GB2603203A

GB2603203A - Method for enriching nucelic acids

Info

Publication number: GB2603203A
Application number: GB2101427.9A
Authority: GB
Inventors: Keraite Ieva; Kersaud-Kerhoas Maiwenn; Reid Leslie Nicholas
Original assignee: Heriot Watt University
Current assignee: Heriot Watt University
Priority date: 2021-02-02
Filing date: 2021-02-02
Publication date: 2022-08-03
Also published as: WO2022167794A1; EP4288564A1; GB202101427D0

Abstract

The method of enriching a nucleic acid in a sample comprises providing a nucleic acid probe with 5 bases 100% complementary to the sequence of interest; an endonuclease which cleaves single-stranded nucleic acids and double-stranded nucleic acids with partial complementarity, but not double-stranded nucleic acids with full complementarity; wherein the probe is added to the sample and incubated for hybridisation and the endonuclease is added and incubated to allow enrichment, wherein the proportion of the nucleic acid of interest within the enriched mixture is higher than that of the initial sample. The sequence of interest may be PIK3CA with H1047R mutation. Also claimed is a kit for enriching, a nucleic acid probe, a method of detecting a nucleic acid sequence and a method of diagnosis of a disease associated with a genetic mutation.

Description

Method for enriching nucleic acids

Field

The present disclosure relates to methods, compositions and kits for enriching nucleic acid populations of interest. The disclosure finds particular utility in enriching a nucleic acid population of interest in a mixed sample comprising a proportion of the nucleic acid population of interest that is too low to be detected using conventional detection methods.

Background

Cancer is one of the leading causes of death in the world. Traditionally, cancer is diagnosed by inspection of a tissue biopsy. While this method of diagnosis can be decisive, it is not only expensive but is also invasive. In addition to that, traditional diagnosis is dependent on the appearance of symptoms that are sufficient to allow identification of target tissue to be biopsied, while in contrast early detection of the disease is crucial in cancer treatment, preferably before the formation of significant tumours.

An alternative, less expensive and less invasive method of diagnosis which can be used in the early stages of disease is detection of DNA shed from tumours in liquid biopsies such as blood samples. While this method of diagnosis has the potential to transform cancer diagnosis, current sample preparation techniques and molecular detection methods still face many challenges, such as low yield of target nucleic acid and lack of analytical sensitivity to robustly detect mutations at very low abundance in a background of wild type DNA (Gorgannezhad et al., 2018) (Ignatiadis, Lee and Jeffrey, 2015) (Wang et aL, 2017) (Lennon, Adalsteinsson and Gabriel, 2016). Therefore, there is a need to develop detection methods with increased sensitivity or to develop methods to enrich the circulating tumour DNA so that it can be detected using standard detection methods.

Next-generation sequencing technology is a detection method with higher sensitivity, but its complexity and high cost prevents its implementation for routine testing at clinical laboratories. Alternative detection methods based on polymerase chain reaction such as TaqMan qPCR, High Resolution Melting (HRM), Amplification-refractory mutation system (ARMS), COLD-PCR, LNA-PCR prior to sequencing, variations of Digital Droplet PCR also involve complex assay design and advanced machinery (Denis et al., 2017) (Krypuy et al., 2006) (Zhao et aL, 2016) (0Imedillas-Lapez, Garcia-Arranz and Garcia-01mo, 2017) (Milbury et al., 2011) (Ang et al., 2013) which are undesirable in a clinical setting.

Existing nucleic acid enrichment methods such as thermal-electrophoretic separation synchronous coefficient of drag alteration (SCODA) (Kidess et al., 2015) and DNA probes for hybrid capture (Cheng et al., 2015), are technically demanding, require extensive optimisation, and do not have good multiplexing capabilities which precludes their use in a clinical setting. By comparison, nuclease-based techniques such as restriction enzyme-based assays like dCas9 (Aalipour et al., 2018) and nuclease-assisted minor-allele enrichment with probe-overlap, NaME-PrO (Song et al., 2016; Liu et a/., 2017) (Markou, Athina; Tzanikou, Elena; Ladas, lonnis, Makrigiorgos, G. Mike; Lianidou, 2019) are robust and have much better multiplexing capabilities as they are less technically demanding and do not require extensive optimisation like PCR-based methods. However, current nuclease-based enrichment techniques suffer from a loss of some of the circulating tumour DNA as a consequence of the enrichment mechanism. Loss of even some of the circulating tumour DNA, which is present in the sample in a low amount to begin with, may lead to tumour DNA not being detected.

Therefore, there is a need for alternative and improved methods for enrichment of a nucleic acid of interest without loss of the overall amount of the nucleic acid of interest. In particular, there is a need for improved methods of enrichment of circulating tumour DNA which is simple and cost-effective.

Accordingly, in at least some aspects the present disclosure describes methods that are aimed to provide improved methods of enriching target DNA, such as tumour DNA present in circulating blood

Summary

In a first aspect, there is provided a method for enriching at least one nucleic acid sequence of interest, the method comprising the steps: - providing a biological sample comprising a plurality of nucleic acids including the at least one nucleic acid sequence of interest; - providing at least one nucleic acid probe, wherein each of the at least one nucleic acid probe has at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest; - providing an endonuclease, wherein the endonuclease is configured to cleave single stranded nucleic acids and to cleave double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity; adding the at least one nucleic acid probe to the biological sample and incubating under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest creating a reactant mixture; adding the endonuclease to the reactant mixture and incubating under suitable conditions to form an enriched mixture, wherein the proportion of the at least one nucleic acid of interest within the enriched mixture is greater than the proportion of the at least one nucleic acid of interest within the biological sample.

Known methods of enrichment which aim to enrich a mutant allele such as the NaME-PrO method of Song et al., 2016 and Liu et a/., 2017 use probes which are fully complementary towards the wild type allele and nucleases such as Duplex specific nuclease (DSN), which degrade double stranded nucleic acid sequences. Therefore, the wild type sequence is cleaved while any mutant sequence (regardless of the mutation) is, in theory, protected as the probes will not be fully complementary to the mutant allele. While this technique has the ability to enrich for any mutant allele regardless of the mutation, DSN requires stringent assay conditions which need to be optimised for every target and is prone to result in some degradation of nucleic acids with partial complementarity and thus some loss of the mutant allele occurs (Song et al., 2016).

In contrast, the method of the present aspect uses at least one nucleic acid probe that targets a single mutant allele. While it does not have the potential to enrich for multiple mutant allele simultaneously, the method avoids degradation of the mutant allele of interest as the nuclease which is used cleaves single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not double stranded nucleic acids with full complementarity. Rather, the probes protect the mutant allele of interest. The method of the present aspect is much cheaper than known enrichment methods as the endonuclease used in the method of the present aspect is significantly cheaper than the DSN nuclease required in the NaME-PrO method, for example.

In some embodiments, the plurality of nucleic acid sequences in the biological sample are double stranded nucleic acid sequences or a mixture of double stranded nucleic acid sequences and single stranded nucleic acid sequences. Suitably in these embodiments, the biological sample may be incubated under denaturing conditions so that at least the majority of the double stranded nucleic acid sequences in the biological sample denature into single stranded nucleic acid sequences. The at least one nucleic acid probe may then be added to the denatured biological sample and the biological sample may then be incubated under conditions suitable for the at least one nucleic acid probe to hybridise to the at least one nucleic acid sequence of interest. Alternatively, the at least one nucleic acid probe may be added to the biological sample and the resultant mixture may then be incubated under denaturing conditions. The biological sample may then be incubated under conditions suitable for the at least one nucleic acid probe to hybridise to the at least one nucleic acid sequence of interest.

Incubating under suitable conditions for probe hybridisation to its target sequence may comprise the step of incubating under one condition or the step of incubating under multiple sequential or concurrent conditions which allow the probe to hybridise to its target sequence.

Incubating under suitable conditions for probe hybridisation to its target sequence may be incubation under 'hybridisation conditions', e.g. increased but not denaturing temperature. Such temperature is preferable as higher temperatures increase probe specificity. Incubating under suitable conditions for probe hybridisation may be a sequence of a plurality of conditions. For example, when the target sequence is double stranded, incubating under suitable conditions for probe hybridisation to its target sequence may be: -incubating under denaturing conditions to denature double stranded sequences into single stranded sequences; -subsequently, incubating under hybridisation conditions to allow the probe to hybridise to its target sequence.

Incubation under denaturing conditions will be readily understood by the skilled person. Any denaturing conditions which result in at least the majority of double stranded nucleotides denaturing. For example, incubation under denaturing conditions may be done by raising the pH of the solution to over 11, by addition of a denaturant, by exposure to air, by sonication, by radiation or by incubation at an elevated temperature. In some embodiments, incubation under denaturing conditions may be carried out by raising the pH of the solution to over 11. In some embodiments, incubation under denaturing conditions may be carried out by addition of a denaturant such as formamide, guanidine, sodium salicylate, dimethyl sulfoxide (DMSO), propylene glycol, or urea. In some embodiments, incubation under denaturing conditions may be done by exposure to air. In some embodiments, incubation under denaturing conditions may be carried out by sonication. In some embodiments, incubation under denaturing conditions may be carried out by radiation.

Preferably, incubation under denaturing conditions may be carried out by incubating at a temperature of at least 75°C, at least 80°C, at least 85°C, at least 90°C, at least 95°C, at least 96°C, or at least 98°C. For example, incubating under denaturing conditions may be carried out by incubating at a temperature of 95°C, 96°C, 97°C or 98°C. Incubation under denaturing conditions may be carried out by incubating at a temperature from 75°C to 120°C. Incubation under denaturing conditions may be carried out by incubating at a temperature from 75°C to 98°C. Incubation under denaturing conditions may be carried out by incubating at a temperature from 80°C to 98°C. Incubation under denaturing conditions may be carried out by incubating at a temperature from 85°C to 98°C.

Suitably, incubating under denaturing conditions may be carried out by incubation at a temperature of at least 80°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 85°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 85°C for at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 90°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 90°C for at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 95°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 95°C for at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 98°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 98°C for at least 120 seconds. In some preferred embodiments, incubation under denaturing conditions may be carried out by incubation at a temperature of 98°C for about 2 minutes, for example.

Incubation conditions suitable for hybridisation of a probe to its target sequence may comprise incubation under hybridisation conditions, such as incubation at a temperature from 55°C to 75°C, preferably from 60°C to 70°C, more preferably from 63°C to 68°C. Suitably, incubation under conditions suitable for hybridisation may be for at least 1 minute, 2 minutes, 3 minutes, 5 minutes, 8 minutes, 10 minutes, 20 minutes, 30 minutes or 40 minutes. Incubation under conditions suitable for hybridisation may be incubation at a temperature of at least 55°C for at least 10 minutes. Incubation under conditions suitable for hybridisation may be incubation at a temperature of at least 60°C for at least 10 minutes. Incubation under conditions suitable for hybridisation may be incubation at a temperature of at least 65°C for at least 10 minutes. Incubation under conditions suitable for hybridisation may be incubation at a temperature of at least 70°C for at least 10 minutes. Incubation under conditions suitable for hybridisation may be incubation at a temperature from 55°C to 75°C, preferably from 60°C to 70°C, more preferably from 63°C to 68°C for at least 1 minute, 2 minutes, 3 minutes, 5 minutes, 8 minutes, 10 minutes, 20 minutes, 30 minutes or 40 minutes. In preferred embodiments, incubation under conditions suitable for hybridisation is done at 67°C for 10 minutes, for example.

In some embodiments, the plurality of nucleic acid sequences in the biological sample are single stranded nucleic acids. Suitably in these embodiments, following the addition of the at least one nucleic acid probe to the biological sample the resultant mixture is incubated under conditions suitable for the at least one nucleic acid probe to hybridise to the at least one nucleic acid sequence of interest.

In the method of the present aspect, hybridisation of the at least one nucleic acid probe to at least one nucleic acid sequence of interest creates a double stranded nucleic acid sequence with full complementarity, which is thereby protected from degradation by the endonuclease. Other nucleic acid sequences are not the at least one nucleic sequence of interest form a double stranded nucleic acid sequence with at least one mis-match defect and therefore, are not protected from degradation by the endonuclease and therefore will be cleaved by the endonuclease.

Typically, the at least one nucleic acid sequence of interest is associated with a disease.

In some embodiments, the nucleic acid sequence of interest may be associated with cancer.

In some preferred embodiments, the at least one nucleic acid sequence of interest may be a mutant sequence shed from a tumour. The at least one nucleic acid sequence of interest may comprise a single base substitution, multiple base substitutions, an insertion or a deletion compared to the respective wild type sequence. The at least one nucleic acid of interest may be shed from a tumour and correspond to a mutation hotspot, i.e. a nucleotide position with an exceptionally high mutation frequency. The mutation hotspot may be selected from the group comprising: PIK3CA Hi 047R (phosphafidylinosito1-4,5-bisphosphate 3-kinase catalytic subunit alpha, Histidine to Arginine mutation at position 1047); BRAF V600E (B-Raf Proto-Oncogene, Serine/Threonine Kinase, Valine to Glutamic Acid at position 600); AKT1 E17K (AKT Serine/Threonine Kinase 1, Glutamic Acid to Lysine at position 17); EGFR L858R (Epidermal Growth Factor Receptor, Leucine to Arginine at position 858); KIT D816V (KIT Proto-Oncogene, Receptor Tyrosine Kinase, Aspartic Acid to Valine at position 816); IDH R132H (Isocitrate Dehydrogenase 1, Arginine to Histidine at position 132); KRAS G12C (Kirsten Rat Sarcoma Viral Oncogene Homolog, Glycine to Cysteine at position 12); KRAS G12D (Kirsten Rat Sarcoma Viral Oncogene Homolog, Glycine to Aspartic Acid at position 12); KRAS G12V (Kirsten Rat Sarcoma Viral Oncogene Homolog, Glycine to Valine at position 12); KRAS G13D Kirsten Rat Sarcoma Viral Oncogene Homolog, Glycine to Aspartic Acid at position 13); TP53 R175H (Tumour Protein P53, Arginine to Histidine at position to 175); TP53 R2480 (Tumour Protein P53, Arginine to Histidine at position 175); TP53 R273C (Tumour Protein P53, Arginine to Cysteine at position 273); and TP53 R273H (Tumour Protein P53, Arginine to Cysteine at position 273). For example, the hotspot mutation may be PIK3CA H1047R, which is associated with breast cancer and other solid tumours. Around 12% of all breast cancers have the PIK3CA Hi 047R mutation.

The method of the present aspect may be used to detect a nucleic acid sequence of interest of any particular length. In some preferred embodiments, the at least one nucleic acid sequence of interest is at least long enough to be detected with standard detection methods.

The at least one nucleic acid sequence of interest may be from 50 to 1000 nucleotides in length, preferably from 100 to 300 nucleotides in length, more preferably from 200 to 400 nucleotides in length.

In some embodiments, the at least one nucleic acid sequence of interest is found within a double stranded nucleic acid of interest. In such embodiments, the double stranded nucleic acid of interest comprises a first strand and a second strand. In some embodiments of the present aspect, the method may comprise the provision and use of at least two nucleic acid probes. A first nucleic acid probe may have at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive bases with full complementarity to at least a portion of the first strand of the double stranded nucleic acid of interest. A second nucleic acid probe may have at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive bases with full complementarity to at least a portion of the second strand. In such embodiments, the first nucleic acid probe may have at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive bases which are fully complementary to the reverse complement to the sequence to which the second nucleic acid probe is fully complementary.

In some embodiments, the at least one nucleic acid sequence of interest is found within a single stranded nucleic acid. In some particularly preferred embodiments of the present disclosure, the method comprises a nucleic acid probe which has at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23 at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 consecutive bases with full complementarity to at least a portion of the single stand nucleic acid of interest.

Biological sample' as used herein is any material collected from a subject, such as a human or an animal. The biological sample may be a sample of tissue such as a tissue biopsy or a sample of bodily liquids such as a blood sample. The biological sample may be a cell sample such as a sample obtained by a nasal swab, mouth swab or a cervical smear.

In some embodiments, the biological sample may be obtained from bodily fluids. In some preferred embodiments, the biological sample may be a blood sample. The biological sample may be a blood fraction such as blood plasma or blood serum, for example. The biological sample may be obtained from interstitial fluid or may be interstitial fluid. The biological sample may be obtained from lymphatic fluid or may be lymphatic fluid. The biological sample may be obtained from cerebrospinal fluid or may be cerebrospinal fluid. In some embodiments, the biological sample may be obtained from a tissue sample or may be a tissue sample.

The biological sample typically may comprise a plurality of nucleic acid sequences.

Plurality of nucleic acids' as used herein refers to multiple nucleic acid molecules. The plurality of nucleic acids according to the present disclosure comprise the at least one nucleic acid sequence of interest and at least one or more non-target nucleic acids sequences.

In some embodiments, it is preferred that the plurality of nucleic acid sequences in the biological sample comprise DNA. Suitably, the plurality of nucleic acid sequences in the biological sample may be genomic DNA. In some embodiments, the plurality of nucleic acid sequences in the biological sample may comprise RNA.

The plurality of nucleic acid sequences may comprise double stranded nucleic acids. In such embodiments, the plurality of nucleic acid sequences may comprise double stranded DNA.

The plurality of nucleic acid sequences may comprise a mixture of double stranded and single stranded nucleic acids. The plurality of nucleic acid sequences may comprise single stranded nucleic acids.

The 'at least one nucleic acid probe' as used herein refers to any polymer or oligomer of pyrimidine and purine bases (cytosine, thymine, and uracil, and adenine and guanine, respectively) which is at least in part complementary to at least a portion of the at least one nucleic acid sequences of interest. The at least one nucleic acid probe may be RNA or DNA.

The at least one nucleic acid probe may have at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest. 'Consecutive bases' as used herein refers to pyrimidine and purine bases following continuously, without interruption. At least five consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest refers to 5 pyrimidine and purine bases following continuously which are 100% complementary to at least a portion of one of the at least one nucleic acid sequence of interest.

Complementary' or 'complementarity' as used herein refers to the Watson-Crick base pairing of two nucleic acid sequences. For example, for the sequence 5'-AGT-3' binds to the complementary sequence 3'-TCA-5'. Complementarity between two nucleic acid sequences is partial when only some of the bases bind to their complement. Complementarity is complete or full when every base in the sequence binds to its complementary base. Complementarity is complete or full in a portion of a sequence when every base in the portion of the sequence binds to its complementary base. Complementarity is full or complete for at least a portion of a sequence when every base in the portion of the sequence binds to its complementary base.

The at least one nucleic acid probe may have at least 10 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest. The at least one nucleic acid probe may have at least fifteen consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest. In some preferred embodiments, the at least one nucleic acid probe may be 100% complementary to at least a portion of the nucleic acid sequence of interest.

The at least one nucleic acid probe may be from 10 base to 30 bases in length. The at least one nucleic acid probe may be from 15 bases to 30 bases in length. The at least one nucleic acid probe may be from 20 to 25 bases in length. For example, the at least one nucleic acid probe may be 20, 21, 22, 23, 24, or 25 bases in length.

The at least one nucleic acid probe may be added in a concentration sufficient to protect substantially the majority of the at least one nucleic acid sequence of interest in the biological sample. The at least one nucleic acid probe may be added in a concentration sufficient to protect substantially all of the at least one nucleic acid sequence of interest in the biological sample. The at least one nucleic acid probe may be added in a concentration in excess of the concentration sufficient to protect substantially the majority or all of the at least one nucleic acid sequence of interest in the biological sample. The at least one nucleic acid probe may be added in the biological sample at a final concentration from 20 to 200 nM. Preferably, the at least one nucleic acid probe may be added in the biological sample at a concentration from 30 to 100 nM. Preferably, the at least one nucleic acid probe may be added in the biological sample at a concentration from 50 to 100 nM. In some embodiments, the at least one nucleic acid probe may be added in the biological sample at a concentration of at least 30 nM, at least 40 nM, at least 50 nM, at least 60 nM, at least 70 nM, at least 80 nM, at least 90 nM or at least 100 nM and concentrations therebetween. In some embodiments, the at least one nucleic acid probe may be added in the biological sample at a concentration of at least 40 nM, at least 50 nM, at least 60 nM, at least 70 nM and concentrations therebetween. For example, the at least one nucleic acid may be added in the biological sample at a concentration of 35 nM, 40 nM, 45 nM, 50 nM, 55 nM, 60 nM, 65 nM and concentrations therebetween. In some embodiments, the at least one nucleic acid probe may be added in the biological sample at a concentration of 50 nM, for example.

In some embodiments, the at least one nucleic acid probe may comprise a sequence according to any one of SEQ ID NO: 1-15 as provided in Table 1 below. In some embodiments the at least one nucleic acid probe may comprise SEQ ID NO: 1 and/or SEQ ID NO: 2. In embodiments wherein the method comprises two nucleic acid probes, the first nucleic acid probe may comprise or consist of SEQ ID NO:1 and the second nucleic acid probe may comprise or consist of SEQ ID NO: 2.

Table 1

Mutation Associated Cancer Probe Sequence 5'-3' SECI ID NO: GC Tm gC** %* PI K3CA H1047R (Forward) Breast CATGAAACAAATGAATGATGCAC CT 1 36.0 56.4 PI K3CA Hi 047R (Reverse) Breast GCCACCATGA C GTGCATCATT 2 52.4 57.9 BRAF Melanoma, Thyroid TTGGTCTAGCTACAG A GAAATCTCGATGG 3 44.8 59.1 V600E AKT1 El 7K Breast, Prostate CACGTCTGTAGGG A AGTACATCAAGACC 4 50.0 59.9 EGF R Lung CAGATTTTGGGC G GGCCAAACTGC 5 58.3 63.5 L858R KIT D816V Germ cell tumours, GIST, Leukaemia GGTCTAGCCAGAG T CATCAAGAATGATTCT 6 43.3 59.3 IDH1 R1 32H GI iobl astom a CCTATCATCATAGGTC A TCATGCTTATGGG 7 43.3 58.2 KRAS G 12C Lung GTAGTTGGAGCTG A TGGCGTAGGCAAG 8 55.6 62.7 KRAS G12D Pancreatic, Colorectal GGTAGTTGGAGCT T GTGGCGTAGGC 9 60.0 63.4 KRAS G12V Pancreatic, Colorectal GTAGTTGGAGCTG T TGGCGTAGGCAAG 10 55.6 63.0 KRAS G13D Colorectal GTTGGAGCTGGTG A CGTAGGCAAGAG 11 57.7 62.8 TP53 Colorectal GTTGTGAGGC A CTGCCCCCAC 12 66.7 63.5 R 175H TP53 R2480 Cervical, Colorectal GGCATGAACC A GAGGCCCATCCTC 13 62.5 63.8 TP53 R273C GI ioblastoma, Pancreatic ACAGCTTTGAGGTG T GTGTTTGTGCCTG 14 50.0 63.2 TP53 R273 H Colorectal, Nasopharynx AGCTTTGAGGTGC A TGTTTGTGCCTGTC 15 50 63.3 *GC%: guanine-cytosine (GC) content is the percentage of nitrogenous bases in a DNA sequence. GC rich sequences are known to be more stable than sequences with lower GC content.

**Tm °C: melting temperature of an oligonucleotide at which point 50% of the oligonucleotide is duplexed with its complement.

The at least one nucleic acid probe may have the structure A-B-C, wherein B denotes at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest, and A and C denote optional flanking sequences.

B may comprise any one of SEQ ID NO: 1-15.

For example, in embodiments where the mutation to be detected is PIK3CA H1047R, B may comprise SEQ ID NO: 1 or SEQ ID NO: 2.

In embodiments wherein the mutation to be detected is any of the mutations listed in Table 1, B may comprise the respective sequence out of SEQ ID NO: 3-15.

Accordingly, in some embodiments, the at least one nucleic acid probe may comprise the structure A-B-C, A-B, B-C or B. In some embodiments, A and C individually may comprise a sequence with 100% complementarity to the portions of the at least one nucleic acid sequence of interest immediately adjacent to the portion of one of the at least one nucleic acid sequence of interest which is 100% complementary to B. A and C may individually comprise an identifier tag or a synthesis tag. Accordingly, the at least one nucleic acid probe may be more readily detected after the method of the present aspect to determine the presence of the at least one nucleic acid sequence of interest.

Suitably, A and/or C may comprise biotinylafion, [NA bases, or 3' phosphates.

In the method according to the present aspect, in addition to the at least one nucleic acid probe, one or more flanking probes may be provided. The one or more flanking probes may target the sequence upstream and or the sequence downstream of the sequence targeted by the at least one nucleic acid probe. The one or more flanking probes may be added to the biological sample along with the at least one nucleic acid probe.

An 'endonuclease' is an enzyme which cleaves the phosphodiester bond within a polynucleotide chain. The endonuclease according to the present disclosure cuts DNA without regards to sequence (non-specifically) but is configured to cleave single stranded nucleic acids and to cleave double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity or the double stranded portion with full complementarity of a sequence with partial complementarity.

The endonuclease used in the method of the present aspect may be any endonuclease configured to cleave single stranded nucleic acids and to cleave double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity. The endonuclease may be Si nuclease, P1 nuclease, N. crassa nucleases, BAL 31 nucleases, U. Maydis nucleases, nuclease Bh1, Aspergillus nuclease, Physarum nuclease, SP nuclease, Mung bean nuclease, wheat chloroplast nuclease, Rye germ ribosomes, Pea seed nuclease, Tabacco nuclease I, and Alfalfa seedling nucleases.

The endonuclease may be any nuclease from Table 1 of (Desai and Shankar, 2003), which is incorporated herein by reference. In some embodiments, the endonuclease may be Si nuclease, P1 nuclease, BAL 31 nucleases or Mung bean nuclease. In some embodiments, the endonuclease may be T7 endonuclease. In some embodiments, the endonuclease may be Si endonuclease, for example.

In such embodiments, the endonuclease may be added in a final concentration from 0.1 U to 0.6 U in a reaction volume of 10 pl, preferably a final concentration from 0.1 U to O. 3 U in a reaction volume of 10 pl. In some embodiments, Si endonuclease is added in a final concentration of 0.1 U to 0. 2 U in a reaction volume of 10 pl. In some embodiments, Si endonuclease is added in a final concentration of 0.2 U in a reaction volume of 10 pl. U refers to enzyme unit or international unit for enzyme. 1 U (pmol/min) is defined as the amount of the enzyme that catalyzes the conversion of one micromole of substrate per minute under the specified conditions of the assay method.

The 'reactant mixture' as used herein refers to the mixture of the biological sample and the at least one nucleic acid probe which has been incubated under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest. In the reactant mixture, the at least one nucleic acid probe has hybridised with the at least one nucleic acid sequence of interest to form a double stranded portion.

The endonuclease may be added to the reactant mixture in any buffer which would allow the endonuclease to function. In embodiments where the endonuclease is Si endonuclease the buffer may be DSN buffer (500 mM Tris-HCI, pH 8.0; 50 mM MgC12; 10 mM DTI) or a buffer of 10mM MgC12, 5mM ZnSat and 10mM KCI. In embodiments where the endonuclease is Si endonuclease, Si endonuclease is preferably added to the reactant mixture in Si buffer (5xS1 buffer is 200 mM sodium acetate (pH 4.5 at 25 °C), 1.5 M NaCI and 10mM Zn504).

The 'enriched mixture' as used herein refers to the mixture of the reactant mixture and the endonuclease which was been incubated under suitable conditions for the endonuclease to cleave single stranded nucleic acids and to cleave double stranded nucleic acids with partial complementarity. The endonuclease does not cleave double stranded nucleic acids with full complementarity such as the at least one nucleic acid probe which has hybridised with the at least one nucleic acid sequence of interest to form a double stranded portion. Therefore, as a result of the endonuclease cleaving single stranded nucleic acids and double stranded nucleic acids with partial complementarity, the proportion of the at least one nucleic acid of interest within the enriched mixture is increased compared with than the proportion of the at least one nucleic acid of interest within the biological sample.

Enrichment' or 'enriching' as used herein refers to increasing the proportion of target nucleic acid or target nucleic acids relative to non-target nucleic acid or non-target nucleic acids. In the present disclosure, the target nucleic acid is the at least one nucleic acid sequence of interest. The non-target nucleic acids are any nucleic acids present in the biological sample excluding the target nucleic acid. In the present disclosure this is achieved by mutation specific oligonucleotide probes hybridising specifically to the region of interest and creating a mismatch with wild type DNA allowing endonuclease to cleave those mismatched sites. The target sequence is protected from endonuclease digestion by the annealed probes. While the nucleotides from which the non-target single-stranded nucleic acids were constructed remain in the mixture, the digested non-target single-stranded nucleic acids have ceased to exist in a meaningful sense. Suitably the enrichment comprises an increase in the proportion of intact (undigested) target nucleic acid sequences to intact (undigested) non-target nucleic acid sequences.

Incubation of the endonuclease and the reactant mixture to form an enriched mixture refers to incubation under one condition or multiple sequential or concurrent conditions which would allow the endonuclease to function. For example, incubation of the endonuclease may be carried out in multiple concurrent conditions such as specific temperature and specific buffer.

Incubation of the endonuclease and the reactant mixture to form an enriched mixture may be from 55°C to 75°C. Incubation of the endonuclease and the reactant mixture to form an enriched mixture may be is carried out at a temperature from 55°C to 75°C, from 60°C to 70°C, or from 63°C to 68°C. Incubation of the endonuclease and the reactant mixture to form an enriched mixture may be is carried out at a temperature from 55°C to 60°C, from 55°C to 63°C, from 55°C to 68°C, from 55°C to 70°C, from 55 °C to 75°C, from 60°C to 63°C, from 60°C to 68°C, from 60°C to 70°C, from 60°C to 75°C, from 63°C to 68°C, from 63°C to 70°C, from 63°C to 75°C, from 68°C to 70°C, from 68°C to 75°C, from 70°C to 75°C for at least 1 minute. Suitably, incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 55°C to 75°C for at least 1 minutes. Suitably, incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 55°C to 75°C for at least 5 minutes. Suitably, incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 60°C to 70°C for at least 1 minutes.

Suitably, incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 60°C to 70°C for at least 5 minutes. Suitably, incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 63°C to 68°C for at least 1 minutes.

Suitably, incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 63°C to 68°C for at least 5 minutes. Suitably, incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature from 63°C to 68°C for at least 1 minute, 2 minutes, 3 minutes, 5 minutes, 8 minutes, 10 minutes, 20 minutes, 30 minutes or 40 minutes. Incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be done at a temperature of 67°C for at least 1 minute, 2 minutes, 3 minutes, 5 minutes, 8 minutes, 10 minutes, 20 minutes, 30 minutes or 40 minutes. For example, incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be carried out at 67°C for 1 minute. For example, incubation of the endonuclease and the reactant mixture in order to form an enriched mixture may be carried out at 67°C for 10 minutes.

The method may further comprise a step of inactivating the endonuclease following the formation of the enriched mixture. The step of inactivating the endonuclease may be done by incubation under denaturing conditions. Incubation under denaturing conditions will be readily understood by the skilled person. Any denaturing conditions which result in at least the majority of the proteins unfolding may be used. For example, incubation under denaturing conditions may be done by raising the pH of the solution to over 11, by addition of a denaturant, by exposure to air, by sonication, by radiation or by incubation at an elevated temperature. In some embodiments, incubation under denaturing conditions may be carried out by raising the pH of the solution to over 11. In some embodiments, incubation under denaturing conditions may be carried out by addition of a denaturant such as formamide, guanidine, sodium salicylate, dimethyl sulfoxide (DMSO), propylene glycol, or urea. In some embodiments, incubation under denaturing conditions may be done by exposure to air. In some embodiments, incubation under denaturing conditions may be carried out by sonication. In some embodiments, incubation under denaturing conditions may be carried out by radiation. Preferably, incubation under denaturing conditions may be carried out by incubating at a temperature of at least 80°C, at least 85°C, at least 90°C, at least 95°C, at least 96°C, or at least 98°C. For example, incubating under denaturing conditions may be carried out by incubation at a temperature of 95°C, 96°C, 97°C or 98°C.

Suitably, incubating under denaturing conditions may be carried out by incubation at a temperature of at least 80°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 85°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 85°C for at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 90°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 90°C for at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 95°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 95°C for at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 98°C for at least 10 seconds, at least 20 seconds, at least 30 seconds, at least 60 seconds or at least 120 seconds. Suitably, incubation under denaturing conditions may be carried out by incubation at a temperature of at least 98°C for at least 120 seconds. In some preferred embodiments, incubation under denaturing conditions may be carried out by incubation at a temperature of 98°C for about 2 minutes, for example.

The inactivation of the endonuclease may be done by incubation at a temperature over 90°C for at least 1 minute, 2 minutes, 3 minutes, 5 minutes, 8 minutes, 10 minutes, 20 minutes, 30 minutes or 40 minutes. In some embodiments, the inactivation of the endonuclease may be done by incubation at a temperature of 98°C for 5 minutes.

In a second aspect, there is provided a kit for enriching at least one nucleic acid sequence of interest comprising: at least one nucleic acid probe wherein each of the at least one nucleic acid probe has at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest; an endonuclease, wherein the endonuclease is configured to cleave single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity; wherein during use the at least one nucleic acid probe is added to a biological sample comprising a plurality of nucleic acids including the at least on nucleic acid sequence of interest and incubated under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest creating a reactant mixture, and wherein addition of the endonuclease to the reactant mixture and incubation under suitable conditions for the endonuclease to be active results in the formation of an enriched mixture, wherein the proportion of the at least one nucleic acid of interest within the enriched mixture is greater than the proportion of the at least one nucleic acid of interest within the biological sample.

The kit may be used with any biological sample comprising a plurality of nucleic acids including the at least one nucleic acid sequence of interest. In some embodiments, the biological sample is obtained from bodily fluids. In some preferred embodiments, the biological sample is a blood sample. Suitably, the biological sample may be obtained from interstitial fluid. Suitably, the biological sample may be obtained from lymphatic fluid. Suitably, the biological sample may be obtained from cerebrospinal fluid. In some embodiments, the biological sample is obtained from a tissue sample.

In some embodiments, the biological sample may comprise a plurality of single stranded nucleic acid sequences.

In some embodiments, the biological sample comprises a plurality of double stranded nucleic acids. In these embodiments, the kit further comprises means for denaturing double stranded nucleic acid sequences into single stranded nucleic acid sequences. In these embodiments, during use the means for denaturing are applied to the biological sample comprising a plurality of double stranded nucleic acid sequences such that at least the majority of the double stranded nucleic acid sequences within the biological sample are denatured into single stranded nucleic acid sequences before incubation of at least one nucleic acid probe and the biological sample under suitable conditions to create a reactant mixture.

The at least one nucleic acid probe may comprise a sequence according to any one of SEQ ID NO: 1-15.

Preferred and optional features of the at least one nucleic acid probe and endonuclease of the first aspect are preferred and optional features of the at least one nucleic acid probe and endonuclease of the second aspect.

Typically, the kit of the second aspect may be used in the method of the first aspect.

Accordingly, preferred and optional features of the first aspect are preferred and optional features of the second aspect, where appropriate In a third aspect, there is provided a nucleic acid probe for use in the method of the first 20 aspect.

The nucleic acid probe may have at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest. The nucleic acid probe may have the structure A-B-C, wherein B denotes the at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest and A and C denote optional flanking sequences. In some embodiments, A and/or C comprise a sequence with 100% complementarity to the portions of the at least one nucleic acid sequence of interest immediately adjacent to the portion of one of the at least one nucleic acid sequence of interest which is 100% complementary to B. In some embodiments, the at least one nucleic acid probe may comprise a sequence according to any one of SEQ ID NO: 1-15.

Preferred and optional features of the at least one nucleic acid as described in the first aspect are preferred and optional features of the at least one nucleic acid of the third aspect.

The at least one nucleic acid probe of the third aspect may be used in the method of the first aspect and may be included in the kit of the second aspect.

In a fourth aspect, there is provided a method for detecting a nucleic acid sequence of interest, the method comprising: providing a biological sample comprising a plurality of nucleic acids including the at least one nucleic acid sequence of interest; providing at least one nucleic acid probe, wherein each of the at least one nucleic acid probe has at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest; providing an endonuclease, wherein the endonuclease is configured to cleave single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity; adding the at least one nucleic acid probe to the biological sample and incubating under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest creating a reactant mixture; adding the endonuclease to the reactant mixture and incubating under suitable conditions to form an enriched mixture, wherein the proportion of the at least one nucleic acid of interest within the enriched mixture is greater than the proportion the at least one nucleic acid of interest within the biological sample; -amplifying the at least one nucleic acid sequence of interest; and -detecting the at least one nucleic acid sequence of interest.

In some embodiments, the at least one nucleic acid sequence of interest is amplified by PCR. In some embodiments, the step of amplifying the at least one nucleic acid sequence of interest and the step of detecting the at least one nucleic acid sequence of interest may be performed by INTPLEX qPCR.

In some embodiments wherein the mutation to be detected is PIK3CA H1047R, the PCR amplification may be with H104R-specific primers (e.g. SEQ ID NO: 18 and SEQ ID NO: 19).

In some embodiments, the PCR reaction may additionally comprise a blocking oligonucleotide i.e. an oligonucleotide which binds and recognises the wild type sequence (e.g. SEQ ID NO: 20). In some embodiments, another internal control PCR reaction with internal control primers may be ran simultaneously (e.g. SEQ ID NO: 21 and SEQ ID NO: 22). In some embodiments, the internal control PCR reaction results are used to calculate the Ct value for total DNA amount (not mutation specific). Subsequently, the Ct value for total DNA amount is used for calculations of AACt to calculate the fold change before/after enrichment.

In a fifth aspect, there is provided a method of diagnosis of a disease associated with a genetic mutation, wherein the genetic mutation is found within at least one nucleic acid sequence of interest, the method comprising: providing a biological sample comprising a plurality of nucleic acids including the at least one nucleic acid sequence of interest; - providing at least one nucleic acid probe, wherein each of the at least one nucleic acid probe has at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest; - providing an endonuclease, wherein the endonuclease is configured to cleave single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity; - adding the at least one nucleic acid probe to the biological sample and incubating under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest creating a reactant mixture; adding the endonuclease to the reactant mixture and incubating under suitable conditions to form an enriched mixture, wherein the proportion of the at least one nucleic acid of interest within the enriched mixture is greater than the proportion the at least one nucleic acid of interest within the biological sample; -amplifying the at least one nucleic acid sequence of interest, -detecting the at least one nucleic acid sequence of interest; and wherein detection of the at least one nucleic acid sequence of interest is indicative of the disease associated with the genetic mutation.

Preferred and optional features of the first aspect are preferred and optional features of the second to fifth aspects.

Brief Description of the Figures

Fig.1: shows a schematic representation of a method according to an embodiment of the present disclosure.

Fig. 2: shows a schematic representation of a method according to an embodiment of the present disclosure.

Fig. 3: (A) chart showing Si nuclease incubation time versus fold change; (B) chart showing Si nuclease amount (U) versus fold change; (C) chart showing probe concentration (nM) versus fold change; (D) chart showing no treatment control, and Si nuclease versus fold change.

Fig. 4: (A) chart showing mutant allele fractions at 10%, 5%, 1% and 0% versus fold change; (B) table showing cycle threshold (Ct) values before and after at 10%, 5%, 1% and 0% mutation abundances.

Fig. 5: (A) chart showing treatment control, Si nuclease and DSN versus relative amplification; (B) chart showing mutant allele fractions at 10%, 5%, 1% and 0% versus relative amplification.

Detailed Description

While the making and using of various embodiments of the present disclosure are discussed in detail below, it should be appreciated that the present disclosure provides many applicable inventive concepts that can be embodied in a wide variety of specific contexts. The specific embodiments discussed herein are merely illustrative of specific ways to make and use the disclosure and do not delimit the scope of the disclosure.

To facilitate the understanding of this disclosure, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the present disclosure. Terms such as "a", "an" and "the" are not intended to refer to only a singular entity, but include the general class of which a specific example may be used for illustration. The terminology herein is used to describe specific embodiments of the disclosure, but their usage does not delimit the disclosure, except as outlined in the claims.

Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred methods, devices, and materials are now described. All publications mentioned herein are incorporated herein by reference for the purpose of describing and disclosing the methodologies that are reported in the publications that might be used in connection with the disclosure.

The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature. See, for example, Current Protocols in Molecular Biology (Ausubel, 2000, Wiley and son Inc, Library of Congress, USA); Molecular Cloning: A Laboratory Manual, Third Edition, (Sambrook et al, 2001, Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press); Oligonucleotide Synthesis (M. J. Gait ed., 1984); U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (Harries and Higgins eds. 1984); Transcription and Translation (Flames and Higgins eds. 1984); Culture of Animal Cells (Freshney, Alan R. Liss, Inc., 1987); Immobilized Cells and Enzymes (IRL Press, 1986); Perbal, A Practical Guide to Molecular Cloning (1984); the series, Methods in Enzymology (Abelson and Simon, eds. -in-chief, Academic Press, Inc., New York), specifically, Vols.154 and 155 (Wu et al. eds.) and Vol. 185, "Gene Expression Technology" (Goeddel, ed.); Gene Transfer Vectors For Mammalian Cells (Miller and Cabs eds., 1987, Cold Spring Harbor Laboratory); lmmunochemical Methods in Cell and Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook of Experimental Immunology, Vols. I-IV (Weir and Blackwell, eds., 1986); and Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).

The following discussion is provided to aid the reader in understanding the disclosure and does not constitute any admission as to the contents or relevance of the prior art.

The term "hybridisation" refers to the process in which two single-stranded polynucleotides bind non-covalently to form a stable double-stranded polynucleotide, that is the pairing of complementary nucleic acids; triple-stranded hybridisation is also theoretically possible. The resulting polynucleotide is a "hybrid".

Hybridisation is a result of oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary bases. Generally, nucleic acid molecules consist of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing." More specifically, A will hydrogen bond to T or U, and G will bond to C. Hybridization and the strength of hybridization (for example, the strength of the association between the nucleic acids) is impacted by such factors as the degree of complementarity between the nucleic acids, stringency of the conditions involved, the melting temperature of the formed hybrid, and the G:C ratio within the nucleic acids.

"Hybridising specifically to" refers to the binding, duplexing or hybridising of a molecule substantially to, or only to, a particular nucleotide sequence or sequences under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular DNA or RNA).

Hybridising conditions can be varied in order to obtain a different level of stringency. This is dependent on the nature of the chosen hybridisation method and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridisation and the ionic strength (especially the Na* and/or Mg' concentration) of the hybridisation buffer will contribute to the stringency of hybridization, though wash times also influence stringency. Calculations regarding hybridisation conditions required for attaining particular degrees of stringency are discussed in Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989, chs. 9 and 11. Generally, stringent conditions are conditions under which hybridisation will only occur if there is less than 50% mismatch between the hybridisation molecule and the DNA target. The levels of stringency can be further delineated. 'Moderate stringency' conditions are those under which molecules with more than 50% sequence mismatch will not hybridise. 'high stringency' conditions are those under which sequences with more than 20% mismatch will not hybridise. 'Very high stringency' conditions are those under which sequences with more than 10% mismatch will not hybridise. The following are representative, non-limiting hybridization conditions: Very High Stringency: Hybridisation in 5x SSC buffer at 65 °C for 16 hours; wash twice in 2x SSC buffer at room temperature for 15 minutes each; and wash twice in 0.5x SSC buffer at 65 °C for 20 minutes each.

High Stringency: Hybridisation in 5x-6x SSC buffer at 65-70 °C for 16-20 hours; wash twice in 2x SSC buffer at room temperature for 5-20 minutes each; and wash twice in lx SSC buffer at 55-70 °C for 30 minutes each.

Moderate Stringency: Hybridisation in 6x SSC buffer at room temperature to 55 °C for 16-20 hours; wash at least twice in 2x-3x SSC buffer at room temperature to 55 °C for 20-30 minutes each The present disclosure is envisaged to work under any stringency conditions but higher stringency conditions are preferable.

"Gene", as used herein, refers to a discrete nucleic acid sequence responsible for a discrete cellular product. The term "gene", as used herein, refers not only to the nucleotide sequence encoding a specific protein, but also to any adjacent 5' and 3' non-coding nucleotide sequence involved in the regulation of expression of the protein encoded by the gene of interest. These non-coding sequences include terminator sequences, promoter sequences, upstream activator sequences, regulatory protein binding sequences, and the like. These non-coding sequence gene regions may be readily identified by comparison with previously identified eukaryofic non-coding sequence gene regions. Furthermore, the person of average skill in the art of molecular biology is able to identify the nucleotide sequences forming the non-coding regions of a gene using well-known techniques such as a site-directed mutagenesis, sequential deletion, promoter probe vectors, and the like.

"Nucleic acid sequence", as used herein, refers to a polymer of nucleotides in which the 3' position of one nucleotide sugar is linked to the 5' position of the next by a phosphodiester bridge. In a linear nucleic acid strand, one end typically has a free 5' phosphate group, the other a free 3' hydroxyl group. Nucleic acid sequences may be used herein to refer to oligonucleotides, or polynucleotides, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin that may be single-or double-stranded, and represent the sense or anfisense strand.

"Oligonucleotide probes" refers to oligonucleotides capable of binding in a base-specific manner to a complementary strand of nucleic acid. Such probes include peptide nucleic acids, as described in Nielsen et al., Science 254, 1497-1500 (1991), and other nucleic acid analogs and nucleic acid mimetics. See U.S. Pat. No. 6,156,501.

"Nucleic acids" according to the present disclosure may include any polymer or oligomer, and fragments or portions thereof, of nucleotides in which the 3' position of one nucleotide sugar is linked to the 5' position of the next by a phosphodiester bridge. In a linear nucleic acid strand, one end typically has a free 5' phosphate group, the other a free 3' hydroxyl group. The nucleic acids are made of of pyrimidine and purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively. See Albert L. Lehninger, PRINCIPLES OF BIOCHEMISTRY, at 793800 (Worth Pub.1982). Nucleic acid may be used herein to refer to DNA or RNA of genomic or synthetic origin that may be single-or double-stranded, and represent the sense or antisense strand.

The present disclosure contemplates in particular DNA and RNA, but peptide nucleic acids, and any chemical variants thereof, such as methylated, hydroxymethylated or glucosylated forms of these bases, are contemplated, as appropriate. The nucleic acids are preferably artificially or synthetically produced. The nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states. Nucleic acids may include modifications. Amino modifier reagents, for example, may be used to introduce a primary amino group into a nucleic acid.

An "oligonucleotide" is a nucleic acid ranging that is at least 5, preferably at least 10, and more preferably at least 20 nucleotides in length. Typically, an oligonucleotide will be at most 1000 nucleotides, preferably at most 500 nucleotides in length.

SNARE assay -general discussion An embodiment of the method of the present disclosure is shown in Fig. 1 to aid understanding of the disclosure and will be described in general terms. A pair of nucleic acid probes fully complementary to a mutant nucleic acid sequence of interest hybridise to the mutant nucleic acid sequence of interest forming sections of double stranded nucleic acids with full complementarity. The pair of nucleic acid probes can also hybridise to wild type nucleic acid sequences (the wild type equivalent of the mutant nucleic acid sequence of interest) forming sections of double stranded nucleic acid with partial complementarity. Si endonuclease degrades single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not double stranded nucleic acids with full complementarity. Therefore, the mutant nucleic acid sequence of interest is not degraded while any wild type nucleic acid sequences are degraded. Reference numeral 1 represent nucleic acids (mutant nucleic acid sequence of interest and wild type nucleic acid sequence), reference numeral 2 represents nucleic acid probe (top), reference numeral 3 represents nucleic acid probe (bottom), reference numeral 4 represents Si endonuclease.

An embodiment of the method according to the present disclosure is shown in Fig. 2 to aid understanding of the disclosure. In step 1 (6) of the nuclease-based mutant allele enrichment assay (SNARE), the biological sample comprising nucleic acids (such as a DNA sample) from a tissue biopsy or a liquid biopsy is prepared by extracting DNA from tissue or blood plasma using a QIAamp DNA mini kit for tissue DNA or QIAamp Circulating Nucleic Acid Kit (Qiagen) for cfDNA extraction from plasma. Then, in step 2 (8), the top and bottom probes are added to the biological sample and the biological sample is denatured by incubation at 98°C so that any double stranded nucleic acid sequences are denatured into single stranded nucleic acid sequences. In step 3 00), the top and bottom probes anneal to their target sequences (wild type nucleic acid sequence (22) and mutant nucleic acid sequence of interest (24)). The probes are fully complementary to the mutant nucleic acid sequence of interest but only partially complementary to the wild type nucleic acid sequence.

Si endonuclease is then added and cleaves the wild type nucleic acid sequence but not the mutant nucleic acid sequence of interest and therefore the mutant nucleic acid sequence of interest is enriched. Finally, in step 4 (12), Si endonuclease is inactivated. Reference numeral 14 represents DNA template, reference numeral 16 represents top stand probe, reference numeral 18 represents bottom strand probe and reference numeral 20 represents double stranded nuclease cut.

Example 1 -Optimisation of Si nuclease conditions

Introduction

Liquid biopsies allow DNA shed from tumours to be detected using non-invasive techniques such as blood tests. However, detection methods often have insufficient sensitivity to detect the low amount of circulating tumour DNA present at an early disease stage. The insufficient sensitivity of the detection methods can be overcome by enriching for the nucleic acid to be detected but current enrichment techniques suffer from a loss of circulating tumour DNA as a consequence of the enrichment mechanisms.

A Si Nuclease Assisted Rare-allele Enrichment (SNARE) method with mutation specific probes was optimised to remove any wild type DNA sequences while preserving the rare allele to be detected thus enhancing the proportion of the rate allele within a mixture and improving the detection of rare genomic events without loss of overall amount of circulating tumour DNA.

The method will be useful to clinicians for the use of liquid biopsies for the accurate, early detection of tumours without invasive surgeries to obtain tissue biopsies. Moreover, the method is of particular value to healthcare providers as it more cost-effective than current nuclease-based enrichment techniques currently available.

Methods Optimising the S1 nuclease conditions A method for nuclease-assisted enrichment using Si endonuclease was optimised in order to find the optimal conditions for enrichment. Oligonucleofide overlap-probes were designed to perfectly match the mutant site PIK3CA H1047R and different assay conditions were tested for its enrichment. Overlapping probes were designed with IDT OligoAnalyzer tool. Sequences as below (shown 5' to 3'): PIK3CA H1047R Fw1CATGAAACAAATGAATGATGCACGT (SEQ ID NO: 1) PIK3CA H1047R Rvl GCCACCATGACGTGCATCATT (SEQ ID NO: 2) Underlined bases show the probe location corresponding to the PIK3CA H1047R point mutation.

PIK3CA WT Exon 20 (SEQ ID NO: 16) gtttcagga gatgtgttac aaggcttatc tagctattcg acagcatgcc aatctcttca taaatctttt ctcaatgatg cttggctctg gaatgccaga actacaatct tttgatgaca ttgcatacat tcgaaagacc ctagccttag ataaaactga gcaagaggct ttggagtatt tcatgaaaca aatgaatgat gcacatcatg gtggctggac aacaaaaatg gattggatct tccacacaat taaacagcat gcattgaact ga PI3KCA H1047R (SEQ ID NO: 17) gtttcagga gatgtgttac aaggcttatc tagctattcg acagcatgcc aatctcttca taaatctttt ctcaatgatg cttggctctg gaatgccaga actacaatct tttgatgaca ttgcatacat tcgaaagacc ctagccttag ataaaactga gcaagaggct ttggagtatt tcatgaaaca aatgaatgat gcacgtcatg gtggctggac aacaaaaatg gattggatct tccacacaat taaacagcat gcattgaact ga Underlined bases show the position of the mutation H1047R at position 3140 of PIK3CA (c.3140A>G, p.H1047R).

Genomic DNA from T-47D cell line, carrying H1047R mutation, was subjected to SNARE enrichment at original mutant fraction. DNA from T-47D cell line harbouring H1047R mutation was incubated with Si endonuclease for 1, 5, 10, and 20min to find the optimum incubation time. The assay was also tested with 0.1, 0.2, 0.4 and 0.6 units (U) 51 endonuclease to find the optimum Si endonuclease amount. The assay was also tested with probe concentrations at 20, 50, 100 and 200 nM to identify the optimum probe concentration.

1 min incubation time, 0.3 units Si endonuclease and 50 nM probe concentration were identified as the optimal conditions based on this experiment. Mutation detection was performed in enriched samples and matched untreated controls by SYBR Green qPCR method with wild type blocking primer. Data analysed by Met method, where relative amplification was calculated in regards to WT human genomic DNA, and shown as mean mutant fold amplification ± SD. Due to a limited enrichment reaction volume (10 pl), all qPCR points were obtained in duplicates in three independent experiments (n=3). **P<0.01, *P < 0.05 (One-way Anova test, GraphPad Prism software).

In subsequent experiments, each reaction contained 1p1 of lx Si buffer (5xS1 buffer is 200 mM sodium acetate (pH 4.5 at 25 °C), 1.5 M NaCI and 10 mM ZnSO4), top and bottom strand probes (50nM), 5 pl of cell line or tissue DNA (20 ng/pl) and DNAse-free water up to a volume of 10 pl. Samples were denatured on TC-512 (Techne) thermal cycler at 98°C for 2 min. The temperature was then reduced to 67C and after 20 min 0.2units of Si nuclease was added into the mixture followed by 1 min incubation at 67°C and 2 min at 95°C for Si nuclease inactivation. Control experiments without Si were run in parallel in all reactions.

No sample purification was performed after nuclease treatment. Samples were stored at - 20°C until further use.

Mutation detection for the PIK3CA H1047R mutation was performed using allele-specific real-time quantitative PCR for which has been described previously (Alvarez-Garcia et aL, 2018) . All qPCR primers and blocking oligonucleotides were purchased from Eurofins.

Reactions targeting the mutant sequence were performed in a reaction volume of 12.5 pl consisting of 6.25 pl of 2x Power Sybr Green master mix (Life Technologies, Catalogue Number: 4367660), 1.25 pl of each forward and reverse primers (final concentration 100 nM) (SEQ ID NOs: 18-19), blocking oligonucleotide (final concentration 200nM) (SEQ ID NO: 20), and 2.5 pl of DNA sample or appropriate control. Internal control reactions were prepared following the same protocol, however 1.25 pl of nucleic-acid free water was used instead of the blocking primer. Cycling conditions on Agilent Mx3005P OPCR system were 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds and 60°C for 60 seconds. Melting curve analysis was performed to confirm single, specific amplification product for each reaction. qPCR data was analysed by the comparative AACt method to calculate the change in fold amplification.

ACt = Ct target gene -Ct reference gene AACt = ACt test sample -ACt calibrator sample Fold difference = 2-tAAC PIK3CA H1047R primer sequences (5'-3'): PIK3CA MUTANT H1047R Fw: AACTGAGCAAGAGGCTTTGGAG (SEQ ID NO: 18) PIK3CA MUTANT H1047R Rv: TTGTTGTCCAGCCACCATGAC (SEQ ID NO: 19) Blocking oligonucleotide (5'-3'): PIK3CA WT BLOCKER (H1047R/L SITE): CCAGCCACCATGATGTGCAT-PHO (SEQ ID NO: 20) PHO refers to phosphate group modification on 3' end of the oligonucleotide.

Internal control -primer sequences: PIK3CA WT Fw: CATTTGCTCCAAACTGACCA (SEQ ID NO: 21) PIK3CA WT Rv: GATTGGCATGCTGTCGAATA (SEQ ID NO: 22) The internal control primers are designed to amplify a sequence that is within the PIK3CA gene but is not mutated. Therefore, the sequence targeted with the internal control primers is equally amplified regardless of any mutation, providing a reference amplicon to reveal PIK3CA template abundance.

All the tested samples were compared to wild type human genomic DNA (Bioline) and were considered to carry the mutation when the relative amplification of the mutant allele was statistically significant in comparison to a wild type control. T-47D cell line DNA harbouring the H1047R mutation was used as a positive control.

Results and Discussion Preliminary experiments were done to show the potential of the SNARE assay in comparison to no treatment control. To develop combined PIK3CA H1047R specific enrichment and qPCR detection, T-47D cell line DNA was applied to SNARE treatment with overlapping probes.

Genomic DNA from T-47D cell line, carrying H1047R mutation, was subjected to SNARE enrichment methodology with different conditions. Si endonuclease was incubated for different time periods (Fig. 3A), the Si endonuclease amount added to the reactant mixture was varied (Fig.3B) and the concentration of the probes added to the biological sample was varied (Fig.3C). Results showed that incubating sample with 50 nM probes and 0.2 U of Si nuclease for 1 min was the optimal conditions for relative amplification of the H1047R mutation compared to no treatment (Fig. 3A-C). Mutation enrichment with these conditions combined together resulted in significant increase in relative amplification of Si treated samples in comparison to untreated controls (Fig.3D).

Mutation detection was performed in enriched samples and matched untreated controls by SYBR Green qPCR method with wild type blocking primer. Data represents relative amplification calculated in regards to wild type human genomic DNA (hgDNA), and is shown as mean mutant fold amplification +/-standard deviation. Due to a limited enrichment reaction volume (10 pl), all qPCR points were obtained in duplicates in three independent experiments (n=3), Student's t test p=0.0144.

Example 2: Enriching mutation alleles at low abundance

Introduction

A limiting factor in the use of liquid biopsies is insufficient sensitivity of the detection methods to allow detection of the low amount of circulating tumour DNA. Mutations may have very low abundances so the ability of the SNARE methodology to enrich mutant alleles of interest at lower abundance was tested. This experiment is designed to test the ability of the SNARE method to be used to enrich low level circulating tumour DNA and allow its detection.

Method DNA from T-47D cell line harbouring H1047R mutation was diluted with wild type DNA to obtain a decreasing mutational abundance of 1%, 5% or 10%. Wild Type human genomic DNA (Bioline) was used as control. SNARE methodology with the optimal conditions described above was performed on the diluted DNA from T-47D cell line.

Mutation detection was performed in enriched samples and matched untreated controls by SYBR Green qPCR method with wild type blocking primer. Data analysed by Abet method as described above. Relative amplification was calculated in regards to WT human genomic DNA, and shown as mean mutant fold amplification ± SD (Ct values in the table). Due to a limited enrichment reaction volume (10 pl), all qPCR points were obtained in duplicates in three independent experiments (n=3). ***P <o00, **P<0.01, *P <0.05 (One-way Anova test, GraphPad Prism software). The results of this experiment are shown in Fig. 4 A and B. Results and Discussion Genomic DNA from the T-47D cell line, carrying H1047R mutation, was diluted in wild type DNA to achieve lower mutant allele fractions (10%, 5%, 1%) and subjected to SNARE enrichment methodology. In Fig. 4A, 10%, 5%, 1% and 0% (hgDNA) refer to mutant abundance fractions. In Fig. 4B, the table shows cycle threshold (Ct) values before and after at 10%, 5%, 1% and 0% (hgDNA) mutation abundance.

It should be noted that a difference up to 1xCt is tolerated between the replicates for the same sample and slight differences are natural due to pipetting errors.

Si enrichment was shown to significantly improve detection of the mutant allele over no treatment control (Fig. 4A-B). Detection of the H1047R mutant allele was possible even at 1% dilution, i.e. the limit of detection (LOD) was 1%.

Example 3: Further optimisation and comparison to known NaME-PrO assay

Introduction

All previous experiments were done with 10X DSN master buffer (500 mM Tris-HCI, pH 8.0; 50 mM MgC12; 10 mM DTT). Further experiments were done with Si Reaction Buffer (5x51 buffer is 200 mM sodium acetate (pH 4.5 at 25 °C), 1.5 M NaCI and 10 mM ZnSO4) and improved results were achieved.

Materials and methods Genomic DNA from T-47D cell line, carrying H1047R mutation, was subjected to SNARE enrichment at original mutant fraction (undiluted T-47D gDNA) (Fig. 5A) and also serially diluted in wild type DNA with decreasing mutation abundances 10%, 5%, 1% (Fig. 5B). The experiments were performed as above but instead of 10X DSN master buffer, diluted Si buffer was used. The SNARE method was compared to the NaME-PrO method. The NaME-PrO method was conducted as described above.

Mutation detection was performed in enriched samples and matched untreated controls by SYBR Green qPCR method with wild type blocking primer. Data analysed by AACt method, where relative amplification was calculated in regards to WT human genomic DNA, and shown as mean mutant fold amplification ± SD. Due to a limited enrichment reaction volume (10 pl), all qPCR points were obtained in duplicates in three independent experiments (n=3). "*"P <0.001, *"P<0.01, *P < 0.05 (One-way Anova test, GraphPad Prism software).

The SNARE assay was compared to the known enrichment method NaME-PrO using the endonuclease Duplex Specific Nuclease (DSN) described in (Song et al., 2016) and a no treatment control Nuclease-assisted minor-allele enrichment with probe-overlap (NaME-PrO) specific to wild type DNA designed for the enrichment of H1047R mutation was conducted for comparison to the SNARE methodology. Overlapping probes were designed with IDT OligoAnalyzer tool according to the assay. Sequences as below (shown 5' to 3'): PIK3CA H1047R Fw1CATGAAACAAATGAATGATGCACAT (SEQ ID NO: 23) PIK3CA H1047R Rv1 GCCACCATGATGTGCATCATT (SEQ ID NO:24) Underlined bases show the probe location corresponding to the PIK3CA H1047R point mutation (point mutation not present in these probes designed for the wild type sequence).

Each reaction contained 1p1 of 10x DSN buffer, top and bottom strand probes (20 nM final concentration), 5 pl of cell line or tissue DNA (20 ng/pl), and DNAse-free water up to a volume of 10 pl. Samples were denatured on TC-512 (Techne) thermal cycler at 98°C for 2 min. The temperature was then reduced to 67°C and 0.2 units of DSN (Evrogen) were added into the mixture followed by 20 min incubation at 67°C and 2 min at 95°C for DSN inactivation. Control experiments without DSN were run in parallel in all reactions. No sample purification was performed after nuclease treatment, and samples were stored at - 20°C until further use.

Results and Discussion Results showed a 34-fold higher PCR product formation for mutant samples that underwent enrichment in regards to wild type control (Fig. 5A). In comparison to a currently known NaME-PrO assay (labelled DSN in the Fig. 5A), no significant difference was observed in enrichment efficiency (Fig. 5A).

In order to show this assay could be potentially applied for circulating tumour DNA enrichment, lower mutant allele fractions were tested (Fig. 5B). Results showed correlation between decreasing allele fraction and specific target amplification in both cases -enriched and untreated samples. However, relative amplification was significantly higher for the samples treated with Si in comparison to those that didn't undergo nuclease treatment. The reported limit of detection (LOD) for the H1047R qPCR assay was -5% mutant fraction.

After mutant allele enrichment the lowest detected H1047R fraction was 1% (Fig. 5B).

The SNARE assay successfully enriches mutant allele and enhances the sensitivity of qPCR detection method. No significant difference was observed in enrichment efficiency between the SNARE assay and the NaME-Pro assay. The SNARE assay has the benefit of being more cost-effective and avoiding loss of circulating tumour DNA during the enrichment process. The SNARE assay would be potentially used to enrich clinically relevant targets in tumour biopsy and circulating DNA samples and enable their detection for diagnostic purposes.

Example 4-detecting further hotspot mutations The SNARE assay has the potential to be used to enrich a wide-range of clinically relevant hotspot mutations and enable their detection for diagnostic purposes.

The SNARE methodology described above can be applied to enriching other clinically relevant hotspot mutations such as the mutations listed in column 1 of Table 1. Nucleic acid probes for SNARE enrichment methodology of each of these hotspot mutations have been designed and can be found in the corresponding line of column 4 of Table 1. The probes may be modified by biotinylation, [NA bases, or 3' phosphates.

Mutation detection can be performed on enriched genomic DNA samples from blood or tumour biopsies and matched untreated controls. DNA samples can be serially diluted in wild type DNA to 10%, 5% and 1% mutation abundancies to test the efficiency of the SNARE assay in enriching low abundancy mutations in different tumour types.

The SNARE assay may be used to detect a wide range of oncogenic hotspot mutations in various cancer types such as the mutations in Table 1. Table 1 provides an example list of known hotspot mutations and some of the cancers associated with said hotspot mutations.

Each hotspot mutation may be associated with multiple cancer types and the cancer types listed in Table 1 are non-exhaustive. Therefore, the SNARE assay may be used to detect many different cancers in routine diagnostic testing.

Bibliography Aalipour, A. et a/. (2018) 'Deactivated crispr associated protein 9 for minor-allele enrichment in cell-free DNA', Clinical Chemistry, 64(2), pp. 307-316. doi: 10.1373/clinchem.2017.278911.

Alvarez-Garcia, V. et a/. (2018) 'A simple and robust real-time qPCR method for the detection of PIK3CA mutations', Scientific Reports, 8(1), pp. 1-10. doi: 10.1038/s41598-01830 22473-9.

Ang, D. et al. (2013) 'Novel method for PIK3CA mutation analysis: Locked nucleic acid-PCR sequencing', Journal of Molecular Diagnostics. American Society for Investigative Pathology, 15(3), pp. 312-318. doi: 10.1016/j.jmoldx.2012.12.005.

Cheng, D. T. et al. (2015) 'Memorial sloan kettering-integrated mutation profiling of actionable cancer targets (MSK-IM PACT): A hybridization capture-based next-generation sequencing clinical assay for solid tumor molecular oncology', Journal of Molecular Diagnostics. American Society for Investigative Pathology and the Association for Molecular Pathology, 17(3), pp. 251-264. doi: 10.10161.jmoldx.2014.12.006.

Denis, J. A. et al. (2017) The Role of BEAMing and Digital PCR for Multiplexed Analysis in Molecular Oncology in the Era of Next-Generation Sequencing', Molecular Diagnosis and Therapy, 21(6), pp. 587-600. doi: 10.1007/s40291-017-0287-7.

Desai, N. A. and Shankar, V. (2003) Single-strand-speci 0 c nucleases', 26.

Gorgannezhad, L. at al. (2018) 'Circulating tumor DNA and liquid biopsy: Opportunities, challenges, and recent advances in detection technologies', Lab on a Chip. Royal Society of Chemistry, 18(8), pp. 1174-1196. doi: 10.1039/c8Ic00100f.

lgnatiadis, M., Lee, M. and Jeffrey, S. S. (2015) 'Circulating tumor cells and circulating tumor DNA: Challenges and opportunities on the path to clinical utility', Clinical Cancer Research, 21(21), pp. 4786-4800. doi: 10.1158/1078-0432.CCR-14-1190.

Kidess, E. et al. (2015) 'Mutation profiling of tumor DNA from plasma and tumor tissue of colorectal cancer patients with a novel, high-sensitivity multiplexed mutation detection platform', Oncotarget, 6(4), pp. 2549-2561. doi: 10.18632/oncotarget.3041.

Krypuy, M. et al. (2006) 'High resolution melting analysis for the rapid and sensitive detection of mutations in clinical samples: KRAS codon 12 and 13 mutations in non-small cell lung cancer', BMC Cancer, 6, pp. 1-12. doi: 10.1186/1471-2407-6-295.

Lennon, N. J., Adalsteinsson, V. A. and Gabriel, S. B. (2016) 'Technological considerations for genome-guided diagnosis and management of cancer', Genome Medicine. Genome Medicine, 8(1), pp. 1-10. doi: 10.1186/s13073-016-0370-4.

Liu, Y. et aL (2017) 'Methylation-sensitive enrichment of minor DNA alleles using a double-strand DNA-specific nuclease', Nucleic Acids Research, 45(6), pp. 1-11. doi: 10.1093/nar/gkw1166.

Markou, Athina; Tzanikou, Elena; Ladas, lonnis, Makrigiorgos, G. Mike; Lianidou, E. (2019) 'Nuclease-Assisted Minor Allele Enrichment Using Overlapping Probes-Assisted Aplification-Refractory Mutation System: An Approach for the Improvement of Amplification-Refractory Mutation System-Plymerase Chain Reaction Specificity in Liquid Biopsies', Anal Chem., 91(29), pp. 13105-13111. doi: 10.1016/j.gde.2016.03.011.

Milbury, C. A. et a/. (2011) 'COLD-PCR: Improving the sensitivity of molecular diagnostics assays', Expert Review of Molecular Diagnostics, 11(2), pp. 159-169. doi: 10.1586/erm.10.115.

Olmedillas-LOpez, S., Garcia-Arranz, M. and Garcia-Olmo, D. (2017) 'Current and Emerging Applications of Droplet Digital PCR in Oncology', Molecular Diagnosis and Therapy, 21(5), pp. 493-510. doi: 10.1007/s40291-017-0278-8.

Song, C. et al. (2016) 'Elimination of unaltered DNA in mixed clinical samples via nuclease-assisted minor-allele enrichment', Nucleic Acids Research, 44(19), pp. 1-11. doi: 10.1093/nar/gkw650.

Wang, J. et al. (2017) 'Application of liquid biopsy in precision medicine: opportunities and challenges', Frontiers of Medicine, 11(4), pp. 522-527. doi: 10.1007/s11684-017-0526-7. Zhao, J. et al. (2016) 'A sensitive and practical method to detect the T790M mutation in the epidermal growth factor receptor', Oncology Letters, 11(4), pp. 2573-2579. doi: 10.3892/o1.2016.4263.

Claims

Claims 1. A method of enriching an at least one nucleic acid sequence of interest, the method comprising the steps: providing a biological sample comprising a plurality of nucleic acids including the at least one nucleic acid sequence of interest; providing at least one nucleic acid probe, wherein each of the at least one nucleic acid probe has at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest; providing an endonuclease, wherein the endonuclease is configured to cleave single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity; adding the at least one nucleic acid probe to the biological sample and incubating under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest creating a reactant mixture; adding the endonuclease to the reactant mixture and incubating under suitable conditions to form an enriched mixture, wherein the proportion of the at least one nucleic acid of interest within the enriched mixture is greater than the proportion of the at least one nucleic acid of interest within the biological sample.
2. The method of claim 1, wherein the plurality of nucleic acid sequences in the biological sample are double stranded nucleic acid sequences or a mixture of double stranded nucleic acid sequences and single stranded nucleic acid sequences.
3. The method of claim 1, wherein the plurality of nucleic acid sequences in the biological sample are single stranded nucleic acids.
4. The method of claim 2, wherein following the addition of at least one nucleic acid probe to the biological sample the resultant mixture is incubated under denaturing conditions so that at least the majority of the double stranded nucleic acid sequences denature into single stranded nucleic acid sequences.
5. The method of claim 4, wherein following the incubation under denaturing conditions, the denaturing conditions are removed.
6. The method of claim 5, wherein following the removal of denaturing conditions, the reactant mixture is incubated under conditions suitable for the at one nucleic acid probe to hybridise to at least one nucleic acid sequence of interest.
7. The method of claim 2, or claim 4 to claim 6, wherein applying denaturing conditions is done by raising the pH of the solution to over 11, by addition of a chemical agent, such as formamide, guanidine, sodium salicylate, dimethyl sulfoxide (DMSO), propylene glycol, or urea, by exposure to air, by sonication, by radiation, by incubation at a temperature of over 90°C, or by incubation at a temperature of 98°C for at least 10 seconds, 20 seconds, 30 seconds, 60 seconds or 120 seconds.
8. The method of claim 3, wherein following the adding the at least one nucleic acid probe to the biological sample the resultant mixture is incubated under conditions suitable for the at one nucleic acid probe to hybridise to at least one nucleic acid sequence of interest.
9. The method of any preceding claim, wherein conditions suitable for the at one nucleic acid probe to hybridise to at least one nucleic acid sequence of interest are incubation at a temperature from 55°C to 75°C, preferably from 60°C to 70°C, more preferably from 63°C to 68°C
10. The method of claim 9, wherein incubation is carried out for at least 1 minute, 2 minutes, 3 minutes, 5 minutes, 8 minutes, 10 minutes, 20 minutes, 30 minutes or 40 minutes.
11. The method of any preceding claim, wherein the endonuclease is any of P1 nuclease, N. crassa nucleases, BAL 31 nucleases, U. Maydis nucleases, nuclease Bh1, Aspergillus nuclease, Physarum nuclease, SP nuclease, Mung bean nuclease, wheat chloroplast nuclease, Rye germ ribosomes, Pea seed nuclease, Tabacco nuclease I, and Alfalfa seedling nucleases, Si endonuclease or T7 endonuclease 1.
12. The method of claim 11, wherein the endonuclease is Si endonuclease.
13. The method of any preceding claim, wherein the nucleic acid sequence of interest is associated with a disease.
14. The method of claim 13, wherein the nucleic acid sequence of interest is associated with cancer.
15. The method of claim 14, wherein the nucleic acid sequence of interest is mutant sequence shed from a tumour.
16. The method of any preceding claim, wherein the at least one nucleic acid sequence of interest is PIK3CA with H1047R mutation.
17. The method of any preceding claim, wherein the at least one nucleic acid probe is 100% complementary to at least a portion of the nucleic acid sequence of interest.
18. The method of claim 17 when dependent on claims 1, 2, 4-7, 9-16, wherein the at least one nucleic acid sequence of interest is found within a double stranded nucleic acid of interest, wherein the double stranded nucleic acid of interest comprises a first strand and a second strand and wherein the method comprises two nucleic acid probes, wherein a first nucleic acid probe has a sequence which is 100% complementary to at least 5 consecutive bases of a portion of the first strand and a second nucleic acid probe has a sequence which is 100% complementary to at least 5 consecutive bases of a portion of the second strand.
19. The method of claim 18 wherein the sequence to which the first nucleic acid probe is 100% complementary to the reverse complement to the sequence to which the second nucleic acid probe is 100% complementary.
20. The method of claim 17 when dependent on any of claims 1, 3 or 8, wherein the at least one nucleic acid sequence of interest is found within a single stranded nucleic acid of interest, wherein the method comprises a nucleic acid probe, wherein a nucleic acid probe has a sequence which is 100% complementary to at least 5 consecutive bases of the single stranded nucleic acid.
21. The method of any preceding claim, wherein the at least one nucleic acid probe is from 10 bases to 30 bases in length, preferably from 15 bases to 25 bases in length.
22. The method of any preceding claim, wherein the at least one nucleic acid probe is added in a concentration from 20 to 200 nM, preferably from 30 to 100 nM.
23. The method of any preceding claim, wherein the endonuclease is added in concentration from 0.1 to O. 6 U in a reaction volume of 10 p1, preferably from 0.1 U to 0.3 U in a reaction volume of 10 pl
24. The method of any preceding claim wherein the endonuclease is added to the reactant mixture in one of the following buffers: DSN buffer, 10mM MgC12, 5mM ZnSat and 10mM KCI buffer or Si buffer.
25. The method of claim 24 when dependent on claim 12 wherein the Si endonuclease is added to the reactant mixture in Si buffer.
26. The method of any preceding claim, wherein the incubation of the endonuclease in the reactant mixture to form enriched mixture is carried out at a temperature from 55 °C to 75°C, preferably from 60°C to 70°C.
27. The method claim 26, wherein the incubation is carried out for at least 1 minute, 2 minutes, 3 minutes, 5 minutes, 8 minutes, 10 minutes, 20 minutes, 30 minutes or 40 minutes.
28. The method of any preceding claim, wherein the method comprises a further step of inactivating the endonuclease following the formation of the enriched mixture by incubation at a temperature over 90°C.
29. The method of any preceding claim, wherein the biological sample comprises genomic DNA.
30. The method of any preceding claim, wherein the biological sample is obtained from tissue or bodily fluids.
31. The method of any preceding claim, wherein the at least one nucleic acid probe comprises a sequence according to any one of SEQ ID NO: 1-15.
32. A kit for enriching at least one nucleic acid sequence of interest comprising: at least one nucleic acid probe wherein each of the at least one nucleic acid probe has at least 5 consecutive bases with 100°/0 complementarity to at least a portion of one of the at least one nucleic acid sequence of interest; an endonuclease, wherein the endonuclease is configured to cleave single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity; wherein during use the at least one nucleic acid probe is added to a biological sample comprising a plurality of nucleic acids including the at least on nucleic acid sequence of interest and incubated under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest creating a reactant mixture, and wherein addition of the endonuclease to the reactant mixture and incubation under suitable conditions for the endonuclease to be active results in the formation of an enriched mixture, wherein the proportion of the at least one nucleic acid of interest within the enriched mixture is greater than the proportion the at least one nucleic acid of interest within the biological sample.
33. A kit according to claim 32, wherein the biological sample comprises a plurality of double stranded nucleic acids and the kit further comprises means for denaturing double stranded nucleic acid sequences into single stranded nucleic acid sequences.
34. A kit according to claim 33 wherein during use the means for denaturing are applied to a biological sample comprising a plurality of double stranded nucleic acid sequences such that at least the majority of the double stranded nucleic acid sequences within the biological sample are denatured into single stranded nucleic acid sequences before incubation of at least one nucleic acid probe and the biological sample under suitable conditions to create a reactant mixture.
35. A nucleic acid probe for use in the method according to any one of claims 1 to 31.
36. The nucleic acid probe for use according to claim 35, wherein at least one nucleic acid probe has at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest.
37. The nucleic acid probe for use according to claim 35 or claim 36, wherein the nucleic acid probe has the structure A-B-C, wherein B denotes the at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest and A and B denote optional flanking sequences.
38. The nucleic acid probe for use according to claim 37, wherein A and B comprise sequence with 100% complementarity to the portions of the at least one nucleic acid sequence of interest immediately adjacent to the portion of one of the at least one nucleic acid sequence of interest which is 100% complementary to B.
39. The nucleic acid probe for use according to claims 35-38, wherein the at least one nucleic acid probe comprises a sequence according to any one of SEQ ID NO: 1-15.
40. A method for detecting a nucleic acid sequence of interest, the method comprising: providing a biological sample comprising a plurality of nucleic acids including the at least one nucleic acid sequence of interest; - providing at least one nucleic acid probe, wherein each of the at least one nucleic acid probe has at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest; providing an endonuclease, wherein the endonuclease is configured to cleave single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity; adding the at least one nucleic acid probe to the biological sample and incubating under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest creating a reactant mixture; providing the endonuclease to the reactant mixture and incubating under suitable conditions to form an enriched mixture, wherein the proportion of the at least one nucleic acid of interest within the enriched mixture is greater than the proportion the at least one nucleic acid of interest within the biological sample; amplifying the at least one nucleic acid sequence of interest; and detecting the at least one nucleic acid sequence of interest.
41. The method of clam 40, wherein the at least one nucleic acid sequence of interest is amplified by PCR.
42. The method of claim 40 or claim 41, wherein the at least one nucleic acid probe comprises a sequence according to any one of SEQ ID NO: 1-15.
43. The method of any one of claim 40 to claim 42, wherein the step of amplifying the at least one nucleic acid sequence of interest and the step of detecting the at least one nucleic acid sequence of interest are performed by INTPLEX qPCR.
44. A method of diagnosis of a disease associated with a genetic mutation, wherein the genetic mutation is found within at least one nucleic acid sequence of interest, the method comprising: providing a biological sample comprising a plurality of nucleic acids including the at least one nucleic acid sequence of interest; providing at least one nucleic acid probe, wherein each of the at least one nucleic acid probe has at least 5 consecutive bases with 100% complementarity to at least a portion of one of the at least one nucleic acid sequence of interest; providing an endonuclease, wherein the endonuclease is configured to cleave single stranded nucleic acids and double stranded nucleic acids with partial complementarity but not to cleave double stranded nucleic acids with full complementarity; adding the at least one nucleic acid probe to the biological sample and incubating under suitable conditions such that the at least one nucleic acid probe hybridises to at least one nucleic acid sequence of interest creating a reactant mixture; - providing the endonuclease to the reactant mixture and incubating under suitable conditions to form an enriched mixture, wherein the proportion of the at least one nucleic acid of interest within the enriched mixture is greater than the proportion the at least one nucleic acid of interest within the biological sample; amplifying the at least one nucleic acid sequence of interest; - detecting the at least one nucleic acid sequence of interest; and wherein detection of the at least one nucleic acid sequence of interest is indicative of the disease associated with the genetic mutation.