forms of PRiMA were removed using an antiserum directed against PRiMA (curve with white squares) or, as a control, with pre-immune serum (curve with black circles).

In Figures 9a, 9b, 9c and 9d, the activity of AChE is represented in arbitrary units as a function of the sedimentation coefficient (S). MATERIALS AND METHODS

A. Obtaining the mouse PRiMA cDNA from mRNA of differentiated neuroblastoma cells:

The N-terminal peptide sequence EPQKSCSKYTD, obtained by chemical sequencing of the N-terminal end of a 20 kDa protein copurified with AChE of ox brain (Boschetti and Brodbeck, 1996; Perrier et al., 2000), corresponds to a fragment coding in a portion of murine genomic sequence of chromosome 14 (AL132642). This peptide appeared to be included in an exon containing in phase a domain rich in prolines. The putative exon of a suitable mouse was obtained by PCR from mouse genomic DNA using the 4 overlapping primers SI, RI then S2, R2 (see Table 1 below) deduced from the murine genomic sequence ALI 32642.

Table 1: List of PCR primers used:

From the sequence of the putative mouse exon thus obtained by sequencing the amplified fragments, RACE-PCR experiments (rapid PCR amplification of the 5 'and 3' ends) could be carried out in order to obtain a complementary DNA. of mice containing the initial putative exon. For this, four overlapping primers specific for the putative exon (mS3 and mS4 for 3'RACE; mR4 and mR3 for 5 'RACE; see Table 1 above) were used in combination with a series of non-specific exon primers ( Q _t containing the two "nested" primers Q ₀ and Qi; see Table 1 above) according to the protocol described by Frohman (Frohman et al, 1988) and from poly A + RNA (1 μg) extracted from NI neuroblastomas 8TG2 (Lazar et al.,

1980) grown in the presence of 2% DMSO for 5 days.

The DNA fragments from the 5 'and 3' RACE-PCR experiments were fused and subcloned into the vector pCRII-TOPO (Invitrogen) and then subcloned again into the vectors pcDNA3.1 and pLRES2-EGFP ( Clontech) at the EcoRI restriction site.

For the constructions pCDNA3.1 PRIMA ΔPRAD and Flag-PRLMA, we carried out mutagenesis, directed according to the method of Kunkel (Kunkel et al., 1987) to delete the amino acids between positions 56 and 70 or to insert the Flag epitope (DYKDE at position 36). For the pcDNA3.1 PRIMA ΔCter construction, the amino acids between positions 122 to 153 were deleted and a STOP codon was inserted by PCR.

B. Cell culture:

The murine neuroblastoma clone N18TG2 (Lazar et al., 1980) is maintained in culture in modified Dulbecco medium (Dulbecco's modified Eagle's medium: DMEM, Gibco) supplemented with 10% of decomplemented fetal calf serum, 2 mM of glutamine, 1 mM sodium pyruvate, cell differentiation is induced by the addition of 2% DMSO. The cells are mechanically dissociated every 3 to 4 days and then cultured in 75 cm ² flasks without changing the medium, in an atmosphere saturated with water containing 5% CO ₂ .

COS-7 cells are maintained in culture according to a conventional method (Bon and Massoulié, 1997). C. Cell transfections:

The N18TG2 cells are transfected into culture plates with 60 mm diameter wells with 1 to 3 μg of DNA and 3 to 6 μl of Fugen 6 (Boehringer-Mannheim) according to the manufacturer's instructions.

COS cells are transfected into culture dishes 100 mm in diameter with 3 to 5 μg of each DNA according to the method described in the references Bon and Massoulié (1997) and Simon et al. (1998).

D. Extraction of molecular forms of AChE and BChE:

The surface of the cells to be extracted is rinsed once with PB S buffer (saline phosphate buffer), then the cells are collected. The cell pellet is then homogenized in the extraction solution (25 mM Tris-HCl pH 7, 10 mM MgCl ₂ , 2 mM Benzamidine, 2% Triton XI 00 (Sigma), 0.8 M NaCl, 20 μg / ml pepstatin, 40 μg / ml leupeptin) by several repeated pipetting and several passages in a Potter (Teflon-glass). The extract is then clarified by centrifligation to facilitate the determination of the activity of cholinesterases according to the method described in the reference Elhnan et al. (1961).

E. Analysis of the molecular forms of ChE by sedimentation in sucrose gradients:

I

The sedimentation analyzes are carried out in 5- 20% sucrose gradients (weight / volume) containing 0.8 M NaCl, 50 mM Tris HC1 pH 7, 10 mM MgCl ₂ , and

1% Brij-96 or Brij-97 (Sigma) and ^' centrifuged at 40,000 rpm at 7 ° C for 16 hours, using a rotor type SW41 (Beckman Instruments, Fullerton CA). The activity of the fractions collected from a gradient (approximately 50 fractions) is measured using the colorimetric method described by Ellman et al. (1961). The sedimentation coefficients are deduced from the position of two internal marker proteins, alkaline phosphatase (6.1 S) and β-galactosidase (16 S) of Escherichia coli, assuming that there is a linear relationship between the sedimentation coefficient and the position in the gradient.

F. Detection of AChE at the cell surface:

Fasciculin, a very specific snake toxin from AChE, is chemically coupled to rhodamine according to the recommendations described in Peng et al. (1999). The transfected N18TG2 cells are cultured for one day on glass coverslips coated with polyornithine (10 μg / ml of poly-L-ornithine in PBS at 37 ° C for 48 h). The slides are then washed with PBS and incubated for 15 minutes at room temperature in blocking buffer ("serum-free protein blocking ready-to-use solution", blocking solution ready to use, DAKO). Then, the slides are incubated for one hour at room temperature with fasciculin coupled to rhodamine (at 1 μg / ml) in TBS-BSA buffer ("Tris-buffered saline", Tris-based saline buffer containing 0.3 % serum albumin from beef). After several washes, the slides are mounted on a slide with a solution containing glycine (Fluoprep, Biomérieux).

G. Extraction of cholinesterases from tissues and immunodepletion of forms of cholinesterases linked to PRiMA:

A whole brain or a skeletal (gastrocnemius) muscle of a mouse is ground in a slide homogenizer (Polytron) in an extraction buffer without detergent (25 mM Tris-HCl pH 7, 10 mM MgCl ₂ , 20 μg / ml pepstatin, 40 μg / ml leupeptin). The extracts are kept for 45 minutes at 4 ° C. and then centrifuged for 30 minutes at 15,000 g. The pellets are washed once with the extraction buffer, then they are extracted again with a buffer containing detergent (25 mM Tris-HCl pH 7, 10 mM MgCl ₂ , 2% Triton XI 00, 20 μg / ml pepstatin , 40 μg / ml leupeptin). The extracts obtained, clarified by centrifligation, contain the molecular membrane forms of cholinesterases.

One hundredth of the brain extract and one tenth of that of muscles are incubated at 4 ° C in the presence of anti-rabbit anti-PRiMA serum or preimmune serum (as control) (dilution 1:50). After two hours of incubation, 50 μl of a protein-G-agarose suspension (Roche) is added to each extract and the mixture is incubated for 2 hours at 4 ° C. After a short centrifligation (10 minutes at 15,000 g), the supernatants are analyzed by sucrose gradient sedimentation. AChE and BChE activities are measured using Ellman's colorimetric method in the presence of 10 ^"4 M iso-OMPA (Austin and Berry, 1953), which is a specific inhibitor of BChE or BW284c51 10 ^"6 M (Austin and Berry, 1953), which is a specific inhibitor of AChE.

H. Description of a new exon in the gene encoding the protein

PRiMA and obtaining a new variant of this protein:

a) In humans:

A new exon has been identified by RT-PCR between exons 4 and 5, exon 4 being delimited from the nucleotide in position (230) to the nucleotide in position (359) of the sequence

SEQ LD NO: 1, and part of exon 5 extending from the nucleotide in position (360) of the sequence SEQ LD NO: 1.

The sequence (SEQ LD NO: 44) of this new exon is as follows:

N H A I * g | ââc | cat | gcc | atc [Eâg [ggagccctctgtggccatctctgcctggaccagggtggaaatgcctctt cttggtttaatgagaccagcctcagctgactcacagagctgcagagccaggctggcgctggcccccggcccc

The sequence translated in the reading phase of exon 4 is written above. The insertion of this exon between exon 4 and 5 introduces a stop codon into the coding sequence which appears shorter than that deduced in the absence of this exon.

The translated sequence is then as follows:

MLLRDLVLRRGCCWSSLLLHCALHPL GFVQVTHGEPQKSCSKVTDSCRHVCQCR PPPPLPPPPPPPPPPRLLSAPAPNSTSCPTEESWWSGLVIIIAVCCASLVFLTVL VIICYKAIKRNHAI b) In mice:

A new exon has been identified by RT-PCR between exons 4 and 5, exon 4 being delimited from the nucleotide in position (230) to the nucleotide in position (359) of the sequence SEQ LD NO: 3, and part of exon 5 extending from the nucleotide in position (360) of the sequence SEQ LD NO: 3.

The sequence (SEQ LD NO: 45) of this new exon is as follows:

N Q A I * g [ââc [cag [gcc | att | Eââaaaaagctttctgtggcctctgccttgcttggtgggaccagcccagatt ggcccgcagattggaggatcggaaagaatcctagcaatgtctgctaggaggagcaggagcaggagcagtagcaggtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagcagtagc]

The sequence translated in the reading phase of exon 4 is written above.

The insertion of this exon between exon 4 and 5 introduces a stop codon into the coding sequence which appears shorter than that deduced in the absence of this exon.

The translated sequence is then as follows:

MLLRDLVPRHGCCWPSLLLHCALHPL GLVQVTHAEPQKSCSKVTDSCQHICQCR PPPPLPPPPPPPPPPRLLSAPAPNSTSCPAEDS WSGLVIIVAVVCASLVFLTVL VIICYKAIKRNQAI

c) Results:

The new proteins differ from the previous ones in the sequence of the cytoplasmic domain that has been identified. In both cases, the PRiMA protein organizes a tetramer of catalytic subunits and addresses it to the membrane.

d) List of PCR primers used:

The oligonucleotides indicated "reverse transcription" served as a primer for the reverse transcriptase to copy the RNA into single-stranded cDNA, the oligonucleotides indicated "PCR" were used for amplification by PCR. PCR products were subcloned into a plasmid and sequenced.

Man

Oligo reverse transcription: GGGACGTCTGTCTGCTGGCTGTGCCG

Oligo PCR meaning: CCACCTCCCAGACTCCTCTCCGCCC

Oligo anti-sense PCR: GGCAGGGAGTGGGCTCCGGACCA

Mouse

Oligo reverse transcription: CCCTCTCCTGCAGGAAACCCACCT Oligo PCR sense: GCCAACACATCTGCCAGTGCCGGCC

Oligo anti-sense PCR:, CACACCACTGCAGCGTTCACATCC

RESULTS

A. cDNA and gene coding for PRiMA, the membrane anchor for cholinesterases:

A human genomic sequence has been identified that coresponds to the ammoterminal peptide of PRiMA, previously obtained by chemical sequencing of the end of the 20 kDa subunit. This anchor protein was eluted with purified AChE SDS gel from a bovine brain detergent extract (Boschetti and Brodbeck, 1996; Perrier et al., 2000). Based on this genomic information (see Figure 1) and using the mRNA of differentiated N18TG2 neuroblastoma cells, which express the tetrameric form linked to the AChE membrane (Perrier et al., 2000), Mouse cDNA by 3 'and 5' RACE (Rapid amplification of the 3 'and 5' ends by PCR). The 900 base pair cDNA contains a single open reading phase. The primary sequences deduced from PRiMA of mice and humans are very similar, with a percentage identity of 90.9% (percentage homology of 93.5%).

In parallel with this analysis, we studied the possible existence of alternative splicing variants of PRiMA. Northern blot analysis of mouse brain using a probe corresponding to the entire coding sequence of PRiMA revealed the existence of a main transcript of 3.3 kb (see Figure 8). The two transcripts of 0.9 and 3.3 kb code for the same protein, namely PRiMA.

The PRiMA gene is located on human chromosome 14 (14q32.12), 93.7 Mb from the centromere in reverse orientation (see Figure 1). Analysis of this region has shown that this gene spans approximately 70 kb and that the mRNA consists of a 5 'non-coding exon and four coding exons, the latter containing the long 3' non-coding sequence (see Figure 1). B. PRiMA anchors the AChE tetramers in cell membranes:

The expected function of PRiMA is to target AChE _τ at the level of the cell membrane in the form of a tetramer; this can be analyzed simply by transfection into cell lines. When the τChE _τ cDNA is transfected alone in undifferentiated N18TG2 cells or in COS cells, the enzyme is not exposed on the surface of the cells (see FIGS. 2a and 2b), as described previously in the reference. Bon et al. (1997). On the contrary, a clear and uniform labeling of AChE is observed on the surface of the cells, when AChE _τ is expressed with PRiMA (see FIGS. 3a and 3b). This localization of AChE on the surface of the transfected cells was examined with fasciculin, a venom toxin with a high affinity for AChE, coupled with rhodamine. To ensure that the complex is targeted at the surface, a "Flag" epitope (DYKDE) has been inserted between the putative signal peptide and the N-terminal end of the mature PRiMA protein.

(position 36). When the _τ AChE was expressed with the Flag-PRiMA construct, immunostaining of the cells not permeabilized with the anti-Flag monoclonal antibody (Ml) showed that PRiMA is exposed on the surface of the transfected cells and that the two proteins are colocalized (see Figures 4b and 4c). This result shows first of all that the Flag epitope is maintained in the mature protein, since it is recognized by the Ml antibodies only when it is located at the N-terminal end, which confirms the position of the putative signal peptide cleavage site. This result also shows that the N-terminal region of PRiMA is extracellular and that AChE and PRiMA are associated. However, targeting PRiMA on the cell surface does not require its association with AChE because PRiMA, expressed alone, integrates the membrane (see Figure 4a), unlike AChE.

The biochemical nature of the membrane-bound tetramer requires a high concentration of Triton X100 for extraction. The molecular forms of AChE, extracted in the presence of 2% Triton XI 00 from COS cells expressing AChE, with or without PRiMA, were analyzed by sucrose gradients containing 1% of Brij-97. Expression of AChE alone produces many molecular forms which can all be extracted without detergent from cells (see Figure 2c). The sedimentation profiles revealed that the coexpression of PRiMA with AChE produces a particular molecular form, the sedimentation coefficient of which is 7.8 S under the experimental conditions of Figure 2c, soluble only in the presence of a detergent, in plus the many forms generated by the expression of AChE _τ alone (see Figure 3c). This specific species of enzyme is amphiphilic, as indicated by the fact that its sedimentation is slower in the presence of Brij-97 than in the presence of Triton XI 00 (Sigma), and corresponds to the tetramer anchored in the membrane. To demonstrate the presence of PRiMA in membrane tetramers, an immune serum was used against a GST fusion protein with the C-terminal cytoplasmic domain of PRiMA. After immunoabsorption with this immune serum but not with the pre-immune serum extracted from cells coexpressing PRiMA and AChE, an almost complete absence of membrane tetramers was observed. These cells have thus been shown to produce AChE tetramers anchored by PRiMA on membranes.

C. The PRiMA extracellular domain contains a new PRAD domain for AChE and BChE:

In the primary structure of PRiMA, four distinct regions can be distinguished (see Figure 5): a signal peptide and extracellular, transmembrane and cytoplasmic domains. Apart from a proline-rich sequence, no resemblance to already identified peptide motifs has been found.

The extracellular domain of the mature protein contains a proline-rich motif (positions 56 to 70) similar to the PRAD domain of the ColQ collagen (Bon et al., 1997). This motif consists of two stretches of 4 and 10 prolines, followed by a doublet of leucines. In order to examine the importance of this proline-rich motif in the attachment of AChE subunits, this region was deleted in PRiMA and in the Flag-PRiMA construction. In the transfected N18TG2 cells, these constructions were conectively localized on the membrane, but they did not make it possible to anchor the AChE (see FIGS. 6a, 6b and 6c), as indicated by labeling with antibodies M1 and with of fasciculin, respectively. The sucrose gradient analyzes showed that the profile of the molecular forms of AChE (see Figure 7a) is identical to the profile generated by the expression of AChE _τ alone (see Figure 2c). Thus, the proline-rich region of PRiMA is essential for binding with AChE.

In the case of ColQ collagen, the PRAD domain does not only make it possible to form the AChE tetramers but also the BChE tetramers. To verify that the same is true for PRiMA, BChE was expressed with PRiMA in cells

COS. The molecular forms of BChE produced by these cells were analyzed by sucrose gradients: a new main compound at 9.8 S (under the experimental conditions of Figure 7b) was then observed which corresponds to the amphiphilic tetramer of BChE similar to the membrane tetramer of BChE extracted from the muscles (see below).

The proline-rich sequence is preceded by four cysteines which can form disulfide bridges with the C-terminal cysteine of AC Er, as reported by Roberts (1991). However, previous experiments have shown that the cysteine residues of ColQ or of the WAT domain ("tryptophan amphiphilic domain tetramerization", amphiphilic domain of tetramerization, see Simon et al., 1998) were not essential for the assembly of a AChE tetramer with the PRAD domain (Bon et al., 1997). This may explain the fact that analyzes by polyacrylamide gel electrophoresis (PAGE) of AChE bound to the membrane without reduction showed that the membrane anchor was associated with several complexes, representing the monomers, dimers, trimers and tetramers (Liao et al.,

1993) while in the gradients there are only tetramers. To determine whether the disulfide bridges between PRiMA and the AChE _τ subunits are necessary for their association, COS cells were transfected with PRiMA and with an AChE mutant. without C-terminal cysteine, AChE _τ (C572S in standard numbering, defined with respect to torpedo AChE) (Bon et al., 1997). The sedimentation analyzes have shown that these cells produce amphiphilic tetramers, identical to those containing the wild type AChE _τ subunits (see FIG. 7c). Thus, the disulfide bridges are not necessary for the organization of the tetramers of AChE associated with PRiMA, which suggests that the quaternary associations of AChE _τ with ColQ and with PRiMA are similar. This also suggests that the organization of a tetramer does not require that the PRiMA cysteines form disulfide bridges with the C-terminal cysteine of _τ AChE. D. PRiMA anchors AChE and BChE in the brain and muscles of mice:

Northern blot analyzes show that the 3.3 kb PRiMA transcript is expressed in the brain, heart and muscles (see Figure 8).

The absence of PRiMA transcripts in the liver suggests that the soluble tetrameric form of BCHE in blood plasma (which comes from the liver) does not group with

PRiMA, nor with a fragment of a soluble protein derived from the same gene. In the kidney and testes, a 0.9 kb transcript was observed which appears to correspond to the short cDNA which has been cloned. These transcripts can be derived from the adrenal glands, which contain the membrane-bound AChE tetramers, rather than from the kidney itself, which does not produce this oligomer.

In conclusion, it has been shown that the membrane-bound ACHE and BChE tetramers from mouse brains and skeletal muscles contain PRiMA, because they can be absorbed by a serum directed against the cytoplasmic region of this protein: Corresponding peaks specifically disappear from the sedimentation profiles after immunoabsorption with this immune serum h but not with the preimmune serum (see Figures 9a, 9b, 9c and 9d).

REFERENCES

- Austin, L. and Berry, WK (1953) Two selective inhibitors of cholinesterase. Biochem J. 125, 183-196,

- Bon, S. and Massoulié, J. (1997) Quaternary associations of acetylcholinesterase. I Oligomeric associations of T subunits with and without the amino-terminal domain of the collagen tail. J Biol. Chem. 272, 3007-3015,

- Boschetti, N. and Brodbeck, U. (1996) The membrane anchor of mammalian brain acetylcholinesterase consists of a single glycosylated protein of 22 kDa. FEDS

Lett., 380, 133-136,

- Ellman, G. L., Courtney, K. D., Andres, V. and Featherstone, R. M. (1961) A new and rapid colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7, 88-95, - Fernandez, H.L., Moreno, R.D. and Lnestrosa, N.C. (1996) Tetrameric (G4) acetylcholinesterase: structure, localization, and physiological regulation. J Neurochem. 66, 1335-1346,

- Frohman, M. A., Dush, M. K. and Martin, G. R. (1988) Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. US A 85, 8998-9002,

- Giacobmi, E. (2000) Cholinesterases and cholinesterase inhibitors. Martin Dunitz, ed., London,

- Gisiger, V., Bélisle, M. and Gardiner, P.F. (19,94) Acetylcholinesterase adaptation to voluntary wheel running is proportional to the volume of activity in fast, but not slow, rat hindlimb muscles. Eur. J. Neurosci. 6, 673-680,

- Kamovsky, M.J. and Roots, L. (1964) A "direct-coloring" thiocoline method for cholinesterases. J Histochem Cytochem. 12, 219-221,

- Kunkel, TA, Roberts, JD and Zakour, RA (1987) Rapid and efficient site- specific mutagenesis without phenotypic selection. Methods Enzymol 154, 367-382, - Lazar, M. and Vigny, M. (1980) Modulation of the distribution of acetylcholinesterase molecular forms in a murine neuroblastoma x sympathetic ganghon cell hybrid line. J Neurochem. 35, 1067-1079, - Liao, J., Norgaard-Pedersen, B. and Brodbeck, U. (1993) Subunit association and glycosilation of acetylcholinesterase from monkey brain. J. Neurochem. 61, 1127-1134,

- Marsh, D., Grassi, J., Vigny, M. and Massoulié, J. (1984) An immunological study of rat acetylcholinesterase: comparison with acetylcholinesterases from other vertebrates. J. Neurochem. 43, 204-213,

- Muller, F., Dumez, Y. and Massoulié, J. (1985) Molecular forms and solubility of acetylcholinesterase during the embryonic development of rat and human brain. Brain Res. 331, 295-302, - Peng, H.B., Xie, H., Rossi, S.G. and Rotundo, R. L. (1999)

Acetylcholinesterase clustering at the neuromuscular junction involves perlecan and dystroglycan. J. CellBiol 145, 911-921,

- Perrier, AL, Cousin, X., Boschetti, N., Haas, R., Chatel, JM, Bon, S., Roberts, WX., Pickett, J., Massoulié, J., Rosenberry, JL and Krejci, E. (2000) two distinct proteins are associated with tetrameric acetylcholinesterase on the cell surface.

J. Biol Chem. 275, 34260-34265,

- Roberts, W.L., Doctor, B.P., Foster, J.D. and Rosenberry, T.L. (1991) Bovine brain acetylcholinesterase primary sequence involved in intersubunit disulfide linkages. J. Biol. Chem. 266, 7481-7487, - Simon, S., Krejci, E. and Massoulié, J. (1998) A four-to-one association between peptide motifs: four C-terminal domains from cholinesterase assemble with one proline-rich attachment domain (PRAD) in the secretory pathway. EMBO J. 17, 6178-6187.

Claims

1. Protein characterized in that it comprises or consists of: - the sequence SEQ LD NO: 2 representing the protein of human origin anchoring to the surface of cell membranes of cholinesterases, in particular of acetylcholinesterase AChE or of butyrylcholinesterase BChE,

- or any sequence derived from the sequence SEQ ID NO: 2 or from a fragment defined below, in particular by substitution, deletion or addition of one or more amino acids, provided that it allows the membrane anchoring of cholinesterases , in particular AChE or BChE,

- or any sequence homologous to the sequence SEQ LD NO: 2 or of a fragment defined below, preferably having a homology of at least about 70% o, and in particular 85% ", with the sequence SEQ LD NO: 2, provided that it allows the membrane anchoring of cholinesterases, in particular AChE or

BChE,

- or any fragment of one of the sequences defined above, provided that it allows the membrane anchoring of cholinesterases, in particular AChE or BChE, in particular any fragment consisting of at least about 6 amino acids , and in particular at least about 40 contiguous amino acids in the sequence SEQ LD

NO: 2.

2. Protein homologous to the sequence SEQ LD NO: 2 according to claim 1, characterized in that it corresponds to the sequence SEQ LD NO: 4 representing the protein of murine origin anchoring to the surface of the cell membranes of cholinesterases , in particular AChE or BChE.

3. Protein fragments characterized in that they are chosen from the following: - the fragments of the sequence SEQ LD NO: 2 represented by the sequences

SEQ LD NO: 6, SEQ LD NO: 8, SEQ LD NO: 10, SEQ LD NO: 12, SEQ LD NO: 14, SEQ LD NO: 16, SEQ LD NO: 18 and SEQ LD NO: 20, the fragments of the sequence SEQ LD NO: 4 represented by the sequences SEQ LD NO: 22, SEQ m NO: 24, SEQ LD NO: 26, SEQ LD NO:, SEQ LD NO: 30, SEQ LD NO: 32, SEQ LD NO: 34 and SEQ LD NO: 36,

the fragment of the anchoring protein on the surface of the cell membranes of rat AChE homologous to the sequence SEQ LD NO: 2, said fragment corresponding to the sequence SEQ LD NO: 37.

4. Protein according to claim 1, characterized in that it comprises or consists of the sequence SEQ LD NO: 39, representing a protein derived from the sequence SEQ LD NO: 2, and in that it allows anchoring membrane of cholinesterases, in particular acetylcholinesterase AChE or butyrylcholinesterase BChE.

5. Protein according to claim 2, characterized in that it comprises or consists of the sequence SEQ LD NO: 42, representing a protein derived from the sequence SEQ LD NO: 4, and in that it allows anchoring membrane of cholinesterases, in particular acetylcholinesterase AChE or butyrylcholinesterase BChE.

6. Nucleotide sequence coding for a protein as defined in one of claims 1 to 5.

7. Nucleotide sequence according to claim 6 „characterized in that it comprises or consists of: - the nucleotide sequence SEQ ID NO: 1 coding for SEQ LD NO: 2,

- or any nucleotide sequence derived, by degeneration of the genetic code, from the sequence SEQ LD NO: 1, and coding for a protein represented by SEQ LD NO: 2,

- or any nucleotide sequence derived, in particular by substitution, deletion or addition of one or more nucleotides, of the sequence SEQ LD NO: 1 coding for a protein derived from SEQ TD NO: 2, as defined in claim 1, - or any nucleotide sequence homologous to SEQ LD NO: 1, preferably having a homology of at least about 70%, with the sequence SEQ LD NO: 1 coding for a protein homologous to SEQ ID NO: 2, as defined in claim 1, - or any fragment of the nucleotide sequence SEQ TD NO: 1 or of the nucleotide sequences defined above, said fragment preferably consisting of at least about 20 contiguous nucleotides in said sequence,

- or any nucleotide sequence complementary to the above-mentioned sequences or fragments, - or any nucleotide sequence capable of hybridizing under stringent conditions with the complementary sequence of one of the sequences or of one of the above-mentioned fragments.

8. Nucleic acid fragments chosen from the following: - the sequences SEQ LD NO: 5, SEQ ID NO: 7, SEQ LD NO: 9, SEQ ID

NO: 11, SEQ LD NO: 13, SEQ LD NO: 15, SEQ LD NO: 17, and SEQ LD NO: 19, coding respectively for the sequences SEQ LD NO: 6, SEQ LD NO: 8, SEQ LD NO: 10, SEQ LD NO: 12, SEQ LD NO: 14, SEQ LD NO: 16, SEQ LD NO: 18 and SEQ LD NO: 20, - the sequences SEQ LD NO: 21, SEQ LD NO: 23, SEQ LD NO : 25, SEQ LD

NO: 27, SEQ LD NO: 29, SEQ ^" Ê> NO: 31, SEQ LD NO: 33, and SEQ LD NO: 35, coding respectively for the sequences SEQ LD NO: 22, SEQ LD NO: 24, SEQ LD NO: 26, SEQ TD NO: 28, SEQ LD NO: 30, SEQ LD NO: 32 ^, SEQ LD NO: 34 and SEQ LD NO: 36.

9. Nucleotide sequence according to claim 6 or 7, characterized in that it comprises or consists of the nucleotide sequence SEQ LD NO: 38, coding for SEQ LD NO: 39.

10. Nucleotide sequence according to claim 6 or 7, characterized in that it comprises or consists of the nucleotide sequence SEQ LD NO: 40, coding for SEQ LD NO: 39.

11. Nucleotide sequence according to claim 6 or 7, characterized in that it comprises or consists of the nucleotide sequence SEQ LD NO: 41, coding for SEQ LD NO: 42.

12. Nucleotide sequence according to claim 6 or 7, characterized in that it comprises or consists of the nucleotide sequence SEQ LD NO: 43, coding for SEQ LD NO: 42.

13. Recombinant vector, in particular plasmid, cosmid, phage or virus DNA, containing a nucleotide sequence according to one of claims 6 to 12.

14. Recombinant vector according to claim 13, containing the elements necessary for the expression in a host cell of the polypeptides encoded by the nucleic acids according to one of claims 6 to 12, inserted in said vector.

15. Host cell, chosen in particular from bacteria, viruses and eukaryotic cells, in particular yeasts, fungi, plant, insect or vertebrate cells, said host cell being transformed, in particular using a recombinant vector according to one of claims 13 or 14.

16. Antisense oligonucleotides or antisense messenger RNA derived from the nucleotide sequences according to one of claims 6 to 12. _i

17. Antibody characterized in that it is directed specifically against a protein according to one of claims 1 to 5.

18. Pharmaceutical composition characterized in that it comprises an antisense oligonucleotide according to claim 16, in association with an acceptable pharmaceutical vehicle.

19. Pharmaceutical composition characterized in that it comprises an antibody according to claim 17, in association with an acceptable pharmaceutical vehicle.

20. Use of antisense oligonucleotides according to claim 16, or of antibodies according to claim 17, for the preparation of medicaments intended for the treatment of pathologies linked to a reduction in the level of AChE in the organism, in particular of linked diseases cholinergic transmission at the level of the cells of the central nervous system, in particular in the case of Alzheimer's disease, or the treatment of diseases linked to cholinergic transmission at the neuromuscular level, in particular myasthenia gravis and more particularly myasthenia gravis.

21. Use of cells selected from those producing AChE and a protein as defined in one of claims 1 to 5, for the implementation of a method for screening for compounds specifically inhibiting AChE as present at the cell surface, or compounds inhibiting the anchoring of AChE membranes.

22. Use according to claim 21, of cells chosen from: - those whose genome codes without prior transformation for AChE and a protein according to claim 1, such as neuroblastomas NI 8TG2,

- those as defined in claim 15, whose genome codes without prior transformation for AChE, and having been transformed by a nucleotide sequence coding for a protein defined in one of claims 1 to 5, - those whose genome code without prior transformation for a protein according to claim 1, and having been transformed by a nucleotide sequence coding for an AChE,

- Cells as defined in claim 15, having been transformed by a gene coding for AChE and by a nucleotide sequence coding for a protein defined in one of claims 1 to 5.

23. A method of screening for compounds which are specifically inhibitors of AChE as present on the cell surface, or of compounds which inhibit membrane anchoring of AChE, and which comprises the following steps:

- bringing together cells as defined in claim 22 with the compound tested,

detection of the possible decrease in the activity of AChE on the surface of the cells relative to the activity of AChE on the surface of control cells which have not been placed in the presence of the test compound.