Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
  • C12Q1/701—Specific hybridization probes
  • C12Q1/708—Specific hybridization probes for papilloma
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6813—Hybridisation assays
  • C12Q1/6841—In situ hybridisation
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q2600/00—Oligonucleotides characterized by their use
  • C12Q2600/154—Methylation markers

Definitions

• the present invention relates to the field of nucleic acid hybridization probes.
• ISH In situ hybridization
• Probes are commonly labeled with haptens for affinity-based, enzyme-mediated colorimetric detection, or fluorescent moieties for direct fluorescent detection (so-called fluorescence in situ hybridization; “FISH”), or radioactively labeled.
• HPV infection Human papillomavirus (HPV) infection is a well-established risk factor for the development of cervical carcinomas and precancerous lesions and, in recent years, the use of in situ hybridization for the detection of HPV genes or transcripts in human cervical cell specimens has been adopted.
• nucleic acid hybridization probes for in situ hybridization applications.
• One embodiment of the invention provides a non-naturally occurring linear nucleic acid molecule having a 5’ end and a 3’ end, which includes: a series of first nucleic acid segments consecutively complementary to a preselected nucleic acid target sequence; and between each adjacent pair of first nucleic acid segments, a spacer nucleic acid segment, wherein the spacer segments are not substantially complementary to the preselected nucleic acid target sequence, and wherein at least some nucleic acid monomers of the spacer segments are labeled with detectable labels, such as fluorescent moieties or haptens.
• the spacer segments may be at least substantially not complementary to the first segments.
• the linear nucleic acid molecule may further include at one or both of the 5’ end and the 3’ end an additional spacer nucleic acid segment.
• Another embodiment of the invention provides a non-naturally occurring linear nucleic acid molecule having a 5’ end and a 3’ end, which includes: a series of first nucleic acid segments consecutively complementary to a preselected nucleic acid target sequence; and between each adjacent pair of first nucleic acid segments, a spacer nucleic acid segment, wherein the spacer segments are not substantially complementary to the preselected nucleic acid target sequence, and wherein at least some nucleic acid monomers of the spacer segments are labeled with an allyl amine group, for example, at least some of the monomers may be aminoallyl ribonucleotides or aminoallyl deoxyribonucleotides.
• the spacer segments may be at least substantially not complementary to the first segments.
• the linear nucleic acid molecule may further include at one or both of the 5’ end and the 3’ end an additional spacer nucleic acid segment.
• a still further embodiment of the invention provides a method for detecting a target nucleic acid sequence in a sample that includes the steps of: providing a non-naturally occurring nucleic acid molecule (or any of the probe embodiments) as described herein; contacting the non-naturally occurring nucleic acid molecule (or probe embodiment) with an isolated biological sample that may contain nucleic acid molecules that include the preselected nucleic acid target sequence under conditions permitting hybridization of the non- naturally occurring nucleic acid molecule (or probe embodiment) to the nucleic acid molecules including the preselected nucleic acid target sequence if present in the sample; and detecting label of any of the non-naturally occurring nucleic acid molecule (or probe embodiment) that may be hybridized to the nucleic acid molecules that include the preselected nucleic acid target sequence if present in the sample.
• the method may further include a washing step after the contacting step and before the detecting step to remove non-naturally occurring linear nucleic acid molecule/probe that is not specifically hybridized to a target nucleic acid molecule in the sample/specimen.
• the detecting step may include a 2D or 3D visualization/image capture using microscopy as known in the art.
• Another embodiment of the invention provides a method for preparing a nucleic acid hybridization probe composition for a nucleic acid target of interest that includes the steps of: providing an in vitro mixture of
• nucleic acid template molecule (a) a nucleic acid template molecule, wherein the template sequence encodes a non- naturally occurring linear nucleic acid molecule having a 5’ end and a 3’ end and including a series of first nucleic acid segments consecutively complementary to a preselected nucleic acid target sequence, and between each adjacent pair of first nucleic acid segments, a spacer nucleic acid segment, wherein the spacer segments are not substantially complementary to the preselected nucleic acid target sequence;
• a template-directed nucleic acid polymerase capable of synthesizing a nucleic acid molecule including labeled nucleic acid monomers and complementary to at least part of the template using the template molecule
• nucleic acid monomers such as ribonucleotides or deoxy ribonucleotides (required by the polymerase synthesize a complementary strand using the template) wherein at least some of said nucleic acid monomers may be labeled (chemically and/or radioactively); and incubating said mixture under conditions permissive for template-directed nucleic acid synthesis by the polymerase, wherein said nucleic acid molecule including labeled nucleic acid monomers (residues) if present in mixture (c) and complementary to at least part of the template using the template molecule is thereby synthesized in quantity.
• nucleic acid monomers such as ribonucleotides or deoxy ribonucleotides
• the spacer segments may be at least substantially not complementary to the first segments.
• the linear nucleic acid molecule may further include at one or both of the 5’ end and the 3’ end an additional spacer nucleic acid segment.
• the mixture of different nucleic acid monomers includes at least some nucleic acid monomers that are labeled.
• a further embodiment of the invention provides a method for preparing a nucleic acid hybridization probe composition for a nucleic acid target of interest that includes the steps of: providing an in vitro mixture of
• RNA polymerase capable of transcribing an RNA molecule including the labeled ribonucleotides from the template under control of the promoter; and incubating said mixture under conditions permissive for transcription of the RNA molecule by the RNA polymerase, wherein said RNA molecule is thereby transcribed in quantity.
• the spacer segments may be at least substantially not complementary to the first segments.
• the linear nucleic acid molecule may further include at one or both of the 5’ end and the 3’ end an additional spacer nucleic acid segment.
• the mixture of different ribonucleotide monomers includes at least some ribonucleotide monomers that are labeled and which are incorporated into the transcribed RNA.
• Still another embodiment of the invention provides a method for preparing a nucleic acid hybridization probe composition that includes the steps of: providing a quantity of a non-naturally occurring linear nucleic acid molecule, such as an RNA molecule or a DNA molecule, having a 5’ end and a 3’ end, that includes: a series of first nucleic acid segments consecutively complementary to a preselected nucleic acid target sequence; and between each adjacent pair of first nucleic acid segments (and optionally at one or both of the 5’ end and the 3’ end), a spacer nucleic acid segment, wherein the spacer segments are not substantially complementary to the preselected nucleic acid target sequence, wherein the spacer segments are not substantially complementary to the first segments, wherein the spacer segments are not substantially complementary to each other, and wherein the spacer segments may include nucleic acid monomers having a chemical label, such as but not limited to an allyl amine group or a detectable label such as a hapten label or a fluorescent label, or the nu
• the non-naturally occurring linear nucleic acid molecule may, for example, be at least 500 monomers in length, such as 500 - 2500 monomers in length, or any subrange therein, and the fragmenting step may, for example, result in a composition including fragments 100-500 monomers in length, or any subranges therein such as 200-500 monomers in length, such as 200 - 400 monomers in length, such as 250 - 350 monomers in length.
• the length of the first segments and the spacer segments may be selected so that at least some fragments, such as those in the aforementioned length ranges, maintain a structure having adjacent first segments connected by an intervening spacer segment.
• first segments may be 40-60 monomers in length, or any subrange or value therein, and spacer segments may be around 20-30 monomers in length or any subrange or value therein.
• the series of first nucleic acid segments may, for example, include at least 2, at least 3, at least 4, or at least 5 first nucleic acid segments.
• the series of first nucleic acid segments may, for example, include in the range of 2-30 first nucleic acid segments or any subrange or whole number of first nucleic acid segments therein.
• the series of first nucleic acid segments may, for example, include in the range of 3-30 first nucleic acid segments or any subrange or whole number of first nucleic acid segments therein.
• FIG. 1 A schematically illustrates a prior art padlock-type probe hybridized to a target nucleic acid strand.
• FIG. IB schematically illustrates a nucleic acid hybridization probe embodiment of the invention having four segments complementary to a target nucleic acid strand and three intervening loop segments that are not complementary to the nucleic acid strand.
• FIG. 1C schematically illustrates a nucleic acid hybridization probe embodiment of the invention similar to that shown in FIG. IB but also including extra non-target-complementary sequence at the 5’ and 3’ termini of the probe.
• FIG. 2A is a photomicrograph showing the in situ hybridization results of an HPV E6/E7 RNA hybridization probe embodiment of the invention to C33A negative control cells, which lack an integrated HPV genome.
• FIG. 2B is a photomicrograph showing the in situ hybridization results of the same HPV
• E6/E7 RNA hybridization probe embodiment as used for FIG. 2A but to SIHA cells, which have two integrated HPV- 16 genomes per cell.
• FIG. 2C is a photomicrograph showing the in situ hybridization results of the same HPV E6/E7 RNA hybridization probe embodiment as used for FIG. 2A but to CASKI cells, which have about 600 integrated HPV- 16 genomes per cell.
• FIG. 3 A is a photomicrograph showing the in situ hybridization results of a HPV genome spanning mixture of RNA hybridization probes according to an embodiment of the invention to C33A negative control cells.
• FIG. 3B is a photomicrograph showing the in situ hybridization results of the same RNA probe mixture as used for FIG. 3 A but to SIHA cells, which have two integrated HPV- 16 genomes per cell.
• FIG. 3C is a photomicrograph showing the in situ hybridization results of the same RNA probe mixture as used for FIG. 3A but to CASKI cells, which have about 600 integrated HPV-16 genomes per cell.
• the invention provides nucleic acid hybridization probes having improved detectability.
• the probes include a plurality of first segments sequentially complementary to a target nucleic acid sequence and, between neighboring first segments, a nucleic acid spacer segment which is not complementary to the target nucleic acid sequence and not complementary to the first segments, and which includes labeled nucleic acid residues.
• a spacer segment may optionally also be disposed at either or both of the termini.
• the labeled nucleic acid monomers of the spacer segments may include labels such as biotin and/or digoxigenin, for secondary detection, e.g., by immunohistochemistry, and/or fluorescently labeled nucleic acid monomers.
• Detectability is improved for the following reasons.
• second, with particular relevance to indirect detection methods such as immunohistochemistry when the probe is hybridized to the target sequence, the labeled spacer segments loop out, thereby providing less-hindered access to the labeled monomers of the segment by secondary detection reagents such as avidin and streptavidin (biotin binders) and enzyme conjugates thereof, or anti-digoxigenin antibodies and enzyme conjugates thereof.
• Such enzyme conjugates may, for example, include those well-recognized in the art such as horseradish peroxidase conjugates and alkaline phosphatase conjugates.
• sequences of at least some of the spacer segments may be at least substantially the same, for example, at least 90% or at least 95% or at least 98% identical, or exactly identical to each other.
• the sequence(s) of the spacer segments may be at least substantially not self complementary.
• first segments of a nucleic acid molecule/probe embodiment of the invention By consecutive or sequential arrangement of the first segments of a nucleic acid molecule/probe embodiment of the invention what is meant is, in the order the first segments occur in the probe in the 5’ to 3’ direction, these segments hybridize in the same order along the target sequence in its 3’ to 5’ direction.
• sequence gaps There may be sequence gaps (“gaps”) or no-gaps between the 3’ end of a given first segment of a probe and the ‘5 end of the next adjacent first segment of the probe (proceeding in the 3’ direction of the probe).
• the gaps correspond to sequence elements that would be present in a full complementary strand to the target nucleic acid that are not provided by or present between the first nucleic acid segments when they are hybridized to the target.
• Gaps may, for example, be in the range of 1-30 residues/nt long with respect to the target strand, or any subrange or numerical value therein such as but not limited to 4-12 residues long.
• a nucleic acid molecule/probe embodiment of the invention has a sequence such that there is a gap between each neighboring first segment when hybridized to the target strand.
• the probes of the invention may, for example, be composed of RNA and/or DNA and/or labeled analogs thereof, in any combination thereof.
• the probes of the invention may be synthesized synthetically, for example, using conventional phosphoramidite chemistry and reagents therefor.
• the probes of the invention may also be synthesized enzymatically, for example, by template-directed nucleic acid synthesis such but not limited to RNA transcription using common viral promoter systems (e.g., T7 and SP6) for synthesizing RNA probes, and polymerase chain reaction (PCR) for synthesizing DNA probes.
• common viral promoter systems e.g., T7 and SP6
• PCR polymerase chain reaction
• labeled nucleotides or ribonucleotides may be included in the reaction mixture for incorporation into the product.
• the monomer mix will include all complementary monomers to synthesize the complementary strand of the template and may generally include nucleic acid monomers having all four bases (A, G, T/U, C).
• one or more or all of the spacer segments include labeled nucleic acid monomers (labeled residues).
• Each or all of the target-complementary first segments may include or exclude labeled nucleic acid monomer(s).
• the labeled monomers may be the same and/or different than the labeled monomers of the spacer segments.
• the probes are chemically synthesized, the type and position of labeled monomers in the probe can be predetermined and precisely controlled, for example, providing labeling only in the spacer segments.
• synthesis is polymerase-mediated (template-directed), assuming the same types of bases occur in both the target-complementary first segments and the spacer segments, both will be labeled by incorporation of the labeled nucleic acid monomers.
• the probe may be labeled as above or have the same structure but be unlabeled, and (for either case) secondary nucleic acid molecules that are complementary to the spacer segments of the probe and which themselves are labeled (for direct or indirect detection) are hybridized to said spacer segments to the probe.
• compositions of matter that include any of the nucleic acid hybridization probes hybridized to a target nucleic acid sequence of a target polynucleic acid molecule.
• the target nucleic acid molecule may, for example, be a naturally-occurring nucleic acid molecule or an otherwise biologically expressed nucleic acid molecule (such as the transcript of an artificial transgene).
• the target nucleic acid molecule may, for example, be a DNA molecule, such as a cellular genomic DNA, such as a chromosome, or viral DNA, or an RNA, such as cellular or viral RNA, such as a cellular or viral mRNA.
• the composition may, for example, include the probe hybridized to the target sequence in an in situ preparation of tissue or collected cells, such as but not limited to human cervical cells.
• the in situ preparation may include genomic DNA, for example, include or consist of one or more chromosomes, such as isolated human chromosomes, isolated non-human mammalian chromosomes, or isolated chromosomes of any desired organism and/or viral nucleic acids such as viral DNA or viral RNAs.
• the spacer segment sequences may, for example, be uniform in length and/or sequence and/or at least some of the spacer segments may be different in length and/or sequence.
• the spacer segments may, for example, be from 10-200 monomers long or any subrange or numerical value in said range such as but not limited to 10-150, 10-100, 20-100, 10-50, 20-50, or 15-30 monomers long.
• the lengths of the segments of target-complementary sequence (the first nucleic acid segments) may, in at least some instances for a probe, for example, all instances, be in the range of 35-100 monomers long, or any subrange or numerical value therein, such as 50 monomers plus/minus 5 monomers long.
• FIG. 1 A schematically illustrates a prior art padlock-type probe (102A) hybridized to a target nucleic acid strand (101 A). As shown, upon hybridization to a complementary target strand, this type of probe is contorted such that the 5’ and 3’ ends of the probe oppose each other in an adjacent manner (with the 5’ and 3’ end portions of the probe complementary to the target strand).
• FIG. IB schematically illustrates (not to scale) a nucleic acid hybridization probe embodiment of the invention (102B) having four segments complementary to a target nucleic acid strand (101B) and three intervening loop segments that are not substantially complementary to the nucleic acid strand.
• FIG. 1C schematically illustrates (not to scale) a nucleic acid hybridization probe embodiment of the invention (102C) having four segments complementary to a target nucleic acid strand (101C), similar to that shown in FIG. IB, but also including extra non-target- complementary sequence at the 5’ and 3’ termini of the probe.
• Probes according to the invention specifically hybridize to a target nucleic acid molecule via the first segments of the probe that are complementary to sequences in the target nucleic acid molecule.
• the spacer segment sequences are selected so that they are at least substantially not complementary to the first segments or to the target nucleic acid molecule.
• the spacer segment sequence(s) may be selected so that they, and the overall probe, at least substantially do not hybridize to any non-target polynucleic acid molecules present in a specimen under the same conditions under which the probe specifically hybridizes via the first segments to a target nucleic acid molecule present in the specimen.
• RNA probe that is useful for in situ detection of HPV16 (human papilloma virus 16) transcripts in mammalian cells, such as isolated, fixed and permeabilized human cervical cells.
• Probes specifically binding selected transcripts of HPV16 were designed such that extra nucleic acid sequences, i.e., spacer segments with additional label, are interspersed in the target-complementary sequence.
• SEQ ID NO:l (shown in Table 1) is the antisense (binding) strand DNA sequence of an HPV16 E6/E7 gene consensus sequence which served as the basis for preparing probes for detecting the E6 and E7 mRNAs of HPV16.
• the complementary DNA strand i.e., the sense strand, is also present throughout preparation of the expression construct and will act as a template for synthesis of anti-sense RNA via transcription.
• the SEQ ID NO:l DNA was modified by inserting the spacer sequence CACATTGCTCTCTTCCTTTC (SEQ ID NO:2) after every 50 bases, and at the beginning and end of the sequence, so that RNA transcribed from the template DNA strand will incorporate significant amounts of biotin-labeled cytosine and biotin-labeled uracil ribonucleotide residues in transcribing the spacer segments in addition to those incorporated in transcribing the target (E6/E7 RNA)-complementary sequences.
• the resulting modified DNA sequence (SEQ ID NO:3) is shown in Table 2 with the inserted spacer sequences indicated in capital letters. The spacer sequence is internally inserted seventeen times and occurs once at each end.
• the SEQ ID NO:3 modified template DNA was placed after a T7 promoter in a plasmid expression vector for in vitro transcription using T7 RNA polymerase and RNA was transcribed in vitro from the isolated plasmid using the Enzo BIO ARRAY HIGHYIELD® RNA transcript labeling kit (T7) (Product No. ENZ-42655; Enzo Life Sciences, Inc., Farmingdale, NY, USA).
• T7 Enzo BIO ARRAY HIGHYIELD® RNA transcript labeling kit
• the transcribed RNA which includes biotin-labeled cytosine and biotin-labeled uracil ribonucleotide residues, was then hydrolyzed by alkaline hydrolysis to an average size of 200 bases using sodium carbonate/bicarbonate buffer.
• RNA fragments were used as a hybridization probe composition to detect nucleic acids in cells in situ using conventional techniques. Similar probes were also made for the HPV16 LI gene, L2 gene, and El gene. E2 gene probes as well as probes for other genes and RNAs may also be made.
• a spacer sequence may be added at both termini, at one end only (at the 5’ end or the 3’ end with respect to the antisense sequence), or not at either termini.
• FIG. 2A is a photomicrograph showing the in situ hybridization results of the HPV E6/E7 RNA hybridization probe embodiment of the example (having SEQ ID NO:3) to C33A negative control cells, which lack an integrated HPV genome.
• FIG. 2B is a photomicrograph showing the in situ hybridization results of the same HPV E6/E7 RNA hybridization probe of the example but to SIHA cells, which have two integrated HPV-16 genomes per cell.
• FIG. 2C is a photomicrograph showing the in situ hybridization results of the same HPV E6/E7 RNA hybridization probe of the example but to CASKI cells, which have about 600 integrated HPV-16 genomes per cell.
• FIGS. 3A-3C Photomicrographs showing the results with this HPV genome-spanning mixture of probes are shown in FIGS. 3A-3C as follows.
• FIG. 3 A is a photomicrograph showing the in situ hybridization results of the HPV genome-spanning mixture of RNA hybridization probes to C33A negative control cells.
• FIG. 3B is a photomicrograph showing the in situ hybridization results of the same RNA probe mixture to SIHA cells, which have two integrated HPV-16 genomes per cell.
• FIG. 3C is a photomicrograph showing the in situ hybridization results of the same RNA probe mixture to CASKI cells, which have about 600 integrated HPV-16 genomes per cell.
• long enzymatically synthesized RNA transcripts may be partially alkaline hydrolyzed to provide a mixture of smaller fragments useful as probes.
• the mixture may, for example, include fragments in the range of 100-500 residues long, such as 200-400 residues long, such as 250-350 residues long, or any subranges therein.
• the mixture may, for example, include a substantial fraction of fragments in these size ranges.
• the mixture of size fragments obtained by the partial alkaline hydrolysis may, if desired, be further size fractionated or enriched, for example, by column chromatography, to obtain a mixture of fragments having a substantial fraction of fragments in the desired size ranges, such as but not limited to the aforementioned size ranges and subranges.
• RNA such as the biotin-labeled RNA transcripts of the example.
• 100 m ⁇ transcribed RNA (20 pg total) is mixed with 100 m ⁇ Hydrolysis Buffer (80 mM NaHC03, 120 mM Na2C03, 20 mM b-mercaptoethanol) and heated to 60°C for 25 minutes.
• 200 m ⁇ Stop Buffer 200 mM sodium acetate, pH 6, 1% Acetic acid, 10 mM dithiothreitol
• RNA Hybridization Probe Stock Solution 1124 m ⁇ ethanol is added with mixing, and the mixture is stored at -80°C for 2 hours.
• the fragmented RNA is then precipitated by centrifugation at 4°C at 16,000 x g for 20 minutes at 4°C. The supernatant is carefully removed, and the pellet is washed with 700 m ⁇ ice cold 70% ethanol, and centrifuged again at 16,000 x g for 5 minutes at 4°C. The supernatant is again removed, and the tube spun a second time for 15 seconds to bring all the remaining liquid down, which is then removed.
• the pelleted fragmented RNA is then resuspended in 100 m ⁇ of 10 mM TrisHCl, pH 7.0, 1 mM EDTA to form an RNA Hybridization Probe Stock Solution.
• Single-stranded DNA probes may also be synthesized enzymatically.
• a pair of peripheral DNA PCR primers may be used to amplify by PCR a double-stranded DNA molecule, which is SEQ ID NO: 3 hybridized to its complement, in a reaction including digoxigenin-labeled cytosine deoxynucleotides (dCTP) and digoxigenin-labeled uracil deoxynucleotides (dUTP), and/or, for example, fluorescently labeled versions of these same deoxynucleotides.
• dCTP digoxigenin-labeled cytosine deoxynucleotides
• dUTP digoxigenin-labeled uracil deoxynucleotides
• One of the PCR primers of the pair may be labeled with biotin so that the sense strand can be bound to an avidin or streptavidin support/bead and separated from the anti-sense strand, e.g., using NaOH, while biotin-streptavidin binding remains unperturbed.
• the isolated, labeled, anti-sense DNA strand can then be used as a single-stranded hybridization probe, for example, for detecting particular mRNAs.
• the isolated, single-stranded, anti-sense DNA may be used directly as a probe and/or may be fragmented, for example, into a probe composition of fragments, for example, having average length of 180-220 bases. Fragmentation of single-stranded DNA may be performed by any suitable method such as Point-sink Shearing (PtS; Thorstenson et al ., An Automated Hydrodynamic Process for Controlled, Unbiased DNA Shearing, Genome Res.
• PtS Point-sink Shearing
• Thorstenson et al . An Automated Hydrodynamic Process for Controlled, Unbiased DNA Shearing, Genome Res.
• acoustical shearing such as Covaris truSHEARTM Mechanical DNA Shearing (Covaris, Inc., Woburn, MA, USA ), needle shearing (by creating shearing forces by passing DNA through a small gauge needle), nebulizati on-based (using compressed air to force DNA through a small hole in a nebulizer unit, and collecting the fragmented, aerosolized DNA - DNA fragment size is determined by the pressure used), and DNAse I treatment.
• Covaris truSHEARTM Mechanical DNA Shearing Covaris, Inc., Woburn, MA, USA
• needle shearing by creating shearing forces by passing DNA through a small gauge needle
• nebulizati on-based using compressed air to force DNA through a small hole in a nebulizer unit, and collecting the fragmented, aerosolized DNA - DNA fragment size is determined by the pressure used
• DNAse I treatment such as Covaris truSHEARTM Mechanical DNA Shearing (Covaris, Inc.
• Still other enzymatic methods for producing single-stranded DNA hybridization probes according to the invention include asymmetric PCR (using labeled nucleotides) and rolling circle amplification (using labeled nucleotides). See Marimuthu etal, Single-stranded DNA (ssDNA) production in DNA aptamer generation, Analyst, 2012, 137, 1307 for a review of methods for producing single-stranded DNA that are readily adaptable to production of single- stranded DNA probes according to the invention.
• the labeled single- stranded DNA molecules according to the invention that may be obtained using these or any methods may, optionally, also be fragmented to obtain probe compositions as described above.
• Fragmentation may also be performed by specifically cleaving the spacer segments, for example by sequence specific cleavage, for example, by using a restriction enzyme. There may, for example, be little, no or only predefined concomitant cleavages within the target complementary segments.
• the spacer segments are selectively cleaved, or are at least substantially selectively cleaved, or are at least predominantly selectively cleaved, versus the target-complementary segments.
• the spacer segments are exclusively cleaved so that the target-complementary segments are not cleaved at all.
• the invention also provides fragmented nucleic acid hybridization probe compositions that are derived from RNA transcripts or DNA molecules that include target-complementary segments and spacer segments as described herein and which are further processed by specifically and/or selectively cleaving the transcripts/molecules within one or more or all of the spacer segments.
• the sequence of the spacer segments may, for example, be selected (predetermined) to include a subsequence (sequence element) that renders the spacer segment a target for a polynucleic acid cleaving enzyme in the presence of any required accessory molecules under reaction conditions for the enzyme.
• the transcript/molecule is cleaved within the spacer sequences, such as at least predominantly within the spacer sequences versus the target-complementary sequences, to obtain a fragmented probe composition.
• a segment of the spacer sequence can be the recognition sequence of one strand for a preselected dsDNA restriction enzyme.
• a synthetic oligonucleotide the same size as or slightly larger than and including complementary sequence to the recognition site is added to and permitted to hybridize to the long dsDNA molecule to constitute a full double stranded restriction enzyme recognition sequence with the subject spacer segments.
• a restriction enzyme reaction is constituted by adding the restriction enzyme in a suitable buffer and incubating the mixture at a permissive temperature, thereby causing the spacer segments to be cleaved at the restriction sites characteristic of the subject restriction enzyme.
• the resulting DNA fragments may then be extracted from the reaction by a conventional aqueous: organic extraction or by any clean-up means known in the art.
• a size exclusion process may optionally be employed to remove any small nucleic acid molecules from the mix, such as remaining oligonucleotides and/or fragments thereof, as known in the art.
• the selection of a restriction enzyme recognition sequence and corresponding restriction enzyme may be driven by the need or lack thereof to exclude or minimize cutting by the enzyme within the target complementary segments of the long ssDNA molecule. For example, if it desired to have no cleavage whatsoever within any of the target complementary segments, then a restriction enzyme recognition sequence that does not occur at all in the target complementary segments should be used in the spacer segment(s).
• the restriction enzyme used for this purpose may, for example, be a rare cutter, i.e., a restriction enzyme having a recognition site 7,
• the restriction enzyme may, for example, be Xcml and the method of Shaw and Muck. Xcml as a universal restriction enzyme for single-stranded DNA. Gene 133 (1993) pp. 85-89, may be employed.
• the restriction enzyme may, for example, be a Class IIS enzyme and the method of Podhajska et ah, Conferring new specificities on restriction enzymes: cleavage at any predetermined site by combining adapter oligodeoxynucleotide and Class IIS enzyme. Methods in Enzymology, 1992 Vol. 216, pp. 303-309, may be employed.
• one or more spacer segments having a self-complementary section that forms a restriction enzyme recognition site when self hybridized is used and is digested using a cognate dsDNA restriction enzyme.
• one or more or all of the spacers include a recognition site sequence for a restriction enzyme having single stranded DNA activity such as Avail, Haell, Ddel, Alul, Sau3 AI, AccII,TthHB8I and HapII, and said enzyme is used to cleave said one or more or all spacer segments without the need to provide a separate nucleic acid, such as an oligonucleotide, that is complementary to said recognition site.
• restriction enzymes cleave ssDNA by recognizing and cleaving transiently formed secondary structures (called canonical structures) in ssDNA composed of two recognition sequences with two fold rotational symmetry. See Nishigaki et al ., Type restriction endonucleases cleave single-stranded DNAs in general. Nucleic Acids Res. 1985, Vol, 13 No. 16, 5747-5760.
• crab duplex-specific nuclease e.g ., Catalog No. EA001 Evrogen, Moscow, Russia
• crab duplex-specific nuclease is used to preferentially cut DNA of spacer sequences that are hybridized to a provided short RNA oligonucleotide, which may, for example, be synthetic. See also: U.S. Pat. No. 7,435,794; U.S. Pat. No. 7,803,922; U.S. Pat. No.
• Still another way to selectively cleave particular ssDNA sequences that may be used to implement the present invention involves the use of Argonaute polypeptide:guide molecule complexes as nucleic acid-guided restriction enzymes for DNA substrates as disclosed in U.S. Pub. No. 20160289734 to Zamore et al.
• One or more or all of spacer segments (or any desired location) of a non-naturally occurring single stranded RNA molecule according to the invention may be similarly selectively cleaved by incorporating therein a restriction enzyme recognition site of a restriction enzyme, such as Avail, AvrII, Banl, Haelll, Hinfl and/or Taql, that recognizes and cleaves RNA in an RNA:DNA duplex that may be formed with said RNA molecule by hybridizing a DNA oligonucleotide, which may be synthetic, to form the hybrid restriction site and constituting a reaction mixture including the subject restriction enzyme(s) under conditions permissive for its activity.
• a restriction enzyme such as Avail, AvrII, Banl, Haelll, Hinfl and/or Taql
• RNA endonucleases may also be used, such as those disclosed in Choudhury et al., Engineering RNA endonucleases with customized sequence specificities. Nature Communications 2012 DOI:
• Still another way to selectively cleave particular ssRNA sequences that may be used to implement the present invention involves the use of Argonaute polypeptide:guide molecule complexes as nucleic acid-guided restriction enzymes for RNA substrates as disclosed in U.S. Pub. No. 20160289734 to Zamore et al.
• rNTPs fluorescently labeled and hapten-labeled ribonucleoside triphosphates
• dNTPs deoxynucleoside triphosphates
• Cyanine 3 UTP enhanced EZ-42505; Enzo Life Sciences
• Cyanine 5-UTP enhanced ENZ-42506
• Fluorescein- 12-UTP ENZ-42834
• Biotin-11-CTP ENZ-42818
• Biotin-16-UTP ENZ-42814
• Digoxigenin-UTP alkali-stable ENZ-NUC114-0250
• Cyanine 3-dUTP ENZ-42501
• Cyanine 5 dUTP ENZ-42502
• Digoxigenin-dUTP alkali-stable ENZ-NUC113-0025
• allyl amine labeled rNTPS or dNTPs such as but not limited to aminoallyl dUTP (ENZ-42861) and aminoallyl TGGR (R1091, ThermoFisher Scientific) may be incorporated and then reacted with fluorescent dye or hapten derivatives to functionally label the probe, as known in the art.
• the aminoallyl group is reactive with N- hydroxysuccinimide (NHS) ester groups of commercially available label derivatives to form a bond with the primary amino group of the incorporated rNTP analog or dNTP analog.
• NHS N- hydroxysuccinimide
• a variety of labeled phosphoramidites are available for incorporation into an oligonucleotide, such as into the loop portions of probes according to the invention, by phosphoramidite chemistry such as but not limited to biotin phosphoramidite (e.g., M042000, Millipore Sigma), Cyanine 3 phosphoramidite (e.g., M047000, Millipore Sigma), Cyanine 5 phosphoramidite (e.g., M046030, Millipore Sigma), fluorescein phosphoramidite (e.g., M041080, Millipore Sigma), 6-fluorescein phosphoramidite (e.g., M041100, Millipore Sigma) and
• the invention also provides nucleic acid “spacer segmented” probes labeled as described along with the aforementioned variations thereof, as well as corresponding probe embodiments that are not labeled but which otherwise have the same structure (and optionally any or all of the variations thereof described herein), for hybridization to a target nucleic acid molecule, such as a naturally occurring target nucleic acid molecule, and detection by labeled nucleic acid probes, such as labeled oligonucleotide probes, that are complementary to and hybridize with one or more or all of the spacer segments of the nucleic acid “spacer segmented” probes.
• a target nucleic acid molecule such as a naturally occurring target nucleic acid molecule
• labeled nucleic acid probes such as labeled oligonucleotide probes
• one embodiment of the invention provides a non-naturally occurring linear nucleic acid molecule having a 5’ end and a 3’ end, which includes: a series of first nucleic acid segments consecutively complementary to a preselected nucleic acid target sequence; and between each adjacent pair of first nucleic acid segments, a spacer nucleic acid segment, wherein the spacer segments are not substantially complementary to the preselected nucleic acid target sequence.
• At least some nucleic acid monomers (residues) of the spacer segments may be labeled with detectable labels or none of the nucleic acid monomers of the spacer segments may be labeled with detectable labels, such as none of the nucleic acid monomers of the non-naturally occurring linear nucleic acid molecule are labeled with detectable labels.
• a further embodiment of the invention provides a composition of matter that includes this non-naturally occurring linear nucleic acid molecule and one or more labeled nucleic acid probes, such as labeled oligonucleotide probes, that are complementary to and hybridized with one or more or all of the spacer segments of said non-naturally occurring linear nucleic acid molecule.
• labeled nucleic acid probes such as labeled oligonucleotide probes
• Another embodiment of the invention provides a composition of matter that includes this non-naturally occurring linear nucleic acid molecule and a naturally occurring target nucleic acid molecule to which the non-naturally occurring linear nucleic acid molecule is hybridized by way of the first nucleic acid segments.
• a still further embodiment of the invention provides a composition of matter that includes: the aforementioned non-naturally occurring linear nucleic acid molecule (either labeled or unlabeled); one or more labeled nucleic acid hybridization probes, such as labeled oligonucleotide probes, that are complementary to and hybridized with one or more or all of the spacer segments of said non-naturally occurring linear nucleic acid molecule; and a naturally occurring target nucleic acid molecule to which the non-naturally occurring linear nucleic acid molecule is hybridized by way of the first nucleic acid segments.
• the detectable labels of the former and the latter may be entirely the same type, entirely different types, or have at least one detectable label type in common and also have at least one detectable label type not in common.
• Unlabeled non-naturally occurring linear nucleic acid molecule embodiments of the invention may be prepared using the same method embodiments disclosed herein for labeled embodiments by leaving out the labeled nucleic acid monomers, i.e., by using only unlabeled nucleic acid monomers.
• Such unlabeled non-naturally occurring linear nucleic acid molecule embodiments of the invention may also be fragmented as described herein to provide a fragmented probe composition (optionally with any or all of the same variations and further processing of fragmented compositions described herein with respect to labeled embodiments).
• a still further embodiment of the invention provides a method for detecting a target nucleic acid sequence in a sample that includes the steps of: providing a non-naturally occurring nucleic acid molecule (labeled or unlabeled and fragmented or unfragmented) as described herein; providing detectably labeled nucleic acid hybridization probes, such as but not limited to oligonucleotide probes, that are complementary to and capable of hybridization with spacer segments of the non-naturally occurring nucleic acid molecule; contacting the non-naturally occurring nucleic acid molecule with an isolated biological sample that may contain nucleic acid molecules that include the preselected nucleic acid target sequence under conditions permitting hybridization of the non-naturally occurring nucleic acid molecule to the nucleic acid molecules including the preselected nucleic acid target sequence if present in the sample; washing away unhybridized non-naturally occurring nucleic acid molecule from the isolated biological sample; contacting the detectably labeled nucleic probes with the isolated biological sample so
• the isolated biological sample contains the target nucleic molecule and it is detected by the method.
• the detecting step may include a 2D or 3D visualization/image capture using microscopy as known in the art. If the non-naturally occurring nucleic acid molecule also includes detectable labels, they may also be detected. For example, if the detectable labels of the non-naturally occurring nucleic acid molecule are the same as those of the nucleic acid probes, all of the detectable labels may be detected in the same detecting step.
• the method may include a further step of detecting label of the non-naturally occurring nucleic acid molecule that remains in the biological sample (after the first washing step and/or after the second washing step).
• the invention also provides a corresponding embodiment in which the non-naturally occurring nucleic acid molecule and the nucleic acid probes are first contacted with the isolated biological sample under conditions permitting nucleic acid hybridization at the same time, and may, for example, be mixed together before or during said contact with the isolated biological sample, followed by washing and detection of label remaining in the sample.
• Still another embodiment provides a method using a nucleic acid hybridization probe, such as any of those disclosed herein, which includes a detectable label such as those described herein and which probe recognizes (is complementary to) a selected locus or region of DNA such as chromosomal DNA for detecting and quantifying DNA methylation in the selected locus or region of DNA in conjunction with a method for detecting methylated DNA.
• a nucleic acid hybridization probe such as any of those disclosed herein, which includes a detectable label such as those described herein and which probe recognizes (is complementary to) a selected locus or region of DNA such as chromosomal DNA for detecting and quantifying DNA methylation in the selected locus or region of DNA in conjunction with a method for detecting methylated DNA.
• the method for detecting methylated DNA may, for example, be binding with a primary antibody, such as a primary monoclonal antibody or polyclonal antibody, which specifically binds methylated DNA, wherein the primary antibody is labeled with a detectable label, such as a fluorophore or chromophore, that is different from (such as orthogonal to, i.e., orthogonally detectable with respect to) the detectable label of the nucleic acid hybridization probe used, or a secondary antibody that binds the primary antibody is provided wherein secondary antibody is labeled with a detectable label, such as a fluorophore or chromophore, that is different from (such as orthogonal to, i.e., orthogonally detectable with respect to) the detectable label of the nucleic acid hybridization probe used.
• a primary antibody such as a primary monoclonal antibody or polyclonal antibody, which specifically binds methylated DNA
• a detectable label such as
• the nucleic acid hybridization probe may be labeled with Cy3 fluorophore and the labeled antibody labeled with Cy5 fluorophore, or vice versa.
• the locus or region of interest in the DNA such as chromosomal DNA
• the amount/quantity of signal corresponding to the amount/quantity of DNA methylation in said locus or region can be determined by measuring the signal from the labeled antibody that is spatially within the locus or region to which the nucleic acid hybridization probe is hybridized.

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Organic Chemistry (AREA)
• Health & Medical Sciences (AREA)
• Zoology (AREA)
• Engineering & Computer Science (AREA)
• Wood Science & Technology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Immunology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Biotechnology (AREA)
• Microbiology (AREA)
• Molecular Biology (AREA)
• Biophysics (AREA)
• Analytical Chemistry (AREA)
• Biochemistry (AREA)
• Physics & Mathematics (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Virology (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=84690599

Family Applications (1)

Country Status (4)

Family Cites Families (6)

• 2022
  • 2022-06-29 EP EP22834120.2A patent/EP4363612A1/de active Pending
  • 2022-06-29 WO PCT/US2022/035455 patent/WO2023278528A1/en active Application Filing
  • 2022-06-29 JP JP2023581074A patent/JP2024526281A/ja active Pending
  • 2022-06-29 CA CA3224437A patent/CA3224437A1/en active Pending

Also Published As

Similar Documents

Legal Events