EP4288564A1 - Procédé d'enrichissement d'acides nucléiques - Google Patents
Procédé d'enrichissement d'acides nucléiquesInfo
- Publication number
- EP4288564A1 EP4288564A1 EP22704554.9A EP22704554A EP4288564A1 EP 4288564 A1 EP4288564 A1 EP 4288564A1 EP 22704554 A EP22704554 A EP 22704554A EP 4288564 A1 EP4288564 A1 EP 4288564A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- nucleic acid
- interest
- acid sequence
- endonuclease
- acid probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6848—Nucleic acid amplification reactions characterised by the means for preventing contamination or increasing the specificity or sensitivity of an amplification reaction
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- the present disclosure relates to methods, compositions and kits for enriching nucleic acid populations of interest.
- the disclosure finds particular utility in enriching a nucleic acid population of interest in a mixed sample comprising a proportion of the nucleic acid population of interest that is too low to be detected using conventional detection methods.
- Cancer is one of the leading causes of death in the world. Traditionally, cancer is diagnosed by inspection of a tissue biopsy. While this method of diagnosis can be decisive, it is not only expensive but is also invasive. In addition to that, traditional diagnosis is dependent on the appearance of symptoms that are sufficient to allow identification of target tissue to be biopsied, while in contrast early detection of the disease is crucial in cancer treatment, preferably before the formation of significant tumours.
- An alternative, less expensive and less invasive method of diagnosis which can be used in the early stages of disease is detection of DNA shed from tumours in liquid biopsies such as blood samples. While this method of diagnosis has the potential to transform cancer diagnosis, current sample preparation techniques and molecular detection methods still face many challenges, such as low yield of target nucleic acid and lack of analytical sensitivity to robustly detect mutations at very low abundance in a background of wild type DNA (Gorgannezhad et al., 2018) (Ignatiadis, Lee and Jeffrey, 2015) (Wang et al., 2017) (Lennon, Adalsteinsson and Gabriel, 2016). Therefore, there is a need to develop detection methods with increased sensitivity or to develop methods to enrich the circulating tumour DNA so that it can be detected using standard detection methods.
- Next-generation sequencing technology is a detection method with higher sensitivity, but its complexity and high cost prevents its implementation for routine testing at clinical laboratories.
- Alternative detection methods based on polymerase chain reaction such as TaqMan qPCR, High Resolution Melting (HRM), Amplification-refractory mutation system (ARMS), COLD-PCR, LNA-PCR prior to sequencing, variations of Digital Droplet PCR also involve complex assay design and advanced machinery (Denis et al., 2017) (Krypuy et al., 2006) (Zhao et al., 2016) (Olmedillas-Lopez, Garcia-Arranz and Garcia-Olmo, 2017) (Milbury et al., 2011) (Ang et al., 2013) which are undesirable in a clinical setting.
- nucleic acid enrichment methods such as thermal-electrophoretic separation synchronous coefficient of drag alteration (SCODA) (Kidess et al., 2015) and DNA probes for hybrid capture (Cheng et al., 2015), are technically demanding, require extensive optimisation, and do not have good multiplexing capabilities which precludes their use in a clinical setting.
- SCODA thermal-electrophoretic separation synchronous coefficient of drag alteration
- nuclease-based techniques such as restriction enzymebased assays like dCas9 (Aalipour et a/., 2018) and nuclease-assisted minor-allele enrichment with probe-overlap, NaME-PrO (Song et al., 2016; Liu et al., 2017) (Markou, Athina; Tzanikou, Maria; Ladas, lonnis, Makrigiorgos, G. Mike; Lianidou, 2019) are robust and have much better multiplexing capabilities as they are less technically demanding and do not require extensive optimisation like PCR-based methods.
- the present disclosure describes methods that are aimed to provide improved methods of enriching target DNA, such as tumour DNA present in circulating blood.
- a method for enriching at least one nucleic acid sequence of interest comprising the steps: providing a biological sample comprising a plurality of nucleic acids including the at least one nucleic acid sequence of interest; providing at least one nucleic acid probe, wherein each of the at least one nucleic acid probe has at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest; providing an endonuclease, wherein the endonuclease is configured to cleave single stranded nucleic acids and to cleave double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity; adding the at least one nucleic acid probe to the biological sample and incubating under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest creating a reactant mixture; adding the endonuclea
- Known methods of enrichment which aim to enrich a mutant allele such as the NaME-PrO method of Song et al., 2016 and Liu et al., 2017 use probes which are fully complementary towards the wild type allele and nucleases such as Duplex specific nuclease (DSN), which degrade double stranded nucleic acid sequences. Therefore, the wild type sequence is cleaved while any mutant sequence (regardless of the mutation) is, in theory, protected as the probes will not be fully complementary to the mutant allele.
- DSN Duplex specific nuclease
- DSN requires stringent assay conditions which need to be optimised for every target and is prone to result in some degradation of nucleic acids with partial complementarity and thus some loss of the mutant allele occurs (Song et al., 2016).
- the method of the present aspect uses at least one nucleic acid probe that targets a single mutant allele. While it does not have the potential to enrich for multiple mutant allele simultaneously, the method avoids degradation of the mutant allele of interest as the nuclease which is used cleaves single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not double stranded nucleic acids with full complementarity. Rather, the probes protect the mutant allele of interest.
- the method of the present aspect is much cheaper than known enrichment methods as the endonuclease used in the method of the present aspect is significantly cheaper than the DSN nuclease required in the NaME-PrO method, for example.
- the plurality of nucleic acid sequences in the biological sample are double stranded nucleic acid sequences or a mixture of double stranded nucleic acid sequences and single stranded nucleic acid sequences.
- the biological sample may be incubated under denaturing conditions so that at least the majority of the double stranded nucleic acid sequences in the biological sample denature into single stranded nucleic acid sequences.
- the at least one nucleic acid probe may then be added to the denatured biological sample and the biological sample may then be incubated under conditions suitable for the at least one nucleic acid probe to hybridise to the at least one nucleic acid sequence of interest.
- the at least one nucleic acid probe may be added to the biological sample and the resultant mixture may then be incubated under denaturing conditions.
- the biological sample may then be incubated under conditions suitable for the at least one nucleic acid probe to hybridise to the at least one nucleic acid sequence of interest.
- Incubating under suitable conditions for probe hybridisation to its target sequence may comprise the step of incubating under one condition or the step of incubating under multiple sequential or concurrent conditions which allow the probe to hybridise to its target sequence.
- Incubating under suitable conditions for probe hybridisation to its target sequence may be incubation under ‘hybridisation conditions’, e.g. increased but not denaturing temperature. Such temperature is preferable as higher temperatures increase probe specificity.
- Incubating under suitable conditions for probe hybridisation may be a sequence of a plurality of conditions. For example, when the target sequence is double stranded, incubating under suitable conditions for probe hybridisation to its target sequence may be: -incubating under denaturing conditions to denature double stranded sequences into single stranded sequences;
- incubation under denaturing conditions will be readily understood by the skilled person. Any denaturing conditions which result in at least the majority of double stranded nucleotides denaturing.
- incubation under denaturing conditions may be done by raising the pH of the solution to over 11 , by addition of a denaturant, by exposure to air, by sonication, by radiation or by incubation at an elevated temperature.
- incubation under denaturing conditions may be carried out by raising the pH of the solution to over 11.
- incubation under denaturing conditions may be carried out by addition of a denaturant such as formamide, guanidine, sodium salicylate, dimethyl sulfoxide (DMSO), propylene glycol, or urea.
- a denaturant such as formamide, guanidine, sodium salicylate, dimethyl sulfoxide (DMSO), propylene glycol, or urea.
- incubation under denaturing conditions may be done by exposure to air. In some embodiments, incubation under denaturing conditions may be carried out by sonication. In some embodiments, incubation under denaturing conditions may be carried out by radiation.
- incubation under denaturing conditions may be carried out by incubating at a temperature of at least 75°C, at least 80°C, at least 85°C, at least 90°C, at least 95°C, at least 96°C, or at least 98°C.
- incubating under denaturing conditions may be carried out by incubating at a temperature of 95°C, 96°C, 97°C or 98°C.
- Incubation under denaturing conditions may be carried out by incubating at a temperature from 75°C to 120°C.
- Incubation under denaturing conditions may be carried out by incubating at a temperature from 75°C to 98°C.
- Incubation under denaturing conditions may be carried out by incubating at a temperature from 80°C to 98°C.
- Incubation under denaturing conditions may be carried out by incubating at a temperature from 85°C to 98°C.
- incubating under denaturing conditions may be carried out by incubation at a temperature of at least 80°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 85°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 85°C for at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 90°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 90°C for at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 95°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 95°C for at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 98°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 98°C for at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of 98°C for about 2 minutes, for example.
- Incubation conditions suitable for hybridisation of a probe to its target sequence may comprise incubation under hybridisation conditions, such as incubation at a temperature from 55°C to 75°C, preferably from 60°C to 70°C, more preferably from 63°C to 68°C.
- incubation under conditions suitable for hybridisation may be for at least 1 minute, 2 minutes, 3 minutes, 5 minutes, 8 minutes, 10 minutes, 20 minutes, 30 minutes or 40 minutes.
- Incubation under conditions suitable for hybridisation may be incubation at a temperature of at least 55°C for at least 10 minutes.
- Incubation under conditions suitable for hybridisation may be incubation at a temperature of at least 60°C for at least 10 minutes.
- Incubation under conditions suitable for hybridisation may be incubation at a temperature of at least 65°C for at least 10 minutes. Incubation under conditions suitable for hybridisation may be incubation at a temperature of at least 70°C for at least 10 minutes. Incubation under conditions suitable for hybridisation may be incubation at a temperature from 55°C to 75°C, preferably from 60°C to 70°C, more preferably from 63°C to 68°C for at least 1 minute, 2 minutes, 3 minutes, 5 minutes, 8 minutes, 10 minutes, 20 minutes, 30 minutes or 40 minutes. In preferred embodiments, incubation under conditions suitable for hybridisation is done at 67°C for 10 minutes, for example.
- the plurality of nucleic acid sequences in the biological sample are single stranded nucleic acids.
- the resultant mixture is incubated under conditions suitable for the at least one nucleic acid probe to hybridise to the at least one nucleic acid sequence of interest.
- hybridisation of the at least one nucleic acid probe to at least one nucleic acid sequence of interest creates a double stranded nucleic acid sequence with full complementarity, which is thereby protected from degradation by the endonuclease.
- Other nucleic acid sequences are not the at least one nucleic sequence of interest form a double stranded nucleic acid sequence with at least one mis-match defect and therefore, are not protected from degradation by the endonuclease and therefore will be cleaved by the endonuclease.
- the at least one nucleic acid sequence of interest is associated with a disease.
- the nucleic acid sequence of interest may be associated with cancer.
- the at least one nucleic acid sequence of interest may be a mutant sequence shed from a tumour.
- the at least one nucleic acid sequence of interest may comprise a single base substitution, multiple base substitutions, an insertion or a deletion compared to the respective wild type sequence.
- the at least one nucleic acid of interest may be shed from a tumour and correspond to a mutation hotspot, i.e. a nucleotide position with an exceptionally high mutation frequency.
- the mutation hotspot may be selected from the group comprising: PIK3CA H1047R (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha, Histidine to Arginine mutation at position 1047); BRAF V600E (B-Raf Proto-Oncogene, Serine/Threonine Kinase, Valine to Glutamic Acid at position 600); AKT1 E17K (AKT Serine/Threonine Kinase 1 , Glutamic Acid to Lysine at position 17); EGFR L858R (Epidermal Growth Factor Receptor, Leucine to Arginine at position 858); KIT D816V (KIT Proto-Oncogene, Receptor Tyrosine Kinase, Aspartic Acid to Valine at position 816); IDH R132H (Isocitrate Dehydrogenase 1 , Arginine to Histidine at position 132); KRAS G12C
- the method of the present aspect may be used to detect a nucleic acid sequence of interest of any particular length.
- the at least one nucleic acid sequence of interest is at least long enough to be detected with standard detection methods.
- the at least one nucleic acid sequence of interest may be from 50 to 1000 nucleotides in length, preferably from 100 to 300 nucleotides in length, more preferably from 200 to 400 nucleotides in length.
- the at least one nucleic acid sequence of interest is found within a double stranded nucleic acid of interest.
- the double stranded nucleic acid of interest comprises a first strand and a second strand.
- the method may comprise the provision and use of at least two nucleic acid probes.
- a first nucleic acid probe may have at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive bases with full complementarity to at least a portion of the first strand of the double stranded nucleic acid of interest.
- a second nucleic acid probe may have at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive bases with full complementarity to at least a portion of the second strand.
- the first nucleic acid probe may have at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23 at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive bases which are fully complementary to the reverse complement to the sequence to which the second nucleic acid probe is fully complementary.
- the at least one nucleic acid sequence of interest is found within a single stranded nucleic acid.
- the method comprises a nucleic acid probe which has at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21 , at least 22, at least 23 at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive bases with full complementarity to at least a portion of the single stand nucleic acid of interest.
- Bio sample as used herein is any material collected from a subject, such as a human or an animal.
- the biological sample may be a sample of tissue such as a tissue biopsy or a sample of bodily liquids such as a blood sample.
- the biological sample may be a cell sample such as a sample obtained by a nasal swab, mouth swab or a cervical smear.
- the biological sample may be obtained from bodily fluids.
- the biological sample may be a blood sample.
- the biological sample may be a blood fraction such as blood plasma or blood serum, for example.
- the biological sample may be obtained from interstitial fluid or may be interstitial fluid.
- the biological sample may be obtained from lymphatic fluid or may be lymphatic fluid.
- the biological sample may be obtained from cerebrospinal fluid or may be cerebrospinal fluid.
- the biological sample may be obtained from a tissue sample or may be a tissue sample.
- the biological sample typically may comprise a plurality of nucleic acid sequences.
- the plurality of nucleic acids refers to multiple nucleic acid molecules.
- the plurality of nucleic acids according to the present disclosure comprise the at least one nucleic acid sequence of interest and at least one or more non-target nucleic acids sequences.
- the plurality of nucleic acid sequences in the biological sample comprise DNA.
- the plurality of nucleic acid sequences in the biological sample may be genomic DNA.
- the plurality of nucleic acid sequences in the biological sample may comprise RNA.
- the plurality of nucleic acid sequences may comprise double stranded nucleic acids.
- the plurality of nucleic acid sequences may comprise double stranded DNA.
- the plurality of nucleic acid sequences may comprise a mixture of double stranded and single stranded nucleic acids.
- the plurality of nucleic acid sequences may comprise single stranded nucleic acids.
- the ‘at least one nucleic acid probe’ as used herein refers to any polymer or oligomer of pyrimidine and purine bases (cytosine, thymine, and uracil, and adenine and guanine, respectively) which is at least in part complementary to at least a portion of the at least one nucleic acid sequences of interest.
- the at least one nucleic acid probe may be RNA or DNA.
- the at least one nucleic acid probe may have at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest.
- Consecutive bases refers to pyrimidine and purine bases following continuously, without interruption. At least five consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest refers to 5 pyrimidine and purine bases following continuously which are 100% complementary to at least a portion of one of the at least one nucleic acid sequence of interest.
- Complementary refers to the Watson-Crick base pairing of two nucleic acid sequences.
- 5AGT-3' binds to the complementary sequence 3 -TCA-5'.
- Complementarity between two nucleic acid sequences is partial when only some of the bases bind to their complement.
- Complementarity is complete or full when every base in the sequence binds to its complementary base.
- Complementarity is complete or full in a portion of a sequence when every base in the portion of the sequence binds to its complementary base.
- Complementarity is full or complete for at least a portion of a sequence when every base in the portion of the sequence binds to its complementary base.
- the at least one nucleic acid probe may have at least 10 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest.
- the at least one nucleic acid probe may have at least fifteen consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest.
- the at least one nucleic acid probe may be 100% complementary to at least a portion of the nucleic acid sequence of interest.
- the at least one nucleic acid probe may be from 10 base to 30 bases in length.
- the at least one nucleic acid probe may be from 15 bases to 30 bases in length.
- the at least one nucleic acid probe may be from 20 to 25 bases in length.
- the at least one nucleic acid probe may be 20, 21 , 22, 23, 24, or 25 bases in length.
- the at least one nucleic acid probe may be added in a concentration sufficient to protect substantially the majority of the at least one nucleic acid sequence of interest in the biological sample.
- the at least one nucleic acid probe may be added in a concentration sufficient to protect substantially all of the at least one nucleic acid sequence of interest in the biological sample.
- the at least one nucleic acid probe may be added in a concentration in excess of the concentration sufficient to protect substantially the majority or all of the at least one nucleic acid sequence of interest in the biological sample.
- the at least one nucleic acid probe may be added in the biological sample at a final concentration from 20 to 200 nM.
- the at least one nucleic acid probe may be added in the biological sample at a concentration from 30 to 100 nM.
- the at least one nucleic acid probe may be added in the biological sample at a concentration from 50 to 100 nM.
- the at least one nucleic acid probe may be added in the biological sample at a concentration of at least 30 nM, at least 40 nM, at least 50 nM, at least 60 nM, at least 70 nM, at least 80 nM, at least 90 nM or at least 100 nM and concentrations therebetween.
- the at least one nucleic acid probe may be added in the biological sample at a concentration of at least 40 nM, at least 50 nM, at least 60 nM, at least 70 nM and concentrations therebetween.
- the at least one nucleic acid may be added in the biological sample at a concentration of 35 nM, 40 nM, 45 nM, 50 nM, 55 nM, 60 nM, 65 nM and concentrations therebetween.
- the at least one nucleic acid probe may be added in the biological sample at a concentration of 50 nM, for example.
- the at least one nucleic acid probe may comprise a sequence according to any one of SEQ ID NO: 1-15 as provided in Table 1 below.
- the at least one nucleic acid probe may comprise SEQ ID NO: 1 and/or SEQ ID NO: 2.
- the method comprises two nucleic acid probes, the first nucleic acid probe may comprise or consist of SEQ ID NO:1 and the second nucleic acid probe may comprise or consist of SEQ ID NO: 2.
- guanine-cytosine (GC) content is the percentage of nitrogenous bases in a DNA sequence. GC rich sequences are known to be more stable than sequences with lower GC content.
- Tm °C melting temperature of an oligonucleotide at which point 50% of the oligonucleotide is duplexed with its complement.
- the at least one nucleic acid probe may have the structure A-B-C, wherein B denotes at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest, and
- a and C denote optional flanking sequences.
- B may comprise any one of SEQ ID NO: 1-15.
- B may comprise SEQ ID NO: 1 or SEQ ID NO: 2.
- B may comprise the respective sequence out of SEQ ID NO: 3-15.
- the at least one nucleic acid probe may comprise the structure A-B-C, A-B, B-C or B.
- a and C individually may comprise a sequence with 100% complementarity to the portions of the at least one nucleic acid sequence of interest immediately adjacent to the portion of one of the at least one nucleic acid sequence of interest which is 100% complementary to B.
- a and C may individually comprise an identifier tag or a synthesis tag. Accordingly, the at least one nucleic acid probe may be more readily detected after the method of the present aspect to determine the presence of the at least one nucleic acid sequence of interest.
- a and/or C may comprise biotinylation, LNA bases, or 3’ phosphates.
- one or more flanking probes may be provided.
- the one or more flanking probes may target the sequence upstream and or the sequence downstream of the sequence targeted by the at least one nucleic acid probe.
- the one or more flanking probes may be added to the biological sample along with the at least one nucleic acid probe.
- An ‘endonuclease’ is an enzyme which cleaves the phosphodiester bond within a polynucleotide chain.
- the endonuclease according to the present disclosure cuts DNA without regards to sequence (non-specifically) but is configured to cleave single stranded nucleic acids and to cleave double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity or the double stranded portion with full complementarity of a sequence with partial complementarity.
- the endonuclease used in the method of the present aspect may be any endonuclease configured to cleave single stranded nucleic acids and to cleave double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity.
- the endonuclease may be S1 nuclease, P1 nuclease, N. crassa nucleases, BAL 31 nucleases, U.
- Maydis nucleases nuclease Bh1, Aspergillus nuclease, Physarum nuclease, SP nuclease, Mung bean nuclease, wheat chloroplast nuclease, Rye germ ribosomes, Pea seed nuclease, Tabacco nuclease I, and Alfalfa seedling nucleases.
- the endonuclease may be any nuclease from Table 1 of (Desai and Shankar, 2003), which is incorporated herein by reference.
- the endonuclease may be S1 nuclease, P1 nuclease, BAL 31 nucleases or Mung bean nuclease.
- the endonuclease may be T7 endonuclease.
- the endonuclease may be S1 endonuclease, for example.
- the endonuclease may be added in a final concentration from 0.1 U to 0.6 U in a reaction volume of 10 pl, preferably a final concentration from 0.1 U to 0. 3 U in a reaction volume of 10 pl.
- S1 endonuclease is added in a final concentration of 0.1 U to 0. 2 U in a reaction volume of 10 pl.
- S1 endonuclease is added in a final concentration of 0. 2 U in a reaction volume of 10 pl.
- U refers to enzyme unit or international unit for enzyme. 1 U (pmol/min) is defined as the amount of the enzyme that catalyzes the conversion of one micromole of substrate per minute under the specified conditions of the assay method.
- the ‘reactant mixture’ as used herein refers to the mixture of the biological sample and the at least one nucleic acid probe which has been incubated under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest.
- the at least one nucleic acid probe has hybridised with the at least one nucleic acid sequence of interest to form a double stranded portion.
- the endonuclease may be added to the reactant mixture in any buffer which would allow the endonuclease to function.
- the buffer may be DSN buffer (500 mM Tris-HCI, pH 8.0; 50 mM MgCh; 10 mM DTT) or a buffer of 10mM MgCh, 5mM ZnSC and 10mM KCI.
- S1 endonuclease is preferably added to the reactant mixture in S1 buffer (5xS1 buffer is 200 mM sodium acetate (pH 4.5 at 25 °C), 1.5 M NaCI and 10 mM ZnSC ).
- the ‘enriched mixture’ as used herein refers to the mixture of the reactant mixture and the endonuclease which was been incubated under suitable conditions for the endonuclease to cleave single stranded nucleic acids and to cleave double stranded nucleic acids with partial complementarity.
- the endonuclease does not cleave double stranded nucleic acids with full complementarity such as the at least one nucleic acid probe which has hybridised with the at least one nucleic acid sequence of interest to form a double stranded portion.
- the proportion of the at least one nucleic acid of interest within the enriched mixture is increased compared with than the proportion of the at least one nucleic acid of interest within the biological sample.
- ‘Enrichment’ or ‘enriching’ as used herein refers to increasing the proportion of target nucleic acid or target nucleic acids relative to non-target nucleic acid or non-target nucleic acids.
- the target nucleic acid is the at least one nucleic acid sequence of interest.
- the non-target nucleic acids are any nucleic acids present in the biological sample excluding the target nucleic acid. In the present disclosure this is achieved by mutation specific oligonucleotide probes hybridising specifically to the region of interest and creating a mismatch with wild type DNA allowing endonuclease to cleave those mismatched sites.
- the target sequence is protected from endonuclease digestion by the annealed probes.
- the enrichment comprises an increase in the proportion of intact (undigested) target nucleic acid sequences to intact (undigested) non-target nucleic acid sequences.
- Incubation of the endonuclease and the reactant mixture to form an enriched mixture refers to incubation under one condition or multiple sequential or concurrent conditions which would allow the endonuclease to function.
- incubation of the endonuclease may be carried out in multiple concurrent conditions such as specific temperature and specific buffer.
- Incubation of the endonuclease and the reactant mixture to form an enriched mixture may be from 55°C to 75°C.
- Incubation of the endonuclease and the reactant mixture to form an enriched mixture may be is carried out at a temperature from 55°C to 75°C, from 60°C to 70°C, or from 63°C to 68°C.
- Incubation of the endonuclease and the reactant mixture to form an enriched mixture may be is carried out at a temperature from 55°C to 60°C, from 55°C to 63°C, from 55°C to 68°C, from 55°C to 70°C, from 55 °C to 75°C, from 60°C to 63°C, from 60°C to 68°C, from 60°C to 70°C, from 60°C to 75°C, from 63°C to 68°C, from 63°C to 70°C, from 63°C to 75°C, from 68°C to 70°C, from 68°C to 75°C, from 70°C to 75°C for at least 1 minute .
- incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 55°C to 75°C for at least 1 minutes.
- incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 55°C to 75°C for at least 5 minutes.
- incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 60°C to 70°C for at least 1 minutes.
- incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 60°C to 70°C for at least 5 minutes.
- incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 63°C to 68°C for at least 1 minutes.
- incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 63°C to 68°C for at least 5 minutes.
- incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 63°C to 68°C for at least 1 minute, 2 minutes, 3 minutes, 5 minutes, 8 minutes, 10 minutes, 20 minutes, 30 minutes or 40 minutes.
- Incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature of 67°C for at least 1 minute, 2 minutes, 3 minutes, 5 minutes, 8 minutes, 10 minutes, 20 minutes, 30 minutes or 40 minutes.
- incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be carried out at 67°C for 1 minute.
- incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be carried out at 67°C for 10 minutes.
- the method may further comprise a step of inactivating the endonuclease following the formation of the enriched mixture.
- the step of inactivating the endonuclease may be done by incubation under denaturing conditions.
- Incubation under denaturing conditions will be readily understood by the skilled person. Any denaturing conditions which result in at least the majority of the proteins unfolding may be used.
- incubation under denaturing conditions may be done by raising the pH of the solution to over 11 , by addition of a denaturant, by exposure to air, by sonication, by radiation or by incubation at an elevated temperature.
- incubation under denaturing conditions may be carried out by raising the pH of the solution to over 11.
- incubation under denaturing conditions may be carried out by addition of a denaturant such as formamide, guanidine, sodium salicylate, dimethyl sulfoxide (DMSO), propylene glycol, or urea.
- a denaturant such as formamide, guanidine, sodium salicylate, dimethyl sulfoxide (DMSO), propylene glycol, or urea.
- incubation under denaturing conditions may be done by exposure to air.
- incubation under denaturing conditions may be carried out by sonication.
- incubation under denaturing conditions may be carried out by radiation.
- incubation under denaturing conditions may be carried out by incubating at a temperature of at least 80°C, at least 85°C, at least 90°C, at least 95°C, at least 96°C, or at least 98°C.
- incubating under denaturing conditions may be carried out by incubation at a temperature of 95°C, 96°C, 97°C
- incubating under denaturing conditions may be carried out by incubation at a temperature of at least 80°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 85°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 85°C for at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 90°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 90°C for at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 95°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 95°C for at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 98°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of at least 98°C for at least 120 seconds.
- incubation under denaturing conditions may be carried out by incubation at a temperature of 98°C for about 2 minutes, for example.
- the inactivation of the endonuclease may be done by incubation at a temperature over 90°C for at least 1 minute, 2 minutes, 3 minutes, 5 minutes, 8 minutes, 10 minutes, 20 minutes, 30 minutes or 40 minutes. In some embodiments, the inactivation of the endonuclease may be done by incubation at a temperature of 98°C for 5 minutes.
- a kit for enriching at least one nucleic acid sequence of interest comprising: at least one nucleic acid probe wherein each of the at least one nucleic acid probe has at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest; an endonuclease, wherein the endonuclease is configured to cleave single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity; wherein during use the at least one nucleic acid probe is added to a biological sample comprising a plurality of nucleic acids including the at least on nucleic acid sequence of interest and incubated under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest creating a reactant mixture, and wherein addition of the endonuclease to the reactant mixture and in
- the kit may be used with any biological sample comprising a plurality of nucleic acids including the at least one nucleic acid sequence of interest.
- the biological sample is obtained from bodily fluids.
- the biological sample is a blood sample.
- the biological sample may be obtained from interstitial fluid.
- the biological sample may be obtained from lymphatic fluid.
- the biological sample may be obtained from cerebrospinal fluid.
- the biological sample is obtained from a tissue sample.
- the biological sample may comprise a plurality of single stranded nucleic acid sequences.
- the biological sample comprises a plurality of double stranded nucleic acids.
- the kit further comprises means for denaturing double stranded nucleic acid sequences into single stranded nucleic acid sequences.
- the means for denaturing are applied to the biological sample comprising a plurality of double stranded nucleic acid sequences such that at least the majority of the double stranded nucleic acid sequences within the biological sample are denatured into single stranded nucleic acid sequences before incubation of at least one nucleic acid probe and the biological sample under suitable conditions to create a reactant mixture.
- the at least one nucleic acid probe may comprise a sequence according to any one of SEQ ID NO: 1-15.
- Preferred and optional features of the at least one nucleic acid probe and endonuclease of the first aspect are preferred and optional features of the at least one nucleic acid probe and endonuclease of the second aspect.
- kit of the second aspect may be used in the method of the first aspect. Accordingly, preferred and optional features of the first aspect are preferred and optional features of the second aspect, where appropriate.
- nucleic acid probe for use in the method of the first aspect.
- the nucleic acid probe may have at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest.
- the nucleic acid probe may have the structure A-B-C, wherein B denotes the at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest and A and C denote optional flanking sequences.
- a and/or C comprise a sequence with 100% complementarity to the portions of the at least one nucleic acid sequence of interest immediately adjacent to the portion of one of the at least one nucleic acid sequence of interest which is 100% complementary to B.
- the at least one nucleic acid probe may comprise a sequence according to any one of SEQ ID NO: 1-15.
- Preferred and optional features of the at least one nucleic acid as described in the first aspect are preferred and optional features of the at least one nucleic acid of the third aspect.
- the at least one nucleic acid probe of the third aspect may be used in the method of the first aspect and may be included in the kit of the second aspect.
- a method for detecting a nucleic acid sequence of interest comprising: providing a biological sample comprising a plurality of nucleic acids including the at least one nucleic acid sequence of interest; providing at least one nucleic acid probe, wherein each of the at least one nucleic acid probe has at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest; providing an endonuclease, wherein the endonuclease is configured to cleave single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity; adding the at least one nucleic acid probe to the biological sample and incubating under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest creating a reactant mixture; adding the endonuclease to the reactant mixture and
- the at least one nucleic acid sequence of interest is amplified by PCR.
- the step of amplifying the at least one nucleic acid sequence of interest and the step of detecting the at least one nucleic acid sequence of interest may be performed by INTPLEX qPCR.
- the PCR amplification may be with H104R-specific primers (e.g. SEQ ID NO: 18 and SEQ ID NO: 19).
- the PCR reaction may additionally comprise a blocking oligonucleotide i.e. an oligonucleotide which binds and recognises the wild type sequence (e.g. SEQ ID NO: 20).
- another internal control PCR reaction with internal control primers may be ran simultaneously (e.g. SEQ ID NO: 21 and SEQ ID NO: 22).
- the internal control PCR reaction results are used to calculate the Ct value for total DNA amount (not mutation specific). Subsequently, the Ct value for total DNA amount is used for calculations of AACt to calculate the fold change before/after enrichment.
- a method of diagnosis of a disease associated with a genetic mutation comprising: providing a biological sample comprising a plurality of nucleic acids including the at least one nucleic acid sequence of interest; providing at least one nucleic acid probe, wherein each of the at least one nucleic acid probe has at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest; providing an endonuclease, wherein the endonuclease is configured to cleave single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity; adding the at least one nucleic acid probe to the biological sample and incubating under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest creating a
- Preferred and optional features of the first aspect are preferred and optional features of the second to fifth aspects.
- Fig.1 shows a schematic representation of a method according to an embodiment of the present disclosure.
- Fig. 2 shows a schematic representation of a method according to an embodiment of the present disclosure.
- Fig. 3 (A) chart showing S1 nuclease incubation time versus fold change; (B) chart showing S1 nuclease amount (II) versus fold change; (C) chart showing probe concentration (nM) versus fold change; (D) chart showing no treatment control, and S1 nuclease versus fold change.
- Fig. 4 (A) chart showing mutant allele fractions at 10%, 5%, 1% and 0% versus fold change; (B) table showing cycle threshold (Ct) values before and after at 10%, 5%, 1% and 0% mutation abundances.
- Fig. 5 (A) chart showing treatment control, S1 nuclease and DSN versus relative amplification; (B) chart showing mutant allele fractions at 10%, 5%, 1% and 0% versus relative amplification.
- hybridisation refers to the process in which two single-stranded polynucleotides bind non-covalently to form a stable double-stranded polynucleotide, that is the pairing of complementary nucleic acids; triple-stranded hybridisation is also theoretically possible.
- the resulting polynucleotide is a “hybrid”.
- Hybridisation is a result of oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases.
- nucleic acid molecules consist of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing." More specifically, A will hydrogen bond to T or U, and G will bond to C.
- Hybridization and the strength of hybridization is impacted by such factors as the degree of complementarity between the nucleic acids, stringency of the conditions involved, the melting temperature of the formed hybrid, and the G:C ratio within the nucleic acids.
- Hybridising specifically to refers to the binding, duplexing or hybridising of a molecule substantially to, or only to, a particular nucleotide sequence or sequences under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular DNA or RNA).
- Hybridising conditions can be varied in order to obtain a different level of stringency. This is dependent on the nature of the chosen hybridisation method and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridisation and the ionic strength (especially the Na + and/or Mg 2+ concentration) of the hybridisation buffer will contribute to the stringency of hybridization, though wash times also influence stringency. Calculations regarding hybridisation conditions required for attaining particular degrees of stringency are discussed in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, chs. 9 and 11.
- stringent conditions are conditions under which hybridisation will only occur if there is less than 50% mismatch between the hybridisation molecule and the DNA target.
- the levels of stringency can be further delineated.
- ‘Moderate stringency’ conditions are those under which molecules with more than 50% sequence mismatch will not hybridise
- ‘high stringency’ conditions are those under which sequences with more than 20% mismatch will not hybridise.
- ‘Very high stringency’ conditions are those under which sequences with more than 10% mismatch will not hybridise. The following are representative, non-limiting hybridization conditions:
- the present disclosure is envisaged to work under any stringency conditions but higher stringency conditions are preferable.
- Gene refers to a discrete nucleic acid sequence responsible for a discrete cellular product.
- Nucleic acid sequence refers to a polymer of nucleotides in which the 3' position of one nucleotide sugar is linked to the 5' position of the next by a phosphodiester bridge. In a linear nucleic acid strand, one end typically has a free 5' phosphate group, the other a free 3' hydroxyl group. Nucleic acid sequences may be used herein to refer to oligonucleotides, or polynucleotides, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin that may be single- or double-stranded, and represent the sense or antisense strand.
- Oligonucleotide probes refers to oligonucleotides capable of binding in a base-specific manner to a complementary strand of nucleic acid. Such probes include peptide nucleic acids, as described in Nielsen et al., Science 254, 1497-1500 (1991), and other nucleic acid analogs and nucleic acid mimetics. See U.S. Pat. No. 6,156,501.
- Nucleic acids may include any polymer or oligomer, and fragments or portions thereof, of nucleotides in which the 3' position of one nucleotide sugar is linked to the 5' position of the next by a phosphodiester bridge.
- one end typically has a free 5' phosphate group, the other a free 3' hydroxyl group.
- the nucleic acids are made of of pyrimidine and purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively. See Albert L. Lehninger, PRINCIPLES OF BIOCHEMISTRY, at 793800 (Worth Pub.1982).
- Nucleic acid may be used herein to refer to DNA or RNA of genomic or synthetic origin that may be single- or doublestranded, and represent the sense or antisense strand.
- the present disclosure contemplates in particular DNA and RNA, but peptide nucleic acids, and any chemical variants thereof, such as methylated, hydroxymethylated or glucosylated forms of these bases, are contemplated, as appropriate.
- the nucleic acids are preferably artificially or synthetically produced.
- the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states.
- Nucleic acids may include modifications. Amino modifier reagents, for example, may be used to introduce a primary amino group into a nucleic acid.
- oligonucleotide is a nucleic acid ranging that is at least 5, preferably at least 10, and more preferably at least 20 nucleotides in length. Typically, an oligonucleotide will be at most 1000 nucleotides, preferably at most 500 nucleotides in length.
- Fig. 1 An embodiment of the method of the present disclosure is shown in Fig. 1 to aid understanding of the disclosure and will be described in general terms.
- a pair of nucleic acid probes fully complementary to a mutant nucleic acid sequence of interest hybridise to the mutant nucleic acid sequence of interest forming sections of double stranded nucleic acids with full complementarity.
- the pair of nucleic acid probes can also hybridise to wild type nucleic acid sequences (the wild type equivalent of the mutant nucleic acid sequence of interest) forming sections of double stranded nucleic acid with partial complementarity.
- Reference numeral 1 represent nucleic acids (mutant nucleic acid sequence of interest and wild type nucleic acid sequence)
- reference numeral 2 represents nucleic acid probe (top)
- reference numeral 3 represents nucleic acid probe (bottom)
- reference numeral 4 represents S1 endonuclease.
- step 1 (6) of the nuclease-based mutant allele enrichment assay the biological sample comprising nucleic acids (such as a DNA sample) from a tissue biopsy or a liquid biopsy is prepared by extracting DNA from tissue or blood plasma using a QIAamp DNA mini kit for tissue DNA or QIAamp Circulating Nucleic Acid Kit (Qiagen) for cfDNA extraction from plasma.
- nucleic acids such as a DNA sample
- step 2 the top and bottom probes are added to the biological sample and the biological sample is denatured by incubation at 98°C so that any double stranded nucleic acid sequences are denatured into single stranded nucleic acid sequences.
- step 3 the top and bottom probes anneal to their target sequences (wild type nucleic acid sequence (22) and mutant nucleic acid sequence of interest (24)).
- the probes are fully complementary to the mutant nucleic acid sequence of interest but only partially complementary to the wild type nucleic acid sequence.
- S1 endonuclease is then added and cleaves the wild type nucleic acid sequence but not the mutant nucleic acid sequence of interest and therefore the mutant nucleic acid sequence of interest is enriched.
- step 4 (12) S1 endonuclease is inactivated.
- Reference numeral 14 represents DNA template
- reference numeral 16 represents top stand probe
- reference numeral 18 represents bottom strand probe
- reference numeral 20 represents double stranded nuclease cut.
- Liquid biopsies allow DNA shed from tumours to be detected using non-invasive techniques such as blood tests.
- detection methods often have insufficient sensitivity to detect the low amount of circulating tumour DNA present at an early disease stage.
- the insufficient sensitivity of the detection methods can be overcome by enriching for the nucleic acid to be detected but current enrichment techniques suffer from a loss of circulating tumour DNA as a consequence of the enrichment mechanisms.
- a S1 Nuclease Assisted Rare-allele Enrichment (SNARE) method with mutation specific probes was optimised to remove any wild type DNA sequences while preserving the rare allele to be detected thus enhancing the proportion of the rate allele within a mixture and improving the detection of rare genomic events without loss of overall amount of circulating tumour DNA.
- SNARE Nuclease Assisted Rare-allele Enrichment
- the method will be useful to clinicians for the use of liquid biopsies for the accurate, early detection of tumours without invasive surgeries to obtain tissue biopsies. Moreover, the method is of particular value to healthcare providers as it more cost-effective than current nuclease-based enrichment techniques currently available.
- a method for nuclease-assisted enrichment using S1 endonuclease was optimised in order to find the optimal conditions for enrichment.
- Oligonucleotide overlap-probes were designed to perfectly match the mutant site PIK3CA H1047R and different assay conditions were tested for its enrichment.
- Overlapping probes were designed with IDT OligoAnalyzer tool. Sequences as below (shown 5’ to 3’):
- PIK3CA H1047R Fw1 CATGAAACAAATGAATGATGCACGT (SEQ ID NO: 1)
- PIK3CA H1047R Rv1 GCCACCATGACGTGCATCATT (SEQ ID NO: 2) Underlined bases show the probe location corresponding to the PIK3CA H1047R point mutation.
- PI3KCA H1047R (SEQ ID NO: 17) gtttcagga gatgtgttac aaggcttatc tagctattcg acagcatgcc aatctcttca taaatcttttt ctcaatgatg cttggctctg gaatgccaga actacaatct tttgatgaca ttgcatacat tcgaaagacc ctagccttag ataaaactga gcaagaggct ttggagtatt tcatgaaaca aatgaatgat gcacgtcatg gtggctggac aaacaaatgaatgatgcacgtcatg gtggctggac aaacaaatgaatgatgcacgtcatg gtggctggac aacaacaa
- Underlined bases show the position of the mutation H1047R at position 3140 of PIK3CA (c.3140A>G, p.H1047R).
- Genomic DNA from T-47D cell line, carrying H1047R mutation was subjected to SNARE enrichment at original mutant fraction.
- DNA from T-47D cell line harbouring H1047R mutation was incubated with S1 endonuclease for 1 , 5, 10, and 20min to find the optimum incubation time.
- the assay was also tested with 0.1 , 0.2, 0.4 and 0.6 units (U) S1 endonuclease to find the optimum S1 endonuclease amount.
- the assay was also tested with probe concentrations at 20, 50, 100 and 200 nM to identify the optimum probe concentration.
- each reaction contained 1 l of 1x S1 buffer (5xS1 buffer is 200 mM sodium acetate (pH 4.5 at 25 °C), 1.5 M NaCI and 10 mM ZnSO4), top and bottom strand probes (50nM), 5 pl of cell line or tissue DNA (20 ng/pl) and DNAse-free water up to a volume of 10 pl.
- Samples were denatured on TC-512 (Techne) thermal cycler at 98°C for 2 min. The temperature was then reduced to 67°C and after 20 min 0.2units of S1 nuclease was added into the mixture followed by 1 min incubation at 67°C and 2 min at 95°C for S1 nuclease inactivation. Control experiments without S1 were run in parallel in all reactions. No sample purification was performed after nuclease treatment. Samples were stored at - 20°C until further use.
- Mutation detection for the PIK3CA H1047R mutation was performed using allele-specific real-time quantitative PCR for which has been described previously (Alvarez-Garcia et al., 2018) .
- All qPCR primers and blocking oligonucleotides were purchased from Eurofins. Reactions targeting the mutant sequence were performed in a reaction volume of 12.5 pl consisting of 6.25 pl of 2x Power Sybr Green master mix (Life Technologies, Catalogue Number: 4367660), 1.25 pl of each forward and reverse primers (final concentration 100 nM) (SEQ ID NOs: 18-19), blocking oligonucleotide (final concentration 200nM) (SEQ ID NO: 20), and 2.5 pl of DNA sample or appropriate control.
- ACt Ct target gene - Ct reference gene
- PIK3CA MUTANT H1047R Fw AACTGAGCAAGAGGCTTTGGAG (SEQ ID NO: 18)
- PIK3CA MUTANT H1047R Rv TTGTTGTCCAGCCACCATGAC (SEQ ID NO: 19)
- PIK3CA WT BLOCKER H1047R/L SITE: CCAGCCACCATGATGTGCAT-PHO (SEQ ID NO: 20)
- PHO refers to phosphate group modification on 3’ end of the oligonucleotide.
- PIK3CA WT Fw CATTTGCTCCAAACTGACCA (SEQ ID NO: 21)
- PIK3CA WT Rv GATTGGCATGCTGTCGAATA (SEQ ID NO: 22)
- the internal control primers are designed to amplify a sequence that is within the PIK3CA gene but is not mutated. Therefore, the sequence targeted with the internal control primers is equally amplified regardless of any mutation, providing a reference amplicon to reveal PIK3CA template abundance.
- Genomic DNA from T-47D cell line, carrying H1047R mutation was subjected to SNARE enrichment methodology with different conditions.
- S1 endonuclease was incubated for different time periods (Fig. 3A), the S1 endonuclease amount added to the reactant mixture was varied (Fig.3B) and the concentration of the probes added to the biological sample was varied (Fig.3C). Results showed that incubating sample with 50 nM probes and 0.2 II of S1 nuclease for 1 min was the optimal conditions for relative amplification of the H1047R mutation compared to no treatment (Fig. 3A-C). Mutation enrichment with these conditions combined together resulted in significant increase in relative amplification of S1 treated samples in comparison to untreated controls (Fig.3D).
- Example 2 Enriching mutation alleles at low abundance
- a limiting factor in the use of liquid biopsies is insufficient sensitivity of the detection methods to allow detection of the low amount of circulating tumour DNA. Mutations may have very low abundances so the ability of the SNARE methodology to enrich mutant alleles of interest at lower abundance was tested. This experiment is designed to test the ability of the SNARE method to be used to enrich low level circulating tumour DNA and allow its detection.
- DNA from T-47D cell line harbouring H1047R mutation was diluted with wild type DNA to obtain a decreasing mutational abundance of 1%, 5% or 10%. Wild Type human genomic DNA (Bioline) was used as control. SNARE methodology with the optimal conditions described above was performed on the diluted DNA from T-47D cell line.
- Genomic DNA from the T-47D cell line, carrying H1047R mutation was diluted in wild type DNA to achieve lower mutant allele fractions (10%, 5%, 1%) and subjected to SNARE enrichment methodology.
- 10%, 5%, 1% and 0% (hgDNA) refer to mutant abundance fractions.
- Fig. 4B the table shows cycle threshold (Ct) values before and after at 10%, 5%, 1% and 0% (hgDNA) mutation abundance.
- Genomic DNA from T-47D cell line, carrying H1047R mutation was subjected to SNARE enrichment at original mutant fraction (undiluted T-47D gDNA) (Fig. 5A) and also serially diluted in wild type DNA with decreasing mutation abundances 10%, 5%, 1% (Fig. 5B).
- the experiments were performed as above but instead of 10X DSN master buffer, diluted S1 buffer was used.
- the SNARE method was compared to the NaME-PrO method.
- the NaME- PrO method was conducted as described above.
- the SNARE assay was compared to the known enrichment method NaME-PrO using the endonuclease Duplex Specific Nuclease (DSN) described in (Song et al., 2016) and a no treatment control.
- DSN Duplex Specific Nuclease
- Nuclease-assisted minor-allele enrichment with probe-overlap (NaME-PrO) specific to wild type DNA designed for the enrichment of H1047R mutation was conducted for comparison to the SNARE methodology.
- Overlapping probes were designed with IDT OligoAnalyzer tool according to the assay. Sequences as below (shown 5’ to 3’):
- PIK3CA H1047R Rv1 GCCACCATGATGTGCATCATT (SEQ ID NO:24) Underlined bases show the probe location corresponding to the PIK3CA H1047R point mutation (point mutation not present in these probes designed for the wild type sequence).
- Each reaction contained 1 l of 10x DSN buffer, top and bottom strand probes (20 nM final concentration), 5 pl of cell line or tissue DNA (20 ng/pl), and DNAse-free water up to a volume of 10 pl.
- Samples were denatured on TC-512 (Techne) thermal cycler at 98°C for 2 min. The temperature was then reduced to 67°C and 0.2 units of DSN (Evrogen) were added into the mixture followed by 20 min incubation at 67°C and 2 min at 95°C for DSN inactivation. Control experiments without DSN were run in parallel in all reactions. No sample purification was performed after nuclease treatment, and samples were stored at - 20°C until further use.
- the SNARE assay successfully enriches mutant allele and enhances the sensitivity of qPCR detection method. No significant difference was observed in enrichment efficiency between the SNARE assay and the NaME-Pro assay.
- the SNARE assay has the benefit of being more cost-effective and avoiding loss of circulating tumour DNA during the enrichment process.
- the SNARE assay would be potentially used to enrich clinically relevant targets in tumour biopsy and circulating DNA samples and enable their detection for diagnostic purposes.
- the SNARE assay has the potential to be used to enrich a wide-range of clinically relevant hotspot mutations and enable their detection for diagnostic purposes.
- the SNARE methodology described above can be applied to enriching other clinically relevant hotspot mutations such as the mutations listed in column 1 of Table 1.
- Nucleic acid probes for SNARE enrichment methodology of each of these hotspot mutations have been designed and can be found in the corresponding line of column 4 of Table 1.
- the probes may be modified by biotinylation, LNA bases, or 3’ phosphates.
- Mutation detection can be performed on enriched genomic DNA samples from blood or tumour biopsies and matched untreated controls. DNA samples can be serially diluted in wild type DNA to 10%, 5% and 1% mutation abundancies to test the efficiency of the SNARE assay in enriching low abundancy mutations in different tumour types.
- the SNARE assay may be used to detect a wide range of oncogenic hotspot mutations in various cancer types such as the mutations in Table 1.
- Table 1 provides an example list of known hotspot mutations and some of the cancers associated with said hotspot mutations. Each hotspot mutation may be associated with multiple cancer types and the cancer types listed in Table 1 are non-exhaustive. Therefore, the SNARE assay may be used to detect many different cancers in routine diagnostic testing.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pathology (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB2101427.9A GB2603203A (en) | 2021-02-02 | 2021-02-02 | Method for enriching nucelic acids |
| PCT/GB2022/050275 WO2022167794A1 (fr) | 2021-02-02 | 2022-02-02 | Procédé d'enrichissement d'acides nucléiques |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP4288564A1 true EP4288564A1 (fr) | 2023-12-13 |
Family
ID=74865408
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP22704554.9A Withdrawn EP4288564A1 (fr) | 2021-02-02 | 2022-02-02 | Procédé d'enrichissement d'acides nucléiques |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP4288564A1 (fr) |
| GB (1) | GB2603203A (fr) |
| WO (1) | WO2022167794A1 (fr) |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4683195A (en) | 1986-01-30 | 1987-07-28 | Cetus Corporation | Process for amplifying, detecting, and/or-cloning nucleic acid sequences |
| US6156501A (en) | 1993-10-26 | 2000-12-05 | Affymetrix, Inc. | Arrays of modified nucleic acid probes and methods of use |
| JP4339062B2 (ja) * | 2003-09-30 | 2009-10-07 | 富士フイルム株式会社 | ミスマッチ領域検出方法 |
| US9279146B2 (en) * | 2012-12-21 | 2016-03-08 | Roche Molecular Systems, Inc. | Compounds and methods for the enrichment of mutated nucleic acid from a mixture |
| WO2015172085A2 (fr) * | 2014-05-09 | 2015-11-12 | Memorial Sloan-Kettering Cancer Center | Biomarqueurs utilisables pour évaluer la réponse aux inhibiteurs de la pi3k |
| CA2955382C (fr) * | 2014-07-21 | 2023-07-18 | Illumina, Inc. | Enrichissement de polynucleotides a l'aide de systemes crispr-cas |
| CA2990846C (fr) * | 2015-06-24 | 2023-09-26 | Dana-Farber Cancer Institute, Inc. | Degradation selective de l'adn de type sauvage et enrichissement en alleles mutants a l'aide d'une nuclease |
| CA3066482C (fr) * | 2018-03-19 | 2023-05-23 | Illumina, Inc. | Methodes et compositions pour le clivage selectif medie par la recombinase d'acides nucleiques |
| CN110699425B (zh) * | 2019-09-20 | 2024-01-26 | 上海臻迪基因科技有限公司 | 基因目标区域的富集方法及体系 |
-
2021
- 2021-02-02 GB GB2101427.9A patent/GB2603203A/en active Pending
-
2022
- 2022-02-02 EP EP22704554.9A patent/EP4288564A1/fr not_active Withdrawn
- 2022-02-02 WO PCT/GB2022/050275 patent/WO2022167794A1/fr not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| GB202101427D0 (en) | 2021-03-17 |
| GB2603203A (en) | 2022-08-03 |
| WO2022167794A1 (fr) | 2022-08-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2021202766B2 (en) | Method of preparing cell free nucleic acid molecules by in situ amplification | |
| EP2825675B1 (fr) | Mesure des variants d'acide nucléique au moyen du séquençage hautement multiplexé, à très haut débit et à suppression d'erreur | |
| CN101815789B (zh) | 靶序列的富集 | |
| US10590473B2 (en) | Rapid quantitative detection of single nucleotide polymorphisms or somatic variants and methods to identify malignant neoplasms | |
| US20210010064A1 (en) | Enrichment of nucleic acids | |
| JP2022530483A (ja) | ヌクレアーゼ協同pcr原理に基づいて低存在比のdna突然変異を濃縮する検出技術システムおよび使用 | |
| AU2016281718A1 (en) | Selective degradation of wild-type DNA and enrichment of mutant alleles using nuclease | |
| KR20140010093A (ko) | 혼합 집단 중 표적 dna의 서열분석을 위한 키트 및 방법 | |
| EP3494236B1 (fr) | Procédé de détection précoce du cancer du côlon et/ou de cellules précurseurs du cancer du côlon, et de surveillance de la récurrence du cancer du côlon | |
| CN108699553A (zh) | 用于筛选甲状腺癌中突变的组合物和方法 | |
| JP2021112194A (ja) | 標的核酸の高感度検出方法 | |
| CN110541033B (zh) | Egfr基因突变检测用组合物及检测方法 | |
| US20250145988A1 (en) | Methods of enriching nucleic acids | |
| WO2017070281A1 (fr) | Système d'enrichissement basé sur des bloqueurs et utilisations de celui-ci | |
| US20180051330A1 (en) | Methods of amplifying nucleic acids and compositions and kits for practicing the same | |
| EP4288564A1 (fr) | Procédé d'enrichissement d'acides nucléiques | |
| EP4267763B1 (fr) | Compositions et procédés de détection hautement sensible de séquences cibles dans des réactions multiplex | |
| WO2023227954A1 (fr) | Préparation d'échantillon pour analyse d'adn acellulaire | |
| CN110964833B (zh) | 一种一管检测血浆游离dna中kras和braf基因突变的试剂盒 | |
| Lian et al. | Capillary electrophoresis based on the nucleic acid detection in the application of cancer diagnosis and therapy | |
| JP7815296B2 (ja) | 核酸の増幅のための試薬、混合物、キット、および方法 | |
| Song et al. | Highly Specific Enrichment of Rare Nucleic Acids using Thermus Thermophilus Argonaute with Applications in Cancer Diagnostics |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
| 17P | Request for examination filed |
Effective date: 20230830 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
| DAV | Request for validation of the european patent (deleted) | ||
| DAX | Request for extension of the european patent (deleted) | ||
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20250902 |