Classifications

• • B—PERFORMING OPERATIONS; TRANSPORTING
  • B09—DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
  • B09C—RECLAMATION OF CONTAMINATED SOIL
  • B09C1/00—Reclamation of contaminated soil
  • B09C1/10—Reclamation of contaminated soil microbiologically, biologically or by using enzymes
• • C—CHEMISTRY; METALLURGY
  • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F3/00—Biological treatment of water, waste water, or sewage
  • C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
• • C—CHEMISTRY; METALLURGY
  • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F3/00—Biological treatment of water, waste water, or sewage
  • C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
  • C02F3/344—Biological treatment of water, waste water, or sewage characterised by the microorganisms used for digestion of mineral oil
• • C—CHEMISTRY; METALLURGY
  • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F3/00—Biological treatment of water, waste water, or sewage
  • C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
  • C02F3/345—Biological treatment of water, waste water, or sewage characterised by the microorganisms used for biological oxidation or reduction of sulfur compounds
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N1/00—Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
  • C12N1/20—Bacteria; Culture media therefor
  • C12N1/205—Bacterial isolates
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y301/00—Hydrolases acting on ester bonds (3.1)
  • C12Y301/06—Sulfuric ester hydrolases (3.1.6)
• • B—PERFORMING OPERATIONS; TRANSPORTING
  • B09—DISPOSAL OF SOLID WASTE; RECLAMATION OF CONTAMINATED SOIL
  • B09C—RECLAMATION OF CONTAMINATED SOIL
  • B09C2101/00—In situ
• • C—CHEMISTRY; METALLURGY
  • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F2101/00—Nature of the contaminant
  • C02F2101/30—Organic compounds
  • C02F2101/301—Detergents, surfactants
• • C—CHEMISTRY; METALLURGY
  • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F2101/00—Nature of the contaminant
  • C02F2101/30—Organic compounds
  • C02F2101/306—Pesticides
• • C—CHEMISTRY; METALLURGY
  • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F2101/00—Nature of the contaminant
  • C02F2101/30—Organic compounds
  • C02F2101/32—Hydrocarbons, e.g. oil
• • C—CHEMISTRY; METALLURGY
  • C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
  • C02F2303/00—Specific treatment goals
  • C02F2303/18—Removal of treatment agents after treatment
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
  • C12R2001/00—Microorganisms ; Processes using microorganisms
  • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
  • C12R2001/38—Pseudomonas

Definitions

• the invention provides novel bacterial strains Pseudomonas jessenii AP3_16 B/00139 and Pseudomonas laurylosulfatovorans AP3_22, which, thanks to produced enzymes, particularly the alkylsulfatases, exhibit exceptional capabilities to survive in high concentrations of surface active agents, such as anionic detergents as well as the ability to decompose such compounds.
• the invention also provides the method of decontamination of the environment contaminated with sulfuric esters, including surface active agents containing sulfuric-ester ester bond, using microorganism expressing alkylsulfatase, or isolated bacterial alkylsulfatase, wherein said microorganism, its lysate or the isolated enzyme with alkylsulfatase activity is introduced into the treated environment.
• the invention also provides novel bacterial strains Pseudomonas jessenii AP3_16 B/00139 and Pseudomonas laurylosulfatovorans AP3_22 which are used in said method and/or are the source of the novel proteins with alkylsulfatase activity, as well as composition comprising thereof.
• the invention also provides novel isolated protein coding alkylsulfatase, the construct of the nucleic acid coding said protein, expression vector able to express nucleic acid construct coding said protein and host cell comprising this nucleid acid construct or the vector which could be used to express this protein.
• the invention also provides the method of producing novel bacterial strains able to decompose sulfuric esters as well as novel bacterial strains obtained using said method.
• the invention also provides the method of obtaining the alkylsulfatase protein and preparation comprising it.
• the invention provides also the use of the novel bacterial strains Pseudomonas jessenii AP3_16 B/00139 and Pseudomonas laurylosulfatovorans AP3_22 and/or lysate thereof, the alkylsulfatase protein, the composition comprising said protein or the novel strain or their mixture for decomposing of the sulfuric esters.
• Novel bacterial strains as well as novel alkylsulfatases provide effective bioremediation method of environment contaminated with xenobiotics.
• Novel bacterial strains as well as the purified proteins could be a valuable source of novel biotools useful in the bioremediation of surface active agents, particularly surfactants and detergents or biotransformation in industrial processes. Background art
• Surfactants are amphiphilic compounds with both hydrophilic and hydrophobic parts. This allows them to accumulate at the interfaces between air and water, or water and oil phases and lower the surface tension. According to their charge in aqueous solutions, surfactants can be grouped into anionic, nonionic, cationic, or amphoteric classes (Im et al., 2008). The low price and beneficial properties of anionic surfactants make them popular additives to a wide range of products such as: cosmetics, pharmaceuticals, household and industrial cleaning products, and in agriculture as adjuvants improving pesticide spraying properties and penetration.
• Anionic surfactants such as detergents e.g. lauryl sulfate (SDS, sodium dodecyl sulfate) are known to have bacteriostatic or even bactericidal properties and inhibit the growth of some nitrogen-assimilating cyanobacteria, algae, crustaceans, and also fishes (Lechuga et al., 2016; Sandbacka et al., 2000).
• Amphoteric features of anionic surfactants underly the mechanism of their accumulation in living organisms and toxicity. Negatively charged acidic part (sulphate group in case of SDS) interact with intracellular components by electrostatic forces, while long chain alcohol binds to cellular proteins by hydrophobic forces (Cserhati et al., 2002).
• lauryl sulfate is one of the most popular detergent proposed for soil bioremediation (Yu et al., 2007; Zhou and Zhu, 2008; Moldes et al., 2013).
• bioremediation stimulated by lauryl sulfate expert suggest use in parallel several types of microorganisms with different biochemical properties.
• microorganisms capable of degrading xenobiotics but resistant to high concentrations of detergent Next to use of microorganisms effectively removing surface active agents from environment, when the xenobiotic bioremediation process was completed.
• microorganisms were selected from environments highly contaminated solely with detergents where there were no other xenobiotics present.
• Surface active agents such as detergents are also widely used as an additives to products containing pesticides allowing the final product to fullfil demands of the end user.
• sulfatases EC 3.1.6.-
• This heterogeneous group of enzymes can be divided into at least three distinct classes, depending on the mechanism of catalysis (Kertesz, 2000).
• the first group gathers arylsulfatases, proteins with highly conserved consensus motif
• the second group consists of Fe(ll) dependent dioxygenases, catalyzing an oxidative cleavage of the sulfate ester to the corresponding aldehyde and inorganic sulfate, with AtsK from Pseudomonas putida as a model example (Miiller et al., 2004).
• the third class includes enzymes with the metallo-3-lactamase-like domain at the N-terminus and SCP-2-like domain at C-terminus of the protein, involved in the binding of sterols.
• this sulfatase class is represented by four sulfatases with different substrate specificity: SdsA having activity towards sodium dodecyl sulfate (SDS) (Davison et al., 1992), SdsAP and SdsA1 active toward primary sulfate esters including sodium dodecyl sulfate (Hagelueken et al., 2006; Long et al., 201 1 ; Schober et al., 201 1 ) and PisA1 specific towards secondary alkyl sulfates (Schober et al., 201 1 ).
• Enzymes from this group differ in the mechanism of action and have ability to catalyze cleavage either of S-0 or C-0 bond causing, in case of assymetrical substrate, the retention or inversion of the product alcohol, which could be verified using chiral or labeled substrates.
• SdsA1 and PisA1 proteins revealed that both sulfatases catalyze cleavage of the C-0 bond.
• the aim of the present invention is to overcome the inconveniences related with removal of anionic detergents from the environment for example from soil, water, solution, preferably wastewater, industrial installation.
• the invention is also intended to provide tools to catalyze the chemical reactions leading to hydrolysis of alkyl and/or arylo sulfonic derivatives.
• the object of this invention is therefore to provide novel bacterial strains and/or constructs to obtain improved bacterial strains able to catalyze the hydrolysis of sulfuric esters, e.g. surface active agents, which are also resistant to high concentrations of surface active agents in the environment and other xenobiotics, e.g. pesticides or hydrocarbons.
• the object of this invention is also to provide novel alkylsulfatases, production of which in the active form allowing to catalyze the hydrolysis of the ester bond of sulfuric esters, e.g. surface active agents, what is possible by their overexpression in the heterologous expression systems preferably Eschericha coli host cells.
• the object of this invention is also to provide alkylsulfatases preparations which are able to hydrolyze the selected sulfuric esters, e.g. surface active agents.
• microorganisms described in the present patent application were isolated from the peaty soil (originating from the root zone) sampled from the subsurface flow constructed wetland of a wastewater treatment plant operated by pesticide packaging company. This strategy allowed to isolate microorganisms capable of both degradation of surface active agents as well as having resistance to high concentrations of other xenobiotics, e.g. pesticides. Moreover, the experiments also revealed in the isolated microorganisms presence of enzymes with alkylsulfatase activity, which are able to catalyze the cleavage of the sodium dodecyl sulfate to the sulfiric acid residue and the long-chain alcohol.
• Enzymes with sulfatases activity isolated from the bacterial strains described in present invention were characterized regarding the amino acid composition and biochemical properties. The results showed that the proteins should be classified to the third class of bacterial sulfatases.
• the inventors isolated and characterized 36 bacterial strains of Pseudomonas spp. that are able to decompose detergent - sodium dodecyl sulfate, although they varied significantly in their ability to use this surface active agent as the sole carbon source.
• the microorganisms were isolated from the subsurface flow constructed wetland of a wastewater treatment plant operated by pesticide packaging company. The isolated microorganisms showed the taxonomical similarity to Pseudomonas jessenii subgroup.
• the invention also provides the method of decontamination of the environment, in particular soil, water, solution, industrial installation contaminated with sulfuric esters, in particular surface active agents including compounds containing sulfuric-ester ester bond, using microorganism expressing alkylsulfatase, or isolated bacterial alkylsulfatase wherein
• alkylsulfatase comprises amino acid sequence encoded by nucleotide sequence comprising sequence set forth in SEQ ID NO: 3 or 4 or at least 95% identical to it, in particular alkylsulfatase comprises amino acid sequence set forth in SEQ ID NO: 1 or 2 or at least 95% identical to it;
• microorganism wherein aforementioned microorganism, its lysate or the enzyme with alkylsulfatase activity isolated from the microorganism is introduced into the treated environment.
• the sulfuric ester is sodium dodecyl sulfate.
• the object of the invention is also the Pseudomonas jessenii AP3_16 strain deposited on the 30 th August 2017 in the Polish Collection of Microorganisms (PCM) of the Institute of Immunology and Experimental Therapy PAS under the number B/00139.
• PCM Polish Collection of Microorganisms
• the object of the invention is also the Pseudomonas laurylsulfatovorans AP3_22 strain deposited on the 30 th August 2017 in the Polish Collection of Microorganisms (PCM) of the Institute of Immunology and Experimental Therapy PAS under the number B/00140.
• the deposited bacterial strains of the invention show the expression of the alkylsulfatases comprising amino acid sequences set forth in SEQ ID NO: 1 and 2 (for Pseudomonas laurylsulfatovorans AP3_22 and Pseudomonas jessenii AP3_16 respectively).
• the alkylsulfatases expressed by the aforementioned strains show high sequence similarity (about 93%) and ensure efficient degradation of sulfuric esters, in particular surface active agents including compounds containing sulfuric-ester ester bond, in particular sodium dodecyl sulfate.
• the inventors reported that the alkylsulfatase comprising the sequence set forth in SEQ ID NO: 1 and 2 could be introduced to other bacterial species and enabled these species to efficiently degrade aforementioned surface active agents.
• These enzymes are also able to hydrolyze the ester bond of the sulfuric esters including surface active agents comprising such bond, e.g. sodium dodecyl sulfate, in broad range of pH and temperature.
• both specified Pseudomonas strains show resistance to xenobiotics and could be used in the bioremediation of environment contaminated not only by surface active agents but also other xenobiotics, e.g. pesticides or hydrocarbons.
• the object of the invention is also the method of the environment decontamination, wherein the treatment of the environment contaminated with sulfuric esters including surface active agents including compounds containing sulfuric-ester ester bond is a part of bioremediation process of the environment contaminated with xenobiotics, preferably hydrocarbons wherein the microorganism producing alkylsulfatase is Pseudomonas jessenii AP3_16 and/or Pseudomonas laurylsulfatovorans AP3_22.
• the object of the invention is also protein, comprising amino acid sequence encoded by nucleotide sequence comprising sequence set forth in SEQ ID NO: 3 or 4 or at least 95% identical with it, in particular comprising amino acid sequence set forth in SEQ ID NO: 1 or 2 or sequence at least 95% identical with it, with alkylsulfatase activity.
• the object of the invention is also the nucleic acid construct encoding protein according to the invention.
• the object of the invention is also an expression vector comprising the construct according to the invention.
• the object of the invention is also the host cell comprising construct according to the invention or the expression vector according to the invention.
• the host cell is a single-cell mesophilic organism, in particular E. coli, more preferably E. coli BL21.
• the object of the invention is also the method of producing the bacterial strains able to decompose sulfuric esters including surface active agents comprising compounds containing sulfuric-ester ester bond in environment, comprising introducting of the construct according to the invention or vector according to the invention into the bacterial cell by genetic engineering or using natural horizontal gene transfer, preferably directly in the environment.
• the object of the invention is also a bacterial strain obtained by the method of producing bacterial strains able to decompose sulfuric esters including surface active agents comprising compounds containing sulfuric-ester ester bond according to the invention.
• the object of the invention is also the method of production of alkylsulfatase protein, comprising the step of culturing the host cell in conditions allowing the expression of proteins, wherein the host cell expresses the protein according to the invention comprising amino acid sequence encoded by nucleotide sequence comprising sequence set forth in SEQ ID NO: 3 or 4 or at least 95% identical with it, in particular protein comprising amino acid sequence set forth in SEQ ID NO: 1 or 2 or sequence at least 95% identical with it with alkylsulfatase activity.
• the object of the invention is also the composition comprising the protein according to the invention or protein produced with the method according to the invention.
• the object of the invention is also the composition comprising the bacterial strain Pseudomonas jessenii AP3_16 and/or Pseudomonas laurylsulfatovorans AP3_22 and/or bacterial strain obtained by the method of providing the bacterial strains able to decompose sulfuric esters according to the invention and/or the cell comprising the construct according to the invention and/or the vector according to the invention.
• the object of the invention is also the use of the bacterial strain Pseudomonas jessenii AP3_16 and/or Pseudomonas laurylsulfatovorans AP3_22 and/or bacterial strain obtained by the method of providing the bacterial strains able to decompose sulfuric esters according to the invention and/or the lysate of the aforementioned strains or the protein according to the invention and/or the composition comprising the bacterial strain Pseudomonas jessenii AP3_16 and/or Pseudomonas laurylsulfatovorans AP3_22 and/or bacterial strain obtained by the method of providing the bacterial strains able to decompose sulfuric esters according to the invention and/or the cell comprising the construct according to the invention and/or the vector according to the invention to the decomposition of the sulfuric esters including surface active agents comprising compounds containing sulfuric-ester ester bond in the environment, in particular soil, water
• the object of the invention is also the method of bioremediation of environment contaminated with xenobiotics comprising:
• step of introducting of the surface active agents comprising compounds containing sulfuric ester ester bond to increase the solubility of hydrocarbons in the water solutions and thus improve their bioavailability for microorganisms b) step of introducting of the microorganisms capable of degrading the xenobiotic which caused the contamination but also resistant to the high concentrations of surface active agents, and
• step of introducting of the novel bacterial strain Pseudomonas jessenii AP3_16 and/or Pseudomonas laurylsulfatovorans AP3_22 and/or bacterial strain obtained by the method of providing the bacterial strains able to decompose sulfuric esters according to the invention and/or the lysate of the aforementioned strains or the protein according to the invention and/or the composition comprising strains according to the invention or a combination thereof, to remove surface active agents from the treated water or soil.
• Scope of the present invention covers novel strains Pseudomonas jessenii AP3_16 deposited on the 30 th August 2017 in the Polish Collection of Microorganisms (PCM) of the Institute of Immunology and Experimental Therapy PAS under the number B/00139 and Pseudomonas laurylosulfatovorans AP3_22 deposited on the 30 th August 2017 in the Polish Collection of Microorganisms (PCM) of the Institute of Immunology and Experimental Therapy PAS under the number B/00140 and their functional derivatives.
• PCM Polish Collection of Microorganisms
• PCM Polish Collection of Microorganisms
• novel variant of the strain or strains obtained by the method according to the invention or functional derivative of the strain is to be understood as a mutant strain or strain obtained by culturing the deposited strain or strains obtained by the method according to the invention as the starting material, which comprises the nucleic acid fragment coding at least one of the alkylsulfatases set forth in the SEQ ID NO: 1-2, in particular nucleic acid fragment comprising sequence set forth in SEQ ID NO: 3 or 4, wherein such strain is able to hydrolyze the ester bond of the sulfuric esters, in particular surface active agents.
• strains belonging to Pseudomonas jessenii group preferably Pseudomonas jessenii AP3_16 and Pseudomonas laurylsulfatovorans AP3_22 are able to survive in the highly contaminated environment and also have the ability to decompose surface active agents, preferably sodium dodecyl sulfate up to 80% from the initial concentration of 1 g/L within 8 hours and are able to tolerate very high concentration of SDS in the environment reaching up to 25 g/L.
• Pseudomonas jessenii group preferably Pseudomonas jessenii AP3_16 and Pseudomonas laurylsulfatovorans AP3_22 are able to survive in the highly contaminated environment and also have the ability to decompose surface active agents, preferably sodium dodecyl sulfate up to 80% from the initial concentration of 1 g/L within 8 hours and are able
• the inventors basing on the sequence similarity, identified in the genomes of the isolated strains of Pseudomonas spp. able to hydrolyze the ester bond of sulfuric esters genes encoding sulfatases. Twenty one genome fragments comprising identified genes together with the promoter regions were cloned into vectors maintained in E. coli TOP10 strain, which were then tested for the SDS degradation capabilities. Unexpectedly, two of the obtained constructs provide the host cells with the ability to decompose sodium dodecyl sulfate.
• strains or their lysates or proteins isolated from these strains are useful in the bioremediation including the bioremediation of environments contaminated with surface active agents.
• the constructs, e.g. plasmids carrying the genes providing the strains the abilities to hydrolyze the ester bond of sulfuric esters including surface active agents such as sodium dodecyl sulfate could be used for the production of novel strains capable of this process or to improve the strains already having such properties.
• Term35bioremediation is to be understood as transformation of the harmful substances present in the environment to the less toxic or completely safe metabolites using the microorganisms or higher organisms.
• ком ⁇ ина ⁇ ии means the introduction into natural or degraded environment, of selected strains or a composition of microorganisms in order to increase the performance and capabilities of the course of a given process.
• the plasmid can be introduced into the environment through the method of bioaugmentation.
• a strain comprising construct or vector carrying any nucleotide sequence set forth in SEQ ID NO: 3-4 or their derivatives is introduced into the environment contaminated with surface active agents and as a result of natural horizontal gene transfer, e.g. the conjugation, the construct or vector comprising any nucleotide sequence set forth in SEQ ID NO 3-4 according to the invention is transferred into the cells of indigenous microflora.
• the inventors developed the method of the construction of strains able to hydrolyze the ester bond of the sulfuric esters, in particular surface active agents, also based on the autochthonic microorganisms isolated from the natural environment, without geographical limitations, preferably from the environment contaminated with surface active agents or hydrocarbons or pesticides mobilization and decontamination of which require usage of surface active agents.
• the hydrolysis of S-0 bond is carried out by the Pseudomonas jessenii AP3_16 or Pseudomonas laurylsulfatovorans AP3_22 or novel bacterial strain able to hydrolyze the ester bond of sulfuric esters obtained by the method according to the invention or the composition of strains able to hydrolyze the ester bond of the sulfuric esters or combination thereof.
• the invention relates to the construct or vector comprising any nucleotide sequence set forth in SEQ ID NO: 3-4 or its functional derivative.
• construct or vector comprising any nucleotide sequence set forth in SEQ ID NO: 3-4 or its functional derivative.
• Such construct could be used as a plasmid or as a sequence fragment integrated into bacterial genome for constructing strains capable of hydrolysis of esters of aliphatic and aromatic alcohols, in particular surface active agents.
• a bacterial strain comprising construct or vector, for example a plasmid comprising any nucleotide sequence set forth in SEQ ID NO: 3-4 or its functional derivative or bacterial strain comprising any nucleotide sequence set forth in SEQ ID NO: 3-4 or its functional derivative integrated into its genome could be used.
• Strains comprising any nucleotide sequence set forth in SEQ ID NO: 3-4 or its functional derivative would be able to hydrolyze the esters of aliphatic and aromatic alcohols.
• Term substrate is to be understood as any organic compound comprising the C-O or S-0 bond.
• alkylsulfatases such as CD175_09595 (SEQ ID NO: 2) or B0D71_15760 (SEQ ID NO: 1) could be used in the hydrolysis of ester bond of sulfuric esters. Particularly preferred application is to use these proteins in the hydrolysis of the ester bond of the sulfuric esters in solutions containing K + and Mg 2+ ions which increase activity of these sulfatases.
• the analyzed alkylsufatases differ in the sensitivity towards Na + , Mn 2+ and 10 mM Ca 2+ ions.
• B0D71_15760 (SEQ ID NO: 1 ) enzyme is activated with Na + ions in 10 mM concentration, although higer concentration of these ions (100 mM) have no significant effect on the alkylsulfatase activity.
• the CD175_09595 (SEQ ID NO: 2) is inhibited by the highier concentrations of Na + ions, while lower sodium ions concentration have no effect on enzyme activity.
• Mn 2+ ions did not affect CD175_09595 (SEQ ID NO: 2) activity, although they have positive effect on B0D71_15670 (SEQ ID NO: 1 ) activity, similarly to lower tested concentration of 10mM Ca 2+ ions.
• alkylsulfatase such as CD175_09595 (SEQ ID NO: 2) or B0D71_15760 (SEQ ID NO: 1) in the hydrolysis of ester bond of sulfuric esters could be performed in the pH of which is preferably in pH range from 6.0 to 9.0 with optimum in pH 8 and in broad spectrum of tempertures (30-90°C).
• the optimal temperature for CD175_09595 (SEQ ID NO: 2) alkylsulfatase is 60°C and for B0D71_15760 (SEQ ID NO: 1 ) alkylsulfatase it is 70°C.
• B0D71_15760 SEQ ID NO: 1 alkylsulfatase in the hydrolysis of the ester bond of sulfuric esters could be performed even during one hour incubation at the optimal temperature of 60°C.
• alkylsulfatase preferably absorbed on the support or onto a carrier matrix of both inorganic (e.g. glass, silica, metal oxide) and organic (e.g. proteins, polysaccharides, synthetic polymers) type.
• Alkylsulfatases could be also immobilized using for example cross-linking or enclosure within semipermeable membranes.
• FIGURE 1 Shows the identification of bacteria strains potentially degrading SDS.
• the photographs show a comparison of growth profile of selected strains cultured on (A) agar solidified 0.1X LB medium or (B) basal medium supplemented with 0.1 % SDS.
• FIGURE 2 Shows a study of the growth rate and SDS degradation ability of isolated bacterial strains.
• A Correlation of growth rate (increase in OD) and SDS degradation ability (decrease in substrate concentration [%]) after 24 h of incubation. The dotted line represents correlation plotted for the 36 selected strains.
• B Time course study of SDS degradation rate of the five most effective bacterial strains.
• C Time course study of growth rate for the five most effective bacterial strains in liquid cultures containing 0.1 % SDS as the sole carbon source. The values are mean values of the three replicates, and the error bars indicate the standard deviations.
• FIGURE 3 Shows a phylogenetic analysis of selected bacterial isolates based on the 16s rRNA sequence. The phylogenetic analysis was computed by Maximum Likelihood method. Examined isolates are marked with black triangles.
• FIGURE 4 Shows the effect of SDS concentration on the bacterial growth rates of selected bacterial strains reflected as optical density of cell cultures after 24 h of incubation. The values are mean values of the three replicates, and the error bars indicate the standard deviations. The dotted line represents the initial OD 60 o of each strain.
• FIGURE 5 Shows an assay for bacterial chemotaxis towards SDS being the only source of carbon. Bacterial growth was observed as rings formed around a source of carbon formed after 8 h of incubation at 30°C. Rows represent selected strains' chemotactic response toward glucose (I), SDS (II) and control plates without carbon source (III).
• FIGURE 6 Shows an alkylsulfatase activity analysis in bacterial lysates of five strains separated in 8% native polyacryloamide gel. The strains were cultured on minimal medium in the presence of glucose (MM + glucose) or SDS (MM + SDS) as the only carbon sources. The presence of insoluble lauryl alcohol bands demonstrating the presence of SDS-degrading proteins was identified after 30 min. or 4 h of incubation.
• FIGURE 7 Shows a comparison of degradation capabilities of E. coli and new strains carrying vectors with different genome fragments coding the potential alkylsulfatases identified in the genomes of AP3_16 and AP3_22 strains.
• the strains were cultured in LB medium supplemented with 0.1 % SDS.
• FIGURE 8. Shows the effect of (A) pH, and (B) temperature on activity of the homogenous protein preparations.
• the activity of the protein preparations was tested (A) in pH range of 4-10 or (B) in the temperature range of 4-90 ° C by determining SDS concentration changes in the solutions using the Stains-all reagent.
• the values marked with squares were obtained for the CD175_09595 protein and marked with triangles were obtained for the B0D71_15760 protein.
• the detergent concentration was measured after 24 h using Stains-all reagent.
• Isolated microorganisms were replicated on solid basal medium plates (per liter: 3.5 g KH 2 P0 4 ; 1.5 g K 2 HP0 4 ; 0.25 g (NH 4 ) 2 S0 4 ; 0.5 g NaCI; 0.14 g MgS0 4 ; 0.15 g MgCI 2 x6H 2 0) (Shahbazi et al., 2013) with SDS (2 g/L) as the carbon source to test the ability of sodium lauryl sulfate degradation.
• the basal medium detergent can precipitate in the form of a homogeneous suspension, which facilitates the observation of clear zone that arise around the growing bacterial colony.
• the selected isolates were pre-cultured overnight in liquid 0.1X LB medium (10 times diluted LB medium) unsupplemented with detergent with 140 rpm orbital agitation.
• the detergent concentration was measured by colorimetric assay at 0, 2, 4, 6, 8, and 24 hours after the beginning of the experiment.
• the minimal medium was used in liquid cultures for colorimetric assays because there was no SDS precipitation observed which could negatively influence measurements.
• the SDS concentration was determined in a 96-well plate using Stains-All reagent (Sigma-Aldrich) as previously described (Rusconi et al., 2001) with minor modifications. Stains- All stock solution (1 mg/mL) was prepared in isopropanohwater (50:50). The working solution consisted of 1 mL of the stock diluted in 18 mL of water and 1 mL of formamide. Samples from each time points were centrifuged and the clear, bacteria-free supernatant was diluted diluted 10 times in water.
• strain AP3_22 which has degraded about 50% and 81 % of the initial amount of sodium lauryl sulfate at 6 and 8 hours, respectively (Fig. 2B).
• the fast degrading isolates were able to degrade: 74.1 % - AP3_10; 84.6% - AP3_16; 85.1 % - AP3_19, 79.4% - AP3_20 and 99.2% - AP3_22 of detergent from the initial concentration of 1 g/L.
• Example 3 Taxonomic identification of strains degrading anionic surface active agents, including the five most efficient strains.
• Taxonomic analysis of 36 isolated strains was based on Sanger's sequencing of the V3- V4 region of the 16S rRNA gene amplicons (approximately 1 ,500 bp).
• Small subunit (16S) of the rRNA gene was amplified by colony PCR using the following primer pair: 27F (AGAGTTTGATCCTGGCTCAG) SEQ ID NR: 7 and 1492R (GGTTACCTTGTTACGACTT) SEQ ID NR: 8 (Lane, 1991).
• the PCR reaction was carried out in a volume of 50 ⁇ !_ on DNA template of a given strain using Phusion High-Fidelity DNA Polymerase (Thermo) in the presence of HF Buffer.
• the PCR involved one cycle at 99°C for 5 min; 10 cycles at 99°C for 30 s, 60°C for 30 s, and 72°C for 45 s; and 20 cycles at 99°C for 30 s, 50°C for 30 s, and 72°C for 45 s with final elongation at 72°C for 5 min.
• the PCR products (approximately 1 ,500 bp) of 16S rRNA genes were purified using AMPureXP with a 0.8: 1 ratio, then cloned into a pCRTMBlunt ll-TOPO® vector (ThermoFisher) according to the manufacturer's protocol, and transformed to Escherichia coli (Sambrook and Russel, 2001).
• the plasmids were isolated using a Plasmid Mini kit (A&A Biotechnology) and the inserts - 16S rRNA gene fragments were sequenced with Sanger using universal M 13 Forward (GTAAAACGACGGCCAG) SEQ ID NR: 9 and M13 Reverse (CAGGAAACAGCTATGAC) SEQ ID NR: 10 primers (ThermoFisher). 16S rRNA partial gene sequences were compared to the EzBioCloud database (Yoon et al., 2017). The general phylogenetic anlysis showed that selected 36 bacterial strains belong to the genus Pseudomonas.
• the 16S rRNA sequence for Pseudomonas jessenii AP3_16 deposited under No. B/00139 is presented as SEQ ID NO: 5 and for Pseudomonas laurylosulfatovorans AP3_22 deposited under No. B/00140 as SEQ ID NO: 6.
• AP3_10, AP3_16 and AP3_22 isolates clustered with P. jessenii CIP 1052274, P. reinekei CCUG 531 16, P. koreensis LMG 21318, and P. moraviensis DSM 16007, while AP3_16, and AP3_19 were sister taxa that clustered together in a group that included the previously mentioned clade, plus P. moorei CCUG 53114, and P. vancouverensis DSM 17555.
• taxonomic analysis indicate that the isolated microorganisms belongs to the Pseudomonas family, with the five best degrading isolates belonging to the Pseudomonas jessenii subgroup.
• the isolates were cultured in triplicate in deep 48-well plates. The optical density of the cultures (OD 600 ) was monitored after 24 hours of incubation. Statistical analysis and interpretation of obtained data was made using the R package version 3.5.0. The Kruskal- Wallis with the Dunn's post hoc tests were used to test differences between initial and final optical density of cultures, with significance set to 0.05.
• Example 5 Chemotaxis of isolated bacterial strains towards a source of sodium lauryl sulfate.
• the chemotactic response of the five selected isolates toward SDS was studied by a drop plate assay, with glucose as a positive control.
• Example 6 Morphological, physiological and biochemical analysis of bacterial strains with high ability to degrade anionic surface active agents
• Gram staining was carried out by standard methods. Cell morphology was analyzed by light microscopy and transmission electron microscopy after overnight cultivation in LB medium at 30°C. Flagella staining was performed using a wet-mount technique with Ryu stain (Heimbrook i wsp., 1989). Temperature, pH and salinity tolerance of the strains were analyzed by monitoring changes in optical density (OD 60 o) in liquid cultures (in comparison to non- inoculated controls).
• Oxidase activity was tested using discs containing N,N-dimethyl-p-phenylenediamine oxolate and ⁇ -naphthol (Sigma-Aldrich, USA). Other biochemical features of the microorganisms were determined using a GEN III Biolog microplate (Biolog, USA) and an API 20NE systems (bioMerieux, France) according to manufacturer's instructions. Degradation of SDS was tested in minimal medium with 0.1 % SDS as a sole carbon source and measured by colorimetric assay, as described in Example 2. Fluorescence pigment production was tested on King B medium (King et al., 1954).
• Pseudomonas vancouverensis DSM 17555 T and Pseudomonas umsongensis DSM 16611 T were used, obtained from the DSMZ collection.
• Cells produce fluorescent pigment on King B medium. Growth is observed in 0-6% NaCI (optimal 0-2%), 5-10 pH (optimal pH 7) and at 8-42°C (optimal 30°C).
• the strains show a positive result in tests for catalase and oxidase activity, and negative for urease, arginine dehydrolase and ⁇ -galactosidase.
• the AP3_22 strain similarly to the P. jessenii DSM17150 and P. umsongensis DSM 1661 1 , has the ability to reduce nitrates. The strains do not hydrolyze esculin and gelatin, and do not ferment glucose.
• the strains assimilate L-arabinose, potassium gluconate, decanoic acid, malic acid, trisodium citrate and phenylacetic acid, but do not assimilate adipic acid.
• Complete information on the phenotypic traits obtained in the Biolog GENIII and API20 NE tests are listed in Table 1 , below.
• the main distinguishing features of the AP3_16 and AP3_22 strains from related Pseudomonas species were: the use of sodium dodecyl sulphate (SDS) as the sole carbon source and the ability to oxidize sucrose, a-keto-butyric acid and acetoacetic acid.
• SDS sodium dodecyl sulphate
• the G + C content of the DNA of AP3_22 strain is 59.6 m ' ol% and AP3_16 strain is 60.1 mol%, wherein the values for reference strains are: P. jessenii DSM 17150 T - 59.7; P. baetica DSM 26532 T - 58.8; P. reinekei DSM 18361 T - 59.2 and P. umsongensis DSM 16611 T - 59.7.
• Adipic Acid Carbon source 1 2 3 4 5 6 7
• Example 7 Initial identification of enzymes produced by bacterial strains responsible for the degradation of anionic sufrace active agents.
• Cell pellets were resuspended in lysis buffer (50 mM HEPES, pH 7.5, 300 mM NaCI, 20 mM imidazole, 50 ⁇ PMSF, 10 mM ⁇ -mercaptoethanol, 0.1 % Tween 20, 10% glycerol, and lysozyme) and additionaly disrupted by sonication (Diagenode sonication system) in a cooled water bath (4°C) at high power (300 W) for 30 cycles of 30 s on and 30 s off. Cell debris was removed by centrifugation at 14,000 g for 30 minutes at 4°C and the supernatants were stored at -20°C.
• lysis buffer 50 mM HEPES, pH 7.5, 300 mM NaCI, 20 mM imidazole, 50 ⁇ PMSF, 10 mM ⁇ -mercaptoethanol, 0.1 % Tween 20, 10% glycerol, and lysozyme
• the crude cell extracts obtained from each of the fast- degrading strains were separated using 8% native polyacrylamide gel (Sambrook and Russel, 2001 ).
• the electrophoresis was carried out at 100 V at 4°C in 0.378 M Tris-glycine buffer (pH 8.3).
• the gel was incubated in a developing solution (20 mM SDS in 0.1 M Tris-CI pH 7.5) at 30°C. Active alkyl sulfatases presence was visualized by the formation of white bands of insoluble alcohol.
• AP3_10, AP3_20, and AP3_22 showed only one band on zymography, suggesting the presence of only one enzyme with , alkyl sulfatase activity toward SDS (Fig. 6).
• AP3_16 and AP3_19 which are phylogenetically distinct from the others, two bands were visible on zymography, suggesting the presence of two different enzymes or two isoforms of alkyl sulfatases.
• Example 8 Genome sequencing of fast SDS-degrading bacterial strains, and identification of potential anionic surface active agents degrading enzymes in genome sequences
• Genomic DNA isolation, library preparation and sequencing For whole genome sequencing of strains AP3_22 T and AP3_16 T , DNA was isolated following a previously described protocol (Furmanczyk et al., 2017) based on enzymatic lysis with lysozyme, achromopeptidase and proteinase K, followed by phenokchloroform extraction and ethanol precipitation. The isolated genomic DNA was used to prepare two types of libraries for each strain: 1) paired-end library with average insert size 500 bp (using KAPA HTP Library Preparation Kit for lllumina platforms according to manufacturer's protocol) (Kapa Biosystems, USA), 2) Nextera® Mate Pair library with average insert size 8 kbp (using lllumina protocol).
• the libraries were verified using a 2100 Bioanalyzer (Agilent, USA) High-Sensitivity DNA Assay and KAPA Library Quantification Kit for the lllumina (Kapa Biosystems, USA). High-throughput sequencing was performed using an lllumina MiSeq and dedicated reagent kits (MiSeq Reagent Kit v3, 600 cycles) (lllumina, USA) with read length of 2x 300 bp.
• Example 9 Cloning of identified enzyme into expression vectors. Verification of enzymatic activity (in the presence of native promoter) in a host other than the environmental bacterium
• DNA sequences coding potential sulfatases involved in SDS degradation with putative promoter regions were amplified using designed primer pairs (Table 2, below). Fragments of the genomes were amplified by PCR.
• the PCR mixture (50 pL) consisted of: template (genomic DNA of each strain (100 ng/pL) - 1 pL); a dNTP mixture (0.2 mM each); pair of primers (0.2 ⁇ each), Phusion High-Fidelity Polymerase DNA Polymerase (0.02 U/pL, Thermo) supplied with 1 x HF-buffer.
• PCR reaction conditions were: initial denaturation (99°C for 5 minutes), 35 cycles: denaturation (99°C for 30 seconds), annealing (56°C for 30 s), elongation (72°C for 30 - 90 seconds (details in Table 2 below)); and final elongation (72°C for 5 minutes).
• the PCR products were purified using AMPureXP (Beckman Coulter, United States) with a 0.8:1 ratio, then cloned into pCRTMBIunt ll-TOPO R (Invitrogen, United States) and transformed into E. coli TOP10. The constructs were verified by Sanger sequencing of the inserts and then preliminary tests of the ability to SDS degradation by obtained strains were carried out.
• the overnight LB-precultures were used to inoculate fresh LB medium (1 :50 v/v) with kanamycin and SDS (1 g/L). After 24 h of incubation (37°C, 140 rpm), the SDS concentration in the media was determined by colorimetric assay using Stains-all reagent.
• Example 10 Overproduction, purification and characterization of novel enzymes degrading anionic surface active agents
• Alkylsulfatase encoding genes identified in Example 9 were amplified using the following primer pairs: A16S14FT
• protein CD175_09595 and A22S04FT GTTTAACTTTAAGAAGGAGATATACCATGGATGCCTCGTTTCACCTTGAGCCCTCG
• A22S04RT GTTTAACTTTAAGAAGGAGATATACCATGGATGCCTCGTTTCACCTTGAGCCCTCG
• the PCR mixture (50 pl_) consisted of: template (genomic DNA of each strain (100 ng/pL) - 1 pL); a dNTP mixture (0.2 mM each); primers pair (0.2 pM each), Phusion High-Fidelity Polymerase DNA Polymerase (0.02 U/pL, Thermo) supplied with 1x HF-buffer.
• PCR reaction conditions were: initial denaturation (99°C for 5 minutes), 10 cycles: denaturation (99°C for 30 seconds), annealing (56°C for 30 s), elongation (72°C for 65 seconds) than 20 cycles: denaturation (99°C for 30 seconds), annealing (62°C for 30 s), elongation (72°C for 65 seconds ); and final elongation (72°C for 5 minutes).
• PCR products were purified using AMPureXP (0.8 x PCR product: 1.0 x AMPureXP) according to the manufacturer's recommendations, then cloned using the sequence- and ligation-independent cloning protocol (Jeong, 2012), into the pET28 derived vector that allows obtaining a recombinant protein with a histidine tag (6xHis) at the C-terminus of the protein (with the possibility of tag cleavage with the TEV protease).
• the vector was digested with restriction enzymes: Ncol and Xhol (FastDigest enzymes, Thermo), and then purified by isolation from agarose gel after electrophoretic separation.
• the vector (100 ng) was mixed with the insert at a molar ratio of 1 :4 and incubated with the addition of T4 DNA polymerase (0.15 U/pL, New England Biolabs) in 1x NEBuffer 2 buffer (New England Biolabs) supplemented with BSA (0,1 mg/ml) for 2.5 minutes at room temperature. Reactions were stopped by 10-minutes incubation on ice. The mixture was then transformed into E. coli MH1. The plasmids were verified by digestion with restriction enzymes followed by sequencing of the inserts. Positively verified construct was transformed into the BL21 E. coli strain.
• Cell pellets were resuspended in lysis buffer (50 mM HEPES pH 7.5, 300 mM NaCI, 20 mM imidazole, 50 mM PMSF, 10 mM ⁇ -mercaptoethanol, 0.1 % Tween 20, 10% glycerol, supplemented with lysozyme).
• Cells were lysed by sonication in the Bioruptor Plus sonication system (Diagenode) in a cooled water bath (4°C) at high power (300 W) for 30 cycles of 30 s on and 30 s off. Debris was removed by centrifugation at 4°C (20 min, 14000 x g). The protein was purified using Protino 96 Ni-IDA.
• Clarified lysate was loaded onto preactivated column.
• the resin was washed with 50 column volumes of wash buffer I (50 mM HEPES pH 7.5, 300 mM NaCI, 10 mM MgCI 2 ) and then with 25 column volumes of wash buffer II (50 mM HEPES pH 7.5, 300 mM NaCI).
• wash buffer II 50 mM HEPES pH 7.5, 300 mM NaCI.
• Protein was eluted with three fractions (300 ml each) of elution buffer (50 mM HEPES, 300 mM NaCI, 250 mM imidazole pH 7.5).
• each purified proteins B0D71_15760 and CD175_09595 was assayed by colorimetric method using Stains-all reagent.
• Two ml_ of enzyme solution 150 mg/mL was mixed with 100 mL of buffer (50 mM Tris-HCI) containing SDS with a final concentration of 0.01 % (w/v). After incubation at 37°C for 5 min, the reaction was terminated by incubation of the sample at 100°C for 10 min.
• the SDS concentration was determined in a 96-well plate using colorimetric assay with reference to the standard curve.
• the optimal temperature for the activity of the alkylsulfatases was determined by carrying out the enzyme activity assay in the range of temperatures (4-90°C) in 50 mM Tris-HCI buffer (pH 8.0) for 5 min.
• the optimal pH for sulfatases was assayed in a pH range of 4.0 - 10.0 with: citrate buffer for pH 4-5; citrate- phosphate buffer for pH 6; Tris-HCI buffer for pH 7-8 and glycine-NaOH buffer for pH 9-10.
• the relative activity was defined as the percentage of activity determined with respect to the maximum activity achieved in optimal conditions of each sulfatase.
• thermostability of the recombinant enzymes B0D71_15760 and CD175_09595 was determined by measuring the residual activity of the enzyme, exposed to 60 and 70 ° C for 1 h. The relative activity was calculated with reference to the activity of the enzyme preparation not incubated at elevated temperature.
• thermostability studies showed that the B0D71_15760 protein retains its activity after an hour incubation at 60°C, but not at 70°C.
• Alkylsulfatase CD175_09595 is sensitive to incubation at both tested temperatures. Both enzymes are inactivated by a 10-minute incubation at 100°C (Table 4).
• MEGA6 Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725-2729. doi: 10.1093/molbev/mst197.
• SEQ ID NR: 1 - corresponds to amino acid sequence of alkylsulfatase B0D71_15760 obtained from AP3_22
• SEQ ID NR: 2. - corresponds to amino acid sequence of alkylsulfatase CD175_09595 obtained from AP3_16
• SEQ ID NR: 3. corresponds to nucleotide sequence of the gene encoding alkylsulftase B0D71_15760 obtained from AP3_22
• SEQ ID NR: 4. corresponds to nucleotide sequence of the gene encoding alkylsulftase CD175_09595 obtained from AP3_16
• SEQ ID NR: 5 - corresponds to 16S rRNA sequence for Pseudomonas jessenii AP3_16 deposited under number B/00139
• SEQ ID NR: 6 - corresponds to 16S rRNA sequence for Pseudomonas laurylosulfatovorans AP3_22 deposited under number B/00140
• sequence list submitted with this application includes a reference to all sequences set forth in SEQ ID NO: 1 to SEQ ID NO: 56 (indicated in the description).
• sequence list contains only references to relevant sequences.

Landscapes

• Life Sciences & Earth Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Engineering & Computer Science (AREA)
• Organic Chemistry (AREA)
• Health & Medical Sciences (AREA)
• Microbiology (AREA)
• Zoology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Genetics & Genomics (AREA)
• Wood Science & Technology (AREA)
• Biotechnology (AREA)
• Environmental & Geological Engineering (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Molecular Biology (AREA)
• General Engineering & Computer Science (AREA)
• Biomedical Technology (AREA)
• Water Supply & Treatment (AREA)
• Hydrology & Water Resources (AREA)
• Biodiversity & Conservation Biology (AREA)
• Medicinal Chemistry (AREA)
• Oil, Petroleum & Natural Gas (AREA)
• Tropical Medicine & Parasitology (AREA)
• Virology (AREA)
• Mycology (AREA)
• Soil Sciences (AREA)
• Processing Of Solid Wastes (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)

Applications Claiming Priority (2)

Publications (1)

Family

ID=66333239

Family Applications (1)

Country Status (3)

Families Citing this family (1)

Family Cites Families (2)

• 2017
  • 2017-10-30 PL PL423299A patent/PL237601B1/pl unknown
• 2018
  • 2018-10-29 WO PCT/PL2018/050055 patent/WO2019088859A1/en not_active Ceased
  • 2018-10-29 EP EP18830543.7A patent/EP3704236A1/de not_active Withdrawn

Also Published As

Similar Documents

Legal Events