Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
  • A61K39/42—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum viral
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/12—Antivirals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P37/00—Drugs for immunological or allergic disorders
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
  • C07K16/08—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from viruses
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K39/00—Medicinal preparations containing antigens or antibodies
  • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
  • A61K2039/572—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
  • C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
  • C07K2317/71—Decreased effector function due to an Fc-modification
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2317/00—Immunoglobulins specific features
  • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
  • C07K2317/72—Increased effector function due to an Fc-modification
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
  • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
  • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

• the present invention lies in the field of drug therapies aimed at solving inflammatory disorders induced by immune complexes. It relates to an antibody specific for a protein antigen capable of binding to nucleic acids, or a fragment or a derivative of such an antibody binding to the antigen, for its use as a medicament, in particular in the treatment or prevention inflammation, in particular that due to an infection or to an autoimmune disease, characterized in that the antibody, fragment or derivative has a reduced capacity for binding to the Fc ⁇ RIlA receptor and/or an increased capacity for binding to the Fc ⁇ RIlB receptor.
• the antibody, fragment or derivative is preferably without an Fc domain, or with a modified Fc domain with a reduced capacity for binding to Fc ⁇ RIlA and optionally Fc ⁇ RIIIA (even with a reduced capacity for binding to all the Fc ⁇ Rs), and/or with a modified Fc domain with increased ability to bind to FcyRIlB.
• Chronic inflammatory reactions can also be triggered during autoimmune disorders and prove to be disabling for the patient. These reactions can be caused in particular by the presence of antibodies specific to self-antigens (Ags) (Sospedra & Martin, 2016). In this case, the presence of IC resulting from the association of self antigens with antibodies (Ab) could be responsible for the inflammation.
• Ags self-antigens
• Abs antibodies
• ICs could induce inflammation responsible for pathological effects both in certain infections by microorganisms and in certain inflammatory and/or autoimmune diseases (Kapingidza et al., 2020).
• the establishment of therapeutic approaches to counter these inflammatory effects is therefore a crucial issue for improving the clinical condition of patients.
• IVIG immunoglobulins intravenously
• FcyRIIb Fc gamma Mb receptor
• FcyRIIb FcyRIIb will therefore transmit an inhibition signal and thereby block the inflammatory reaction mediated by CIs (Ben Mkaddem et al., 2019).
• This relatively effective approach tends to abrogate the activity of all of the body's FcyRIIbs. The treatment could therefore disrupt other physiological processes in which the FcyRIIbs would be involved in order to maintain homeostasis. This type of treatment could therefore be less well tolerated by the patient.
• Another anti-inflammatory approach consists in using antibodies capable of blocking activating Fc gamma receptors, such as FcyRIlA and FcyRIIIA, in order to limit the inflammatory process mediated by CIs (Ben Mkaddem et al., 2019).
• FcyRIlA and FcyRIIIA FcyRIlA and FcyRIIIA
• This approach will lead to the blocking of all FcyRIlA and FcyRIIIA in the body and could therefore disrupt other physiological processes in which these receptors would be involved in order to maintain homeostasis.
• This type of treatment like the approaches described above, may be less well tolerated by the patient.
• protein antigens with the ability to bind nucleic acids There are many proteins from microorganisms or humans that have the ability to bind nucleic acids (hereinafter “protein antigens with the ability to bind nucleic acids” or “Ag nUc” ). Moreover, it has been shown that antibody responses are generated against such proteins, in particular against viral nucleocapsid proteins and human ribonucleoproteins (Hoffman & Greidinger, 2000; Leung et al., 2004; Migliorini et al., 2005).
• IC nUc an Ag nUc
• nUc ICs in particular those of the nucleocapsid protein of the SARS-Cov2 virus
• nUc ICs can trigger inflammatory responses. They then observed that nUc ICs only formed with fragments of Ab lacking the ability to bind Fcys receptors are unable to mediate inflammation and can even inhibit inflammation induced by nUc ICs. or derivatives specific for a nUc Ag and unable to bind to Fcys receptors can be used to reduce the inflammation associated with nuc ICs
• the present invention therefore relates to an antibody specific for a protein antigen capable of binding to nucleic acids, or a fragment or a derivative of such an antibody binding to the antigen, for its use as a medicament, characterized in that the antibody, fragment or derivative has a reduced ability to bind to the FcyRIlA receptor and/or an increased ability to bind to the FcyRIlB receptor.
• the invention further relates to an antibody specific for a protein antigen capable of binding to nucleic acids, or a fragment or a derivative of such an antibody binding to the antigen, for its use in the treatment or prevention of inflammation, characterized in that the antibody, fragment or derivative has a reduced capacity for binding to the Fc ⁇ RIlA receptor and/or an increased capacity for binding to the Fc ⁇ RIlB receptor.
• Fig. 1A Determination of the B epitopes recognized by the Ac aTat12S and aTat7S.
• the Tat1-37 peptide was adsorbed onto microtiter plates and the binding of the two Abs aTat12S and aTat7S to Tat1-37-b was evaluated by enzyme immunoassay.
• Fig. 1 B Determination of the B epitopes recognized by the Ac aTat12S and aTat7S.
• the Tat37-57-b peptide was adsorbed on microtitration plates and the binding of the two Abs aTat12S and aTat7S to Tat37-57-b was evaluated by immunoenzymatic assay.
• Fig. 2 Evaluation of the capacity of ICs Tat/aTat12S and Tat/aTat7S to induce the inflammatory response of human PBMCs.
• Human PBMCs were incubated in vitro with 100nM free Tat, 100nM free aTat12S, 100nM free aTat7S, Tat/aTat12S (100 mM each) and Tat/aTat7S (100 mM each), respectively. After 18 hours of incubation, the supernatants were removed and the presence of IL-6 was evaluated by immunoenzymatic assay.
• Fig. 3 Evaluation of the capacity of ICs Ncp/aNcp2 and Ncp/aNcp15 to induce the inflammatory response of human PBMCs.
• Human PBMCs were incubated in vitro with 30nM free Ncp, 30nM free aNcp2, 30nM free aNcp15, Ncp/aNcp2 (30nM each) and Ncp/aNcp15 (30nM each), respectively. After 18 hours of incubation, the supernatants were removed and the presence of IL-6 was evaluated by immunoenzymatic assay.
• Fig. 4 The Fab-aNcp15 and hcaNcp15Fcmute have the ability to bind the Ncp protein.
• the hcaNcp15 chimeric antibody was adsorbed onto microtiter plates. A fixed concentration of N-biotinylated protein (178 pM) was incubated in the wells of the plate in the presence or absence of series of dilutions of hcaNcp15 or of Fab-Ncp15 or of hcaNcp15Fcmute. After an overnight incubation at 4°C, the plate was washed, streptavidin coupled to peroxidase was added. After 30 minutes, washes were performed and a colorimetric substrate (ABTS) was added to measure the presence of Ncp-biotinylated.
• ABTS colorimetric substrate
• Fig. 5 The ability of Ncp/aNcp ICs to induce the inflammatory response of human PBMCs is altered when the Ab included in the complex lacks the Fc region.
• Human PBMCs were incubated in vitro with Ncp (30nM), Fab-aNcp15 (333nM), Ncp/hcaNcp15 (30nM for each protein) and Ncp/Fab-aNcp15 (30nM for Ncp, 333 nM for Fab)) respectively. After 18 hours of incubation, the supernatants were removed and the presence of IL-6 was evaluated by immunoenzymatic assay.
• Fig. 6 The ability of Ncp/aNcp ICs to induce the inflammatory response of human CMSPs is altered when the Ac included in the complex is mutated in its Fc region so as to no longer be able to bind Fcys receptors.
• Human PBMCs were incubated in vitro with Ncp (30nM), hcaNcp15Fcmute (30nM), Ncp/hcaNcp15 (30nM for each protein) and Ncp/hcaNcp15Fcmute (30nM for each protein) respectively. After 18 hours of incubation, the supernatants were removed and the presence of IL-6 was evaluated by immunoenzymatic assay.
• Fig. 7 The ability of an aNcp to induce the inflammatory response of human PBMCs is altered by an Ac derivative lacking the Fc region.
• Human PBMCs were incubated in vitro with Ncp (30nM), Ncp/hcaNcp15 (30nM for each protein), Ncp/Fab-aNcp15 (30nM for Ncp, 333nM for Fab), Ncp/hcaNcp15/Fab-aNcp15 (30nM for the first two proteins, 333nM for the Fab), respectively. After 18 hours of incubation, the supernatants were removed and the presence of IL-6 was evaluated by immunoenzymatic assay.
• Fig. 8 The ability of an aNcp to induce the inflammatory response of human PBMCs in the presence of Ncp is altered by an Ac derivative mutated in its ability to bind RFcys.
• Human PBMCs were incubated in vitro with Ncp (10nM), Ncp/hcaNcp15 (1 OnM for Ncp, 10nM for Ac), Ncp/hcaNcp15Fcmute (1 OnM for Ncp, 30nM for Ac), Ncp/hcaNcp15/ hcaNcp15Fcmute (10nM for Ncp, 10nM for hcaNcp15, 30nM for hcaNcp15Fcmute), respectively. After 18 hours of incubation, the supernatants were removed and the presence of IL-6 was evaluated by immunoenzymatic assay.
• the invention relates to an antibody specific for a protein antigen capable of binding to nucleic acids, or a fragment or a derivative of such an antibody binding to the antigen, for its use as a medicament, characterized in that the antibody, fragment or derivative has a reduced ability to bind to the FcyRIlA receptor and/or an increased ability to bind to the FcyRIlB receptor.
• It also relates to an antibody specific for a protein antigen capable of binding to nucleic acids, or a fragment or a derivative of such an antibody binding to the antigen, for its use in the treatment or prevention of inflammation , characterized in that the antibody, fragment or derivative has a reduced ability to Fc ⁇ RIlA receptor binding and/or increased Fc ⁇ RIlB receptor binding capacity.
• an antibody specific for a protein antigen capable of binding to nucleic acids, or of a fragment or derivative of such an antibody binding to the antigen, for the preparation of a medicinal product intended for the treatment or prevention of inflammation characterized in that the antibody, fragment or derivative has a reduced capacity for binding to the Fc ⁇ RIlA receptor and/or an increased capacity for binding to the Fc ⁇ RIlB receptor.
• an antibody specific for a protein antigen capable of binding nucleic acids, or a fragment or derivative of such an antibody binding to the antigen for the treatment or the prevention of inflammation, characterized in that the antibody, fragment or derivative has a reduced ability to bind to the FcyRIlA receptor and/or an increased ability to bind to the FcyRIlB receptor.
• composition comprising an antibody specific for a protein antigen capable of binding to nucleic acids, or a fragment or a derivative of such an antibody binding to the antigen, for its use in the treatment or prevention of inflammation, characterized in that the antibody, fragment or derivative has a reduced ability to bind to the Fc ⁇ RIlA receptor and/or an increased capacity to bind to the Fc ⁇ RIlB receptor.
• the present invention is based on the therapeutic use of an antibody specific for a protein antigen capable of binding to nucleic acids.
• antibody or “Ac” or “immunoglobulin” is meant a molecule comprising at least one domain for binding to a given antigen and a constant domain comprising an Fc fragment capable of binding to FcR receptors.
• an antibody is composed of 4 polypeptide chains: 2 heavy chains and 2 light chains linked together by a variable number of disulphide bridges providing flexibility to the molecule.
• Each light chain consists of a constant domain (CL) and a variable domain (VL); the heavy chains being composed of a variable domain (VH) and 3 or 4 constant domains (CH1 to CH3 or CH1 to CH4) depending on the isotype of the antibody.
• antibodies consist of only two heavy chains, each heavy chain comprising a variable domain (called VhH in camelids and V-NAR in sharks) and a constant region (Holliger & Hudson, 2005).
• Variable domains are involved in antigen recognition, while constant domains are involved in the biological, pharmacokinetic and effector properties of the antibody.
• variable region differs from one antibody to another.
• the genes coding for the heavy and light chains of the antibodies are generated by recombination of respectively three and two distinct gene segments called VH, DH and JH-CH for the heavy chain and VL and JL-CL for the light chain.
• the CH and CL segments do not participate in recombination and form the heavy and light chain constant regions respectively.
• Recombinations of the VH-DH-JH and VL-JL segments form the heavy and light chain variable regions respectively.
• the VH and VL regions each have 3 hypervariable zones or complementarity determining regions (CDRs), called CDR1, CDR2 and CDR3, the CDR3 region being the most variable, since it is located at the level of the recombination zone.
• CDRs complementarity determining regions
• CDR regions are found in the part of the antibody that will be in contact with the antigen and are therefore very important for the recognition of the antigen.
• antibodies retaining the three CDR regions of each of the heavy and light chains of an antibody retain the vast majority of the antigenic specificity of the original antibody.
• an antibody retaining only one of the CDRs, and in particular CDR3 also retains the specificity of the original antibody.
• the CDR1, CDR2 and CDR3 regions are each preceded by the FR1, FR2 and FR3 regions respectively, corresponding to the framework regions (framework region, FR) which vary the least from one VH or VL segment to another.
• the CDR3 region is also followed by an FR4 framework region.
• An antibody, fragment, or derivative that "binds" an antigen of interest is an antibody, fragment, or derivative that binds the antigen with sufficient affinity for the antibody to be useful as a diagnostic and/or therapeutic agent for target the antigen in circulating form or expressed by a cell or tissue, and does not react significantly with other antigens.
• the extent of binding of the antibody, fragment or derivative to a "non-target" antigen will be less than approximately 10% of the binding of the antibody to its target antigen, as determined by fluorescence activated cell sorting analysis (FACS) or radioimmunoprecipitation (RIPA).
• the expressions "specific binding” or “specifically binds to” or is “specific for” a particular antigen or an epitope of a particular antigen means a binding that is measurably different from a non-specific interaction.
• Specific binding can be measured, for example, by measuring antigen binding against binding to a control antigen, which is generally a structurally similar antigen that has no binding activity.
• specific binding can be determined by competition with a control antigen which is similar to the target, for example by measuring binding to the labeled target antigen in the presence or absence of an excess of unlabeled target antigen.
• the binding is considered specific if the binding of the labeled target is competitively inhibited by an excess of unlabeled target.
• there is “specific binding” or that the antibody, fragment or derivative "specifically binds to” or is “specific for” a particular antigen or an epitope on an antigen for example, if the antibody, fragment or derivative has a KD for the target of at most about 10 6 M, alternatively at most about 10 7 M, alternatively at most about 10 8 M, alternatively at most about 10 9 M, alternatively at most plus about 10 1 ° M, alternatively at most about 10 11 M, alternatively at most about 10 12 M, or even less.
• the term "specific binding” refers to binding in which the antibody, fragment or derivative binds to a particular antigen or epitope on an antigen without substantially binding to another antigen or epitope.
• an antibody, fragment, or derivative that binds nucAg has a dissociation constant (KD) of less than or equal to 1 mM, ⁇ 100 nM, ⁇ 10 nM, ⁇ 1 nM, or ⁇ 0.1 nM.
• KD means a dissociation constant of a specific antibody-antigen interaction and is used as an indicator to measure the affinity of an antibody for an antigen.
• a lower KD signifies a higher affinity of an antibody for an antigen.
• constant domains are characterized by an amino acid sequence very close from one antibody to another, characteristic of the species and the isotype, possibly with some somatic mutations.
• the Fc fragment is naturally composed of the constant region of the heavy chain excluding the CH1 domain, i.e. the lower hinge region and the constant domains CH2 and CH3 or CH2 to CH4 (depending on the isotype ).
• the complete Fc fragment is composed of the C-terminal part of the heavy chain from the cysteine residue at position 226 (C226), the numbering of the amino acid residues in the Fc fragment being throughout the present description that of the EU index described in the publications Edelman et al-1969 and Kabat et al-1991 (Edelman et al., 1969; Kabat E.A., Wu T.T., Perry H.M. Foeller C., 1991).
• the corresponding Fc fragments of other types of immunoglobulins can easily be identified by those skilled in the art by sequence alignments.
• the Fc fragment of the IgG is glycosylated at the level of the CH2 domain with the presence, on each of the 2 heavy chains, of an N-glycan linked to the asparagine residue at position 297 (Asn 297).
• binding domains located in the Fc, are important for the biological properties of the antibody:
• complement-dependent cytotoxicity located in the CH2 domain;
• Antibodies can be of several isotypes, depending on the nature of their constant region: the constant regions g, a, m, e and d correspond respectively to the immunoglobulins IgG, IgA, IgM, IgE and IgD.
• the monoclonal antibody present in a composition used as medicament in the context of the invention is of IgG isotype.
• the antibody can be monoclonal or polyclonal.
• the antibody is monoclonal.
• monoclonal antibody or “monoclonal antibody composition” is meant a composition comprising antibody molecules having an identical and unique antigenic specificity.
• the antibody molecules present in the composition are likely to vary at the level of their post-translational modifications, and in particular at the level of their glycosylation structures or their isoelectric point, but have all been encoded by the same sequences of heavy chains and slight and therefore have, before any post-translational modification, the same protein sequence.
• the antibody is polyclonal.
• polyclonal antibody is meant a mixture of antibodies recognizing different epitopes on a given antigen. It may be a polyclonal antibody purified from the serum of a subject immunized with the antigen of interest (we will then speak of “natural polyclonal”, whether the immunization is natural or induced by humans) or a mixture of at least 2 (for example 2, 3, 4, or 5) monoclonal antibodies recognizing different epitopes on a given antigen (we will then speak of “synthetic polyclonal”).
• a natural polyclonal or synthetic polyclonal antibody can be used, with a preference for a synthetic polyclonal antibody.
• the antibody, functional fragment or derivative thereof according to the invention is advantageously a chimeric or humanized antibody, in particular a chimeric antibody whose constant region of the heavy and light chains is of human.
• chimeric antibody an antibody which contains a natural variable region (light chain and heavy chain) derived from an antibody of a given species in association with the light chain and heavy chain constant regions of an antibody of a species heterologous to said given species.
• the monoclonal antibody composition for its use as medicament according to the invention comprises a chimeric monoclonal antibody, the latter comprises human constant regions.
• a chimeric antibody can be prepared using genetic recombination techniques well known to those skilled in the art.
• the chimeric antibody could be produced by cloning for the heavy chain and the light chain a recombinant DNA comprising a promoter and a sequence coding for the variable region of the non-human antibody, and a sequence coding for the constant region d a human antibody.
• a recombinant DNA comprising a promoter and a sequence coding for the variable region of the non-human antibody, and a sequence coding for the constant region d a human antibody.
• humanized antibody is meant an antibody which contains CDR regions derived from an antibody of non-human origin, the other parts of the antibody molecule being derived from one (or more) human antibodies.
• some of the backbone segment residues (designated FR) can be modified to retain binding affinity (Jones et al., 1986; Riechmann et al., 1988; Verhoeyen et al., 1988).
• the humanized antibodies according to the invention can be prepared by techniques known to those skilled in the art such as “CDR grafting”, “resurfacing”, SuperHumanization, “Human string content”, “FR libra ries”, “Guided selection”, “FR shuffling” and “Humaneering”, as summarized in the review by Almagro et al. (Almagro & Fransson, 2008).
• whole antibody immunoglobulin binding
• immunoglobulin binding immunoglobulin binding
• full length antibody immunoglobulin binding
• the constant domains may be native sequence constant domains (eg, human native sequence constant domains) or amino acid sequence variants thereof.
• fragment of an antibody binding to the antigen is meant an antibody fragment retaining the antigen-binding domain and therefore having the same antigenic specificity as the original antibody.
• fragments include F(ab')2, Fab, Fab', ScFv, Fv, VhH, and V-NAR fragments. The structures of these fragments and the methods for obtaining them are known to those skilled in the art (Holliger & Hudson, 2005).
• derivative of an antibody binding to the antigen is meant a complex comprising several fragments of an antibody arranged in a non-natural form.
• fragments include derivatives ScFv, Bis-scFv, scFv-Fc, Fab2, Fab3, miniantibody (or “minibody”), diantibody ("diabodies”), triantibody (“triabodies”), tetraantibody (“tetrabodies”) ).
• miniantibody or "minibody”
• diantibody diabodies
• triantibody triantibody
• tetraantibody tetrabodies
• antibodies form “immune complexes” (or “ICs"), i.e. antigen-antibody aggregates comprising several antibodies linked to the surface of one or more antigen molecules.
• ICs immune complexes
• the antibody, fragment or derivative used in the invention has a reduced capacity for binding to the Fc ⁇ RIlA receptor and/or an increased capacity for binding to the Fc ⁇ RIlB receptor.
• Antibodies are bifunctional molecules. They interact with the various Fcy domain receptors (FcyRs) via their Fc domain and bind antigens via their two Fab domains.
• FcyRs Fcy domain receptors
• the ICs formed allow better uptake of antigens by immune cells expressing FcyRs on their surface.
• FcyRs are classified into two functional groups, activating (FcyRI, FcyRIlA, FcyRIIC, FcyRIIIA) and inhibitory (FcyRIlB) FcyRs.
• FcyRI is a high affinity receptor capable of binding antibodies in monomeric form
• FcyRIiA, FcyRIIC, and FcyRIIIA are low affinity receptors that mainly bind ICs.
• the inhibitory receptor FcyRIlB is also a low affinity receptor, binding mainly ICs.
• an antibody, fragment or derivative having a reduced ability to bind to the FcyRIIA receptor is used.
• the antibody, fragment or derivative may further possess a reduced ability to bind to the FcyRIl IA receptor. It may also possess a reduced ability to bind to all FcyRs.
• reduced binding capacity to one or more FcyRs, it is meant that the binding of the antibody, of the fragment or of the derivative to the FcyR is weaker than that of an antibody with the same variable regions, but whose constant regions are natural (native antibody), advantageously the FcyR binding capacity is lower by a factor of at least 2, at least 5, at least 10, or sometimes even at least 25, at least 50, at least 75, or even at least 100, to that of the native antibody.
• a fragment or a derivative without an Fc domain can advantageously be used. Indeed, the absence of the Fc domain prevents any binding to FcyRs, and therefore in particular to FcyRIIA, and to FcyRIIIA.
• the fragments without an Fc domain include in particular the F(ab′)2, Fab, Fab′, Fv, VhH, and V-NAR fragments.
• Derivatives without an Fc domain include in particular derivatives of the ScFv, Bis-scFv, Fab2, Fab3, diantibody (“diabodies”), trantibody (“triabodies”), tetraantibodies (“tetrabodies”) type.
• a fragment or a derivative without an Fc domain advantageously chosen from F(ab')2, F(ab'), Fab, Fab', Fv, VhH, V-NAR, ScFv, Bis-scFv, Fab2, Fab3, diantibodies (“diabodies”), triantibodies (“triabodies”), and tetraantibodies (“tetrabodies”), are used.
• the CH2 domain of IgG isotype antibodies is known to comprise the Fc ⁇ R binding domain. Therefore, it is also possible to use a fragment or derivative that has part of the Fc domain, but does not include the CH2 domain, such as miniantibodies (or "minibody").
• a first modification strategy of the Fc domain making it possible to reduce or abolish the binding to the FcyRs of interest consists in inserting one or more mutations in the Fc domain. Indeed, many mutations or combinations of mutations in the Fcy domain are known to reduce or abolish binding to some or all of the FcyRs.
• L235E and L234A/L235A mutations and combinations of mutations reduce effector functions.
• V234A/G237A/P238S/H268A/V309L/A330S/P331S which reduce binding to FcyRs;
• the antibody used in the invention is of the IgG1 isotype and its Fc domain comprises a combination of the 4 mutations E233P, F234V, L235A, and D265A.
• a second strategy for modifying the Fc domain making it possible to reduce or abolish the binding to the FcyRs consists in altering the glycosylation of the Fc domain according to embodiments known to those skilled in the art (Strohl & Strohl, 2012). This alteration can be achieved using cells with variable post-translational capacities, by deletion of the glycosylation site, or by enzymatic deglycosylation of the antibody.
• the glycosylation site of the Fc domain can in particular be deleted by replacing the asparagine residue to which N-glycans are linked by another amino acid (for example, for an lgG1, by a mutation N297A, N297Q or N297G (elimination of the interaction with Fc ⁇ RIlA and Fc ⁇ RIIIA, reduced interaction with Fc ⁇ RI), see (Wang et al., 2018).
• non-glycosylated antibody it is also possible to produce the antibody in a host without an N-glycosylation system, such as for example bacteria, which naturally lack an N-glycosylation system, or in any other host which is normally provided with an N-glycosylation system but which has been modified to no longer N-glycosylate proteins, for example yeasts, plants, insect cells or mammalian cells.
• an N-glycosylation system such as for example bacteria, which naturally lack an N-glycosylation system, or in any other host which is normally provided with an N-glycosylation system but which has been modified to no longer N-glycosylate proteins, for example yeasts, plants, insect cells or mammalian cells.
• non-glycosylated antibody it is also possible to deglycosylate the antibody a) enzymatically, for example using PNGase F (Peptide-N4-(acetyl-B-glucosaminyl)-asparagine amidase, EC 3.5.1.52) , an endoglycosidase such as Gendo-alpha-N-acetyl-galactosaminidase, endoglycosidase F1, endoglycosidase F2, endoglycosidase F3, or endoglycosidase H, or b) chemically.
• PNGase F Peptide-N4-(acetyl-B-glucosaminyl)-asparagine amidase, EC 3.5.1.52
• an endoglycosidase such as Gendo-alpha-N-acetyl-galactosaminidase
• the modification strategies 1 and 2 presented above can potentially be combined (mutation(s) in the Fc reducing the binding to the FcyRs of interest and absence of glycosylation).
• the glycosylation is not suppressed, one will avoid producing the whole antibody or the derivative with an Fc domain under conditions resulting in glycosylation known to increase the capacity of binding to the FcyRs of interest (one will in particular avoid to produce an antibody or derivative whose Fc domain is glycosylated with low fucosylation, this strongly increasing the binding to FCYRIIIA).
• an antibody, fragment or derivative possessing an increased capacity for binding to the FCYRIIB receptor is used.
• increased binding capacity to the FCYRIIB receptor it is meant that the binding of the antibody, of the fragment or of the derivative to the FCYRIIB receptor is stronger than that of an antibody with the same variable regions, but whose constant regions are natural (native antibody), advantageously the binding capacity to the FCYRIIB receptor is greater by a factor of at least 2, at least 5, at least 10, or sometimes even at least 25, at least 50, at least 75, or even at least 100, to that of the native antibody.
• FcyRIIB receptor The appropriate modifications of the Fc domain making it possible to increase the binding capacity to the FcyRIIB receptor include in particular the combinations of mutations S267E/L328F (or "SELF", but maintenance of a high affinity for FcyRIlA-R), N325S/L328F (reduction concomitant of the interaction with FcyRIIIA) and
• the antibody, fragment or derivative used in the invention specifically recognizes a protein antigen capable of binding to nucleic acids (“Ag nUc” ).
• the protein antigen specifically recognized by the antibody, fragment or derivative used in the invention has one of the following characteristics: a) it is capable of binding to nucleic acids alone, that is to say without being complexed with another molecule (another protein in particular); b) it is capable of binding to nucleic acids without specificity for a given nucleic sequence; c) it is able to bind nucleic acids more efficiently at a pH between 7.0 and 7.5 than at acidic pH (below 7.0); d) it comprises one or more positively charged accessible region(s).
• the nUc Ag preferably comprises one or more positively charged surface region(s); in the case of proteins/peptides naturally in an unfolded form, the nUc Ag preferably comprises one or more region(s) in the primary sequence containing positively charged amino acids; e) it is also capable of binding to heparan sulphate membrane proteoglycans, preferably alone, without being complexed with another molecule (another protein in particular); and f) any combination of features a) to e).
• the protein antigen specifically recognized by the antibody, fragment or derivative used in the invention may possess one of the following combinations of characteristics: i. the combination of features a) and d); ii. the combination of features a) and e); iii. the combination of features b) and d); iv. the combination of features b) and e); v. the combination of features d) and e); vi. the combination of features a), b) and d); vii. the combination of features a), d) and e); viii. the combination of features b), d) and e); ix. the combination of features a), b), d) and e); x. the combination of features b) to e); or xi. the combination of features a) to e)
• This second binding would reinforce the activating effect of the binding between the Fc domains of the antibodies and the Fcy receptors.
• nucleic acid recognition is also generally obtained without specificity for a given nucleic sequence (feature b)), and a combination of features b) and d) is therefore also of particular interest.
• nucleic acid recognition is also generally obtained without it being complexed to another molecule (feature a)), and a combination of features a) and d) is therefore also particularly of interest.
• Three or four of features a), b), d) and e) will also be present in many nUc Ags, and a combination of features a), b), and d), a combination of features a), d) and e), a combination of features b), d) and e), or a combination of a), b), d) and e) are also combinations of interest.
• nUc Ags are in particular described in various publicly accessible databases, in particular those described in Table 1 below:
• the nUc Ag that the antibody, fragment or derivative used in the invention specifically recognizes is chosen from the proteins of infectious microorganisms capable of binding to nucleic acids. This type of antibody is used when the inflammation is due to infection by a microorganism.
• the infectious microorganism protein capable of binding nucleic acids is preferably internal to the infectious microorganism, in other words it is not on the surface of the infectious microorganism. It is additionally or alternatively preferably capable of binding to nucleic acids in native form, before any cleavage inducing a conformational change.
• the nUc Ag that the antibody, fragment or derivative used in the invention specifically recognizes is advantageously chosen from viral proteins capable of binding to the viral genome.
• the nUc Ag as the antibody, fragment or derivative used in the invention specifically recognizes is chosen from the internal proteins of the virus, excluding the viral proteins located on the surface of the virus.
• Preferred viral nUCAgs generally include viral capsid proteins, but also other viral proteins such as transcriptional transactivator (Tat) and reverse transcriptase (RT, p66/p51) of human immunodeficiency virus 1 (HIV -1 ).
• capsid is meant the shell that surrounds the viral genome.
• the protein capable of packaging the viral genome to form the capsid is called “capsid protein” or “nucleocapsid protein”.
• capsid protein The protein capable of packaging the viral genome to form the capsid
• nucleocapsid protein designates in principle the viral genome surrounded by the capsid, but is sometimes also used to designate the capsid.
• Other proteins may associate with the capsid, such as matrix proteins, or the envelope around the capsid of enveloped viruses, but are not considered capsid proteins.
• the capsid protein of HIV-1 also called p24 (amino acid sequence corresponding to Genbank accession number NP_057850.1 (residues 133-363 ), Genbank version 241 of December 15, 2020); the capsid protein of severe acute respiratory syndrome coronavirus 2 virus (“SARS-Cov-2”, causative of Covid-19, amino acid sequence corresponding to Genbank accession no. YP_009724397.2, version 241 of Genbank of December 15, 2020), influenza virus capsid protein (amino acid sequence corresponding to Genbank accession no.
• SARS-Cov-2 severe acute respiratory syndrome coronavirus 2 virus
• AAA43798.1 Genbank version 241 of December 15, 2020
• hepatitis B virus capsid protein HBV, amino acid sequence corresponding to Genbank accession no. AXM44956.1, Genbank version 241 of December 15, 2020
• hepatitis E virus capsid protein HEV, amino acid sequence corresponding to Genbank accession no. P03314.1 (residues 1 to 101), Genbank version 241 of December 15, 2020
• human papillomavirus capsid protein HVP, amino acid sequence corresponds to Genbank accession no. AQZ41126.1, Genbank version 241 of December 15, 2020
• dengue virus capsid protein amino acid sequence corresponding to Genbank accession no. AAW51422.1 (residues 5-114), Genbank version 241 dated December 15, 2020).
• these proteins are known to generate an antibody response in patients infected with these viruses and, in some cases, the presence of immune complexes (IC) formed of these antigens and antibodies specifically recognizing them is also known to be associated with pathogenesis (Cafaro et al., 2019; Carter et al., 2000; Fenouillet et al., 1993; Hashida et al., 1997; Hu, 2002; Kamar et al., 2017; Ni et al., 2020; Rumbaugh et al., 2013).
• IC immune complexes
• the ICs of the intracellular protein of Yersinia enterocolitica 0.3 are also associated with certain chronic arthritis, and antibodies, fragments or specific derivatives of this protein can therefore also be used.
• Monoclonal antibodies specifically recognizing the HIV-1 transcriptional transactivator (Tat) have been described in vaccine strategies (Cafaro et al., 2019) and are available on the market, such as:
• Monoclonal antibodies specifically recognizing HIV-1 reverse transcriptase are available on the market, such as: “anti-HIV1 - RT antibody, mouse monoclonal antibody, ref. : ABIN933463, marketed by Antibodies-online.
• Monoclonal antibodies specifically recognizing the nucleocapsid of HIV-1 (p24) are available on the market, such as:
• Anti-HIV1 p24 antibody [39/5.4A] mouse monoclonal antibody, ref: ab9071, marketed by the company Abcam.
• Monoclonal antibodies specifically recognizing the nucleocapsid of the SARS-Cov2 virus are available on the market, such as:
• Nucleocapsid Antibody mouse monoclonal antibody, ref. : MAB104741, marketed by R&D SYSTEMS.
• SARS-CoV-2 Nucleocapsid Antibody (bcn11)
• humanized antibody ref: MA5-35953, marketed by Thermo Fisher Scientific.
• Monoclonal antibodies specifically recognizing the nucleocapsid of the influenza virus are available on the market, such as: "Recombinant Mouse Anti-Influenza A virus Nucleocapsid protein Antibody (CBI49YJ)", mouse monoclonal antibody, ref. : HPAB-0295-YJ marketed by Creative Biolabs.
• Monoclonal antibodies specifically recognizing the nucleocapsid of HBV are marketed, such as for example: “Recombinant Hepatitis B Core Antigen (rHBcAg)”, mouse monoclonal antibody, ref. : bsm-2000M, marketed by BiossAntibodies.
• rHBcAg Recombinant Hepatitis B Core Antigen
• bsm-2000M mouse monoclonal antibody
• Monoclonal antibodies specifically recognizing the HEV nucleocapsid are marketed, for example: “HEV/Hepatitis E Virus Monoclonal Antibody”, mouse monoclonal antibody, ref. : LS-C67675, marketed by LifeSpan Biosciences.
• Monoclonal antibodies specifically recognizing the nucleocapsid of HPV such as for example: “Human Papilloma Virus L1 Antibody”, mouse monoclonal antibody, ref. : MBS320499, marketed by MyBioSource.com (Specific for the major structural protein of the L1 capsid).
• Monoclonal antibodies specifically recognizing the intracellular protein of Yersinia enterocolitica 0.3 (IcP-Ye) such as for example mouse monoclonal Ac, ref.: 2D8-P, marketed by PROGEN.
• nUc Ags of infectious microorganisms in particular viruses, such as the transcriptional transactivator (Tat) or the reverse transcriptase (RT) of HIV-1 or the viral nucleocapsid proteins, in particular those of SARS-Cov- 2, influenza, HBV, HEV, and HPV
• viruses such as the transcriptional transactivator (Tat) or the reverse transcriptase (RT) of HIV-1 or the viral nucleocapsid proteins, in particular those of SARS-Cov- 2, influenza, HBV, HEV, and HPV
• the nuc Ag that the antibody, fragment or derivative used in the invention specifically recognizes is chosen from the self proteins of the subject to be treated. This type of antibody is used when the inflammation is due to an autoimmune disease.
• the self protein capable of binding nucleic acids is preferably an intracellular protein. It is additionally or alternatively preferably capable of binding to nucleic acids in native form, before any cleavage inducing a conformational change.
• the Ag nuc can in particular be chosen from the ribonucleoproteins and the deoxyribonucleoproteins of the subject to be treated.
• the ribonucleoproteins mention may be made more particularly of the proteins: the protein RibP (sequence of amino acids corresponding to Genbank accession number NP_000993.1 (subunit PO), NP_000994.1 (subunit P1) and NP_000995 .1 (P2 subunit), Genbank version 241 of 15 Dec 2020, ICs of RibP are associated with the pathogenesis of systemic lupus erythematosus, see (Choi et al., 2020) snRNPs proteins, including protein A, protein C and 70K protein (amino acid sequences corresponding to Genbank accession numbers NPJXM587.1, NP_003084.1 and NP_003080.2, Genbank version 241 of December 15, 2020, ICs of snRNPs A, C and 70K are associated with
• NP_003082.1 and NP_008869.1 Genbank version 241 dated Dec 15, 2020
• ICs of snRNPs B, B' and D are associated with the pathogenesis of systemic lupus erythematosus, see (Pisetsky & Lipsky, 2020), protein Ro60 (sequence of amino acids corresponding to Genbank accession no.
• NP_001035828.1 Genbank version 241 of December 15, 2020
• ICs of Ro60 are associated with the pathogenesis of systemic lupus erythematosus, primary Sjogren's syndrome, and systemic sclerosis, see (Schulte-Pelkum et al., 2009)
• the Ro52 protein amino acid sequence corresponding to Genbank accession no. NP_003132.2, Genbank version 241 of December 15, 2020
• ICs of Ro52 are associated with the pathogenesis systemic lupus erythematosus, see (Schulte-Pelkum et al., 2009)
• the La protein La protein (Lupus antigen, amino acid sequence corresponding to Genbank accession no. NP_001281074.1, Genbank version 241 of December 15, 2020, La ICs are associated with the pathogenesis of systemic lupus erythematosus, see (To & Petri, 2005).
• histones for example the amino acid sequence corresponding to Genbank accession number NP_001035807.1 (histone 2A), CAA41051.1 (histone 2-B), AAN39284.1 ( histone 3), NP_003486.1 (histone 4), Genbank version 241 dated 15 Dec 2020
• histone ICs are associated with the pathogenesis of systemic lupus erythematosus, see (Ghiggeri et al., 2019).
• RibP protein Polyclonal antibodies specifically recognizing the RibP protein are available on the market, such as: "Ribosomal P Antigen antibody”, rabbit polyclonal antibody, ref. : GTX39242, marketed by GeneTex.
• Monoclonal antibodies specifically recognizing the snRNPs protein are available on the market, for example: “Anti-Sm BB' Proteins (Human autoantigens) Monoclonal Antibody”, mouse monoclonal antibodies, ref. : 03-57029 marketed by American Research Products, Inc. TM.
• Monoclonal antibodies specifically recognizing the Ro60 protein are available on the market, such as: “Anti-Ro60 (SS-A) Protein Monoclonal Antibody”, clone 1 D8, mouse monoclonal antibody, ref. : 03-57039 marketed by American Research Products, Inc. TM.
• Monoclonal antibodies specifically recognizing the Ro52 protein are available on the market, for example: “Anti-TRIM21 Mouse mAb”, mouse monoclonal antibody, ref. : MBS475588, marketed by MyBioSource.com.
• Polyclonal antibodies specifically recognizing the lupus antigen (La) are available on the market, such as: “Anti-Lupus La Protein SSB Antibody”, rabbit polyclonal antibody, ref. : A00705, marketed by BosterBio.
• Monoclonal antibodies specifically recognizing histones are available on the market, such as: “Histone Monoclonal Antibody”, mouse monoclonal antibody, ref.: LS-C68011, marketed by LifeSpan Biosciences.
• the antibodies, fragments and derivatives described above are useful in the treatment of inflammation, and in particular in the treatment of inflammation due to the presence of immune complexes (IC) formed from an Ag nUc and antibodies specifically recognizing this Ag nUc .
• IC immune complexes
• ICs formed between a nUc Ag of the infectious microorganism (in particular viral capsid proteins, which generate strong antibody responses) and antibodies recognizing this nUc Ag can induce acute inflammation that can go as far as "cytokine storms" (strong secretion of inflammatory cytokines having deleterious effects on the tissues) described in the severe forms of Covid-19 and influenza, or chronic inflammation, and - diseases autoimmune, where the presence of ICs formed between a nUc Ag of the self and the antibodies recognizing this Ag nUc can also induce an acute or chronic inflammation.
• cytokine storms strong secretion of inflammatory cytokines having deleterious effects on the tissues
• the antibodies, fragments and derivatives described above are particularly useful in the treatment of inflammation due to: a) an infection by a microorganism; or b) an autoimmune disease. Inflammation due to infection with a microorganism
• an antibody, a fragment or a derivative as described here which binds specifically to a nuc Ag of the microorganism responsible for the infection.
• the infection is a viral infection, since it is in this type of infection that the greatest number of CIs associated with the pathogenesis of the infection have been observed, and an antibody, fragment or derivative is then used as described here which binds specifically to an Ag nUc (in particular the capsid protein) of the virus responsible for the infection.
• an antibody, fragment or derivative is then used as described here which binds specifically to an Ag nUc (in particular the capsid protein) of the virus responsible for the infection.
• the viral infection is advantageously chosen from Covid-19, influenza, AIDS, hepatitis B, hepatitis E, human papillomavirus infections and dengue fever.
• an antibody, fragment or derivative as described may be used. here which specifically binds to the capsid protein of the SARS-Cov2 virus.
• an antibody, fragment or derivative as described here which specifically binds to the capsid protein of the influenza virus may be used.
• p24 capsid protein
• Tat transcriptional transactivator
• RT HIV-1 reverse transcriptase
• an antibody, fragment or derivative as described here which specifically binds to the capsid protein of the HBV virus may be used.
• an antibody, fragment or derivative as described here which specifically binds to the capsid protein of the HEV virus may be used.
• an antibody, a fragment or a derivative as described here which specifically binds to the capsid protein of the HPV virus may be used.
• an antibody, fragment or derivative as described herein which specifically binds to the capsid protein of the dengue virus may be used.
• the inflammation can also be due to a bacterial or parasitic infection.
• use will be made of an antibody, a fragment or a derivative as described here which binds specifically to an Ag nUC of the bacterium or of the parasite responsible for the infection.
• an antibody, a fragment or a derivative as described here which binds specifically to the intracellular protein of Yersinia enterocolitica 0.3 (IcP-Ye) .
• IcP-Ye intracellular protein of Yersinia enterocolitica 0.3
• an antibody, a fragment or a derivative as described here will be used which binds specifically to an Ag nUC of the self of the patient to be treated.
• the autoimmune disease is advantageously chosen from rheumatoid arthritis, Kawasaki disease, systemic lupus erythematosus, systemic sclerosis and primary Sjogren's syndrome because these are the autoimmune diseases in which the greatest number of CIs associated with the pathogenesis of disease were observed.
• an antibody, a fragment or a derivative as described here which binds specifically to a protein chosen from among the snRNPs A, C or 70K proteins.
• systemic lupus erythematosus it is possible in particular to use an antibody, a fragment or a derivative as described here which binds specifically to a protein chosen from the protein RibP, the histones, the proteins snRNPs A, B, B', C, D and 70K, the Ro60 protein, and the Ro52 protein.
• systemic sclerosis it will be possible in particular to use an antibody, a fragment or a derivative as described here which binds specifically to a protein chosen from among the Ro60 protein and the snRNPs A, C or 70K proteins.
• Example 1 The inflammatory reaction can be induced in vitro by ICs containing the transcriptional transactivator (Tat) of HIV-1, which is an Ag endowed with the capacity to bind nucleic acids
• Tat is a 101-residue protein which was prepared by peptide synthesis as described in the publication by Kittiworakarn et al (Kittiworakarn et al., 2006).
• the aTat12S and aTat7S Abs are derived from Tat-specific hybridomas, they were obtained by following the protocol described in the publication by Lecoq et al. (Lecoq et al., 2008).
• the epitope specificity of these two Abs was evaluated by ELISA.
• microtitration plates were adsorbed at a rate of 100m1 per well with 10pg/ml of a peptide possessing the sequence 1 -37 of Tat, called Tat1 -37, or with 10pg/ml of a peptide-biotinylated having the sequence 37-57 of Tat, called Tat-37-57-b.
• the wells were then saturated with 200 ml of 0.3% bovine serum albumin (BSA).
• BSA bovine serum albumin
• the plates were then washed and dilution series of the two Abs were added. After 4 hours of incubation at room temperature, the plates were washed and a goat anti-mouse antibody coupled to peroxidase was added. After 30 minutes of incubation at room temperature the plates were washed and ABTS was added. After 30 minutes, the optical density was then measured at 414nm using an ELISA reader.
• Tat HIV-1 transcriptional transactivator
• the Ac aTat7S does not bind to Tat1 -37 but interacts with Tat-37-57-b which indicates that it recognizes the 37-57 region of Tat (cf Figure 1 B). These data therefore indicate that these two Abs recognize different and non-overlapping epitopes on the Tat protein.
• the aTat12S and aTat7S Abs are both lgG1 isotypes.
• this isotype recognizes type II Fc gamma receptors, with the acronym FcyRIl, in humans (Temming et al., 2020).
• FcyRIl type II Fc gamma receptors
• This observation therefore led us to evaluate whether the Tat/aTat12S and Tat/aTat7S ICs can induce in vitro the secretion of the inflammatory cytokine IL-6 by human PBMCs.
• Example 2 The inflammatory reaction can be induced by ICs containing the nucleocapsid protein (Ncp) of the SARS-Cov-2 virus, which is an Ag endowed with the ability to bind nucleic acids
• the nucleocapsid protein of the SARS-Cov-2 virus has the sequence with the Genbank code YP_009724397.2, version 241 of Genbank of December 15, 2020. It was prepared by the recombinant route using a protocol similar to that described in the publication by Stadlbauer et al. (Stadlbauer et al., 2020). Thus, the sequence encoding Ncp was inserted into the pcDNA3.4 plasmid.
• HEK cells 2.5.10 6 cells/ml
• plasmid DNA (1 ⁇ g/m ⁇
• freestyle 293F medium then with PEI at 0.5 mg/ml. Finally, they were incubated at 37° C.
• the anti-Ncp monoclonal antibodies were produced using a protocol similar to that described in the publication by Féraudet Tarisse et al (Tarisse et al., 2021). Biozzi mice were immunized four times at three week intervals by injection of 10 pg of Ncp with aluminum hydroxide adjuvant gel, followed by three injections of 50 pg of Ncp at 1 day intervals. Two mice were selected for the production of monoclonal antibodies according to the method developed by (Kohler & Milstein, 1975). Monoclonal antibodies produced in culture supernatant were purified by protein G affinity chromatography.
• Ncp nucleocapsid protein of the SARS-Cov-2 virus
• FcyRII type II Fc gamma receptors
• Example 3 The inflammatory reaction induced by nUC ICs depends on the Fc region of the Acs included in the IC.
• a controlled proteolysis of the Ac aTat12S and aNcp2 is carried out to obtain their F(ab)’2.
• aTat12S and aNcp2 are respectively incubated in the presence of pepsin in buffer pH3 for one hour at 37° C.
• the antibodies are then purified by immunoaffinity either on a column containing Tat, or on a column containing Ncp.
• Tat and NCP are covalently coupled via their amine groups to a pre-activated sepharose resin of the "CNBr Activated Sepharose® 4B" type (Ref: GE17-0430-01; Sigma-Aldrich).
• the preparation of the column as well as the implementation of the affinity chromatography are done according to the manufacturer's recommendations.
• Ncp is initially incubated in the presence or absence of the Ab aNcp2 or of the F(ab)VaNcp2 fragment. These mixtures are then transferred to plates containing human peripheral blood mononuclear cells (PBMCs) at a rate of 0.1 M cells per well. After 18 h of incubation at 37° C., the supernatants are removed and then it is evaluated whether they contain the pro-inflammatory cytokine IL-6.
• PBMCs peripheral blood mononuclear cells
• the Tat protein is initially incubated in the presence or in the absence of the Ac aNcp2 or of the F(ab)VaNcp2 fragment. These mixtures are then transferred to plates containing human peripheral blood mononuclear cells (PBMCs) at a rate of 0.1 M cells per well. After 18 h of incubation at 37° C., the supernatants are removed and then it is evaluated whether they contain the pro-inflammatory cytokine IL-6.
• PBMCs peripheral blood mononuclear cells
• hybridomas expressing the Ac aTat12S and aNcp2 respectively are placed in culture in order to then be used as a source of messenger RNA. From these hybridomas, the antibody sequences are obtained by following the methods described by Stravinskiene 2020 and Meyer et al. 2019. Briefly, hybridoma RNAs (3-10x10 6 cells) are obtained using the GeneJET RNA Purification Kit (Thermo Fisher Scientific, K0731) and directly used for the synthesis of cDNAs.
• the cDNAs are amplified by PCR using the ISPCR Universal sense primer (AAG CAGT G GTAT C AACG CAG AG, SEQ ID NO: 5) and one of the specific primers: antisense primer for kappa mIGK chain for PCR (ACATTGATGTCTTTGGGTAGAAG, SEQ ID NO: :6), mIGL lambda chain reverse primer for PCR (ATCGTACACACCAGTGTGGC, SEQ ID NO:7) or mIGHG heavy chain reverse primer for PCR (GGGATCCAGAGTTCCAGGTC, SEQ ID NO:8).
• ISPCR Universal sense primer AAG CAGT G GTAT C AACG CAG AG, SEQ ID NO: 5
• antisense primer for kappa mIGK chain for PCR ACATTGATGTCTTTGGGTAGAAG, SEQ ID NO:6
• mIGL lambda chain reverse primer for PCR ATCGTACACACCAGTGTGGC, SEQ ID NO:7
• the amplicons are then analyzed by agarose gel electrophoresis, purified, cloned into the plasmid pJet1.2 (Thermo Fisher Scientific, K1231) and sequenced by the Sanger method. From the sequences obtained, new specific primers are used for the cloning of the VH region of aTat12S or aNcp2 in the AbVec-hlgG1 vector (including a human heavy chain constant region of isotype lgG1, Genbank accession number: FJ475055.1; between Age I and Apal sites, Genbank version 241 of December 15, 2020).
• new specific primers are used for cloning the VL region of aTat12S or aNcp2 in the AbVec-hlgKappa vector (comprising a human kappa isotype light chain constant region, Genbank accession number: FJ475056. 1, between Age I and Bs/WI sites, Genbank version 241 of December 15, 2020) or AbVec-hlgLambda (comprising a human light chain constant region of isotype lambda, Genbank accession number: FJ517647.1, between Age I and Xho ⁇ sites, Genbank version 241 of December 15, 2020).
• a variant of the AbVec-hlgG1 plasmid allowing translation to be stopped after the CH1 domain (stop codon after position C220 in the K218-S219-C220 sequence) is used to obtain two plasmids encoding the VH-CH1 regions of hcaTat12S and hcaNcp2, respectively.
• 293-F cells For expression of recombinant Fab fragments and whole antibodies lacking the ability to bind FcyRs, 293-F cells (HEK, Thermo Fisher Scientific, R790-07) are co-transfected (equimolar ratio) with a corresponding plasmid either to the VH-CH1 region or to the complete heavy chain of an lgG1 antibody and to the light chain of the kappa or lambda type by the PEI method (0.5mg/ml; Longo et al 2013) and cultured for 5-8 days in FreeStyleTM 293 Expression Medium (Thermo Fisher Scientific, 12338-018).
• the Fabs labeled with their poly-histidine units in the medium are purified by affinity chromatography with immobilized metal ions (Nickel column coupled to Fast Flow Sepharose beads (GE Healthcare, 17-0575-01)
• the whole Abs secreted in the medium are purified by protein A affinity chromatography (Millipore, 113115827).
• 293-F cells For the expression of whole antibodies lacking the ability to bind FcyRs, 293-F cells (HEK, Thermo Fisher Scientific, R790-07) are co-transfected (equimolar ratio) with a plasmid corresponding to the heavy chain of an lgG1 antibody and either a kappa or lambda type light chain by the PEI method (0.5mg/ml; Longo et al 2013) and cultured for 5-8 days in FreeStyleTM 293 Expression Medium (Thermo Fisher Scientific, 12338-018 ). The antibodies secreted in the medium are purified are purified by protein A affinity chromatography (Millipore, 113115827).
• the ICs generally interact, via the Fc domain of the Abs, with the FcyRs, it is evaluated whether the Fc domain of an Ab included in an IC nUc is involved in the inflammatory response.
• the Ab aTat12S and the Ab aNcp2 are used. It is chosen here to alter their ability to bind the FcyRs by eliminating their respective Fc domains. Removal of these domains is achieved by proteolysis with pepsin. This controlled proteolysis makes it possible to obtain F(ab)′2 fragments, called respectively F(ab)′2-aTat12S and F(ab)′2-aNcp2.
• the IC-Ac-aTat12S and IC-Ac-aNcp2 behave as in examples 1 and 2, that is to say that they trigger the secretion of IL-6 by CMSPs.
• the IC-F(ab)' 2 -aTat12S and IC-F(ab)' 2 -aNcp2 present a reduced or no inflammatory capacity, due to the absence of an Fc region which compromises the capacity to bind the FcyRs.
• the ICs generally interact, via the Fc domain of the Abs, with the FcyRs, it is evaluated whether the Fc domain of an Ab included in an IC nUc is involved in the inflammatory response.
• the Ab aTat12S and the Ab aNcp2 are used. It is chosen here to alter their ability to bind the Fc ⁇ Rs from recombinant constructs lacking their respective Fc domains.
• Fab fragments called Fab-aTat12S and Fab-aNcp2 respectively, are produced. These two fragments of Ab devoid of the Fc region are then incubated with their respective Ag nUc .
• IC-Fab-aTat12S and IC-Fab-aNcp2 Two ICs called respectively IC-Fab-aTat12S and IC-Fab-aNcp2 are thus formed. They are then compared to ICs containing whole Abs, respectively called IC-Ac-aTat12S and IC-Ac-aNcp2, for the ability to induce the secretion of IL-6 by human PBMCs.
• IC-Ac-aTat12S and IC-Ac-aNcp2 behave as in examples 1 and 2, that is to say that they trigger the secretion of IL-6 by CMSPs.
• IC-Fab-aTat12S and IC-Fab-aNcp2 present a reduced or null inflammatory capacity, due to the absence of an Fc region which compromises the capacity to bind FcyRs.
• the Fc domain of the Abs As the ICs generally interact, via the Fc domain of the Abs, with the FcyRs, it is evaluated whether the Fc domain of an Ab included in an IC nUc is involved in the inflammatory response.
• the Ab aTat12S and the Ab aNcp2 are used. It is chosen here to alter their ability to bind the FcyRs from recombinant constructs mutated in their respective Fc domains.
• these mutated Ac respectively called hcaTat12S-Fc mut and hcaNcp2-Fc mut are produced.
• These two mutated Abs are then incubated with their respective nUc Ags.
• IC-hcaTat12S-Fc mut and IC-hcaNcp2-Fc mut . They are then compared to ICs containing the whole non-mutated Abs, respectively called IC-Ac-aTat12S and IC-Ac-aNcp2, for the ability to induce the secretion of IL-6 by human PBMCs.
• the IC-Ac-aTat12S and IC-Ac-aNcp2 behave as in examples 1 and 2, that is to say that they trigger the IL-6 secretion by PBMCs.
• the IC-hcaTat12S-Fc mut and IC-hcaNcp2-FC mut present a reduced or null inflammatory capacity, due to the absence of an Fc region which impairs the capacity to bind the FcyRs.
• Example 4 The inflammatory reaction induced by whole Abs is blocked by an Ab derivative impaired in its ability to bind FCYRS.
• Ncp is first incubated alone or with aNcp2 and in the presence or absence of F(ab)VaNcp2. To evaluate whether an anti-inflammatory effect can be provided by a non-specific F(ab)'2, Ncp is also incubated with the Ab aNcp2 in the presence or absence of F(ab)' 2 -aTat12S.
• the Tat protein is first incubated alone or with the Ab aTat12S and in the presence or absence of the F(ab)VaTat12S.
• Tat is also incubated with the Ab aTat12S in the presence or absence of F(ab)VaNcp2.
• PBMCs peripheral blood mononuclear cells
• Ncp is first incubated alone or with the Ab aNcp2 and in the presence or absence of Fab-aNcp2. To assess whether the anti-inflammatory effect can be provided by a non-specific Fab2, Ncp is also incubated with the Ab aNcp2 in the presence or absence of Fab-aTat12S.
• the Tat protein is first incubated alone with the Ab aTat12S and in the presence or absence of the Fab-aTat12S.
• Tat is also incubated with the Ab aTat12S and in the presence or absence of the Fab-aNcp2.
• PBMCs peripheral blood mononuclear cells
• Ncp is first incubated alone or with the Ab aNcp2 and in the presence or absence of the Ab hcaNcp2-Fc mut .
• Ncp is incubated with the Ab aNcp2 in the presence or absence of hcaTat12S-Fc mut .
• Tat is first incubated alone or with the Ab aTat12S and in the presence or absence of hcaTat12S-Fc mut .
• Tat is incubated with the Ac aTat12S in the presence or absence of the Ac hcaNcp2-Fc mut .
• PBMCs peripheral blood mononuclear cells
• F( ab)'2-aTat12S described in Example 3 is used.
• Tat is incubated with one of the two whole Abs in the absence or presence of F(ab)'2-aTat12S in order to form different types of immune complexes. These mixtures are then incubated for 24 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
• the IC-Ac-aTat12S behaves as in example 1, that is to say that it triggers the secretion of IL-6 by CMSPs. It is also expected that this secretion is not significantly modified when Tat, aTat12S, F(ab)'2-aNcp2 are incubated individually. On the other hand, it is expected that this secretion is reduced or nil when Tat, aTat12S, F(ab)'2-aTat12S are incubated together.
• F( ab)'2-aNcp2 described in Example 3 is used. Ncp is incubated with one of the two whole Abs in the absence or presence of F(ab)'2-aNcp2 so as to form different types of immune complexes. These mixtures are then incubated for 24 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
• the IC-Ac-aNcp2 behaves as in example 2, that is to say that it triggers the secretion of IL-6 by CMSPs. It is also expected that this secretion is not significantly modified when Ncp, aNcp2, F(ab)'2-aTat12S are incubated individually. On the other hand, it is expected that this secretion is reduced or nil when Ncp, aNcp2, F(ab)′2-aNcp2 are incubated together.
• Fab- aTat12S described in example 3 is used. Tat is incubated with one of the two whole Abs in the absence or presence of Fab-aTat12S in order to form different types of immune complexes. These mixtures are then incubated for 24 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
• the IC-Ac-aTat12S behaves as in example 1, that is to say that it triggers the secretion of IL-6 by CMSPs. It is also expected that this secretion is not significantly modified when Tat, aTat12S, Fab-aNcp2 are incubated individually. On the other hand, it is expected that this secretion is reduced or nil when Tat, aTat12S, Fab-aTat12S are incubated together.
• Fab- aNcp2 described in example 3 is used. Ncp is incubated with one of the two whole Abs in the absence or presence of Fab-aNcp2 in order to form different types of immune complexes. These mixtures are incubated for 24 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
• the IC-Ac-aNcp2 behaves as in example 2, that is to say that it triggers the secretion of IL-6 by PBMCs. It is also expected that this secretion is not significantly modified when Ncp, aNcp2, Fab-aTat12S are incubated individually. On the other hand, it is expected that this secretion is reduced or nil when Ncp, aNcp2, Fab-aNcp2 are incubated together.
• Ab hcaTat12S mutated (hcaTat12S-Fc mut ) described in Example 3 is used.
• Tat is incubated with one of the two whole Abs in the absence or in the presence of the hcaTat12S-Fc mut so as to form different types of immune complexes. These mixtures are then incubated for 24 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
• the IC-Ac-hcaTat12S behaves as in example 1, that is to say that it triggers the secretion of IL-6 by CMSPs. It is also expected that this secretion is not significantly modified when Tat, aTat12S, hcaNcp2-Fc mut are incubated individually. On the other hand, it is expected that this secretion is reduced or nil when Tat, aTat12S, hcaTat12S-FC mut are incubated together.
• the antibody hcaNcp2 mutated (hcaNcp2 Fc mut ) described in example 3 is used. Ncp is incubated with one of the two whole Abs in the absence or in the presence of the hcaNcp2 Fc mut so as to form different types of immune complexes. These mixtures are then incubated for 24 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
• the IC-Ac-aNcp2 behaves as in example 2, that is to say that it triggers the secretion of IL-6 by CMSPs. It is also expected that this secretion is not significantly modified when Ncp, aNcp2, hcaNcp2 Fc mut are incubated individually. On the other hand, it is expected that this secretion is reduced or nil when Ncp, aNcp2, hcaNcp2-Fc mut are incubated together.
• Example 5 The inflammatory reaction induced by nUC ICs depends on the Fc region of the Acs included in the IC.
• hybridoma expressing the Ac aNcp15 is placed in culture in order to then be used as a source of messenger RNA. From this hybridoma, the antibody sequences are obtained by following the methods described by Stravinskiene 2020 and Meyer et al. 2019. Briefly, hybridoma RNAs (3-10x10 6 cells) are obtained using the GeneJET RNA Purification Kit (Thermo Fisher Scientific, K0731) and directly used for the synthesis of cDNAs.
• the cDNAs are amplified by PCR using the ISPCR Universal forward primer (AAGCAGTGGTATCAACGCAGAG, SEQ ID NO:5) and one of the specific primers: antisense primer for kappa mIGK chain for PCR (ACATTGATGTCTTTGGGGTAGAAG, SEQ ID NO:6), antisense primer for mIGL lambda chain for PCR (ATCGTACACACCAGTGTGGC, SEQ ID NO:7) or mIGHG heavy chain antisense primer for PCR
• the amplicons are then analyzed by agarose gel electrophoresis, purified, cloned in the plasmid pJet1.2 (Thermo Fisher Scientific, K1231) and sequenced by the Sanger method. From the sequences obtained, new specific primers are used for the cloning of the VH region of aNcp15 in the AbVec-hlgG1 vector (comprising a human heavy chain constant region of isotype lgG1, Genbank accession number: FJ475055 .1; between Age I and Apal sites, Genbank version 241 of December 15, 2020).
• new specific primers are used for the cloning of the VL region of aNcp15 in the vector AbVec-hlgKappa (comprising a human constant region of kappa isotype light chain, Genbank accession number: FJ475056.1 , between Age I and Bs/WI sites, Genbank version 241 of December 15, 2020) or AbVec-hlgLambda (comprising a human light chain constant region of isotype lambda, Genbank accession number: FJ517647.1, between Agel and Xho ⁇ sites, Genbank version 241 of December 15, 2020).
• AbVec-hlgKappa comprising a human constant region of kappa isotype light chain, Genbank accession number: FJ475056.1 , between Age I and Bs/WI sites, Genbank version 241 of December 15, 2020
• AbVec-hlgLambda comprising a human light chain constant region of isotype lamb
• hcaNcp15 a chimeric antibody with human constant regions
• hc human constant regions
• the E233P, F234V, L235A and D265A mutations are incorporated into the AbVec-hlgG1 plasmid to obtain the aNcp15 variant lacking effector activity.
• a plasmid derived from AbVec-hlgG1 was constructed by inserting the coding sequence for ENLYFQSHHHHHH (TEV protease cleavage site followed by 6 histidines) downstream of cysteine 220 (C220, in the sequence K218-S219- C220) followed by a stop codon allowing translation to be stopped.
• This plasmid (AbVec-hlgG1_Fab-TEV-6xHis) is used for the expression of the VH-CH1 -TEV-6xHis fusion of aNcp15 necessary for the production of the corresponding Fab (Fab-aNcp15).
• 293-F cells For expression of recombinant Fab fragments and whole antibodies lacking the ability to bind FcyRs, 293-F cells (HEK, Thermo Fisher Scientific, R790-07) are co-transfected (equimolar ratio) with a corresponding plasmid either to the VH-CH1 region or to the complete heavy chain of an lgG1 antibody and either a light chain of the kappa or lambda type by the PEI method (0.5mg/ml; Longo et al 2013) and cultured for 5-8 days in FreeStyleTM 293 Expression Medium (ThermoFisher Scientific, 12338-018).
• the Fabs containing polyhistidine tags and secreted into the medium are purified by IMAC (immobilized metal ion affinity chromatography, GE Healthcare Cat.N. 17-0575-01).
• the whole antibodies secreted into the medium are purified by protein A affinity chromatography (Millipore, 113115827).
• 293-F cells For the expression of whole antibodies lacking the ability to bind FcyRs, 293-F cells (HEK, Thermo Fisher Scientific, R790-07) are co-transfected (equimolar ratio) with a plasmid corresponding to the heavy chain of an lgG1 antibody and either a light chain of the kappa or lambda type by the PEI method (0.5mg/ml; Longo et al 2013) and cultured for 5-8 days in FreeStyleTM 293 Expression Medium (Thermo Fisher Scientific, 12338- 018).
• the Abs secreted into the medium are purified by protein A affinity chromatography (Millipore, 113115827).
• hcaNcp15 Immunoenzymatic study of hcaNcp15, hcaNcp15Fcmutated and Fab-aNcp15 for the ability to bind the Ncp protein.
• the hcaNcp15 antibody was adsorbed onto microtiter plates (0.1 pg/1 OOmI/well). The plates were then saturated with PBS buffer containing 0.3% bovine serum albumin. The plates were then washed and a fixed concentration of N-biotinylated protein (178pM) was added to the wells in the presence or absence of series of dilutions of hcaNcp15, or of hcaNcp15Fcmute or of Fab-aNcp15.
• ABTS colorimetric substrate
• Results A) Recombinant production of the mutated Ab aNcp15Fcm and of the Fab-aNcp15 fragment, and characterization of their ability to bind the Ncp protein.
• the Ac hcaNcp15 is used. It is chosen here to produce two recombinant constructs lacking the ability to bind the Fc ⁇ Rs. The first construct corresponds to the Fab fragment of aNcp15, called Fab-aNcp15. The second corresponds to the Ac hcaNcp15 containing a mutated Fc domain in order to alter its ability to bind FcyRs. This construct is called hcaNcp15Fcmute.
• Fab-aNcp15 and of mutated hcaNcp15Fc to bind Ncp is then compared with that of whole hcaNcp15 Ac, by immunoenzymatic assay. For this, series of dilutions of Fab-aNcp15, of hcaNcpl 5Fcmute or of Ac hcaNcpl 5 were incubated in the presence of a fixed quantity of Ncp-biotinylated in previously adsorbed plates. with Ac hcaNcp15.
• the full-length hcaNcp15 and hcaNcp15Fcmute antibody show similar inhibition capacity indicating that mutations in the Fc domain of the antibody do not alter the binding capacity.
• the whole Ac has a greater capacity for inhibition than the Fab fragment, which is expected because the whole molecule has two Fab domains which contribute to the avidity of the interaction.
• the previously produced Fab-aNcp15 fragment is used. It is incubated in the presence of the Ncp protein so as to form an IC called Ncp/Fab-aNcp15. Its ability to induce IL-6 secretion by human PBMCs is then compared to that of free Ncp, free Fab-aNcp15, and IC Ncp/aNcp15. This last IC, whose ability to trigger IL-6 secretion is shown in Figure 3, is used as a positive control.
• the free Fab-aNcp15, the free Ncp protein and the IC containing the Fab-aNcp15 behave in the same way since they exhibit almost zero inflammatory capacity (Fig. 5).
• the aNcp15 IC used as a positive control triggers the secretion of IL-6 by PBMCs.
• This last observation indicates that the absence of effect of the IC Ncp/Fab-aNcp15 is not due to a loss of reactivity of the cells.
• the muteated hcaNcp15Fcm antibody lacking the ability to bind Fcys receptors is used.
• This mutated Ac is incubated with Ncp so as to form an immune complex called Ncp/hcaNcp15- Fcmut .
• This complex is compared to i) the IC containing the whole non-mutated Ac called Ncp/hcaNcp15, ii) hcaNcp15 -Fcmut , iii) free Ncp for the ability to induce the secretion of IL-6 by human PBMCs.
• the IC Ncp/hcaNcp15- F mut behave in the same way since they have a capacity virtually no inflammation (figure 6).
• the Ncp/hcaNcp15 IC behaves as in examples 1 and 2, that is to say that it triggers the secretion of IL-6 by CMSPs.
• Example 6 The inflammatory reaction induced by whole Abs is blocked by an Ncp-specific Fab or by an Ab derivative impaired in its ability to bind FCYRS.
• Fab-aNcp15 can block the inflammation caused by an nUc IC containing Ncp.
• Ncp is incubated alone or with hcaNcp15 and in the presence or absence of Fab-aNcp15.
• Ncp is also incubated in the presence of Fab-aNcp15 as a control.
• the various mixtures are then transferred to plates containing human peripheral blood mononuclear cells (PBMCs) at a rate of 0.1 M cells per well. After 18 h of incubation at 37° C., the supernatants are removed and then it is evaluated whether they contain the pro-inflammatory cytokine IL-6.
• PBMCs peripheral blood mononuclear cells
• Ncp is first incubated alone or with the hcNcp15 Ab and in the presence or absence of the Ab. hcaNcp15-Fcmute.
• PBMCs peripheral blood mononuclear cells
• Ncp is incubated alone or in the presence of Fab-aNcp15.
• Ncp is also incubated with the whole hcaNcp15 Ac in the absence or presence of Fab-aNcp15 so as to form different types of immune complex.
• PBMCs peripheral blood mononuclear cells
• Ncp is incubated alone or in the presence of hcaNcp15Fcmute. Ncp is also incubated with whole hcaNcp15 Ab in the absence or presence of hcaNcp15Fcmute to form different types of immune complex. These mixtures are then incubated for 18 hours with PBMCs and the presence of IL-6 in the supernatants is measured.
• HIV-1 Tat raises an adjuvant-free humoral immune response controlled by its core region and its ability to form cysteine-mediated oligomers.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Medicinal Chemistry (AREA)
• Organic Chemistry (AREA)
• General Health & Medical Sciences (AREA)
• Public Health (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• Animal Behavior & Ethology (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• General Chemical & Material Sciences (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Immunology (AREA)
• Virology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Engineering & Computer Science (AREA)
• Communicable Diseases (AREA)
• Epidemiology (AREA)
• Molecular Biology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• Oncology (AREA)
• Genetics & Genomics (AREA)
• Mycology (AREA)
• Microbiology (AREA)
• Pain & Pain Management (AREA)
• Rheumatology (AREA)
• Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
• Peptides Or Proteins (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=75439032

Family Applications (1)

Country Status (2)

Family Cites Families (1)

• 2022
  • 2022-02-24 WO PCT/FR2022/050338 patent/WO2022180342A1/fr active Application Filing
  • 2022-02-24 EP EP22710424.7A patent/EP4297787A1/de active Pending

Also Published As

Similar Documents

Legal Events