EP4297787A1 - Anticorps, fragments ou derives se liant specifiquement a un antigene proteique capable de se lier aux acides nucleiques et leurs utilisations - Google Patents

Anticorps, fragments ou derives se liant specifiquement a un antigene proteique capable de se lier aux acides nucleiques et leurs utilisations

Info

Publication number
EP4297787A1
EP4297787A1 EP22710424.7A EP22710424A EP4297787A1 EP 4297787 A1 EP4297787 A1 EP 4297787A1 EP 22710424 A EP22710424 A EP 22710424A EP 4297787 A1 EP4297787 A1 EP 4297787A1
Authority
EP
European Patent Office
Prior art keywords
antibody
binding
fragment
derivative
bind
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP22710424.7A
Other languages
German (de)
English (en)
Inventor
Michel Leonetti
Oscar PEREIRA RAMOS
Stéphanie SIMON
Gwénaëlle LE ROUX
Nathalie Morel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Commissariat a lEnergie Atomique et aux Energies Alternatives CEA
Original Assignee
Commissariat a lEnergie Atomique CEA
Commissariat a lEnergie Atomique et aux Energies Alternatives CEA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Commissariat a lEnergie Atomique CEA, Commissariat a lEnergie Atomique et aux Energies Alternatives CEA filed Critical Commissariat a lEnergie Atomique CEA
Publication of EP4297787A1 publication Critical patent/EP4297787A1/fr
Pending legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/42Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum viral
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • C07K16/102Coronaviridae (F)
    • C07K16/104Severe acute respiratory syndrome coronavirus 2 [SARS‐CoV‐2]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/081DNA viruses
    • C07K16/082Hepadnaviridae (F), e.g. hepatitis B virus
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/081DNA viruses
    • C07K16/084Papillomaviridae (F); Polyomaviridae (F), e.g. SV40, BK virus or JC virus
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • C07K16/108Orthomyxoviridae (F), e.g. influenza virus
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • C07K16/112Retroviridae (F), e.g. leukemia viruses
    • C07K16/114Lentivirus (G), e.g. human immunodeficiency virus [HIV], feline immunodeficiency virus [FIV] or simian immunodeficiency virus [SIV]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/08Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
    • C07K16/10RNA viruses
    • C07K16/112Retroviridae (F), e.g. leukemia viruses
    • C07K16/114Lentivirus (G), e.g. human immunodeficiency virus [HIV], feline immunodeficiency virus [FIV] or simian immunodeficiency virus [SIV]
    • C07K16/1147Regulatory proteins, e.g. trans-activator of transcription [TAT], rev or vacuolar protein targeting [VPT]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/57Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/572Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/71Decreased effector function due to an Fc-modification
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/72Increased effector function due to an Fc-modification
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • the present invention lies in the field of drug therapies aimed at solving inflammatory disorders induced by immune complexes. It relates to an antibody specific for a protein antigen capable of binding to nucleic acids, or a fragment or a derivative of such an antibody binding to the antigen, for its use as a medicament, in particular in the treatment or prevention inflammation, in particular that due to an infection or to an autoimmune disease, characterized in that the antibody, fragment or derivative has a reduced capacity for binding to the Fc ⁇ RIlA receptor and/or an increased capacity for binding to the Fc ⁇ RIlB receptor.
  • the antibody, fragment or derivative is preferably without an Fc domain, or with a modified Fc domain with a reduced capacity for binding to Fc ⁇ RIlA and optionally Fc ⁇ RIIIA (even with a reduced capacity for binding to all the Fc ⁇ Rs), and/or with a modified Fc domain with increased ability to bind to FcyRIlB.
  • Chronic inflammatory reactions can also be triggered during autoimmune disorders and prove to be disabling for the patient. These reactions can be caused in particular by the presence of antibodies specific to self-antigens (Ags) (Sospedra & Martin, 2016). In this case, the presence of IC resulting from the association of self antigens with antibodies (Ab) could be responsible for the inflammation.
  • Ags self-antigens
  • Abs antibodies
  • ICs could induce inflammation responsible for pathological effects both in certain infections by microorganisms and in certain inflammatory and/or autoimmune diseases (Kapingidza et al., 2020).
  • the establishment of therapeutic approaches to counter these inflammatory effects is therefore a crucial issue for improving the clinical condition of patients.
  • IVIG immunoglobulins intravenously
  • FcyRIIb Fc gamma Mb receptor
  • FcyRIIb FcyRIIb will therefore transmit an inhibition signal and thereby block the inflammatory reaction mediated by CIs (Ben Mkaddem et al., 2019).
  • This relatively effective approach tends to abrogate the activity of all of the body's FcyRIIbs. The treatment could therefore disrupt other physiological processes in which the FcyRIIbs would be involved in order to maintain homeostasis. This type of treatment could therefore be less well tolerated by the patient.
  • Another anti-inflammatory approach consists in using antibodies capable of blocking activating Fc gamma receptors, such as FcyRIlA and FcyRIIIA, in order to limit the inflammatory process mediated by CIs (Ben Mkaddem et al., 2019).
  • FcyRIlA and FcyRIIIA FcyRIlA and FcyRIIIA
  • This approach will lead to the blocking of all FcyRIlA and FcyRIIIA in the body and could therefore disrupt other physiological processes in which these receptors would be involved in order to maintain homeostasis.
  • This type of treatment like the approaches described above, may be less well tolerated by the patient.
  • protein antigens with the ability to bind nucleic acids There are many proteins from microorganisms or humans that have the ability to bind nucleic acids (hereinafter “protein antigens with the ability to bind nucleic acids” or “Ag nUc” ). Moreover, it has been shown that antibody responses are generated against such proteins, in particular against viral nucleocapsid proteins and human ribonucleoproteins (Hoffman & Greidinger, 2000; Leung et al., 2004; Migliorini et al., 2005).
  • IC nUc an Ag nUc
  • nUc ICs in particular those of the nucleocapsid protein of the SARS-Cov2 virus
  • nUc ICs can trigger inflammatory responses. They then observed that nUc ICs only formed with fragments of Ab lacking the ability to bind Fcys receptors are unable to mediate inflammation and can even inhibit inflammation induced by nUc ICs. or derivatives specific for a nUc Ag and unable to bind to Fcys receptors can be used to reduce the inflammation associated with nuc ICs
  • the present invention therefore relates to an antibody specific for a protein antigen capable of binding to nucleic acids, or a fragment or a derivative of such an antibody binding to the antigen, for its use as a medicament, characterized in that the antibody, fragment or derivative has a reduced ability to bind to the FcyRIlA receptor and/or an increased ability to bind to the FcyRIlB receptor.
  • the invention further relates to an antibody specific for a protein antigen capable of binding to nucleic acids, or a fragment or a derivative of such an antibody binding to the antigen, for its use in the treatment or prevention of inflammation, characterized in that the antibody, fragment or derivative has a reduced capacity for binding to the Fc ⁇ RIlA receptor and/or an increased capacity for binding to the Fc ⁇ RIlB receptor.
  • Fig. 1A Determination of the B epitopes recognized by the Ac aTat12S and aTat7S.
  • the Tat1-37 peptide was adsorbed onto microtiter plates and the binding of the two Abs aTat12S and aTat7S to Tat1-37-b was evaluated by enzyme immunoassay.
  • Fig. 1 B Determination of the B epitopes recognized by the Ac aTat12S and aTat7S.
  • the Tat37-57-b peptide was adsorbed on microtitration plates and the binding of the two Abs aTat12S and aTat7S to Tat37-57-b was evaluated by immunoenzymatic assay.
  • Fig. 2 Evaluation of the capacity of ICs Tat/aTat12S and Tat/aTat7S to induce the inflammatory response of human PBMCs.
  • Human PBMCs were incubated in vitro with 100nM free Tat, 100nM free aTat12S, 100nM free aTat7S, Tat/aTat12S (100 mM each) and Tat/aTat7S (100 mM each), respectively. After 18 hours of incubation, the supernatants were removed and the presence of IL-6 was evaluated by immunoenzymatic assay.
  • Fig. 3 Evaluation of the capacity of ICs Ncp/aNcp2 and Ncp/aNcp15 to induce the inflammatory response of human PBMCs.
  • Human PBMCs were incubated in vitro with 30nM free Ncp, 30nM free aNcp2, 30nM free aNcp15, Ncp/aNcp2 (30nM each) and Ncp/aNcp15 (30nM each), respectively. After 18 hours of incubation, the supernatants were removed and the presence of IL-6 was evaluated by immunoenzymatic assay.
  • Fig. 4 The Fab-aNcp15 and hcaNcp15Fcmute have the ability to bind the Ncp protein.
  • the hcaNcp15 chimeric antibody was adsorbed onto microtiter plates. A fixed concentration of N-biotinylated protein (178 pM) was incubated in the wells of the plate in the presence or absence of series of dilutions of hcaNcp15 or of Fab-Ncp15 or of hcaNcp15Fcmute. After an overnight incubation at 4°C, the plate was washed, streptavidin coupled to peroxidase was added. After 30 minutes, washes were performed and a colorimetric substrate (ABTS) was added to measure the presence of Ncp-biotinylated.
  • ABTS colorimetric substrate
  • Fig. 5 The ability of Ncp/aNcp ICs to induce the inflammatory response of human PBMCs is altered when the Ab included in the complex lacks the Fc region.
  • Human PBMCs were incubated in vitro with Ncp (30nM), Fab-aNcp15 (333nM), Ncp/hcaNcp15 (30nM for each protein) and Ncp/Fab-aNcp15 (30nM for Ncp, 333 nM for Fab)) respectively. After 18 hours of incubation, the supernatants were removed and the presence of IL-6 was evaluated by immunoenzymatic assay.
  • Fig. 6 The ability of Ncp/aNcp ICs to induce the inflammatory response of human CMSPs is altered when the Ac included in the complex is mutated in its Fc region so as to no longer be able to bind Fcys receptors.
  • Human PBMCs were incubated in vitro with Ncp (30nM), hcaNcp15Fcmute (30nM), Ncp/hcaNcp15 (30nM for each protein) and Ncp/hcaNcp15Fcmute (30nM for each protein) respectively. After 18 hours of incubation, the supernatants were removed and the presence of IL-6 was evaluated by immunoenzymatic assay.
  • Fig. 7 The ability of an aNcp to induce the inflammatory response of human PBMCs is altered by an Ac derivative lacking the Fc region.
  • Human PBMCs were incubated in vitro with Ncp (30nM), Ncp/hcaNcp15 (30nM for each protein), Ncp/Fab-aNcp15 (30nM for Ncp, 333nM for Fab), Ncp/hcaNcp15/Fab-aNcp15 (30nM for the first two proteins, 333nM for the Fab), respectively. After 18 hours of incubation, the supernatants were removed and the presence of IL-6 was evaluated by immunoenzymatic assay.
  • Fig. 8 The ability of an aNcp to induce the inflammatory response of human PBMCs in the presence of Ncp is altered by an Ac derivative mutated in its ability to bind RFcys.
  • Human PBMCs were incubated in vitro with Ncp (10nM), Ncp/hcaNcp15 (1 OnM for Ncp, 10nM for Ac), Ncp/hcaNcp15Fcmute (1 OnM for Ncp, 30nM for Ac), Ncp/hcaNcp15/ hcaNcp15Fcmute (10nM for Ncp, 10nM for hcaNcp15, 30nM for hcaNcp15Fcmute), respectively. After 18 hours of incubation, the supernatants were removed and the presence of IL-6 was evaluated by immunoenzymatic assay.
  • the invention relates to an antibody specific for a protein antigen capable of binding to nucleic acids, or a fragment or a derivative of such an antibody binding to the antigen, for its use as a medicament, characterized in that the antibody, fragment or derivative has a reduced ability to bind to the FcyRIlA receptor and/or an increased ability to bind to the FcyRIlB receptor.
  • It also relates to an antibody specific for a protein antigen capable of binding to nucleic acids, or a fragment or a derivative of such an antibody binding to the antigen, for its use in the treatment or prevention of inflammation , characterized in that the antibody, fragment or derivative has a reduced ability to Fc ⁇ RIlA receptor binding and/or increased Fc ⁇ RIlB receptor binding capacity.
  • an antibody specific for a protein antigen capable of binding to nucleic acids, or of a fragment or derivative of such an antibody binding to the antigen, for the preparation of a medicinal product intended for the treatment or prevention of inflammation characterized in that the antibody, fragment or derivative has a reduced capacity for binding to the Fc ⁇ RIlA receptor and/or an increased capacity for binding to the Fc ⁇ RIlB receptor.
  • an antibody specific for a protein antigen capable of binding nucleic acids, or a fragment or derivative of such an antibody binding to the antigen for the treatment or the prevention of inflammation, characterized in that the antibody, fragment or derivative has a reduced ability to bind to the FcyRIlA receptor and/or an increased ability to bind to the FcyRIlB receptor.
  • composition comprising an antibody specific for a protein antigen capable of binding to nucleic acids, or a fragment or a derivative of such an antibody binding to the antigen, for its use in the treatment or prevention of inflammation, characterized in that the antibody, fragment or derivative has a reduced ability to bind to the Fc ⁇ RIlA receptor and/or an increased capacity to bind to the Fc ⁇ RIlB receptor.
  • the present invention is based on the therapeutic use of an antibody specific for a protein antigen capable of binding to nucleic acids.
  • antibody or “Ac” or “immunoglobulin” is meant a molecule comprising at least one domain for binding to a given antigen and a constant domain comprising an Fc fragment capable of binding to FcR receptors.
  • an antibody is composed of 4 polypeptide chains: 2 heavy chains and 2 light chains linked together by a variable number of disulphide bridges providing flexibility to the molecule.
  • Each light chain consists of a constant domain (CL) and a variable domain (VL); the heavy chains being composed of a variable domain (VH) and 3 or 4 constant domains (CH1 to CH3 or CH1 to CH4) depending on the isotype of the antibody.
  • antibodies consist of only two heavy chains, each heavy chain comprising a variable domain (called VhH in camelids and V-NAR in sharks) and a constant region (Holliger & Hudson, 2005).
  • Variable domains are involved in antigen recognition, while constant domains are involved in the biological, pharmacokinetic and effector properties of the antibody.
  • variable region differs from one antibody to another.
  • the genes coding for the heavy and light chains of the antibodies are generated by recombination of respectively three and two distinct gene segments called VH, DH and JH-CH for the heavy chain and VL and JL-CL for the light chain.
  • the CH and CL segments do not participate in recombination and form the heavy and light chain constant regions respectively.
  • Recombinations of the VH-DH-JH and VL-JL segments form the heavy and light chain variable regions respectively.
  • the VH and VL regions each have 3 hypervariable zones or complementarity determining regions (CDRs), called CDR1, CDR2 and CDR3, the CDR3 region being the most variable, since it is located at the level of the recombination zone.
  • CDRs complementarity determining regions
  • CDR regions are found in the part of the antibody that will be in contact with the antigen and are therefore very important for the recognition of the antigen.
  • antibodies retaining the three CDR regions of each of the heavy and light chains of an antibody retain the vast majority of the antigenic specificity of the original antibody.
  • an antibody retaining only one of the CDRs, and in particular CDR3 also retains the specificity of the original antibody.
  • the CDR1, CDR2 and CDR3 regions are each preceded by the FR1, FR2 and FR3 regions respectively, corresponding to the framework regions (framework region, FR) which vary the least from one VH or VL segment to another.
  • the CDR3 region is also followed by an FR4 framework region.
  • An antibody, fragment, or derivative that "binds" an antigen of interest is an antibody, fragment, or derivative that binds the antigen with sufficient affinity for the antibody to be useful as a diagnostic and/or therapeutic agent for target the antigen in circulating form or expressed by a cell or tissue, and does not react significantly with other antigens.
  • the extent of binding of the antibody, fragment or derivative to a "non-target" antigen will be less than approximately 10% of the binding of the antibody to its target antigen, as determined by fluorescence activated cell sorting analysis (FACS) or radioimmunoprecipitation (RIPA).
  • the expressions "specific binding” or “specifically binds to” or is “specific for” a particular antigen or an epitope of a particular antigen means a binding that is measurably different from a non-specific interaction.
  • Specific binding can be measured, for example, by measuring antigen binding against binding to a control antigen, which is generally a structurally similar antigen that has no binding activity.
  • specific binding can be determined by competition with a control antigen which is similar to the target, for example by measuring binding to the labeled target antigen in the presence or absence of an excess of unlabeled target antigen.
  • the binding is considered specific if the binding of the labeled target is competitively inhibited by an excess of unlabeled target.
  • there is “specific binding” or that the antibody, fragment or derivative "specifically binds to” or is “specific for” a particular antigen or an epitope on an antigen for example, if the antibody, fragment or derivative has a KD for the target of at most about 10 6 M, alternatively at most about 10 7 M, alternatively at most about 10 8 M, alternatively at most about 10 9 M, alternatively at most plus about 10 1 ° M, alternatively at most about 10 11 M, alternatively at most about 10 12 M, or even less.
  • the term "specific binding” refers to binding in which the antibody, fragment or derivative binds to a particular antigen or epitope on an antigen without substantially binding to another antigen or epitope.
  • an antibody, fragment, or derivative that binds nucAg has a dissociation constant (KD) of less than or equal to 1 mM, ⁇ 100 nM, ⁇ 10 nM, ⁇ 1 nM, or ⁇ 0.1 nM.
  • KD means a dissociation constant of a specific antibody-antigen interaction and is used as an indicator to measure the affinity of an antibody for an antigen.
  • a lower KD signifies a higher affinity of an antibody for an antigen.
  • constant domains are characterized by an amino acid sequence very close from one antibody to another, characteristic of the species and the isotype, possibly with some somatic mutations.
  • the Fc fragment is naturally composed of the constant region of the heavy chain excluding the CH1 domain, i.e. the lower hinge region and the constant domains CH2 and CH3 or CH2 to CH4 (depending on the isotype ).
  • the complete Fc fragment is composed of the C-terminal part of the heavy chain from the cysteine residue at position 226 (C226), the numbering of the amino acid residues in the Fc fragment being throughout the present description that of the EU index described in the publications Edelman et al-1969 and Kabat et al-1991 (Edelman et al., 1969; Kabat E.A., Wu T.T., Perry H.M. Foeller C., 1991).
  • the corresponding Fc fragments of other types of immunoglobulins can easily be identified by those skilled in the art by sequence alignments.
  • the Fc fragment of the IgG is glycosylated at the level of the CH2 domain with the presence, on each of the 2 heavy chains, of an N-glycan linked to the asparagine residue at position 297 (Asn 297).
  • binding domains located in the Fc, are important for the biological properties of the antibody:
  • complement-dependent cytotoxicity located in the CH2 domain;
  • Antibodies can be of several isotypes, depending on the nature of their constant region: the constant regions g, a, m, e and d correspond respectively to the immunoglobulins IgG, IgA, IgM, IgE and IgD.
  • the monoclonal antibody present in a composition used as medicament in the context of the invention is of IgG isotype.
  • the antibody can be monoclonal or polyclonal.
  • the antibody is monoclonal.
  • monoclonal antibody or “monoclonal antibody composition” is meant a composition comprising antibody molecules having an identical and unique antigenic specificity.
  • the antibody molecules present in the composition are likely to vary at the level of their post-translational modifications, and in particular at the level of their glycosylation structures or their isoelectric point, but have all been encoded by the same sequences of heavy chains and slight and therefore have, before any post-translational modification, the same protein sequence.
  • the antibody is polyclonal.
  • polyclonal antibody is meant a mixture of antibodies recognizing different epitopes on a given antigen. It may be a polyclonal antibody purified from the serum of a subject immunized with the antigen of interest (we will then speak of “natural polyclonal”, whether the immunization is natural or induced by humans) or a mixture of at least 2 (for example 2, 3, 4, or 5) monoclonal antibodies recognizing different epitopes on a given antigen (we will then speak of “synthetic polyclonal”).
  • a natural polyclonal or synthetic polyclonal antibody can be used, with a preference for a synthetic polyclonal antibody.
  • the antibody, functional fragment or derivative thereof according to the invention is advantageously a chimeric or humanized antibody, in particular a chimeric antibody whose constant region of the heavy and light chains is of human.
  • chimeric antibody an antibody which contains a natural variable region (light chain and heavy chain) derived from an antibody of a given species in association with the light chain and heavy chain constant regions of an antibody of a species heterologous to said given species.
  • the monoclonal antibody composition for its use as medicament according to the invention comprises a chimeric monoclonal antibody, the latter comprises human constant regions.
  • a chimeric antibody can be prepared using genetic recombination techniques well known to those skilled in the art.
  • the chimeric antibody could be produced by cloning for the heavy chain and the light chain a recombinant DNA comprising a promoter and a sequence coding for the variable region of the non-human antibody, and a sequence coding for the constant region d a human antibody.
  • a recombinant DNA comprising a promoter and a sequence coding for the variable region of the non-human antibody, and a sequence coding for the constant region d a human antibody.
  • humanized antibody is meant an antibody which contains CDR regions derived from an antibody of non-human origin, the other parts of the antibody molecule being derived from one (or more) human antibodies.
  • some of the backbone segment residues (designated FR) can be modified to retain binding affinity (Jones et al., 1986; Riechmann et al., 1988; Verhoeyen et al., 1988).
  • the humanized antibodies according to the invention can be prepared by techniques known to those skilled in the art such as “CDR grafting”, “resurfacing”, SuperHumanization, “Human string content”, “FR libra ries”, “Guided selection”, “FR shuffling” and “Humaneering”, as summarized in the review by Almagro et al. (Almagro & Fransson, 2008).
  • whole antibody immunoglobulin binding
  • immunoglobulin binding immunoglobulin binding
  • full length antibody immunoglobulin binding
  • the constant domains may be native sequence constant domains (eg, human native sequence constant domains) or amino acid sequence variants thereof.
  • fragment of an antibody binding to the antigen is meant an antibody fragment retaining the antigen-binding domain and therefore having the same antigenic specificity as the original antibody.
  • fragments include F(ab')2, Fab, Fab', ScFv, Fv, VhH, and V-NAR fragments. The structures of these fragments and the methods for obtaining them are known to those skilled in the art (Holliger & Hudson, 2005).
  • derivative of an antibody binding to the antigen is meant a complex comprising several fragments of an antibody arranged in a non-natural form.
  • fragments include derivatives ScFv, Bis-scFv, scFv-Fc, Fab2, Fab3, miniantibody (or “minibody”), diantibody ("diabodies”), triantibody (“triabodies”), tetraantibody (“tetrabodies”) ).
  • miniantibody or "minibody”
  • diantibody diabodies
  • triantibody triantibody
  • tetraantibody tetrabodies
  • antibodies form “immune complexes” (or “ICs"), i.e. antigen-antibody aggregates comprising several antibodies linked to the surface of one or more antigen molecules.
  • ICs immune complexes
  • the antibody, fragment or derivative used in the invention has a reduced capacity for binding to the Fc ⁇ RIlA receptor and/or an increased capacity for binding to the Fc ⁇ RIlB receptor.
  • Antibodies are bifunctional molecules. They interact with the various Fcy domain receptors (FcyRs) via their Fc domain and bind antigens via their two Fab domains.
  • FcyRs Fcy domain receptors
  • the ICs formed allow better uptake of antigens by immune cells expressing FcyRs on their surface.
  • FcyRs are classified into two functional groups, activating (FcyRI, FcyRIlA, FcyRIIC, FcyRIIIA) and inhibitory (FcyRIlB) FcyRs.
  • FcyRI is a high affinity receptor capable of binding antibodies in monomeric form
  • FcyRIiA, FcyRIIC, and FcyRIIIA are low affinity receptors that mainly bind ICs.
  • the inhibitory receptor FcyRIlB is also a low affinity receptor, binding mainly ICs.
  • an antibody, fragment or derivative having a reduced ability to bind to the FcyRIIA receptor is used.
  • the antibody, fragment or derivative may further possess a reduced ability to bind to the FcyRIl IA receptor. It may also possess a reduced ability to bind to all FcyRs.
  • reduced binding capacity to one or more FcyRs, it is meant that the binding of the antibody, of the fragment or of the derivative to the FcyR is weaker than that of an antibody with the same variable regions, but whose constant regions are natural (native antibody), advantageously the FcyR binding capacity is lower by a factor of at least 2, at least 5, at least 10, or sometimes even at least 25, at least 50, at least 75, or even at least 100, to that of the native antibody.
  • a fragment or a derivative without an Fc domain can advantageously be used. Indeed, the absence of the Fc domain prevents any binding to FcyRs, and therefore in particular to FcyRIIA, and to FcyRIIIA.
  • the fragments without an Fc domain include in particular the F(ab′)2, Fab, Fab′, Fv, VhH, and V-NAR fragments.
  • Derivatives without an Fc domain include in particular derivatives of the ScFv, Bis-scFv, Fab2, Fab3, diantibody (“diabodies”), trantibody (“triabodies”), tetraantibodies (“tetrabodies”) type.
  • a fragment or a derivative without an Fc domain advantageously chosen from F(ab')2, F(ab'), Fab, Fab', Fv, VhH, V-NAR, ScFv, Bis-scFv, Fab2, Fab3, diantibodies (“diabodies”), triantibodies (“triabodies”), and tetraantibodies (“tetrabodies”), are used.
  • the CH2 domain of IgG isotype antibodies is known to comprise the Fc ⁇ R binding domain. Therefore, it is also possible to use a fragment or derivative that has part of the Fc domain, but does not include the CH2 domain, such as miniantibodies (or "minibody").
  • a first modification strategy of the Fc domain making it possible to reduce or abolish the binding to the FcyRs of interest consists in inserting one or more mutations in the Fc domain. Indeed, many mutations or combinations of mutations in the Fcy domain are known to reduce or abolish binding to some or all of the FcyRs.
  • L235E and L234A/L235A mutations and combinations of mutations reduce effector functions.
  • V234A/G237A/P238S/H268A/V309L/A330S/P331S which reduce binding to FcyRs;
  • the antibody used in the invention is of the IgG1 isotype and its Fc domain comprises a combination of the 4 mutations E233P, F234V, L235A, and D265A.
  • a second strategy for modifying the Fc domain making it possible to reduce or abolish the binding to the FcyRs consists in altering the glycosylation of the Fc domain according to embodiments known to those skilled in the art (Strohl & Strohl, 2012). This alteration can be achieved using cells with variable post-translational capacities, by deletion of the glycosylation site, or by enzymatic deglycosylation of the antibody.
  • the glycosylation site of the Fc domain can in particular be deleted by replacing the asparagine residue to which N-glycans are linked by another amino acid (for example, for an lgG1, by a mutation N297A, N297Q or N297G (elimination of the interaction with Fc ⁇ RIlA and Fc ⁇ RIIIA, reduced interaction with Fc ⁇ RI), see (Wang et al., 2018).
  • non-glycosylated antibody it is also possible to produce the antibody in a host without an N-glycosylation system, such as for example bacteria, which naturally lack an N-glycosylation system, or in any other host which is normally provided with an N-glycosylation system but which has been modified to no longer N-glycosylate proteins, for example yeasts, plants, insect cells or mammalian cells.
  • an N-glycosylation system such as for example bacteria, which naturally lack an N-glycosylation system, or in any other host which is normally provided with an N-glycosylation system but which has been modified to no longer N-glycosylate proteins, for example yeasts, plants, insect cells or mammalian cells.
  • non-glycosylated antibody it is also possible to deglycosylate the antibody a) enzymatically, for example using PNGase F (Peptide-N4-(acetyl-B-glucosaminyl)-asparagine amidase, EC 3.5.1.52) , an endoglycosidase such as Gendo-alpha-N-acetyl-galactosaminidase, endoglycosidase F1, endoglycosidase F2, endoglycosidase F3, or endoglycosidase H, or b) chemically.
  • PNGase F Peptide-N4-(acetyl-B-glucosaminyl)-asparagine amidase, EC 3.5.1.52
  • an endoglycosidase such as Gendo-alpha-N-acetyl-galactosaminidase
  • the modification strategies 1 and 2 presented above can potentially be combined (mutation(s) in the Fc reducing the binding to the FcyRs of interest and absence of glycosylation).
  • the glycosylation is not suppressed, one will avoid producing the whole antibody or the derivative with an Fc domain under conditions resulting in glycosylation known to increase the capacity of binding to the FcyRs of interest (one will in particular avoid to produce an antibody or derivative whose Fc domain is glycosylated with low fucosylation, this strongly increasing the binding to FCYRIIIA).
  • an antibody, fragment or derivative possessing an increased capacity for binding to the FCYRIIB receptor is used.
  • increased binding capacity to the FCYRIIB receptor it is meant that the binding of the antibody, of the fragment or of the derivative to the FCYRIIB receptor is stronger than that of an antibody with the same variable regions, but whose constant regions are natural (native antibody), advantageously the binding capacity to the FCYRIIB receptor is greater by a factor of at least 2, at least 5, at least 10, or sometimes even at least 25, at least 50, at least 75, or even at least 100, to that of the native antibody.
  • FcyRIIB receptor The appropriate modifications of the Fc domain making it possible to increase the binding capacity to the FcyRIIB receptor include in particular the combinations of mutations S267E/L328F (or "SELF", but maintenance of a high affinity for FcyRIlA-R), N325S/L328F (reduction concomitant of the interaction with FcyRIIIA) and
  • the antibody, fragment or derivative used in the invention specifically recognizes a protein antigen capable of binding to nucleic acids (“Ag nUc” ).
  • the protein antigen specifically recognized by the antibody, fragment or derivative used in the invention has one of the following characteristics: a) it is capable of binding to nucleic acids alone, that is to say without being complexed with another molecule (another protein in particular); b) it is capable of binding to nucleic acids without specificity for a given nucleic sequence; c) it is able to bind nucleic acids more efficiently at a pH between 7.0 and 7.5 than at acidic pH (below 7.0); d) it comprises one or more positively charged accessible region(s).
  • the nUc Ag preferably comprises one or more positively charged surface region(s); in the case of proteins/peptides naturally in an unfolded form, the nUc Ag preferably comprises one or more region(s) in the primary sequence containing positively charged amino acids; e) it is also capable of binding to heparan sulphate membrane proteoglycans, preferably alone, without being complexed with another molecule (another protein in particular); and f) any combination of features a) to e).
  • the protein antigen specifically recognized by the antibody, fragment or derivative used in the invention may possess one of the following combinations of characteristics: i. the combination of features a) and d); ii. the combination of features a) and e); iii. the combination of features b) and d); iv. the combination of features b) and e); v. the combination of features d) and e); vi. the combination of features a), b) and d); vii. the combination of features a), d) and e); viii. the combination of features b), d) and e); ix. the combination of features a), b), d) and e); x. the combination of features b) to e); or xi. the combination of features a) to e)
  • This second binding would reinforce the activating effect of the binding between the Fc domains of the antibodies and the Fcy receptors.
  • nucleic acid recognition is also generally obtained without specificity for a given nucleic sequence (feature b)), and a combination of features b) and d) is therefore also of particular interest.
  • nucleic acid recognition is also generally obtained without it being complexed to another molecule (feature a)), and a combination of features a) and d) is therefore also particularly of interest.
  • Three or four of features a), b), d) and e) will also be present in many nUc Ags, and a combination of features a), b), and d), a combination of features a), d) and e), a combination of features b), d) and e), or a combination of a), b), d) and e) are also combinations of interest.
  • nUc Ags are in particular described in various publicly accessible databases, in particular those described in Table 1 below:
  • the nUc Ag that the antibody, fragment or derivative used in the invention specifically recognizes is chosen from the proteins of infectious microorganisms capable of binding to nucleic acids. This type of antibody is used when the inflammation is due to infection by a microorganism.
  • the infectious microorganism protein capable of binding nucleic acids is preferably internal to the infectious microorganism, in other words it is not on the surface of the infectious microorganism. It is additionally or alternatively preferably capable of binding to nucleic acids in native form, before any cleavage inducing a conformational change.
  • the nUc Ag that the antibody, fragment or derivative used in the invention specifically recognizes is advantageously chosen from viral proteins capable of binding to the viral genome.
  • the nUc Ag as the antibody, fragment or derivative used in the invention specifically recognizes is chosen from the internal proteins of the virus, excluding the viral proteins located on the surface of the virus.
  • Preferred viral nUCAgs generally include viral capsid proteins, but also other viral proteins such as transcriptional transactivator (Tat) and reverse transcriptase (RT, p66/p51) of human immunodeficiency virus 1 (HIV -1 ).
  • capsid is meant the shell that surrounds the viral genome.
  • the protein capable of packaging the viral genome to form the capsid is called “capsid protein” or “nucleocapsid protein”.
  • capsid protein The protein capable of packaging the viral genome to form the capsid
  • nucleocapsid protein designates in principle the viral genome surrounded by the capsid, but is sometimes also used to designate the capsid.
  • Other proteins may associate with the capsid, such as matrix proteins, or the envelope around the capsid of enveloped viruses, but are not considered capsid proteins.
  • the capsid protein of HIV-1 also called p24 (amino acid sequence corresponding to Genbank accession number NP_057850.1 (residues 133-363 ), Genbank version 241 of December 15, 2020); the capsid protein of severe acute respiratory syndrome coronavirus 2 virus (“SARS-Cov-2”, causative of Covid-19, amino acid sequence corresponding to Genbank accession no. YP_009724397.2, version 241 of Genbank of December 15, 2020), influenza virus capsid protein (amino acid sequence corresponding to Genbank accession no.
  • SARS-Cov-2 severe acute respiratory syndrome coronavirus 2 virus
  • AAA43798.1 Genbank version 241 of December 15, 2020
  • hepatitis B virus capsid protein HBV, amino acid sequence corresponding to Genbank accession no. AXM44956.1, Genbank version 241 of December 15, 2020
  • hepatitis E virus capsid protein HEV, amino acid sequence corresponding to Genbank accession no. P03314.1 (residues 1 to 101), Genbank version 241 of December 15, 2020
  • human papillomavirus capsid protein HVP, amino acid sequence corresponds to Genbank accession no. AQZ41126.1, Genbank version 241 of December 15, 2020
  • dengue virus capsid protein amino acid sequence corresponding to Genbank accession no. AAW51422.1 (residues 5-114), Genbank version 241 dated December 15, 2020).
  • these proteins are known to generate an antibody response in patients infected with these viruses and, in some cases, the presence of immune complexes (IC) formed of these antigens and antibodies specifically recognizing them is also known to be associated with pathogenesis (Cafaro et al., 2019; Carter et al., 2000; Fenouillet et al., 1993; Hashida et al., 1997; Hu, 2002; Kamar et al., 2017; Ni et al., 2020; Rumbaugh et al., 2013).
  • IC immune complexes
  • the ICs of the intracellular protein of Yersinia enterocolitica 0.3 are also associated with certain chronic arthritis, and antibodies, fragments or specific derivatives of this protein can therefore also be used.
  • Monoclonal antibodies specifically recognizing the HIV-1 transcriptional transactivator (Tat) have been described in vaccine strategies (Cafaro et al., 2019) and are available on the market, such as:
  • Monoclonal antibodies specifically recognizing HIV-1 reverse transcriptase are available on the market, such as: “anti-HIV1 - RT antibody, mouse monoclonal antibody, ref. : ABIN933463, marketed by Antibodies-online.
  • Monoclonal antibodies specifically recognizing the nucleocapsid of HIV-1 (p24) are available on the market, such as:
  • Anti-HIV1 p24 antibody [39/5.4A] mouse monoclonal antibody, ref: ab9071, marketed by the company Abcam.
  • Monoclonal antibodies specifically recognizing the nucleocapsid of the SARS-Cov2 virus are available on the market, such as:
  • Nucleocapsid Antibody mouse monoclonal antibody, ref. : MAB104741, marketed by R&D SYSTEMS.
  • SARS-CoV-2 Nucleocapsid Antibody (bcn11)
  • humanized antibody ref: MA5-35953, marketed by Thermo Fisher Scientific.
  • Monoclonal antibodies specifically recognizing the nucleocapsid of the influenza virus are available on the market, such as: "Recombinant Mouse Anti-Influenza A virus Nucleocapsid protein Antibody (CBI49YJ)", mouse monoclonal antibody, ref. : HPAB-0295-YJ marketed by Creative Biolabs.
  • Monoclonal antibodies specifically recognizing the nucleocapsid of HBV are marketed, such as for example: “Recombinant Hepatitis B Core Antigen (rHBcAg)”, mouse monoclonal antibody, ref. : bsm-2000M, marketed by BiossAntibodies.
  • rHBcAg Recombinant Hepatitis B Core Antigen
  • bsm-2000M mouse monoclonal antibody
  • Monoclonal antibodies specifically recognizing the HEV nucleocapsid are marketed, for example: “HEV/Hepatitis E Virus Monoclonal Antibody”, mouse monoclonal antibody, ref. : LS-C67675, marketed by LifeSpan Biosciences.
  • Monoclonal antibodies specifically recognizing the nucleocapsid of HPV such as for example: “Human Papilloma Virus L1 Antibody”, mouse monoclonal antibody, ref. : MBS320499, marketed by MyBioSource.com (Specific for the major structural protein of the L1 capsid).
  • Monoclonal antibodies specifically recognizing the intracellular protein of Yersinia enterocolitica 0.3 (IcP-Ye) such as for example mouse monoclonal Ac, ref.: 2D8-P, marketed by PROGEN.
  • nUc Ags of infectious microorganisms in particular viruses, such as the transcriptional transactivator (Tat) or the reverse transcriptase (RT) of HIV-1 or the viral nucleocapsid proteins, in particular those of SARS-Cov- 2, influenza, HBV, HEV, and HPV
  • viruses such as the transcriptional transactivator (Tat) or the reverse transcriptase (RT) of HIV-1 or the viral nucleocapsid proteins, in particular those of SARS-Cov- 2, influenza, HBV, HEV, and HPV
  • the nuc Ag that the antibody, fragment or derivative used in the invention specifically recognizes is chosen from the self proteins of the subject to be treated. This type of antibody is used when the inflammation is due to an autoimmune disease.
  • the self protein capable of binding nucleic acids is preferably an intracellular protein. It is additionally or alternatively preferably capable of binding to nucleic acids in native form, before any cleavage inducing a conformational change.
  • the Ag nuc can in particular be chosen from the ribonucleoproteins and the deoxyribonucleoproteins of the subject to be treated.
  • the ribonucleoproteins mention may be made more particularly of the proteins: the protein RibP (sequence of amino acids corresponding to Genbank accession number NP_000993.1 (subunit PO), NP_000994.1 (subunit P1) and NP_000995 .1 (P2 subunit), Genbank version 241 of 15 Dec 2020, ICs of RibP are associated with the pathogenesis of systemic lupus erythematosus, see (Choi et al., 2020) snRNPs proteins, including protein A, protein C and 70K protein (amino acid sequences corresponding to Genbank accession numbers NPJXM587.1, NP_003084.1 and NP_003080.2, Genbank version 241 of December 15, 2020, ICs of snRNPs A, C and 70K are associated with
  • NP_003082.1 and NP_008869.1 Genbank version 241 dated Dec 15, 2020
  • ICs of snRNPs B, B' and D are associated with the pathogenesis of systemic lupus erythematosus, see (Pisetsky & Lipsky, 2020), protein Ro60 (sequence of amino acids corresponding to Genbank accession no.
  • NP_001035828.1 Genbank version 241 of December 15, 2020
  • ICs of Ro60 are associated with the pathogenesis of systemic lupus erythematosus, primary Sjogren's syndrome, and systemic sclerosis, see (Schulte-Pelkum et al., 2009)
  • the Ro52 protein amino acid sequence corresponding to Genbank accession no. NP_003132.2, Genbank version 241 of December 15, 2020
  • ICs of Ro52 are associated with the pathogenesis systemic lupus erythematosus, see (Schulte-Pelkum et al., 2009)
  • the La protein La protein (Lupus antigen, amino acid sequence corresponding to Genbank accession no. NP_001281074.1, Genbank version 241 of December 15, 2020, La ICs are associated with the pathogenesis of systemic lupus erythematosus, see (To & Petri, 2005).
  • histones for example the amino acid sequence corresponding to Genbank accession number NP_001035807.1 (histone 2A), CAA41051.1 (histone 2-B), AAN39284.1 ( histone 3), NP_003486.1 (histone 4), Genbank version 241 dated 15 Dec 2020
  • histone ICs are associated with the pathogenesis of systemic lupus erythematosus, see (Ghiggeri et al., 2019).
  • RibP protein Polyclonal antibodies specifically recognizing the RibP protein are available on the market, such as: "Ribosomal P Antigen antibody”, rabbit polyclonal antibody, ref. : GTX39242, marketed by GeneTex.
  • Monoclonal antibodies specifically recognizing the snRNPs protein are available on the market, for example: “Anti-Sm BB' Proteins (Human autoantigens) Monoclonal Antibody”, mouse monoclonal antibodies, ref. : 03-57029 marketed by American Research Products, Inc. TM.
  • Monoclonal antibodies specifically recognizing the Ro60 protein are available on the market, such as: “Anti-Ro60 (SS-A) Protein Monoclonal Antibody”, clone 1 D8, mouse monoclonal antibody, ref. : 03-57039 marketed by American Research Products, Inc. TM.
  • Monoclonal antibodies specifically recognizing the Ro52 protein are available on the market, for example: “Anti-TRIM21 Mouse mAb”, mouse monoclonal antibody, ref. : MBS475588, marketed by MyBioSource.com.
  • Polyclonal antibodies specifically recognizing the lupus antigen (La) are available on the market, such as: “Anti-Lupus La Protein SSB Antibody”, rabbit polyclonal antibody, ref. : A00705, marketed by BosterBio.
  • Monoclonal antibodies specifically recognizing histones are available on the market, such as: “Histone Monoclonal Antibody”, mouse monoclonal antibody, ref.: LS-C68011, marketed by LifeSpan Biosciences.
  • the antibodies, fragments and derivatives described above are useful in the treatment of inflammation, and in particular in the treatment of inflammation due to the presence of immune complexes (IC) formed from an Ag nUc and antibodies specifically recognizing this Ag nUc .
  • IC immune complexes
  • ICs formed between a nUc Ag of the infectious microorganism (in particular viral capsid proteins, which generate strong antibody responses) and antibodies recognizing this nUc Ag can induce acute inflammation that can go as far as "cytokine storms" (strong secretion of inflammatory cytokines having deleterious effects on the tissues) described in the severe forms of Covid-19 and influenza, or chronic inflammation, and - diseases autoimmune, where the presence of ICs formed between a nUc Ag of the self and the antibodies recognizing this Ag nUc can also induce an acute or chronic inflammation.
  • cytokine storms strong secretion of inflammatory cytokines having deleterious effects on the tissues
  • the antibodies, fragments and derivatives described above are particularly useful in the treatment of inflammation due to: a) an infection by a microorganism; or b) an autoimmune disease. Inflammation due to infection with a microorganism
  • an antibody, a fragment or a derivative as described here which binds specifically to a nuc Ag of the microorganism responsible for the infection.
  • the infection is a viral infection, since it is in this type of infection that the greatest number of CIs associated with the pathogenesis of the infection have been observed, and an antibody, fragment or derivative is then used as described here which binds specifically to an Ag nUc (in particular the capsid protein) of the virus responsible for the infection.
  • an antibody, fragment or derivative is then used as described here which binds specifically to an Ag nUc (in particular the capsid protein) of the virus responsible for the infection.
  • the viral infection is advantageously chosen from Covid-19, influenza, AIDS, hepatitis B, hepatitis E, human papillomavirus infections and dengue fever.
  • an antibody, fragment or derivative as described may be used. here which specifically binds to the capsid protein of the SARS-Cov2 virus.
  • an antibody, fragment or derivative as described here which specifically binds to the capsid protein of the influenza virus may be used.
  • p24 capsid protein
  • Tat transcriptional transactivator
  • RT HIV-1 reverse transcriptase
  • an antibody, fragment or derivative as described here which specifically binds to the capsid protein of the HBV virus may be used.
  • an antibody, fragment or derivative as described here which specifically binds to the capsid protein of the HEV virus may be used.
  • an antibody, a fragment or a derivative as described here which specifically binds to the capsid protein of the HPV virus may be used.
  • an antibody, fragment or derivative as described herein which specifically binds to the capsid protein of the dengue virus may be used.
  • the inflammation can also be due to a bacterial or parasitic infection.
  • use will be made of an antibody, a fragment or a derivative as described here which binds specifically to an Ag nUC of the bacterium or of the parasite responsible for the infection.
  • an antibody, a fragment or a derivative as described here which binds specifically to the intracellular protein of Yersinia enterocolitica 0.3 (IcP-Ye) .
  • IcP-Ye intracellular protein of Yersinia enterocolitica 0.3
  • an antibody, a fragment or a derivative as described here will be used which binds specifically to an Ag nUC of the self of the patient to be treated.
  • the autoimmune disease is advantageously chosen from rheumatoid arthritis, Kawasaki disease, systemic lupus erythematosus, systemic sclerosis and primary Sjogren's syndrome because these are the autoimmune diseases in which the greatest number of CIs associated with the pathogenesis of disease were observed.
  • an antibody, a fragment or a derivative as described here which binds specifically to a protein chosen from among the snRNPs A, C or 70K proteins.
  • systemic lupus erythematosus it is possible in particular to use an antibody, a fragment or a derivative as described here which binds specifically to a protein chosen from the protein RibP, the histones, the proteins snRNPs A, B, B', C, D and 70K, the Ro60 protein, and the Ro52 protein.
  • systemic sclerosis it will be possible in particular to use an antibody, a fragment or a derivative as described here which binds specifically to a protein chosen from among the Ro60 protein and the snRNPs A, C or 70K proteins.
  • Example 1 The inflammatory reaction can be induced in vitro by ICs containing the transcriptional transactivator (Tat) of HIV-1, which is an Ag endowed with the capacity to bind nucleic acids
  • Tat is a 101-residue protein which was prepared by peptide synthesis as described in the publication by Kittiworakarn et al (Kittiworakarn et al., 2006).
  • the aTat12S and aTat7S Abs are derived from Tat-specific hybridomas, they were obtained by following the protocol described in the publication by Lecoq et al. (Lecoq et al., 2008).
  • the epitope specificity of these two Abs was evaluated by ELISA.
  • microtitration plates were adsorbed at a rate of 100m1 per well with 10pg/ml of a peptide possessing the sequence 1 -37 of Tat, called Tat1 -37, or with 10pg/ml of a peptide-biotinylated having the sequence 37-57 of Tat, called Tat-37-57-b.
  • the wells were then saturated with 200 ml of 0.3% bovine serum albumin (BSA).
  • BSA bovine serum albumin
  • the plates were then washed and dilution series of the two Abs were added. After 4 hours of incubation at room temperature, the plates were washed and a goat anti-mouse antibody coupled to peroxidase was added. After 30 minutes of incubation at room temperature the plates were washed and ABTS was added. After 30 minutes, the optical density was then measured at 414nm using an ELISA reader.
  • Tat HIV-1 transcriptional transactivator
  • the Ac aTat7S does not bind to Tat1 -37 but interacts with Tat-37-57-b which indicates that it recognizes the 37-57 region of Tat (cf Figure 1 B). These data therefore indicate that these two Abs recognize different and non-overlapping epitopes on the Tat protein.
  • the aTat12S and aTat7S Abs are both lgG1 isotypes.
  • this isotype recognizes type II Fc gamma receptors, with the acronym FcyRIl, in humans (Temming et al., 2020).
  • FcyRIl type II Fc gamma receptors
  • This observation therefore led us to evaluate whether the Tat/aTat12S and Tat/aTat7S ICs can induce in vitro the secretion of the inflammatory cytokine IL-6 by human PBMCs.
  • Example 2 The inflammatory reaction can be induced by ICs containing the nucleocapsid protein (Ncp) of the SARS-Cov-2 virus, which is an Ag endowed with the ability to bind nucleic acids
  • the nucleocapsid protein of the SARS-Cov-2 virus has the sequence with the Genbank code YP_009724397.2, version 241 of Genbank of December 15, 2020. It was prepared by the recombinant route using a protocol similar to that described in the publication by Stadlbauer et al. (Stadlbauer et al., 2020). Thus, the sequence encoding Ncp was inserted into the pcDNA3.4 plasmid.
  • HEK cells 2.5.10 6 cells/ml
  • plasmid DNA (1 ⁇ g/m ⁇
  • freestyle 293F medium then with PEI at 0.5 mg/ml. Finally, they were incubated at 37° C.
  • the anti-Ncp monoclonal antibodies were produced using a protocol similar to that described in the publication by Féraudet Tarisse et al (Tarisse et al., 2021). Biozzi mice were immunized four times at three week intervals by injection of 10 pg of Ncp with aluminum hydroxide adjuvant gel, followed by three injections of 50 pg of Ncp at 1 day intervals. Two mice were selected for the production of monoclonal antibodies according to the method developed by (Kohler & Milstein, 1975). Monoclonal antibodies produced in culture supernatant were purified by protein G affinity chromatography.
  • Ncp nucleocapsid protein of the SARS-Cov-2 virus
  • FcyRII type II Fc gamma receptors
  • Example 3 The inflammatory reaction induced by nUC ICs depends on the Fc region of the Acs included in the IC.
  • a controlled proteolysis of the Ac aTat12S and aNcp2 is carried out to obtain their F(ab)’2.
  • aTat12S and aNcp2 are respectively incubated in the presence of pepsin in buffer pH3 for one hour at 37° C.
  • the antibodies are then purified by immunoaffinity either on a column containing Tat, or on a column containing Ncp.
  • Tat and NCP are covalently coupled via their amine groups to a pre-activated sepharose resin of the "CNBr Activated Sepharose® 4B" type (Ref: GE17-0430-01; Sigma-Aldrich).
  • the preparation of the column as well as the implementation of the affinity chromatography are done according to the manufacturer's recommendations.
  • Ncp is initially incubated in the presence or absence of the Ab aNcp2 or of the F(ab)VaNcp2 fragment. These mixtures are then transferred to plates containing human peripheral blood mononuclear cells (PBMCs) at a rate of 0.1 M cells per well. After 18 h of incubation at 37° C., the supernatants are removed and then it is evaluated whether they contain the pro-inflammatory cytokine IL-6.
  • PBMCs peripheral blood mononuclear cells
  • the Tat protein is initially incubated in the presence or in the absence of the Ac aNcp2 or of the F(ab)VaNcp2 fragment. These mixtures are then transferred to plates containing human peripheral blood mononuclear cells (PBMCs) at a rate of 0.1 M cells per well. After 18 h of incubation at 37° C., the supernatants are removed and then it is evaluated whether they contain the pro-inflammatory cytokine IL-6.
  • PBMCs peripheral blood mononuclear cells
  • hybridomas expressing the Ac aTat12S and aNcp2 respectively are placed in culture in order to then be used as a source of messenger RNA. From these hybridomas, the antibody sequences are obtained by following the methods described by Stravinskiene 2020 and Meyer et al. 2019. Briefly, hybridoma RNAs (3-10x10 6 cells) are obtained using the GeneJET RNA Purification Kit (Thermo Fisher Scientific, K0731) and directly used for the synthesis of cDNAs.
  • the cDNAs are amplified by PCR using the ISPCR Universal sense primer (AAG CAGT G GTAT C AACG CAG AG, SEQ ID NO: 5) and one of the specific primers: antisense primer for kappa mIGK chain for PCR (ACATTGATGTCTTTGGGTAGAAG, SEQ ID NO: :6), mIGL lambda chain reverse primer for PCR (ATCGTACACACCAGTGTGGC, SEQ ID NO:7) or mIGHG heavy chain reverse primer for PCR (GGGATCCAGAGTTCCAGGTC, SEQ ID NO:8).
  • ISPCR Universal sense primer AAG CAGT G GTAT C AACG CAG AG, SEQ ID NO: 5
  • antisense primer for kappa mIGK chain for PCR ACATTGATGTCTTTGGGTAGAAG, SEQ ID NO:6
  • mIGL lambda chain reverse primer for PCR ATCGTACACACCAGTGTGGC, SEQ ID NO:7
  • the amplicons are then analyzed by agarose gel electrophoresis, purified, cloned into the plasmid pJet1.2 (Thermo Fisher Scientific, K1231) and sequenced by the Sanger method. From the sequences obtained, new specific primers are used for the cloning of the VH region of aTat12S or aNcp2 in the AbVec-hlgG1 vector (including a human heavy chain constant region of isotype lgG1, Genbank accession number: FJ475055.1; between Age I and Apal sites, Genbank version 241 of December 15, 2020).
  • new specific primers are used for cloning the VL region of aTat12S or aNcp2 in the AbVec-hlgKappa vector (comprising a human kappa isotype light chain constant region, Genbank accession number: FJ475056. 1, between Age I and Bs/WI sites, Genbank version 241 of December 15, 2020) or AbVec-hlgLambda (comprising a human light chain constant region of isotype lambda, Genbank accession number: FJ517647.1, between Age I and Xho ⁇ sites, Genbank version 241 of December 15, 2020).
  • a variant of the AbVec-hlgG1 plasmid allowing translation to be stopped after the CH1 domain (stop codon after position C220 in the K218-S219-C220 sequence) is used to obtain two plasmids encoding the VH-CH1 regions of hcaTat12S and hcaNcp2, respectively.
  • 293-F cells For expression of recombinant Fab fragments and whole antibodies lacking the ability to bind FcyRs, 293-F cells (HEK, Thermo Fisher Scientific, R790-07) are co-transfected (equimolar ratio) with a corresponding plasmid either to the VH-CH1 region or to the complete heavy chain of an lgG1 antibody and to the light chain of the kappa or lambda type by the PEI method (0.5mg/ml; Longo et al 2013) and cultured for 5-8 days in FreeStyleTM 293 Expression Medium (Thermo Fisher Scientific, 12338-018).
  • the Fabs labeled with their poly-histidine units in the medium are purified by affinity chromatography with immobilized metal ions (Nickel column coupled to Fast Flow Sepharose beads (GE Healthcare, 17-0575-01)
  • the whole Abs secreted in the medium are purified by protein A affinity chromatography (Millipore, 113115827).
  • 293-F cells For the expression of whole antibodies lacking the ability to bind FcyRs, 293-F cells (HEK, Thermo Fisher Scientific, R790-07) are co-transfected (equimolar ratio) with a plasmid corresponding to the heavy chain of an lgG1 antibody and either a kappa or lambda type light chain by the PEI method (0.5mg/ml; Longo et al 2013) and cultured for 5-8 days in FreeStyleTM 293 Expression Medium (Thermo Fisher Scientific, 12338-018 ). The antibodies secreted in the medium are purified are purified by protein A affinity chromatography (Millipore, 113115827).
  • the ICs generally interact, via the Fc domain of the Abs, with the FcyRs, it is evaluated whether the Fc domain of an Ab included in an IC nUc is involved in the inflammatory response.
  • the Ab aTat12S and the Ab aNcp2 are used. It is chosen here to alter their ability to bind the FcyRs by eliminating their respective Fc domains. Removal of these domains is achieved by proteolysis with pepsin. This controlled proteolysis makes it possible to obtain F(ab)′2 fragments, called respectively F(ab)′2-aTat12S and F(ab)′2-aNcp2.
  • the IC-Ac-aTat12S and IC-Ac-aNcp2 behave as in examples 1 and 2, that is to say that they trigger the secretion of IL-6 by CMSPs.
  • the IC-F(ab)' 2 -aTat12S and IC-F(ab)' 2 -aNcp2 present a reduced or no inflammatory capacity, due to the absence of an Fc region which compromises the capacity to bind the FcyRs.
  • the ICs generally interact, via the Fc domain of the Abs, with the FcyRs, it is evaluated whether the Fc domain of an Ab included in an IC nUc is involved in the inflammatory response.
  • the Ab aTat12S and the Ab aNcp2 are used. It is chosen here to alter their ability to bind the Fc ⁇ Rs from recombinant constructs lacking their respective Fc domains.
  • Fab fragments called Fab-aTat12S and Fab-aNcp2 respectively, are produced. These two fragments of Ab devoid of the Fc region are then incubated with their respective Ag nUc .
  • IC-Fab-aTat12S and IC-Fab-aNcp2 Two ICs called respectively IC-Fab-aTat12S and IC-Fab-aNcp2 are thus formed. They are then compared to ICs containing whole Abs, respectively called IC-Ac-aTat12S and IC-Ac-aNcp2, for the ability to induce the secretion of IL-6 by human PBMCs.
  • IC-Ac-aTat12S and IC-Ac-aNcp2 behave as in examples 1 and 2, that is to say that they trigger the secretion of IL-6 by CMSPs.
  • IC-Fab-aTat12S and IC-Fab-aNcp2 present a reduced or null inflammatory capacity, due to the absence of an Fc region which compromises the capacity to bind FcyRs.
  • the Fc domain of the Abs As the ICs generally interact, via the Fc domain of the Abs, with the FcyRs, it is evaluated whether the Fc domain of an Ab included in an IC nUc is involved in the inflammatory response.
  • the Ab aTat12S and the Ab aNcp2 are used. It is chosen here to alter their ability to bind the FcyRs from recombinant constructs mutated in their respective Fc domains.
  • these mutated Ac respectively called hcaTat12S-Fc mut and hcaNcp2-Fc mut are produced.
  • These two mutated Abs are then incubated with their respective nUc Ags.
  • IC-hcaTat12S-Fc mut and IC-hcaNcp2-Fc mut . They are then compared to ICs containing the whole non-mutated Abs, respectively called IC-Ac-aTat12S and IC-Ac-aNcp2, for the ability to induce the secretion of IL-6 by human PBMCs.
  • the IC-Ac-aTat12S and IC-Ac-aNcp2 behave as in examples 1 and 2, that is to say that they trigger the IL-6 secretion by PBMCs.
  • the IC-hcaTat12S-Fc mut and IC-hcaNcp2-FC mut present a reduced or null inflammatory capacity, due to the absence of an Fc region which impairs the capacity to bind the FcyRs.
  • Example 4 The inflammatory reaction induced by whole Abs is blocked by an Ab derivative impaired in its ability to bind FCYRS.
  • Ncp is first incubated alone or with aNcp2 and in the presence or absence of F(ab)VaNcp2. To evaluate whether an anti-inflammatory effect can be provided by a non-specific F(ab)'2, Ncp is also incubated with the Ab aNcp2 in the presence or absence of F(ab)' 2 -aTat12S.
  • the Tat protein is first incubated alone or with the Ab aTat12S and in the presence or absence of the F(ab)VaTat12S.
  • Tat is also incubated with the Ab aTat12S in the presence or absence of F(ab)VaNcp2.
  • PBMCs peripheral blood mononuclear cells
  • Ncp is first incubated alone or with the Ab aNcp2 and in the presence or absence of Fab-aNcp2. To assess whether the anti-inflammatory effect can be provided by a non-specific Fab2, Ncp is also incubated with the Ab aNcp2 in the presence or absence of Fab-aTat12S.
  • the Tat protein is first incubated alone with the Ab aTat12S and in the presence or absence of the Fab-aTat12S.
  • Tat is also incubated with the Ab aTat12S and in the presence or absence of the Fab-aNcp2.
  • PBMCs peripheral blood mononuclear cells
  • Ncp is first incubated alone or with the Ab aNcp2 and in the presence or absence of the Ab hcaNcp2-Fc mut .
  • Ncp is incubated with the Ab aNcp2 in the presence or absence of hcaTat12S-Fc mut .
  • Tat is first incubated alone or with the Ab aTat12S and in the presence or absence of hcaTat12S-Fc mut .
  • Tat is incubated with the Ac aTat12S in the presence or absence of the Ac hcaNcp2-Fc mut .
  • PBMCs peripheral blood mononuclear cells
  • F( ab)'2-aTat12S described in Example 3 is used.
  • Tat is incubated with one of the two whole Abs in the absence or presence of F(ab)'2-aTat12S in order to form different types of immune complexes. These mixtures are then incubated for 24 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
  • the IC-Ac-aTat12S behaves as in example 1, that is to say that it triggers the secretion of IL-6 by CMSPs. It is also expected that this secretion is not significantly modified when Tat, aTat12S, F(ab)'2-aNcp2 are incubated individually. On the other hand, it is expected that this secretion is reduced or nil when Tat, aTat12S, F(ab)'2-aTat12S are incubated together.
  • F( ab)'2-aNcp2 described in Example 3 is used. Ncp is incubated with one of the two whole Abs in the absence or presence of F(ab)'2-aNcp2 so as to form different types of immune complexes. These mixtures are then incubated for 24 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
  • the IC-Ac-aNcp2 behaves as in example 2, that is to say that it triggers the secretion of IL-6 by CMSPs. It is also expected that this secretion is not significantly modified when Ncp, aNcp2, F(ab)'2-aTat12S are incubated individually. On the other hand, it is expected that this secretion is reduced or nil when Ncp, aNcp2, F(ab)′2-aNcp2 are incubated together.
  • Fab- aTat12S described in example 3 is used. Tat is incubated with one of the two whole Abs in the absence or presence of Fab-aTat12S in order to form different types of immune complexes. These mixtures are then incubated for 24 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
  • the IC-Ac-aTat12S behaves as in example 1, that is to say that it triggers the secretion of IL-6 by CMSPs. It is also expected that this secretion is not significantly modified when Tat, aTat12S, Fab-aNcp2 are incubated individually. On the other hand, it is expected that this secretion is reduced or nil when Tat, aTat12S, Fab-aTat12S are incubated together.
  • Fab- aNcp2 described in example 3 is used. Ncp is incubated with one of the two whole Abs in the absence or presence of Fab-aNcp2 in order to form different types of immune complexes. These mixtures are incubated for 24 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
  • the IC-Ac-aNcp2 behaves as in example 2, that is to say that it triggers the secretion of IL-6 by PBMCs. It is also expected that this secretion is not significantly modified when Ncp, aNcp2, Fab-aTat12S are incubated individually. On the other hand, it is expected that this secretion is reduced or nil when Ncp, aNcp2, Fab-aNcp2 are incubated together.
  • Ab hcaTat12S mutated (hcaTat12S-Fc mut ) described in Example 3 is used.
  • Tat is incubated with one of the two whole Abs in the absence or in the presence of the hcaTat12S-Fc mut so as to form different types of immune complexes. These mixtures are then incubated for 24 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
  • the IC-Ac-hcaTat12S behaves as in example 1, that is to say that it triggers the secretion of IL-6 by CMSPs. It is also expected that this secretion is not significantly modified when Tat, aTat12S, hcaNcp2-Fc mut are incubated individually. On the other hand, it is expected that this secretion is reduced or nil when Tat, aTat12S, hcaTat12S-FC mut are incubated together.
  • the antibody hcaNcp2 mutated (hcaNcp2 Fc mut ) described in example 3 is used. Ncp is incubated with one of the two whole Abs in the absence or in the presence of the hcaNcp2 Fc mut so as to form different types of immune complexes. These mixtures are then incubated for 24 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
  • the IC-Ac-aNcp2 behaves as in example 2, that is to say that it triggers the secretion of IL-6 by CMSPs. It is also expected that this secretion is not significantly modified when Ncp, aNcp2, hcaNcp2 Fc mut are incubated individually. On the other hand, it is expected that this secretion is reduced or nil when Ncp, aNcp2, hcaNcp2-Fc mut are incubated together.
  • Example 5 The inflammatory reaction induced by nUC ICs depends on the Fc region of the Acs included in the IC.
  • hybridoma expressing the Ac aNcp15 is placed in culture in order to then be used as a source of messenger RNA. From this hybridoma, the antibody sequences are obtained by following the methods described by Stravinskiene 2020 and Meyer et al. 2019. Briefly, hybridoma RNAs (3-10x10 6 cells) are obtained using the GeneJET RNA Purification Kit (Thermo Fisher Scientific, K0731) and directly used for the synthesis of cDNAs.
  • the cDNAs are amplified by PCR using the ISPCR Universal forward primer (AAGCAGTGGTATCAACGCAGAG, SEQ ID NO:5) and one of the specific primers: antisense primer for kappa mIGK chain for PCR (ACATTGATGTCTTTGGGGTAGAAG, SEQ ID NO:6), antisense primer for mIGL lambda chain for PCR (ATCGTACACACCAGTGTGGC, SEQ ID NO:7) or mIGHG heavy chain antisense primer for PCR
  • the amplicons are then analyzed by agarose gel electrophoresis, purified, cloned in the plasmid pJet1.2 (Thermo Fisher Scientific, K1231) and sequenced by the Sanger method. From the sequences obtained, new specific primers are used for the cloning of the VH region of aNcp15 in the AbVec-hlgG1 vector (comprising a human heavy chain constant region of isotype lgG1, Genbank accession number: FJ475055 .1; between Age I and Apal sites, Genbank version 241 of December 15, 2020).
  • new specific primers are used for the cloning of the VL region of aNcp15 in the vector AbVec-hlgKappa (comprising a human constant region of kappa isotype light chain, Genbank accession number: FJ475056.1 , between Age I and Bs/WI sites, Genbank version 241 of December 15, 2020) or AbVec-hlgLambda (comprising a human light chain constant region of isotype lambda, Genbank accession number: FJ517647.1, between Agel and Xho ⁇ sites, Genbank version 241 of December 15, 2020).
  • AbVec-hlgKappa comprising a human constant region of kappa isotype light chain, Genbank accession number: FJ475056.1 , between Age I and Bs/WI sites, Genbank version 241 of December 15, 2020
  • AbVec-hlgLambda comprising a human light chain constant region of isotype lamb
  • hcaNcp15 a chimeric antibody with human constant regions
  • hc human constant regions
  • the E233P, F234V, L235A and D265A mutations are incorporated into the AbVec-hlgG1 plasmid to obtain the aNcp15 variant lacking effector activity.
  • a plasmid derived from AbVec-hlgG1 was constructed by inserting the coding sequence for ENLYFQSHHHHHH (TEV protease cleavage site followed by 6 histidines) downstream of cysteine 220 (C220, in the sequence K218-S219- C220) followed by a stop codon allowing translation to be stopped.
  • This plasmid (AbVec-hlgG1_Fab-TEV-6xHis) is used for the expression of the VH-CH1 -TEV-6xHis fusion of aNcp15 necessary for the production of the corresponding Fab (Fab-aNcp15).
  • 293-F cells For expression of recombinant Fab fragments and whole antibodies lacking the ability to bind FcyRs, 293-F cells (HEK, Thermo Fisher Scientific, R790-07) are co-transfected (equimolar ratio) with a corresponding plasmid either to the VH-CH1 region or to the complete heavy chain of an lgG1 antibody and either a light chain of the kappa or lambda type by the PEI method (0.5mg/ml; Longo et al 2013) and cultured for 5-8 days in FreeStyleTM 293 Expression Medium (ThermoFisher Scientific, 12338-018).
  • the Fabs containing polyhistidine tags and secreted into the medium are purified by IMAC (immobilized metal ion affinity chromatography, GE Healthcare Cat.N. 17-0575-01).
  • the whole antibodies secreted into the medium are purified by protein A affinity chromatography (Millipore, 113115827).
  • 293-F cells For the expression of whole antibodies lacking the ability to bind FcyRs, 293-F cells (HEK, Thermo Fisher Scientific, R790-07) are co-transfected (equimolar ratio) with a plasmid corresponding to the heavy chain of an lgG1 antibody and either a light chain of the kappa or lambda type by the PEI method (0.5mg/ml; Longo et al 2013) and cultured for 5-8 days in FreeStyleTM 293 Expression Medium (Thermo Fisher Scientific, 12338- 018).
  • the Abs secreted into the medium are purified by protein A affinity chromatography (Millipore, 113115827).
  • hcaNcp15 Immunoenzymatic study of hcaNcp15, hcaNcp15Fcmutated and Fab-aNcp15 for the ability to bind the Ncp protein.
  • the hcaNcp15 antibody was adsorbed onto microtiter plates (0.1 pg/1 OOmI/well). The plates were then saturated with PBS buffer containing 0.3% bovine serum albumin. The plates were then washed and a fixed concentration of N-biotinylated protein (178pM) was added to the wells in the presence or absence of series of dilutions of hcaNcp15, or of hcaNcp15Fcmute or of Fab-aNcp15.
  • ABTS colorimetric substrate
  • Results A) Recombinant production of the mutated Ab aNcp15Fcm and of the Fab-aNcp15 fragment, and characterization of their ability to bind the Ncp protein.
  • the Ac hcaNcp15 is used. It is chosen here to produce two recombinant constructs lacking the ability to bind the Fc ⁇ Rs. The first construct corresponds to the Fab fragment of aNcp15, called Fab-aNcp15. The second corresponds to the Ac hcaNcp15 containing a mutated Fc domain in order to alter its ability to bind FcyRs. This construct is called hcaNcp15Fcmute.
  • Fab-aNcp15 and of mutated hcaNcp15Fc to bind Ncp is then compared with that of whole hcaNcp15 Ac, by immunoenzymatic assay. For this, series of dilutions of Fab-aNcp15, of hcaNcpl 5Fcmute or of Ac hcaNcpl 5 were incubated in the presence of a fixed quantity of Ncp-biotinylated in previously adsorbed plates. with Ac hcaNcp15.
  • the full-length hcaNcp15 and hcaNcp15Fcmute antibody show similar inhibition capacity indicating that mutations in the Fc domain of the antibody do not alter the binding capacity.
  • the whole Ac has a greater capacity for inhibition than the Fab fragment, which is expected because the whole molecule has two Fab domains which contribute to the avidity of the interaction.
  • the previously produced Fab-aNcp15 fragment is used. It is incubated in the presence of the Ncp protein so as to form an IC called Ncp/Fab-aNcp15. Its ability to induce IL-6 secretion by human PBMCs is then compared to that of free Ncp, free Fab-aNcp15, and IC Ncp/aNcp15. This last IC, whose ability to trigger IL-6 secretion is shown in Figure 3, is used as a positive control.
  • the free Fab-aNcp15, the free Ncp protein and the IC containing the Fab-aNcp15 behave in the same way since they exhibit almost zero inflammatory capacity (Fig. 5).
  • the aNcp15 IC used as a positive control triggers the secretion of IL-6 by PBMCs.
  • This last observation indicates that the absence of effect of the IC Ncp/Fab-aNcp15 is not due to a loss of reactivity of the cells.
  • the muteated hcaNcp15Fcm antibody lacking the ability to bind Fcys receptors is used.
  • This mutated Ac is incubated with Ncp so as to form an immune complex called Ncp/hcaNcp15- Fcmut .
  • This complex is compared to i) the IC containing the whole non-mutated Ac called Ncp/hcaNcp15, ii) hcaNcp15 -Fcmut , iii) free Ncp for the ability to induce the secretion of IL-6 by human PBMCs.
  • the IC Ncp/hcaNcp15- F mut behave in the same way since they have a capacity virtually no inflammation (figure 6).
  • the Ncp/hcaNcp15 IC behaves as in examples 1 and 2, that is to say that it triggers the secretion of IL-6 by CMSPs.
  • Example 6 The inflammatory reaction induced by whole Abs is blocked by an Ncp-specific Fab or by an Ab derivative impaired in its ability to bind FCYRS.
  • Fab-aNcp15 can block the inflammation caused by an nUc IC containing Ncp.
  • Ncp is incubated alone or with hcaNcp15 and in the presence or absence of Fab-aNcp15.
  • Ncp is also incubated in the presence of Fab-aNcp15 as a control.
  • the various mixtures are then transferred to plates containing human peripheral blood mononuclear cells (PBMCs) at a rate of 0.1 M cells per well. After 18 h of incubation at 37° C., the supernatants are removed and then it is evaluated whether they contain the pro-inflammatory cytokine IL-6.
  • PBMCs peripheral blood mononuclear cells
  • Ncp is first incubated alone or with the hcNcp15 Ab and in the presence or absence of the Ab. hcaNcp15-Fcmute.
  • PBMCs peripheral blood mononuclear cells
  • Ncp is incubated alone or in the presence of Fab-aNcp15.
  • Ncp is also incubated with the whole hcaNcp15 Ac in the absence or presence of Fab-aNcp15 so as to form different types of immune complex.
  • PBMCs peripheral blood mononuclear cells
  • Ncp is incubated alone or in the presence of hcaNcp15Fcmute. Ncp is also incubated with whole hcaNcp15 Ab in the absence or presence of hcaNcp15Fcmute to form different types of immune complex. These mixtures are then incubated for 18 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
  • HIV-1 Tat raises an adjuvant-free humoral immune response controlled by its core region and its ability to form cysteine-mediated oligomers.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Communicable Diseases (AREA)
  • Transplantation (AREA)
  • Microbiology (AREA)
  • Oncology (AREA)
  • Mycology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Epidemiology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Pulmonology (AREA)
  • AIDS & HIV (AREA)

Abstract

46 ABREGE La présente invention concerne un anticorps spécifique d'un antigène protéique capable de se lier aux acides nucléiques, ou un fragment ou un dérivé d'un tel anticorps se liant à l'antigène, pour son utilisation comme médicament, en particulier dans le traitement ou la prévention de l'inflammation, notamment celle due à une infection ou 5 à une maladie autoimmune, caractérisé en ce que l'anticorps, fragment ou dérivé possède une capacité réduite de liaison au récepteur FcγRIIA et/ou une capacité augmentée de liaison au récepteur FcγRIIB. L'anticorps, fragment ou dérivé est de préférence sans domaine Fc, ou avec un domaine Fc modifié avec une capacité réduite de liaison à FcγRIIA et éventuellement FcγRIIIA (voire avec une capacité réduite de liaison à tous les FcγR), 10 et/ou avec un domaine Fc modifié avec une capacité augmentée de liaison à FcγRIIB.

Description

ANTICORPS, FRAGMENTS OU DÉRIVES SE LIANT SPÉCIFIQUEMENT A UN ANTIGÈNE PROTÉIQUE CAPABLE DE SE LIER AUX ACIDES NUCLÉIQUES ET LEURS UTILISATIONS
DOMAINE DE L’INVENTION La présente invention se situe dans le domaine des thérapies médicamenteuses ayant pour objet de résoudre les désordres inflammatoires induits par des complexes immuns. Elle concerne un anticorps spécifique d’un antigène protéique capable de se lier aux acides nucléiques, ou un fragment ou un dérivé d’un tel anticorps se liant à l’antigène, pour son utilisation comme médicament, en particulier dans le traitement ou la prévention de l’inflammation, notamment celle due à une infection ou à une maladie autoimmune, caractérisé en ce que l’anticorps, fragment ou dérivé possède une capacité réduite de liaison au récepteur FcyRIlA et/ou une capacité augmentée de liaison au récepteur FcyRIlB. L’anticorps, fragment ou dérivé est de préférence sans domaine Fc, ou avec un domaine Fc modifié avec une capacité réduite de liaison à FcyRIlA et éventuellement FcyRIIIA (voire avec une capacité réduite de liaison à tous les FcyR), et/ou avec un domaine Fc modifié avec une capacité augmentée de liaison à FcyRIlB.
ART ANTÉRIEUR
Lors d’infections par des microorganismes, des réactions inflammatoires aiguës et incontrôlées peuvent se déclencher et contribuer à la pathogenèse (Cecconi et al., 2018 ; Horvath et al., 2011 ). Ces réactions délétères peuvent se produire précocement, au commencement de l’infection (Hawkins et al., 2018 ; Tisoncik et al., 2012). Cependant, elles peuvent aussi se déclencher plus tardivement, lors de l’apparition de la réponse immunitaire spécifique (Hung, 2020). Dans ce second cas, il a été observé que des complexes immuns (IC), résultant de l’association de sous-unités du pathogène avec des anticorps (Ac) spécifiques, induisent une hyperproduction de cytokines, notamment inflammatoires, qui tendent à accroître la pathologie. Ce phénomène a notamment été observé dans le cas des infections par le virus de la dengue (OhAinle et al., 2011 ). Il est postulé qu’il pourrait survenir dans le cas des infections par le virus SARS-COV2 et qu’il pourrait contribuer à une sévérité accrue de la maladie (Fu et al., 2020 ; Tillett et al., 2021 ; Torres et al., 2020).
Des réactions inflammatoires chroniques peuvent aussi se déclencher lors de désordres auto-immuns et s’avérer invalidantes chez le patient. Ces réactions peuvent notamment être causées par la présence d’anticorps spécifiques d’antigènes (Ags) du soi (Sospedra & Martin, 2016). Dans ce cas, la présence d’IC résultant de l’association d’antigènes du soi avec des anticorps (Ac) pourrait être responsable de l’inflammation.
Ainsi, les ICs pourraient induire des inflammations responsables d’effets pathologiques aussi bien dans certaines infections par des microorganismes que dans certaines maladies inflammatoires et/ou auto-immunes (Kapingidza et al., 2020). La mise en place d’approches thérapeutiques permettant de contrer ces effets inflammatoires représente donc un enjeu crucial pour améliorer l’état clinique des patients.
Une part importante des traitements anti-inflammatoire est fondée sur des médicaments capables de bloquer des cytokines impliquées dans l’inflammation ou les récepteurs associés (Dinarello, 2010). Ces médicaments tendent cependant à bloquer l’ensemble des activités médiées par la cytokine ou le récepteur considéré. Or, ces dernières molécules peuvent par ailleurs jouer des rôles cruciaux dans nombre d’autres processus physiologiques nécessaires au maintien de l’homéostasie. Il en résulte que ces approches anti-inflammatoires peuvent induire des effets secondaires indésirables et être, de ce fait, moins bien tolérées par le patient.
Pour bloquer l’inflammation, une autre approche consiste en l’injection d’immunoglobulines par voie intraveineuse (IVIG). Les IVIG sont non-spécifiques de la pathologie. Il est postulé que, suite à leur injection, elles vont interagir avec le récepteur Fc gamma Mb (FcyRIIb). FcyRIIb va de ce fait transmettre un signal d’inhibition et permettre de ce fait un blocage de la réaction inflammatoire médiée par les ICs (Ben Mkaddem et al., 2019). Cette approche relativement efficace tend cependant à abroger l’activité de l’ensemble des FcyRIIbs de l’organisme. Le traitement pourrait de ce fait perturber d’autres processus physiologiques dans lesquels les FcyRIIbs seraient impliqués de façon à maintenir l’homéostasie. Ce type de traitement pourrait de ce fait être moins bien toléré par le patient.
Une autre approche anti-inflammatoire, consiste à utiliser des anticorps capables de bloquer les récepteurs Fc gamma activateurs, comme les FcyRIlA et FcyRIIIA, afin de limiter le processus inflammatoire médié par les ICs (Ben Mkaddem et al., 2019). Cette approche va conduire au blocage de l’ensemble des FcyRIlA et FcyRIIIA de l’organisme et pourrait de ce fait perturber d’autres processus physiologiques dans lesquels ces récepteurs seraient impliqués de façon à maintenir l’homéostasie. Ce type de traitement, comme les approches décrites précédemment, pourrait être moins bien toléré par le patient.
Les approches existantes visant à réduire l’inflammation induite par les ICs aussi bien dans certaines infections par des microorganismes que dans certaines maladies inflammatoires et/ou auto-immunes ne sont donc pas assez spécifiques, et il existe par conséquent un besoin pour de nouvelles approches, plus efficaces, avec moins de risque d’effets secondaires et qui préservent l’aptitude de l’organisme à lutter contre d’autres pathologies.
RÉSUME DE L’INVENTION
Il existe de nombreuses protéines issues de microorganismes ou humaines qui sont dotées de la capacité à lier les acides nucléiques (ci-après « antigènes protéiques dotés de la capacité à lier les acides nucléiques » ou « AgnUc »). De plus, il a été montré que des réponses en anticorps sont générées contre de telles protéines, notamment contre les protéines de nucléocapside virales et les ribonucléoprotéines humaines (Hoffman & Greidinger, 2000 ; Leung et al., 2004 ; Migliorini et al., 2005). La présence d’ICs contenant un AgnUc (ci-après « ICnUc »), est avérée chez l’homme et a dans certains cas été associée à la pathogenèse de la maladie (Cafaro et al., 2019 ; Carter et al., 2000 ; Choi et al., 2020 ; Fenouillet et al., 1993 ; Ghiggeri et al., 2019 ; Hashida et al., 1997 ; Hu, 2002 ; Kamar et al., 2017 ; Ni et al., 2020 ; Pisetsky & Lipsky, 2020 ; Rumbaugh et al., 2013 ; Schulte-Pelkum et al., 2009 ; To & Pétri, 2005).
Les travaux réalisés récemment sur les coronavirus et le rôle des ICs dans l’apparition des formes sévères suggéraient cependant que les ICnuc pourraient jouer un rôle protecteur et n’encourageraient pas à bloquer leur activité activatrice. En effet, l’équipe de Gao et al. (Gao et al., 2020) a montré que trois AgnUc - correspondant respectivement aux protéines de nucléocapside des coronavirus SRAS-COV, MERS-COV et SRAS-COV-2 - peuvent chacun déclencher des effets inflammatoires pathologiques et que l’injection, chez l’animal préalablement infecté, d’un Ac intégral et spécifique de l’AgnUc de SRAS-COV-2 peut bloquer ces effets délétères. De plus, Zohar et al. (Zohar et al. , 2020) ont montré que les personnes qui ne survivent pas à la maladie ont des Ac qui possèdent une capacité réduite à lier les récepteurs Fcys. Enfin, Combes et al. (Combes et al., 2021 ) a montré que les patients avec des formes sévères développent des Ac qui engagent le récepteur FcyllB inhibiteur.
Dans le cadre de la présente invention, les inventeurs se sont intéressés aux AgnUc, et ont montré de manière surprenante que les ICnUc (notamment ceux de la protéine de nucléocapside du virus SARS-Cov2) peuvent déclencher des réponses inflammatoires. Ils ont ensuite observé que des ICnUc uniquement formés avec des fragments d’Ac dépourvus de la capacité à lier les récepteurs Fcys sont incapables de médier l’inflammation et peuvent même inhiber l’inflammation induite par des ICnUc Ainsi, des anticorps, fragments ou dérivés spécifique d’un AgnUc et incapables de se lier aux récepteurs Fcys peuvent être utilisés pour réduire l’inflammation associée aux ICnuc
En bloquant l’activité d’ICs spécifiques d’une pathologie donnée, elle s’attaque aux causes du développement de la réponse inflammatoire. Elle diffère en cela de la plupart des traitements actuels qui ont pour objet de s’attaquer aux conséquences symptomatologiques, le plus souvent par le blocage de voies inflammatoires, cytokines, ou récepteurs impliqués dans l’inflammation (Dinarello, 2010). Ce fonctionnement amont pourrait rendre le traitement plus efficace que les autres médicaments sur le marché ou en développement.
De plus, l’invention se focalise sur les ICs générés lors d’une pathologie et s’avère de ce fait uniquement spécifique de cette pathologie. En ne bloquant que l’activité des ICs spécifiques de la pathologie elle permet à d’autres ICs d’interagir avec les FcRs et préserve ainsi les autres processus de régulation physiologique des mécanismes immunitaires. Dans un premier aspect, la présente invention concerne donc un anticorps spécifique d’un antigène protéique capable de se lier aux acides nucléiques, ou un fragment ou un dérivé d’un tel anticorps se liant à l’antigène, pour son utilisation comme médicament, caractérisé en ce que l’anticorps, fragment ou dérivé possède une capacité réduite de liaison au récepteur FcyRIlA et/ou une capacité augmentée de liaison au récepteur FcyRIlB.
L’invention concerne en outre un anticorps spécifique d’un antigène protéique capable de se lier aux acides nucléiques, ou un fragment ou un dérivé d’un tel anticorps se liant à l’antigène, pour son utilisation dans le traitement ou la prévention de l’inflammation, caractérisé en ce que l’anticorps, fragment ou dérivé possède une capacité réduite de liaison au récepteur FcyRIlA et/ou une capacité augmentée de liaison au récepteur FcyRIlB. DESCRIPTION DES FIGURES
Fig. 1A : Détermination des épitopes B reconnus par les Ac aTat12S et aTat7S. Le peptide Tat1 -37 a été adsorbé sur des plaques de microtitration et la liaison des deux Ac aTat12S et aTat7S à Tat1 -37-b a été évaluée par dosage immunoenzymatique.
Fig. 1 B : Détermination des épitopes B reconnus par les Ac aTat12S et aTat7S. Le peptide Tat37-57-b a été adsorbé sur des plaques de microtitration et la liaison des deux Ac aTat12S et aTat7S à Tat37-57-b a été évaluée par dosage immunoenzymatique.
Fig. 2 : Évaluation de la capacité des ICs Tat/aTat12S et Tat/aTat7S à induire la réponse inflammatoire de CMSPs humaines. Des CMSPs humaines ont été incubées in vitro avec 100nM de Tat libre, 100nM de aTat12S libre, 100nM de aTat7S libre, Tat/aTat12S (100 mM chacun) et Tat/aTat7S (100 mM chacun), respectivement. Après 18 heures d’incubation les surnageants ont été prélevés et la présence d’IL-6 a été évaluée par dosage immunoenzymatique.
Fig. 3 : Évaluation de la capacité des ICs Ncp/aNcp2 et Ncp/aNcp15 à induire la réponse inflammatoire de CMSPs humaines. Des CMSPs humaines ont été incubées in vitro avec 30nM de Ncp libre, 30nM de aNcp2 libre, 30nM de aNcp15 libre, Ncp/aNcp2 (30nM chacun) et Ncp/aNcp15 (30nM chacun), respectivement. Après 18 heures d’incubation les surnageants ont été prélevés et la présence d’IL-6 a été évaluée par dosage immunoenzymatique.
Fig. 4 : Le Fab-aNcp15 et hcaNcp15Fcmuté sont dotés de la capacité à lier la protéine Ncp. L’anticorps chimérique hcaNcp15 a été adsorbé sur des plaques de microtitration. Une concentration fixe de protéine N-biotinylée (178pM) a été incubée dans les puits de la plaque en présence ou en absence de séries de dilutions d’hcaNcp15 ou de Fab-Ncp15 ou de hcaNcp15Fcmuté. Après une incubation d’une nuit à 4°C, la plaque a été lavée, de la streptavidine couplée à la péroxydase a été ajoutée. Après 30 minutes, des lavages ont été effectués et un substrat colorimétrique (ABTS) a été ajouté pour mesurer la présence de Ncp-biotinylé.
Fig. 5 : La capacité d’ICs Ncp/aNcp à induire la réponse inflammatoire de CMSPs humaines est altérée quand l’Ac inclus dans le complexe est dépourvu de la région Fc. Des CMSPs humaines ont été incubées in vitro avec Ncp (30nM), Fab-aNcp15 (333nM), Ncp/hcaNcp15 (30nM pour chaque protéine) et Ncp/ Fab-aNcp15 (30nM pour Ncp, 333 nM pour le Fab)) respectivement. Après 18 heures d’incubation les surnageants ont été prélevés et la présence d’IL-6 a été évaluée par dosage immunoenzymatique.
Fig. 6 : La capacité d’ICs Ncp/aNcp à induire la réponse inflammatoire de CMSPs humaines est altérée quand l’Ac inclus dans le complexe est muté dans sa région Fc de façon à ne plus être capable de lier les récepteurs Fcys. Des CMSPs humaines ont été incubées in vitro avec Ncp (30nM), hcaNcp15Fcmuté (30nM), Ncp/hcaNcp15 (30nM pour chaque protéine) et Ncp/hcaNcp15Fcmuté (30nM pour chaque protéine) respectivement. Après 18 heures d’incubation les surnageants ont été prélevés et la présence d’IL-6 a été évaluée par dosage immunoenzymatique.
Fig. 7 : La capacité d’un aNcp à induire la réponse inflammatoire de CMSPs humaines est altérée par un dérivé d’Ac dépourvu de la région Fc. Des CMSPs humaines ont été incubées in vitro avec Ncp (30nM), Ncp/hcaNcp15 (30nM pour chaque protéine), Ncp/Fab-aNcp15 (30nM pour Ncp, 333nM pour le Fab), Ncp/hcaNcp15/Fab-aNcp15 (30nM pour les deux premières protéines, 333nM pour le Fab), respectivement. Après 18 heures d’incubation les surnageants ont été prélevés et la présence d’IL-6 a été évaluée par dosage immunoenzymatique.
Fig. 8 : La capacité d’un aNcp à induire la réponse inflammatoire de CMSPs humaines en présence de Ncp est altérée par un dérivé d’Ac muté dans sa capacité à lier les RFcys. Des CMSPs humaines ont été incubées in vitro avec Ncp (10nM), Ncp/hcaNcp15 (1 OnM pour Ncp, 10nM pour l’Ac), Ncp/hcaNcp15Fcmuté (1 OnM pour Ncp, 30nM pour l’Ac), Ncp/hcaNcp15/hcaNcp15Fcmuté (10nM pour Ncp, 10nM pour hcaNcp15, 30 nM pour hcaNcp15Fcmuté), respectivement. Après 18 heures d’incubation les surnageants ont été prélevés et la présence d’IL-6 a été évaluée par dosage immunoenzymatique.
DESCRIPTION DÉTAILLÉE DE L’INVENTION
L’invention concerne un anticorps spécifique d’un antigène protéique capable de se lier aux acides nucléiques, ou un fragment ou un dérivé d’un tel anticorps se liant à l’antigène, pour son utilisation comme médicament, caractérisé en ce que l’anticorps, fragment ou dérivé possède une capacité réduite de liaison au récepteur FcyRIlA et/ou une capacité augmentée de liaison au récepteur FcyRIlB.
Elle concerne également un anticorps spécifique d’un antigène protéique capable de se lier aux acides nucléiques, ou un fragment ou un dérivé d’un tel anticorps se liant à l’antigène, pour son utilisation dans le traitement ou la prévention de l’inflammation, caractérisé en ce que l’anticorps, fragment ou dérivé possède une capacité réduite de liaison au récepteur FcyRIlA et/ou une capacité augmentée de liaison au récepteur FcyRIlB.
Elle concerne en outre l’utilisation d’un anticorps spécifique d’un antigène protéique capable de se lier aux acides nucléiques, ou d’un fragment ou d’un dérivé d’un tel anticorps se liant à l’antigène, pour la préparation d’un médicament destiné au traitement ou la prévention de l’inflammation, caractérisé en ce que l’anticorps, fragment ou dérivé possède une capacité réduite de liaison au récepteur FcyRIlA et/ou une capacité augmentée de liaison au récepteur FcyRIlB.
Elle concerne en outre l’utilisation d’un anticorps spécifique d’un antigène protéique capable de se lier aux acides nucléiques, ou d’un fragment ou d’un dérivé d’un tel anticorps se liant à l’antigène, pour le traitement ou la prévention de l’inflammation, caractérisé en ce que l’anticorps, fragment ou dérivé possède une capacité réduite de liaison au récepteur FcyRIlA et/ou une capacité augmentée de liaison au récepteur FcyRIlB.
Elle concerne en outre une composition pharmaceutique comprenant un anticorps spécifique d’un antigène protéique capable de se lier aux acides nucléiques, ou un fragment ou un dérivé d’un tel anticorps se liant à l’antigène, pour son utilisation dans le traitement ou la prévention de l’inflammation, caractérisé en ce que l’anticorps, fragment ou dérivé possède une capacité réduite de liaison au récepteur FcyRIlA et/ou une capacité augmentée de liaison au récepteur FcyRIlB.
Elle concerne en outre une méthode de traitement ou de prévention de l’inflammation chez un sujet en ayant besoin, comprenant l’administration d’une quantité efficace d’un anticorps spécifique d’un antigène protéique capable de se lier aux acides nucléiques, ou d’un fragment ou d’un dérivé d’un tel anticorps se liant à l’antigène, caractérisé en ce que l’anticorps, fragment ou dérivé possède une capacité réduite de liaison au récepteur FcyRIlA et/ou une capacité augmentée de liaison au récepteur FcyRIlB.
Caractéristiques de l’anticorps, fragment ou dérivé
La présente invention repose sur l’utilisation thérapeutique d’un anticorps spécifique d’un antigène protéique capable de se lier aux acides nucléiques.
Par « anticorps » ou « Ac » ou « immunoglobuline », on entend une molécule comprenant au moins un domaine de liaison à un antigène donné et un domaine constant comprenant un fragment Fc capable de se lier aux récepteurs FcR. Chez la plupart des mammifères, comme l’homme et la souris, un anticorps est composé de 4 chaînes polypeptidiques : 2 chaînes lourdes et 2 chaînes légères reliées entre elles par un nombre variable de ponts disulfures assurant une flexibilité à la molécule. Chaque chaîne légère est constituée d'un domaine constant (CL) et d'un domaine variable (VL); les chaînes lourdes étant composées d'un domaine variable (VH) et de 3 ou 4 domaines constants (CH1 à CH3 ou CH1 à CH4) selon l’isotype de l'anticorps. Chez quelques rares mammifères, comme les camélidés tels que les chameaux et les lamas, et chez les requins, les anticorps sont constitués de seulement deux chaînes lourdes, chaque chaîne lourde comprenant un domaine variable (appelé VhH chez les camélidés et V-NAR chez les requins) et une région constante (Holliger & Hudson, 2005).
Les domaines variables sont impliqués dans la reconnaissance de l’antigène, tandis que les domaines constants sont impliqués dans les propriétés biologiques, pharmacocinétiques et effectrices, de l’anticorps.
La région variable diffère d’un anticorps à un autre. En effet, les gènes codant pour les chaînes lourdes et légères des anticorps sont générés par recombinaison de respectivement trois et deux segments de gènes distincts appelés VH, DH et JH-CH pour la chaîne lourde et VL et JL-CL pour la chaîne légère. Les segments CH et CL ne participent pas à la recombinaison et forment les régions constantes des chaînes lourdes et légères respectivement. Les recombinaisons des segments VH-DH-JH et VL-JL forment les régions variables des chaînes lourdes et légères respectivement. Les régions VH et VL possèdent chacune 3 zones hyper variables ou régions déterminant la complémentarité (CDR), appelées CDR1 , CDR2 et CDR3, la région CDR3 étant la plus variable, puisqu’elle se situe au niveau de la zone de recombinaison. Ces trois régions CDR, et particulièrement la région CDR3, se trouvent dans la partie de l’anticorps qui sera en contact avec l’antigène et sont donc très importantes pour la reconnaissance de l’antigène. Ainsi, les anticorps conservant les trois régions CDR de chacune des chaînes lourde et légère d’un anticorps conservent en grande majorité la spécificité antigènique de l’anticorps d’origine. Dans un certain nombre de cas, un anticorps ne conservant que l’un des CDR, et notamment le CDR3, conserve également la spécificité de l’anticorps d’origine. Les régions CDR1 , CDR2 et CDR3 sont chacune précédées des régions FR1 , FR2 et FR3 respectivement, correspondant aux régions charpentes ( framework région, FR) qui varient le moins d’un segment VH ou VL à un autre. La région CDR3 est également suivie d’une région charpente FR4.
Un anticorps, fragment ou dérivé qui « se lie » à un antigène d'intérêt est un anticorps, fragment ou dérivé qui se lie à l'antigène avec une affinité suffisante pour que l'anticorps soit utile comme agent diagnostique et / ou thérapeutique pour cibler l’antigène sous forme circulante ou exprimé par une cellule ou un tissu, et ne réagit pas significativement avec d'autres antigènes. L'étendue de la liaison de l'anticorps, fragment ou dérivé à un antigène « non cible » sera inférieure à environ 10% de la liaison de l'anticorps à son antigène cible, telle que déterminée par analyse de tri cellulaire activé par fluorescence (FACS) ou radio-immunoprécipitation (RIPA). En ce qui concerne la liaison d'un anticorps, fragment ou dérivé à un antigène cible, les expressions « liaison spécifique » ou « se lie spécifiquement à » ou est « spécifique de » un antigène particulier ou un épitope d’un antigène particulier signifie une liaison qui est mesurablement différente d'une interaction non spécifique. La liaison spécifique peut être mesurée, par exemple, en mesurant la liaison à l’antigène par rapport à la liaison à un antigène témoin, qui est généralement un antigène de structure similaire qui n'a pas d'activité de liaison. Par exemple, une liaison spécifique peut être déterminée par compétition avec un antigène témoin qui est similaire à la cible, par exemple en mesurant la liaison à l’antigène ciblé marqué en présence ou en absence d’un excès d’antigène cible non marqué. Dans ce cas, la liaison est considérée comme spécifique si la liaison de la cible marquée est inhibée de manière compétitive par un excès de cible non marquée. On pourra notamment considérer qu’il y a «liaison spécifique» ou que l’anticorps, fragment ou dérivé «se lie spécifiquement à» ou est «spécifique de» un antigène particulier ou un épitope sur un antigène, par exemple, si l’anticorps, fragment ou dérivé possède un KD pour la cible d'au plus environ 106 M, en variante au plus environ 107 M, en variante au plus environ 108 M, en variante au plus environ 109 M, en variante au plus environ 101° M, en variante au plus environ 1011 M, en variante au plus environ 1012 M, ou moins encore. Dans certains modes de réalisation, le terme « liaison spécifique » fait référence à une liaison dans laquelle l’anticorps, fragment ou dérivé se lie à un antigène ou à un épitope particulier sur un antigène sans se lier substantiellement à un autre antigène ou épitope. Dans certains modes de réalisation, un anticorps, fragment ou dérivé qui se lie à un Agnuc a une constante de dissociation (KD) inférieure ou égale à 1 mM, < 100 nM, < 10 nM, < 1 nM ou < 0,1 nM.
Le terme « KD » utilisé ici signifie une constante de dissociation d'une interaction anticorps-antigène spécifique et est utilisé comme indicateur pour mesurer l'affinité d'un anticorps pour un antigène. Un KD inférieur signifie une affinité plus élevée d'un anticorps pour un antigène.
Contrairement aux domaines variables dont la séquence varie fortement d’un anticorps à un autre, les domaines constants sont caractérisés par une séquence en acides aminés très proche d'un anticorps à l'autre, caractéristique de l'espèce et de l'isotype, avec éventuellement quelques mutations somatiques. Le fragment Fc est naturellement composé de la région constante de la chaîne lourde à l’exclusion du domaine CH1 , c’est- à-dire de la région charnière inférieure et des domaines constants CH2 et CH3 ou CH2 à CH4 (selon l’isotype). Chez les lgG1 humaines, le fragment Fc complet est composé de la partie C-terminale de la chaîne lourde à partir du résidu cystéine en position 226 (C226), la numérotation des résidus d’acides aminés dans le fragment Fc étant dans toute la présente description celle de l’index EU décrit dans les publications Edelman et al-1969 et Kabat et al-1991 (Edelman et al., 1969 ; Kabat E.A., Wu T. T., Perry H.M. Foeller C., 1991 ). Les fragments Fc correspondants d’autres types d’immunoglobulines peuvent être identifiés aisément par l’homme du métier par des alignements de séquences.
Le fragment Fc des IgG est glycosylé au niveau du domaine CH2 avec la présence, sur chacune des 2 chaînes lourdes, d'un N-glycanne lié au résidu asparagine en position 297 (Asn 297).
Les domaines de liaison suivants, situés dans le Fc, sont importants pour les propriétés biologiques de l’anticorps :
- domaine de liaison au récepteur FcRn, impliqué dans les propriétés pharmacocinétiques (demi-vie in vivo) de l’anticorps : Différentes données suggèrent que certains résidus situés à l’interface des domaines CH2 et CH3 sont impliqués dans la liaison au récepteur FcRn.
- domaine de liaison à la protéine du complément C1 q, impliqué dans la réponse CDC (pour « cytotoxicité dépendante du complément ») : situé dans le domaine CH2;
- domaine de liaison aux récepteurs FcR, impliqué dans les réponses de type phagocytose ou ADCC (pour « cytotoxicité cellulaire dépendante de l’anticorps) : situé dans le domaine CH2.
Les anticorps peuvent être de plusieurs isotypes, en fonction de la nature de leur région constante : les régions constantes g, a, m, e et d correspondent respectivement aux immunoglobulines IgG, IgA, IgM, IgE et IgD. Avantageusement, l’anticorps monoclonal présent dans une composition utilisée en tant que médicament dans le cadre de l’invention est d’isotype IgG.
Dans le cadre de l’invention, l’anticorps peut être monoclonal ou polyclonal.
Dans un mode de réalisation avantageux, l’anticorps est monoclonal. Par « anticorps monoclonal » ou « composition d’anticorps monoclonal », on entend une composition comprenant des molécules d’anticorps possédant une spécificité antigénique identique et unique. Les molécules d’anticorps présentes dans la composition sont susceptibles de varier au niveau de leurs modifications post-traductionnelles, et notamment au niveau de leurs structures de glycosylation ou de leur point isoélectrique, mais ont toutes été codées par les mêmes séquences de chaînes lourde et légère et ont donc, avant toute modification post-traductionnelle, la même séquence protéique. Certaines différences de séquences protéique, liées à des modifications post- traductionnelles (comme par exemple le clivage de la lysine C-terminale de la chaîne lourde, la déamidation de résidus asparagine et/ou l’isomérisation de résidus aspartate), peuvent néanmoins exister entre les différentes molécules d’anticorps présentes dans la composition.
Dans un autre mode de réalisation, l’anticorps est polyclonal. Par « anticorps polyclonal », on entend un mélange d'anticorps reconnaissant différents épitopes sur un antigène donné. Il peut s’agir d’un anticorps polyclonal purifié à partir du sérum d’un sujet immunisé avec l’antigène d’intérêt (on parlera alors de « polyclonal naturel », que l’immunisation soit naturelle ou induite par l’homme) ou d’un mélange d’au moins 2 (par exemple 2, 3, 4, ou 5) anticorps monoclonaux reconnaissant différents épitopes sur un antigène donné (on parlera alors de « polyclonal synthétique »). Dans le cadre de l’invention, un anticorps polyclonal naturel ou polyclonal synthétique peut être utilisé, avec une préférence pour un anticorps polyclonal synthétique.
Pour une utilisation chez l’homme, l’anticorps, fragment fonctionnel ou dérivé de celui-ci selon l’invention est avantageusement un anticorps chimérique ou humanisé, en particulier un anticorps chimérique dont la région constante des chaînes lourdes et légères est d’origine humaine.
Par anticorps « chimérique », on entend désigner un anticorps qui contient une région variable (chaîne légère et chaîne lourde) naturelle dérivée d'un anticorps d'une espèce donnée en association avec les régions constantes de chaîne légère et chaîne lourde d'un anticorps d'une espèce hétérologue à ladite espèce donnée. Avantageusement, si la composition d’anticorps monoclonal pour son utilisation en tant que médicament selon l’invention comprend un anticorps monoclonal chimérique, celui- ci comprend des régions constantes humaines. Partant d’un anticorps non humain, un anticorps chimérique peut être préparé en utilisant les techniques de recombinaison génétique bien connues de l’homme du métier. Par exemple, l'anticorps chimérique pourra être réalisé en clonant pour la chaîne lourde et la chaîne légère un ADN recombinant comportant un promoteur et une séquence codant pour la région variable de l’anticorps non humain, et une séquence codant pour la région constante d'un anticorps humain. Pour les méthodes de préparation d'anticorps chimériques, on pourra par exemple se référer aux documents (Verhoeyen et al., 1988 ; Verhoeyen & Riechmann, 1988).
Par anticorps « humanisé », on entend désigner un anticorps qui contient des régions CDRs dérivées d'un anticorps d'origine non humaine, les autres parties de la molécule d'anticorps étant dérivées d'un (ou de plusieurs) anticorps humains. En outre, certains des résidus des segments du squelette (dénommés FR) peuvent être modifiés pour conserver l'affinité de liaison (Jones et al., 1986 ; Riechmann et al., 1988 ; Verhoeyen et al., 1988). Les anticorps humanisés selon l'invention peuvent être préparés par des techniques connues de l'homme de l'art telles les technologies de « CDR grafting », de « resurfacing », de SuperHumanisation, de « Human string content », de « FR libra ries », de « Guided sélection », de « FR shuffling » et de « Humaneering », comme résumé dans la revue de Almagro et al. (Almagro & Fransson, 2008).
Les expressions « anticorps entier », « anticorps intact » ou « anticorps de pleine longueur » sont utilisées de manière interchangeable pour désigner un anticorps sous sa forme sensiblement intacte, par opposition à un fragment d'anticorps. Spécifiquement, les « anticorps entiers » tels qu'utilisés ici comprennent ceux avec des chaînes lourdes et légères comprenant un domaine Fc. Les domaines constants peuvent être des domaines constants de séquence native (par exemple, des domaines constants de séquence native humaine) ou des variants de séquence d'acides aminés de ceux-ci.
Par « fragment d’un anticorps se liant à l’antigène », on entend un fragment d’anticorps conservant le domaine de liaison à l’antigène et ayant donc la même spécificité antigénique que l’anticorps d’origine. Des exemples non limitatifs de fragments incluent les fragments F(ab’)2, Fab, Fab’, ScFv, Fv, VhH, et V-NAR. Les structures de ces fragments et les méthodes pour les obtenir sont connues de l’homme du métier (Holliger & Hudson, 2005).
Par « dérivé d’un anticorps se liant à l’antigène », on entend un complexe comprenant plusieurs fragments d’un anticorps arrangés sous une forme non naturelle. Des exemples non limitatifs de fragments incluent les dérivés ScFv, Bis-scFv, scFv-Fc, Fab2, Fab3, minianticorps (ou « minibody »), dianticorps (« diabodies »), trianticorps (« triabodies »), tétraanticorps (« tetrabodies »). Les structures de ces dérivés et les méthodes pour les obtenir sont également connues de l’homme du métier (Holliger & Hudson, 2005).
En présence de leur antigène, les anticorps forment des « complexes immuns » (ou « ICs »), c’est-à-dire des agrégats antigène-anticorps comprenant plusieurs anticorps liés à la surface d’une ou plusieurs molécules d’antigène.
L’anticorps, fragment ou dérivé utilisé dans l’invention possède une capacité réduite de liaison au récepteur FcyRIlA et/ou une capacité augmentée de liaison au récepteur FcyRIlB.
Les anticorps, notamment les IgGs, sont des molécules bifonctionnelles. Ils interagissent avec les différents récepteurs du domaine Fcy (FcyRs) via leur domaine Fc et lient les antigènes par l’intermédiaire de leurs deux domaines Fab. Les ICs formés permettent une meilleure prise en charge des antigènes par les cellules immunitaires exprimant des FcyRs à leur surface. Les FcyRs sont classés en deux groupes fonctionnels, les FcyRs activateurs (FcyRI, FcyRIlA, FcyRIIC, FcyRIIIA) et inhibiteurs (FcyRIlB). Parmi les FcyRs activateurs, FcyRI est un récepteur de haute affinité capable de lier les anticorps sous forme monomérique, tandis que FcyRIlA, FcyRIIC, et FcyRIIIA sont des récepteurs de faible affinité qui lient principalement les ICs. Le récepteur inhibiteur FcyRIlB est également un récepteur de faible affinité, liant principalement les ICs.
Anticorps, fragment, ou dérivé avec une capacité réduite de liaison au récepteur FCYRIIA
Dans un mode de réalisation avantageux, on utilise un anticorps, un fragment ou un dérivé possédant une capacité réduite de liaison au récepteur FcyRIIA.
L’anticorps, fragment ou dérivé peut en outre posséder une capacité réduite de liaison au récepteur FcyRIl IA. Il peut également posséder une capacité réduite de liaison à tous les FcyRs.
Par « capacité réduite de liaison » à un ou plusieurs FcyR, on entend que la liaison de l’anticorps, du fragment ou du dérivé au FcyR est plus faible que celle d’un anticorps avec les mêmes régions variables, mais dont les régions constantes sont naturelles (anticorps natif), avantageusement la capacité de liaison au FcyR est inférieure d’un facteur au moins 2, au moins 5, au moins 10, ou parfois même au moins 25, au moins 50, au moins 75, voire au moins 100, à celle de l’anticorps natif.
Dans ce cas, un fragment ou un dérivé sans domaine Fc peut avantageusement être utilisé. En effet, l’absence de domaine Fc empêche toute liaison aux FcyRs, et donc notamment à FcyRIIA, et à FcyRIIIA.
Les fragments sans domaine Fc incluent notamment les fragments F(ab’)2, Fab, Fab’, Fv, VhH, et V-NAR. Les dérivés sans domaine Fc incluent notamment les dérivés de type ScFv, Bis- scFv, Fab2, Fab3, dianticorps (« diabodies »), tranticorps (« triabodies »), tétraanticorps (« tetrabodies »).
Ainsi, dans un mode de réalisation préféré, un fragment ou un dérivé sans domaine Fc, avantageusement choisi parmi les F(ab’)2, F(ab’), Fab, Fab’, Fv, VhH, V-NAR, ScFv, Bis-scFv, Fab2, Fab3, dianticorps (« diabodies »), trianticorps (« triabodies »), et tétraanticorps (« tetrabodies »), est utilisé.
De plus, comme indiqué précédemment le domaine CH2 des anticorps d’isotype IgG est connu pour comprendre le domaine de liaison aux FcyRs. Par conséquent, il est également possible d’utiliser un fragment ou dérivé qui possède une partie du domaine Fc, mais ne comprend pas le domaine CH2, comme les minianticorps (ou « minibody »).
Pour réduire la capacité liaison à FcyRIlA, il est également possible d’utiliser un anticorps entier d’isotype lgG4, cet isotype liant très faiblement FcyRIlA. Il est en outre possible d’utiliser un anticorps entier d’isotype croisé lgG2-lgG4 comprenant le domaine CH1 et la région charnière de l’isotype lgG2 et les domaines CH2 et CH3 de l’isotype lgG4 (Rother et al., 2007).
Pour réduire la capacité de liaison à FcyRIlA et éventuellement aussi à FcyRIIIA (ou même à tous les FcyRs), il est également possible d’utiliser un anticorps entier d’isotype IgG ou un dérivé de celui-ci avec un domaine Fc (comme les scFv-Fc), dont le domaine Fcy a été modifié pour réduire ou abolir sa liaison aux récepteurs d’intérêt (FcyRIlA seul, FcyRIlA et FcyRIIIA, ou tous les FcyRs).
Une première stratégie de modification du domaine Fc permettant de réduire ou d’abolir la liaison aux FcyRs d’intérêt consiste à insérer une ou plusieurs mutations dans le domaine Fc. En effet, de nombreuses mutations ou combinaisons de mutations du domaine Fcy sont connues pour réduire ou abolir la liaison à certains ou à tous les FcyRs.
Parmi les mutations et combinaisons de mutations particulièrement d’intérêt, on peut citer (Chenoweth et al., 2020 ; Vafa et al., 2014 ; Wang et al., 2018) :
- pour les lgG1 : mutations ponctuelles E233P, L234A, L234F, L235A, L235E, L236E, D265A, P331S, ou toute combinaison de ces mutations, notamment les combinaisons L234A/L235A et L234A/L235E/P331S, qui réduisent ou éliminent la liaison aux FcyRs.
Les mutations E233P, F234V, L235A, D265A éliminent les fonctions effectrices.
Les mutations et combinaisons de mutations L235E et L234A/L235A réduisent les fonctions effectrices.
-pour les lgG2 : mutations ponctuelles V234A, G237A, P238S, H268A, H268Q, V309L, A330S, P331S, ou toute combinaison de ces mutations, notamment les combinaisons H268Q/V309L/A330S/P331S et
V234A/G237A/P238S/H268A/V309L/A330S/P331S, qui réduisent la liaison aux FcyRs ; - pour les lgG4: mutations ponctuelles F234A, L235A, et L235E ou les combinaisons F234A/L235A, H268Q/V309L/A330S/P331S (faible interaction avec FcyRI, élimination de l’interaction avec FcyRIlA FcyRIIIA), S228P/L234A/L235A (interaction très faible avec FcyRI, FcyRIlA and FCYRIIIA) qui réduisent la liaison aux FcyRs.
Dans un mode de réalisation préféré, l’anticorps utilisé dans l’invention est d’isotype lgG1 et son domaine Fc comprend une combinaison des 4 mutations E233P, F234V, L235A, et D265A.
Une 2ème stratégie de modification du domaine Fc permettant de réduire ou d’abolir la liaison aux FcyRs consiste à altérer la glycosylation du domaine Fc selon des modes de réalisation connus de l’homme de l’art (Strohl & Strohl, 2012). Cette altération peut être réalisée à l’aide de cellules présentant des capacités post-traductionnelles variables, par la suppression du site de glycosylation, ou par déglycosylation enzymatique de l’anticorps.
Le site de glycosylation du domaine Fc peut notamment être supprimé en remplaçant le résidu asparagine auquel sont liés des N-glycannes par un autre acide aminé (par exemple, pour un lgG1 , par une mutation N297A, N297Q ou N297G (élimination de l’interaction avec FcyRIlA et FcyRIIIA, interaction réduite avec FcyRI), voir (Wang et al., 2018).
Pour obtenir un anticorps non glycosylé, il est également possible de produire l’anticorps dans un hôte sans système de N-glycosylation, comme par exemple des bactéries, qui sont naturellement dépourvues de système de N-glycosylation, ou dans tout autre hôte qui est normalement pourvu d’un système de N-glycosylation mais qui a été modifié pour ne plus N-glycosyler les protéines, par exemple des levures, des plantes, des cellules d’insecte ou des cellules de mammifère.
Pour obtenir un anticorps non glycosylé, il est également possible de déglycosyler l’anticorps a) de manière enzymatique, par exemple en utilisant la PNGase F (Peptide- N4-(acetyl-B-glucosaminyl)-asparagine amidase, EC 3.5.1.52), une endoglycosidase telle que G endo-alpha-N-acetyl-galactosaminidase, l’endoglycosidase F1 , l’endoglycosidase F2, l’endoglycosidase F3, ou l’endoglycosidase H, ou b) de manière chimique.
Les stratégies de modifications 1 et 2 présentées ci-dessus peuvent potentiellement être combinées (mutation(s) dans le Fc réduisant la liaison aux FcyRs d’intérêt et absence de glycosylation). En revanche, lorsque la glycosylation n’est pas supprimée, on évitera de produire l’anticorps entier ou le dérivé avec un domaine Fc dans des conditions résultant en une glycosylation connue pour augmenter la capacité de liaison aux FcyRs d’intérêt (on évitera notamment de produire un anticorps ou dérivé dont le domaine Fc est glycosylé avec une faible fucosylation, cela augmentant fortement la liaison à FCYRIIIA). Anticorps, fragment, ou dérivé avec une capacité augmentée de liaison au récepteur FCYRIIB
Dans un autre mode de réalisation avantageux, on utilise un anticorps, un fragment ou un dérivé possédant une capacité augmentée de liaison au récepteur FCYRIIB. Par « capacité augmentée de liaison au récepteur FCYRIIB », on entend que la liaison de l’anticorps, du fragment ou du dérivé au récepteur FCYRIIB est plus forte que celle d’un anticorps avec les mêmes régions variables, mais dont les régions constantes sont naturelles (anticorps natif), avantageusement la capacité de liaison au récepteur FCYRIIB est supérieure d’un facteur au moins 2, au moins 5, au moins 10, ou parfois même au moins 25, au moins 50, au moins 75, voire au moins 100, à celle de l’anticorps natif.
Dans ce cas, on utilisera avantageusement un anticorps entier d’isotype IgG qui possède une ou plusieurs mutation(s) dans le domaine Fc augmentant significativement sa liaison au récepteur inhibiteur FcyRI Ib.
Les modifications appropriées du domaine Fc permettant d’augmenter la capacité de liaison au récepteur FcyRIIB incluent notamment les combinaisons de mutations S267E/L328F (ou « SELF », mais maintien d’une forte affinité pour FcyRIlA-R), N325S/L328F (réduction concomitante de l’interaction avec FcyRIIIA) et
P238D/E233D/G237D/H268D/P271G/A330R (ou « V12 », pas de modification de l’interaction avec FcyRI la-R131 ) (Chenoweth et al., 2020 ; Mimoto et al., 2013; Wang et al., 2018).
Antigène reconnu par l’anticorps, fragment ou dérivé
L’anticorps, fragment ou dérivé utilisé dans l’invention reconnaît spécifiquement un antigène protéique capable de se lier aux acides nucléiques (« AgnUc »). De préférence, l’antigène protéique reconnu spécifiquement par l’anticorps, fragment ou dérivé utilisé dans l’invention possède l’une des caractéristiques suivantes : a) il est capable de se lier aux acides nucléiques seul, c’est-à-dire sans être complexé à une autre molécule (autre protéine notamment) ; b) il est capable de se lier aux acides nucléiques sans spécificité pour une séquence nucléique donnée ; c) il est capable de se lier aux acides nucléiques plus efficacement à un pH compris entre 7,0 et 7,5 qu’à pH acide (inférieur à 7,0); d) il comprend une ou plusieurs région(s) accessible(s) chargée(s) positivement. Dans le cas des protéines globulaires, l’AgnUc comprend de préférence une ou plusieurs région(s) de surface chargée(s) positivement ; dans le cas de protéines/peptides naturellement sous une forme non repliée, l’AgnUc comprend de préférence une ou plusieurs région(s) dans la séquence primaire contenant des acides aminés chargés positivement ; e) il est également capable de se lier aux protéoglycanes à héparane sulfate membranaires, de préférence seul, sans être complexé à une autre molécule (autre protéine notamment) ; et f) toute combinaison des caractéristiques a) à e).
En particulier, l’antigène protéique reconnu spécifiquement par l’anticorps, fragment ou dérivé utilisé dans l’invention peut posséder l’une des combinaisons de caractéristiques suivantes : i. la combinaison des caractéristiques a) et d) ; ii. la combinaison des caractéristiques a) et e) ; iii. la combinaison des caractéristiques b) et d) ; iv. la combinaison des caractéristiques b) et e) ; v. la combinaison des caractéristiques d) et e) ; vi. la combinaison des caractéristiques a), b) et d) ; vii. la combinaison des caractéristiques a), d) et e) ; viii. la combinaison des caractéristiques b), d) et e) ; ix. la combinaison des caractéristiques a), b), d) et e) ; x. la combinaison des caractéristiques b) à e) ; ou xi. la combinaison des caractéristiques a) à e)
La caractéristique e) (capacité à se lier aux protéoglycanes à héparane sulfate membranaires, de préférence seul) présente un intérêt particulier dans la mesure où une hypothèse concernant le mécanisme par lequel les complexes immuns (IC) entre des protéines de capsides virales ou des ribo- ou désoxyribo-nucléoprotéines et des acides nucléiques causent une hyperinflammation in vivo serait que ces IC activent de manière excessive les cellules effectrices par double liaison :
• la liaison des domaines Fc des anticorps des IC aux récepteurs Fcy, et
• la liaison de l’antigène reconnu par les anticorps (protéines de capsides virales ou des ribo- ou désoxyribo-nucléoprotéines) avec les protéoglycanes à héparane sulfate membranaires également présents à la surface des cellules effectrices.
Cette deuxième liaison renforcerait l’effet activateur de la liaison entre des domaines Fc des anticorps et les récepteurs Fcy.
Cette capacité à lier également les protéoglycanes à héparane sulfate membranaires, de préférence seul, est présente chez de nombreuses protéines ayant la caractéristique d), les protéoglycanes à héparane sulfate membranaires étant chargés négativement.
Lorsque l’AgnUc comprend la caractéristique d), la reconnaissance des acides nucléiques est aussi généralement obtenue sans spécificité pour une séquence nucléique donnée (caractéristique b)), et une combinaison des caractéristiques b) et d) est donc aussi particulièrement d’intérêt. Lorsque l’AgnUc comprend la caractéristique d), la reconnaissance des acides nucléiques est aussi généralement obtenue sans qu’elle soit complexée à une autre molécule (caractéristique a)), et une combinaison des caractéristiques a) et d) est donc aussi particulièrement d’intérêt. Trois ou quatre des caractéristiques a), b), d) et e) seront également présentes chez de nombreux AgnUc, et une combinaison des caractéristiques a), b), et d), une combinaison des caractéristiques a), d) et e), une combinaison des caractéristiques b), d) et e), ou une combinaison des a), b), d) et e) sont également des combinaisons d’intérêt.
La liaison entre l’anticorps et son AgnUc devant se faire in vivo, celle-ci est de préférence plus efficace à un pH compris entre 7,0 et 7,5 (caractéristique c)). Chacune des combinaisons ci-dessus peut donc être en outre combinée à la caractéristique c).
De nombreux antigènes protéiques sont capables de se lier aux acides nucléiques. De tels AgnUc sont notamment décrits dans différentes bases de données publiquement accessibles, notamment celles décrites dans le Tableau 1 ci-dessous :
Tableau 1. Bases de données décrivant des AgnUc
Antigènes de microorganismes infectieux : Dans un mode de réalisation avantageux, l’AgnUc que l’anticorps, fragment ou dérivé utilisé dans l’invention reconnaît spécifiquement est choisi parmi les protéines de microorganismes infectieux capables de se lier aux acides nucléiques. Ce type d’anticorps est utilisé lorsque l’inflammation est due à une infection par un microorganisme.
La protéine de microorganisme infectieux capable de se lier aux acides nucléiques est de préférence interne au microorganisme infectieux, en d’autres termes elle ne se trouve pas à la surface du microorganisme infectieux. Elle est en outre ou alternativement de préférence capable de se lier aux acides nucléiques sous forme native, avant tout clivage induisant un changement de conformation.
En particulier, l’AgnUc que l’anticorps, fragment ou dérivé utilisé dans l’invention reconnaît spécifiquement est avantageusement choisi parmi les protéines virales capables de se lier au génome viral. De préférence, l’AgnUc que l’anticorps, fragment ou dérivé utilisé dans l’invention reconnaît spécifiquement est choisi parmi les protéines internes du virus, à l’exclusion des protéines virales situées à la surface du virus. Les AgnUc viraux préférés incluent de manière générale les protéines de capsides virales, mais également d’autres protéines virales telles que le transactivateur transcriptionnel (Tat) et la rétrotranscriptase (RT, p66/p51 ) du virus de l’immunodéficience humaine 1 (VIH -1 ).
Par « capside », on entend la coque qui entoure le génome viral. La protéine capable d’empaqueter le génome viral pour former la capside est appelée « protéine de capside » ou « protéine de nucléocapside ». En effet, le terme « nucléocapside » désigne en principe le génome viral entouré de la capside, mais est parfois aussi utilisé pour désigner la capside. D’autres protéines peuvent s’associer à la capside, telles que les protéines de matrice, ou à l’enveloppe autour de la capside de virus enveloppés, mais ne sont pas considérées comme des protéines de capside.
Parmi les protéines de capsides virales plus particulièrement d’intérêt, on peut citer : la protéine de capside du VIH-1 , également appelée p24 (séquence d’acides aminés correspondant au n° d’accession Genbank NP_057850.1 (résidus 133- 363), version 241 de Genbank du 15 décembre 2020) ; la protéine de capside du virus du syndrome respiratoire aigu sévère à coronavirus 2 (« SARS-Cov-2 », responsable de la Covid-19, séquence d’acides aminés correspondant au n° d’accession Genbank YP_009724397.2, version 241 de Genbank du 15 décembre 2020), la protéine de capside du virus de la grippe (séquence d’acides aminés correspondant au n° d’accession Genbank AAA43798.1 , version 241 de Genbank du 15 décembre 2020) ; la protéine de capside du virus de l’hépatite B (VHB, séquence d’acides aminés correspondant au n° d’accession Genbank AXM44956.1 , version 241 de Genbank du 15 décembre 2020) ; la protéine de capside du virus de l’hépatite E (VHE, séquence d’acides aminés correspondant au n° d’accession Genbank P03314.1 (résidus 1 à 101 ), version 241 de Genbank du 15 décembre 2020) ; la protéine de capside du papillomavirus humain (PVH, séquence d’acides aminés correspond au n° d’accession Genbank AQZ41126.1 , version 241 de Genbank du 15 décembre 2020) ; la protéine de capside du virus de la dengue (séquence d’acides aminés correspondant au n° d’accession Genbank AAW51422.1 (résidus 5 à 114), version 241 de Genbank du 15 décembre 2020).
En effet, ces protéines (protéines de capside ci-dessus et Tat ou RT du VIH-1 ) sont connues pour générer une réponse anticorps chez les patients infectés par ces virus et, dans certains cas, la présence de complexes immuns (IC) formés de ces antigènes et d’anticorps les reconnaissant spécifiquement est également connue pour être associée à la pathogénèse (Cafaro et al., 2019; Carter et al., 2000; Fenouillet et al., 1993; Hashida et al., 1997; Hu, 2002; Kamar et al., 2017; Ni et al., 2020; Rumbaugh et al., 2013).
Les IC de la protéine intracellulaire de Yersinia enterocolitica 0.3 (IcP-Ye) sont également associés à certaines arthrites chroniques, et des anticorps, fragments ou dérivés spécifique de cette protéine peuvent également donc être utilisés.
Des anticorps monoclonaux reconnaissant spécifiquement le transactivateur transcriptionnel (Tat) du VIH-1 ont été décrits dans des stratégies vaccinales (Cafaro et al., 2019) et sont disponibles sur le marché comme par exemple :
« Purified anti-HIV TAT », anticorps monoclonal de souris, réf = 919001 , commercialisé par BioLegend.
« Recombinant Human anti-HIV-1 Tat Antiboby (B1 E3) », anticorps recombinant humain, réf = MRO-4310CQ, commercialisé par Creative Biolabs.
Des anticorps monoclonaux reconnaissant spécifiquement la rétrotranscriptase (RT, p66/p51 ) du VIH-1 sont disponibles sur le marché comme par exemple : « anti-HIV1 - RT antibody, anticorps monoclonal de souris, réf. : ABIN933463, commercialisé par Antibodies-online.
Des anticorps monoclonaux reconnaissant spécifiquement la nucléocapside du VIH- 1 (p24) sont disponibles sur le marché comme par exemple :
« Anti-HIV1 p24 antibody [39/5.4A] », anticorps monoclonal de souris, réf : ab9071 , commercialisé par la société Abcam.
« Anti-HIV-1 p24 Therapeutic Antibody (19H2) », anticorps recombinant humain (IgG), réf = MRO-082LC, commercialisé par la société Creative Biolabs.
Des anticorps monoclonaux reconnaissant spécifiquement la nucléocapside du virus SARS-Cov2 sont disponibles sur le marché comme par exemple :
« Nucleocapsid Antibody », anticorps monoclonal de souris, réf. : MAB104741 , commercialisé par R&D SYSTEMS.
« SARS-CoV-2 Nucleocapsid Antibody (bcn11 ) », anticorps humanisé, réf : MA5- 35953, commercialisé par Thermo Fisher Scientific.
Des anticorps monoclonaux reconnaissant spécifiquement la nucléocapside du virus de la grippe sont disponibles sur le marché comme par exemple : « Recombinant Mouse Anti-lnfluenza A virus Nucleocapsid protein Antibody (CBI49YJ) », anticorps monoclonal de souris, réf. : HPAB-0295-YJ commercialisé par Creative Biolabs.
Des anticorps monoclonaux reconnaissant spécifiquement la nucléocapside du VHB sont commercialisés, comme par exemple : « Recombinant Hepatitis B Core Antigen (rHBcAg) », anticorps monoclonal de souris, réf. : bsm-2000M, commercialisé par BiossAntibodies.
Des anticorps monoclonaux reconnaissant spécifiquement la nucléocapside du VHE sont commercialisés comme par exemple : « HEV/Hepatitis E Virus Monoclonal Antibody », anticorps monoclonal de souris, réf. : LS-C67675, commercialisé par LifeSpan Biosciences. Des anticorps monoclonaux reconnaissant spécifiquement la nucléocapside du PVH comme par exemple : « Human Papilloma Virus L1 Antibody », anticorps monoclonal de souris, réf. : MBS320499, commercialisé par MyBioSource.com (Spécifique de la protéine structurale majeure de la capside L1 ). Des anticorps monoclonaux reconnaissant spécifiquement la protéine intracellulaire de Yersinia enterocolitica 0.3 (IcP-Ye) comme par exemple l’Ac monoclonal de souris, réf.: 2D8-P, commercialisé par PROGEN.
D’autres anticorps monoclonaux reconnaissant les AgnUc de microorganismes infectieux (notamment de virus, telles que le transactivateur transcriptionnel (Tat) ou la rétrotranscriptase (RT) du VIH-1 ou les protéines de nucléocapsides virales, en particulier celles de SARS-Cov-2, de la grippe, du VHB, du VHE, et du PVH) peuvent être générés par l’homme du métier sur la base des séquences de ces protéines, en utilisant des méthodes de routine, par exemple celle décrite dans les exemples.
Sur la base tels anticorps monoclonaux, l’homme du métier saura générer des fragments ou dérivés sans domaine Fc, ou avec un domaine Fc modifié pour ne pas se lier à FcyRIlA et FcyRIIIA (récepteurs activateurs), pour ne se lier à aucun FcyR, ou encore pour se lier préférentiellement à FcyRIIb (récepteur inhibiteur).
Antigènes du soi : Dans un autre mode de réalisation avantageux l’Agnuc que l’anticorps, fragment ou dérivé utilisé dans l’invention reconnaît spécifiquement est choisi parmi les protéines du soi du sujet à traiter. Ce type d’anticorps est utilisé lorsque l’inflammation est due à une maladie autoimmune.
La protéine du soi capable de se lier aux acides nucléiques est de préférence une protéine intracellulaire. Elle est en outre ou alternativement de préférence capable de se lier aux acides nucléiques sous forme native, avant tout clivage induisant un changement de conformation.
L’Agnuc peut notamment être choisi parmi les ribonucléoprotéines et les désoxyribonucléoprotéines du sujet à traiter. Parmi les ribonucléoprotéines, on peut mentionner plus particulièrement les protéines : la protéine RibP (séquence d’acides aminés correspondant au n° d’accession Genbank NP_000993.1 (sous-unité PO), NP_000994.1 (sous-unité P1 ) et NP_000995.1 (sous-unité P2), version 241 de Genbank du 15 décembre 2020, des IC de RibP sont associés à la pathogénèse du lupus érythémateux disséminé, voir (Choi et al., 2020) les protéines snRNPs, comprenant la protéine A, la protéine C et la protéine à 70K (séquences d’acides aminés correspondant aux n° d’accession Genbank NPJXM587.1 , NP_003084.1 et NP_003080.2, version 241 de Genbank du 15 décembre 2020, des IC de snRNPs A, C et 70K sont associés à la pathogenèse du lupus érythémateux disséminé, de la polyarthrite rhumatoïde, et de la sclérose systémique, voir (Pisetsky & Lipsky, 2020) ainsi que les protéines B, B’ et D (séquences d’acides aminés correspondant aux n° d’accession Genbank NP_003082.1 et NP_008869.1 , version 241 de Genbank du 15 décembre 2020, des IC de snRNPs B, B’ et D sont associés à la pathogenèse du lupus érythémateux disséminé, voir (Pisetsky & Lipsky, 2020), la protéine Ro60 (séquence d’acides aminés correspondant au n° d’accession Genbank NP_001035828.1 , version 241 de Genbank du 15 décembre 2020, des IC de Ro60 sont associés à la pathogenèse du lupus érythémateux disséminé, du syndrome de Sjogren primaire, et de la sclérose systémique, voir (Schulte- Pelkum et al., 2009), la protéine Ro52 (séquence d’acides aminés correspondant au n° d’accession Genbank NP_003132.2, version 241 de Genbank du 15 décembre 2020, des IC de Ro52 sont associés à la pathogenèse du lupus érythémateux disséminé, voir (Schulte-Pelkum et al., 2009), et la protéine La (antigène de Lupus, séquence d’acides aminés correspondant au n° d’accession Genbank NP_001281074.1 , version 241 de Genbank du 15 décembre 2020, des IC de La sont associés à la pathogenèse du lupus érythémateux disséminé, voir (To & Pétri, 2005).
Parmi les désoxyribonucléoprotéines, on peut mentionner plus particulièrement les histones (par exemple la séquence d’acides aminés correspondant au n° d’accession Genbank NP_001035807.1 (histone 2A), CAA41051.1 (histone 2-B), AAN39284.1 (histone 3), NP_003486.1 (histone 4), version 241 de Genbank du 15 décembre 2020), des IC d’histones sont associés à la pathogénèse du lupus érythémateux disséminé, voir (Ghiggeri et al., 2019).
Des anticorps polyclonaux reconnaissant spécifiquement la protéine RibP sont disponibles sur le marché comme par exemple : « Ribosomal P Antigen antibody », anticorps polyclonal de lapin, réf. : GTX39242, commercialisé par GeneTex.
Des anticorps monoclonaux reconnaissant spécifiquement la protéine snRNPs sont disponibles sur le marché comme par exemple : « Anti-Sm BB' Proteins (Human autoantigens) Monoclonal Antibody », anticorps monoclonaux de souris, réf. : 03-57029 commercialisé par American Research Products, Inc. TM.
Des anticorps monoclonaux reconnaissant spécifiquement la protéine Ro60 sont disponibles sur le marché comme par exemple : « Anti-Ro60 (SS-A) Protein Monoclonal Antibody », clone 1 D8, anticorps monoclonal de souris, réf. : 03-57039 commercialisé par American Research Products, Inc. TM.
Des anticorps monoclonaux reconnaissant spécifiquement la protéine Ro52 sont disponibles sur le marché comme par exemple : « Anti-TRIM21 Mouse mAb », anticorps monoclonal de souris, réf. : MBS475588, commercialisé par MyBioSource.com. Des anticorps polyclonaux reconnaissant spécifiquement l’antigène de lupus (La) sont disponibles sur le marché comme par exemple : « Anti-Lupus La Protein SSB Antibody », anticorps polyclonal de lapin, réf. : A00705, commercialisés par BosterBio.
Des anticorps monoclonaux reconnaissant spécifiquement les histones sont disponibles sur le marché comme par exemple : « Histone Monoclonal Antibody », anticorps monoclonal de souris, réf.: LS-C68011 , commercialisé par LifeSpan Biosciences.
D’autres anticorps monoclonaux reconnaissant les AgnUc de protéines du soi (notamment celles décrites ci-dessus) peuvent être générés par l’homme du métier sur la base des séquences de ces protéines en utilisant des méthodes de routine, par exemple celle décrite dans les exemples.
Sur la base tels anticorps monoclonaux, l’homme du métier saura générer des fragments ou dérivés sans domaine Fc, ou avec un domaine Fc modifié pour ne pas se lier à FcyRIlA et FcyRIIIA (récepteurs activateurs), pour ne se lier à aucun FcyR, ou encore pour se lier préférentiellement à FcyRIIb (récepteur inhibiteur).
Inflammation
Les anticorps, fragments et dérivés décrits ci-dessus sont utiles dans le traitement de l’inflammation, et en particulier dans le traitement de l’inflammation due à la présence de complexes immuns (IC) formés d’un AgnUc et d’anticorps reconnaissant spécifiquement cet AgnUc.
Les maladies dans lesquelles ces IC sont le plus souvent observés et ont été associés à la pathogénèse de la maladie sont principalement :
- les infections par des microorganismes (en particulier les infections virales), dans lesquelles des ICs formés entre un AgnUc du microorganisme infectieux (notamment les protéines de capsides virales, qui génèrent de fortes réponses anticorps) et les anticorps reconnaissant cet AgnUc peuvent induire une inflammation aiguë pouvant aller jusqu’aux « orages cytokiniques » (forte sécrétion de cytokines inflammatoires ayant des effets délétères sur les tissus) décrits dans les formes sévères de la Covid-19 et de la grippe, ou une inflammation chronique, et - les maladies autoimmunes, où la présence d’ICs formés entre un AgnUc du soi et les anticorps reconnaissant cet AgnUc peuvent aussi induire une inflammation aiguë ou chronique.
Ainsi, les anticorps, fragments et dérivés décrits ci-dessus sont notamment utiles dans le traitement de l’inflammation due à : a) une infection par un microorganisme ; ou b) une maladie autoimmune. Inflammation due à une infection par un microor anisme
Dans le cas d’une inflammation due à une infection par un microorganisme, on utilisera un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à un Agnuc du microorganisme responsable de l’infection.
Avantageusement, l’infection est une infection virale, puisque c’est dans ce type d’infection que le plus grand nombre d’IC associés à la pathogénèse de l’infection ont été observés, et on utilise alors un anticorps, fragment ou dérivé tel que décrit ici qui se lie spécifiquement à un AgnUc (en particulier la protéine de capside) du virus responsable de l’infection.
L’infection virale est avantageusement choisie parmi la Covid-19, la grippe, le SIDA, l’hépatite B, l’hépatite E, les infections au papillomavirus humain et la dengue.
Ainsi, dans le cas d’une inflammation au cours de la Covid-19 due au virus SARS- Cov2 (notamment en cas de forme sévère de la Covid-19), on pourra utiliser un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à la protéine de capside du virus SARS-Cov2.
Dans le cas d’une inflammation au cours de la grippe due au virus influenza, on pourra utiliser un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à à la protéine de capside du virus influenza.
Dans le cas d’une inflammation au cours du SIDA due au virus VIH-1 , on pourra utiliser un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à la protéine de capside (p24), au transactivateur transcriptionnel (Tat) ou à la rétrotranscriptase (RT) du VIH-1.
Dans le cas d’une inflammation au cours de l’hépatite B due au virus VHB, on pourra utiliser un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à la protéine de capside du virus VHB.
Dans le cas d’une inflammation au cours de l’hépatite E due au virus VHB, on pourra utiliser un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à la protéine de capside du virus VHE.
Dans le cas d’une inflammation au cours des infections par le virus PVH, on pourra utiliser un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à la protéine de capside du virus PVH.
Dans le cas d’une inflammation au cours de la dengue due au virus de la dengue, on pourra utiliser un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à la protéine de capside du virus de la dengue.
L’inflammation peut cependant aussi être due à une infection bactérienne ou parasitaire. Dans ce cas, on utilisera un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à un AgnUc de la bactérie ou du parasite responsable de l’infection. Par exemple, en cas d’arthrite chronique due à une infection par Yersinia enterocolitica 0.3, on pourra utiliser un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à la protéine intracellulaire de Yersinia enterocolitica 0.3 (IcP-Ye). Inflammation due à une maladie autoimmune
Dans le cas d’une inflammation due à une maladie autoimmune, on utilisera un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à un AgnUc du soi du patient à traiter.
La maladie autoimmune est avantageusement choisie parmi la polyarthrite rhumatoïde, la maladie de Kawasaki, le lupus érythémateux disséminé, la sclérose systémique et le syndrome de Sjogren primaire car ce sont les maladies autoimmunes dans lesquelles le plus grand nombre d’IC associés à la pathogénèse de la maladie ont été observés.
Par exemple, dans le cas de la polyarthrite rhumatoïde, on pourra notamment utiliser un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à une protéine choisie parmi les protéines snRNPs A, C ou 70K.
Dans le cas du lupus érythémateux disséminé, on pourra notamment utiliser un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à une protéine choisie parmi la protéine RibP, les histones, les protéines snRNPs A, B, B’, C, D et 70K, la protéine Ro60, et la protéine Ro52.
Dans le cas de la sclérose systémique, on pourra notamment utiliser un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à une protéine choisie parmi la protéine Ro60 et les protéines snRNPs A, C ou 70K.
Dans le cas du syndrome de Sjogren primaire, on pourra notamment utiliser un anticorps, un fragment ou un dérivé tel que décrit ici qui se lie spécifiquement à la protéine Ro60.
Les exemples qui suivent visent à illustrer la présente invention.
EXEMPLES
Exemple 1 : La réaction inflammatoire peut être induite in vitro par des ICs contenant le transactivateur transcriptionnel (Tat) du VIH-1, qui est un Ag doté de la capacité à lier les acides nucléiques
Matériels et méthodes :
Tat est une protéine de 101 résidus qui a été préparée par synthèse peptidique comme décrit dans la publication de Kittiworakarn et al (Kittiworakarn et al., 2006). Les Ac aTat12S et aTat7S sont issus d’hybridomes spécifiques de Tat, ils ont été obtenus en suivant le protocole décrit dans la publication de Lecoq et al. (Lecoq et al., 2008).
La spécificité épitopique de ces deux Acs a été évalué par ELISA. Pour cela des plaques de microtitration ont été adsorbées à raison de 100m1 par puits avec 10pg/ml d’un peptide possédant la séquence 1 -37 de Tat, appelé Tat1 -37, ou avec 10pg/ml d’un peptide-biotinylé possédant la séquence 37-57 de Tat, appelé Tat-37-57-b. Les puits ont ensuite été saturés avec 200mI de sérum-albumine bovine (SAB) à 0,3%. Les plaques ont ensuite été lavées et des séries de dilution des deux Ac ont été ajoutées. Après 4 heures d’incubation à température ambiante, les plaques ont été lavées et un anticorps de chèvre anti-anticorps de souris couplé à la péroxydase a été ajouté. Après 30 minutes d’incubation à température ambiante les plaques ont été lavées et de l’ABTS a été ajouté. Après 30 minutes, la densité optique a ensuite été mesurée à 414nm à l’aide d’un lecteur ELISA.
Pour évaluer l’aptitude inflammatoire nous avons dans un premier temps incubé Tat (100nM final) en présence ou en absence de l’un des Ac aTat12S et aTat7S (100nM final pour chaque Ac), respectivement. Nous avons ensuite transféré ces mélanges dans des plaques contenant des cellules mononuclées du sang périphérique (CMSP) humain à raison de 0,1 M de cellules par puits. Après 18h d’incubation à 37° C, nous avons prélevé les surnageants puis avons évalué s’ils contiennent la cytokine pro-inflammatoire IL-6 en utilisant un kit ELISA (ref. DY206, RandD Systems).
Résultats
Pour évaluer la capacité inflammatoire de complexes immuns contenant un AgnUc nous nous sommes tout d’abord intéressés au transactivateur transcriptionnel du VIH-1 , appelé Tat, car cette protéine de 101 résidus de long est dotée de la capacité à lier les acides nucléiques. Nous avons utilisé deux anticorps monoclonaux de souris spécifiques de Tat. Ces deux anticorps sont appelés aTat12S et aTat7S. Nous avons dans un premier temps évalué la spécificité épitopique de ces Ac par dosage immunoenzymatique à l’aide de plaques ELISA adsorbées avec les peptides Tat1 -37 et Tat-37-57-b, respectivement. Comme on peut le voir sur la Figure 1A, l’Ac aTat12S se lie à Tat1 -37 mais pas à Tat-37- 57 ce qui indique qu’il reconnaît la région N-terminale de Tat. En revanche, l’Ac aTat7S ne se lie pas à Tat1 -37 mais interagit avec Tat-37-57-b ce qui indique qu’il reconnaît la région 37-57 de Tat (cf Figure 1 B). Ces données indiquent donc que ces deux Ac reconnaissent des épitopes différents et non-chevauchants sur la protéine Tat.
Les Ac aTat12S et aTat7S sont tous deux d’isotypes lgG1 . Or, cet isotype reconnaît bien les récepteurs Fc gamma de type II, d’acronyme FcyRIl, chez l’humain (Temming et al., 2020). Cette observation nous a donc conduit à évaluer si les ICs Tat/aTat12S et Tat/aTat7S peuvent provoquer in vitro la sécrétion de la cytokine inflammatoire IL-6 par des CMSPs humaines. Pour cela, nous avons incubé des CMSPs humaines en présence de ces mélanges, ou de Tat libre, ou des Ac libres. Après 18h d’incubation nous avons prélevé les surnageants pour évaluer la présence d’IL-6 qui est une cytokine produite lors de la réponse inflammatoire. Nous avons ainsi pu observer que Tat et aTat12S libres n’induisent pas la sécrétion d’IL-6 (cf Figure 2). En revanche, l’IC Tat/aTat12S induit la sécrétion d’IL-6 ce qui indique que cet IC induit une réponse inflammatoire des CMSPs. L’Ac aTat7S libre induit pour sa part la sécrétion d’IL-6 mais cette sécrétion est accrue lorsque l’IC est formé. Ces données indiquent donc que ces ICnUc induisent une inflammation ou l’amplifient en fonction de l’Ac inclus dans le complexe. Comme les lgG1 de souris se lient chez l’humain uniquement aux FcyRIIs nous en concluons, de plus, que l’effet inflammatoire prodigué par de tels complexes dépend de ce type de récepteurs Fc.
Exemple 2 : La réaction inflammatoire peut être induite par des ICs contenant la protéine de nucléocapside (Ncp) du virus SARS-Cov-2, qui est un Ag dotée de la capacité à lier les acides nucléiques
Matériels et méthodes
Préparation de la protéine de nucléocapside du virus SARS-Cov-2 (Ncp)
La protéine de nucléocapside du virus SARS-Cov-2, dénommée Ncp, a la séquence possédant le code Genbank YP_009724397.2, version 241 de Genbank du 15 décembre 2020. Elle a été préparée par voie recombinante en utilisant un protocole proche de celui décrit dans la publication de Stadlbauer et al. (Stadlbauer et al., 2020). Ainsi, la séquence codant pour Ncp a été insérée dans le plasmide pcDNA3.4. Des cellules HEK (2.5.106 cellules/ml) ont été incubées avec l’ADN plasmidique (1 pg/mΐ) en milieu 293F freestyle, puis avec du PEI à 0.5mg/ml. Enfin, elles ont été incubées à 37° C. Après 2 jours les cellules ont été diluées au demi en milieu 293F freestyle. Au cinquième jour les cellules ont été centrifugées. Les surnageants récupérés ont ensuite été passés sur une colonne HiTrap Heparin (GE réf 71 -7004-01 ). La protéine retenue sur la colonne, correspondant à Ncp, a ensuite été éluée en tampon sodium phosphate 1 ,5M pH7 puis concentrée sur vivaspin MWCO=10000 avec un tampon 100mM sodium phosphate +150mM NaCl pH7. Elle a été conservée à -20°C jusqu’à utilisation.
Production des anticorps monoclonaux anti-Ncp
Les anticorps monoclonaux anti-Ncp ont été produits en utilisant un protocole proche de celui décrit dans la publication de Féraudet Tarisse et al (Tarisse et al., 2021 ). Des souris Biozzi ont été immunisées quatre fois à trois semaines d’intervalle par injection de 10 pg de Ncp avec du gel adjuvant d’hydroxyde d’aluminium, puis de trois injections de 50pg de Ncp à 1 jour d’intervalle. Deux souris ont été sélectionnées pour la production d’anticorps monoclonaux selon la méthode développée par (Kohler & Milstein, 1975). Les anticorps monoclonaux produits en surnageant de culture ont été purifiés par chromatographie d’affinité protéine G.
Évaluation de l’aptitude inflammatoire
Pour évaluer l’aptitude inflammatoire nous avons dans un premier temps incubé Ncp (30nM final) en présence ou en absence de l’un des Ac aNcp2 et anti-Ncp15 (30nM final pour chaque Ac), respectivement. Nous avons ensuite transféré ces mélanges dans des plaques contenant des cellules mononuclées du sang périphérique (CMSP) humain à raison de 0,1 M de cellules par puits. Après 18h d’incubation à 37° C, nous avons prélevé les surnageants puis avons évalué s’ils contiennent la cytokine pro-inflammatoire IL-6.
Résultats
Pour évaluer la capacité inflammatoire de complexes immuns contenant un AgnUc nous nous sommes intéressés à la protéine de nucléocapside du virus SARS-Cov-2, appelée Ncp, car cette protéine est dotée de la capacité à lier l’ARN. Nous avons utilisé deux anticorps monoclonaux de souris spécifiques de Ncp. Ces deux anticorps sont appelés aNcp2 et aNcp15. Ils sont d’isotypes lgG1 et peuvent de ce fait interagir chez l’humain avec les récepteurs Fc gamma de type II, d’acronyme FcyRII. Nous avons pré-incubé Ncp avec ces deux Ac independament afin de former deux ICs. Nous avons ensuite incubé des CMSPs humaines in vitro en présence de ces mélanges, ou de Ncp libre, ou des Ac libres. Après 18h d’incubation nous avons prélevé les surnageants pour évaluer la présence d’IL- 6 qui est une cytokine produite lors de la réponse inflammatoire. Nous avons ainsi pu observer que Ncp libre ou les Ac libres induisent une faible sécrétion d’IL-6 mais que la concentration de cette cytokine est significativement accrue par les deux ICs (cf Figure 3). Ces données indiquent donc que ces ICnUc présentent une capacité inflammatoire. Comme les lgG1 de souris se lient chez l’humain uniquement aux FcyRIIs (Temming et al., 2020) nous en concluons, de plus, que l’effet inflammatoire prodigué par de tels complexes dépend de ce type de récepteurs Fc.
Exemple 3 : La réaction inflammatoire induite par des ICnUc dépend de la région Fc des Ac inclus dans l’IC.
Matériels et méthodes
Obtention de fragments F(ab)’2 par protéolyse ménagée
Une protéolyse ménagée des Ac aTat12S et aNcp2 est réalisée pour obtenir leurs F(ab)’2. Pour cela, aTat12S et aNcp2 sont respectivement incubés en présence de pepsine en tampon pH3 pendant une heure à 37° C. Les anticorps sont ensuite purifiés par immunoaffinité soit sur une colonne contenant Tat, soit sur une colonne contenant Ncp. Tat et NCP sont couplés covalemment par l’intermédiaire de leurs groupements amine à une résine de sépharose pré-activée de type « CNBr Activated Sepharose® 4B » (Ref : GE17-0430-01 ; Sigma-Aldrich). La préparation de la colonne ainsi que la mise en oeuvre de la chromatographie d’affinité se font selon les recommandations du fabriquant.
Pour évaluer l’aptitude inflammatoire d’un IC contenant F(ab)VaNcp2, Ncp est dans un premier temps incubée en présence ou en absence de l’Ac aNcp2 ou du fragment F(ab)VaNcp2. Ces mélanges sont ensuite transférés dans des plaques contenant des cellules mononuclées du sang périphérique (CMSP) humain à raison de 0,1M de cellules par puits. Après 18h d’incubation à 37° C, les surnageants sont prélevés puis il est évalué s’ils contiennent la cytokine pro-inflammatoire IL-6. Pour évaluer l’aptitude inflammatoire d’un IC contenant F(ab)’2-aTat12S, la protéine Tat est dans un premier temps incubée en présence ou en absence de l’Ac aNcp2 ou du fragment F(ab)VaNcp2. Ces mélanges sont ensuite transférés dans des plaques contenant des cellules mononuclées du sang périphérique (CMSP) humain à raison de 0,1 M de cellules par puits. Après 18h d’incubation à 37° C, les surnageants sont prélevés puis il est évalué s’ils contiennent la cytokine pro-inflammatoire IL-6.
Clonage des Ac aTat12S et aNcp2 par biologie moléculaire et production recombinante des fragments Fab qui en dérivent.
Les hybridomes exprimant respectivement les Ac aTat12S et aNcp2 sont mis en culture pour être ensuite utilisés comme source d’ARN messager. À partir de ces hybridomes, les séquences des anticorps sont obtenues en suivant les méthodes décrites par Stravinskiene 2020 and Meyer et al. 2019. Brièvement, les ARNs d’hybridome (3- 10x106 cellules) sont obtenus en utilisant le kit GeneJET RNA Purification Kit (Thermo Fisher Scientific, K0731 ) et directement utilisés pour la synthèse de cDNAs. Pour chaque anticorps trois réactions sont préparées en utilisant l’enzyme SMARTScribe Reverse Transcriptase (Clontech, 639537), l’amorce sens Template-switch oligo Universal ( AAG CAGT G GTAT C AACG C AG AGT ACAT rG rG rG , SEQ ID NO :1 , où rG signifie qu’il s’agit d’une base G d’ARN, alors que les autres bases sont des bases ADN) et une des amorces spécifiques : TTGTCGTTCACTGCCATCAATC (SEQ ID NO :2, amorce antisens pour chaîne kappa mIGK pour RT), GGGGTACCATCTACCTTCCAG (SEQ ID NO :3, amorce antisens pour chaîne lambda mIGL pour RT) ou AGCTGGGAAGGTGTGCACAC (SEQ ID NO :4, amorce antisens pour chaîne lourde mIGHG pour RT). Les cDNA sont amplifiés par PCR en utilisant l’amorce sens ISPCR Universal (AAG CAGT G GTAT C AACG CAG AG , SEQ ID NO :5) et une des amorces spécifiques : amorce antisens pour chaîne kappa mIGK pour PCR (ACATTGATGTCTTTGGGGTAGAAG, SEQ ID NO :6), amorce antisens pour chaîne lambda mIGL pour PCR (ATCGTACACACCAGTGTGGC, SEQ ID NO :7) ou amorce antisens pour chaîne lourde mIGHG pour PCR (GGGATCCAGAGTTCCAGGTC, SEQ ID NO :8).
Les amplicons sont ensuite analysés par électrophorèse en gel d’agarose, purifiés, clonés dans le plasmide pJet1.2 (Thermo Fisher Scientific, K1231 ) et séquencés par la méthode Sanger. À partir des séquences obtenues, de nouvelles amorces spécifiques sont utilisées pour le clonage de la région VH d’aTat12S ou aNcp2 dans le vecteur AbVec-hlgG1 (comprenant une région constante humaine de chaîne lourde d’isotype lgG1 , numéro d’accès Genbank: FJ475055.1 ; entre les sites Age I et Apal, version 241 de Genbank du 15 décembre 2020). De la même manière de nouvelles amorces spécifiques sont utilisées pour le clonage de la région VL d’aTat12S ou aNcp2 dans le vecteur AbVec-hlgKappa (comprenant une région constante humaine de chaîne légère d’isotype kappa, numéro d’accès Genbank: FJ475056.1 , entre les sites Age I et Bs/WI, version 241 de Genbank du 15 décembre 2020) ou AbVec-hlgLambda (comprenant une région constante humaine de chaîne légère d’isotype lambda, numéro d’accès Genbank: FJ517647.1 , entre les sites Age I et Xho\, version 241 de Genbank du 15 décembre 2020). Ces vecteurs permettent de produire des anticorps dirigés contre Tat12S et aNcp2 chimériques, avec une région constante humaine (dénotés hcaTat12S et hcaNcp2, où « hc » signifie qu’il s’agit d’un anticorps chimérique avec une région constante humaine, cette terminologie est utilisée dans tous les exemples). Les mutations E233P, F234V, L235A et D265A sont incorporées sur le plasmide AbVec-hlgG1 pour l’obtention de variants des anticorps aTat12S et aNcp2 dépourvus d’activité effectrice. Un variant du plasmide AbVec-hlgG1 permettant l’arrêt de la traduction après le domaine CH1 (stop codon après la position C220 dans la séquence K218-S219-C220) est utilisé pour obtenir deux plasmides codant pour les régions VH-CH1 d’hcaTat12S et hcaNcp2, respectivement.
Pour l’expression des fragments Fab recombinants et des anticorps entiers dépourvus de la capacité à lier les FcyRs, des cellules 293-F (HEK, Thermo Fisher Scientific, R790-07) sont co- transfectées (rapport équimolaire) avec un plasmide correspondant soit à la région VH-CH1 soit à la chaîne lourde complète d’un anticorps lgG1 et à la chaîne légère du type kappa ou lambda par la méthode PEI (0.5mg/ml ; Longo et al 2013) et cultivés pendant 5-8 jours dans du FreeStyle™ 293 Expression Medium (Thermo Fisher Scientific, 12338-018). Les Fabs marqués par leurs motifs poly-histidine dans le milieu sont purifiés par chromatographie d’affinité aux ions métalliques immobilisés (Colonne de nickel couplé à des billes de Sépharose Fast Flow (GE Healthcare, 17-0575-01 ) Les Ac entiers secrétés dans le milieu sont purifiés par chromatographie d’affinité protéine A (Millipore, 113115827).
Pour l’expression des anticorps entiers dépourvus de la capacité à lier les FcyRs, des cellules 293-F (HEK, Thermo Fisher Scientific, R790-07) sont co-transfectées (rapport équimolaire) avec un plasmide correspondant à la chaîne lourde d’un anticorps lgG1 et soit une chaîne légère du type kappa ou lambda par la méthode PEI (0.5mg/ml ; Longo et al 2013) et cultivés pendant 5-8 jours dans du FreeStyle™ 293 Expression Medium (Thermo Fisher Scientific, 12338-018). Les anticorps secrétés dans le milieu sont purifiés sont purifiés par chromatographie d’affinité protéine A (Millipore, 113115827).
Résultats
A) Etude de l’effet inflammatoire avec les fragments F(ab)’2 obtenus par protéolyse ménagée
Comme les ICs interagissent généralement, via le domaine Fc des Ac, avec les FcyRs, il est évalué si le domaine Fc d’un Ac inclus dans un ICnUc est impliqué dans la réponse inflammatoire. Pour cela, on utilise l’Ac aTat12S et l’Ac aNcp2. Il est ici choisi d’altérer leur capacité à lier les FcyRs par élimination de leurs domaines Fc respectifs. L’élimination de ces domaines est réalisée par protéolyse avec de la pepsine. Cette protéolyse ménagée permet d’obtenir des fragments F(ab)’2, appelés respectivement F(ab)’2-aTat12S et F(ab)’2-aNcp2. Ces deux fragments d’Ac dépourvus de la région Fc sont ensuite incubés avec leurs AgnUc respectifs. Deux ICs appelés respectivement IC- F(ab)’2-aTat12S et IC-F(ab)’2-aNcp2 sont ainsi formés. Ils sont ensuite comparés aux ICs contenant les Ac entiers, respectivement appelés IC-Ac-aTat12S et IC-Ac-aNcp2, pour la capacité à provoquer la sécrétion d’IL-6 par des CMSPs humaines.
Dans ces conditions expérimentales, il est attendu que les IC-Ac-aTat12S et IC-Ac- aNcp2 se conduisent comme dans les exemples 1 et 2, c’est-à-dire qu’ils déclenchent la sécrétion d’IL-6 par des CMSPs. En revanche, il est attendu que les IC-F(ab)’2-aTat12S et IC-F(ab)’2-aNcp2 présentent une capacité inflammatoire réduite ou nulle, en raison de l’absence de région Fc qui obère la capacité à lier les FcyRs.
B) Étude de l’effet inflammatoire avec les fragments Fab obtenus par voie recombinante
Comme les ICs interagissent généralement, via le domaine Fc des Ac, avec les FcyRs, il est évalué si le domaine Fc d’un Ac inclus dans un ICnUc est impliqué dans la réponse inflammatoire. Pour cela, on utilise l’Ac aTat12S et l’Ac aNcp2. Il est ici choisi d’altérer leur capacité à lier les FcyRs à partir de constructions recombinantes dépourvues de leurs domaines Fc respectifs. Par biologie moléculaire, des fragments Fab, appelés respectivement Fab-aTat12S et Fab-aNcp2, sont produits. Ces deux fragments d’Ac dépourvus de la région Fc sont ensuite incubés avec leurs AgnUc respectifs. Deux ICs appelés respectivement IC-Fab-aTat12S et IC-Fab-aNcp2 sont ainsi formés. Ils sont ensuite comparés aux ICs contenant les Ac entiers, respectivement appelés IC-Ac-aTat12S et IC- Ac-aNcp2, pour la capacité à provoquer la sécrétion d’IL-6 par des CMSPs humaines.
Dans ces conditions expérimentales, il est attendu que les IC-Ac-aTat12S et IC-Ac- aNcp2 se conduisent comme dans les exemples 1 et 2, c’est-à-dire qu’ils déclenchent la sécrétion d’IL-6 par des CMSPs. En revanche, il est attendu que les IC-Fab-aTat12S et IC- Fab-aNcp2 présentent une capacité inflammatoire réduite ou nulle, en raison de l’absence de région Fc qui obère la capacité à lier les FcyRs.
C) Etude de l’effet inflammatoire avec les Ac aTat12S et aNcp2 dépourvus de la capacité à lier les récepteurs Fcys.
Comme les ICs interagissent généralement, via le domaine Fc des Ac, avec les FcyRs, il est évalué si le domaine Fc d’un Ac inclus dans un ICnUc est impliqué dans la réponse inflammatoire. Pour cela, on utilise l’Ac aTat12S et l’Ac aNcp2. Il est ici choisi d’altérer leur capacité à lier les FcyRs à partir de constructions recombinantes mutées dans leurs domaines Fc respectifs. Par biologie moléculaire, ces Ac mutés, appelés respectivement hcaTat12S-Fcmutet hcaNcp2-Fcmut sont produits. Ces deux Ac mutés sont ensuite incubés avec leurs AgnUc respectifs. On peut ainsi former deux ICs appelés respectivement IC-hcaTat12S-Fcmut et IC-hcaNcp2-Fcmut. Ils sont ensuite comparés aux ICs contenant les Ac entiers non mutés, respectivement appelés IC-Ac-aTat12S et IC-Ac- aNcp2, pour la capacité à provoquer la sécrétion d’IL-6 par des CMSPs humaines.
Dans ces conditions expérimentales, il est attendu que les IC-Ac-aTat12S et IC-Ac- aNcp2 se conduisent comme dans les exemples 1 et 2, c’est-à-dire qu’ils déclenchent la sécrétion d’IL-6 par des CMSPs. En revanche, il est attendu que les IC-hcaTat12S-Fcmut et IC-hcaNcp2-FCmut présentent une capacité inflammatoire réduite ou nulle, en raison de l’absence de région Fc qui obère la capacité à lier les FcyRs.
Exemple 4 : La réaction inflammatoire induite par des Ac entiers est bloquée par un dérivé d’Ac altéré dans sa capacité à lier les FCYRS.
Matériels et méthodes
Évaluation du blocage de l’inflammation par les F(ab)’2
Pour évaluer si le F(ab)VaNcp2 peut bloquer l’inflammation causée par un ICnUc contenant Ncp, Ncp est dans un premier temps incubée seule ou avec l’aNcp2 et en présence ou en absence du F(ab)VaNcp2. Pour évaluer si un effet anti-inflammatoire peut être prodigué par un F(ab)’2 non spécifique, Ncp est aussi incubée avec l’Ac aNcp2 en présence ou en absence de du F(ab)’2-aTat12S.
Pour évaluer si le F(ab)’2-anti-Tat peut bloquer l’inflammation causée par un ICnUc contenant Tat, la protéine Tat est dans un premier temps incubée seule ou avec l’Ac aTat12S et en présence ou en absence du F(ab)VaTat12S. Pour évaluer si l’effet anti inflammatoire peut être prodigué par un F(ab)’2 non spécifique, Tat est aussi incubée avec l’Ac aTat12S en présence ou en absence du F(ab)VaNcp2.
Les différents mélanges sont ensuite transférés dans des plaques contenant des cellules mononuclées du sang périphérique (CMSP) humain à raison de 0,1M de cellules par puits. Après 18h d’incubation à 37°C, les surnageants sont prélevés puis il est évalué s’ils contiennent la cytokine pro-inflammatoire IL-6.
Évaluation du blocage de l’inflammation par les Fab
Pour évaluer si le Fab-aNcp2 peut bloquer l’inflammation causée par un ICnUc contenant Ncp, Ncp est dans un premier temps incubée seule ou avec l’Ac aNcp2 et en présence ou en absence du Fab-aNcp2. Pour évaluer si l’effet anti-inflammatoire peut être prodigué par un Fab2 non spécifique, Ncp est aussi incubée avec l’Ac aNcp2 en présence ou en absence de du Fab-aTat12S.
Pour évaluer si le Fab-anti-Tat peut bloquer l’inflammation causée par un ICnUc contenant Tat, la protéine Tat est dans un premier temps incubée seule avec l’Ac aTat12S et en présence ou en absence du Fab-aTat12S. Pour évaluer si l’effet anti-inflammatoire peut être prodigué par un Fab non spécifique, Tat est aussi incubée avec l’Ac aTat12S et en présence ou en absence du Fab-aNcp2.
Les différents mélanges sont ensuite transférés dans des plaques contenant des cellules mononuclées du sang périphérique (CMSP) humain à raison de 0,1M de cellules par puits. Après 18h d’incubation à 37° C, les surnageants sont prélevés puis il est évalué s’ils contiennent la cytokine pro-inflammatoire IL-6. Évaluation du blocage de l’inflammation par les Ac hcaTat12S et hcaNcp2 entiers et dépourvus de la capacité à lier les récepteurs Fcys.
Pour évaluer si un Ac dépourvu de la capacité à lier les FcyRs peut bloquer l’inflammation causée par un ICnUc contenant Ncp, Ncp est dans un premier temps incubée seule ou avec l’Ac aNcp2 et en présence ou en absence de l’Ac hcaNcp2-Fcmut. Pour évaluer si l’effet anti-inflammatoire peut être prodigué par un F(ab)’2 non spécifique, Ncp est incubée avec l’Ac aNcp2 en présence ou en absence d’hcaTat12S-Fcmut.
Pour évaluer si un Ac dépourvu de la capacité à lier les FcyRs peut bloquer l’inflammation causée par un ICnUc contenant Tat, Tat est dans un premier temps incubée seule ou avec l’Ac aTat12S et en présence ou en absence hcaTat12S-Fcmut. Pour évaluer si l’effet anti-inflammatoire peut être prodigué par un F(ab)’2 non spécifique, Tat est incubée avec l’Ac aTat12S en présence ou en absence du de l’Ac hcaNcp2-Fcmut.
Les différents mélanges sont ensuite transférés dans des plaques contenant des cellules mononuclées du sang périphérique (CMSP) humain à raison de 0,1M de cellules par puits. Après 18h d’incubation à 37° C, les surnageants sont prélevés puis il est évalué s’ils contiennent la cytokine pro-inflammatoire IL-6.
Résultats
Évaluation du blocage de l’inflammation par les F(ab)’2
Pour évaluer si l’inflammation induite par des ICs contenant Tat et l’Ac aTat12S ou l’Ac aTat7S peut être diminuée, voire abolie, en présence d’un Ac anti-Tat dépourvu de la capacité à lier les FcyRs, le F(ab)’2-aTat12S décrit dans l’exemple 3 est utilisé. Tat est incubée avec l’un des deux Ac entiers en absence ou en présence du F(ab)’2-aTat12S de façon à former différents types d’immun complexes. Ces mélanges sont ensuite incubés pendant 24 heures avec des CMSPs et la présence d’IL-6 dans les surnageants est mesurée.
Dans ces conditions expérimentales, il est attendu que l’IC-Ac-aTat12S se conduise comme dans l’exemple 1 , c’est-à-dire qu’il déclenche la sécrétion d’IL-6 par des CMSPs. Il est aussi attendu que cette sécrétion ne soit pas significativement modifiée lorsque Tat, aTat12S, F(ab)’2-aNcp2 sont incubés individuellement. En revanche, il est attendu que cette sécrétion soit réduite ou nulle lorsque Tat, aTat12S, F(ab)’2-aTat12S sont incubés conjointement.
Pour évaluer si l’inflammation induite par des ICs contenant Ncp et l’Ac aNcp2 ou l’Ac aNcp15 peut être diminuée, voire abolie, en présence d’un Ac anti-Ncp dépourvu de la capacité à lier les FcyRs, le F(ab)’2-aNcp2 décrit dans l’exemple 3 est utilisé. Ncp est incubée avec l’un des deux Ac entiers en absence ou en présence du F(ab)’2-aNcp2 de façon à former différents types d’immun complexes. Ces mélanges sont ensuite incubés pendant 24 heures avec des CMSPs et la présence d’IL-6 dans les surnageants est mesurée. Dans ces conditions expérimentales, il est attendu que l’IC-Ac-aNcp2 se conduise comme dans l’exemple 2, c’est-à-dire qu’il déclenche la sécrétion d’IL-6 par des CMSPs. Il est aussi attendu à ce que cette sécrétion ne soit pas significativement modifiée lorsque Ncp, aNcp2, F(ab)’2-aTat12S sont incubés individuellement. En revanche, il est attendu que cette sécrétion soit réduite ou nulle lorsque Ncp, aNcp2, F(ab)’2-aNcp2 sont incubés conjointement.
Évaluation du blocage de l’inflammation par les Fab
Pour évaluer si l’inflammation induite par des ICs contenant Tat et l’Ac aTat12S ou l’Ac aTat7S peut être diminuée, voire abolie, en présence d’un Ac anti-Tat dépourvu de la capacité à lier les FcyRs, le Fab-aTat12S décrit dans l’exemple 3 est utilisé. Tat est incubée avec l’un des deux Ac entiers en absence ou en présence du Fab-aTat12S de façon à former différents types d’immun complexes. Ces mélanges sont ensuite incubés pendant 24 heures ces mélanges avec des CMSPs et la présence d’IL-6 dans les surnageants est mesurée.
Dans ces conditions expérimentales, il est attendu que l’IC-Ac-aTat12S se conduise comme dans l’exemple 1 , c’est-à-dire qu’il déclenche la sécrétion d’IL-6 par des CMSPs. Il est aussi attendu que cette sécrétion ne soit pas significativement modifiée lorsque Tat, aTat12S, Fab-aNcp2 sont incubés individuellement. En revanche, il est attendu que cette sécrétion soit réduite ou nulle lorsque Tat, aTat12S, Fab-aTat12S sont incubés conjointement.
Pour évaluer si l’inflammation induite par des ICs contenant Ncp et l’Ac aNcp2 ou l’Ac aNcp15 peut être diminuée, voire abolie, en présence d’un Ac anti-Ncp dépourvu de la capacité à lier les FcyRs, le Fab-aNcp2 décrit dans l’exemple 3 est utilisé. Ncp est incubée avec l’un des deux Ac entiers en absence ou en présence du Fab-aNcp2 de façon à former différents types d’immun complexes. Ces mélanges sont incubés pendant 24 heures avec des CMSPs et la présence d’IL-6 dans les surnageants est mesurée.
Dans ces conditions expérimentales, il est attendu que l’IC-Ac-aNcp2 se conduise comme dans l’exemple 2, c’est-à-dire qu’il déclenche la sécrétion d’IL-6 par des CMSPs. Il est également attendu que cette sécrétion ne soit pas significativement modifiée lorsque Ncp, aNcp2, Fab-aTat12S sont incubés individuellement. En revanche, il est attendu que cette sécrétion soit réduite ou nulle lorsque Ncp, aNcp2, Fab-aNcp2 sont incubés conjointement.
Évaluation du blocage de l’inflammation par les Ac hcaTat12S et hcaNcp2 entiers mutés dépourvus de la capacité à lier les récepteurs Fcys.
Pour évaluer si l’inflammation induite par des ICs contenant Tat et l’Ac aTat12S ou l’Ac aTat7S peut être diminuée, voire abolie, en présence d’un Ac anti-Tat dépourvu de la capacité à lier les FcyRs, l’Ac hcaTat12S muté (hcaTat12S-Fcmut) décrit dans l’exemple 3 est utilisé. Tat est incubée avec l’un des deux Ac entiers en absence ou en présence du hcaTat12S-Fcmut de façon à former différents types d’immuns complexes. Ces mélanges sont ensuite incubés pendant 24 heures avec des CMSPs et la présence d’IL-6 dans les surnageants est mesurée.
Dans ces conditions expérimentales, il est attendu que l’IC-Ac-hcaTat12S se conduise comme dans l’exemple 1 , c’est-à-dire qu’il déclenche la sécrétion d’IL-6 par des CMSPs. Il est également attendu que cette sécrétion ne soit pas significativement modifiée lorsque Tat, aTat12S, hcaNcp2-Fcmut sont incubés individuellement. En revanche, il est attendu que cette sécrétion soit réduite ou nulle lorsque Tat, aTat12S, hcaTat12S-FCmut sont incubés conjointement.
Pour évaluer si l’inflammation induite par des ICs contenant Ncp et l’Ac aNcp2 ou l’Ac aNcp15 peut être diminuée, voire abolie, en présence d’un Ac anti-Ncp dépourvu de la capacité à lier les FcyRs, l’anticorps hcaNcp2 muté (hcaNcp2 Fcmut) décrit dans l’exemple 3 est utilisé. Ncp est incubée avec l’un des deux Ac entiers en absence ou en présence du hcaNcp2 Fcmut de façon à former différents types d’immun complexes. Ces mélanges sont ensuite incubés pendant 24 heures avec des CMSPs et la présence d’IL-6 dans les surnageants est mesurée.
Dans ces conditions expérimentales, il est attendu que l’IC-Ac-aNcp2 se conduise comme dans l’exemple 2, c’est-à-dire qu’il déclenche la sécrétion d’IL-6 par des CMSPs. Il est également attendu que cette sécrétion ne soit pas significativement modifiée lorsque Ncp, aNcp2, hcaNcp2 Fcmut sont incubés individuellement. En revanche, il est attendu que cette sécrétion soit réduite ou nulle lorsque Ncp, aNcp2, hcaNcp2-Fcmut sont incubés conjointement.
Exemple 5 : La réaction inflammatoire induite par des ICnUc dépend de la région Fc des Ac incluse dans l’IC.
Matériels et méthodes
Clonage d’Ac aNcp15 par biologie moléculaire et production recombinante des fragments Fab et des anticorps dépourvus de la capacité à lier les FcyRs qui en dérivent.
L’hybridome exprimant l’Ac aNcp15 est mis en culture pour être ensuite utilisé comme source d’ARN messager. À partir de cet hybridome, les séquences de l’anticorps sont obtenues en suivant les méthodes décrites par Stravinskiene 2020 and Meyer et al. 2019. Brièvement, les ARNs d’hybridome (3-10x106 cellules) sont obtenus en utilisant le kit GeneJET RNA Purification Kit (Thermo Fisher Scientific, K0731 ) et directement utilisés pour la synthèse de cDNAs. Pour chaque anticorps trois réactions sont préparées en utilisant l’enzyme SMARTScribe Reverse Transcriptase (Clontech, 639537), l’amorce sens Template-switch oligo Universal ( AAG CAGT G GTAT CAACG CAG AGT ACAT rG rG rG , SEQ ID NO :1 , où rG signifie qu’il s’agit d’une base G d’ARN, alors que les autres bases sont des bases ADN) et une des amorces spécifiques : TTGTCGTTCACTGCCATCAATC (SEQ ID NO :2, amorce antisens pour chaîne kappa mIGK pour RT), GGGGTACCATCTACCTTCCAG (SEQ ID NO :3, amorce antisens pour chaîne lambda mIGL pour RT) ou AGCTGGGAAGGTGTGCACAC (SEQ ID NO :4, amorce antisens pour chaîne lourde mIGHG pour RT). Les cDNA sont amplifiés par PCR en utilisant l’amorce sens ISPCR Universal (AAGCAGTGGTATCAACGCAGAG, SEQ ID NO :5) et une des amorces spécifiques : amorce antisens pour chaîne kappa mIGK pour PCR (ACATTGATGTCTTTGGGGTAGAAG, SEQ ID NO :6), amorce antisens pour chaîne lambda mIGL pour PCR (ATCGTACACACCAGTGTGGC, SEQ ID NO :7) ou amorce antisens pour chaîne lourde mIGHG pour PCR
(GGGATCCAGAGTTCCAGGTC, SEQ ID NO :8).
Les amplicons sont ensuite analysés par électrophorèse en gel d’agarose, purifiés, clonés dans le plasmide pJet1.2 (Thermo Fisher Scientific, K1231 ) et séquencés par la méthode Sanger. À partir des séquences obtenues, de nouvelles amorces spécifiques sont utilisées pour le clonage de la région VH de l’aNcp15 dans le vecteur AbVec-hlgG1 (comprenant une région constante humaine de chaîne lourde d’isotype lgG1 , numéro d’accès Genbank: FJ475055.1 ; entre les sites Age I et Apal, version 241 de Genbank du 15 décembre 2020). De la même manière de nouvelles amorces spécifiques sont utilisées pour le clonage de la région VL de l’aNcp15 dans le vecteur AbVec-hlgKappa (comprenant une région constante humaine de chaîne légère d’isotype kappa, numéro d’accès Genbank: FJ475056.1 , entre les sites Age I et Bs/WI, version 241 de Genbank du 15 décembre 2020) ou AbVec-hlgLambda (comprenant une région constante humaine de chaîne légère d’isotype lambda, numéro d’accès Genbank: FJ517647.1 , entre les sites Agel et Xho\, version 241 de Genbank du 15 décembre 2020). Ces vecteurs codent pour les chaînes lourdes et légères d’un anticorps chimérique avec des régions constantes humaines dénoté hcaNcp15 (où « hc » signale que l’anticorps est chimérique avec des régions constantes humaines, cette terminologie est utilisée dans tous les exemples). Les mutations E233P, F234V, L235A et D265A sont incorporées sur le plasmide AbVec-hlgG1 pour l’obtention du variant d’aNcp15 dépourvu d’activité effectrice. Un plasmide dérivé d’AbVec-hlgG1 a été construit par l’insertion de la séquence codante pour ENLYFQSHHHHHH (site de clivage par la protease TEV suivi de 6 histidines) en aval de la cystéine 220 (C220, dans la séquence K218-S219-C220) suivi d’un codon stop permettant l’arrêt de la traduction. Ce plasmide (AbVec-hlgG1_Fab-TEV-6xHis) est utilisé pour l’expression de la fusion VH-CH1 -TEV-6xHis d’aNcp15 nécessaire à la production du Fab correspondant (Fab-aNcp15).
Pour l’expression des fragments Fab recombinants et des anticorps entiers dépourvus de la capacité à lier les FcyRs, des cellules 293-F (HEK, Thermo Fisher Scientific, R790-07) sont co- transfectées (rapport équimolaire) avec un plasmide correspondant soit à la région VH-CH1 ou à la chaîne lourde complète d’un anticorps lgG1 et soit une chaîne légère du type kappa ou lambda par la méthode PEI (0.5mg/ml ; Longo et al 2013) et cultivés pendant 5-8 jours dans du FreeStyle™ 293 Expression Medium (Thermo Fisher Scientific, 12338-018). Les Fabs contenant des étiquettes de poly- histidines et sécrétés dans le milieu sont purifiés par IMAC (chromatographie d’affinité aux ions métalliques immobilisés, GE Healthcare Cat.N. 17-0575-01 ). Les Ac entiers secrétés dans le milieu sont purifiés par chromatographie d’affinité protéine A (Millipore, 113115827).
Pour l’expression des anticorps entiers dépourvus de la capacité à lier les FcyRs, des cellules 293-F (HEK, Thermo Fisher Scientific, R790-07) sont co-transfectées (rapport équimolaire) avec un plasmide correspondant à la chaîne lourde d’un anticorps lgG1 et, soit une chaîne légère du type kappa ou lambda par la méthode PEI (0.5mg/ml ; Longo et al 2013) et cultivés pendant 5-8 jours dans du FreeStyle™ 293 Expression Medium (Thermo Fisher Scientific, 12338-018). Les Ac secrétés dans le milieu sont purifiés par chromatographie d’affinité protéine A (Millipore, 113115827).
Étude immunoenzymatique de hcaNcp15, hcaNcp15Fcmuté et Fab-aNcp15 pour la capacité à lier la protéine Ncp. Pour cette étude l’anticorps hcaNcp15 a été adsorbé sur des plaques de microtitration (0,1 pg/1 OOmI/puits). Les plaques ont ensuite été saturées avec un tampon PBS contenant de la Sérum-albumine bovine à 0,3%. Les plaques ont ensuite été lavées et une concentration fixe de protéine N-biotinylée (178pM) a été ajoutée dans les puits en présence ou en absence de séries de dilutions d’hcaNcp15, ou de hcaNcp15Fcmuté ou de Fab-aNcp15. Après une incubation d’une nuit à 4°C, la plaque a été lavée, de la streptavidine couplée à la péroxydase a été ajouté. Après 30 minutes, des lavages ont été effectués et un substrat colorimétrique (ABTS) a été ajouté pour mesurer la présence de Ncp-biotinylé.
Résultats A) Production par voie recombinante de l’Ac aNcp15Fcmuté et du fragment Fab- aNcp15, et caractérisation de leur capacité à lier la protéine Ncp.
Comme les ICs interagissent généralement, via le domaine Fc des Ac, avec les FcyRs, il est évalué si le domaine Fc d’un Ac inclus dans un ICnUc est impliqué dans la réponse inflammatoire. Pour cela, on utilise l’Ac hcaNcp15. Il est ici choisi de produire deux constructions recombinantes dépourvues de la capacité à lier les FcyRs. La première construction, correspond au fragment Fab de aNcp15, appelé Fab-aNcp15. La seconde, correspond à l’Ac hcaNcp15 contenant un domaine Fc muté afin d’altérer sa capacité à lier les FcyRs. Cette construction est appelée hcaNcp15Fcmuté.
La capacité de Fab-aNcp15 et de hcaNcpl 5Fcmuté à lier Ncp est ensuite comparée à celle de l’Ac hcaNcpl 5 entier, par dosage immunoenzymatique. Pour cela, des séries de dilutions de Fab-aNcp15, de hcaNcpl 5Fcmuté ou d’Ac hcaNcpl 5 ont été incubées en présence d’une quantité fixe de Ncp-biotinylé dans des plaques préalablement adsorbées avec l’Ac hcaNcp15. Les plaques ont ensuite été lavées et incubées en présence de streptavidine-péroxydase et d’un substrat colorimétrique pour évaluer la liaison de Ncp- biotine aux puits de microtitration. Comme on peut le voir sur la figure 4, la liaison de Ncp-biotine aux plaques est inhibée de façon dose-dépendante par l’Ac hcaNcp15 entier, par hcaNcp15Fcmuté ainsi que par le Fab-aNcp15. Ces données indiquent donc que hcaNcp15Fcmuté et le fragment Fab conservent la capacité à interagir avec la protéine Ncp. L’Ac hcaNcp15 entier et hcaNcp15Fcmuté présentent une capacité d’inhibition similaire ce qui indique que les mutations dans le domaine Fc de l’Ac n’altèrent pas la capacité de liaison. L’Ac entier présente en revanche une capacité d’inhibition supérieure au fragment Fab, ce qui est attendu car la molécule intégrale possède deux domaines Fab qui contribuent à l’avidité de l’interaction.
B) Étude de l’effet inflammatoire avec le fragment Fab obtenu par voie recombinante
Pour évaluer si l’effet inflammatoire médié par un complexe immun dépend du domaine Fc de l’Ac, le fragment Fab-aNcp15 précédemment produit est utilisé. Il est incubé en présence de la protéine Ncp de façon à former un IC appelé Ncp/Fab-aNcp15. Ensuite sa capacité à provoquer la sécrétion d’IL-6 par des CMSPs humaines est comparée à celle de Ncp libre, Fab-aNcp15 libre, et de l’IC Ncp/aNcp15. Ce dernier IC dont la capacité à déclencher la sécrétion d’IL-6 est montrée dans la figure 3, est utilisé à titre de contrôle positif.
Dans ces conditions expérimentales, le Fab-aNcp15 libre, la protéine Ncp libre et l’IC contenant le Fab-aNcp15 se comportent de la même manière puisqu’ils présentent une capacité inflammatoire quasi nulle (figure. 5). L’IC aNcp15 utilisé à titre de contrôle positif déclenche pour sa part la sécrétion d’IL-6 par des CMSPs. Cette dernière observation indique que l’absence d’effet de l’IC Ncp/Fab-aNcp15 n’est pas due à une perte de réactivité des cellules. Ces résultats démontrent donc que la sécrétion d’IL-6 ne peut être provoquée par un complexe immun contenant un Fab. Elles indiquent de plus que l’effet inflammatoire dépend de la présence de la région Fc dans le complexe.
C) Etude de l’effet inflammatoire avec l’Ac hcaNcp15 dépourvu de la capacité à lier les récepteurs Fcys.
Pour évaluer si l’effet inflammatoire médié par un complexe immun dépend de la capacité à lier les RFcgs, l’Ac hcaNcp15Fcmuté dépourvu de la capacité à lier les récepteurs Fcys est utilisé. Cet Ac muté est incubé avec Ncp de façon à former un complexe immun appelé Ncp/hcaNcp15-Fcmut. Ce complexe est comparé à i) l’IC contenant l’Ac entier non muté appelé Ncp/hcaNcp15, ii) hcaNcp15-Fcmut, iii) Ncp libre pour la capacité à provoquer la sécrétion d’IL-6 par des CMSPs humaines.
Dans ces conditions expérimentales, l’IC Ncp/hcaNcp15-F mut, la protéine Ncp libre et hcaNcp15-Fcmut se comportent de la même manière puisqu’ils présentent une capacité inflammatoire quasi nulle (figure 6). L’IC Ncp/hcaNcp15 se conduit en revanche comme dans les exemples 1 et 2, c’est-à-dire qu’il déclenche la sécrétion d’IL-6 par des CMSPs. Ces résultats indiquent donc que la sécrétion d’IL-6 ne peut être provoquée avec un Ac dont la région Fc est altérée pour la capacité à lier les FcyRs ce qui démontre que le phénomène dépend de cette capacité d’interaction.
Exemple 6 : La réaction inflammatoire induite par des Ac entiers est bloquée par un Fab spécifique de Ncp ou par un dérivé d’Ac altéré dans sa capacité à lier les FCYRS.
Matériels et méthodes
Évaluation du blocage de l’inflammation par un Fab spécifique de Ncp.
Pour évaluer si le Fab-aNcp15 peut bloquer l’inflammation causée par un ICnUc contenant Ncp, l’Ac hcaNcp15, préalablement décrit dans l’exemple 2, est utilisé. Ncp est incubé seul ou avec hcaNcp15 et en présence ou en absence du Fab-aNcp15. Ncp est aussi incubé en présence du Fab-aNcp15 à titre de contrôle. Les différents mélanges sont ensuite transférés dans des plaques contenant des cellules mononuclées du sang périphérique (CMSP) humain à raison de 0,1M de cellules par puits. Après 18h d’incubation à 37° C, les surnageants sont prélevés puis il est évalué s’ils contiennent la cytokine pro inflammatoire IL-6.
Évaluation du blocage de l’inflammation par les Ac aNcp15 entiers et dépourvus de la capacité à lier les récepteurs Fcys.
Pour évaluer si un Ac dépourvu de la capacité à lier les FcyRs peut bloquer l’inflammation causée par un ICnUc contenant Ncp, Ncp est dans un premier temps incubée seule ou avec l’Ac hcNcp15 et en présence ou en absence de l’Ac hcaNcp15-Fcmuté.
Les différents mélanges sont ensuite transférés dans des plaques contenant des cellules mononuclées du sang périphérique (CMSP) humain à raison de 0,1M de cellules par puits. Après 18h d’incubation à 37° C, les surnageants sont prélevés puis il est évalué s’ils contiennent la cytokine pro-inflammatoire IL-6.
Résultats
Évaluation du blocage de l’inflammation par un fragment Fab
Pour évaluer si l’inflammation induite par des ICs contenant Ncp peut être altérée en présence d’un Fab spécifique de Ncp, l’Ac hcaNcp15 et le Fab-aNcp15 sont utilisés. Ncp est incubée seule ou en présence de Fab-aNcp15. Ncp est aussi incubée avec l’Ac hcaNcp15 entier en absence ou en présence de Fab-aNcp15 de façon à former différents types d’immun complexe. Ces mélanges sont ensuite incubés pendant 18 heures avec des CMSPs et la présence d’IL-6 dans les surnageants est mesurée. Dans ces conditions expérimentales, nous avons observé que l’IC Ncp/hcaNcp15 déclenche la sécrétion d’IL-6 par des CMSPs (cf figure 7). En revanche, cette sécrétion est réduite lorsque Ncp, hcaNcp15, Fab-aNcp15 sont incubés conjointement. Ces résultats indiquent donc que la sécrétion d’IL-6 induite par un complexe immun peut être altérée en présence d’un Fab spécifique de Ncp.
Évaluation du blocage de l’inflammation par l’Ac hcaNcp15Fcmuté dépourvu de la capacité à lier les récepteurs Fcys.
Pour évaluer si l’inflammation induite par des ICs contenant Ncp peut être altérée en présence d’un Ac muté dépourvu de la capacité à lier les récepteurs Fcys, l’Ac hcaNcp15 et l’Ac hcaNcp15Fcmuté sont utilisés. Ncp est incubée seule ou en présence d’hcaNcp15Fcmuté. Ncp est aussi incubée avec l’Ac hcaNcp15 entier en absence ou en présence de hcaNcp15Fcmuté de façon à former différents types d’immun complexe. Ces mélanges sont ensuite incubés pendant 18 heures avec des CMSPs et la présence d’IL-6 dans les surnageants est mesurée. Dans ces conditions expérimentales, nous avons observé que l’IC Ncp/hcaNcp15 déclenche la sécrétion d’IL-6 par des CMSPs (cf figure 8). En revanche, cette sécrétion est réduite lorsque Ncp, hcaNcp15, hcaNcp15Fcmuté sont incubés conjointement. Ces résultats indiquent donc que la sécrétion d’IL-6 induite par un complexe immun peut être altérée en présence d’un Ac spécifique dont la région Fc est altérée pour la capacité à lier les FcyRs.
REFERENCES BIBLIOGRAPHIQUES
Almagro, J. C., & Fransson, J. (2008). Humanization of antibodies. Frontiers in Bioscience : A Journal and Virtual Library, 13, 1619-1633. http://www.ncbi.nlm.nih.gov/pubmed/17981654 Ben Mkaddem, S., Benhamou, M., & Monteiro, R. C. (2019). Understanding Fc Receptor
Involvement in Inflammatory Diseases: From Mechanisms to New Therapeutic Tools. Frontiers in Immunology, 10, 811. https://doi.org/10.3389/fimmu.2019.00811
Cafaro, A., Tripiciano, A., Picconi, O., Sgadari, C., Moretti, S., Buttô, S., Monini, P., & Ensoli, B. (2019). Anti-Tat Immunity in HIV-1 Infection: Effects of Naturally Occurring and Vaccine-lnduced Antibodies Against Tat on the Course of the Disease. Vaccines, 7(3). https://doi.org/10.3390/vaccines7030099
Carter, J. J., Koutsky, L. A., Hughes, J. P., Lee, S. K., Kuypers, J., Kiviat, N., & Galloway, D. A. (2000). Comparison of human papillomavirus types 16, 18, and 6 capsid antibody responses following incident infection. The Journal of Infectious Diseases, 181 (6), 1911-1919. https://doi.org/10.1086/315498
Cecconi, M., Evans, L., Levy, M., & Rhodes, A. (2018). Sepsis and septic shock. Lancet (London, England), 392(10141), 75-87. https://doi.org/10.1016/S0140-6736(18)30696-2 Chenoweth, A. M., Wines, B. D., Anania, J. C., & Mark Hogarth, P. (2020). Harnessing the immune System via FcyR function in immune therapy: a pathway to next-gen mAbs. Immunology and Cell Biology, 98(4), 287-304. https://doi.org/10.1111 /imcb.12326
Choi, M. Y., FitzPatrick, R. D., Buhler, K., Mahler, M., St Fritzler, M. J. (2020). A review and meta-analysis of anti-ribosomal P autoantibodies in systemic lupus erythematosus. Autoimmunity Reviews, 19(3), 102463. https://doi.Org/10.1016/j.autrev.2020.102463
Combes, A. J., Courau, T., Kuhn, N. F., Hu, K. H., Ray, A., Chen, W. S., Chew, N. W., Cleary, S. J., Kushnoor, D., Reeder, G. C., Shen, A., Tsui, J., Hiam-Galvez, K. J., Munoz- Sandoval, P., Zhu, W. S., Lee, D. S., Sun, Y., You, R., Magnen, M., ... Krummel, M. F. (2021 ). Global absence and targeting of protective immune States in severe COVID-19. Nature. https://doi.org/10.1038/s41586-021-03234-7
Dinarello, C. A. (2010). Anti-inflammatory Agents: Présent and Future. Cell, 140(6), 935-950. https://doi.Org/10.1016/j.cell.2010.02.043
Edelman, G. M., Cunningham, B. A., Gall, W. E., Gottlieb, P. D., Rutishauser, U., St Waxdal, M. J. (1969). The covalent structure of an entire gammaG immunoglobulin molécule. Proceedings of the National Academy of Sciences of the United States of America, 63(1 ), 78- 85. https://doi.Org/10.1073/pnas.63.1.78
Fenouillet, E., Blanes, N., Coutellier, A., St Gluckman, J. C. (1993). Relationship between anti-p24 antibody levels and p24 antigenemia in HIV-infected patients. AIDS Research and Human Retroviruses, 9(12), 1251-1255. https://doi.Org/10.1089/aid.1993.9.1251
Fu, Y., Cheng, Y., St Wu, Y. (2020). Understanding SARS-CoV-2-Mediated Inflammatory Responses: From Mechanisms to Potential Therapeutic Tools. Virologica Sinica, 35(3), 266- 271. https://doi.org/10.1007/s12250-020-00207-4
Gao, T., Hu, M., Zhang, X., Li, H., Zhu, L., Liu, H., Dong, Q., Zhang, Z., Wang, Z., Hu, Y., Fu, Y., Jin, Y., Li, K., Zhao, S., Xiao, Y., Luo, S., Li, L., Zhao, L., Liu, J., ... Cao, C. (2020). Highly pathogenic coronavirus N protein aggravâtes lung injury by MASP-2-mediated complément over-activation. MedRxiv, 2020.03.29.20041962. https://doi.org/10.1101 /2020.03.29.20041962
Ghiggeri, G. M., D’Alessandro, M., Bartolomeo, D., Degl’lnnocenti, M. L., Magnasco, A., Lugani, F., Prunotto, M., St Bruschi, M. (2019). An Update on Antibodies to Necleosome Components as Biomarkers of Sistemic Lupus Erythematosus and of Lupus Flares. International Journal of Molecular Sciences, 20(22). https://doi.org/10.3390/ijms20225799
Hashida, S., Hashinaka, K., Ishikawa, S., St Ishikawa, E. (1997). More reliable diagnosis of infection with human immunodeficiency virus type 1 (HIV-1 ) by détection of antibody IgGs to pol and gag proteins of HIV-1 and p24 antigen of HIV-1 in urine, saliva, and/or sérum with highly sensitive and spécifie enzyme immunoas. Journal of Clinical Laboratory Analysis, 11 (5), 267-286. http : / / www. nebi . nlm . nih . gov/ pubmed/9292394
Hawkins, R. B., Raymond, S. L., Stortz, J. A., Horiguchi, H., Brakenridge, S. C., Gardner, A., Efron, P. A., Bihorac, A., Segal, M., Moore, F. A., St Moldawer, L. L. (2018). Chronic Critical lllness and the Persistent Inflammation, Immunosuppression, and Catabolism Syndrome. Frontiers in Immunology, 9, 1511. https://doi.org/10.3389/fimmu.2018.01511 Hoffman, R. W., & Greidinger, E. L. (2000). Mixed connective tissue disease. Current Opinion in Rheumatology, 12(5), 386-390. https://doi.org/10.1097/00002281-200009000- 00006
Holliger, P., St Hudson, P. J. (2005). Engineered antibody fragments and the rise of single domains. Nature Biotechnology, 23(9), 1126-1136. https://doi.org/10.1038/nbt1142
Horvath, G. L., Schrum, J. E., De Nardo, C. M., St Latz, E. (2011). Intracellular sensing of microbes and danger signais by the inflammasomes. Immunological Reviews, 243(1 ), 119- 135. https://doi.Org/10.1111 / j.1600-065X.2011.01050.x
Hu, K.-Q. (2002). Occult hepatitis B virus infection and its clinical implications. Journal of Viral Hepatitis, 9(4), 243-257. https://doi.Org/10.1046/j.1365-2893.2002.00344.x
Hung, I. F. N. (2020). Treatment of coronavirus disease 2019. Current Opinion in HIV and AIDS, 15(6), 336-340. https://doi.org/10.1097/COH.0000000000000652
Jones, P. T., Dear, P. H., Foote, J., Neuberger, M. S., St Winter, G. (1986). Replacing the complementarity-determining régions in a human antibody with those from a mouse. Nature, 321 (6069), 522-525. https://doi.org/10.1038/321522a0
Kabat E.A., Wu T.T., Perry H.M. , Foeller C., G. K. S. (1991 ). Sequences of Proteins of Immunological Interest (5th ed.). U. S. Department of Health and Human Services, National Institutes for Health.
Kamar, N., Izopet, J., Pavio, N., Aggarwal, R., Labrique, A., Wedemeyer, H., St Dalton, H. R. (2017). Hepatitis E virus infection. Nature Reviews. Disease Primers, 3, 17086. https://doi.org/10.1038/nrdp.2017.86
Kapingidza, A. B., Kowal, K., St Chruszcz, M. (2020). Antigen-Antibody Complexes. Sub-Cellular Biochemistry, 94, 465-497. https://doi.org/10.1007/978-3-030-41769-7_19
Kittiworakarn, J., Lecoq, A., Moine, G., Thaï, R., Lajeunesse, E., Drevet, P., Vidaud, C., Ménez, A., St Léonetti, M. (2006). HIV-1 Tat raises an adjuvant-free humoral immune response controlled by its core région and its ability to form cysteine-mediated oligomers. The Journal of Biological Chemistry, 281 (6), 3105-3115. https://doi.org/10.1074/jbc.M509899200
Kohler, G., St Milstein, C. (1975). Continuous cultures of fused cells secreting antibody of predefined specificity. Nature, 256(5517), 495-497. https://doi.org/10.1038/256495a0
Lecoq, A., Moine, G., Bellanger, L., Drevet, P., Thaï, R., Lajeunesse, E., Ménez, A., St Léonetti, M. (2008). Increasing the humoral immunogenic properties of the HIV-1 Tat protein using a ligand-stabilizing strategy. Vaccine, 26(21 ), 2615-2626. https://doi.Org/10.1016/j.vaccine.2008.02.057
Leung, D. T. M., Tarn, F. C. H., Ma, C. H., Chan, P. K. S., Cheung, J. L. K., Niu, H., Tarn, J. S. L., St Lim, P. L. (2004). Antibody response of patients with severe acute respiratory syndrome (SARS) targets the viral nucleocapsid. The Journal of Infectious Diseases, 190(2), 379-386. https://doi.org/10.1086/422040
Migliorini, P., Baldini, C., Rocchi, V., St Bombardieri, S. (2005). Anti-Sm and anti-RNP antibodies. Autoimmunity, 38(1 ), 47-54. https://doi.org/10.1080/08916930400022715
Mimoto, F., Katada, H., Kadono, S., Igawa, T., Kuramochi, T., Muraoka, M., Wada, Y., Haraya, K., Miyazaki, T., St Hattori, K. (2013). Engineered antibody Fc variant with selectively enhanced FcyRllb binding over both FcYRIIa(R131 ) and FcyRI la(H 131 ). Protein Engineering, Design & Sélection : PEDS, 26(10), 589-598. https://doi.org/10.1093/protein/gzt022
Ni, L, Ye, F., Cheng, M.-L, Feng, Y., Deng, Y.-Q., Zhao, H., Wei, P., Ge, J., Gou, M., Li, X., Sun, L, Cao, T., Wang, P., Zhou, C., Zhang, R., Liang, P., Guo, H., Wang, X., Qin, C.- F., ... Dong, C. (2020). Détection of SARS-CoV-2-Specific Humoral and Cellular Immunity in COVID-19 Convalescent Individuals. Immunity, 52(6), 971 -977. e3. https://doi.Org/10.1016/j.immuni.2020.04.023
OhAinle, M., Balmaseda, A., Macalalad, A. R., Tellez, Y., Zody, M. C., Saborio, S., Nuhez, A., Lennon, N. J., Birren, B. W., Gordon, A., Henn, M. R., St Harris, E. (2011 ). Dynamics of dengue disease severity determined by the interplay between viral genetics and serotype- specific immunity. Science Translational Medicine, 3(114), 114ra128. https://doi.Org/10.1126/scitranslmed.3003084
Pisetsky, D. S., St Lipsky, P. E. (2020). New insights into the role of antinuclear antibodies in systemic lupus erythematosus. Nature Reviews. Rheumatology, 16(10), 565-579. https://doi.org/10.1038/s41584-020-0480-7
Riechmann, L., Clark, M., Waldmann, H., St Winter, G. (1988). Reshaping human antibodies for therapy. Nature, 332(6162), 323-327. https://doi.org/10.1038/332323a0
Rother, R. P., Rollins, S. A., Mojcik, C. F., Brodsky, R. A., St Bell, L. (2007). Discovery and development of the complément inhibitor eculizumab for the treatment of paroxysmal nocturnal hemoglobinuria. Nature Biotechnology, 25(11 ), 1256-1264. https://doi.org/10.1038/nbt1344
Rumbaugh, J. A., Bachani, M., Li, W., Butler, T. R., Smith, K. J., Bianchet, M. A., Wang, T., Prendergast, M. A., Sacktor, N., St Nath, A. (2013). HIV immune complexes prevent excitotoxicity by interaction with NMDA receptors. Neurobiology of Disease, 49, 169-176. https://doi.Org/10.1016/j.nbd.2012.08.013
Schulte-Pelkum, J., Fritzler, M., St Mahler, M. (2009). Latest update on the Ro/SS-A autoantibody System. Autoimmunity Reviews, 8(7), 632-637. https://doi.Org/10.1016/j.autrev.2009.02.010
Sospedra, M., St Martin, R. (2016). Immunology of Multiple Sclerosis. Seminars in Neurology, 36(2), 115-127. https://doi.org/10.1055/s-0036-1579739
Stadlbauer, D., Amanat, F., Chromikova, V., Jiang, K., Strohmeier, S., Arunkumar, G. A., Tan, J., Bhavsar, D., Capuano, C., Kirkpatrick, E., Meade, P., Brito, R. N., Teo, C., McMahon, M., Simon, V., St Krammer, F. (2020). SARS-CoV-2 Séroconversion in Humans: A Detailed Protocol for a Serological Assay, Antigen Production, and Test Setup. Current Protocols in Microbiology, 57(1 ), e100. https://doi.org/10.1002/cpmc.100
Strohl, W. R., St Strohl, L. M. B. T. -T. A. E. (Eds.). (2012). 11 - IgG glycans and glyco- engineering. In Woodhead Publishing Sériés in Biomedicine (pp. 251-595). Woodhead Publishing. https://doi.Org/https://doi.org/10.1533/9781908818096.251
Tarisse, C. F., Goulard-Huet, C., Nia, Y., Devilliers, K., Marcé, D., Dambrune, C., Lefebvre, D., Hennekinne, J. -A., St Simon, S. (2021 ). Highly Sensitive and Spécifie Détection of Staphylococcal Enterotoxins SEA, SEG, SEH, and SEI by Immunoassay. Toxins, 13(2). https://doi.org/10.3390/toxins13020130 Temming, A. R., Bentlage, A. E. H., de Taeye, S. W., Bosman, G. P., Lissenberg- Thunnissen, S. N., Derksen, N. I. L, Brasser, G., Mok, J. Y., van Esch, W. J. E., Howie, H. L, Zimring, J. C., & Vidarsson, G. (2020). Cross-reactivity of mouse IgG subclasses to human Fc gamma receptors: Antibody deglycosylation only éliminâtes lgG2b binding. Molecular Immunology, 127, 79-86. https://doi.Org/10.1016/j.molimm.2020.08.015
Tillett, R. L., Sevinsky, J. R., Hartley, P. D., Kerwin, H., Crawford, N., Gorzalski, A., Laverdure, C., Verma, S. C., Rossetto, C. C., Jackson, D., Farrell, M. J., Van Hooser, S., St Pandori, M. (2021 ). Genomic evidence for reinfection with SARS-CoV-2: a case study. The Lancet. Infectious Diseases, 21(1 ), 52-58. https://doi.org/10.1016/S1473-3099(20)30764-7
Tisoncik, J. R., Korth, M. J., Simmons, C. P., Farrar, J., Martin, T. R., St Katze, M. G. (2012). Into the eye of the cytokine storm. Microbiology and Molecular Biology Reviews : MMBR, 76(1 ), 16-32. https://doi.org/10.1128/MMBR.05015-11
To, C. H., St Pétri, M. (2005). Is antibody clustering prédictive of clinical subsets and damage in systemic lupus erythematosus? Arthritis and Rheumatism, 52(12), 4003-4010. https://doi.org/10.1002/art.21414
Torres, D. de A., Ribeiro, L. do C. B., Riello, A. P. de F. L., Horovitz, D. D. G., Pinto, L. F. R., St Croda, J. (2020). Reinfection of COVID-19 after 3 months with a distinct and more aggressive clinical présentation: Case report. Journal of Medical Virology, jmv.26637. https://doi.org/10.1002/jmv.26637
Vafa, O., Gilliland, G. L., Brezski, R. J., Strake, B., Wilkinson, T., Lacy, E. R., Scallon, B., Teplyakov, A., Malia, T. J., St Strohl, W. R. (2014). An engineered Fc variant of an IgG éliminâtes ail immune effector functions via structural perturbations. Methods (San Diego, Calif.), 65(1 ), 114-126. https://doi.Org/10.1016/j.ymeth.2013.06.035
Verhoeyen, M., Milstein, C., St Winter, G. (1988). Reshaping human antibodies: grafting an antilysozyme activity. Science (New York, N. Y.), 239(4847), 1534-1536. https://doi.Org/10.1126/science.2451287
Verhoeyen, M., St Riechmann, L. (1988). Engineering of antibodies. BioEssays : News and Reviews in Molecular, Cellular and Developmental Biology, 8(2), 74-78. https://doi.org/10.1002/bies.950080207
Wang, X., Mathieu, M., St Brezski, R. J. (2018). IgG Fc engineering to modulate antibody effector functions. Protein St Cell, 9(1), 63-73. https://doi.org/10.1007/s13238-017- 0473-8
Zohar, T., Loos, C., Fischinger, S., Atyeo, C., Wang, C., Slein, M. D., Burke, J., Yu, J., Feldman, J., Hauser, B. M., Caradonna, T., Schmidt, A. G., Cai, Y., Streeck, H., Ryan, E. T., Barouch, D. H., Charles, R. C., Lauffenburger, D. A., St Alter, G. (2020). Compromised Humoral Functional Evolution Tracks with SARS-CoV-2 Mortality. Cell, 183(6), 1508-1519. e12. https://doi.Org/10.1016/j.cell.2020.10.052

Claims

REVENDICATIONS
1. Anticorps spécifique d’un antigène protéique capable de se lier aux acides nucléiques, ou fragment ou dérivé d’un tel anticorps se liant à l’antigène, pour son utilisation comme médicament, caractérisé en ce que l’anticorps, fragment ou dérivé possède une capacité réduite de liaison au récepteur FcyRIlA et/ou une capacité augmentée de liaison au récepteur FcyRIlB.
2. Anticorps spécifique d’un antigène protéique capable de se lier aux acides nucléiques, ou fragment ou dérivé d’un tel anticorps se liant à l’antigène, pour son utilisation selon la revendication 1 , dans le traitement ou la prévention de l’inflammation, caractérisé en ce que l’anticorps, fragment ou dérivé possède une capacité réduite de liaison au récepteur FcyRIlA et/ou une capacité augmentée de liaison au récepteur FcyRIlB.
3. Anticorps, fragment ou dérivé pour son utilisation selon la revendication 2, caractérisé en ce que l’inflammation est due à : a) une infection, avantageusement une infection virale, plus avantageusement choisie parmi la Covid-19, la grippe, le SIDA, l’hépatite B, l’hépatite E et la dengue ; ou b) une maladie inflammatoire ou autoimmune, avantageusement choisie parmi la polyarthrite rhumatoïde, la maladie de Kawasaki, le lupus érythémateux disséminé, la sclérose systémique et le syndrome de Sjogren primaire.
4. Anticorps pour son utilisation selon l’une quelconque des revendications 1 à 3, caractérisé en ce qu’il s’agit d’un anticorps entier d’isotype lgG4 ou d’isotype croisé lgG2- lgG4.
5. Anticorps, fragment ou dérivé pour son utilisation selon l’une quelconque des revendications 1 à 3, caractérisé en ce que l’anticorps, le fragment ou le dérivé possède une capacité réduite de liaison aux récepteurs FcyRIlA et FcyRIIIA, ou une capacité réduite de liaison à tous les FcyR.
6. Anticorps, fragment ou dérivé pour son utilisation selon la revendication 5, caractérisé en ce qu’il s’agit d’un fragment ou d’un dérivé sans domaine Fc, avantageusement choisi parmi les F(ab’)2, F(ab’), Fab, Fab’, Fv, VhH, V-NAR, ScFv, Bis- scFv, Fab2, Fab3, dianticorps (« diabodies »), trianticorps (« triabodies »), et tétraanticorps (« tetrabodies »).
7. Anticorps pour son utilisation selon la revendication 5, caractérisé en ce qu’il s’agit d’un anticorps entier d’isotype IgG qui possède une ou plusieurs mutation(s) dans le domaine Fc diminuant significativement sa liaison à FcyRIlA, à FcyRIlA et FcyRIIIA, ou à tous les FcyR.
8. Anticorps, fragment ou dérivé pour son utilisation selon la revendication 7, caractérisé en ce que l’anticorps est d’isotype lgG1 et son domaine Fc comprend une combinaison des 4 mutations E233P, F234V, L235A, et D265A.
9. Anticorps pour son utilisation selon la revendication 5, caractérisé en ce qu’il s’agit d’un anticorps entier d’isotype IgG qui n’est pas glycosylé dans le domaine Fc.
10. Anticorps pour son utilisation selon l’une quelconque des revendications 1 à 3, caractérisé en ce qu’il s’agit d’un anticorps entier d’isotype IgG qui possède une ou plusieurs mutation(s) dans le domaine Fc augmentant significativement sa liaison au récepteur inhibiteur FcyRIlb.
11. Anticorps, fragment ou dérivé pour son utilisation selon l’une quelconque des revendications 1 à 10, caractérisé en ce que l’antigène protéique capable de se lier aux acides nucléiques possède l’une des caractéristiques suivantes : a) il est capable de se lier aux acides nucléiques seul, sans être complexé à une autre molécule ; b) il est capable de se lier aux acides nucléiques sans spécificité pour une séquence nucléique donnée ; c) il est capable de se lier aux acides nucléiques plus efficacement à un pH compris entre 7,0 et 7,5 qu’à pH acide ; d) il comprend une ou plusieurs région(s) accessible(s) chargée(s) positivement ; e) il est également capable de se lier aux protéoglycanes à héparane sulfate membranaires, de préférence seul, sans être complexé à une autre molécule ; et f) toute combinaison des caractéristiques a) à e).
12. Anticorps, fragment ou dérivé pour son utilisation selon l’une quelconque des revendications 1 à 11 , caractérisé en ce que l’antigène protéique capable de se lier aux acides nucléiques est choisi parmi les protéines virales capables de se lier au génome viral.
13. Anticorps, fragment ou dérivé pour son utilisation selon la revendication 12, caractérisé en ce que les protéines virales capables de se lier au génome viral sont choisies parmi :
- les protéines de capsides virales, notamment celles du VIH-1 , du SARS-Cov2, du virus de la grippe, du VHB, du VHC, VHE, et du PVH, et - le transactivateur transcriptionnel (Tat) et la rétrotranscriptase (RT, p66/p51 ) du VI H - 1.
14. Anticorps, fragment ou dérivé pour son utilisation selon l’une quelconque des revendications 1 à 10, caractérisé en ce que l’antigène protéique capable de se lier aux acides nucléiques est choisi parmi les protéines du soi du sujet à traiter.
15. Anticorps, fragment ou dérivé pour son utilisation selon la revendication 14, caractérisé en ce que les protéines du soi du sujet à traiter sont choisies parmi les ribonucléoprotéines et les désoxyribonucléoprotéines du sujet à traiter, avantageusement la ribonucléoprotéine est choisie parmi les protéines RibP, snRNPs, Ro60, Ro52, et l’antigène de lupus La, et la désoxyribonucléoprotéine est une histone.
EP22710424.7A 2021-02-24 2022-02-24 Anticorps, fragments ou derives se liant specifiquement a un antigene proteique capable de se lier aux acides nucleiques et leurs utilisations Pending EP4297787A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR2101789 2021-02-24
PCT/FR2022/050338 WO2022180342A1 (fr) 2021-02-24 2022-02-24 Anticorps, fragments ou derives se liant specifiquement a un antigene proteique capable de se lier aux acides nucleiques et leurs utilisations

Publications (1)

Publication Number Publication Date
EP4297787A1 true EP4297787A1 (fr) 2024-01-03

Family

ID=75439032

Family Applications (1)

Application Number Title Priority Date Filing Date
EP22710424.7A Pending EP4297787A1 (fr) 2021-02-24 2022-02-24 Anticorps, fragments ou derives se liant specifiquement a un antigene proteique capable de se lier aux acides nucleiques et leurs utilisations

Country Status (3)

Country Link
US (1) US20240182550A1 (fr)
EP (1) EP4297787A1 (fr)
WO (1) WO2022180342A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024092031A1 (fr) 2022-10-25 2024-05-02 Seismic Therapeutic, Inc. Polypeptides fc d'igg variants et leurs utilisations

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20070148171A1 (en) * 2002-09-27 2007-06-28 Xencor, Inc. Optimized anti-CD30 antibodies
US20090017023A1 (en) * 2002-08-14 2009-01-15 Macrogenics, Inc. FcGammaRIIB Specific Antibodies and Methods of Use Thereof
US20090010920A1 (en) * 2003-03-03 2009-01-08 Xencor, Inc. Fc Variants Having Decreased Affinity for FcyRIIb
WO2005063815A2 (fr) * 2003-11-12 2005-07-14 Biogen Idec Ma Inc. Variants de polypeptides de liaison au recepteur fc$g(g) et procede apparentes
BRPI0517837A (pt) * 2004-11-12 2008-10-21 Xencor Inc variantes fc com ligação alterada a fcrn

Also Published As

Publication number Publication date
US20240182550A1 (en) 2024-06-06
WO2022180342A1 (fr) 2022-09-01

Similar Documents

Publication Publication Date Title
CN112142847B (zh) 改造的Fc片段,包含其的抗体及其应用
JP6817211B2 (ja) 抗cd3抗体、抗cd123抗体及びcd3及び/又はcd123に特異的に結合する二重特異性抗体
US11649293B2 (en) Method for enhancing humoral immune response
JP6904616B2 (ja) 緑内障治療のための配列相同性を有するファミリー、メンバーa5抗体の用途
JP7034499B2 (ja) 線維症の治療のための抗fam19a5抗体の用途
JP7730162B2 (ja) 配列類似性19、メンバーa5抗体を有する抗ファミリー及びその使用方法
KR20160107304A (ko) 이중특이적 cd3 및 cd19 항원 결합 작제물
AU2016210889A1 (en) Anti-transthyretin antibodies
US20240190960A1 (en) Antigen-binding molecule and combination
DK2463368T3 (en) HUMANIZED ANTI-AMYLOID-BETA OLIGOMER ANTIBODY
KR20190117009A (ko) 항 인간 아넥신 a1 항체
JP2019530428A (ja) 抗トランスサイレチン抗体
JP6731933B2 (ja) Pcsk9抗体、及び医薬組成物とその使用
FR3075200A1 (fr) Variants avec fragment fc ayant une affinite augmentee pour fcrn et une affinite augmentee pour au moins un recepteur du fragment fc
US20230416394A1 (en) Novel conjugate molecules targeting cd39 and tgfbeta
JP7777632B2 (ja) 抗pd-1抗体
JP2025124689A (ja) 抗配列類似性19を持つファミリー、メンバーa5抗体及びその使用方法
CA2913318A1 (fr) Molecules de liaison qui se lient au facteur c2 du complement humain et utilisations de celui-ci
CN112074292A (zh) 治疗性抗sPLA2-GIB抗体及其用途
US20240228637A9 (en) Chemokine receptor 8 (ccr8) antibodies
US20220162305A1 (en) Antibodies having specificity for btn2 and uses thereof
WO2022180342A1 (fr) Anticorps, fragments ou derives se liant specifiquement a un antigene proteique capable de se lier aux acides nucleiques et leurs utilisations
WO2022116079A1 (fr) Anticorps anti-ceacam5 humanisé et son procédé de préparation et son utilisation
CN119013301A (zh) 与epcam和/或cd137结合的结合剂
JP7862462B2 (ja) 抗原結合分子および組合せ

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: UNKNOWN

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20230824

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
RAP3 Party data changed (applicant data changed or rights of an application transferred)

Owner name: COMMISSARIAT A L'ENERGIE ATOMIQUE ET AUX ENERGIESALTERNATIVES