FR2804435A1 - ISOLATED COMPLEX COMPRISING AN NNT-1 PROTEIN AND FURTHER AT LEAST ONE CLF-1 PROTEIN AND / OR A sCNTFRalpha PROTEIN - Google Patents

Abstract

The invention concerns a novel isolated complex comprising a NNT-1 protein and in addition at least a CLF-1 protein and/or a sCNTFR alpha protein and antibodies specifically directed against said complex. The invention further comprises a composition comprising said complex as medicine for preventing and/or treating neurodegenerative diseases such as amyotrophic lateral sclerosis, Parkinson's disease or Huntington's disease, for maintaining muscle mass in paralyzed persons, for treating obesity or cancer.

Description

<Desc / Clms Page number 1>

 The present invention relates to a new isolated complex comprising an NNT-1 protein and in addition at least one CLF-1 protein and / or a sCNTFRa protein as well as antibodies directed specifically against said complex. The invention also includes a composition comprising said complex as a medicament for the prevention and / or treatment of neurodegenerative diseases such as amyotrophic lateral sclerosis, Parkinson's disease or Huntington's disease, for the maintenance of muscle mass in the paralyzed. , for the treatment of obesity or cancer.

 The IL-6 cytokine family includes IL-6, IL-11, leukemia Inhibitory Factor (Leukemia Inhibitory Factor), oncostatin M OSM, ciliary neurotrophic factor CNTF ( for Ciliary NeuroTrophic Factor), cardiotrophin-1 CT-1 as well as neurotrophin-1 NNT-1 also called BSF-3 (for B cell Stimulatory Factor 3) or CLC (for Cardiotrophin-Like Cytokine) (Taga, T. and al., Annu. Rev. Immunol. 15: 797-819, 1997; Senaldi, G., et al., Proc. Natl.

Acad. Sci. U.S.A. 96: 11458-11463, 1999; Shi, Y. et al., Biochem. Biophys. Res.

Common. 262: 132-138, 1999). All of these cytokines use the glycoprotein gp130 as the receptor chain involved in signal transduction. The cytokines LIF, OSM, CNTF, CT-1 and NNT-1 share a second receptor subunit involved in signal transduction inside the cell, the ss chain of the LIF receptor: LIFRss (Senaldi, G ., et al., 1999; PC, et al., Biochem. J., 334: 297-314, 1998). It has been described that the cytokines IL-6, IL-11, CNTF and CT-1 still use an α chain not involved in the signal transduction which forms a high affinity complex with gpl30 and / or LIFRJ3. Soluble forms of the receptor chains for IL-6, IL-11 and CNTF can act as an agonist on the corresponding cytokines which implies that complexes formed between these a chains and the cytokines can stimulate any cell expressing gp130 (for IL-6 and IL-11) or the combination of gpl30 and LIFRJ3 (for CNTF) (Davis, S., et al., Science 259: 1736-1739, 1993). This is why these cytokines have redundant functions and pleiotropic effects on the immune, hematopoietic, central nervous and reproductive system (Taga, T. et al., Annu. Rev. Immunol. 15: 797-819, They also play a role in the control of liver function and bone resorption (Taga, T. et al.,

<Desc / Clms Page number 2>

 Annu. Rev. Immunol. 15: 797-819, 1997). Effects on tumor growth have also been reported, IL-6 being a factor involved in the autocrine growth of myelomas and OS (oncostatin), an autocrine growth factor of Kaposi's sarcomas, which is also capable of inhibiting growth. melanoma cells. Effects on angiogenesis have also been described (Van Damme, J., et al., J. Exp. Med. 165: 914-919, 1987; Nordan, RP et al., Science 233: 566-569, 1986 ; Kawano, M., et al., Nature 332: 83-85, 1988; Malik, N., et al., Mol. Cell. Biol. 9: 2847-2853, 1989; Nair, BC, et al., Science 255: 1430-1432, Miles, SA, et al., Science 255: 1432-1434, 1992; Pepper, MS, et al., Curr. Top. Microbiol. Immunol. 213: 31-67, 1996).

la transduction du signal (IL-12R(31 et IL-12R(32) sont elles homologues à gpl30. Le système IL-12/IL-12R est donc proche du système cytokine de la famille IL-6/gp130 plus LIFRp. The cytokine factor 1 called CLF-1 (for Cytokine-Like Factor-1) has been identified as a protein having homology with gpl30 and the receptor chains for the family of cytokines close to IL-6. It has been proposed that CLF-1 acts as a classic a chain of this family or that it participates in a molecule of the IL-12 type (Elson, GC, et al., J. Immunol. 161: 1371-1379, 1998 ). IL-12 is a heterodimeric cytokine comprising two polypeptide chains, p35 and p40. The two subunits of IL-12 are the products of two independent genes. The p35 and p40 subunits are homologous, respectively, to members of the IL-6 family and to cytokine receptors. The two IL-12 receptor chains involved in

signal transduction (IL-12R (31 and IL-12R (32) are they homologous to gpl30. The IL-12 / IL-12R system is therefore close to the cytokine system of the IL-6 / gp130 family plus LIFRp.

 The production of IL-12 is controlled in an original way. When expressed alone, the p35 subunit is only secreted in very small quantities. It is only released by the cells in the presence of the p40 subunit. The synthesis of this chain is therefore absolutely required for the production of IL-12. Unlike p35, p40 expressed alone is secreted in the form of a homodimer capable of binding the receptor and which has an antagonistic effect (Trinchieri, G., Annu. Rev. Immunol., 13: 251-276, The authors of the present invention have demonstrated the production of homodimers of CLF-1 by cells transfected with the corresponding cDNA. This observation is compatible with the hypothesis that CLF-1 is involved in a multimeric cytokine of IL-12 type ( Elson, GC, et al., J. Immunol. 161: 1371-1379, 1998).

<Desc / Clms Page number 3>

 Since the comparison of the phenotypes of mice for which the genes coding for CNTF or the α chain of its receptor, the existence of a second ligand for CNTFRa has been speculated. This ligand is generally called CNTF-2 and is believed to be important for development. Indeed, mice deficient for CNTF are only slightly affected in their phenotype and only in adulthood (Masu, Y., et al., Nature 365: 27-32, 1993). Similarly, there are human populations homozygous for CNTF inactivating mutations which are completely asymptomatic (DeChiara, T.M., et al., Cell. 83: 313-322, 1995). In contrast to these observations on the role of CNTF, mice without CNTFRa are unable to suckle, die soon after birth and have a dramatic loss in the population of motor neurons (Yssel, H., et al., J. Immunol.

Methods 72: 219-227, We are also looking for new cytokines capable of binding to LIFRP and / or gpl30 receptors and thus capable of stimulating the cells expressing these receptors.

 Thus, there remains today a great need to isolate and identify a new ligand specific for the CNTFRa receptor, just like new ligands specific for the LIFRss and / or gpl30 receptors. Such ligands are indeed likely to have an important role in particular in the development of the central nervous system, in the survival of central and peripheral neurons as well as in neuromuscular function. This is precisely the object of the present invention.

 The inventors have surprisingly demonstrated that the secretion of the NNT-1 cytokine of the IL-6 family is dependent on the co-expression of CLF-1 and that NNT-1 and CLF-1 form a complex capable of stimulating cell proliferation via a receptor comprising the CNTFRa, gpl30 and LIFRp subunits.

 During this demonstration, the formation of the complexes NNT-1 / sCNTFRa and NNT-1 / CLF-1 / sCNTFRa was also surprisingly observed; sCNTFRa designating the α chain of the CNTFR receptor in soluble form, agonist for CNTF (Davis, S., et al., Science 259: 1736-1739, These complexes can act on all cells expressing LIFRp and gpl30, and therefore have effects on all the systems whose cells express LIFRP and gpl30, such as the immune, hematopoietic, nervous, reproductive system as well as on the liver, bones and skeletal muscles.

<Desc / Clms Page number 4>

 The main object of the present invention is thus an isolated complex comprising an NNT-1 protein, characterized in that it further comprises at least one CLF-1 protein and / or an sCNTFRa protein.

 The subject of the present invention is therefore in particular an isolated complex, also called CNTF2, characterized in that it comprises an NNT-1 protein and a CLF-1 protein. The invention also relates to the complex comprising the proteins NNT-1 and sCNTFRa and the complex comprising the proteins NNT-1, CLF-1 and sCNTFRa.

 The term “protein” is also intended to denote the terms of peptide or polypeptide, these 3 terms being used interchangeably in the present description.

 In the present description, in particular in the claims, unless specifically mentioned, the term NNT-1 protein will be understood to mean the NNT-1 protein of sequence SEQ ID No. 2 and its derived proteins as defined below; by protein CLF-1 the protein CLF-1 of sequence SEQ ID No. 4 or No. 6 and their derived proteins as defined below and by soluble protein sCNTFRa the soluble protein sCNTFRa of sequence SEQ ID No. 7 and its proteins derivatives as defined below.

 By protein derived from the NNT-1 protein of sequence SEQ ID No. 2, is meant in the present description any protein whose sequence comprises a fragment of at least 5 consecutive amino acids of the sequence SEQ ID No. 2, of preferably 8, 10, 15, 20, 25.50 and 100 consecutive amino acids of the sequence SEQ ID No. 2, capable of forming a complex with the CLF-1 protein of sequence SEQ ID No. 4 or No. 6 and / or with the soluble protein sCNTFRa of sequence SEQ ID No. 7.

récepteur complexe CNTFRocIgp130/LIFR(3. Among these proteins derived from the sequence SEQ ID No. 2, preference is given in particular to proteins forming a complex with the CLF-1 protein of sequence SEQ ID No. 4 or No. 6, said complex being capable of modulating the biological activity of the

CNTFRocIgp130 / LIFR complex receptor (3.

The term “biological activity of the CNTFRoc / gp130 / LIFR3 complex receptor” is intended to denote in particular that measured by standard techniques below described in the examples such as the phosphorylation in tyrosine of gp 130 and LIFRJ3 from BAF / 3 and SK-N- cells. MC expressing the CNTFRa, gpl30 and LIFRp subunits or their cell proliferation.

<Desc / Clms Page number 5>

 Among these proteins derived from the sequence SEQ ID No. 2, preference is also given to proteins forming a complex with the soluble protein sCNTFRa of sequence SEQ ID No. 7, said complex being capable of modulating the biological activity of the receptor complex gp130 / LIFRss .

 The term “biological activity of the gp130 / LIFRss complex receptor” is intended to denote in particular that measured by standard techniques below described in the examples, such as the proliferation of BAF3 cells transfected by the cDNAs coding for gpl30 and LIFRss. Other usable techniques are based on the proliferation of TF-1 cells, the production of IL-6 by KB cells or the phosphorylation of STAT-3 in HEP62 cells.

 Among the proteins derived from the sequence SEQ ID No. 2, very particularly preferred are the proteins comprising one of said fragments of the sequence SEQ ID No. 2 and forming a complex with the CLF-1 protein of sequence SEQ ID No. 4 or No .6 and / or with the soluble protein sCNTFRa of sequence SEQ ID No. 7, the biological activity of said complex being at least 50%, preferably 60% or 80% of that measured for the complex formed with the protein NNT- 1 of sequence SEQ ID No. 2 and the protein CLF-1 of sequence SEQ ID No. 4 and / or with the soluble protein sCNTFRa of sequence SEQ ID No. 7 in the examples below.

 Among the proteins derived from the sequence SEQ ID No. 2, preference is also given to proteins comprising one of said fragments of the sequence SEQ ID No. 2 and forming a complex with the CLF-1 protein of sequence SEQ ID No. 4 or No. 6 and / or with the soluble protein sCNTFRa of sequence SEQ ID No. 7, said complex being capable of inhibiting the biological activity of the complex obtained with the protein NNT-1 of sequence SEQ ID No. 2 and the protein CLF-1 of sequence SEQ ID No. 4 or No. 6 and / or with the soluble protein sCNTFRa of sequence SEQ ID No. 7.

 Indeed, such complexes, as competitive inhibitors of the complex formed with the protein NNT-1 of sequence SEQ ID No. 2 and the protein CLF-1 of sequence SEQ ID No. 4 or No. 6 and / or with the soluble protein sCNTFRa of sequence SEQ ID No. 7, may be used to modulate, in particular decrease, the biological activity of the CNTFR [alpha] / gp130 / LIFRss complex receptor or of the gpl30 / LIFRp receptor, in

<Desc / Clms Page number 6>

 in particular the survival, growth or proliferation of cells expressing said complex receptor, in particular tumor.

 Among the proteins derived from the sequence SEQ ID No. 2, particular preference is given to proteins whose sequence has an identity percentage of at least 80%, preferably 85%, 90%, 95% and 99%, after alignment optimal with the sequence SEQ ID No. 2 or with one of its fragments, and comprising at least 5 consecutive amino acids, preferably 8,10, 15,20, 25, 50 and 100 consecutive amino acids of the sequence SEQ ID No. 2.

 Thus, said proteins derived from the NNT-1 protein, the sequence of which has a percentage identity of at least 80%, with the sequence SEQ ID No. 2 or with one of its fragments, may thus comprise one or more substitutions, preferably conservative, deletions or insertions, compared to the wild type protein NNT-1 of sequence SEQ ID No. 2.

CNTFRocIgp130/LIFR(3 ou du récepteur gpl30/LIFRp. The term “conservative substitution” is intended to denote any amino acid substitution which has little or no effect on the total charge, the polarity or the hydrophobicity of the reference protein, said substitution making it possible to increase or decrease the activity sought for the NNT-1 / CLF-1 complex and / or sCNTFRa comprising said substituted NNT-1 protein. This sought-after activity can either be an agonist or an antagonist (competitive inhibitor) activity of the complex receptor

CNTFRocIgp130 / LIFR (3 or gpl30 / LIFRp receptor.

 By protein derived from the CLF-1 protein of sequence SEQ ID No. 4 or No. 6, is meant in the present description any protein whose sequence comprises a fragment of at least 5 consecutive amino acids of sequence SEQ ID No. 4 or No. 6, preferably 8, 10, 15, 20, 25.50 and 100 consecutive amino acids of sequence SEQ ID No. 4 or No. 6, capable of forming a complex with the protein NNT-1 of sequence SEQ ID No. 2.

complexe CNTFR(x/gpl30/LlFRP, activité biologique telle que précédemment définie. Among the proteins derived from sequence SEQ ID No. 4 or No. 6, preference is also given to proteins forming a complex with the protein NNT-1 of sequence SEQ ID No. 2, said complex being capable of modulating the biological activity of the receptor

CNTFR complex (x / gpl30 / LlFRP, biological activity as defined above.

<Desc / Clms Page number 7>

 Among the proteins derived from the sequence SEQ ID No. 4 or No. 6, very particularly preferred are the proteins comprising one of said fragments of the sequence SEQ ID No. 4 or No. 6 and forming a complex with the protein NNT-1 of sequence SEQ ID No. 2, the biological activity of said complex being at least 50%, preferably 60% or 80% of that measured for the complex formed with the protein NNT-1 of sequence SEQ ID No. 2 and the protein CLF -1 of sequence SEQ ID No. 4.

 Among the proteins derived from the sequence SEQ ID No. 4 or No. 6, preference is also given to proteins comprising one of said fragments of the sequence SEQ ID No. 4 or No. 6 and forming a complex with the protein NNT-1 of sequence SEQ ID No. 2, said complex being capable of inhibiting the biological activity of the complex obtained with the NNT-1 protein of sequence SEQ ID No. 2 and the CLF-1 protein of sequence SEQ ID No. 4. Indeed, such a complex, as a competitive inhibitor of the complex formed with the protein NNT-1 of sequence SEQ ID No. 2 and the protein CLF-1 of sequence SEQ ID No. 4 or No. 6, may be used to modulate the biological activity of the CNTFR [alpha] / gp130 / LIFRss complex receptor, in particular to decrease the survival, growth or proliferation of cells expressing said complex receptor, in particular tumor cells.

 Among the proteins derived from the sequence SEQ ID No. 4 or No. 6, particular preference is given to proteins whose sequence has a percentage identity of at least 80%, preferably 85%, 90%, 95% and 99 %, after optimal alignment with the sequence SEQ ID No. 4 or No. 6 or with one of their fragments, and comprising at least 5 consecutive amino acids, preferably 8,10, 15,20, 25,50 and 100 consecutive amino acids of the sequence SEQ ID No. 4 or No. 6.

 Thus, said proteins derived from the CLF-1 protein, the sequence of which has a percentage identity of at least 80%, with the sequence SEQ ID No. 4 or No. 6 or with one of their fragments, may thus comprise one or more substitutions, preferably conservative, deletions or insertions, compared to the CLF-1 protein of sequence SEQ ID No. 4 or No. 6.

 By protein derived from the soluble protein sCNTFRa of sequence SEQ ID No. 7, is meant in the present description any protein whose sequence comprises a fragment of at least 5 consecutive amino acids of sequence SEQ ID

<Desc / Clms Page number 8>

 No. 7, preferably 8, 10, 15, 20, 25.50 and 100 consecutive amino acids of sequence SEQ ID No. 7, capable of forming a complex with the NNT-1 protein of sequence SEQ ID No. 2.

 Among the proteins derived from sequence SEQ ID No. 7, preference is also given to proteins forming a complex with the protein NNT-1 of sequence SEQ ID No. 2, said complex being capable of modulating the biological activity of the gpl30 / LIFRp receptor, activity biological as previously defined.

 Among the proteins derived from the sequence SEQ ID No. 7, very particularly preferred are the proteins comprising one of said fragments of the sequence SEQ ID No. 7 and forming a complex with the NNT-1 protein of sequence SEQ ID No. 2, l the biological activity of said complex being at least 50%, preferably 60% or 80% of that measured for the complex formed with the protein NNT-1 of sequence SEQ ID No. 2 and the soluble protein sCNTFRa of sequence SEQ ID No. 7.

 Among the proteins derived from the sequence SEQ ID No. 7, preference is also given to proteins comprising one of said fragments of the sequence SEQ ID No. 7 and forming a complex with the NNT-1 protein of sequence SEQ ID No. 2, said complex being capable of inhibiting the biological activity of the complex obtained with the protein NNT-1 of sequence SEQ ID No. 2 and the protein sCNTFRa of sequence SEQ ID No. 7. In fact, such a complex, as a competitive inhibitor of the complex formed with the protein NNT-1 of sequence SEQ ID No. 2 and the protein sCNTFRa of sequence SEQ ID No. 7, may be used to modulate the biological activity of the gp130 / LIFRss receptor, in particular to decrease survival, growth or proliferation of cells expressing said complex receptor, in particular tumor cells.

 Among the proteins derived from the sequence SEQ ID No. 7, particular preference is given to proteins whose sequence has an identity percentage of at least 80%, preferably 85%, 90%, 95% and 99%, after alignment optimal with the sequence SEQ ID No. 7 or with one of their fragments, and comprising at least 5 consecutive amino acids, preferably 8, 10, 15, 20, 25.50 and 100 consecutive amino acids of the sequence SEQ ID No. 7.

 Thus, said proteins derived from the sCNTFRa protein, the sequence of which has a percentage identity of at least 80%, with the sequence SEQ ID No. 7 or

<Desc / Clms Page number 9>

 with one of their fragments, may thus comprise one or more substitutions, preferably conservative, deletions or insertions, compared with the protein sCNTFRa of sequence SEQ ID No. 7.

 By percentage of identity between two nucleic acid or amino acid sequences within the meaning of the present invention is intended to denote a percentage of nucleotides or identical amino acid residues between the two sequences to be compared, obtained after the best alignment, this percentage being purely statistical and the differences between the two sequences being distributed randomly and over their entire length. Sequence comparisons between two nucleic acid or amino acid sequences are traditionally carried out by comparing these sequences after having optimally aligned them, said comparison being carried out by segment or by comparison window to identify and compare the local regions of sequence similarity. The optimal alignment of the sequences for comparison can be achieved, besides manually, by means of the local homology algorithm of Smith and Waterman (1981) [Ad. App. Math. 2: 482], using the local homology algorithm of Neddleman and Wunsch (1970) [J. Mol. Biol. 48: 443], using the similarity search method of Pearson and Lipman (1988) [Proc. Natl. Acad. Sci. USA 85: 2444], using computer software using these algorithms (GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI, or by BLAST comparison software N or BLAST P).

 The percentage of identity between two nucleic acid or amino acid sequences is determined by comparing these two optimally aligned sequences per comparison window in which the region of the nucleic acid or amino acid sequence to be compared. may include additions or deletions with respect to the reference sequence for optimal alignment between these two sequences. The percentage of identity is calculated by determining the number of identical positions for which the nucleotide or the amino acid residue is identical between the two sequences, by dividing this number of identical positions by the total number of positions in the comparison window. and multiplying the result obtained by 100 to obtain the percentage of identity between these two sequences.

<Desc / Clms Page number 10>

 For example, we could use the BLAST program, BLAST 2 sequences, available on the website http://www.ncbi.nlm.nih.gov/BLAST/; the parameters used being those given by default (in particular for the parameters open gap penalty: 5, and extension gap penalty: 2; the chosen matrix being for example the BLOSUM 62 matrix proposed by the program), the percentage of identity between the two sequences to compare being calculated directly by the program.

 The invention comprises a complex according to the invention, characterized in that it comprises the NNT-1 protein of sequence SEQ ID No. 2, or a protein whose sequence has a percentage identity of at least 80% with the sequence SEQ ID No. 2; CLF-1 protein of sequence SEQ ID No. 4 or No. 6, or a protein whose sequence has a percentage identity of at least 80% with the sequence SEQ ID No. 4 or No. 6; an sCNTFRa protein of sequence SEQ ID No. 7, or a protein whose sequence has a percentage identity of at least 80% with the sequence SEQ ID No. 7.

 In general, in the present description, the expression "complex type" is intended to denote comprising "A, B and / or C" or also "A; B and / or C" (as in claim 2) or also A / B and / or C "- complexes comprising A and B, - complexes comprising A and B and C, or - complexes comprising A and C.

 Generally also, by the expression of type "A, and / or B and / or C" is intended to denote all the possible combinations of these three elements taken alone, by two or three (A, B, C, A and B, A and C, B and C, A and B and C).

 Generally also, by the expression of the coupling type between "A, and B and / or C", it is intended to denote: - the coupling between A and B, - the coupling between A and B and C, or - the coupling between A and C.

 Among said NNT-1 / CLF-1 and / or sCNTFRa complexes according to the invention, those characterized in that the NNT-1 protein, the CLF-1 protein or the sCNTFRa protein is obtained by chemical synthesis or by recombinant route are preferred.

<Desc / Clms Page number 11>

 Said NNT-1, CLF-1 and sCNTFRa proteins can be obtained in the form of recombinant proteins, glycosylated or not, by standard techniques of genetic recombination using prokaryotic or eukaryotic cells transformed by plasmid or viral vectors containing nucleic acids encoding for said proteins, or by chemical synthesis.

 Among said complexes according to the invention, preference is also given to those characterized in that the NNT-1 protein is coupled by covalent bond to the CLF-1 protein and / or to the sCNTFRa protein to form a fusion protein, in particular by chemical coupling .

 In a particular embodiment, the complex according to the invention is characterized in that one or more binding elements are introduced into said protein NNT-1, and / or said protein CLF-1 and / or protein sCNTFRa to facilitate chemical coupling, preferably said connecting element introduced is an amino acid.

 According to the invention, it is possible to introduce one or more binding elements, in particular amino acids to facilitate the coupling reactions between said NNT-1 protein, said CLF-1 protein and / or said sCNTFRa protein. The covalent coupling between said NNT-1 protein, and said CLF-1 protein and / or said sCNTFRa protein according to the invention can be carried out at the N- or C-terminal end of said NNT-1 protein, and / or said CLF-1 protein and / or said sCNTFRa protein. The bifunctional reagents allowing this coupling will be determined as a function of the end of said NNT-1 protein, and / or of said CLF-1 protein and / or said sCNTFRa protein chosen to couple.

 In another particular embodiment, the complex according to the invention is characterized in that said fusion protein obtained after coupling between said NNT-1 protein, and said CLF-1 protein and / or said sCNTFRa protein is prepared by genetic recombination .

 The fusion protein can be produced by recombinant DNA techniques by insertion or addition to the DNA sequence coding for said NNT-1 protein, of a sequence coding for said CLF-1 protein and / or of a sequence encoding said protein sCNTFRa.

<Desc / Clms Page number 12>

 The methods of synthesizing fusion or hybrid molecules include the methods used in genetic engineering to construct hybrid polynucleotides encoding the desired polypeptide sequences. We can, for example, advantageously refer to the technique for obtaining genes coding for fusion proteins described by DV Goeddel (Gene expression technology, Methods in Enzymology, vol. 185: 3-187, 1990). Among said complexes according to the invention, preference is also given to those characterized in that the protein NNT-1, CLF-1 and sCNTFRa are natural proteins expressed by cells or cell lines, in particular of animal origin, naturally comprising nucleic acids coding for said ones NNT-1 and / or CLF-1 and / or sCNTFRa proteins, in particular by cells capable of naturally producing the complex according to the invention, in particular in the culture medium in which they are cultivated.

 The invention further comprises a complex according to the invention, characterized in that said complex is obtained by a method comprising bringing an NNT-1 protein into contact with a CLF-1 protein and / or a sCNTFRa protein, preferably in a medium favoring the formation of said complex.

 The invention also relates to a vector or a system of two or three vectors for co-expression of the proteins NNT-1, CLF-1 and / or sCNTFRa in a host cell, said proteins NNT-1, CLF-1 and / or sCNTFRa being capable of forming a complex according to the invention, characterized in that said vector or said system of two or three vectors contains a nucleic sequence coding for an NNT-1 protein, a CLF-1 protein and / or a sCNTFRa protein. The vector or system of two or three vectors according to the invention is characterized in that it comprises the elements allowing the expression of said sequences in a host cell and optionally the secretion of said sequences out of the host cell. The expression expression or coexpression vector is understood to mean expression vectors with autonomous replication of the plasmid type as well as systems intended to ensure integration into cells, but these expression vectors may also be vectors for expression of the viral type or even, when it is desired to carry out, for example, gene therapy, naked DNA. Among the viral vectors, those derived from the adenovirus, from the virus associated with

<Desc / Clms Page number 13>

 adenovirus (AAV), retroviruses, lentiviruses, and preferably derivatives of HIV, poxviruses, herpes virus for expression in the eukaryotic system. Among the non-viral vectors, naked polynucleotides such as naked DNA or naked RNA are preferred according to the technique developed by the company VICAL, artificial yeast chromosomes (YAC) for expression in yeast. , mouse artificial chromosomes (MAC) for expression in murine cells and preferably human artificial chromosomes (HAC, human artificial chromosome) for expression in human cells.

 According to a particular embodiment, the vector according to the invention comprises elements for controlling the expression of the proteins NNT-1, CLF-1 and / or sCNTFRa adapted to the chosen host cell.

 The invention furthermore includes host cells, in particular eukaryotic and prokaryotic cells, characterized in that they are transformed by the vectors or two-vector systems according to the invention. Preferably, the host cells are transformed under conditions allowing the expression of the two recombinant proteins capable of forming a complex according to the invention. The cell host can be chosen from bacterial cells but also from yeast cells, as well as from plant and animal cells; preferably, the cell host is a mammalian cell, but also an insect cell in which methods using baculoviruses can be used, for example. These cells can be obtained by the introduction into host cells of nucleotide sequence inserted into a vector or system of two vectors as defined above, then the culturing of said cells under conditions allowing the expression of the transfected nucleotide sequence.

 The invention also relates to a method for preparing an NNT-1 / CLF-1 and / or sCNTFRa complex characterized in that it implements a vector or system of two or three vectors according to the invention. More particularly, the invention relates to a method for preparing a recombinant NNT-1 / CLF-1 and / or sCNTFRa characterized in that cells transformed according to the invention are cultivated under conditions allowing expression proteins NNT-1, CLF-1 and / or sCNTFR

<Desc / Clms Page number 14>

 a recombinant and that said NNT-1 / CLF-1 and / or recombinant sCNTFRa complex is recovered.

 The recombinant NNT-1 / CLF-1 and / or sCNTFRa complex according to the invention is capable of being obtained according to a method of the invention and according to the techniques for producing recombinant proteins known to those skilled in the art. The present invention therefore relates to the NNT-1 / CLF-1 complex and / or recombinant sCNTFRa capable of being obtained by the method presented above. In this case, the nucleic acid sequence used is placed under the control of signals allowing its expression in a cellular host. An efficient recombinant protein production system requires a vector, for example of plasmid or viral origin, and a compatible host cell. The vector must include a promoter, translation initiation and termination signals, as well as appropriate regions for transcription regulation. It must be able to be maintained in a stable manner in the cell and may possibly have particular signals specifying the secretion of the proteins translated. These different control signals are chosen according to the cellular host used. For this purpose, the nucleic acid sequences coding for the proteins NNT-1, CLF-1 and / or sCNTFRa capable of forming the NNT-1 / CLF-1 and / or sCNTFRa complex according to the invention can be inserted into vectors with autonomous replication within the chosen host, or integrative vectors of the chosen host.

Such vectors will be prepared according to the methods commonly used by those skilled in the art, and the resulting clones can be introduced into an appropriate host by standard methods such as, for example, calcium phosphate precipitation transfection, lipofection, electroporation, thermal shock.

 The recombinant NNT-1 / CLF-1 and / or sCNTFRa complexes according to the invention obtained as indicated above, can be both in glycosylated and non-glycosylated form and may or may not have the natural tertiary structure. Of course, said recombinant NNT-1 / CLF-1 and / or sCNTFRa complexes according to the invention can be obtained from NNT-1 protein coupled to a CLF-1 protein and / or coupled to an sCNTFRa protein by genetic fusion like this. was mentioned earlier.

<Desc / Clms Page number 15>

 The NNT-1 / CLF-1 and / or sCNTFRa complexes according to the invention which can be formed from NNT-1 and / or CLF-1 and / or sCNTFRa proteins obtained by chemical synthesis and can thus contain non-amino acids. natural, are also included in the invention.

 The methods for purifying recombinant or natural proteins NNT-1, CLF-1 and sCNTFRa, or NNT-1 / CLF-1 and / or sCNTFRa complexes according to the invention are known to those skilled in the art. The proteins NNT-1, CLF-1 and sCNTFR a or the NNT-1 / CLF-1 complex and / or sCNTFRa according to the invention, in particular recombinant, can be purified from lysates and cellular extracts, from the supernatant of the medium of culture, by methods used individually or in combination, such as fractionation, chromatography methods, immuno-affinity techniques using specific mono- or polyclonal antibodies, etc. A preferred variant consists in producing a recombinant protein fused to a carrier protein (chimeric protein). The advantage of this system is that it allows stabilization and a decrease in the proteolysis of the recombinant product, an increase in the solubility during the in vitro renaturation and / or a simplification of the purification when the fusion partner has a affinity for a specific ligand.

 Cells characterized in that they contain a vector or system of two vectors according to the invention also form part of the present invention, in particular prokaryotic or eukaryotic cells, preferably mammalian cells.

 Preferably, the invention comprises a complex according to the invention, characterized in that said complex is obtained by a method comprising the following steps: a) culture of a cell containing a DNA sequence coding for the protein NNT-1 and a DNA sequence coding for the CLF-1 protein and / or a DNA sequence coding for a sCNTFRa protein in a culture medium suitable for said cell; b) recovering said complex formed from the culture medium and / or lysate of said cultured cells.

<Desc / Clms Page number 16>

 Preferably, said cell in step a) is a transformed cell according to the invention.

 Also preferably, said cell in step a) is a cell naturally expressing an NNT-1 protein, a CLF-1 protein and / or a sCNTFRa protein, that is to say a cell naturally comprising a nucleic sequence encoding for an NNT-1 protein and a nucleic sequence coding for a CLF-1 protein and / or a nucleic sequence coding for a sCNTFRa protein.

 Among the cells naturally expressing an NNT-1 protein and a CLF-1 protein and / or a sCNTFRa protein, cells from a cell line, in particular animal, such as those described below in the examples, are particularly preferred, these examples are not limiting.

 In a preferred embodiment, the NNT-1 protein, the CLF-1 protein and / or the sCNTFRa protein are secreted outside said cultured cell and the complex formed is directly taken from said culture medium, obtained at 1 'step a).

 The invention also comprises a complex according to the invention, characterized in that said complex is obtained by a process comprising the following steps: a) culture of a cell containing a DNA sequence coding for the protein NNT-1, d 'a cell containing a DNA sequence coding for the protein CLF-1 and / or a cell containing a DNA sequence coding for the protein sCNTFRa in a culture medium suitable for each of said cells; b) bringing the NNT-1 proteins and the CLF-1 proteins and / or the sCNTFRa proteins contained in their respective culture medium and / or in their respective cell lysate into contact; c) recovery of said complex formed in step b).

 Preferably, said cells in step a) are cells transformed according to the invention.

 In a preferred embodiment, the cells used in step a) before transformation are of the same type and are cultured after transformation in the same culture medium, contacting the NNT-1 proteins and the CLF-1 proteins and / or sCNTFRa proteins then contained in the common culture medium and / or in the overall cell lysate occurring naturally.

<Desc / Clms Page number 17>

 Preferably, the NNT-1 protein, the CLF-1 protein and / or the sCNTFRa protein are secreted outside said cultured cells and the complex formed is directly taken from said culture medium obtained in step a) .

 In general, the processes for preparing the complexes according to the invention described above, or described in the examples below, also form part of the present invention, as well as the complexes NNT-1 / CLF-1 and / or sCNTFRa obtained or likely to be obtained by these processes.

 One embodiment of the invention relates to an NNT-1 / CLF-1 complex according to the invention capable of fixing the CNTFRa receptor.

 An embodiment of the invention also relates to an NNT-1 / s CNTFRa complex according to the invention capable of fixing the LIFRss receptor.

 In another aspect, the present invention comprises a monoclonal, polyclonal antibody or a fragment thereof, characterized in that it is specifically directed against an NNT-I / CLF-1 complex according to the invention. It also comprises monoclonal, polyclonal antibodies, or one of their fragments, directed specifically against an NNT-1 / CLF-1 / sCNTFR [alpha] complex or an NNT-1 / sCNTFRa complex according to the invention.

 Preferably, the monoclonal, polyclonal antibody or one of their fragments specifically directed against an NNT-1 / CLF-1 complex according to the invention, is characterized in that it is capable of binding specifically to an epitope or determinant of the NNT-1 / CLF-1 complex according to the invention responsible for the specific interaction of the NNT-1 / CLF-1 complex with the receptor complex CNTFRo / gp 130 / LIFRss.

 Preferably, the monoclonal, polyclonal antibody or one of their fragments specifically directed against an NNT-1 / CLF-1 / sCNTFRa complex or an NNT-1 / sCNTFRa complex according to the invention, is characterized in that it is capable of binding specifically to an epitope or determinant of the NNT-1 / CLF-1 / sCNTFR [alpha] or NNT-1 / sCNTFRa complex according to the invention responsible for the specific interaction of the NNT-1 / CLF-1 complex / sCNTFRa or NNT-1 / sCNTFRa with the gp130 / LIFRss complex receptor.

<Desc / Clms Page number 18>

 Epitopic determinants usually consist of groups of molecules having chemically active surfaces such as amino acids or sugar side chains and having a specific three-dimensional structure and / or a characteristic specific charge.

 More preferably, the monoclonal, polyclonal antibody or one of their fragments, directed specifically against an NNT-1 / CLF-1 complex according to the invention will be able to recognize specifically (or with greater affinity) the complex NNT-1 / CLF-1 according to the invention consisting of the protein NNT-1 of sequence SEQ ID No. 2 and the protein CLF-1 of sequence SEQ ID No. 4 or SEQ ID No. 6 without however recognizing (or with significantly lower affinity) the NNT-1 protein of sequence SEQ ID No. 2 and the CLF-1 protein of sequence SEQ ID No. 4 or SEQ ID No. 6 taken separately.

(ou avec une plus grande affinité) le complexe NNT-I/CLF-l/sCNTFRa. ou le complexe NNT-1/sCNTFRa selon l'invention constitué de la protéine NNT-1 de séquence SEQ ID No. 2, de la protéine CLF-1 de séquence SEQ ID No. 4 ou SEQ ID No. 6 et de la protéine sCNTFRa de séquence SEQ ID No. 7 sans toutefois reconnaître (ou avec une affinité significativement inférieure) la protéine NNT-1 de séquence SEQ ID No. 2, la protéine CLF-1 de séquence SEQ ID No. 4 ou SEQ ID No. 6 et la protéine sCNTFRa de séquence SEQ ID No. 7 prises séparément. More preferably, the monoclonal, polyclonal antibody or one of their fragments, directed specifically against an NNT-1 / CLF-1 / sCNTFRa complex or an NNT-1 / sCNTFRa complex according to the invention will be able to recognize specifically

(or with greater affinity) the NNT-I / CLF-1 / sCNTFRa complex. or the NNT-1 / sCNTFRa complex according to the invention consisting of the NNT-1 protein of sequence SEQ ID No. 2, the CLF-1 protein of sequence SEQ ID No. 4 or SEQ ID No. 6 and the protein sCNTFRa of sequence SEQ ID No. 7 without however recognizing (or with a significantly lower affinity) the protein NNT-1 of sequence SEQ ID No. 2, the protein CLF-1 of sequence SEQ ID No. 4 or SEQ ID No. 6 and the protein sCNTFRa of sequence SEQ ID No. 7 taken separately.

 The NNT-1 / CLF-1 and / or sCNTFR complexes according to the invention make it possible to prepare monoclonal or polyclonal antibodies characterized in that they specifically recognize the NNT-1 / CLF-1 and / or sCNTFR complexes. The monoclonal antibodies can advantageously be prepared from hybridomas according to the technique described by Kohler and Milstein in 1975 (Nature, 256: 495-497, The polyclonal antibodies can be prepared, for example by immunization of an animal, in particular a mouse, with an NNT-1 / CLF-1 and / or sCNTFR complex according to the invention associated with an adjuvant of the immune response, then purification of the specific antibodies contained in the serum of the immunized animals on a column

<Desc / Clms Page number 19>

 affinity to which the NNT-1 / CLF-1 complex and / or sCNTFR having previously served as an antigen has been fixed.

 The invention therefore preferably relates to mono- or polyclonal antibodies or their fragments, characterized in that they are capable of specifically recognizing the NNT-1 / CLF-1 complex according to the invention consisting of the NNT-1 protein. sequence SEQ ID No. 2 and the protein CLF-1 of sequence SEQ ID No. 4 or SEQ ID No. 6.

 The invention also preferably relates to mono- or polyclonal antibodies or their fragments, characterized in that they are capable of specifically recognizing the NNT-1 / sCNTFRa complex according to the invention consisting of the NNT-1 protein of sequence SEQ ID No. 2 and the protein sCNTFRa of sequence SEQ ID No. 7.

 The antibodies of the invention, or their fragments, can also be labeled with an enzymatic, fluorescent or radioactive type of labeling.

 Such an antibody could not only be useful for studying and thus better understanding the role played by the NNT-1 / CLF-1 and / or sCNTFRa complexes, in particular in the regulation of genes, but also would be useful with regard to the results presented by the inventors in the present invention, for other applications such as therapeutic or diagnostic applications.

complexe CNTFRa/gp130/LIFRp, ou du complexe NNT-11CLF-l. The monoclonal, polyclonal antibodies or one of their fragments, directed specifically against an NNT-1 / CLF-1 complex according to the invention would be particularly useful for targeting compounds capable of modulating the biological activity of the receptor

CNTFRa / gp130 / LIFRp complex, or NNT-11CLF-1 complex.

 The monoclonal, polyclonal antibodies or one of their fragments, directed specifically against an NNT-1 / sCNTFRa complex according to the invention would be particularly useful for targeting compounds capable of modulating the biological activity of the receptor complex gp130 / LIFRss, or of the NNT-1 / sCNTFRa complex.

 The fragments of monoclonal or polyclonal antibody according to the invention comprise any fragment of said monoclonal antibody capable of binding to the epitope of the NNT-1 / CLF-1 and / or CNTFRa complex on which the monoclonal or polyclonal antibody is attached, said fragment is derived. Examples of such fragments include in particular single chain monoclonal antibodies or monovalent fragments Fab or Fab 'and divalent fragments such as F (ab') 2, which have the same specificity.

<Desc / Clms Page number 20>

 fixation as the monoclonal or polyclonal antibody from which they are derived. A fragment according to the invention may also be a single chain Fv fragment produced by methods known to those skilled in the art and as described for example by Skerra et al. (Science, 240: 1038-1041, 1988) and King et al. (Biochemical J., 290: 723-729, 1991).

 According to the present invention, fragments of monoclonal or polyclonal antibodies of the invention can be obtained from the monoclonal or polyclonal antibodies as described above by methods such as digestion with enzymes, such as pepsin or papain and / or by cleavage of the disulfide bridges by chemical reduction. Alternatively, the monoclonal or polyclonal antibody fragments included in the present invention can be synthesized by automatic peptide synthesizers such as those provided by the company Applied Biosystems, etc., or can be prepared manually using techniques known to those skilled in the art and as described for example by Geysen et al. (J.

Immunol. Methods, 102: 259-274, 1978).

 In general, for the preparation of monoclonal, polyclonal antibodies or their fragments, reference may be made to the techniques which are in particular described in the Antibodies manual (Harlow et al., Antibodies: Laboratory Manual, Cold Spring Harbor Publications pp. 726, 1988) or to the technique of preparation from hybridomas described by Kohler and Milstein in 1975.

 The monoclonal or polyclonal antibodies according to the invention may for example be purified on an affinity column on which the NNT-1 / CLF-1 and / or sCNTFRa complex or one of its fragments comprising the epitope has previously been immobilized specifically recognized by said monoclonal or polyclonal antibodies according to the invention.

 The invention further comprises a monoclonal antibody or one of its fragments according to the invention, characterized in that it is chosen from humanized, chimeric or anti-idiotypic antibodies.

 The humanized monoclonal antibodies according to the invention or their fragments can be prepared by techniques known to those skilled in the art (Carter et al., PNAS 89: 4285-4289, 1992; Mountain et al., Biotechnol. Genet. Eng. Rev., 10: 1-142, 1992).

<Desc / Clms Page number 21>

 Such humanized monoclonal antibodies according to the invention are preferred for their use in therapeutic methods.

 The monoclonal antibodies or their chimeric type fragments according to the invention can be produced using the techniques of genetic recombination.

 The invention also comprises a monoclonal, polyclonal antibody or one of their fragments according to the invention, characterized in that it is labeled.

 The monoclonal or polyclonal antibodies according to the invention or their fragments can also, according to the invention, be in the form of labeled antibodies in order to obtain a detectable and / or quantifiable signal.

 The monoclonal antibodies labeled according to the invention or their fragments include, for example, so-called immunoconjugate antibodies which can be conjugated, for example, with enzymes such as peroxidase, alkaline phosphatase, ss-Dgalactosidase, glucose oxidase, glucose amylase, l carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase or glucose-6 phosphate dehydrogenase or by a molecule such as biotin, digoxigenin or 5-bromodesoxyuridine. Fluorescent markers can also be conjugated to the monoclonal antibodies or their fragments of the invention and include in particular fluorescein and its derivatives, fluorochrome, rhodamine and its derivatives, GFP (GFP for Green Fluorescent Protein), dansyl, umbelliferone etc. In such conjugates, the monoclonal antibodies of the invention or their fragments can be prepared by methods known to those skilled in the art. They can be coupled to enzymes or fluorescent markers directly or through a spacer group or a linking group such as a polyaldehyde, such as glutaraldehyde, ethylenediaminetetraacetic acid (EDTA), diethylenetriaminepentaacetic acid (DPTA), or in the presence of coupling agents such as periodate, etc. The conjugates comprising markers of the fluorescein type can be prepared by reaction with an isothiocyanate.

 Other conjugates can also include chemiluminescent markers such as luminol and dioxetanes or bioluminescent markers such as luciferase and luciferin.

<Desc / Clms Page number 22>

36C1 57Co, 58Co, 51Cr, 152 Eu, > 59çe 1 > 3"i 1251, > i3y 32p@ 35S, 71 SE et 99mTc qui peuvent être détectés par des moyens connus tels que le compteur gamma ou à scintillations, par autoradiographie, etc.. Among the markers which can be attached to the monoclonal antibody or one of its fragments according to the invention, radioactive markers such as 14C are also preferred,

36C1 57Co, 58Co, 51Cr, 152 Eu,> 59çe 1> 3 "i 1251,> i3y 32p @ 35S, 71 SE and 99mTc which can be detected by known means such as gamma or scintillation counter, autoradiography, etc. ..

 In another aspect, the subject of the invention is the use of an NNT-1 / CLF-1 complex according to the invention or of a monoclonal, polyclonal or one of the anti-NNT-1 / CLF-1 antibodies. of their fragments according to the invention, for the preparation of a medicament intended to modulate the biological activity of the CNTFR [alpha] / gp130 / LIFRssM complex receptor, in particular the signal transduction induced by the tyrosine phosphorylation of gpl30 and LIFRss .

CNTFRoc/gp130/LIFR(3, on entend désigner aussi bien l'induction ou l'accroissement que son inhibition, en particulier lorsque le complexe formé entre les protéines NNT-1 et CLF-1 ou lesdits anticorps anti-NNT-l/CLF-1 agissent en tant qu'inhibiteur compétitif ou antagoniste. By modulation of the biological activity of the complex receptor

CNTFRoc / gp130 / LIFR (3, it is intended to denote both the induction or the increase as well as its inhibition, in particular when the complex formed between the proteins NNT-1 and CLF-1 or the said anti-NNT-1 / CLF antibodies -1 act as a competitive inhibitor or antagonist.

 Preferably, said NNT-1 / CLF-1 complex is the complex formed between the NNT-1 protein of sequence SEQ ID No. 2, or a protein whose sequence has a percentage identity of at least 80% with the sequence SEQ ID No. 2, and the protein CLF-1 of sequence SEQ ID No. 4 or No. 6, or a protein whose sequence has a percentage identity of at least 80% with the sequence SEQ ID No. 4 or No. 6, and the drug is intended to induce or increase the biological activity of the CNTFR [alpha] / gp130 / LIFRss receptor complex.

 The subject of the invention is also the use of an NNT-1 / CLF-1 complex according to the invention or of a monoclonal, polyclonal anti-NNT-1 / CLF-1 antibody or one of their fragments according to the invention for the preparation of a medicament intended to increase or decrease the survival, growth, proliferation or differentiation of cells expressing the CNTFR [alpha] / gp130 / LIFRss receptor complex.

 The subject of the invention is in particular the use of an NNT-1 / CLF-1 complex according to the invention or of a monoclonal, polyclonal anti-NNT-I / CLF-1 antibody or one of their fragments according to the invention, for the preparation of a medicament intended for

<Desc / Clms Page number 23>

 increase the survival, growth, proliferation or differentiation of central, peripheral neurons and those involved in neuro-muscular function, in particular intended for the treatment of abnormal development of the fetal brain, or skeletal muscle cells.

 The invention preferably also relates to the use of an NNT-1 / CLF-1 complex according to the invention or of an anti-NNT-1 / CLF-1 antibody monoclonal, polyclonal or one of their fragments according to the invention, for the preparation of a medicament intended to decrease the survival, growth, proliferation or differentiation of tumor cells expressing the CNTFR [alpha] / gp130 / LIFRss complex receptor or a receptor capable of specifically fixing the NNT-1 / CLF-1 complex according to the invention.

 The invention also includes the use of an NNT-1 / CLF-1 / sCNTFR a or NNT-1 / sCNTFRa complex according to the invention or of anti-antibodies (NNT-1 / CLF-1 / sCNTFRa or NNT -1 / sCNTFRa) for the preparation of a medicament intended to modulate the biological activity of the gp130 / LIFRss receptor, in particular the signal transduction induced by the tyrosine phosphorylation of gp130 and LIFRp.

 The subject of the invention is also the use of an NNT-1 / CLF-1 / sCNTFRa or NNT-1 / sCNTFRa complex or of anti-antibodies (NNT-1 / CLF-1 / sCNTFRa or NNT-1 / sCNTFRa) according to the invention for the preparation of a medicament intended to modulate the activity of the gpl30 / LIFRp receptor of cells expressing said gp130 / LIFRss receptor, such as the cells involved in the immune system, the hematopoietic system, the nervous system , the reproductive system, the liver, bones or skeletal muscle.

 The invention also relates to the use of an NNT-1 / CLF-1 complex according to the invention to facilitate the proliferation and / or inhibit the differentiation of stem cells and more particularly of embryonic stem cells. Indeed, it is known that the LIF cytokine allows the proliferation of stem cells and inhibits their differentiation.

 In another aspect, the invention comprises a complex according to the invention, or a monoclonal, polyclonal antibody or one of their fragments according to the invention as a medicament.

<Desc / Clms Page number 24>

The invention also comprises a pharmaceutical composition characterized in that it comprises at least one compound chosen from the following compounds: - a complex according to the invention; - a monoclonal, polyclonal antibody or one of their fragments according to the invention; - a vector or vector system, or a transformed cell according to the invention; and - a cell capable of naturally expressing an NNT-1 protein and a CLF protein -
1 and / or an sCNTFRa protein.

 Such pharmaceutical compositions comprising a vector or vector system according to the invention may in particular be used for the transfer of nucleic acid coding for the proteins NNT-1, CLF-1 and / or sCNTFRa into a given cell in vivo in as part of a treatment for a neurodegenerative disease by gene therapy. This new technology, the scope of which is vast, makes it possible to envisage the treatment of neurodegenerative diseases for which conventional therapeutic alternatives are ineffective or even non-existent and relate to both genetic and acquired diseases. The most practiced approach consists in using a viral vehicle to introduce the therapeutic nucleic acid into the cell to be treated and, in particular, retroviral and adenoviral. In fact, viruses have developed sophisticated mechanisms to cross cell membranes, escape degradation at the level of lysosomes and make their genome penetrate into the nuclei in order to ensure the expression of the therapeutic gene.

 More and more gene transfer methods use non-viral vectors. Other methods of gene transfer can be employed such as for example the delivery of the therapeutic nucleic acid by means of synthetic vectors, such as the cationic lipids which interact spontaneously with the nucleic acid to form positively charged complexes capable of fusing with the anionic cell membranes and penetrate the nucleic acid which they transport; see for example Behr, Bioconjugate Chemistry, 5: 382, 1994). Finally, an even simpler approach can also be envisaged by direct administration of naked DNA coding for the proteins NNT-1, CLF-1 and / or sCNTFRa, in particular in the context of diseases affecting the muscles by intramuscular injection. These non-viral methods generally use a vector or system of plasmid vectors according to

<Desc / Clms Page number 25>

 the invention carrying the therapeutic genes coding for the two proteins NNT-1 and CLF-1 and / or sCNTFRa, and the elements necessary for its expression.

 Such pharmaceutical compositions comprising a vector or vector system according to the invention may also be used for the transfer of nucleic acid coding for the proteins NNT-1, CLF-1 and / or sCNTFRa, into a given cell ex vivo in as part of a treatment for neurodegenerative disease, in particular for the repair or regeneration of neurons or neuronal tissue, which will then be implanted or reimplanted in the patient to be treated (xenograft or allograft).

 The invention further relates to a pharmaceutical composition according to the invention for the prevention or treatment of neurodegenerative diseases, in particular amyotrophic lateral sclerosis, Parkinson's disease or Huntington's disease, for the treatment of abnormal development of the brain f #tal, for the regeneration of nervous tissue or skeletal muscle or for the maintenance of muscle mass in the paralyzed or for the treatment of cancer or obesity.

 Indeed, among the potential applications of the NNT-1 / CLF-1 complex as a specific activator of the CNTF receptor, one can also cite its use in the preparation of a medicament intended for the treatment of obesity and its associated diseases such as hyperglycemia as described in particular in patent applications WO 98/22128, WO 98/32458 and WO 99/08701. Obese mice have been shown to lose weight following treatment with the CNTF protein. A CNTF derivative, axokine, has also obtained similar results and thus confirms the usefulness of the NNT-1 / CLF-1 complex in the treatment of obesity.

 The pharmaceutical compositions according to the invention can also be used to improve fertility, and in particular to avoid endometriosis and / or facilitate the implantation of blastocysts.

 They can also be used to facilitate hematopoiesis and particularly in the treatment of thrombocytopenia. In this case, the compositions according to the invention also comprise GM-CSF. It was found that the number of platelets produced was increased in the presence of LIF.

 Finally, the compositions according to the invention can be used for the treatment of retinitis and more particularly pigmentary retinitis.

<Desc / Clms Page number 26>

 In another aspect, the subject of the invention is a pharmaceutical composition for the treatment or prevention of pathology linked to an abnormal expression of the NNT-1 / CLF-1 and / or sCNTFRa complex, characterized in that it comprises: a ) a monoclonal, polyclonal antibody or a fragment thereof, according to the invention; and b) a pharmaceutically acceptable excipient.

 Preferably, the pharmaceutical composition according to the invention is characterized in that said pathology is chosen from cancers.

 The invention also relates to the use of a monoclonal, polyclonal antibody or one of their fragments according to the invention for the manufacture of a medicament intended for the prevention or treatment of cancer.

 The amount of compounds included in the pharmaceutical compositions according to the present invention and necessary for effective therapy will depend on various factors such as the mode of administration, the targeted part of the body, the physiological state of the patient, the administration of other drugs, possible side effects, etc. The dosage for such preventions or therapeutic treatments should be carried out in such a way as to optimize its safety and effectiveness. In general, animal models can be used to determine the effective amounts of the compounds entering into the pharmaceutical compositions according to the present invention for the treatment or the prevention of particular pathologies. These methods are in particular discussed in works such as Gilman et al. (The Pharmacological Bases of Therapeutics, 8th Ed. Pergamon Press, 1990) and Remington's Pharmaceutical Sciences (17th ed., 1990) for administration methods such as oral, intravenous, intraperitoneal, intramuscular or transdermal methods. The pharmaceutically acceptable excipients include in particular water, saline solutions, buffers or any other compound described for example in the Merck Index.

 Also within the scope of the invention is a diagnostic kit or kit comprising an antibody according to the invention, in particular for the assay (including detection) or the identification of NNT-1 / CLF-1 and / or sCNTFRa complex. , in a biological sample, preferably in vitro.

 In particular, a diagnostic kit characterized in that it includes the following elements:

<Desc / Clms Page number 27>

 - a polyclonal, monoclonal antibody or one of their fragments according to the invention, optionally labeled; - If necessary, a reagent for the constitution of the medium suitable for carrying out the immunological reaction; - where appropriate, a reagent allowing the detection of antigen-antibody complexes produced by the immunological reaction, this reagent can also carry a marker, or be capable of being recognized in turn by a labeled reagent, more particularly in the case where said antibody monoclonal, polyclonal or one of their fragments is not marked.

 The invention also includes a method for the detection and / or the assay of NNT-1 / CLF-1 complex and / or sCNTFRa, in a biological sample, characterized in that it comprises the following steps: a) contacting of the biological sample (tissue or biological fluid) with a monoclonal, polyclonal antibody or one of their fragments according to the invention (under conditions allowing an immunological reaction between said antibodies and said NNT-1 / CLF-1 complexes and / or sCNTFRa); b) highlighting of the antigen-antibody complex possibly formed.

 The invention further comprises the use of a monoclonal, polyclonal antibody or a fragment thereof for the diagnosis, in particular in vitro of pathology linked to the abnormal expression of NNT-1 / CLF-1 and / or sCNTFRa complex. , especially for the diagnosis of cancer.

 Furthermore, the monoclonal, polyclonal antibodies or their fragments according to the invention, can also be used for the identification or the localization, in particular tissue or cellular, and / or the assay of NNT-1 / CLF-1 complex and / or sCNTFRa, said use being included in the invention.

 The monoclonal, polyclonal antibodies or their fragments according to the invention also constitute a means of analysis of the expression of NNT-1 / CLF-1 and / or sCNTFRa complexes, in biological samples (fluids or on sections of specific tissues ), for example by immunofluorescence, by enzymatic, radioactive or gold labeling. They make it possible in particular to demonstrate and quantify the normal or abnormal specific presence of NNT-1 / CLF-1 and / or sCNTFRa complex,

<Desc / Clms Page number 28>

 in tissues or biological samples, which makes them useful for the identification and localization of the expression of NNT-1 / CLF-1 complex and / or sCNTFRa, for the diagnosis of pathologies linked to the abnormal presence of NNT complex -l / CLF-1 and / or sCNTFRa, but also for monitoring the development of methods of prevention or treatment of pathology requiring said detection or said assay.

 More generally, the monoclonal, polyclonal antibodies or their fragments according to the invention can be advantageously used in any situation where the expression of NNT-1 / CLF-1 and / or sCNTFRa complex must be observed qualitatively and / or quantitative.

 Preferably, the biological sample consists of a biological fluid, such as serum, whole blood, cells, a tissue sample or biopsies of human origin.

 Any conventional procedure or test can be used to carry out such a detection and / or assay. Said test can be a competition or sandwich test, or any test known to those skilled in the art dependent on the formation of an antibody-antigen immune complex. Depending on the applications according to the invention, the monoclonal, polyclonal antibody or one of their fragments can be immobilized or labeled. This immobilization can be carried out on numerous supports known to those skilled in the art.

These supports may in particular include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, or natural or modified celluloses. These supports can be either soluble or insoluble.

 For example, a preferred method involves immunoenzymatic processes according to the ELISA technique, by immunofluorescence, or radioimmunological (RIA) or equivalent.

 In another aspect, the invention relates to a method for evaluating the affinity of a compound to be tested for the NNT-1 / CLF-1 complex and / or sCNTFRa, characterized in that it comprises: a) bringing a sample containing said NNT-1 / CLF-1 and / or sCNTFRa complex into contact with i) a monoclonal, polyclonal antibody or one of their fragments according to the invention; and ii) said compound to be tested; and

<Desc / Clms Page number 29>

 b) measuring the amount of said monoclonal, polyclonal antibody or one of their fragments, said amount being inversely proportional to the amount of test compounds attached to said NNT-1 / CLF-1 and / or sCNTFRa complex.

 The monoclonal, polyclonal antibodies according to the invention or their fragments can also be used in in vitro methods for the selection of compounds capable of binding to the NNT-1 / CLF-1 and / or sCNTFRa complex, with the desired affinity. Thus, the present invention also comprises methods of selection by competition of pharmaceutical compounds in which the monoclonal or polyclonal antibodies of the invention or their fragments compete with the test compound capable of binding to the NNT-1 / CLF- complex 1 and / or sCNTFRa. Thus, these compounds, identified by the method according to the invention can be used to occupy these binding sites on the NNT-1 / CLF-1 and / or sCNTFR a complex, and act as a modulator or antagonist of the biological activity of NNT-1 / CLF-1 and / or sCNTFRa complexes.

 In a last aspect, the present invention also comprises: the peptide CLF-1 (splicing variant) of sequence SEQ ID No. 4 as well as any derived peptide whose sequence comprises a fragment of at least 5.8, 10, 15, 20,25, 30,35, 40 or 45 consecutive amino acids of the fragment between the positions aa 405 and aa 445 of the sequence SEQ ID No. 4.

 Preferably, such peptides derived from the CLF-1 splicing variant of sequence SEQ ID No. 4 according to the invention are capable of forming an NNT-1 / CLF-1 and / or sCNTFRa complex according to the invention, and / or can be obtained by genetic recombination or by chemical synthesis.

 The invention also includes the nucleic acids coding for the peptide CLF-1 of sequence SEQ ID No. 4 or one of its peptides derived according to the invention, the vectors comprising such nucleic acids as well as the host cells transformed with the using said vectors or nucleic acids.

 The invention further comprises an antibody capable of specifically recognizing the aa 405 - aa 445 domain, or one of its fragments, of the peptide of sequence SEQ ID No. 4.

<Desc / Clms Page number 30>

 The invention also includes any method, using such a peptide of sequence SEQ ID No. 4, or one of its derivatives, a nucleic sequence coding for such peptides, or said body.

 The use of peptides of sequence SEQ ID No. 4 or one of its peptides derived according to the invention in any application known from the prior art for the peptide CLF-1 of sequence SEQ ID No. 6 is also included in the present invention.

 Other characteristics and advantages of the invention appear in the following description with the examples and the figures, the legends of which are shown below.

Legend to the figures: Figures 1A and 1B. Formation of a secreted complex between NNT-1 and CLF-1 1A Upper part: the expression of NNT-1 was detected by Western blot in the lysate of cells transfected with the cDNAs coding for the proteins indicated.

 Bottom part: the NNT-1 / CLF-1 complexes were isolated from the culture media of the same cells by immunoprecipitation with an anti-C-myc monoclonal antibody and the presence of NNT-1 revealed by Western blot with the monoclonal antibody anti-C-myc coupled with peroxidase.

1B Upper part: the expression of NNT-1 was detected by Western blot in the lysate of cells transfected with the anti-C-myc monoclonal antibody coupled to peroxidase.

 Middle part: the fusion proteins containing an Fc region secreted in the supernatant of the transfected cells were revealed by immunoaffinity on the GSepharose protein and Western blot with an antibody directed against human IgG coupled to peroxidase.

 Bottom part: the presence of NNT-1 in the same culture media was analyzed by immunoaffinity on protein G-Sepharose and Western blot with an anti-C-myc monoclonal antibody coupled to peroxidase.

Figure 2. The NNT-1 / CLF-1 heterocomplex induces the proliferation of BAF 3 cells transfected with gp130 / LIFRss and CNTFRa.

<Desc / Clms Page number 31>

 Control BAF cells or stable transfectants expressing the receptors indicated in the figure were cultured in the presence of dilutions of culture medium from COS cells transfected with cDNAs coding for CLF-1 NNT-1 (called CLC), CLF-1 and NNT -1 or relevant controls. The incorporation of [3 H] thymidine expressed in CPM was done in triplicate. The x-axis represents the concentration of culture medium expressed as a one-third serial dilution.

Figure 3. The NNT-1 / CLF-1 complex induces tyrosine phosphorylation of gpl30 and LIFRss.

 The cells were incubated for 20 min. with the heterocomplex NNT-1 / CLF-1 (dilution 1: 7), a preparation purified from cells transfected with a control plasmid (indicated mock in the figure; dilution 1: 7) or CNTF (50 ng / ml). After lysis of the cells and immunoprecipitation with an anti-LIFRP antibody, the proteins were separated by SDS-PAGE, transferred to a PVDF membrane and the proteins phosphorylated in tyrosine revealed using a monoclonal antiphosphotyrosine antibody.

 Left side: BAF cells transfected with cDNAs encoding CNTFa / gpl30 / LIFRp.

 Right part: SK-N-MC cells.

Figures 4A and 4B. Expression of mRNA encoding NNT-1 and CLF-1 in brain tumor cell lines.

 Total RNA was isolated from the indicated cells and analyzed by RT-PCR using primers specific for NNT-1, CLF-1 or P-actin (control).

Figures 5A, 5B, 5C and 5D. Formation of a secreted complex between NNT-1 and sCNTFR.

Figure 5A: The expression of NNT-1 was detected by Western blot in the lysate of cells transfected with the cDNAs coding for the proteins indicated.

Figure 5B: Expression of CNTFR was detected by Western blot in the lysate of cells transfected with cDNAs encoding the proteins indicated.

Figure 5C: The presence of NNT-1 in the culture media of the same cells was detected by immunoprecipitation with the anti-C-myc monoclonal antibody followed by a Western blot of the fraction purified with the anti-protein monoclonal antibody vs.

<Desc / Clms Page number 32>

Figure 5D: The NNT-1 / CNTFR complexes were isolated from the culture media of the same cells by immunoprecipitation with an anti-CNTFR monoclonal antibody and the presence of NNT-1 revealed by Western blot with the anti-protein C monoclonal antibody.

SN: supernatant; PI: immunoprecipitation; WB: Western blot.

Figure 6. The NNT-1 / sCNTFR heterocomplex induces the proliferation of BAF 3 cells transfected with gpl30 and LIFRss.

 The BAF 3 cells transfected in a stable manner with the gpl30 and LIFRss receptors were cultured in the presence of dilutions of culture medium from COS cells transfected with the cDNAs coding for NNT-1, sCNTFR, NNT-1 and CLF-1 or NNT-1 and sCNTFR. The recombinant LIF protein has been used as a positive control of cell proliferation. The incorporation of [3 H] thymidine expressed in CPM was done in triplicate. The abscissa axis represents the concentration of culture medium expressed in the form of a one-third serial dilution.

EXAMPLE 1 Materials and Methods
Cell cultures
COS I monkey, SK-N-MC human neuroblastoma, U373 MG human glioma and BAF / 3 mouse myeloid lines were obtained from the American Type Culture Collection (ATCC, Rockville, MD) and maintained according to specifications. . The LN 215, LN 229 and LN 415 glioma lines were generously donated by Dr. PY Dietrich (Hôpital Cantonal Universitaire de Genève, Geneva, Switzerland) and cultured in DMEM medium supplemented with 10% fetal calf serum (SVF ). For protein purifications, COS 1 cells were cultured in Yssel medium {Yssel, De Vries, et al. 1984 ID: 378} after transfection. Recombinant cytokines and soluble receptors were obtained from R & D systems (Abingdon, Oxon, UK).

Cloning of the cDNA encoding NNT-1
An EST (Expressed Sequence Tag) coding for NNT-1 (GenBank, Accession No. AI752561) was identified by TBLASTN bioinformatics search using the known amino acid sequence of NNT-1 in the search query.

<Desc / Clms Page number 33>

 The cDNA encoding NNT-1a was then amplified by PCR anchored on lymph node cDNA (Race-Ready human lymph node cDNA; Clontech, Palo Alto, CA) using the primer AP-1 ( from the Clonetech Marathon amplification kit) and the specific primer for NNT-1 5'-AAGGGGGAGCGAAGAGGAGAAGG-3 '(SEQ ID No. 8) (35 PCR cycles, 94 C, 30; 60 C, 30; 72 C , 1). The amplified cDNA was cloned into the vector pGEM-Teasy (Promega Corp., Madison, WI) and sequenced. To produce an NNT-1 derivative containing the C-myc epitope EQKLISEEDL (SEQ ID No. 9) (NNTlmyc) the cDNA of NNT-1 was amplified from the insert of the vector pGEM-Teasy using primers 5'-CGCGGATCCGCCATGGACCTCCGAGC-3 '(SEQ ID No. 10) and 5'GCGGAATTCAGAGGTCCTCCTCGGAGATCAGCTTCTGCTCGAAGCCATGAGC CCCCAG-3' (SEQ ID No. 11) (10 PCR cycles, 94 C, 30; 60 C, 30; ).

The cDNA coding for NNT-1myc was cloned into the expression vector pCDNA3 (Invitrogen, Leek, Holland) using the restriction enzymes Bam HI and Eco RI and verified by sequencing.

Cloning of a new CLF-1 splicing variant and production of chimeric cDNA coding for a CLF-1-Fc fusion protein
By bioinformatic screening using BLASTN on the EST database at NCBI (http //: www.ncbi.nlm.nih / BLAST), we identified an EST coding for a new variant of CLF-1 splicing (GenBank , accession No. AI406406) containing 293 additional nucleotides to the published sequence of CLF-1 due to the use of a splice acceptor sequence for exon 9 in the gene sequence upstream from that published for CLF-1. The cDNA coding for this splicing variant (SEQ ID No. 3) was amplified from human fetal lung cDNA (Clonetech) using the primers 5'-CGCGAATTCCCATGCCCGCCGGCCGCCG-3 '(SEQ ID No. 12 ) and 5'CGCGAATTCTAACTAGGGTGAGTATGTTC-3 '(SEQ ID No. 13) (30 PCR cycles, 94 C, 30; 60 C, 30; 72 C, 2). The amplified cDNA was cloned into the Eco RI restriction site of the vector pCDNA3 (Invitrogen). The amino acid sequence of the protein encoded by this cDNA diverges only at the C-terminus of the original CLF-1 sequence. To produce a cDNA coding for a CLF-1Fc fusion protein, the coding region of CLF-1 was amplified by PCR, cloned in phase with a cDNA fragment coding for the Fc region of human IgG1 and sequenced.

<Desc / Clms Page number 34>

Production of a chimeric cDNA coding for a CNTFRaFc fusion protein
The cDNA encoding a soluble form of the a chain of the CNTF receptor was amplified using the primers 5'-CCGCTCGAGGCCCAGAGACACAGTCCACA-3 '(SEQ ID No. 14) and 5'-CCGCTCGAGGTCACAGATCTTCGTGGT-3' (SEQ ID No.

15), cloned in phase with a cDNA fragment coding for the Fc part of human IgG1 and sequence.

Transient transfection
COS 1 cells were cultured at the rate of 1 × 10 5 cells / well in 6-well culture dishes of 35 mm 2 and transfected the next day with Fugene 6 ™ (Roche Diagnostics, Meylan, France) according to the manufacturer's instructions. For cotransfections, the plasmid / Fugene 6TM complexes were generated and added to the cells independently.

Immunoprecipitation of the CLF-lFc / NNT-lmyc complex and analysis by Western blot
COS 1 cells were lysed 72 hours after transfection in RIPA buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 1% Nonidet P40.0.5% sodium deoxycholate, 0.1% SDS). Cell lysates were passed through 0.8 mm syringe needles and cell debris removed by centrifugation. The lysates were then mixed 1: 1 with Tris-Glycine-SDS sample buffer (Novex, San Diego, CA) containing 750 mM p-mercaptoethanol and heated to 95 C for 5 '. In parallel, the culture media were centrifuged sequentially at 3000 then 13000 RPM in a microcentrifuge to remove cell debris. The media were incubated for one hour with 25 μl of protein G-Sepharose (Pharmacia, Uppsala, Sweden) at 4 C. After elimination of the protein G-Sepharose, from the anti-Cmyc monoclonal antibody (Sigma Chemical Co. St. Louis, MO) was added (final concentration 10 µg / ml) for 2 hours at 4 ° C. 50 l of protein G-Sepharose were then added and the incubation continued for one hour. The G-Sepharose protein was washed three times with PBS, taken up in 100 μl of tris-Glycine-SDS sample buffer containing 375 mM of p-mercaptoethanol and heated to 95 ° C. for 5 '. For the immunoprecipitation of Fc fusion proteins, the same procedure was followed, except that the first

<Desc / Clms Page number 35>

 incubation was carried out with Sepharose coupled to human serum albumin and the addition of anti-C-myc antibodies omitted. The proteins were analyzed by SDSPAGE on a 12% polyacrylamide gel and electrotransferred on a PVDF membrane (Millipore Corp., Bedford, MA). The membranes were blocked in TBS buffer supplemented with 0.15% Tween-20 and 5% milk powder (blocking buffer). Proteins comprising the C-myc epitope were detected by incubation with an anti-C-myc antibody coupled to peroxidase (Roche Diagnostics) diluted 1: 1000 in blocking buffer. Fusion proteins containing an Fc region were revealed using a human anti-IgG coupled to peroxidase (1: 2000 dilution in blocking buffer; Amersham France SA). Peroxidase was revealed by chemiluminescence (ECL; Amersham France S. A.) following the manufacturer's instructions.

Purification of CLF-1-Fc and the NNT-lmyc / CLF-1-Fc complex
Culture media from cells transfected with cDNAs encoding CLF-1-Fc or NNT-1-myc and CLF-1-Fc were harvested 3 days after transfection. Cell debris was removed by centrifugation, culture media concentrated
10 x using Centricon-30 concentrators (Millipore corp.) Then pre-incubated with 25 l / ml of Sepharose coupled to human albumin. The CLF-1-Fc / NNT-1- myc complexes were affinity purified by incubating the concentrated culture media with anti-mouse IgG magnetic beads (3 × 108 a-mouse IgG Dynabeads M-450; DynalA.S ., Olso, Norway) preincubated with the anti-C-myc monoclonal antibody. The complexes were eluted from the beads by the addition of C-myc peptide (final concentration
100 g / ml; Roche Diagnostics) for 16 h at 4 C. The excess peptides were removed by dilution and successively on a Microcon-30 column (Millipore Corp.). The presence of CLF-1-Fc and NNT-1-myc in the immunoaffinity-purified complex was verified by Western blot, as described in the previous section (Pierce, Rockford, IL).

Analysis of tyrosine phosphorylation
The SN-N-MC cells were incubated in serum-free culture medium for 16 h, stimulated for 10 minutes at 37 ° C. in the presence of the samples to be tested and then lysed in 10 mM Tris-HCl buffer pH 7.6, 5 mM EDTA, 50 mM NaCl, 30 mM sodium pyruvate, 50 mM sodium fluoride, 1 mM sodium orthovanadate, 1% Brij 96 containing protease inhibitors (1 g / ml pepstatin A, 2 ug / ml leupeptine,

<Desc / Clms Page number 36>

 5 µg / ml aprotinin, 1 mM phenylmethylsulphonyl fluoride; Sigma Chemical Corp. ). The lysates were stirred for 60 min at 4 ° C and the insoluble fractions removed by centrifugation at 12,000 x g for 30 min. After having been adjusted for the protein content, the lysates were incubated for 16 h in the presence of specific antibodies directed against LIFRss (10 μg Ab / ml, SC-659; Cruz Biotechnology, Santa Cruz, CA). The antigen-antibody complexes were isolated by affinity chromatography on protein A-Sepharose (Pharmacia), washed in lysis buffer and eluted in Tris-Glycine-SDS sample buffer containing 375 mM P-mercaptoethanol, analyzed by SDSPAGE and transferred to a PVDF membrane. After blocking, the membrane was successively incubated with an anti-phosphotyrosine monoclonal antibody (4G10, 1 g / ml; UBI, Lake Placid, NY) and a polyclonal goat anti-mouse antibody coupled to peroxidase (diluted 1: 4000; Biosource, Camarillo, CA). The membrane bound antibody was revealed by chemiluminescence.

Proliferation of BAF / 3 cells
BAF / 3 cells are negative for the expression of many cytokine receptors and can be transfected to stably express various combinations of receptors for IL-6 family cytokines. In this study, transfected BAF / 3 cells expressing the following combinations of receptors were used: gpl30, gpl30 + LIFRss, gpl30 + OSMR ss (chain (3 of the OSM receptor), gpl30 + IL- 6Ra, gpl30 + LIFRp + IL -6Ra, gpl30 + LIFRss + CNTFRa. The parental or transfected cells were cultured in triplicate at the rate of 104 cells / well in 100 μl culture medium supplemented with 10% FCS and serial dilution of the samples to be tested. a 72 hour incubation at 37 ° C., 0.5 Ci of [6-3H] thymidine (74 GBq / mmol; Amersham France SA) was added to each well for a period of 4 hours. The incorporation was measured at using a counter (3.

Detection of mRNAs coding for CLF-1 and NNT-1 by RT-PCR
The RNA was isolated using TRIzol (Life Technologies, Paisley, UK). The cDNA was synthesized with SuperScript II reverse transcriptase using 5 g of RNA as substrate and hexamers as primer (Life Technologies). One-fiftieth of the cDNA was then amplified by PCR using, respectively, the primers 5'TGGCTCCTGCCTCTATGTTG-3 '(SEQ ID No. 16) and 5'-

<Desc / Clms Page number 37>

 CCACTCGGTAGCGGATCTGG-3 '(SEQ ID No. 17) for CLF-1, and 5'-CTCAATCG CACAGGGGAC-3' (SEQ ID No. 18) and 5'-AAGGGGGAGCGAAGAGGAGAAGG-3 '(SEQ ID No. 8) for NNT- 1. The PCR product was analyzed by agarose gel electrophoresis.

EXAMPLE 2 NNT-1 is only secreted in the presence of CLF-1 The cytokine NNT-1 contains a signal peptide (Senaldi et al., 1999; et al., 1999). A derivative of this cytokine (NNT-1-myc) was expressed comprising an epitope recognized by an anti-C-myc antibody in the monkey kidney fibroblastic line COS.

Although the production of the recombinant protein is clearly detectable in these cells (cf. FIG. 1A), the secretion of NNT-1 in the culture medium was not observed (cf. FIGS. 1A and 1B and results not presented) . To test whether coexpression of a second chain was required for secretion of NNT-1, as described for IL-12, the cDNA encoding NNT-1-myc was transfected alone or co-transfected with that encoding CLF-1 in COS cells. The culture medium was analyzed for the presence of NNT-1-myc by immunoprecipitation and Western blot. The cytokine NNT-1 was only observed in the supernatants of cells co-transfected with the cDNAs coding for NNT-1 and CLF-1 (cf. FIG. 1A). These results indicate that the release of NNT-1 by the cells is dependent on the co-expression of CLF-1.

EXAMPLE 3 NNT-1 Complexes with a CLF-1Fc Fusion Protein
It was then tested whether NNT-1 and CLF-1 were released as a heterocomplex. The expression vector encoding NNT-1-myc was co-transfected with cDNAs encoding fusion proteins CLF-1-Fc or sCNTFRa-Fc.

As a control, transfections with the cDNAs for NNT-1-myc, CLF-1-Fc, sCNTFRa-Fc or the empty expression vector were carried out in parallel. The proteins complexed with the Fc fusion proteins were immunoprecipitated and NNTlmyc revealed by Western blotting with an anti-myc antibody. NNT-1 was only detected in the culture media of cells co-transfected with NNT-1-myc and CLF-1Fc, clearly showing the formation of a secreted heterodimeric complex between these two proteins (see Figure 1B ).

EXAMPLE 4 The NNT-1 / CLF-1 complex induces the proliferation of BAF / 3 cells transfected with cDNAs encoding CNTFR [alpha] / gp130 / LIFRss

<Desc / Clms Page number 38>

To identify the components of the receptor for NNT / CLF-1, the ability of the complex to induce the proliferation of BAF / 3 cells transfected with different combinations of the cDNAs coding for IL-6Ra, CNTFRa, gpl30 and LIFRP was studied.

The culture medium of the COS cells co-transfected with NNT-1 / CLF-1 or NNT-1 / CLF-1-Fc was tested at various concentrations on the BAF / 3 transfectants. The culture medium of COS cells transfected with NNT-1 or CLF-1 alone was used as a control. Proliferation was only observed on BAF / 3 cells cotransfected with the combination of cDNAs coding for CNTFRa, gpl30 and LIFRp.

No incorporation of [3H] -thymidine was observed in the cells transfected with gp130 or gp130 and LIFRP (FIG. 2). These results show that the NNT-1 / CLF-1 complex is biologically active and underline the importance of the a chain of the CNTF receptor in the formation of a functional receptor for this heteromeric cytokine.

EXAMPLE 5 The NNT-1 / CLF-1 complex induces the tyrosine phosphorylation of gpl30 and LIFRp in SK-N-MC cells and transfected BAF / 3
To examine the capacity of the NNT-1 / CLF-1 complex to induce intracellular signals, said complex was purified from the culture medium of COS cells cotransfected with the two cDNAs by immunoaffinity and its capacity to induce the tyrosine phosphorylation of gpl30, LIFRss has been tested in BAF / 3 transfectants and SK-N-MC neuroblastoma cells. Exposure to the NNT-1 / CLF-1 complex of BAF / 3 cells transfected by the combination of cDNAs coding for CNTFRa, gpl30 and LIFRss induced the phosphorylation of LIFRp (cf. FIG. 3). No phosphorylation was observed with the control represented by the proteins purified by immunoaffinity of COS cells transfected with an empty expression vector (cf. FIG. 3). Similarly, the induction of phosphorylation of gpl30 and LIFRp was observed on SK-N-MC neuroblastoma cells which are known to express CNTFRa, gpl30 and LIFRp (see Figure 3) at heterocomplex a was followed by the tyrosine phosphorylation of gpl30, demonstrating that the complex is biologically active These results are in agreement with the observations that the preparations of recombinant NNT-1 produced in bacteria can induce the tyrosine phosphorylation of gp130, LIFRss and STAT 3 .

<Desc / Clms Page number 39>

EXAMPLE 6 Expression Profiles of the mRNAs Coding for CLF-1 and NNT-1
The CNTFRa, gpl30 and LIFRss subunits forming the receptor for the NNT-1 / CLF-1 complex are known to be expressed by several cell lines derived from brain tumor. The coexpression of CLF-1 and NNT-1 by these cells would result in the production of the heterocomplex and an autocrine activity on their proliferation. The expression of mRNAs encoding CLF-1 and NNT-1 was therefore studied by reverse-PCR transcriptase (RT-PCR) in cell lines derived from brain tumors. As shown in Figures 4A and 4B, expression of mRNA encoding NNT-1 was observed in the cells of neuroblastoma SK-N-MC and glioblastoma U373. Similarly, CLF-1 is detectable by RT-PCR in SK-NMC cells and in several glioblastoma lines.

 These examples show that NNT-1 forms a stable complex with CLF-1. The formation of this heterocomplex is essential for the release of NNT-1 into the cell culture medium and represents the first demonstration of such a mechanism of production control in the family of cytokines homologous to IL-6. This control mode is close to that described for the IL-12 heterodimer (cf. FIGS. 1A and 1B) (Trinchieri, G., Annu. Rev. Immunol. 13: 251-276, 1995). It is therefore very likely that although active at high concentration after production in bacteria, NNT-1 is normally secreted and therefore functionally active only in the form of a complex with CLF-1.

 The heterocomplex NNT-1 / CLF-1 is capable of inducing the tyrosine phosphorylation of gpl30, and LIFRss (cf. FIG. 2) as well as the proliferation of BAF / 3 cells via CNTFRa, gpl30 and LIFRss (cf. FIG. 3) . If we consider NNT-1 as a conventional cytokine and CLF-1 as a soluble a chain, the NNT-1 receptor complex comprises two a chains (CLF-1 and CNTFRa). Such an organization is unprecedented in this family. As the name suggests, CNTFRa was originally identified as a receptor for CNTF (Ip, N. Y. et al., Annu. Rev. Neurosci.

19: 491-515, 1996), a cytokine allowing the survival of motor neurons, inducing the differentiation and proliferation of certain neuronal lines and having neuromuscular functions (Alexander, WS, et al., Curr. Biol. 9: 605- 608, 1999). Acting on the same receptor, the NNT-1 / CLF-1 complex most likely has the same properties.

<Desc / Clms Page number 40>

The mRNAs encoding NNT-1 and CLF-1 are expressed by a relatively large number of tissues (Senaldi, G., et al., Proc. Natl. Acad. Sci. USA 96: 11458-11463, 1999; Shi, Y ., et al., Biochem. Biophys. Commun. Res. 262: 132-138, and Elson, GC, et al., J. Immunol. 161: 1371-1379, 1998). The expression of CNTFRa, on the other hand, seems to be restricted to developing or adult nervous tissue and to skeletal muscle. The effects of the NNT-1 / CLF-1 complex will therefore be limited by the restricted distribution of one of the receptor chains, CNTFRa. Expression of the mRNA encoding CLF-1 mRNA was detected by in situ hybridization in the developing brain, the craniofacial mesenchyme (Takahashi, R., et al., Nat.

Broom. 7: 79-84, 1994) and by Northern blot in skeletal muscles (Elson, GC, et al., J. Immunol. 161: 1371-1379, Although expression of NNT-1 mRNA in adult skeletal muscle or fetal brain has not yet been reported, these observations strongly suggest a potential role for the NNT-1 / CLF-1 heterocomplex in the developing brain, especially in neuronal survival and differentiation as well as in neuromuscular function.

 Mice deficient in the gene coding for CNTF, although exhibiting neuronal degeneration have a phenotype that is little affected, observable only late in adults (Masu, Y., et al., Nature, 365: 27-32, It has also been observed 2.5% of the Japanese population is homozygous for a mutation inactivating the CNTF gene without any effect being detected even in the elderly (DeChiara, TM, et al., Cell., 83: 313-322, Contrasting strongly with these observations, mice deficient for CNTFRa do not suckle, die quickly after birth and show a dramatic loss in the population of motor neurons (Yssel, H., et al., J. Immunol. Methods 72: 219- 227, These observations indicate the existence of another unidentified ligand of CNTFRa important during development, commonly called CNTF-2. It is clear that CNTF-2 most certainly corresponds to the heterocomplex NNT-1 / CLF-1 This hypothesis is supported by the s observations on mice in which the gene coding for CLF-1 has been inactivated: these mice have a phenotype which can be superimposed on that observed in mice deficient for CNTFRa (Takahashi, R., et al., Nat. Broom. 7: 79-84, 1994).

<Desc / Clms Page number 41>

 CNTFRa, gpl30 and LIFR (3 are known to be expressed by numerous neuroblastoma lines. A strong expression of the mRNAs coding for CLF-1 and NNT-1 has been observed in the lines of neuroblastomas and glioblastomas. signal induction via gpl30 and LIFRss can induce cell proliferation, it is highly likely that the NNT-1 / CLF-1 complex is involved as a growth factor in these types of brain tumors. In addition, like mRNA for CLF -1 and NNT-1 are detectable in muscle, NNT-1 / CLF-1 should also be involved in the growth of certain tumors derived from muscle such as myosarcomas. We have observed by flow cytometry that lines derived from myosarcomas express CNTFRa (results not shown).

 The NNT-1 / CLF-1 complex, a ligand for the CNTFRa receptor, is thus capable of forming a ternary complex with the soluble form of CNTFRa which has been identified in the cerebrospinal fluid and the skeletal muscles after damage (Davis, S. , et al., Science, 259: 1736-1739, 1993). Such an NNT-1 / CLF-1 / sCNTFR [alpha] complex formed in the cerebrospinal fluid would have certain distant actions in the central nervous system, making cells normally insensitive, sensitive to the effect of NNT-1 / CLF - 1. An NNT-1 / CLF-1 / sCNTFR [alpha] complex would thus act on any cell expressing gp130 and LIFRp. The formation of an NNT-1 / CLF-1 / sCNTFR [alpha] complex in skeletal muscle and diffusion in the circulation would allow systematic action.

 As already mentioned, CLF-1 and NNT-1 have a wide tissue distribution and it therefore seems likely that the activity of CLF-1 / NNT-1 is limited by the restricted expression of CNTFRa. Unlike other members of the IL-6 family, effects of CNTF on hematopoiesis have not been reported. However, the addition of soluble CNTFRα or the transfection of the cDNA encoding CNTFRα into hematopoietic precursor cells makes them sensitive to CNTF (Davis, S., et al., Science, 259: 1736-1739, 1993; Ip, NY, et al., Neuron 10: 89-102, These observations indicate that although soluble forms of the receptor make these cells sensitive to CNTF, CNTFRα is not normally expressed by hematopoietic precursors, however, mice in which the gene encoding CLF-1 has been inactivated have a reduced number of hematopoietic precursors which suggests a role for

<Desc / Clms Page number 42>

 this protein in the regulation of hematopoiesis (Takahashi, R., et al., Nat. Genet.

7: 79-84, 1994). It is likely that a complex between NNT-1, CLF-1 and CNTFRa is responsible for this effect, although a reduction in hematopoiesis in mice deficient for CNTFRa has not been reported.

EXAMPLE 7 NNT-1 is also secreted in the presence of CNTFR and the two proteins form a secreted heterodimeric complex.

 It has been tested whether the co-expression of CNTFR with an NNT-1 derivative (NNTImyc / pc) results in the secretion of NNT-1 myc / pc. The cDNA coding for NNT-1myc / pc was transfected alone or co-transfected with that coding either for CLF-1, or for the transmembrane form of CNTFR (tmCNTFR), or for a soluble derivative (sCNTFR) in COS cells . The presence of NNT-1-myc / pc in the culture medium was analyzed by immunoprecipitation and Western blot. The cytokine NNT-1 was only observed in the supernatants of cells co-transfected with the cDNAs coding for NNT-1 and either CLF-1 or both forms of CNTFR (cf. FIG. 5C). These results indicate that the release of NNT-1 by the cells is carried out after the coexpression of sCNTFR or the membrane form of CNTFR. It was then tested whether NNT-1 and CNTFR were released as a heterocomplex. The culture media of the cells transfected only with NNT-1 myc / pc or co-transfected with NNT-lmyc / pc and sCNTFR or tmCNTFR were immunoprecipitated with anti-CNTFR monoclonal antibodies. The presence of NNT-lmyc / pc in the resulting purified fractions was analyzed by Western blot. NNT-1 was only observed in the purified fractions of the supernatants of cells co-transfected with the cDNAs coding for NNT-1 and sCNTFR or tmCNTFR (cf. FIG. 5D). These results demonstrate that NNT-1 and sCNTFR form a secreted complex, and that tmCNTFR can probably be cleaved and thus give rise to a released form of CNTFR which will generate the NNT-1 / CNTFRs complex.

EXAMPLE 8 The NNT-1 / CNTFR complex induces the proliferation of BAF / 3 cells transfected with the cDNAs coding for gp130 and LIFRss.

 The culture medium for COS cells co-transfected with NNT-1 / sCNTFR was tested at various concentrations on BAF / 3 transfected with cDNAs coding for gp130 and LIFRp. The culture medium for COS cells transfected with NNT-1 or

<Desc / Clms Page number 43>

 sCNTFR alone or co-transfected with NNT-1 and CLF-1 was used as a control as well as a culture medium containing the purified recombinant LIF protein (rLIF). This control was added because the functional complex receptor for LIF comprises gpl30 and LIFRp. Proliferation was only observed with the culture medium of the COS cells co-transfected with NNT-1 and sCNTFR and with rLIF (FIG. 6). These results show that the NNT-1 / sCNTFR complex is biologically active on cells expressing only gpl30 and LIFRP and demonstrate that the activity of this heterodimeric cytokine is independent of the membrane protein CNTFR.

Claims (41)

1. Isolated complex comprising an NNT-1 protein, characterized in that it also comprises at least one CLF-1 protein and / or an sCNTFRa protein.  2. Complex according to claim 1, characterized in that it comprises: i) the NNT-1 protein of sequence SEQ ID No. 2, or a protein whose sequence has a percentage identity after optimal alignment of at least 80% with the sequence SEQ ID No. 2; ii) the CLF-1 protein of sequence SEQ ID No. 4 or No. 6, or a protein whose sequence exhibits a percentage of identity after optimal alignment of at least 80% with the sequence SEQ ID No. 4 or No. 6; and / or iii) the sCNTFRa protein of sequence SEQ ID No. 7 or a protein whose sequence has a percentage identity after optimal alignment of at least 80% with the sequence SEQ ID No. 7.  3. Complex according to claim 1 or 2, characterized in that the NNT-1 protein, the CLF-1 protein and / or the sCNTFRa protein is obtained by chemical synthesis or by recombinant route.  4. Complex according to one of claims 1 to 3, characterized in that the NNT-1 protein, the CLF-1 protein and / or the sCNTFRa protein are natural proteins expressed by cells or cell lines, in particular of origin animal.  5. Complex according to one of claims 1 to 4, characterized in that said complex is obtained by a process comprising bringing the NNT-1 protein into contact with the CLF-1 protein and / or the sCNTFRa protein, preferably in a medium favoring the formation of said complex.  6. Complex according to one of claims 1 to 3, characterized in that the NNT-1 protein is coupled by covalent bond to the CLF-1 protein and / or to the sCNTFRa protein to form a fusion protein.  7. Vector or a system of two or three co-expression vectors, characterized in that said vector or said system of two or three vectors contains a nucleic sequence coding for an NNT-1 protein, a nucleic sequence coding for a CLF protein -1 and / or a nucleic sequence coding for a protein <Desc / Clms Page number 45>  sCNTFRa.  8. Vector or a system of two or three vectors according to claim 7, characterized in that said expressed NNT-1 protein, said expressed CLF-1 protein and / or said expressed sCNTFRa protein are capable of forming a complex when they are put in contact with each other.  9. Cell, characterized in that it contains a vector or a system of two or three vectors according to claim 7 or 8.  10. Cell according to claim 9, characterized in that said cell is a eukaryotic or prokaryotic cell.  11. Cell according to claim 10, characterized in that said cell is a mammalian cell.  12. A method of preparing a complex as defined in claim 1, characterized in that it implements a vector or system of two or three vectors according to claim 7 or 8, or a cell according to one of claims 9 to 11.  13. Process for the preparation of a complex as defined in claim 1, characterized in that cells transformed according to one of claims 9 to 11 are cultured under conditions allowing the expression of the NNT-1 proteins, CLF-1 and / or sCNTFRa and that said complex formed is recovered.  14. A method of preparing a complex as defined in claim 1, characterized in that it comprises the following steps: a) culture of a cell containing a DNA sequence coding for an NNT- protein 1 and a DNA sequence coding for a CLF-1 protein and / or a DNA sequence coding for a sCNTFRa protein in a culture medium suitable for said cell; b) recovering said complex formed from the culture medium and / or lysate of said cultured cells.  15. Method according to claim 14, characterized in that said cell in step a) is a cell according to one of claims 9 to 11.  16. The method of claim 14, characterized in that said cell in step a) is a cell naturally expressing an NNT-1 protein, a CLF-1 protein and / or an sCNTFRa protein. <Desc / Clms Page number 46>  17. The method of claim 16, characterized in that said cell in step a) is a cell from an animal cell line.  18. Method according to one of claims 13 to 17, characterized in that the NNT-1 protein, the CLF-1 protein and / or the sCNTFRa protein are secreted outside said cultured cell and the complex formed is directly taken from the culture medium.  19. A method of preparing a complex as defined in claim 1, characterized in that it comprises the following steps: a) culture of a cell containing a DNA sequence coding for an NNT- protein 1, a cell containing a DNA sequence coding for a CLF-1 protein and / or a cell containing a DNA sequence coding for a protein sCNTFRa in a culture medium suitable for each of said cells; b) bringing the NNT-1 proteins, CLF-1 proteins and / or sCNTFRa proteins contained in their respective culture medium and / or in their respective cell lysate into contact; c) recovery of said complex formed in step b).  20. Complexes capable of being obtained by a process according to one of claims 12 to 19.  21. NNT-I / CLF-1 complex as defined in one of claims 1 to 6 and 20, characterized in that said complex is capable of fixing the CNTFRa receptor.  22. NNT-1 / sCNTFRa complex as defined in claims 1 to 6 and 20, characterized in that said complex is capable of fixing the LIFRss receptor.  23. Monoclonal, polyclonal antibodies, or a fragment thereof, directed specifically against an NNT-1 / CLF-1 complex as defined in one of claims 1 to 6, 20 and 21.  24. Monoclonal, polyclonal antibodies, or a fragment thereof, directed specifically against an NNT-1 / CLF-1 / sCNTFRa complex or an NNT-1 / sCNTFRa complex as defined in one of claims 1 to 6, 20 and 22.  25. Use of an NNT-1 / CLF-1 complex as defined in one of claims 1 to 6 and 20 to 21, or of an antibody according to claim 23, for the preparation of a medicament intended for modulate the biological activity of the receptor <Desc / Clms Page number 47>  CNTFRo / gpl30 / LIFRp complex.  26. Use of an NNT-1 / CLF-1 complex or of an antibody according to claim 25, for modulating the signal transduction induced by the tyrosine phosphorylation of gpl30 and LIFRss.  27. Use of an NNT-1 / CLF-1 complex or of an antibody according to claim 25, for increasing or decreasing the survival, growth, proliferation or differentiation of cells expressing the receptor complex CNTFR [alpha] / gp130 / LIFRss.  28. Use of an NNT-1 / CLF-1 complex or of an antibody according to claim 27, characterized in that said cells expressing the CNTFR [alpha] / gp130 / LIFRss receptor complex are central, peripheral neurons, neurons involved in neuromuscular function or skeletal muscle cells.  29. Use of an NNT-1 / CLF-1 complex or of an antibody according to claim 27, for decreasing the survival, growth or proliferation of tumor cells.  30. Use of an NNT-1 / CLF-1 complex according to claim 27, to facilitate the proliferation and / or inhibit the differentiation of stem cells.  31. Use of an NNT-1 / CLF-1 / sCNTFRa or NNT-1 / sCNTFRa complex as defined in one of claims 1 to 6, 20 and 22 or of an antibody according to claim 24, for the preparation of a medicament intended to modulate the biological activity of the gp130 / LIFRss receptor of cells expressing said gpl30 / LIFRp receptor.  32. Use according to claim 31, characterized in that said cells expressing said gp130 / LIFRss receptor are the cells involved in the immune system, the hematopoietic system, the nervous system, the reproductive system, the liver, the bones or the skeletal muscle .  33. Complex according to one of claims 1 to 6.20 to 22 or an antibody according to claim 23 or 24 as a medicament.  34. Pharmaceutical composition, characterized in that it comprises at least one compound chosen from the following compounds: a) a complex according to one of claims 1 to 6, 20 to 22; b) an antibody according to claim 23 or 24; <Desc / Clms Page number 48>  c) a vector or vector system according to claim 7 or 8; d) a cell according to one of claims 9 to 11; and e) an animal cell capable of naturally expressing an NNT-1 protein, a CLF-1 protein and / or an sCNTFRa protein.  35. Pharmaceutical composition according to claim 34, for the prevention or treatment of neurodegenerative diseases, for the repair or regeneration of nervous tissue or skeletal muscle, or for the maintenance of muscle mass in the paralyzed.  36. Pharmaceutical composition according to claim 34, for the prevention or treatment of amyotrophic lateral sclerosis, Parkinson's disease or Huntington's disease.  37. Pharmaceutical composition according to claim 34, for the treatment of obesity or its associated diseases.  38. Pharmaceutical composition according to claim 34, for the prevention or treatment of cancer.  39. Pharmaceutical composition according to claim 34, for improving fertility, and in particular for avoiding endometriosis and / or facilitating the implantation of blastocysts, for facilitating hematopoiesis and particularly in the treatment of thrombocytopenia, or for the treatment of retinitis and more particularly retinitis pigmentosa.  40. A diagnostic kit comprising a monoclonal, polyclonal antibody, or a fragment thereof according to claim 23 or 24.  41. Use of a monoclonal, polyclonal antibody, or a fragment thereof according to claim 23 or 24 for the assay or the in vitro identification of a complex as defined in claim 1 in a biological sample.