WO2001023424A1

WO2001023424A1 - A phosphatidylethanolamine binding protein (pebp-2) and uses thereof

Info

Publication number: WO2001023424A1
Application number: PCT/AU2000/001177
Authority: WO
Inventors: Moira Kathleen O'bryan; Milton Thomas William Hearn; David Morritz De Kretser; Deborah Maree Hickox
Original assignee: Monash University
Priority date: 1999-09-24
Filing date: 2000-09-22
Publication date: 2001-04-05
Also published as: AUPQ305199A0

Abstract

The present invention relates to a new phosphatidylethanolamine binding protein (pebp-2). The invention further relates to isolating, cloning and sequencing nucleic acid sequences encoding pebp-2. Also provided are methods of using the protein for the prevention, treatment and diagnosis of conditions associated with the protein. There is provided a nucleic acid and amino acid sequence of pebp-2 or part thereof comprising a sequence according to Figure 1 or part thereof, or an analogue, variant, mutant or functional equivalent thereof. Preferably the nucleic acid or amino acid sequence encodes a pebp-2 having a molecular weight of approximately 21 kDa or 20 kDa and having an isoelectric point of approximately 8.42 or 8.77 respectively, or an analogue, variant, mutant or functional equivalent thereof.

Description

A phosphatidylethanolamine binding protein (pebp-2) and uses thereof

The present invention relates to a new phosphatidylethanolamine binding protein (pebp-2). The invention further relates to isolating, cloning and sequencing nucleic acid sequences encoding pebp-2. Also provided are methods of using the protein for the prevention, treatment and diagnosis of conditions associated with the protein.

INTRODUCTION

A number of soluble, cytosolic proteins share a common ability to specifically bind phospholipids such as phosphophatidylethanolamine (PE), which is a common phospholipid of cell membranes. Over the past decade a subgroup of PE binding proteins have been identified which contain similar amino acid sequences from a number of sources ranging from flowering plants, parasites, nematodes, insects and mammals including cows, monkeys and humans and collectively called pebps. Although they may have these similarities, they do not have the same molecular mechanisms of function, do not fall into the same superfamily in terms of their protein sequence characteristics or genomic organization. To date, only one pebp had been delineated in the literature.

The pebp proteins have been implicated in a number of functions including membrane biogenesis, membrane fluidity, the formation of functional domains and neuronal development, including the stimulation of acetylcholine secretion. Hence the proteins may have a pivotal role in cell regulation which may be manipulated to control various functions in the cell, as well as effecting downstream processes which have a greater impact on the overall functioning of the body. For instance, the pebp may be capable of binding to various kinase proteins involved in kinase pathways whereby binding to a receptor on the cell membrane causes a chain of events within the cytoplasm. Activated proteins interact with other proteins at the cell membrane and / or cytoplasm resulting in a further cascade of phosphorylation events leading to activation of various genes in the nucleus or a change in cell function. There are many pebp's with various functional roles. To identify and isolate a specific pebp would provide for a greater understanding of the roles of the various pebp's and their effect on cell regulation.

Accordingly, it is an object of the present invention to overcome or at least alleviate some of the problems of the prior art and to identify a specific pebp which may be involved in the process of cell regulation.

SUMMARY OF THE INVENTION

Throughout the description and claims of this specification, the word "comprise" and variations of the word, such as "comprising" and "compπses", is not intended to exclude other additives, components, integers or steps.

The discussion of documents, acts, materials, devices, articles and the like is included in this specification solely for the purpose of providing a context for the present invention. It is not suggested or represented that any or all of these matters formed part of the prior art base or were common general knowledge in the field relevant to the present invention as it existed in Australia before the priority date of each claim of this application.

In one aspect of the present invention, there is provided a nucleic acid sequence of pebp-2 or part thereof comprising a sequence according to Figure 1 (SEQ ID NO:1 ) or part thereof, or an analogue, variant, mutant or functional equivalent thereof. Preferably the nucleic acid sequence encodes a pebp-2 having a molecular weight of approximately 21 kDa or 20kDa and having an isoelectric point of approximately 8.43 or 8.77 respectively, or an analogue, variant, mutant or functional equivalent thereof. Also included are nucleic acid sequences or parts thereof which encode the amino acid sequence in Figure 1 (SEQ ID NO:1) or parts thereof.

Accordingly, in a further aspect of the present invention there is provided a vector including a nucleic acid sequence according to Figure 1 (SEQ ID NO:1) or part thereof, or an analogue, variant, mutant or functional equivalent thereof. Preferably, the nucleic acid sequence encodes pebp-2 or parts thereof. Preferably, the vector includes a nucleic acid sequence encoding a pebp-2 having a molecular weight of approximately 21 kDa or 20kDa and having an isoelectric point of approximately 8.43 or 8.77 respectively, or an analogue, variant, mutant or functional equivalent thereof. More preferably, the nucleic acid sequence is according to Figure 1 , or an analogue, variant, mutant or functional equivalent thereof.

In yet another aspect of the invention there is provided a host cell including a vector including a nucleic acid sequence according to Figure 1 (SEQ ID NO:1) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

Preferably the nucleic acid sequence encodes pebp-2 or part thereof.

Preferably, the host cell includes a vector including a nucleic acid sequence encoding a pebp-2 having a molecular weight of approximately 21 kDa or 20 kDa and having an isoelectric point of approximately 8.43 or 8.77 respectively, or an analogue, variant, mutant or functional equivalent thereof.

In another aspect of the present invention there is provided a recombinant pebp-2 or part thereof encoded by a nucleic acid sequence having a sequence according to Figure 1 (SEQ ID NO:1) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

Preferably the recombinant pebp-2 has a molecular weight of approximately 21 kDa or 20 kDa and has an isoelectric point of approximately 8.43 or 8.77 respectively, or an analogue, variant, mutant or functional equivalent thereof.

In another aspect of the present invention there is provided an amino acid sequence encoding a pebp-2 and having a sequence according to Figure 1 (SEQ ID NO:2) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

Preferably, the amino acid sequence encoding the pebp-2 has a molecular weight of approximately 21 kDa or 20kDa and has an isoelectric point of approximately 8.43 or 8.77 respectively, or an analogue, variant, mutant or functional equivalent thereof.

In another aspect of the present invention there is provided a pebp-2 or part thereof encoded by a nucleic acid sequence or amino acid sequence according to Figure 1 (SEQ ID NO:2) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

Preferably the pebp-2 has a molecular weight of approximately 21 kDa or 20kDa and has an isoelectric point of approximately 8.43 or 8.77 respectively, or an analogue, variant, mutant or functional equivalent thereof.

In a further preferred aspect of the present invention there is provided peptide fragments, produced by solid or solution phase chemical synthesis or by genetic engineering/recombinant DNA technologies, and comprising part or all of the sequence of pebp-2 preferably having a molecular weight of approximately 21 kDa or 20kDa and having an isoelectric point of approximately 8.43 or 8.77 respectively, an analogue, variant, mutant or functional equivalent thereof. These synthetic peptides can be employed as immunogens to generate antibodies as part of the immune response in humans or other animal species. Moreover, these peptides can be employed as agonists/antagonists related to various functional or binding activities of pebp2.

In another aspect of the present invention, there is provided a composition comprising a pebp-2 encoded by a nucleic acid sequence or amino acid sequence according to Figure 1 (SEQ ID NO:1 ) and (SEQ ID NO:2) or part thereof, or an analogue, variant, mutant or functional equivalent thereof and a carrier.

Preferably, the composition compπses a pebp-2 having a molecular weight of approximately 21 kDa or 20kDa and having an isoelectric point of approximately 8.43 or 8.77 respectively, or an analogue, variant, mutant or functional equivalent thereof and a carrier. In another aspect of the present invention there is provided a polyclonal or monoclonal antibody against a polypeptide encoded by a nucleic acid sequence according to Figure 1 (SEQ ID NO:1) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

In a further preferred aspect of the present invention there is provided a polyclonal or monoclonal antibody reactive against a pebp-2 having a molecular weight of approximately 21 kDa or 20kDa and having an isoelectric point of approximately 8.43 or 8.77 respectively, an analogue, variant, mutant or functional equivalent thereof.

In a further aspect of the present invention there is provided a method of modulating a pebp-2 associated activity said method comprising administering an effective amount of a pebp-2 or part thereof according to the present invention.

In another aspect of the present invention there is provided a method of treating or preventing conditions associated with pebp-2 comprising administering to a mammal in need thereof an effective amount of a pebp-2 or part thereof.

The present invention also provides in vitro and in vivo gene therapy approaches to express pebp-2 in a host. This includes the expression of peptides as well as antisense nucleic molecules

In yet another aspect, there is provided a method of diagnosing a pebp-2 associated condition, said method comprising detecting the presence or absence of pebp-2 or parts thereof.

IN THE FIGURES

Figure 1 shows the cDNA and predicted amino acid (upper line) sequence of the mouse pebp-2 and a comparison with another mouse pebp sequence (lower line). The numbers on the right hand side indicate the relative position of nucleotides. The numbers on the left-hand side indicate the relative position of predicted amino acids. The boxed area indicates the stretch of amino acids which is spliced out of the short pebp-2 variant. The highlighted areas indicate potential poly-adenylation consensus sites.

Figure 2 shows an RT-PCR analysis of pebp-2 expression in mouse tissues. Primers were chosen to flank the alternative splicing region, in order to distinguish the two pebp-2 transcripts ie. long and short. Mouse cDNA samples were from brain (2), epididymis (3), heart (4), kidney (5), liver (6), lung (7), ovary (8), skeletal muscle (9), small intestine (10), spleen (11), uterus with oviducts (12) and testis (13 and 2). Lanes 14 and 15 contain the amplification products from the long and short variants of pebp-2 positive controls ie. plasmid DNA. Lane 1 contains a DNA mass ladder.

Figure 3 shows a comparison of the amino acid sequences of the PEBP family members most homologous to mouse pebp-2. Numbers on the right hand side indicate the amino acid number relative to mouse pebp-2. In descending order, sequences represent: mouse pebp-2 (M-2), rat pebp-2 (R-2), human pebp-2, a bovine pebp (B), a second rat pebp (R-1), its mouse orthologue (M-1 ) and a third rat pebp (R-3). The shaded area indicates the pebp family signature and the boxed area indicated the sequence of amino acids synthetic for pebp-2 specific antisera (DH4) production. (-) indicate that the amino acid is conserved and (?) indicate the residue is unknown.

Figure 4 shows the predicted amino acid sequence and possible post- translational modifications of mouse pebp-2. Highlighted in green, is sequence corresponding to a potential N-linked glycosylation site, Potential protein kinase C phosphorylation sites are highlighted in red. Potential casein kinase II phosphorylation sites are highlighted in yellow. Blue underlining indicates four potential N-myristolylation sites, two of which lie within the spliced out region in the shorter variant of pebp-2. The purple underlining indicates the pebp family signature. The pink underlining indicates potential nuclear localization sequences. Figure 5 shows a Northern blot analysis of pebp-2 expression during rat testicular development. Numbers along the bottom axis indicate testicular age and arrows indicate the approximate transcript size.

Figure 6 shows the pebp-2 mRNA expression. (A) A Northern blot analysis of pebp-2 expression during mouse testicular development and in adult tissues. The testis was the only adult tissue to contain easily detectable amounts of pebp-2 mRNA. Longer exposure times showed very low levels of expression in the brain. (B) The expression of pebp-2 mRNA within the adult mouse testis as determined by in situ hybridization. (Ba) a sense cRNA control indicating the specificity of the antisense cRNA interaction. (Bb-c) Pebp-2 was expressed in a stage specific manner and was first seen within late pachytene spermatocytes (stage IX, arrow heads) and continued into round spermatids (arrows). (C) The expression of the other pebp, pebp-1 , mRNA within the mouse testis. (Ca) A sense cRNA negative control. (Cb-c) Within the testis pebp-1 (the other mouse pebp) was expressed in a stage specific manner and was first seen within late pachytene spermatocytes (stage VIII, arrow heads) and continued in spermatids (arrows). Roman numerals indicate the relative stage of germ cell development as defined by Russell et al (1990). The asterisks indicate intertubular tissue. Magnifications: a and b - 40X and c 200X. (D) A comparison of the expression pattern of pebp-2 and pebp-1 mRNA within germ cells of the adult mouse testis. The relative pigment density of the lines indicates the relative density of the respective pebp mRNAs within germ cells.

Figure 7 shows the expression of pebp-2 protein within the mouse testis and caudal epididymal sperm. (A) An immunoprecipitation-Westem blot showing the existence of the long (20k) and short (19k) variant of pebp-2. The 55k and 25k bands represent immunoglobulin heavy (lgG_H) and light chain (lgG_L) respectively. (B-E) The immunohistochemical distribution of pebp-2 protein within the mouse testis. (B) A pebp-2 pre-absorbed negative control to indicate the specificity of the antiserum and immunohistochmical techniques. (C-E ) within the testis pebp-2 protein was expressed in a stage specific manner and was first seen within late pachytene spermatocytes (arrow heads) and continued to be seen into round and elongating spermatids (arrows). Germ cells prior to late pachytene spermatocytes, Sertoli cells and cells within the testicular interstitium were negative for pebp-2 immunostaining. Magnifications: B and C - 40X D 200X and E 400X. (F-G) Pebp-2 protein expression on caudal epididymal sperm. (F) A negative control section of cauda epididymal sperm probed with pre-immune sera (G) The same field shown in panel F stained with DAPI in order to delineate sperm heads. (H) Pebp-2 protein immunostaining of cauda epididymal sperm showing labeling of the sperm tail (arrow head) in association with the mid- and principal-pieces, the proximal-ventral region (solid arrow) and the distal-dorsal region of the sperm head (open arrow). (Be): DAPI staining of nuclear DNA. Magnification F-G = 630X.

Figure 8 shows the reciprocal immunoprecipitations (IP) and subsequent western immunoblotting using an anti-pebp-2 serum (αpebp-2: DH4) , anti-A- raf (R14320), anti-B-raf (αB-raf: C-19), anti-Raf-1 (αRaf-1 : R19120) and anti- MEK1 (αMEK: C-18) sera from testis homogenates. A. Immunoprecipitations using the DH4 antiserum in addition to precipitating pebp-2 protein, were found to precipitate 3 bands of 88 kDa, 86 kDa and 82 kDa corresponding to B-raf forms within the testis, a 74 kDa band corresponding to raf-1 and a MEK1 band at 45 kDa. B. Immunoprecipitations using either the A-raf, B-raf, raf-1 or MEK1 antiserum showed that at least a proportion A-raf, B-raf, raf-1 and MEK1 within the testis was bound to the 21 kDa form of pebp-2.

Fig. 9 The immunohistochemical distribution of B-raf protein within the adult mouse testis and cauda epididymal sperm. (A) A negative control section to illustrate the specificity of the B-raf staining. Low levels of background staining were detected in testicular intertubular fluid only. (B) B-raf immunostaining was first dectable within developing germ cells in step 13 elongating spermatids. Prior to this stage as illustrated in the right hand tubule (stage XI) germ cells were not stained for B-raf protein. Intense B-raf staining was seen within the final stages of elongating spermatid maturation as indicated in the left-hand tubule (stage 4). (C) A stage VIII tubule showing that at the completion of spermiogenesis, B-raf protein was localized to the mid-piece region of the sperm tail. (D) Spermatozoa within the tubules of the cauda epididymis showing B-raf staining on the mid-piece of the tail. (E) A negative control slide showing caudal epididymal sperm double labeled with non-immune rabbit serum and DAPI. (F) Caudal epididymal sperm double labeled with a B-raf antiserum and DAPI showing the presence of B-raf protein on the mid-piece of the sperm tail.

Figure 10 shows the nucleotide sequence for the 20 kDa form of pebp-2 (SEQ ID NO:3) and the amino acid sequence (SEQ ID NO:4).

Figure 11 shows the nucleotide sequence for the 21 kDa form of the pebp-2 (SEQ ID NO:5) and the amino acid sequence (SEQ ID NO:6).

DESCRIPTION OF THE INVENTION

In one aspect of the present invention, there is provided a nucleic acid sequence which encodes a pebp-2, or part thereof having a sequence according to Figure 1 (SEQ ID NO:1) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

The term "analogue, variant, mutant or functional equivalent" as used herein means a sequence which functions in a similar way but may have deletions, additions or substitutions that do not substantially change the activity or function of the sequence. Here the function is to act as a regulator of cellular activities which can be compared against the cellular activities where there are no deletions, substitutions or additions.

The term "fragments" or "or part thereof relates to a portion of a nucleic acid or amino acid sequence that is less than that of full length but is capable of encoding an amino acid sequence of the protein or a polypeptide which is a portion of the full length sequence of the protein. The fragments also must be capable of acting as regulators of the cellular activities or be able to elicit a biological response.

Nucleic acid sequences which encode the amino acid sequence of Figure 1 are also included in the present invention. Due to the degeneracy of the genetic code, other nucleic sequences which encode the same or functionally equivalent amino acid sequence are included within the scope of the current invention. Such alterations to the nucleotide sequence may include substitutions of different nucleotides resulting in the same or a functionally equivalent gene product. Also included in the scope of this invention are nucleic acid sequences having deletions and/or additions and which result in a functionally equivalent gene product. In addition the gene product may include additions, deletions or substitutions of amino acid residues within the sequence, which result in changes that still result in a functionally active product.

The pebp proteins have been implicated in membrane biogenesis (Moore et al, 1996, Frayne et al, 1998), membrane fluidity and the formation of functional domains (Perry et al, 1994, Schoentgen and Jolles, 1995) and neuronal development, including the stimulation of acetylcholine secretion (Oijka et al, 1992, Oijka et al, 2000).

A pebp orthologue (RKIP, raf kinase inhibitory protein) has recently been identified using a yeast two hybrid screen as a suppressor of raf-1 kinase activity and MAP kinase signaling in fibroblasts through its ability to sequester inactive Raf-1 and MEK1 (Yeung et al, 1999, Yeung et al, 2000). This pebp (referred to as pebp-1 throughout) has been implicated in the differentiation of septo-hippocampal cholinergic neurons by the presence of an 11 amino acid sequence identified as the neurogenic peptide HCNP which is generated by the action of a unique 68 kDa protease that cleaves at the Leu¹²-Ser¹³ site within the HCNP 'precursor' protein, pebp-1 (Otsuka and Ojika, 1996). This motif is conserved in pebp-2, now suggesting that the amino terminus of pebp-2 may also have similar neurostimulatory activity or acts as a paracrine regulatory signal between developing germ cells and Sertoli cells in the testis or during fertilization. However, upon comparison in Figure 1 , it is evident that the nucleotide sequence and the amino acid sequence encoded thereby are distinctly different. The nucleotide sequence of the present invention encodes a new sequence, which has not previously been identified in presently available databases. Preferably, the sequence encodes a pebp-2 which may act as a paracrine factor in several tissues including the developing testis concordant with the commencement of spermiogenesis and the appearance of haploid germ cells or in the brain and be involved in a number of neurological conditions including Alzheimer's disease. However, low levels have also been detected in most/all tissues including (but not limited to) brain, heart, kidney, liver, lung or skeletal muscle.

The pebp proteins (excluding pebp-2) have been described in the male reproductive tract where they have been implicated in the biogenesis and maintenance of antigen segregation of membranes. In particular, they have been implicated in elongating spermatids, residual bodies and interstitial Leydig cells. In the adult epididymis, pebps have been localised to epithelial cells of caput and corpus epididymis. In prepubertal animals, pebps were expressed in both testis and epididymis from day 1 and day 3 post-partum, respectively. In prepubertal testis, pebp was localised to Leydig cells from day 1 postpartum and was not detected in any other cell type until the differentiation of elongate spermatids, when it was detected in step 17-19 elongating spermatids. This suggests that pebps may be involved in the organisation of sperm membranes during spermiogenesis. The presence of pebps in Leydig cells, however suggests diverse roles for this protein as a lipid carrier or binding protein.

Nevertheless, applicants have now identified and isolated a new nucleic acid sequence of a pebp which has not been isolated or identified or characterised previously.

In a preferred aspect of the present invention there is provided a nucleic acid sequence encoding a pebp-2 having a molecular weight of approximately 21 kDa and having an isoelectric point of approximately 8.43, or an analogue, variant, mutant or functional equivalent thereof. Preferably the sequence is according to Figure 11 (SEQ ID NO:5). In another preferred aspect of the invention there is provided a nucleic acid sequence encoding a pebp-2 having a molecular weight of approximately 20 kDa and having an isoelectric point of approximately 8.77, or an analogue, variant, mutant or functional equivalent thereof. Preferably the sequence is according to Figure 10 (SEQ ID NO:3).

According to various aspects of the invention, the polypeptides of the invention are characterized by their apparent molecular weights based on the polypeptides' migration in SDS-PAGE relative to the migration of known molecular weight markers. Any molecular weight standards known in the art may be used with the SDS-PAGE. One skilled in the art will appreciate that the polypeptides of the invention may migrate differently in different types of gel systems (eg, different buffers; different concentration of gel, crosslinker or SDS). One skilled in the art will also appreciate that the polypeptides may have different apparent molecular weights due to different molecular weight markers used with the SDS-PAGE. Hence, the molecular weight characterization of the polypeptides of the invention is intended to be directed to cover the same polypeptides on any SDS-PAGE systems and with any molecular weight markers which might indicate slightly different apparent molecular weights for the polypeptides than those disclosed here.

More preferably, the nucleic acid sequence is according to Figure 1 (SEQ ID NO:1) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

The nucleic acids encoding the factor may be obtained from cell sources that produce the pebp proteins. For example, the nucleic acid sequence may be obtained from testis, brain, heart, kidney, liver, lung or skeletal muscle. Preferably, the nucleic acid is obtained from testis. The nucleic acid encoding the pebp-2 is preferably obtained by (but is not restricted to) reverse transcription of mRNA into complementary cDNA and subsequent Polymerase Chain reaction (PCR) amplification using oligonucleotide primers containing nucleic acid sequences encoding portions, preferably the extreme N and C terminal portions of the polypeptide. Other methods, well known to those in the art, for obtaining nucleic acids encoding proteins exist, and the use of these methods to obtain nucleic acids is also included within the scope of the current invention. These methods may include (but are not restricted to) either chemically synthesising the nucleic acid sequence from knowledge of the nucleic acid or amino acid sequence of the mature and/or precursor forms of the pebp-2 or screening a cDNA and/or genomic library, with isotopically or non-isotopically labelled nucleic acid sequences homologous to a nucleic acid sequence encoding part or all of the pebp-2 as provided in Figure 1 (SEQ ID NO:1).

The nucleic acid may be from any animal source. Preferably the source is mammalian including bovine, ovine, porcine, equine, murine (including rat and mouse) or of human origin. Most preferably, the source is a murine source including mouse or rat.

Preferably, the nucleic acid encoding the pebp-2 or part thereof is expressed in late pachytene spermatocytes or in round and elongating spermatids.

Whilst the factor may be involved in spermatogenesis, it may also be found in tissues including brain, heart, kidney, liver, lung or skeletal muscle. However, this invention is not restricted to any one of these sources. Preferably, the source is from testis.

The process of spermatogenesis is a complex one. Spermatids are transformed into functional spermatozoa and part of this involves the remarkable transformation of a round cell into the highly specialized, cell replete with the ability for motility and fertility. The processes underlying this transformation remain ill-defined but include the initiation and elongation of a cilium and associated structures, the formation of the acrosome which contains enzymes essential for fertilization, the extrusion of excess cytoplasm and extensive membrane modifications. Part of the process of transformation also involves nuclear modifications including chromatin condensation and morphological changes. Chromatin condensation helps to streamline the cell by reducing volume. It also may serve a protective function, reducing the susceptibility of the DNA to mutation or physical damage. Condensation is facilitated by formation of specific DNA-protein complexes. Proteins that may be involved include protamines (small, highly basic, arginine-rich proteins), histone-like proteins or other sperm-specific proteins.

However, physical damage still occurs despite the protective mechanisms being involved.

Many infertile men show an increased percentage of abnormally shaped and immotile sperm arising from unknown factors. It is postulated that some of these abnormalities arise from mutations in genes critically related to the formation of the spermatozoa.

Applicants have also found that the pebp-2 of the present intention is capable of binding to kinase proteins including A-raf, B-raf, raf-1 and MEK-1. These kinase proteins are involved in the MAP (mitogen-activated protein) kinase pathway.

The MAP (mitogen-activated protein) kinase pathway is a major player in the cell cycle and its regulation. In nature, activation of the pathway is by binding of a ligand to a competent receptor on the outer surface of the cell membrane, causing ras protein to bind guanosine triphosphate (GTP) within the cell cytoplasm. Activated GTP then interacts with a raf protein at the cell membrane, resulting in the phosphorylation of raf by a poorly defined mechanism. Raf then in turn phosphorylates a MEK (MAP kinase kinase or ERK kinase) which in turn phosphorylates an ERK (extracellular signal- regulated kinase). The ERK is then transported into the nucleus where it activates various transcription factor (including c-Jun, Elk-1 and AFT-2) which in turn modify gene activity. Alternatively ERK phosphorylates cytoskeletal elements resulting in a modification of their function.

There are a number of diseases and conditions that regulation of MAP kinase signaling may be advantageous. For example, regulation of the MAP kinase pathway appears to play a role in the process of spermatogenesis, and therefore male fertility.

The MAP kinase pathway is a major player in the cell cycle and its dys- regulation. There is a high association between mutations in MAP kinase members and cancers for example, possibly indicating defective regulation of the cell cycle pathway. Similarly B-raf in particular has been implicated in angiogenesis and apoptosis (Wojnowski et al, 1997). There is also evidence that the MAP kinase pathway is integral in cardiac hypertrophy. Potentially pepb-2 analogues could be used to inhibit cancer progression for example.

In a further aspect of the present invention there is provided a vector including a nucleic acid sequence which encodes a pebp-2 or part thereof having a nucleic acid sequence according to Figure 1 (SEQ ID NO:1) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

In a preferred aspect of the present invention, there is provided a vector including a nucleic acid sequence encoding a pebp-2 having a molecular weight of approximately 21 kDa and having an isoelectric point of approximately 8.43, or an analogue, variant, mutant or functional equivalent thereof. Preferably the nucleic acid sequence is according to Figure 11 (SEQ ID NO:5).

More preferably, the nucleic acid sequence is according to Figure 1 , or an analogue, variant, mutant or functional equivalent thereof.

In another preferred aspect of the invention there is provided a vector including a nucleic acid sequence which encodes a pebp-2 having a molecular weight of approximately 20 kDa and having an isoelectric point of approximately 8.77, or an analogue, variant, mutant or functional equivalent thereof. Preferably the nucleic acid sequence is according to Figure 10 (SEQ ID NO:3).

More preferably, the nucleic acid sequence is according to Figure 1 (SEQ ID NO:1), or an analogue, variant, mutant or functional equivalent thereof. Using standard techniques of recombinant DNA technology, well known to those skilled in the art, the nucleic acid encoding the pebp-2 may be cloned into an appropriate vector, for example an expression vector.

Possible vectors include, but are not limited to plasmids or modified viruses, but the vector system must be compatible with the host cell used. Such vectors include, but are not limited to, bacteriophages such as lambda derivatives, or plasmids such as pBR322 or pUC plasmid derivatives. The insertion into a cloning vector can, for example be accomplished by ligating the DNA fragment into the cloning vector or the expression vector which has complimentary cohesive termini. However, if the complementary restriction sites used to fragment the DNA are not present in the vector, the ends of the DNA molecules may be enzymatically modified. Alternatively, any site desired may be produced by ligating nucleotide sequences (linkers) into the DNA termini; these ligated linkers may comprise specific chemically synthesised oligonucleotides encoding restriction endonuclease restriction sequences. In an alternative method, the cleaved DNA may be modified by homopolymeric tailing.

In yet another aspect of the invention there is provided a host cell including a vector including a nucleic acid sequence which encodes a pebp-2 or part thereof having a nucleic acid sequence according to Figure 1 (SEQ ID NO:1) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

In a preferred aspect, the host cell includes a vector including a nucleic acid sequence which encodes a pebp-2 having a molecular weight of approximately 21 kDa and having an isoelectric point of approximately 8.43, or an analogue, variant, mutant or functional equivalent thereof. Preferably the nucleic acid sequence is according to Figure 11 (SEQ ID NO:5).

In yet another preferred aspect, the host cell includes a vector including a nucleic acid sequence which encodes a pebp-2 having a molecular weight of approximately 20 kDa and having an isoelectric point of approximately 8.77, or an analogue, variant, mutant or functional equivalent thereof. Preferably the nucleic acid sequence is according to Figure 10 (SEQ ID NO:3).

Substitute Sheet ⁽Rule 26) RO/AU More preferably, the nucleic acid sequence is according to Figure 1 (SEQ ID NO:1), or an analogue, variant, mutant or functional equivalent thereof.

The vector may be introduced into the host cell by methods such as (but not restricted to) transformation, transfection, electroporation and infection. Host cells may include but are not restricted to prokaryotes such as E.coli cells, or eukaryotes such as yeast or mammalian cells such as CHO cells. Immature sperm cells may have the vector introduced, particularly for gene therapy purposes. Additionally, embryonic cells may have the vector or nucleic acid introduced during the process of gene therapy.

In another aspect of the present invention there is provided a pebp-2 or part thereof encoded by a nucleic acid sequence having a sequence according to Figure 1 or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

In another aspect of the present invention there is provided a pebp-2 having a molecular weight of approximately 21 kDa and having an isoelectric point of approximately 8.43, or an analogue, variant, mutant or functional equivalent thereof. Preferably the pebp-2 has an amino acid sequence according to Figure 11 (SEQ ID NO:6).

More preferably, the recombinant pebp-2 is encoded by a nucleic acid sequence according to Figure 1 (SEQ ID NO:1), or an analogue, variant, mutant or functional equivalent thereof.

In another preferred aspect of the invention there is provided a recombinant pebp-2 having a molecular weight of approximately 20 kDa and having an isoelectric point of approximately 8.77, or an analogue, variant, mutant or functional equivalent thereof. Preferably the pebp-2 has an amino acid sequence according to Figure 10 (SEQ ID NO:4). More preferably, the recombinant pebp-2 or part thereof is encoded by a nucleic acid sequence according to Figure 1 (SEQ ID NO:1 ) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

The recombinant pebp-2 or part thereof may be expressed as a fusion protein. The fusion proteins formed according to this aspect of the present invention may be isolated as inclusion bodies within the host cell or as a secreted product from host cells.

It will be understood that the recombinant pebp-2 or part thereof including fragments so formed may be isolated, preferably following disruption of the host cell, by conventional methods of polypeptide purification well known to those skilled in the art, utilising techniques such as ion-exchange chromatography, size-exclusion chromatography, affinity chromatography, reversed-phase high performance liquid chromatography and/or if necessary further purification processes. The recombinant MAP kinase pathway regulation factor may be isolated as a fusion protein or cleaved from its fusion partner using conventional methods well known to those in the art.

In another aspect of the present invention there is provided an amino acid sequence encoding a pebp-2 or part thereof having a sequence according to Figure 1 (SEQ ID NO:2) or part thereof, or an analogue, variant, mutant or functional equivalent thereof. In a preferred aspect of the present invention, there is provided an amino acid sequence encoding a pebp-2 having a molecular weight of approximately 21 kDa and having an isoelectric point of approximately 8.43, or an analogue, variant, mutant or functional equivalent thereof. Preferably the pebp-2 has an amino acid sequence according to Figure 11 (SEQ ID NO:6).

In another preferred aspect of the invention there is provided an amino acid sequence encoding a pebp-2 having a molecular weight of approximately 20 kDa and having an isoelectric point of approximately 8.77, or an analogue, variant, mutant or functional equivalent thereof. Preferably the pebp-2 has an amino acid sequence according to Figure 10 (SEQ ID NO:4).

More preferably, the amino acid sequence is according to Figure 1 (SEQ ID NO:2), or an analogue, variant, mutant or functional equivalent thereof.

The full-length mouse pebp-2 sequence encodes a protein of 187 amino acids with a Mr of 21 ,191 and pi of 8.43. As a consequence of alternative splicing, the shorter pebp-2 mRNA encodes a protein of 173 amino acids with a Mr of 19,861 and pi of 8.77. Mouse pebp-2 encodes a putative PE binding sequence between amino acids 64-87.

Mouse pebp-2 also contains motifs for potential protein kinase C (amino acid numbers 71-73, 135-137, 181-183) and casein kinase II phosphorylation sites (amino acids 9-12, 24-27, 26-29, 65-68), a ρat4 type and a pat7 type nuclear localization signal (amino acids 77-80 and 74-81 respectively), one potential N- linked glycosylation site (amino acid number 136-139) and several sequence regions consistent with putative N-myristolylation sites (amino acids 53-58, 90- 95, 96-101 , 157-162).

Like the nucleic acid sequences described above, the amino acid sequences may be obtained from any sources that will express the pebp-2 or part thereof. The description above is referred to here and incorporates those sources described. In another aspect of the present invention there is provided a pebp-2 or part thereof encoded by a nucleic acid sequence or amino acid sequence according to Figure 1 (SEQ ID NO:1) or (SEQ ID NO:2) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

In a preferred aspect of the present invention, there is provided a pebp-2 having a molecular weight of approximately 21 kDa and having an isoelectric point of approximately 8.43, or an analogue, variant, mutant or functional equivalent thereof. Preferably the pebp-2 has an amino acid sequence according to Figure 11 (SEQ ID NO:6).

In another preferred aspect of the invention there is provided a pebp-2 having a molecular weight of approximately 20 kDa and having an isoelectric point of approximately 8.77, or an analogue, vaπant, mutant or functional equivalent thereof. Preferably the pebp-2 has an amino acid sequence according to Figure 10 (SEQ ID NO:4).

Preferably the pebp-2 or part thereof is encoded by the amino acid sequence or the nucleic acid sequence which encodes the amino acid sequence according to Figure 1 (SEQ ID NO:2) or part thereof or an analogue, variant, mutant or functional equivalent thereof.

The present invention also includes within its scope precursor forms of polypeptides encoded by the pebp-2 and functionally active fragments (peptides) of polypeptides encoded by the pebp-2. Such fragments may have enhanced or diminished activity and/or may expand or limit the range of cells responsive to its activity. They may find useful applications in areas such as, but not limited to spermiogenesis, post-testicular sperm maturation, MAP kinase pathway regulation, and neurostimulatory activity and neuronal functions, and fertility. It will be understood that the pebp-2 or parts thereof and analogues, variants, mutants or functional equivalents thereof described in the present invention may be purified by any of the methods described above.

In another aspect of the present invention, there is provided an composition comprising a pebp-2 or part thereof encoded by a nucleic acid sequence or amino acid sequence according to Figure 1 (SEQ ID NO:1) or (SEQ ID NO:2) or part thereof, or an analogue, variant, mutant or functional equivalent thereof and a carrier.

In another aspect of the present invention, there is provided an composition comprising peptide fragments, prepared by solid phase or solution methods or by recombinant DNA/genetic engineering procedures using well known procedures, of pebp-2 encoded by a nucleic acid sequence or amino acid sequence according to Figure 1 (SEQ ID NO:1) or (SEQ ID NO:2) or part thereof, or an analogue, variant, mutant or functional equivalent thereof and a carrier.

The compositions of the present invention may be pharmaceutical compositions and also include other pharmaceutically acceptable excipients, buffers, salts, preservatives, additives and the like depending on the intent. For instance, for topical or transdermal administration, ointments, aqueous buffers, micro capsules, creams, lotions or aerosol sprays may be used. For parenteral administration sterile solutions containing saline and glucose may be used.

In a preferred aspect of the present invention, there is provided a composition comprising a pebp-2 having a molecular weight of approximately 21 kDa and having an isoelectric point of approximately 8.43 or an analogue, variant, mutant or functional equivalent thereof and a carrier. Preferably the pebp-2 has an amino acid sequence according to Figure 11 (SEQ ID NO:6).

More preferably, the nucleic acid sequence is according to Figure 1 (SEQ ID NO:1), or an analogue, variant, mutant or functional equivalent thereof. In yet another preferred aspect of the present invention, there is provided a composition comprising a pebp-2 having a molecular weight of approximately 20 kDa and having an isoelectric point of approximately 8.77 or an analogue, variant, mutant or functional equivalent thereof and a carrier. Preferably the pebp-2 has an amino acid sequence according to Figure 10 (SEQ ID NO:4).

More preferably, the nucleic acid sequence is according to Figure 1 (SEQ ID NO:1), or an analogue, variant, mutant or functional equivalent thereof.

The carrier may be any physiologically acceptable carrier that stabilises the pebp-2 and/or facilitates delivery of the pebp-2 or part thereof to a patient in need thereof. However, the carrier is not restricted to these uses.

In another aspect of the present invention there is provided a polyclonal or monoclonal antibody reactive against a polypeptide or part thereof encoded by a nucleic acid sequence according to Figure 1 (SEQ ID NO:1 ), or an analogue, variant, mutant or functional equivalent thereof. Preferably the polypeptide is pebp-2 or part thereof.

In a further preferred aspect of the present invention there is provided a polyclonal or monoclonal antibody reactive against a pebp-2 having a molecular weight of approximately 21 kDa and having an isoelectric point of approximately 8.43, an analogue, variant, mutant or functional equivalent thereof. Preferably the amino acid sequence of the pebp-2 is according to Figure 11 (SEQ ID NO:6).

In a further preferred aspect of the present invention there is provided a polyclonal or monoclonal antibody against pebp-2 having a molecular weight of approximately 20 kDa and having an isoelectric point of approximately 8.77 an analogue, variant or functional equivalent thereof. Preferably the amino acid sequence of the pebp-2 is according to Figure 10 (SEQ ID NO:4).

In a further preferred aspect of the present invention there is provided a polyclonal or monoclonal antibody against synthetic peptides related to pebp-2 variants preferably having molecular weights of approximately 21 kDa or 20 kDa and having isoelectric points of approximately 8.43 or approximately 8.77 respectively, or an analogue, variant or functional equivalent thereof.

It is understood that the term "antibody" includes whole immunoglobulin molecules of any isotype, as well as mixed isotypes. The term also includes antibody fragments which are functionally similar to whole immunoglobulin molecules. Fragments may be generated as a result of treatment of antibody molecules with proteases such as papain and trypsin. Examples of such fragments include but are not limited to Fab fragments and F(ab')2 fragments.

A substantially purified polypeptide either recombinant, encoded by an amino acid sequence or naturally occurring, as isolated by methods available to the skilled addressee and as described above may be used in the production of polyclonal and monoclonal antibodies which recognise and/or bind to the polypeptide. These are considered within the scope of the present invention.

Various procedures are known in the art which may be used for the production of antibodies to epitopes of the pebp-2. Various host animals may be used in the production of these antibodies following immunisation with the polypeptide including but not restricted to rabbits, mice, goats etc. Adjuvants may be used to increase the immunological response, depending on the host species, and may include but are not restπcted to Freund's (complete and incomplete). Monoclonal antibodies may be prepared by using techniques which enable the continuous production of antibody molecules by cell lines in vitro. These may include, but are not limited to, the hybridoma technique (Kohler and Milstein, Nature 256, 495, (1975)). Antibodies to the polypeptide may find use in the detection of mature and precursor forms of the factor in various tissues, body fluids and cell lines, for example in screening assays for different forms of spermatocytes, and in the affinity purification of the pebp-2.

In yet another aspect of the present invention, there is provided a method of diagnosing a pebp-2 associated activity, said method comprising: detecting the presence or absence of pebp-2 or parts thereof as herein described; and determining the effect of the presence or absence of pebp-2 on said activity.

Pebp-2 has been associated with a number of activities, as listed below and the presence or absence of pebp-2 has been found to affect these activities.

Detection of the pebp-2 may be conducted by methods known to the skilled addressee once having a sample of the nucleic acid or protein. These methods include (but are not limited to) (i) measurement of pebp-2 expression such as in Northern and Western blots to measure mRNA or protein expression, or (ii) measurement of the presence of the protein by use antibodies (polyclonal or monoclonal, as described above) in immunochemical testing.

In another aspect there is provided a method of diagnosing a condition associated with pebp-2, said method comprising detecting the presence or absence of pebp-2 or a part thereof as herein descπbed.

Detecting includes measurement of the protein per se as well as fragments of the protein by any of the methods descπbed above it extends to measurement of expression since some conditions such as infertility may result from poor expression of the pebp-2 gene. Hence the diagnosis of conditions associated with pebp-2 includes monitoring regulation of the pebp-2 expression to detect abnormalities. Conditions include those conditions discussed below.

The detection and diagnosis of conditions associated with pebp-2 may be provided in kit form comprising for instance antibodies to pebp-2 for screening in a immunochemical test.

In a further aspect of the present invention there is provided a method of modulating pebp-2 associated activities said method comprising administering an effective amount of pebp-2 according to the present invention. The term "pebp-2 associated activity" as used herein means those activities which are affected by the presence or absence of pebp-2. These activities may include spermatogenesis, regulation of the MAP kinase pathway, and neuronal activities including neurostimulatory activities.

Accordingly, the present invention provides a method of regulating or modulating spermatogenesis, said method including administering an effective amount of pebp-2 as herein described to a patient in need. Such a method would be useful as a means of controlling fertility where agonists or antagonists of pebp-2 are administered to increase or decrease spermatogenesis.

This method would also be effective for those conditions where infertility is due to an inability to produce functional spermatozoa by virtue of an absence of the pebp-2. In these cases an effective amount sufficient to induce spermatogenesis could be administered.

For decreasing the spermatogenesis this may involve the administration of antibodies or antagonists to the pebp-2 as described above or it may involve inducing mutations in the nucleic acid encoding the spermatogenesis factor so that the pebp-2 is no longer active.

The term "effective amount" as used herein in methods of use means an amount sufficient to elicit a statistically significant response preferably at a 95% confidence level (p<0.05 that the effect is due to chance alone).

The pebp-2 of the present invention, including the naturally-derived mature or precursor forms of pebp-2, and recombinant pebp-2 protein isolated as either the mature or precursor form with or without its fusion partner (and variants, mutants, analogues, fragments and derivatives thereof) or antibodies (monoclonal or polyclonal) to the factor may be utilised (but not restricted to) in the following uses:

- in the growth and/or proliferation of mammalian spermatogenic cells either alone or in combination with other factors; - in the enhancement of spermiogenesis or sperm function;

- in the reduction of spermiogenesis or sperm function;

- in the prevention, amelioration or treatment of conditions associated with spermiogenesis, either alone or in combination with other factors; - in the prevention, treatment or amelioration of reproductive diseases including infertility;

- in the diagnosis of aberrations to the normal spermatogenesis process within a mammal;

- in the inhibition of cancer progression; and - in the detection, prevention, treatment or amelioration of neurological or neurodegenerative diseases associated with pebp2 functions.

The nucleic acid sequence of pebp-2 may also be utilised in the process of gene therapy. Nucleic acid sequences such as descπbed above may be introduced into an embryo either as a vector or nucleic acid sequence. Sperm cells (mature or immature) may also be subjected to the nucleic acid or amino acid sequences as described.

The present invention also provides gene therapy approaches to deliver pebp-2 and antisense nucleic acid molecules. The gene therapy approaches of the present invention may be used to treat any disorder in humans or other animals for which regulating the pebp-2 levels are beneficial. These approaches may be used alone or in combination therapy with other drugs.

One method of gene therapy is based on the artificial replacement or augmentation of a gene which is absent or defective. Specifically, one or more copies of a normal gene coding for a pebp-2, or a functionally equivalent fragment thereof, may be inserted into the appropriate cells within a patient. The insertion may be effected using vectors that include, but are not limited to adenovirus, adeno-associated virus, and retrovirus vectors in addition to other particles that introduce DNA into cells such as liposomes.

Additional methods that may be utilised to increase the overall level of pebp-2 expression include the introduction into a patient of cells expressing the factor. Preferably the cells are autologous cells, and are introduced into a patient at positions and in numbers that are sufficient to ameliorate the symptoms. Such cells may be recombinant or nonrecombinant.

The expression of the pebp-2 peptide sequences is controlled by the appropriate gene regulatory sequences to allow such expression in the necessary cell types. Such cell-based gene therapy techniques are well known to those skilled in the art, see for example United States Patent No. 5,399,349 incorporated herein by reference in its entirety.

When the cells to be administered are non-autologous cells, they can be administered using well known techniques that prevent a host immune response against the introduced cells from developing. For example, the cells may be introduced in an encapsulated form which, while allowing for an exchange of components with the immediate extracellular environment, does not allow the introduced cells to be recognised by the host immune system.

Gene therapy may also be utilised to down regulate the expression of pebp-2 by the host cells. One such approach is to use antisense methods whereby cells in which the expression of the pebp-2 is to be down regulated are genetically altered to synthesise nucleic molecules (DNA or RNA). These nucleic acid molecules have sequences which are at least partly complementary to the gene or message RNA responsible for the expression of the pebp-2. The gene encoding the antisense molecule can be introduced into host cells by one of the methods referred to above, or any other appropriate method. The gene encoding the antisense molecule is transcribed by the cell to produce a RNA molecule which may either bind to the gene encoding the MAP kinase regulation factor (thereby inhibiting transcription), or by binding to the mRNA molecule which is transcribed from the pebp-2 gene (thereby inhibiting translation).

The present invention will now be more fully described with reference to the following examples. It should be understood, however, that the description

Substitute Sheet (Rule 26) RO/AU following is illustrative only and should not be taken in any way as a restriction on the generality of the invention described above.

EXAMPLES

Experimental Procedures (a) Animals and reagents

Balb/c mice, male Sprague-Dawley rats and virgin adult New Zealand White female rabbits were obtained from the Monash University Central Animal House, and maintained under standardised conditions of lighting (12 h light: 12 h dark) and nutrition (food and water ad libitim) throughout the experimental period. Studies were performed in accordance with the NH&MRC Guidelines on Ethics in Animal Experimentation, and were approved by the Monash Medical Centre Animal Experimentation Ethics Committee. Mice were killed by cervical dislocation and rats in a C0₂ chamber. Tissues were either snap frozen for mRNA collection or emersion fixed in Bouin's fixative and processed into paraffin blocks as described previously (O'Bryan et al, 2000a). For immunofluorescence studies, sperm were collected from the cauda epididymis and prepared as descπbed previously (O'Bryan et al, 2000d).

Unless stated otherwise reagents were obtained from Sigma Chemical Co (St. Louis , MO, USA). Enzymes for molecular biology were obtained from New England Biolabs (Beverly, MA, U.S.A.) and oligonucleotide primers were obtained from Geneworks (Adelaide, Australia). Reagents for in situ hybridisation were obtained from Roche (Mannheim, Germany) and for library screening were from Pharmacia Amersham (Uppsala, Sweden).

B-raf and MEK antiserum were from Santa Cruz and A-raf and raf-1 antiserum were from Transduction Laboratories.

(b) Cloning of mouse FS35 (pebp-2) During the process of screening a rat testis expression library for novel testis transcripts involved in spermiogenesis using an antiserum raised against rat spermatid components (Kim et al, 1995) a previously unreported sequence was obtained and designated FS35 (data not shown). Rat FS35 corresponded to a partial sequence of 394bp that at the time of isolation shared no homology with any previously reported sequence in any of the NCBI/EMBL or expression sequence tag (EST) databases.

Because of significant and well known difficulties in obtaining a rat testis expression library of sufficient quality, the mouse orthologue was sort using a library screening approach. The mouse orthologue of rat FS35 was isolated from a mouse testis expression library (Stratagene, La Jolla, CA, U.S.A.) using standard methods (Sambrook et al, 1989). Briefly, purified rat FS35 insert was labelled with α³²P-dCTP using random priming under standard conditions. Lytic plaque DNA were lifted onto duplicate nitrocellulose membranes (Hybond-C extra, Pharmacia Amersham) and probed with the labelled FS35 cDNA. Membranes were washed to a maximum stringency of 0.1 X SSC / 0.1 % SDS at 60°C and exposed to X-OMAT x-ray film (Kodak Eastman). Duplicate positive plaques were cored and re-plated until homogeneity was achieved. Positive inserts in pBluescript phagmid SK^" were recovered by in vivo excision using the ExAssist/SolR system as recommended by the manufacturer. Additional 5' sequence was obtained using a 5' rapid amplification of cDNA ends (RACE) method as outlined by Ansari-Lari et al (1996). Briefly, total RNA was prepared using the method of Chomocznski and Sacchi (1987) and first strand cDNA synthesis performed using random hexamers in the presence of RNAs in using Superscript II reverse transcriptase (Life Technologies/Gibco, Gaithersburg, MD, U.S.A.) as recommended by the manufacturer. Residual RNA was degraded using RNase ONE (Promega Corporation, Madison, Wl, U.S.A.) and the cDNA purified using a QIAquick PCR Purification system (QIAGEN; Hilden, Germany). The anchor oligonucleotide T3LA

(TTTAGTGAGGGTTAATAAGCGGCCGCGTCGTGACTGGGAGCGGC) (SEQ ID NO:7) was modified to contain 5' phosphate groups and blocked 3' OH groups (Integrated DNA Technologies Inc., Coralville, IA, USA). Ligation of the anchor to the first-strand cDNA was performed in a total reaction volume of 50ml and contained 10ml of cDNA / 250pmol of T3LA / 56mM Tris-HCI (pH8.0) / 10mM MgCI₂ / 1 mM hexamine cobalt chloride / 20mm ATP / 25% (wt/vol) PEG 8000 / 10mg/ml bovine serum albumin / 20U of T4 RNA ligase at 37°C for 2h. Following enzyme inactivation at 65°C for 15min, samples were desalted and excess anchor removed using the QIAquick PCR purification system (QIAGEN).

Substitute Sheet Rule 26) RO/AU The 5' end of the mouse FS35 orthologue was amplified by PCR using an anchor specific oligonucleotide primer (T3) as the forward primer (GCGGCCGCTTATTAACCCTCACTAAA) (SEQ ID NO:8) and a mouse FS35 specific primer 3R (GTGTACAGGGAATGGCACCATTTTC) (SEQ ID NO: 9) as the reverse primer using pfu polymerase (Life Technologies / Gibco) under standard conditions. Cycling conditions were as follows: denaturation 94°C for 15sec, annealing at 65°C for 45°C and extension at 72°C for 25 cycles followed by a final extension of 15min. In order to increase the specificity of amplification, a second round of amplification was carried out using primers T3 as the forward primer and the 5' nested mouse specific primer 2R (AAACCCGTGTACAGGGAATGGCAC) (SEQ ID NO: 10) as the reverse primer under the same conditions. Following gel purification using the Wizard PCR purification system (Promega Corporation), PCR products were cloned into the pGEM-T vector (Promega Corporation) as recommended by the manufacturer. All sequences were obtained by direct sequencing using the Big Dye terminator method at the Monash Institute of Reproduction and Development - Prince Henry's Joint Sequencing Facility (Monash Medical Centre, Clayton, Australia). In order to assure the veracity of sequences, both DNA strands and inserts from multiple colonies of each plasmid were sequenced. Following database searches and analyses, significant homology between the mouse FS35 cDNA sequences and the nucleotide sequences of putative phosphatidylethanolamine binding proteins (PEBP) family members from several species was realised. As such, mouse FS35 was re-designated pebp-2. In order to avoid confusion FS35 will be subsequently be referred to as pebp-2.

(c) Mouse pebp-2 alternative splice forms

The existence of alternatively spliced mouse pebp-2 was confirmed using a RT- PCR approach. Adult mouse testis total RNA was purified and reverse- transcribed to cDNA using Superscript II reverse transcriptase. The equivalent of 0.25μg of RNA was used for the PCR amplification of mouse pebp-2 cDNA products using the specific primers, GAGCAGCCCCAGCACCTA (SEQ ID NO:11) and CAGCCAGACATAGCGATGGA (SEQ ID NO: 12) and taq polymerase (Pharmacia Amersham) under standard conditions. Primers were designed to span the region alternative splicing. Amplification of both the short and long forms of mouse pebp-2 would result in amplicons of 272 and 314bp respectively. Cycling conditions were 35 cycles of denaturation at 94°C for 30 sec, followed by annealing at 58°C for 30 sec, followed by extension at 72°C for 1 min. Cycling was followed by a final extension of 5 min at 72°C. Products of approximately 280 and 310bp product were gel purified using a QIAGEN Gel Extraction Kit and subcloned into pCR-Script Amp SK(+) as outlined by the manufacturer (Stratagene) and designated as the P2S and P2L clones.

(d) Sequence analyses The Blast-N and Blast-P programs were used to compare the nucleotide and deduced amino acid sequences obtained for clones with the information stored in the genomic and protein sequence databases (Althschul et al., 1990). Signal peptide prediction was carried out using the SignalP program (Nielsen et al, 1997) and the predicted pi and molecular weight were calculated using the Compute pl/MW program (Bjellqvist et al, 1993, Bjellqvist et al, 1994). Potential post-translational modifications and intracellular sorting predictions were calculated using Prosite set of analyses tools (expasy.hcuge.ch/cgi-bin).

(e) Northern blotting The developmental expression of pebp-2 within mouse and rat testes and in adult mouse tissues was determined by Northern blotting. Total RNA was extracted from day 1 , 15, 25, 35 and 90 day rat testes, day 0, 14, 18, 22, 30 and 36 day mouse testes and from adult mouse brain, liver, spleen, kidney, heart, stomach, large intestine and small intestine using the method of Chomcznski and Sacchi (1987). Approximately 20μg RNA at each age was size fractionated by electrophoresis on an 1% agarose formaldehyde gel and transferred to Nytran⁺ membrane (Schleicher & Schuell, Keene, NH) in 10X SSC. RNA was fixed onto the membrane by baking at 80°C for 2h. Pre-hybridisation was carried out in 50% deionised formamide / 5X Denhardt's buffer / 3% dextran sulfate (w/v) / 5X SSPE / 1% SDS (w/v) / 100μg denatured Herring sperm DNA (Promega Corporation) at 42°C for 4h. Hybridisation was performed overnight at 42°C with α³²P labelled cDNA corresponding to the rat FS35 insert for rat RNA or with α³²P labelled P2 insert (see below) for mouse RNA in pre- hybridisation solution containing 1x10⁶ cpm/ml. Membranes were washed to a maximum stringency of 0.1 X SSC / 0.1 % SDS at 65°C prior to autoradiography.

A mouse pebp-2 specific cDNA containing plasmid (designated plasmid P2) was prepared from the 5A clone of mouse pebp-2 obtained from the library screening (4A) by restriction enzyme digestion with AlwNI and Asel. The resultant cDNA, corresponded to nucleotides 1030-1274 (Fig. 1), was gel purified and subcloned into pPCRscript SK(+). The pebp-2 specific plasmid was designated clone P2. - this clone may be used to confirm the developmental expression of mouse pebp-2 compared to that observed for rat pebp-2 mRNA.

(f) In situ hybridisation

The cellular expression of pebp-2 and the related transcript pebp-1 , within the adult mouse testis was determined using digoxigenin (DIG)-labelled cRNA probes in an in situ hybridisation protocol described elsewhere (O'Bryan et al, 1998). Because of the high degree of nucleotide homology between these two transcripts in the protein-coding region, transcript specific probes were prepared based on the extensive differences in the 3' untranslated regions, pebp-2 mRNA was detected using cRNA probes generated using the P2 plasmid and pebp-1 mRNA was detected using cRNA probes generated from the plasmid P1. The pebp-1 specific plasmid, P1 , was prepared by RT-PCR from adult mouse testis using the primers PEBPIf (TGTGAATGGTTGAACAAAGA) (SEQ ID NO: 13) as the forward primer and PEBPI r (AGGATCAACACACTCGGCAG) (SEQ ID NO:14) as the reverse primer using a touch-down PCR protocol as defined previously (O'Bryan et al, 2000b). A pebp-1 specific cDNA of 241 bp, corresponding to nucleotides 1004-1245 (Fig. 1) was amplified and subcloned into pCRScript Amp SK(+). Anti-sense and sense cRNA probes were prepared by digestion with either Notl or HINDIII and incubation in the presence of either T7 or T3 RNA polymerase as appropriate for the restriction enzyme employed. Prior to hybridisation mouse tissues were permeabilized with proteinase K: 10μg/ml for pebp-1 mRNA and 20μg/ml for pebp-2 mRNA. Sections were probed for pebp-2 mRNA by hybridised overnight at 50°C in the presence of 200ng/ml of cRNA. Sections were probed for pebp-1 mRNA by hybridised overnight at 50°C in the presence of 100ng/ml of cRNA. Non-specifically bound probe was removed by a post-hybridisation wash in 20mg/ml RNase A and washing to a maximum stringency of 0.1X SSC. For the purposes of determining the stage of germ cell development, some sections were counterstained with Mayer's haematoxylin and classified according to the criteria outlined by Russell et al (1990). Sections were examined using a

DMR/HSC microscope (Leica Microsystems, Wetzlar, Germany), captured using a MPS60 digital camera and assembled using Coreldraw (version 8,

Corel Corporation Ltd., Dublin, Ireland).

(g) Peptide synthesis and antibody production

A synthetic peptide was produced based on differences between the NH₂ terminus of pebp-2 and other published PEBPs. The peptide and its corresponding antisera were designated DH4 (TGPLSLHEVDEQ) (SEQ ID NO: 15) and had 66% sequence homology between pebp-2 and its closest mouse homologue. Peptides were produced using solid-phase Fmoc-based protocols and purified and characterised as described elsewhere (Thompson et al, 1995, O'Bryan et al, 2000). Peptides were conjugated onto keyhole limpet haemocyanine and immunised into rabbits as outlined previously (O'Bryan et al, 2000c). The antigenic response of rabbits was monitored using an ELISA protocol on synthetic peptide coated plates as outlined previously (Keah et al, 2000b).

(h) Immunohistochemistry Pebp-2 protein expression within adult mouse testis sections was determined using an avidin-biotin amplified immunohistochemical method as described previously (O'Bryan et al, 2000c) with the exception that signal was further amplified using DAB Enhancer (Zymed, San Francisco, CA, U.S.A.). The specificity of immunohistochemical staining was assured by replacing the primary antibody with antiserum which had been pre-absorbed with a 10 fold excess (wt:wt) of the immunising peptide overnight at 4°C prior to histochemistry. (i) SDS-PAGE, Western immunoblotting and Immunoprecipitation Proteins were extracted from adult mouse testes tissues using homogenisation in 0.1 M sodium phosphate / 1 % NP40 / 0.5% Tween 20 / 0.1% SDS in the presence of Complete protease inhibitor cocktail (Roche). Following 30 min incubation on ice, particulate material was removed by centrifugation. The protein concentration of the resultant supernatant was determined using the DC Protein Assay Kit (BioRad, Hercules, CA, U.S.A.) as outlined by the manufacturer. Proteins were size fractionated on 15% SDS-PAGE gels under reducing conditions and transferred to a PVDF membrane (Millipore). pebp-2 specific bands and their approximate size were determined using an enhanced chemiluminesce method as described previously (O'Bryan et al, 2000c) and using the ECL plus system (Pharmacia Amersham).

The ability of pebp-2 to bind to A-raf, B-raf, raf-1 and MEK1 within the testis was investigated using recipricol immunoprecipitations and Western immunoblotting using the DH4 antiserum and either anti-A-raf (R14320, Transduction

Laboratories), anti-B-raf (C-19, Santa Cruz), anti-raf-1 (R19120, Transduction

Laboratories) or anti-MEK1 (C-18 and H-8 separately, Santa Cruz) as described above with the exception that B-raf and MEK1 binding to pebp-2 was fractionated by 12.5% SDS-PAGE. Binding to B-raf and MEK1 were specifically investigated because of the identified sequence homology between pebp-2 and

RKIP and because previous mRNA analyses had shown that B-raf was the major raf species present at the time of pebp-2 expresssion in the testis

(Wadewitz et al, 1993).

Example 1 Cloning and sequencing of FS35/pebp-2 cDNA

The mouse pepb-2 cDNA sequence was obtained by screening a mouse testis expression library with the orthologous rat FS35 insert. From approximately 2.5x10⁶ clones screened, 78 clones were positive for mouse pebp-2 (representing a frequency of -0.03% of pebp-2 transcripts within the testis as a whole), 6 of which were subsequently purified to homogeneity and sequenced. The longest clone (E1) contained an insert of 1243 bp. With the exception of one clone (5A), which contained an in-frame deletion of 42 bp in the putative coding region, all clones contained overlapping and identical sequences. Based on the determined nucleotide and the predicted protein sequence similarity to previously published data for pebps, the derived murine FS35 was re-named pebp-2. An additional 3 nucleotides upstream were identified using 5' RACE

(Fig. 1). Based on similar methods, the clone 5A was found to encode a truncated pebp-2 that we presumed to represent an alternatively spliced vaπant

(Fig. 1). The existence of this truncated mouse pebp-2 mRNA in vivo was confirmed by the RT-PCR amplification and sequencing of two amplicons varying in size by 42 bp in the region of predicted alternative splicing (Figure 2). The sequence and testicular expression of mouse pebp-2 was further substantiated by the existence of EST database entries with 100% identity to mouse pebp-2. Examples of entries with identity to mouse pebp-2 include AI326308 and AA065517.

Subsequent to the completion of cloning mouse pebp-2, an additional 847 bp of the rat pebp-2 cDNA sequence was obtained using 5' RACE. Our analyses revealed an overall homology between the rat and mouse pebp-2 sequence of 83.5% at the nucleotide level and 91.2% at the predicted protein level (Fig. 2). The sequences of the mouse and rat pebp-2 cDNAs were more highly homologous to each other than to other previously reported pebp-like sequences. As such, the two sequences reported herein appear to represent inter-species orthologues, whilst the other pebp-like sequences already contained within the public DNA databases represent paralogues, since they exhibit significantly lower sequence homology (Fig. 2). The published sequence with highest homology to the mouse pebp-2 sequence was human PBP (Tohdoh et al, 1995), which shared 29.3% identity at the nucleotide level and 79% identity at the protein level (Fig. 2, sequence H). Comparison of the rat pebp-2 sequence with the databases also indicates that a third member of the pebp family exists (Fig. 2 - accession # S18358 in rats and #AAB32876 in humans). This pebp (which for consistency in nomenclature has been referred to as pebp-3) shared 82% and 83% amino acid identity with mouse and rat pebp-2 respectively; and 85% and 83% identity with mouse and rat pebp-1 / HCNP-precursor / RKIP respectively (Fig. 2). Further, the rat pebp- 3 sequence is most homologous to the bovine brain pebp sequences originally reported by Schoentagen et al (1987). These analyses thus suggest that pebp- 2 is a previously unidentified member of the pebp family. In addition, our results suggest rats and mice contain at least two, and probably three, pebp family members.

The full-length mouse pebp-2 sequence is predicted to encode a protein of 187 amino acids with a Mr of 21 ,191 and pi of 8.43. As a consequence of alternative splicing, the shorter pebp-2 mRNA is predicted to encode a protein of 173 amino acids with a Mr of 19,861 and pi of 8.77. Mouse pebp-2 is predicted to encode a putative PE binding sequence between amino acids 64-87. Further, alternative splicing to produce the shorter pebp-2 vaπant would remove part of the predicted raf-1 binding region based on the mapping of pebp-1 / RKIP by Yeung et al (2000).

Mouse pebp-2 also contains motifs for potential protein kinase C (amino acid numbers 71-73, 135-137, 181-183) and casein kinase II phosphorylation sites (amino acids 9-12, 24-27, 26-29, 65-68), a pat4 type and a pat7 type nuclear localization signal (amino acids 77-80 and 74-81 respectively), one potential N- linked glycosylation site (amino acid number 136-139) and several sequence regions consistent with putative N-myristolylation sites (amino acids 53-58, 90- 95, 96-101 , 157-162) (Figure 4). Because of their distal location from the carboxy-terminus, these putative myristolylation sites are unlikely to be utilised. On the basis of the SDS-PAGE/Westem immunoblot analyses, and by analogy with other pebp's, the putative glycosylation site also does not appear to be post-translationally modified. Further, pebp-2 does not contain known targeting motifs for translocation into the endoplasmic reticulum, mitochondria, peroxisomes or vesicles of the secretory system. Since pebp-2 lacks a classical leader sequence at the NH₂-terminus as such, pebp-2 cDNA is predicted to encode a soluble intracellular protein, with the potential to exist in both the cytoplasm and nucleus and with the ability to bind to PE in cell membranes. Example 2 The mRNA expression of pebp family members in the mouse

Northern blotting of rat testis RNA indicated a up-regulation of a 1.6kb transcript, from undetectable levels in new born and 15 day old rats, to easily detectable level in 25 day old rat testes. A further increase was observed in 35 day old testes. A similar level of pebp-2 mRNA expression was seen in 35 day old testes and adult rat testes (Fig. 5). This pattern of expression is consistent with the commencement of spermiogenesis and the appearance of round spermatids (de Kretser and Kerr, 1994).

The cellular expression pattern of pebp-2 mRNA within the mouse testis was determined by in situ hybridisation. Hybridisation using a sense cRNA probe did not result in staining of any mouse testicular cells, thus indicating the specificity of the antisense cRNA hybridisation (Fig. 6). Within the mouse testis, pebp-2 mRNA was confined solely to the germ cells and expressed in a stage specific manner (Fig. 6B and D). Under the in situ hybridisation conditions described here Sertoli cells, spermatogonia, peritubular cells, Leydig cells, testicular macrophages and blood vessels did not contain detectable pebp-2 mRNA. pebp-2 mRNA was first seen within stage IX pachytene spermatocytes

(Fig. 6D). Maximal levels of expression were seen within stage X and XI pachytene spermatocytes (Fig. 6B and D), after which the levels of expression decreased in haploid germ cells and was no longer visible after step 5 of spermatid development (Fig. 6B and D).

Northern blotting analysis of various tissues revealed that the dominant tissue site for expression of pebp-2 mRNA in the mouse was the testis (Fig. 6A), whilst long exposures revealed a low level of mRNA within the brain. Liver, spleen, kidney, heart, stomach, large intestine, and small intestine were negative for pebp-2 mRNA using this technique. Low levels of both the long and short variants of pebp-2 mRNA could, however, be detected in all of these tissues by RT-PCR Figure 2 . Within the developing testis, pebp-2 mRNA was first seen in low levels within day 14 testes, consistent with the appearance of late pachytene spermatocytes. The level of pebp-2 mRNA continued to increase with the appearance of round and elongating spermatids and did not reach maximal levels until day 36 (Fig. 6A). The developmental expression of pebp-2 mRNA was confirmed by in situ hybridization. Hybridization using a sense cRNA probe did not result in any staining of mouse testicular cells, thus indicating the specificity of the antisense cRNA hybridization (Fig. 6B). Within the mouse testis pebp-2 mRNA was confined solely to the germ cells and expressed in a stage specific manner (Fig. 6B and D). Pebp-2 mRNA was first seen within stage IX pachytene spermatocytes. Maximal expression was seen within stage X and XI pachytene and diplotene spermatocytes, after which the levels of expression decreased in haploid germ cells and was not visible after step 5 of spermatid development (Fig. 6B and D). The expression of the pebp-2 mRNA within the mouse testis was less widespread and distinctly different from that of pebp-1 (Fig. 6C and D). Hybridization of mouse testis sections using a pebp-1 sense cRNA probe did not result in any staining of mouse testicular cells (Fig. 6C). Within the testis, pebp-1 mRNA was confined solely to germ cells and expressed in a stage specific manner. Pebp-1 mRNA was first seen in stage VII pachytene spermatocytes. Pebp-1 mRNA continued to be expressed in increasing levels throughout meiosis although maximal levels of expression were not seen until steps 7-8 of spermatid development, after which the levels declined and were no longer visible in elongating spermatids after step 15 of spermiogenesis (Fig. 6C and D).

Example 3

The expression of pebp-2 protein in the mouse testis and on spermatozoa

(a) The expression of pebp-2 protein in the mouse testis and on spermatozoa Immunoprecipitation Western blots of mouse testis extract using a peptide- specific antisera (DH4) showed that pepb-2 exists within the testis as -21 and ~20 kDa proteins, consistent with the Mr predicted for the long and short variants (Fig. 7A). As with the library screening results, the long variant of pebp-2 appeared to be the dominant form in the testis. Within the adult mouse testis, pebp-2 was first seen within late pachytene spermatocytes (stage X) and was seen throughout the process of spermiogenesis (Fig. 7B). Within the epithelium, distinct rings of staining were seen suggestive of labelling of cell plasma membranes. This type of staining was most evident in round spermatids (Fig. 7D to E). Spermatogonia, early spermatocytes, Sertoli cells and cells within the intertubular space were not stained for pebp-2 protein. The specificity of the anti-peptide antiserum used for these immunohistochemical studies was indicated by a lack of staining when the primary antisera was pre- absorbed with a 10 fold excess of immunising peptide prior to immunohistochemistry (Fig. 7B). Within sperm isolated from the cauda epididymis, immunofluorescence for pebp-2 protein was seen as discrete patches along the mid- and principal-pieces of the tail, on the ventral post- acrosomal region of the sperm head and in approximately 50% of sperm as a thin line of immunofluorescence on the curved tip of dorsal region of the sperm head (Fig. 5B). Substitution of the DH4 antiserum with pre-immune serum did not result in any staining indicating DH4 staining specificity.

The expression of pebp-2 protein within spermatogenesis was consistent with the expression of pebp-2 mRNA. Unlike many mRNA/proteins involved in spermiogenesis (Schmidt et al, 1999), pebp-2 mRNA did not appear to undergo cytoplasmic storage and translational delay.

(b) Pebp-2 binding to A-raf, B-raf, raf-1 and MEK1

The ability of pebp-2 to binding to A-raf, B-raf, raf-1 and MEK1 was investigated using immunoprecipitations from testis homogenate initially using the DH4 antiserum to pull down pebp-2 and any associating proteins followed by separation on 12.5% SDS-PAGE and Western blot analysis using raf variant and MEK specific antiserum respectively (Fig. 8A). Western immunoblotting revealed a major B-raf band of 86 kDa with fainter bands visible at 82 kDa and 88 kDa (Fig. 8A), a raf-1 band at 75 kDa and a MEK1 band at 45 kDa consistent with the previously reported size of B-raf, raf-1 and MEK1 within the mouse testis (Vianney Barnier et al, 1995, Daum et al, 1994, Crews et al, 1992). An A- raf band was not detected under the conditions used.

The binding of B-raf, raf-1 and MEK1 to pebp-2 was confirmed and the ability of A-raf to bind to pebp-2 further investigated using reciprocal immunoprecipitations whereby the anti-A-raf, anti-B-raf, anti-raf-1 and anti- MEK1 antisera were separately used to pull-down A-raf, B-raf, raf-1 and MEK, respectively, potentially in association with pebp-2 (Figure 8A). Any bound pebp-2 was visualised following size fractionation on 15% SDS-PAGE, using the DH4 antiserum. A pebp-2 band was clearly visible at 21 kDa in all of the A- raf, B-raf, raf-1 and MEK1 immunoprecipitations. Of note, the intensity of the pebp-2 band in the A-raf precipitation band was considerably less intense than the bands visualized in the B-raf, raf-1 or MEK1 lanes, suggesting that within the testis only minimal amounts of A-raf are bound to pebp-2. This difference however, could be due to differences in antibody affinities. The binding of pebp- 2 to MEK1 was further confirmed using the H8 monoclonal antibody. Immunoprecipitation data suggested that only the longer form of pebp-2 was capable of binding either B-raf and MEK1 (Fig. 8B).

Example 4

The expression of B-raf protein in the mouse testis and on spermatozoa

B-raf protein was expressed exclusively within the elongating spermatid compartment of the adult mouse testis. Faint staining first became visible within the cytoplasm of step 2-3 elongating spermatids, but was dramatically up- regulated as spermiogenesis proceeded (Fig. 9C to D). Just prior to spermiation, B-raf immunostaining was clearly associated with the mid-pieces of elongating spermatid tails. A more precise localisation of B-raf protein to the mid-piece of the sperm tail was achieved using immunofluorescence microscopy on caput and caudal epididymal spermatozoa (Fig. 9E to F). At high magnification B-raf staining appeared as two parallel lines of fluorescence. A comparison of the protein staining with that of the previously published mRNA distribution (Wadewitz et al, 1993) indicates that B-raf protein undergoes significant translational delay. REFERENCES

Altschul, S.F, Gish,W., Miller, W., Myers,E.W. and Lipman.D.J. (1990) Basic local alignment search tool. J. Mol. Biol. 215, 403-410.

Ansari-Lari.M.A., Jones.S.N., Timms.K.M., and Gibbs.R.A. (1996) Improved ligation-anchored PCR strategy for identification of 5' ends of transcripts. BioTechniques 21 , 34-38.

Bjellqvist B, Basse B, Olsen E & Celis JE 1994 Reference points for comparison of two-dimensional maps of proteins from different human cell types defined in a pH scale where isoelectric points correlate with polypeptide compositions. Electrophoresis 15 529-539.

Bjellqvist B, Hughes GJ, Pasquali C, Paquet N, Ravier F, Snachez JC, Frutiger S & Hochstrasser DF 1993 The focusing position of polypeptides in immobilized pH gradients can be predicted from their amino acid sequences. Electrophoresis 14 1023-1031.

Chomozcynski.P. and Sacchi, N. (1987) Single step method of RNA isolation by acid guanidinium thiocynanate-phenol-chioroform extraction. Anal. Biochem. 162, 156-159.

Crews CM. and Erikson R.L. (1992) Purification of a murine protein- tyrosine/threonine kinase that phosphorylates and activates the Erk-1 gene product: relationship to the fission yeast byrl gene product. Proc. Natl. Acad. Sci. U.S.A. 89, 8205-8209.

Daum G., Eisenmann-Tappe I., Gries, H.W., Troppmair J., and Rapp U.R. (1994). Ins and outs of Raf kinases. Trends Biochem. Sci. 19, 474-480. de Kretser D.M. and Kerr J.B. 'Cytology of the testis' In The Physiology of

Reproduction, 2^nd Edition, Knobil E. and Neill J.D. (Editors). Raven Press Ltd.,

New York, NY 1994: 1177-1290.

Frayne.J., McMillenA Love,S., Hall,L. (1998) Expression of phosphatidylethanolamine-binding protein in the male reproductive tract: immunolocalisation and expression in prepubertal and adult rat testes and epididymides. Mol. Reprod. Dev. 49, 454-60.

Keah H.-H., O'Bryan M.K., de Kretser D.M., and Hearn M.T.W., 2000. Synthetic approaches for peptides related to the sperm tail protein tpx-1 , a member of the CRISP family of proteins. J. Peptide Research, in press.

Kim Y.H., McFarlane J.R., Almahbobi G., Stanton P.G., Temple-Smith P.D., and de Kretser D.M. (1995) Isolation and partial characterization of rat sperm tail fibrous sheath proteins and comparison with rabbit and human spermatozoa using a polyclonal antiserum. J. Reprod. Fertil. 104, 107-114.

Kohler G., and Milstein C. (1975) Continuous cultures of fused cells secreting antibody of predefined specificity. Nature 256, 495-497.

Moore, C, Perry,A.CF., Love,S., and Hall.L. (1996) Sequence analysis and immunolocalisation of phosphatidylethanolamine binding protein (PBP) in human brain tissue. Mol. Brain Res. 37, 74-78.

Nielson H., Engelbrecht J., Brunak S., and von Heijne G. (1997) A neural network method for identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Int. J. Neural Syst. 8, 581-599.

O'Bryan, M.K., Loveland,LL, Herszfeld,D., McFarlane.J.R., Hearn, M.T.W., de Kretser.D.M. (1998) Identification of a rat testis-specific gene encoding a potential rat outer dense fibre protein. Mol. Reprod. Dev. 50, 313-322. O'Bryan M.K., Schlatt S., Phillips D.J., de Kretser D.M., and Hedger M.P., 2000a. Bacterial lipopolysaccharide-induced inflammation compromises testicular function at multiple levels. Endocrinology 141 : 238-246.

O'Bryan, M..K., Sebire,K.L, GerdprasertO., Hedger,M.P., Hearn, M.T.W., and de Kretser, D..M., (2000b). Cloning and regulation of the rat activin β_E subunit. J. Mol. Endocr. 24, 409-418.

O'Bryan, M.K., Sebire.K.L, MeinhardtA, Edgar,K.A., Keah, H.-H., Hearn, M.T.W., and de Kretser.D.M. (2000d) Tpx-1 is a component of the outer dense fibers and acrosome of rat spermatozoa. Mol. Reprod. Dev., in press.

Oijka.K., Kojima,S.-l., Ueki,Y., Fukushima.N., Hayasi,K.-l., and Yamamota,M. (1992) Purification and structural analysis of hippocampal cholinergic neurostimulating peptide. Brain Res. 272, 164-171.

Oijka.K., Mitake.S., Tohdoh,N., Appel.S.H., Otsuka,Y., Katada.E., and Matsukawa.N. (2000) Hippocampal cholinergic neurostimulating peptides (HCNP). Prog. Neurobiol. 60, 37-83.

Otsuka.Y., and Ojika.K. (1996) Demonstration and characterization of hippocampal cholinergic neurostimulating peptide (HCNP) processing enzyme activity in rat hippocampus. Neurochem. Res. 21 , 369-376.

Perry.CF., Hall.L, Bell.A.E., Jones, R. (1994) Sequence analysis of a mammalian phospholipid-binding protein from testis and epididymis and its distribution between spermatozoa and extracellular secretions. Biochem. J. 301 , 235-242.

Russell, L.D., Ettlin.RA, Sinha Hikim,A.P., Clegg.E.D. (1990) Histological and histopathological evalutation of the testis. Cache River Press, Clearwater FL pp.120-161. Sambrook,J., Fritsch,E.F., and Maniatis.T. (1989) Molecular cloning, a laboratory manual. 2^nd Edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Schoentgen.F., and Jolles,P. (1995) From structure to function: possible biological roles of a new widespread protein family binding hydrophobic ligands and displaying a nucleotide binding site. FEBS Letters 369, 22-26.

Schoentgen,F., Saccoccio.F., Jolles.J., Bernier,!., and Jolles.P. (1987) Relationships between molecular interactions (nucleotides, Iipids and proteins) and structural features of the bovine brain 21-kDa protein. Eur. J. Biochem. 225, 1203-1210.

Thompson,J.D., Higgins, D.G. and Gibson.T.J. (1994) CLUSTALW: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weighted matrix choice. Nucl. Acid Res., 22: 4673-4680.

Tohdoh.N., Tojo,S., Agui.H. and Ojika,K. (1995) Sequence homology of rat and human HCNP precursor proteins, bovine phosphatidylethanolamine-binding protein and rat 23-kDa protein associated with the opoid-binding protein. Mol. Brain Res. 30, 381-384.

Vianney Barnier J., Papin c, Eychene A., Lecoq O., and Calothy G. (1995) The mouse B-raf gene encodes multiple protein isoforms with tissue-specific expression. J. Biol. Chem. 270: 23381-23389.

Wadewitz A.G., Winer M.A., and Wolgemuth D.J. (1993) Developmental and cell lineage specificity of raf family gene expression in mouse testis. Oncogene 8, 1055-1062.

Wojnowski L., Zimmer A.M., Beck T.W., Hahn H., Bernal R., Rapp U.R., and Zimmer A. (1997) Endothelial apoptosis in Braf-deficient mice. Nature Genetics 16, 293-297. Yeung, K., Janosch.P., McFerran.B., Rose,D.W., Mischak.H., Sedivy.J.M., and Kolch,W. (2000) Mechanism of suppression of the Raf/MEK/extracellular signal-regulated kinase pathway by the raf kinase inhibitor protein. Mol. Cell Biol. 20, 3079-3085.

Finally it is to be understood that various other modifications and/or alterations may be made without departing from the spirit of the present invention as outlined herein.

Claims

1. A nucleic acid sequence of a pebp-2 or part thereof comprising a sequence according to Figure 1 (SEQ ID NO:1) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

2. A nucleic acid sequence of a pebp-2 which encodes a protein having a molecular weight of approximately 21 kDa and having an isoelectric point of approximately 8.43, or an analogue, variant, mutant or functional equivalent thereof.

3. A nucleic acid sequence according to claim 2 having a sequence according to Figure 11 (SEQ ID NO:5).

4. A nucleic acid sequence of a pebp-2 which encodes a protein having a molecular weight of approximately 20 kDa and having an isoelectric point of approximately 8.77, or an analogue, variant, mutant or functional equivalent thereof.

5. A nucleic acid sequence according to claim 4 having a sequence according to Figure 10 (SEQ ID NO:3).

6. A nucleic acid sequence according to claims 2 to 4 comprising a sequence according to Figure 1 (SEQ ID NO:1), or an analogue, variant, mutant or functional equivalent thereof.

7. A nucleic acid sequence which encodes an amino acid sequence according to Figure 1 (SEQ ID NO:1) or part thereof.

8. A nucleic acid molecule which is complementary to a nucleic acid molecule according to any one of claims 1 to 7.

9. A vector including a nucleic acid sequence according to any one of claims 1 to 8.

10. A host cell including a vector according to claim 9.

11. A recombinant pebp-2 encoded by a nucleic acid sequence wherein said sequence is according to any one of claims 1 to 8.

12. An amino acid sequence of a pebp-2 or part thereof comprising a sequence according to Figure 1 (SEQ ID NO:2) or part thereof, or an analogue, vaπant, mutant or functional equivalent thereof.

13. An amino acid sequence of a pebp-2 which encodes a polypeptide having a molecular weight of approximately 21 kDa and having an isoelectric point of approximately 8.43, or an analogue, variant, mutant or functional equivalent thereof.

14. An amino acid sequence according to claim 13 having a sequence according to Figure 11 (SEQ ID NO:6).

15. An amino acid sequence of a pebp-2 which encodes a polypeptide having a molecular weight of approximately 20 kDa and having an isoelectric point of approximately 8.77, or an analogue, variant, mutant or functional equivalent thereof.

16. An amino acid sequence according to claim 15 having a sequence according to Figure 10 (SEQ ID NO:4).

17. An amino acid sequence according to any one of claims 13 to 16 comprising a sequence according to Figure 1 (SEQ ID NO:2) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

18. A pebp-2 or part thereof encoded by a nucleic acid sequence or amino acid sequence according to Figure 1 (SEQ ID NO:1) or (SEQ ID NO:2) or part thereof, or an analogue, variant, mutant or functional equivalent thereof.

19. A pebp-2 according to claim 14 having a molecular weight of approximately 21 kDa and having an isoelectric point of approximately 8.43, or an analogue, variant, mutant or functional equivalent thereof.

20. A pebp-2 according to claim 14 having an amino acid sequence according to Figure 11 (SEQ ID NO:6).

21. A pebp-2 according to claim 14 having a molecular weight of approximately 20 kDa and having an isoelectric point of approximately 8.77. or an analogue, variant, mutant or functional equivalent thereof.

22. A pebp-2 according to claim 21 having an amino acid sequence according to Figure 10 (SEQ ID NO:4).

23. A pebp-2 according to any one of claims 19 to 22 having a nucleic acid or amino acid sequence according to Figure 1 (SEQ ID NO:1) or (SEQ ID

NO:2), or an analogue, variant, mutant or functional equivalent thereof.

24. A composition comprising a pebp-2 according to any one of claims 11 , or 18 to 23 and a carrier.

25. A polyclonal or monoclonal antibody reactive against a polypeptide or part thereof encoded by a nucleic acid sequence according to any one of claims 1 to 8.

26. A method of regulating a pebp-2 associated activity said method comprising administering to a mammal in need thereof an effective amount of a composition according to claim 24.

27. A method of treating or preventing a condition associated with pebp-2 comprising administering to a mammal in need thereof an effective amount of a composition according to claim 24 .

28. A method of diagnosing a condition associated with pebp-2 comprising detecting the presence or absence of pebp-2 or parts thereof according to any one of claims 18 to 23.

29. A method according to claims 27 or 28 wherein the condition is selected from the group including male infertility, neurodegenerative disease, cancer or cardiac hypertrophy.

30. A method of regulating the MAP kinase pathway said method comprising administering to a mammal in need thereof an effective amount of an antibody according to claim 25 or of a composition according to 24.

31. A diagnostic kit for detecting a condition associated with pebp-2, said kit comprising an antibody according to claim 25 and a means for detecting a reaction between pebp-2 and the antibody.