EP3682903A1 - Modified oligonucleotides for telomerase inhibition - Google Patents

Modified oligonucleotides for telomerase inhibition Download PDF

Info

Publication number
EP3682903A1
EP3682903A1 EP19209408.4A EP19209408A EP3682903A1 EP 3682903 A1 EP3682903 A1 EP 3682903A1 EP 19209408 A EP19209408 A EP 19209408A EP 3682903 A1 EP3682903 A1 EP 3682903A1
Authority
EP
European Patent Office
Prior art keywords
oligonucleotide
lipid
compound
compounds
solid support
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP19209408.4A
Other languages
German (de)
English (en)
French (fr)
Inventor
Sergei Gryaznov
Krisztina Pongracz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Geron Corp
Original Assignee
Geron Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Geron Corp filed Critical Geron Corp
Publication of EP3682903A1 publication Critical patent/EP3682903A1/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/542—Carboxylic acids, e.g. a fatty acid or an amino acid
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/543—Lipids, e.g. triglycerides; Polyamines, e.g. spermine or spermidine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/543—Lipids, e.g. triglycerides; Polyamines, e.g. spermine or spermidine
    • A61K47/544—Phospholipids
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/54—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound
    • A61K47/554—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic compound the modifying agent being a steroid plant sterol, glycyrrhetic acid, enoxolone or bile acid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C233/00—Carboxylic acid amides
    • C07C233/01—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms
    • C07C233/16—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by singly-bound oxygen atoms
    • C07C233/17—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by singly-bound oxygen atoms with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom
    • C07C233/18—Carboxylic acid amides having carbon atoms of carboxamide groups bound to hydrogen atoms or to acyclic carbon atoms having the nitrogen atom of at least one of the carboxamide groups bound to a carbon atom of a hydrocarbon radical substituted by singly-bound oxygen atoms with the substituted hydrocarbon radical bound to the nitrogen atom of the carboxamide group by an acyclic carbon atom having the carbon atom of the carboxamide group bound to a hydrogen atom or to a carbon atom of an acyclic saturated carbon skeleton
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07049—RNA-directed DNA polymerase (2.7.7.49), i.e. telomerase or reverse-transcriptase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/314—Phosphoramidates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/35—Nature of the modification
    • C12N2310/351—Conjugate
    • C12N2310/3515—Lipophilic moiety, e.g. cholesterol
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications

Definitions

  • This invention relates to compounds useful for the inhibition of telomerase. More specifically, the invention provides modified oligonucleotides that are targeted to the RNA component of telomerase and have enhanced cellular uptake characteristics.
  • nucleic acids particularly oligonucleotides
  • RNAi RNA interference
  • the design of nucleic acids, particularly oligonucleotides, for in vivo delivery requires consideration of various factors including binding strength, target specificity, serum stability, resistance to nucleases and cellular uptake.
  • a number of approaches have been proposed in order to produce oligonucleotides that have characteristics suitable for in vivo use, such as modified backbone chemistry, formulation in delivery vehicles and conjugation to various other moieties.
  • Therapeutic oligonucleotides with characteristics suitable for systemic delivery would be particularly beneficial.
  • Oligonucleotides with modified chemical backbones are reviewed in Micklefield, Backbone modification of nucleic acids: synthesis, structure and therapeutic applications, Curr. Med. Chem., 8(10):1157-79,2001 and Lyer et al., Modified oligonucleotides--synthesis, properties and applications, Curr. Opin. Mol. Ther., 1(3): 344-358, 1999 .
  • modified backbone chemistries include:
  • peptide nucleic acids display good nuclease resistance and binding strength, but have reduced cellular uptake in test cultures;
  • phosphorothioates display good nuclease resistance and solubility, but are typically synthesized as P-chiral mixtures and display several sequence-non-specific biological effects;
  • methylphosphonates display good nuclease resistance and cellular uptake, but are also typically synthesized as P-chiral mixtures and have reduced duplex stability.
  • N3' ⁇ P5' phosphoramidate internucleoside linkages are reported to display favorable binding properties, nuclease resistance, and solubility ( Gryaznov and Letsinger, Nucleic Acids Research, 20:3403-3409, 1992 ; Chen et al., Nucleic Acids Research, 23:2661-2668, 1995 ; Gryaznov et al., Proc. Natl. Acad. Sci., 92:5798-5802, 1995 ; Skorski et al., Proc. Natl. Acad. Sci., 94:3966-3971, 1997 ).
  • Acid stability of an oligonucleotide is an important quality given the desire to use oligonucleotide agents as oral therapeutics.
  • the addition of a sulfur atom to the backbone in N3' ⁇ P5' thiophosphoramidate oligonucleotides provides enhanced acid stability.
  • Patent No. 6,448,392 Lipid derivatives of antiviral nucleosides: liposomal incorporation and method of use
  • U.S. Patent No. 5,420,330 Lipo-phosphoramidites
  • U.S. Patent No. 5,763,208 Oligonucleotides and their analogs capable of passive cell membrane permeation
  • Gryaznov & Lloyd Nucleic Acids Research, 21:5909-5915, 1993 (Cholesterol-conjugated oligonucleotides)
  • Telomerase is a ribonucleoprotein that catalyzes the addition of telomeric repeat sequences to chromosome ends. See Blackburn, 1992, Ann. Rev. Biochem., 61:113-129 . There is an extensive body of literature describing the connection between telomeres, telomerase, cellular senescence and cancer (for a general review, see Oncogene, volume 21, January 2002 , which is an entire issue of the journal focused on telomerase). Telomerase has therefore been identified as an excellent target for cancer therapeutic agents (see Lichsteiner et al., Annals New York Acad. Sci., 886:1-11, 1999 ).
  • telomere inhibitors identified to date include small molecule compounds and oligonucleotides.
  • oligonucleotides to inhibit telomerase, either targeted against the mRNA encoding the telomerase protein component (the human form of which is known as human telomerase reverse transcriptase or hTERT) or the RNA component of the telomerase holoenzyme (the human form of which is known as human telomerase RNA or hTR).
  • Oligonucleotides that are targeted to the hTERT mRNA are generally believed to act as conventional antisense drugs in that they bind to the mRNA, resulting in destruction of the mRNA, and thereby preventing production of the hTERT protein (see, for example, U.S. Patent No. 6,444,650 ).
  • oligonucleotides that are targeted to hTR are designed to bind to hTR molecules present within the telomerase holoenzyme, and thereby disrupt enzyme function (see, for example, U.S. Patent No. 6,548,298 ). Examples of publications describing various oligonucleotides designed to reduce or eliminate telomerase activity include:
  • compositions and methods of the present invention relate to telomerase inhibiting compounds comprising an oligonucleotide and at least one covalently linked lipid group.
  • the compounds of the invention have superior cellular uptake properties compared to unmodified oligonucleotides. This means that an equivalent biological effect may be obtained using smaller amounts of the conjugated oligonucleotide compared to the unmodified form. When applied to the human therapeutic setting, this may translate to reduced toxicity risks, and cost savings.
  • the compounds of the invention inhibit telomerase in cells, including cancer cells, the resultant effect of which is to inhibit proliferation of the cells. Accordingly, a primary application of the compounds of the invention is as cancer therapeutics, and the invention provides pharmaceutical formulations of the compounds that may be utilized in this manner.
  • the lipid group L is typically an aliphatic hydrocarbon or fatty acid, including derivatives of hydrocarbons and fatty acids, with examples being saturated straight chain compounds having 14-20 carbons, such as myristic acid (C14, also known as tetradecanoic acid), palmitic acid (C16, also known as hexadecanoic acid) and stearic acid (C18, also known as octadeacanoic acid), and their corresponding aliphatic hydrocarbon forms, tetradecane, hexadecane and octadecane, together with derivatives such as amine and amide derivatives.
  • myristic acid C14, also known as tetradecanoic acid
  • palmitic acid C16, also known as hexadecanoic acid
  • stearic acid C18, also known as octadeacanoic acid
  • lipid groups examples include sterols, such as cholesterol, and substituted fatty acids and hydrocarbons, particularly poly-fluorinated forms of these groups.
  • the oligonucleotide component O can be a ribo- or deoxyribonucleic acid or modified forms thereof, and the linkages connecting the nucleobases may be made with any compatible chemistry, including, but not limited to: phosphodiester; phosphotriester; methylphosphonate; P3' ⁇ N5' phosphoramidate; N3' ⁇ P5' phosphoramidate; N3' ⁇ P5' thiophosphoramidate; and phosphorothioate linkages.
  • the sequence of the oligonucleotide component O includes at least one sequence region that is complementary, preferably exactly complementary, to a selected "target" region of the sequence of the telomerase RNA component.
  • the sequence of the oligonucleotide component O contains a sequence region that is complementary to sequence within one of the following regions of the human telomerase RNA component, hTR (the sequence of which is provided in SEQ ID NO:1): 46 - 56, 137 - 196, 290 - 319, and 350 - 380.
  • the length of sequence within the O component that is exactly complementary to a region of hTR is preferably at least 5 bases, more preferably at least 8 bases, and still more preferably at least 10 bases. Additional sequence regions may be added to the O component that are not exactly complementary to hTR, but which may provide an additional beneficial function.
  • Exemplary compounds of the invention include those depicted in the structures below in which the O component has N3' ⁇ P5' thiophosphoramidate inter-nucleoside linkages and is exactly complementary to bases 42-54 of hTR (SEQ ID NO:1).
  • L the lipid moiety is palmitoyl amide (derived from palmitic acid), conjugated through an aminoglycerol linker to the 5' thiophosphate group of the oligonucleotide O:
  • L is conjugated through the 3' amino group of the oligonucleotide to palmitoyl amide:
  • the compounds of the present invention may be used in methods to inhibit telomerase enzymatic activity. Such methods comprise contacting a telomerase enzyme with a compound of the invention.
  • the compounds of the present invention may also be used to inhibit telomerase in cells that express telomerase, thereby inhibiting the proliferation of such cells.
  • Such methods comprise contacting a cell or cells having telomerase activity with a compound of the invention. Cells treated in this manner, which may be cells in vitro, or cells in vivo, will generally undergo telomere shortening and cease proliferating. Since cancer cells require telomerase activity for long-term proliferation, the compounds of the invention are particularly useful for inhibiting the growth of cancer cells, and may be used in therapeutic applications to treat cancer.
  • aspects of the invention therefore include the compounds as described herein for use in medicine, and in particular for use in treating cancer.
  • compositions comprising an oligonucleotide conjugate according to the invention formulated with a pharmaceutically acceptable excipient.
  • SEQ ID NO:1 of the accompanying Sequence Listing provides the sequence of the human telomerase RNA component (hTR) (see also Feng et al., Science 269(5228):1236-1241, 1995 , and GenBank, Accession No. U86046).
  • hTR human telomerase RNA component
  • Various oligonucleotides, the sequences of which are complementary to regions contained within SEQ ID NO:1, are referred to throughout this disclosure by reference to the location of the sequence within SEQ ID NO:1 to which they are complementary.
  • alkyl group refers to an alkyl or substituted alkyl group having 1 to 20 carbon atoms, such as methyl, ethyl, propyl, and the like. Lower alkyl typically refers to C 1 to C 5 . Intermediate alkyl typically refers to C 6 to C 10 .
  • An "acyl group” refers to a group having the structure RCO wherein R is an alkyl. A lower acyl is an acyl wherein R is a lower alkyl.
  • alkylamine refers to an alkyl group with an attached nitrogen, e.g., 1-methyl1-butylamine (CH 3 CHNH 2 CH 2 CH 2 CH 3 ).
  • aryl group refers to an aromatic ring group having 5 - 20 carbon atoms, such as phenyl, naphthyl, anthryl, or substituted aryl groups, such as, alkyl- or aryl-substitutions like tolyl, ethylphenyl, biphenylyl, etc. Also included are heterocyclic aromatic ring groups having one or more nitrogen, oxygen, or sulfur atoms in the ring.
  • Oligonucleotide refers to ribose and/or deoxyribose nucleoside subunit polymers having between about 2 and about 200 contiguous subunits.
  • the nucleoside subunits can be joined by a variety of intersubunit linkages, including, but not limited to, phosphodiester, phosphotriester, methylphosphonate, P3' ⁇ N5' phosphoramidate, N3' ⁇ P5' phosphoramidate, N3' ⁇ P5' thiophosphoramidate, and phosphorothioate linkages.
  • oligonucleotides includes modifications, known to one skilled in the art, to the sugar (e.g., 2' substitutions), the base (see the definition of "nucleoside” below), and the 3' and 5' termini.
  • each linkage may be formed using the same chemistry or a mixture of linkage chemistries may be used.
  • polynucleotide as used herein, has the same meaning as “oligonucleotide” and is used interchangeably with “oligonucleotide”.
  • oligonucleotide is represented by a sequence of letters, such as "ATGUCCTG,” it will be understood that the nucleotides are in 5' ⁇ 3' order from left to right. Representation of the base sequence of the oligonucleotide in this manner does not imply the use of any particular type of internucleoside subunit in the oligonucleotide.
  • nucleoside includes the natural nucleosides, including 2'-deoxy and 2'-hydroxyl forms, e.g., as described in Komberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992 ), and analogs.
  • "Analogs" in reference to nucleosides includes synthetic nucleosides having modified nucleobase moieties (see definition of “nucleobase” below) and/or modified sugar moieties, e.g., described generally by Scheit, Nucleotide Analogs (John Wiley, New York, 1980 ).
  • Such analogs include synthetic nucleosides designed to enhance binding properties, e.g., stability, specificity, or the like, such as disclosed by Uhlmann and Peyman (Chemical Reviews, 90:543-584, 1990 ).
  • lipid is used broadly herein to encompass substances that are soluble in organic solvents, but sparingly soluble, if at all, in water.
  • the term lipid includes, but is not limited to, hydrocarbons, oils, fats (such as fatty acids, glycerides), sterols, steroids and derivative forms of these compounds.
  • Preferred lipids are fatty acids and their derivatives, hydrocarbons and their derivatives, and sterols, such as cholesterol.
  • the term lipid also includes amphipathic compounds which contain both lipid and hydrophilic moieties.
  • Fatty acids usually contain even numbers of carbon atoms in a straight chain (commonly 12 - 24 carbons) and may be saturated or unsaturated, and can contain, or be modified to contain, a variety of substituent groups.
  • fatty acid also encompasses fatty acid derivatives, such as fatty amides produced by the synthesis scheme shown in Fig. 2A (see for example, the compounds shown Figs. 1A - 1E ).
  • hydrocarbon encompasses compounds that consist only of hydrogen and carbon, joined by covalent bonds.
  • the term encompasses open chain (aliphatic) hydrocarbons, including straight chain and branched hydrocarbons, and saturated as well as mono- and poly-unsaturated hydrocarbons.
  • the term also encompasses hydrocarbons containing one or more aromatic rings.
  • substituted refers to a compound which has been modified by the exchange of one atom for another.
  • the term is used in reference to halogenated hydrocarbons and fatty acids, particularly those in which one or more hydrogen atoms are substituted with fluorine.
  • nucleobase as used herein includes (i) typical DNA and RNA nucleobases (uracil, thymine, adenine, guanine, and cytosine), (ii) modified nucleobases or nucleobase analogs (e.g., 5-methyl-cytosine, 5-bromouracil, or inosine) and (iii) nucleobase analogs.
  • a nucleobase analog is a chemical whose molecular structure mimics that of a typical DNA or RNA base.
  • pyrimidine means the pyrimidines occurring in natural nucleosides, including cytosine, thymine, and uracil, and analogs thereof, such as those containing oxy, methyl, propynyl, methoxy, hydroxyl, amino, thio, halo, and substituents.
  • the term as used herein further includes pyrimidines with protection groups attached, such as N 4 -benzoylcytosine. Further pyrimidine protection groups are disclosed by Beaucage and Iyer (Tetrahedron 48:223-2311, 1992 ).
  • purine means the purines occurring in natural nucleosides, including adenine, guanine, and hypoxanthine, and analogs thereof, such as those containing oxy, methyl, propynyl, methoxy, hydroxyl, amino, thio, halo, and substituents.
  • the term as used herein further includes purines with protection groups attached, such as N 2 -benzoylguanine, N 2 -isobutyrylguanine, N 6 -benzoyladenine, and the like. Further purine protection groups are disclosed by Beaucage and Iyer (cited above).
  • the term "protected" as a component of a chemical name refers to art-recognized protection groups for a particular moiety of a compound, e.g., "5'-protected-hydroxyl" in reference to a nucleoside includes triphenylmethyl (i.e., trityl), p-anisyldiphenylmethyl (i.e., monomethoxytrityl or MMT), di-p-anisylphenylmethyl (i.e., dimethoxytrityl or DMT), and the like.
  • triphenylmethyl i.e., trityl
  • p-anisyldiphenylmethyl i.e., monomethoxytrityl or MMT
  • di-p-anisylphenylmethyl i.e., dimethoxytrityl or DMT
  • halogen or halo is used in its conventional sense to refer to a chloro, bromo, fluoro or iodo substituent.
  • halogen substituents are generally fluoro, bromo, or chloro, preferably fluoro or chloro.
  • the compounds of the invention may be represented by the formula: O-(x-L) n , where O represents the oligonucleotide, x is an optional linker group, L represents the lipid moiety and n is an integer from 1 - 5.
  • Design of the compounds therefore requires the selection of two entities, O and L, and the determination of the structural linkage(s) between these entities, which may involve the optional linker group x.
  • the oligonucleotide component O may be regarded as the "effector" component of the compound in that it is this component that effects inhibition of the telomerase enzyme by binding to the RNA component of telomerase.
  • the sequence of O is selected such that it includes a region that is complementary to the sequence of the telomerase RNA, which is shown in SEQ ID NO:1.
  • the region that is complementary to the telomerase RNA component may in theory be targeted to any portion of the telomerase RNA, but particular regions of the telomerase RNA are preferred target for inhibitory oligonucleotides.
  • One preferred target region is the region spanning nucleotides 30 - 67 of SEQ ID NO:1, which includes the "template region," an 11 nucleotide region of sequence 5'-CUAACCCUAAC-3' that spans nucleotide 46 - 56 of SEQ ID NO: 1.
  • the template region functions to specify the sequence of the telomeric repeats that telomerase adds to the chromosome ends and is essential to the activity of the telomerase enzyme (see Chen et al., Cell 100:503-514, 2000 ; Kim et al., Proc. Natl, Acad. Sci., USA 98(14):7982-7987,2001 ).
  • oligonucleotide moiety comprising a sequence complementary to all or part of the template region.
  • Another preferred target region is the region spanning nucleotides 137 -179 of hTR (see Pruzan et al., Nucl. Acids Research, 30:559-568, 2002 ). Within this region, the sequence spanning 141 - 153 is a preferred target.
  • PCT publication WO 98/28442 describes the use of oligonucleotides of at least 7 nucleotides in length to inhibit telomerase, where the oligonucleotides are designed to be complementary to accessible portions of the hTR sequence outside of the template region, including nucleotides 137 - 196, 290 - 319, and 350 - 380 of hTR.
  • the region of O that is targeted to the hTR sequence is preferably exactly complementary to the corresponding hTR sequence. While mismatches may be tolerated in certain instances, they are expected to decrease the specificity and activity of the resultant oligonucleotide conjugate, in particular embodiments, the base sequence of the oligonucleotide O is thus selected to include a sequence of at least 5 nucleotides exactly complementary to the telomerase RNA, and enhanced telomerase inhibition may be obtained if increasing lengths of complementary sequence are employed, such as at least 8, at least 10, at least 12, at least 13 or at least 15 nucleotides exactly complementary to the telomerase RNA.
  • the sequence of the oligonucleotide includes a sequence of from at least 5 to 20, from at least 8 to 20, from at least 10 to 20 or from at least 10 to 15 nucleotides exactly complementary to the telomerase RNA sequence.
  • Optimal telomerase inhibitory activity may be obtained when the full length of the oligonucleotide O is selected to be complementary to the telomerase RNA.
  • the oligonucleotide sequence may include regions that are not complementary to the target sequence. Such regions may be added, for example, to confer other properties on the compound, such as sequences that facilitate purification.
  • oligonucleotide component O is to include regions that are not complementary to the target sequence, such regions are typically positioned at one or both of the 5' or 3' termini.
  • region of exact complementarity is targeted to the template region, effective telomerase inhibition may be achieved with a short (5 - 8 nucleotide) region of exact complementarity to which a telomerase-like (G-rich) sequence is joined at the 5' end.
  • Exemplary sequences that are complementary to the human telomerase RNA and which may be included as part of the oligonucleotide component O, or which may be used as the entire oligonucleotide component O include the following: Oligonucleotide sequence hTR complementary sequence (region of SEQ ID NO:1) GCTCTAGAATGAACGGTGGAAGGCGGCAGG 137-166 GTGGAAGGCGGCAGG 137-151 GGAAGGCGGCAGG 137-149 GTGGAAGGCGGCA 139-151 GTGGAAGGCGG 141-151 CGGTGGAAGGCGG 141-153 ACGGTGGAAGGCG 142-154 AACGGTGGAAGGCGGC 143-155 ATGAACGGTGGAAGGCGG 144-158 ACATTTTTTGTTTGCTCTAG 160-179 TAGGGTTAGACAA 42-54 GTTAGGGTTAG 46-56 GTTAGGGTTAGAO 44-56 GTTAGGGTTAGACAA 42-56 GGGTTAGAC 44-52 CAGT
  • inter-nucleoside linkages used in the synthesis of the O component may be made from any of the available oligonucleotide chemistries, including but not limited to, phosphodiester, phosphotriester, methylphosphonate, P3' ⁇ N5' phosphoramidate, N3' ⁇ P5' phosphoramidate, N3' ⁇ P5' thiophosphoramidate, and phosphorothioate linkages.
  • all of the internucleoside linkages within the oligonucleotide O will be of the same type, although the oligonucleotide component may be synthesized using a mixture of different linkages.
  • the lipid moiety is to be conjugated to the 3' terminus of the oligonuclotide, the synthesis of the conjugate is greatly facilitated by a 3' amino group on the oligonucleotide.
  • the addition of a 3' amino group is advantageous.
  • the compounds of the invention are more effective in producing telomerase inhibition in cells than corresponding oligonucleotides that are not conjugated to lipid components.
  • the lipid component L is believed to function to enhance cellular uptake of the compound, particularly in facilitating passage through the cellular membrane. While the mechanism by which this occurs has not been fully elucidated, one possibility is that the lipid component may facilitate binding of the compound to the cell membrane as either a single molecule, or an aggregate (micellar) form, with subsequent internalization. However, understanding of the precise mechanism is not required for the invention to be utilized.
  • the lipid component may be any lipid or lipid derivative that provides enhanced cellular uptake compared to the unmodified oligonucleotide.
  • Preferred lipids are hydrocarbons, fats (e.g., glycerides, fatty acids and fatty acid derivatives, such as fatty amides) and sterols.
  • the L component may be a substituted or unsubstituted cyclic hydrocarbon or an aliphatic straight chain or branched hydrocarbon, which may be saturated or unsaturated.
  • Preferred examples are straight chain unbranched hydrocarbons that are fully saturated or polyunsaturated.
  • the length of the hydrocarbon chain may vary from C 2 - C 30 , but optimal telomerase inhibition may be obtained with carbon chains that are C 8 - C 22 .
  • Preferred examples of saturated hydrocarbons (alkanes) are listed below: Systematic name Carbon chain Tetradecane C 14 H 30 Pentadecane C 15 H 32 Hexadecane C 16 H 34 Heptadecane C 17 H 36 Octadecane C 18 H 38 Nonadecane C 19 H 40 Eicosane C 20 H 42
  • Mono- and poly-unsaturated forms (alkenes and polyenes, such as alkadienes and alkatrienes) of hydrocarbons may also be selected, with compounds having one to three double bonds being preferred, although compound having more double bonds may be employed.
  • Alkynes (containing one or more triple bonds) and alkenynes (triple bond(s) and double bond(s)) may also b utilized. Examples of common mono- and poly-unsaturated hydrocarbons that may be employed include those shown in Figs. 1M, 1L and 1O .
  • Substituted forms of hydrocarbons may be employed in the compounds of the invention, with substituent groups that are inert in vivo and in vitro being preferred.
  • a particularly preferred substituent is fluorine.
  • Exemplary generic structures of polyfluorinated hydrocarbons include:
  • Fig. 1W shows an example of a polyfluorinated hydrocarbon conjugated to the 5' terminus of an oligonucleotide.
  • lipid components include simple fatty acids and fatty acid derivatives, glycerides and more complex lipids such as sterols, for example cholesterol.
  • Fatty acids and their derivatives may be fully saturated or mono- or poly-unsaturated. The length of the carbon chain may vary from C 2 - C 30 , but optimal telomerase inhibition may be obtained with carbon chains that are C 8 - C 22 .
  • Preferred examples of saturated fatty acids are listed below: Systematic name Trivial name Carbon chain Tetradecanoic myristic 14:0 Hexadecanoic palmitic 16:0 Octadecanoic stearic 18:0 Eicosanoic arachidic 20:0
  • Mono- and poly-unsaturated forms of fatty acids may also be employed, with compounds having one to three double bonds being preferred, although compounds having more double bonds may also be employed.
  • Examples of common mono- and poly-unsaturated fatty acids that may be employed include: Systematic name Trivial name Carbon chain Cis -9-hexadecanoic palmitoleic 16:1(n-7) Cis -6-octadecanoic petroselinic 18:1 (n-12) Cis -9-octadecanoic oleic 18:1 (n-9) 9,12-octadecadienoic linoleic 18:2 (n-6) 6,9,12-octadecatrienoic gamma -linolenic 18:3 (n-6) 9,12,15-octadecatrienoic alpha -linolenic 18:3 (n-3) 5,8,11,14-eicosatetraenoic arachidonic 20:4 (
  • Fatty acids with one or more triple bonds in the carbon chain may also be employed in the compounds of the invention.
  • Substituted forms of fatty acids may be employed in the compounds of the invention.
  • substituent groups that are inert in vivo and in vitro are preferred, with fluorine being a particularly preferred.
  • Exemplary generic structures of polyfluorinated derivatives of fatty acids suitable for use in the invention are:
  • Figs. 1U and 1V Examples of compounds of the invention having polyfluorinated derivatives of fatty acids are shown in Figs. 1U and 1V .
  • each L component is independently selected.
  • the use of the aldehyde form of a fatty acid (a fatty aldehyde) as the starting material results in the formation of an amine linkage between the lipid chain and the oligonucleotide, such that the lipid group appears as a hydrocarbon.
  • the linkage between the O and L components may be a direct linkage, or may be via an optional linker moiety, x.
  • the linker group may serve to facilitate the chemical synthesis of the compounds (discussed in the synthesis section below). Whether or not a linker group is used to mediate the conjugation of the O and L components, there are multiple sites on the oligonucleotide component O to which the L component(s) may be conveniently conjugated. Suitable linkage points include the 5' and 3' termini, one or more sugar rings, the internucleoside backbone and the nucleobases of the oligonucleotide. Typically, the L moiety is attached to the 3' or 5' terminus of the oligonucleotide.
  • the attachment may be directly to the 3' substituent, which in the case of the preferred phosphoramidate and thiophosphoramidate oligonucleotides is the 3'-amino group (examples are shown in Figs. 1A - C ), and in other instances, such as conventional phosphodiester oligonucleotides, is a 3-hydroxy group.
  • the L moiety may be linked via a 3'-linked phosphate group (an example is shown in Fig.
  • a hexadecane hydrocarbon is linked to the 3' phosphate of a thiophosphoramidate oligonucleotide through an O-alkyl linker.
  • the L moiety is typically attached through a 5'-linked phosphate group (see Fig. 1F which shows the use of an amino glycerol linker, and Fig. 1G which shows the use of a bis-amino glycerol linker).
  • Attachment to a base on the O moiety may through any suitable atom, for example to the N 2 amino group of guanosine (see Figs. 1Q - R ).
  • the individually selected L components may be attached at any suitable site(s).
  • one L group may be attached to each terminus, various L groups may be attached to the bases, or two or more L groups may be attached at one terminus (see Figs. 1E , 1J, 1K ).
  • the optional linker component x may be used to join the O and L components of the compounds. If a linker is to be employed, it is incorporated into the synthesis procedures as described in the legend to Fig. 2 , above. Examples of suitable linker groups include amino glycerol and O-alkyl glycerol-type linkers which respectively can be depicted by the generic structures:
  • Fig. 1 Examples of invention compounds are shown in Fig. 1 .
  • a generic base, B being depicted and R indicating the attachment point for the remainder of the oligonucleotide.
  • Compounds linked to the 3' terminus are illustrated with a 3'-nitrogen, consistent with the preferred thiophosphoramidate and phosphoramidate oligonucleotide chemistries.
  • Figs. 1A - 1L illustrate compounds having saturated lipid groups attached to the 5' or 3' termini.
  • Figs. 1M - 1P illustrate compounds having mono- or poly-unsaturated lipid groups.
  • Figs. 1A - 1L illustrate compounds having saturated lipid groups attached to the 5' or 3' termini.
  • Figs. 1M - 1P illustrate compounds having mono- or poly-unsaturated lipid groups.
  • Figs. 1A - 1L illustrate compounds having saturated lipid groups attached to the 5' or 3' termini.
  • 1Q - 1R illustrate compounds having lipid groups conjugated to the oligonucleotide through a base (in this case, guanosine).
  • Figs. 1S and 1CC illustrate 3'-and 5'-conjugated cholesterol lipid moiety, respectively.
  • Figs. 1U and 1V illustrate 5'-conjugated polyfluorine substituted fatty acid derivatives
  • Fig. 1W illustrates a 5' conjugated polyfluorinated hydrocarbon.
  • Figs. 1X - Z illustrate 5' lipid moieties containing oxygen.
  • the nomenclatures used herein for each of the lipid groups illustrated are as follows:
  • oligonucleotide components of the invention compounds may be synthesized using standard protocols for the type of chemistry selected. Methods for the synthesis of oligonucleotides having the preferred N3' ⁇ P5' phosphoramidate and N3' ⁇ P5' thiophosphoramidate chemistries are described in McCurdy et al., (1997) Tetrahedron Letters, 38:207-210 and Pongracz & Gryaznov, (1999) Tetrahedron Letters, 49:7661-7664 , respectively.
  • oligonucleotide The synthesis of compounds of the invention in which the lipid moiety is conjugated at the 5' or 3' terminus of the oligonucleotide can be achieved through use of suitable functional groups at the appropriate terminus, most typically an amino group, which can be reacted with carboxylic acids, acid chlorides, anhydrides and active esters. Thiol groups are also suitable as functional groups (see Kupihar et al., (2001) Bioorganic and Medicinal Chemistry 9:1241-1247 ). Both amino- and thiol- modifiers of different chain lengths are commercially available for oligonucleotide synthesis.
  • Oligonucleotides having N3' ⁇ P5' phosphoramidate and N3' ⁇ P5' thiophosphoramidate linkages contain 3'-amine groups (rather than 3'-hydroxy found in most conventional oligonucleotide chemistries), and hence these oligonucleotides provide a unique opportunity for conjugating lipid groups to the 3'-end of the oligonucleotide.
  • lipid groups can be attached to the termini of oligonucleotides with the preferred N3' ⁇ P5' phosphoramidate and N3' ⁇ P5' thiophosphoramidate chemistries.
  • Examples of synthetic schemes for producing the conjugated compounds of the invention are shown in Fig. 2 .
  • the conjugated compounds can be synthesized by reacting the free 3'- amino group of the fully protected solid support bound oligonucleotide with the corresponding acid anhydride followed by deprotection with ammonia and purification.
  • This approach yields a phosphoramidate or thiophosphoramidate linkage connecting the lipid and the oligonucleotide (exemplified by propyl-palmitoyl and 2-hydroxy-propyl-palmitoyl compounds).
  • Still another approach involves reaction of the free 3'-amino group of the fully protected support bound oligonucleotide with a suitable lipid aldehyde, followed by reduction with sodium cyanoborohydride, which produces an amine linkage.
  • the oligonucleotide can be synthesized using a modified, lipid-containing solid support, followed by synthesis of the oligonucleotide in the 5- to 3' direction as described in Pongracz & Gryaznov (1999).
  • An example of the modified support is provided in Schematic C below.
  • the fatty acid is palmitic acid: reaction of 3-amino-1,2-propanediol with palmitoyl chloride, followed by dimethoxytritylation and succinylation provided the intermediate used for coupling to the solid support.
  • R is long chain alkyl amine controlled pore glass.
  • the conjugates of the present invention may be used to inhibit or reduce telomerase enzyme activity and/or proliferation of cells having telomerase activity.
  • inhibition or reduction of the enzyme activity or cell proliferation refer to a lower level of the measured activity relative to a control experiment in which the enzyme or cells are not treated with the conjugate.
  • the inhibition or reduction in the measured activity is at least a 10% reduction or inhibition.
  • reduction or inhibition of the measured activity of at least 20%, 50%, 75%, 90% or 100% may be preferred for particular applications.
  • the ability of the invention compounds to inhibit telomerase can be determined in a cell-free assay (referred to as a biochemical assay) and in cells.
  • telomerase inhibitory activity Methods for measuring telomerase activity, and the use of such methods to determine the telomerase inhibitory activity of compounds are well known.
  • the TRAP assay is a standard assay method for measuring telomerase activity in a cell extract system and has been widely used in the search for telomerase inhibiting compounds ( Kim et al., Science 266:2011, 1997 ; Weinrich et al., Nature Genetics 17:498, 1997 ).
  • the TRAP assay measures the amount of radioactive nucleotides incorporated into elongation products (polynucleotides) formed by nucleotide addition to a telomerase substrate or primer.
  • the radioactivity incorporated can be measured as the intensity of a band on a detection screen (e.g., a Phosphorimager screen) exposed to a gel on which the radioactive products are separated.
  • a detection screen e.g., a Phosphorimager screen
  • the TRAP assay is also described in detail in U.S. Patent Nos. 5,629,154 , 5,837,453 and 5,863,726 , and its use in testing the activity of telomerase inhibitory compounds is described in various publications including WO 01/18015 .
  • the following kits are available commercially for research purposes for measuring telomerase activity: TRAPeze® XK Telomerase Detection Kit (Cat. s7707; Intergen Co., Purchase NY); and Telo TAGGG Telomerase PCR ELISA plus (Cat. 2,013,89; Roche Diagnostics, Indianapolis IN).
  • a preferred protocol for measuring the ability of compounds to inhibit telomerase in a biochemical assay is the direct (non-PCR based) cell-free telomerase assay, referred to as the "Flashplate assay", and described in Asai et al., Cancer Research, 63:3931-3939 (2003 ).
  • telomere activity in a cytosolic extract.
  • a preferred protocol for the cell-based assay is the cell-based telomerase assay described in Asai et al. (2003).
  • Telomerase-expressing tumor cell lines that are suitable for such assays include HME50-5E human breast epithelial cells (provided by Dr.
  • ovarian tumor cell lines OVCAR-5 MIISB, Milan
  • SK-OV-3 American Type Culture Collection, ATCC
  • human kidney carcinoma Caki-1 cells Japanese Collection of Research Bioresources, JCRB
  • human lung carcinoma 1549 cells ATCC
  • human epidermoid carcinoma A431 cells JCRB
  • human prostate cancer DU145 cells ATCC
  • a key therapeutic application of the compounds of the invention is the inhibition of the growth of telomerase-expressing cells, particularly tumor cells.
  • Compounds of the invention that inhibit telomerase activity in cells will, like other known telomerase-inhibiting compounds, induce crisis in telomerase-positive cell lines, leading to cessation of cell growth and death.
  • telomerase-positive cell lines leading to cessation of cell growth and death.
  • no crisis or other toxicity is induced by treatment with the invention compounds.
  • the ability of the compounds to specifically inhibit the growth of tumor cells can be assayed using tumor cell lines in vitro, or in xenograft animal models in vivo.
  • a preferred protocol for such growth curve assays is the short term cell viability assay described in Asai et al. (2003).
  • the compound In selecting a compound of the invention for therapeutic applications, it is preferred that the compound produce no significant cytotoxic effects at concentrations below about 10 ⁇ M in normal cells that do not express telomerase.
  • the present invention provides compounds that can specifically and potently inhibit telomerase activity, and which may therefore be used to inhibit the proliferation of telomerase-positive cells, such as tumor cells.
  • telomerase-positive cells such as tumor cells.
  • cancer cells have been shown to be telomerase-positive, including cells from cancer of the skin, connective tissue, adipose, breast, lung, stomach, pancreas, ovary, cervix, uterus, kidney, bladder, colon, prostate, central nervous system (CNS), retina and hematologic tumors (such as myeloma, leukemia and lymphoma).
  • the compounds provided herein are broadly useful in treating a wide range of malignancies. More importantly, the compounds of the present invention can be effective in providing treatments that discriminate between malignant and normal cells to a high degree, avoiding many of the deleterious side-effects present with most current chemotherapeutic regimens which rely on agents that kill dividing cells indiscriminately. Moreover, the compounds of the invention are more potent than equivalent unconjugated oligonucleotides, which means that they can be administered at lower doses, providing enhanced safety and significant reductions in cost of treatment.
  • One aspect of the invention therefore is a method of treating cancer in a patient, comprising administering to the patient a therapeutically effective dose of a compound of the present invention. Telomerase inhibitors, including compounds of the invention, may be employed in conjunction with other cancer treatment approaches, including surgical removal of primary tumors, chemotherapeutic agents and radiation treatment.
  • a compound of the invention is formulated in a therapeutically effective amount with a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier for example, having different L or O components
  • the pharmaceutical carrier may be solid or liquid.
  • Liquid carriers can be used in the preparation of solutions, emulsions, suspensions and pressurized compositions. The compounds are dissolved or suspended in a pharmaceutically acceptable liquid excipient.
  • liquid carriers for parenteral administration of the oligonucleotides preparations include water (which may contain additives, e.g., cellulose derivatives, preferably sodium carboxymethyl cellulose solution), phosphate buffered saline solution (PBS), alcohols (including monohydric alcohols and polyhydric alcohols, e.g., glycols) and their derivatives, and oils (e.g., fractionated coconut oil and arachis oil).
  • PBS phosphate buffered saline solution
  • alcohols including monohydric alcohols and polyhydric alcohols, e.g., glycols
  • oils e.g., fractionated coconut oil and arachis oil.
  • the liquid carrier can contain other suitable pharmaceutical additives including, but not limited to, the following: solubilizers, suspending agents, emulsifiers, buffers, thickening agents, colors, viscosity regulators, preservatives, stabilizers and osmolarity regulators.
  • the carrier can also be an oily ester such as ethyl oleate and isopropyl myristate.
  • Sterile carriers are useful in sterile liquid form compositions for parenteral administration.
  • Sterile liquid pharmaceutical compositions, solutions or suspensions can be utilized by, for example, intraperitoneal injection, subcutaneous injection, intravenously, or topically.
  • the oligonucleotides can also be administered intravascularly or via a vascular stent.
  • the liquid carrier for pressurized compositions can be a halogenated hydrocarbon or other pharmaceutically acceptable propellant.
  • Such pressurized compositions may also be lipid encapsulated for delivery via inhalation.
  • the oligonucleotides may be formulated into an aqueous or partially aqueous solution, which can then be utilized in the form of an aerosol.
  • the compounds may be administered topically as a solution, cream, or lotion, by formulation with pharmaceutically acceptable vehicles containing the active compound.
  • compositions of this invention may be orally administered in any acceptable dosage including, but not limited to, formulations in capsules, tablets, powders or granules, and as suspensions or solutions in water or non-aqueous media.
  • Pharmaceutical compositions and/or formulations comprising the oligonucleotides of the present invention may include carriers, lubricants, diluents, thickeners, flavoring agents, emulsifiers, dispersing aids or binders.
  • carriers which are commonly used include lactose and corn starch.
  • Lubricating agents such as magnesium stearate, are also typically added.
  • useful diluents include lactose and dried corn starch.
  • the compounds of the invention have superior characteristics for cellular and tissue penetration, they may be formulated to provide even greater benefit, for example in liposome carriers.
  • liposomes to facilitate cellular uptake is described, for example, in U.S. Patent No. 4,897,355 and U.S. Patent No. 4,394,448 . Numerous publications describe the formulation and preparation of liposomes.
  • the compounds can also be formulated by mixing with additional penetration enhancers, such as unconjugated forms of the lipid moieties described above, including fatty acids and their derivatives.
  • Examples include oleic acid, lauric acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, recinleate, monoolein (a.k.a.
  • bile salts may be used in combination with fatty acids to make complex formulations.
  • exemplary combinations include chenodeoxycholic acid (CDCA), generally used at concentrations of about 0.5 to 2%, combined with sodium caprate or sodium laurate, generally used at concentrations of about 0.5 to 5%.
  • DCA chenodeoxycholic acid
  • compositions and/or formulations comprising the oligonucleotides of the present invention may also include chelating agents, surfactants and non-surfactants.
  • Chelating agents include, but are not limited to, disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines).
  • Surfactants include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether; and perfluorochemical emulsions, such as FC-43.
  • Non-surfactants include, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives, and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone.
  • a method of formulating a pharmaceutical composition comprising providing a compound as described herein, and combining the compound with a pharmaceutically acceptable excipient.
  • the compound is provided at pharmaceutical purity, as defined below.
  • the method may further comprise adding to the compound, either before or after the addition of the excipient, a penetration enhancing agent.
  • the pharmaceutical composition will typically comply with pharmaceutical purity standards.
  • a compound of this invention is generally purified away from other reactive or potentially immunogenic components present in the mixture in which they are prepared.
  • the active ingredient is provided in at least about 50% homogeneity, and more preferably 60%, 70%, 80% or 90% homogeneity, as determined by functional assay, chromatography, or gel electrophoresis.
  • the active ingredient is then compounded into a medicament in accordance with generally accepted procedures for the preparation of pharmaceutical preparations.
  • providing the compounds at pharmaceutical purity requires that the compound be provided at at least about 50% homogeneity, and more preferably at least 80% or 90% homogeneity.
  • the pharmaceutical composition will also typically be aliquoted and packaged in either single dose or multi-dose units.
  • the dosage requirements for treatment with the oligonucleotide compound vary with the particular compositions employed, the route of administration, the severity of the symptoms presented, the form of the compound and the particular subject being treated.
  • compositions of the invention can be administered to a subject in a formulation and in an amount effective to achieve a clinically desirable result.
  • desirable results include reduction in tumor mass (as determined by palpation or imaging; e.g., by radiography, radionucleotide scan, CAT scan, or MRI), reduction in the rate of tumor growth, reduction in the rate of metastasis formation (as determined e.g., by histochemical analysis of biopsy specimens), reduction in biochemical markers (including general markers such as ESR, and tumor-specific markers such as serum PSA), and improvement in quality of life (as determined by clinical assessment, e.g., Karnofsky score), increased time to progression, disease-free survival and overall survival.
  • the amount of compound per dose and the number of doses required to achieve such effects will vary depending on many factors including the disease indication, characteristics of the patient being treated and the mode of administration. Typically, the formulation and route of administration will provide a local concentration at the disease site of between 1 ⁇ M and 1 nM of the compound.
  • the compounds are administered at a concentration that affords effective results without causing any harmful or deleterious side effects.
  • concentration can be achieved by administration of either a single unit dose, or by the administration of the dose divided into convenient subunits at suitable intervals throughout the day.
  • lipid moieties are conjugated at either the 3' or 5' terminus, or both, either with or without a linker.
  • the general structure of these compounds can be represented as: wherein R 1 and R 2 are independently either H or a lipid moiety (L), Y is O (phosphoramidate oligonucleotide) or S (thiophosphoramidate oligonucleotide), n is an integer, typically between 4 and 49, and B represents a base (independently selected for each nucleoside subunit).
  • R 1 and R 2 are independently either H or a lipid moiety (L)
  • Y is O (phosphoramidate oligonucleotide) or S (thiophosphoramidate oligonucleotide)
  • n is an integer, typically between 4 and 49
  • B represents a base (independently selected for each nucleoside subunit).
  • the optional linker is not depicted in this structure.
  • Oligonucleotide N3' ⁇ P5' phosphoramidates (NP) and thiophosphoramidates (NPS) were synthesized on a 1 ⁇ mole scale using the amidite transfer reaction on an ABI 394 synthesizer according to the procedures described by McCurdy et al., (1997) Tetrahedron Letters, 38:207-210 and Pongracz & Gryaznov, (1999) Tetrahedron Letters 49:7661-7664 , respectively.
  • the fully protected monomer building blocks were 3'-aminotrityl-nucleoside-5'-(2-cyanoethyl-N,N-diisopropylamino)nucleosidephosphoramidites, specifically 3'-deoxy-thymidine, 2',3'-dideoxy-N 2 -isobutyryl-guanosine, 2',3'-dideoxy-N 6 -benzoyl-adenosine, and 2',3'-dideoxy-N 4 -benzoyl-cytidine purchased from Transgenomic, Inc. (Omaha, Iowa).
  • 3'-aminotrityl-5'-succinyl-nucleosides were coupled with amino group containing long chain controlled pore glass (LCAA-CPG) and used as the solid support.
  • the synthesis was performed in the 5'to 3' direction.
  • Oligonucleotides with NP backbones were synthesized using the standard 1 ⁇ M (ABI Perkin Elmer) procedure with an iodine/H 2 O oxidation step, while oligonucleotides with NPS backbones were prepared using the sulfur protocol in which a 0.1 M solution of phenylacetyl disulfide (PADS) in an acetonitrile: 2,6-lutidine 1:1 mixture was used as the sulfurization reagent.
  • PADS phenylacetyl disulfide
  • Coupling time was 25 seconds for preparation of both types of backbone.
  • An 18:1:1 mixture of THF:isobutyric anhydride:2,6-lutidine was used as the capping agent.
  • Three methods were used to conjugate the lipid moiety to the oligonucleotide: method (i) coupling using phosphoramidite reagents on the synthesizer to introduce the lipid moiety at the 3' end; method (ii) use of a modified solid support (exemplified in Schematic C above) to which the lipid group was conjugated prior to initiation of elongation synthesis for production of 5' conjugates; and method (iii) reaction of the free 3'- amino group while still on the solid support followed by deprotection.
  • Oligonucleotides were deprotected with concentrated ammonia for lipid groups attached to the 3' terminus or a nucleobase, or a 1:1 mixture of ethanol:concentrated ammonia for lipid groups attached to the 5' terminus, at 55°C for 6 - 8 hrs.
  • the crude products were either desalted on Pharmacia NAP-25 gel filtration columns or precipitated with ethanol from 1 M sodium chloride then lyophilized in vacuo.
  • the oligonucleotide products were subsequently purified by reversed phase HPLC using a Beckman Ultrasphere C18 (5 ⁇ ) 250 x 10 mm column.
  • the products were eluted with a linear gradient of acetonitrile in 50 mM triethylammonium acetate at a flow rate of 2 ml/min and converted to sodium salt with precipitation from 1 M sodium chloride with neat cold ethanol.
  • Purity of the compounds was assessed by analytical RP HPLC using the above solvent system and by PAGE. 1 H and 31 P NMR spectra were recorded on a VARIAN Unity Plus 400 MHz instrument and electrospray ionization mass spectra (ESI MS) were obtained using a WATERS Micromass ZMD mass spectrometer.
  • ESI MS electrospray ionization mass spectra
  • Method (i) In this method phosphoramidite reagents containing a conjugated lipid group are added as the 3' nucleoside during the oligonucleotide synthesis process, resulting in lipid group conjugated to the 3' terminus of the oligonucleotide.
  • Method (i) phosphoramidite reagents containing a conjugated lipid group are added as the 3' nucleoside during the oligonucleotide synthesis process, resulting in lipid group conjugated to the 3' terminus of the oligonucleotide.
  • the synthesis and subsequent coupling of two fatty acid-containing phosphoramidites exemplify this approach.
  • the vessel was then placed on a shaker and the reaction allowed to proceed overnight at room temperature.
  • the CPG was filtered, and then washed with methylene chloride, methanol and acetonitrile.
  • the unreacted amino groups were capped using a 1:1 solution of THF-2,6-lutidine-isobutyric anhydride 18:1:1 and Cap B (N-methylimidazole/THF) for 1 hour at room temperature on a shaker. After further filtration, the beads were washed with methanol, methylene chloride and acetonitrile.
  • the loading was determined by the standard method of measuring the dimethoxytrityl cation absorbance at 498 nm of a sample deblocked using methanolic perchloric acid and was found to be 50-60 ⁇ mole/g.
  • modified solid supports were produced, they were employed in oligonucleotide syntheses as described above. Examples of the oligonucleotide conjugates produced in this way are shown in Figs. 1F, 1G and 1H .
  • the lipid group is conjugated not to a terminus of the oligonucleotide, but to a nucleobase on the chain, for example a guanosine.
  • a nucleobase on the chain for example a guanosine.
  • These compounds are synthesized using a conventional oligonucleotide chain extension protocol, as described above, but with the incorporation of a base modified with a covalently conjugated lipid group, such as depicted in Fig. 2E . Examples of compounds in which the lipid group is conjugated to a nucleobase are shown in Figs. 1Q and R .
  • the following table shows the melting temperatures of each of these three compounds when associated with matched RNA (determined using standard methods), the IC 50 value for telomerase inhibition determined using the biochemical assay, and the IC 50 for telomerase inhibition determined using the cell-based assay (with HT-3 cells) as described above.
  • the non-conjugated oligonucleotide A showed very high affinity binding to its target, with a melting temperature of 70°C, and an IC 50 value for telomerase inhibition of 0.15 nM in a biochemical assay (where cellular uptake is not an issue).
  • compound A had good uptake into intact cells, with a low micromolar IC 50 for telomerase inhibition in multiple different tumor cell lines (1.6 ⁇ M in HT-3 cells in this experiment), this reflected an approximately 10,000-fold loss of potency in intact cells relative to biochemical potency.
  • FIGs. 3 and 4 show data obtained with compounds A, B and C in intact U251 (human glioblastoma) cells and DU145 (human prostate cancer) cells, respectively.
  • the IC 50 of compound C (5' lipidated form) was approximately 10-fold lower than that of compound A in the U251 cells, and approximately 38 fold lower in the DU145 cells, confirming the increased efficacy of treatment with compound C.
  • mice were inoculated with DU-145 tumor cells in both flanks. When the tumors (two tumors/mouse) reached 50 - 100 mm 3 in size, the mice received a single tail vein injection of PBS, FITC-labeled compound A, or FITC-labeled compound C (both compounds administered at 40 mg/kg). Mice were sacrificed 24 hours post IV injection; one tumor was harvested for fluorescent imaging and the other tumor was analyzed for telomerase activity by TRAP assay.
  • the plasma of patients with myeloma contains a characteristic high level (detected as a "myeloma spike” or M-protein) of the antibody produced by the cancerous cells. Reduction of the M-protein level is correlative with remission of the disease.
  • M-protein myeloma spike
  • the abilities of the non-conjugated oligonucleotide compound A and the lipid-conjugated oligonucleotide compound C to reduce the level of the level of M-protein in animals injected with myeloma cells were compared.
  • Irradiated NOD/SCID mice were injected with 10 6 CAG myeloma cells and then treated with intraperitoneal (IP) injections of PBS, compound A in PBS, or compound C in PBS.
  • Compound A was dosed at 25 mg/kg/day (175 mg/kg week x 5 weeks); compound C was dosed at 25 mg/kg/day for the first 2 weeks, held for week three, and then dosed at 25 mg/kg/day three days per week for the last two weeks (average dose of 100 mg/kg/week over the five weeks).
  • the mice were sacrificed, and the plasma pooled within each group (4 - 5 mice/group) for determination of myeloma protein.
  • the compound C group demonstrated a lower level of myeloma protein (values normalized per mouse).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Epidemiology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Virology (AREA)
  • Botany (AREA)
  • Oncology (AREA)
  • Hematology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Saccharide Compounds (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
EP19209408.4A 2003-09-09 2004-09-09 Modified oligonucleotides for telomerase inhibition Pending EP3682903A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US50150903P 2003-09-09 2003-09-09
EP17200625.6A EP3342425B1 (en) 2003-09-09 2004-09-09 Modified oligonucleotides for telomerase inhibition
EP04783801.6A EP1667522B1 (en) 2003-09-09 2004-09-09 Modified oligonucleotides for telomerase inhibition
PCT/US2004/029718 WO2005023994A2 (en) 2003-09-09 2004-09-09 Modified oligonucleotides for telomerase inhibition

Related Parent Applications (2)

Application Number Title Priority Date Filing Date
EP17200625.6A Division EP3342425B1 (en) 2003-09-09 2004-09-09 Modified oligonucleotides for telomerase inhibition
EP04783801.6A Division EP1667522B1 (en) 2003-09-09 2004-09-09 Modified oligonucleotides for telomerase inhibition

Publications (1)

Publication Number Publication Date
EP3682903A1 true EP3682903A1 (en) 2020-07-22

Family

ID=34273050

Family Applications (3)

Application Number Title Priority Date Filing Date
EP04783801.6A Expired - Lifetime EP1667522B1 (en) 2003-09-09 2004-09-09 Modified oligonucleotides for telomerase inhibition
EP17200625.6A Expired - Lifetime EP3342425B1 (en) 2003-09-09 2004-09-09 Modified oligonucleotides for telomerase inhibition
EP19209408.4A Pending EP3682903A1 (en) 2003-09-09 2004-09-09 Modified oligonucleotides for telomerase inhibition

Family Applications Before (2)

Application Number Title Priority Date Filing Date
EP04783801.6A Expired - Lifetime EP1667522B1 (en) 2003-09-09 2004-09-09 Modified oligonucleotides for telomerase inhibition
EP17200625.6A Expired - Lifetime EP3342425B1 (en) 2003-09-09 2004-09-09 Modified oligonucleotides for telomerase inhibition

Country Status (20)

Country Link
US (8) US7494982B2 (sl)
EP (3) EP1667522B1 (sl)
JP (10) JP4690324B2 (sl)
KR (3) KR101319388B1 (sl)
CN (2) CN100393209C (sl)
AU (2) AU2004271215B2 (sl)
BR (1) BRPI0414222B8 (sl)
CA (1) CA2536015C (sl)
CY (2) CY1120113T1 (sl)
DK (2) DK3342425T3 (sl)
ES (2) ES2662196T3 (sl)
HK (1) HK1257622A1 (sl)
HU (2) HUE048359T2 (sl)
IL (1) IL173747A (sl)
MX (1) MXPA06002660A (sl)
NZ (1) NZ545516A (sl)
PL (2) PL3342425T3 (sl)
PT (2) PT3342425T (sl)
SI (2) SI3342425T1 (sl)
WO (1) WO2005023994A2 (sl)

Families Citing this family (59)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BRPI0414222B8 (pt) * 2003-09-09 2021-05-25 Geron Corp compostos oligonucleotídeos modificados para inibição da telomerase, métodos, composição farmacêutica e usos relacionados
US9133233B2 (en) 2003-11-04 2015-09-15 Geron Corporation RNA amidates and thioamidates for RNAi
ME02933B (me) 2004-07-02 2018-04-20 Geron Corp Sinteza zaštićenih 3'-amino nukleozionih monomera
WO2006113470A2 (en) * 2005-04-15 2006-10-26 Geron Corporation Cancer treatment by combined inhibition of proteasome and telomerase activities
WO2006138145A1 (en) 2005-06-14 2006-12-28 Northwestern University Nucleic acid functionalized nanoparticles for therapeutic applications
WO2007127163A2 (en) * 2006-04-24 2007-11-08 Geron Corporation Cns-tumor treatment method and composition
EP2898887B1 (en) * 2006-10-30 2018-09-26 Geron Corporation Combined telomerase inhibitor and gemcitabine for the treatment of cancer
WO2008094640A2 (en) 2007-01-30 2008-08-07 Geron Corporation Compounds having anti-adhesive effects on cancer cells
CA2691066C (en) 2007-02-09 2018-07-31 Northwestern University Particles for detecting intracellular targets
US9155753B2 (en) * 2007-03-09 2015-10-13 Geron Corporation Treatment of carcinomas with a combination of EGF-pathway and telomerase inhibitors
EP2476689B1 (en) 2007-05-10 2015-10-21 Agilent Technologies, Inc. Thiocarbon-protecting groups for RNA synthesis
AU2008259907B2 (en) 2007-05-30 2014-12-04 Northwestern University Nucleic acid functionalized nanoparticles for therapeutic applications
TW200927177A (en) * 2007-10-24 2009-07-01 Nat Inst Of Advanced Ind Scien Lipid-modified double-stranded RNA having potent RNA interference effect
EP2307029A1 (en) * 2008-07-02 2011-04-13 Santaris Pharma A/S Rna antagonists targeting hsp27
EP2175023A1 (en) * 2008-07-31 2010-04-14 The University of Zurich Anti-tumor activity of small double-stranded oligodeoxynucleotides targeting telomerase RNA
EP3719139B1 (en) 2008-10-17 2022-11-30 Geron Corporation Method for identification of sensitivity of a patient to telomerase inhibition therapy
EP3335705A1 (en) 2008-11-24 2018-06-20 Northwestern University Polyvalent rna-nanoparticle compositions
KR101881596B1 (ko) 2008-12-02 2018-07-24 웨이브 라이프 사이언시스 재팬 인코포레이티드 인 원자 변형된 핵산의 합성 방법
US20100233270A1 (en) 2009-01-08 2010-09-16 Northwestern University Delivery of Oligonucleotide-Functionalized Nanoparticles
CN102596204B (zh) 2009-07-06 2016-11-23 波涛生命科学有限公司 新的核酸前药及其使用方法
CN102666879B (zh) 2009-10-30 2016-02-24 西北大学 模板化的纳米缀合物
WO2011079290A1 (en) * 2009-12-24 2011-06-30 Northwestern University Oligonucleotide specific uptake of nanoconjugates
WO2012039448A1 (ja) 2010-09-24 2012-03-29 株式会社キラルジェン 不斉補助基
EP2691775B1 (en) 2011-03-28 2017-12-13 Geron Corporation Telomere length measurement in formalin-fixed, paraffin embedded (ffpe) samples by quantitative pcr
ES2626488T3 (es) 2011-07-19 2017-07-25 Wave Life Sciences Pte. Ltd. Procedimientos para la síntesis de ácidos nucleicos funcionalizados
WO2013040499A1 (en) 2011-09-14 2013-03-21 Northwestern University Nanoconjugates able to cross the blood-brain barrier
SG11201500232UA (en) 2012-07-13 2015-04-29 Wave Life Sciences Pte Ltd Chiral control
AU2013288048A1 (en) 2012-07-13 2015-01-22 Wave Life Sciences Ltd. Asymmetric auxiliary group
CA3201145A1 (en) * 2012-10-26 2014-05-01 Geron Corporation C-myc antisense oligonucleotides and methods for using the same to treat cell-proliferative disorders
US9228189B2 (en) 2012-10-26 2016-01-05 Geron Corporation C-myc antisense oligonucleotides and methods for using the same to treat cell-proliferative disorders
SG11201504209YA (en) 2012-11-30 2015-06-29 Geron Corp Diagnostic markers for treating cell proliferative disorders with telomerase inhibitors
US9200327B2 (en) 2012-11-30 2015-12-01 Geron Corporation Diagnostic markers for treating cell proliferative disorders with telomerase inhibitors
US9375485B2 (en) 2012-12-07 2016-06-28 Geron Corporation Use of telomerase inhibitors for the treatment of myeloproliferative disorders and myeloproliferative neoplasms
DK3456333T3 (da) 2012-12-07 2020-05-18 Geron Corp Anvendelse af telomeraseinhibitor imetelstat til behandling af myelodysplastisk syndrom
WO2014130909A1 (en) 2013-02-22 2014-08-28 The Board Of Trustees Of The Leland Stanford Junior University Compounds, compositions, methods, and kits relating to telomere extension
EP3024936B1 (en) 2013-07-25 2019-09-04 Exicure, Inc. Spherical nucleic acid-based constructs as immunostimulatory agents for prophylactic and therapeutic use
US9708360B2 (en) 2013-09-30 2017-07-18 Geron Corporation Phosphorodiamidate backbone linkage for oligonucleotides
EP3095459A4 (en) 2014-01-15 2017-08-23 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having antitumor effect and antitumor agent
EP3095461A4 (en) 2014-01-15 2017-08-23 Shin Nippon Biomedical Laboratories, Ltd. Chiral nucleic acid adjuvant having immunity induction activity, and immunity induction activator
CN106068325B (zh) 2014-01-16 2021-07-09 波涛生命科学有限公司 手性设计
JOP20200257A1 (ar) 2014-05-01 2017-06-16 Geron Corp تركيبات أوليجو نوكليوتيد وطرق لتحضيرها
CA2953216C (en) 2014-06-04 2020-12-22 Exicure, Inc. Multivalent delivery of immune modulators by liposomal spherical nucleic acids for prophylactic or therapeutic applications
AU2015349680A1 (en) 2014-11-21 2017-06-08 Northwestern University The sequence-specific cellular uptake of spherical nucleic acid nanoparticle conjugates
KR101766373B1 (ko) * 2015-01-05 2017-08-09 권영아 루테리온을 이용한 암세포의 텔로머라아제 억제방법
PE20221275A1 (es) * 2015-04-23 2022-09-01 Geron Corp Metodos de preparacion de polinucleotidos usando composiciones salinas de cationes multivalentes
ES2781459T3 (es) 2015-07-29 2020-09-02 Ifom Fondazione St Firc Di Oncologia Molecolare Oligonucleótidos terapéuticos
EP3124609A1 (en) 2015-07-29 2017-02-01 IFOM Fondazione Istituto Firc di Oncologia Molecolare Therapeutics oligonucleotides
MA45290A (fr) * 2016-05-04 2019-03-13 Wave Life Sciences Ltd Procédés et compositions d'agents biologiquement actifs
EP3318276A1 (en) 2016-11-04 2018-05-09 Janssen Biotech, Inc. Combinations of a telomerase inhibitor and a bcl-2 inhibitor for the treatment of hematological cancers
KR20190141184A (ko) 2017-04-20 2019-12-23 신테나 아게 트리시클로-dna 뉴클레오시드를 포함하는 변형 올리고머 화합물 및 그의 용도
US11696954B2 (en) 2017-04-28 2023-07-11 Exicure Operating Company Synthesis of spherical nucleic acids using lipophilic moieties
US11433131B2 (en) 2017-05-11 2022-09-06 Northwestern University Adoptive cell therapy using spherical nucleic acids (SNAs)
KR102709587B1 (ko) 2017-07-10 2024-09-27 제론 코포레이션 이메텔스타트를 제조하기 위한 향상된 공정
KR20200033269A (ko) 2017-07-28 2020-03-27 제론 코포레이션 골수형성이상 증후군의 치료 방법
KR20210018267A (ko) 2018-05-07 2021-02-17 알닐람 파마슈티칼스 인코포레이티드 간외 전달
JPWO2021054370A1 (sl) * 2019-09-18 2021-03-25
MX2022005008A (es) 2019-10-28 2022-08-08 Geron Corp Sales de 3-(ácido graso amido)-2-hidroxi-1-(hidroxi protegido)-propano succinilada solida amorfa y métodos para elaborarlas.
US11987540B2 (en) 2019-10-28 2024-05-21 Geron Corporation Crystalline solids of 3-palmitoyl-amido-1,2-propanediol and 3-palmitoyl-amido-2-hydroxy-1-dimethoxytriphenylmethylether-propane and methods of making and using the same
WO2022186350A1 (ja) * 2021-03-03 2022-09-09 国立大学法人東京大学 非環式スレオニノール核酸

Citations (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4394448A (en) 1978-02-24 1983-07-19 Szoka Jr Francis C Method of inserting DNA into living cells
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
WO1990010448A2 (en) 1989-03-07 1990-09-20 Genentech, Inc. Covalent conjugates of lipid and oligonucleotide
WO1991014696A1 (en) * 1990-03-29 1991-10-03 Gilead Sciences, Inc. Oligonucleotide-transport agent disulfide conjugates
US5411947A (en) 1989-06-28 1995-05-02 Vestar, Inc. Method of converting a drug to an orally available form by covalently bonding a lipid to the drug
US5416203A (en) 1989-06-06 1995-05-16 Northwestern University Steroid modified oligonucleotides
US5419966A (en) * 1991-06-10 1995-05-30 Microprobe Corporation Solid support for synthesis of 3'-tailed oligonucleotides
US5420330A (en) 1990-09-07 1995-05-30 Pharmacia P-L Biochemicals Inc. Lipo-phosphoramidites
US5583016A (en) 1994-07-07 1996-12-10 Geron Corporation Mammalian telomerase
US5629154A (en) 1993-11-12 1997-05-13 Geron Corporation Telomerase activity assays
US5763208A (en) 1992-04-14 1998-06-09 Gilead Sciences, Inc. Oligonucleotides and their analogs capable of passive cell membrane permeation
WO1998028442A1 (en) 1996-12-20 1998-07-02 Geron Corporation Methods for detecting and inhibiting the rna component of telomerase
US5837453A (en) 1992-05-13 1998-11-17 Geron Corporation Telomerase activity assays
US5863726A (en) 1993-11-12 1999-01-26 Geron Corporation Telomerase activity assays
WO2001018015A1 (en) 1999-09-10 2001-03-15 Geron Corporation Oligonucleotide n3'→p5' thiophosphoramidates: their synthesis and use
US6261836B1 (en) 1996-10-01 2001-07-17 Geron Corporation Telomerase
US6331399B1 (en) 2000-05-16 2001-12-18 Isis Pharmaceuticals, Inc. Antisense inhibition of tert expression
US6444650B1 (en) 1996-10-01 2002-09-03 Geron Corporation Antisense compositions for detecting and inhibiting telomerase reverse transcriptase
US6448392B1 (en) 1985-03-06 2002-09-10 Chimerix, Inc. Lipid derivatives of antiviral nucleosides: liposomal incorporation and method of use
US6548298B2 (en) 1994-07-07 2003-04-15 Geron Corporation Mammalian telomerase
US20030096776A1 (en) * 1992-09-29 2003-05-22 Isis Pharmaceuticals, Inc. Modulation of telomere length by oligonucleotides having a G-core sequence
US20030138814A1 (en) * 2001-03-23 2003-07-24 Sergei Gryaznov Oligonucleotide conjugates

Family Cites Families (45)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5185444A (en) 1985-03-15 1993-02-09 Anti-Gene Deveopment Group Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages
US4757141A (en) 1985-08-26 1988-07-12 Applied Biosystems, Incorporated Amino-derivatized phosphite and phosphate linking agents, phosphoramidite precursors, and useful conjugates thereof
US4659774A (en) 1985-11-01 1987-04-21 American Hoechst Corporation Support for solid-phase oligonucleotide synthesis
US4904582A (en) 1987-06-11 1990-02-27 Synthetic Genetics Novel amphiphilic nucleic acid conjugates
US6153737A (en) 1990-01-11 2000-11-28 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US6114513A (en) 1990-01-11 2000-09-05 Isis Pharmaceuticals, Inc. Thiol-derivatized oligonucleotides
US6395492B1 (en) 1990-01-11 2002-05-28 Isis Pharmaceuticals, Inc. Derivatized oligonucleotides having improved uptake and other properties
US5489508A (en) 1992-05-13 1996-02-06 University Of Texas System Board Of Regents Therapy and diagnosis of conditions related to telomere length and/or telomerase activity
US6235886B1 (en) 1993-09-03 2001-05-22 Isis Pharmaceuticals, Inc. Methods of synthesis and use
IL107150A0 (en) 1992-09-29 1993-12-28 Isis Pharmaceuticals Inc Oligonucleotides having a conserved g4 core sequence
US5476925A (en) 1993-02-01 1995-12-19 Northwestern University Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups
US6350853B1 (en) 1993-04-26 2002-02-26 Peter E. Nielsen Conjugated peptide nucleic acids having enhanced cellular uptake
DE4331670A1 (de) 1993-09-17 1995-03-23 Hoechst Ag Neue Antisense-Oligonucleotide gegen HSV-1 sowie deren Herstellung
JP4281926B2 (ja) 1993-10-18 2009-06-17 ザ・ワルター・アンド・エリザ・ホール・インスティテュート・オヴ・メディカル・リサーチ ニューロンの生き残りを増加させる方法およびそれに有用な薬剤
US5599922A (en) 1994-03-18 1997-02-04 Lynx Therapeutics, Inc. Oligonucleotide N3'-P5' phosphoramidates: hybridization and nuclease resistance properties
US5726297A (en) 1994-03-18 1998-03-10 Lynx Therapeutics, Inc. Oligodeoxyribonucleotide N3' P5' phosphoramidates
HUT76094A (en) 1994-03-18 1997-06-30 Lynx Therapeutics Oligonucleotide n3'-p5' phosphoramidates: synthesis and compounds; hybridization and nuclease resistance properties
GB9413035D0 (en) 1994-06-29 1994-08-17 Scras Antisense oligonucleeotides
ATE308554T1 (de) 1994-07-07 2005-11-15 Geron Corp Säugetier-telomerase
AU4101396A (en) 1994-11-07 1996-05-31 Hybridon, Inc. Synthesis of 35s-labeled oligonucleotides with 3h-1,2-benzodithiol-3-1,1-dioxide
US5656638A (en) 1995-04-18 1997-08-12 Geron Corporation Telomerase inhibitors
US5760062A (en) 1995-04-18 1998-06-02 Geron Corporation Telomerase inhibitors
US5863936A (en) 1995-04-18 1999-01-26 Geron Corporation Telomerase inhibitors
US5840490A (en) 1995-06-07 1998-11-24 Mcmaster University Telomerase activity associated with hematological and colorectal malignancies
US5770613A (en) 1995-09-29 1998-06-23 Geron Corporation Telomerase inhibitors
US5767278A (en) 1995-10-06 1998-06-16 Geron Corporation Telomerase inhibitors
US5684143A (en) 1996-02-21 1997-11-04 Lynx Therapeutics, Inc. Oligo-2'-fluoronucleotide N3'->P5' phosphoramidates
US5859233A (en) 1996-02-21 1999-01-12 Lynx Therapeutics, Inc. Synthons for synthesis of oligonucleotide N3-P5 phosphoramidates
GB9606158D0 (en) 1996-03-23 1996-05-29 Ciba Geigy Ag Chemical compounds
US6015710A (en) 1996-04-09 2000-01-18 The University Of Texas System Modulation of mammalian telomerase by peptide nucleic acids
AU2445997A (en) * 1996-04-10 1997-10-29 Lynx Therapeutics, Inc. Telomerase inhibitors
US6111085A (en) 1996-09-13 2000-08-29 Isis Pharmaceuticals, Inc. Carbamate-derivatized nucleosides and oligonucleosides
US6001991A (en) 1996-10-04 1999-12-14 Isis Pharmaceuticals Inc. Antisense oligonucleotide modulation of MDR P-glycoprotein gene expression
US5846723A (en) 1996-12-20 1998-12-08 Geron Corporation Methods for detecting the RNA component of telomerase
US5877309A (en) 1997-08-13 1999-03-02 Isis Pharmaceuticals, Inc. Antisense oligonucleotides against JNK
US5998604A (en) 1997-09-15 1999-12-07 The Perkin-Elmer Corporation Polynucleotide purification method
JP3722630B2 (ja) 1998-10-28 2005-11-30 パイオニア株式会社 記録再生装置
US6656730B1 (en) 1999-06-15 2003-12-02 Isis Pharmaceuticals, Inc. Oligonucleotides conjugated to protein-binding drugs
AU2002245717A1 (en) 2001-03-23 2002-10-08 Geron Corporation Oligonucleotide conjugates
BRPI0414222B8 (pt) 2003-09-09 2021-05-25 Geron Corp compostos oligonucleotídeos modificados para inibição da telomerase, métodos, composição farmacêutica e usos relacionados
US20120329858A1 (en) 2010-08-04 2012-12-27 Geron Corporation Modified oligonucleotides for telomerase inhibition
ME02933B (me) 2004-07-02 2018-04-20 Geron Corp Sinteza zaštićenih 3'-amino nukleozionih monomera
WO2006113470A2 (en) 2005-04-15 2006-10-26 Geron Corporation Cancer treatment by combined inhibition of proteasome and telomerase activities
WO2007127163A2 (en) 2006-04-24 2007-11-08 Geron Corporation Cns-tumor treatment method and composition
EP2898887B1 (en) 2006-10-30 2018-09-26 Geron Corporation Combined telomerase inhibitor and gemcitabine for the treatment of cancer

Patent Citations (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4394448A (en) 1978-02-24 1983-07-19 Szoka Jr Francis C Method of inserting DNA into living cells
US4897355A (en) 1985-01-07 1990-01-30 Syntex (U.S.A.) Inc. N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor
US6448392B1 (en) 1985-03-06 2002-09-10 Chimerix, Inc. Lipid derivatives of antiviral nucleosides: liposomal incorporation and method of use
WO1990010448A2 (en) 1989-03-07 1990-09-20 Genentech, Inc. Covalent conjugates of lipid and oligonucleotide
US5416203A (en) 1989-06-06 1995-05-16 Northwestern University Steroid modified oligonucleotides
US5411947A (en) 1989-06-28 1995-05-02 Vestar, Inc. Method of converting a drug to an orally available form by covalently bonding a lipid to the drug
WO1991014696A1 (en) * 1990-03-29 1991-10-03 Gilead Sciences, Inc. Oligonucleotide-transport agent disulfide conjugates
US5420330A (en) 1990-09-07 1995-05-30 Pharmacia P-L Biochemicals Inc. Lipo-phosphoramidites
US5419966A (en) * 1991-06-10 1995-05-30 Microprobe Corporation Solid support for synthesis of 3'-tailed oligonucleotides
US5763208A (en) 1992-04-14 1998-06-09 Gilead Sciences, Inc. Oligonucleotides and their analogs capable of passive cell membrane permeation
US5837453A (en) 1992-05-13 1998-11-17 Geron Corporation Telomerase activity assays
US20030096776A1 (en) * 1992-09-29 2003-05-22 Isis Pharmaceuticals, Inc. Modulation of telomere length by oligonucleotides having a G-core sequence
US5629154A (en) 1993-11-12 1997-05-13 Geron Corporation Telomerase activity assays
US5863726A (en) 1993-11-12 1999-01-26 Geron Corporation Telomerase activity assays
US6548298B2 (en) 1994-07-07 2003-04-15 Geron Corporation Mammalian telomerase
US5583016A (en) 1994-07-07 1996-12-10 Geron Corporation Mammalian telomerase
US6261836B1 (en) 1996-10-01 2001-07-17 Geron Corporation Telomerase
US6444650B1 (en) 1996-10-01 2002-09-03 Geron Corporation Antisense compositions for detecting and inhibiting telomerase reverse transcriptase
WO1998028442A1 (en) 1996-12-20 1998-07-02 Geron Corporation Methods for detecting and inhibiting the rna component of telomerase
WO2001018015A1 (en) 1999-09-10 2001-03-15 Geron Corporation Oligonucleotide n3'→p5' thiophosphoramidates: their synthesis and use
US6608036B1 (en) * 1999-09-10 2003-08-19 Geron Corporation Oligonucleotide N3′→P5′ thiophosphoramidates: their synthesis and administration to treat neoplasms
US6331399B1 (en) 2000-05-16 2001-12-18 Isis Pharmaceuticals, Inc. Antisense inhibition of tert expression
US20030138814A1 (en) * 2001-03-23 2003-07-24 Sergei Gryaznov Oligonucleotide conjugates

Non-Patent Citations (53)

* Cited by examiner, † Cited by third party
Title
"Oligonucleotide Synthesis: A Practical Approach", 1984, IRL PRESS
"Synthesis and Applications of DNA and RNA", 1987, ACADEMIC PRESS
AMARNATHBROOM: "Chemical Reviews", vol. 77, 1977, pages: 183 - 217
ASAI ET AL., CANCER RESEARCH, vol. 63, 2003, pages 3931 - 3939
BENNETT, MOL. PHARMACOL, vol. 41, 1992, pages 1023 - 1033
BLACKBURN, ANN. REV. BIOCHEM., vol. 61, 1992, pages 113 - 129
CHEN ET AL., CELL, vol. 100, 2000, pages 503 - 514
CHEN ET AL., NUCLEIC ACIDS RESEARCH, vol. 23, 1995, pages 2661 - 2668
DAMM, EMBO J., vol. 20, 2001, pages 6958 - 6968
ECKSTEIN, ANTISENSE NUCLEIC ACID DRUG DEV., vol. 10, no. 2, 2000, pages 117 - 21
FENG ET AL., SCIENCE, vol. 269, no. 5228, 1995, pages 1236 - 1241
FIEDLER ET AL., LANGENBECK'S ARCH. SURG., vol. 383, 1998, pages 269 - 275
GERSTER ET AL., ANALYTICAL BIOCHEMISTRY, vol. 262, 1998, pages 177 - 184
GREENEWUTS: "Oligonucleotides and Analogues: A Practical Approach", 1991, JOHN WILEY & SONS
GRYAZNOV ET AL., NUCLEIC ACIDS RESEARCH, vol. 24, 1996, pages 1508 - 1514
GRYAZNOV ET AL., NUCLEOSIDES NUCLEOTIDES NUCLEIC ACIDS, vol. 20, no. 4-7, 2001, pages 401 - 410
GRYAZNOV ET AL., PROC. NATL. ACAD. SCI., vol. 92, 1995, pages 5798 - 5802
GRYAZNOV, BIOCHEM. BIOPHYS. ACTA, vol. 1489, no. 1, 1999, pages 131 - 40
GRYAZNOVLETSINGER, NUCLEIC ACIDS RESEARCH, vol. 20, 1992, pages 3403 - 3409
GRYAZNOVLLOYD, NUCLEIC ACIDS RESEARCH, vol. 21, 1993, pages 5909 - 5915
HERBERT ET AL., ONCOGENE, vol. 21, no. 4, 2002, pages 638 - 42
KIM ET AL., PROC, NATL, ACAD. SCI., USA, vol. 98, no. 14, 2001, pages 7982 - 7987
KIM, SCIENCE, vol. 266, 1997, pages 2011
KUPIHAR, BIOORGANIC AND MEDICINAL CHEMISTRY, vol. 9, 2001, pages 1241 - 1247
LICHSTEINER ET AL., ANNALS NEW YORK ACAD. SCI., vol. 886, 1999, pages 1 - 11
LYER ET AL.: "Modified oligonucleotides-synthesis, properties and applications", CURR. OPIN. MOL. THER., vol. 1, no. 3, 1999, pages 344 - 358, XP009103623
MANOHARAN ET AL., ANTISENSE AND NUCLEIC ACID DRUG DEV., vol. 12, 2002, pages 103 - 128
MCCURDY ET AL., TETRAHEDRON LETTERS, vol. 38, 1997, pages 207 - 210
MICKLEFIELD: "Backbone modification of nucleic acids: synthesis, structure and therapeutic applications", CURR. MED. CHEM., vol. 8, no. 10, 2001, pages 1157 - 79, XP002365763
MILLER, CURR MED CHEM., vol. 10, no. 14, 2003, pages 1195 - 211
MISHRA ET AL., BIOCHEMICA ET BIOPHYSICA ACTA, vol. 1264, 1995, pages 229 - 237
NIELSEN, METHODS MOL. BIOL., vol. 208, 2002, pages 3 - 26
OHTSUKA ET AL., NUCLEIC ACIDS RESEARCH, vol. 10, 1982, pages 6553 - 6570
ONCOGENE, vol. 21, January 2002 (2002-01-01)
PEDROSO DE LIMA ET AL., CURR MED CHEM, vol. 10, no. 14, 2003, pages 1221 - 1231
PETERSENWEN GEL, TRENDS BIOTECHNOL., vol. 21, no. 2, 2003, pages 74 - 81
PON, BIOTECHNIQUES, vol. 6, 1988, pages 768 - 775
PONGRACZGRYAZNOV, TETRAHEDRON LETTERS, vol. 49, 1999, pages 7661 - 7664
PRUZAN ET AL., NUCL. ACIDS RESEARCH, vol. 30, 2002, pages 559 - 568
PRUZAN ET AL., NUCLEIC ACIDS RESEARCH, vol. 30, no. 2, 2002, pages 559 - 568
PRUZAN, NUCLEIC ACIDS RES., vol. 30, no. 2, 2002, pages 559 - 68
RAKESH KUMAR MISHRA ET AL: "IMPROVED LEISHMANICIDAL EFFECT OF PHOSPHOROTIOATE ANTISENSE OLIGONUCLEOTIDES BY LDL-MEDIATED DELIVERY", BIOCHIMICA ET BIOPHYSICA ACTA, ELSEVIER, NL, vol. 1264, no. 2, 1 January 1995 (1995-01-01), pages 229 - 237, XP008034024, ISSN: 0006-3002 *
RUMP ET AL., BIOCONJ. CHEM., vol. 9, 1998, pages 341 - 349
SCHEIT: "Nucleotide Analogs", 1980, JOHN WILEY
SCORSKI ET AL., PROC. NAT!. ACAD. SCI. USA, vol. 94, 1997, pages 3966 - 3971
SHEA ET AL., NUCLEIC ACIDS RES., vol. 18, 1990, pages 3777 - 3783
SKORSKI ET AL., PROC. NATL. ACAD. SCI., vol. 94, 1997, pages 3966 - 3971
STETSENKO D A ET AL: "A convenient solid-phase method for synthesis of 3'-conjugates of oligonucleotides", BIOCONJUGATE CHEMISTRY, AMERICAN CHEMICAL SOCIETY, US, vol. 12, no. 4, 7 June 2001 (2001-06-07), pages 576 - 586, XP009087878, ISSN: 1043-1802, DOI: 10.1021/BC000157G *
TETRAHEDRON, vol. 48, 1992, pages 223 - 2311
THIVIYANATHAN ET AL., BIOCHEMISTRY, vol. 41, no. 3, 2002, pages 827 - 38
UHLMANNPEYMAN, CHEMICAL REVIEWS, vol. 90, 1990, pages 543 - 584
VAN JANTA-LIPINSKI, NUCLEOSIDES NUCLEOTIDES, vol. 18, no. 6-7, 1999, pages 1719 - 20
WEINRICH ET AL., NATURE GENETICS, vol. 17, 1997, pages 498

Also Published As

Publication number Publication date
EP1667522A2 (en) 2006-06-14
PT3342425T (pt) 2020-03-05
IL173747A (en) 2011-10-31
MXPA06002660A (es) 2006-09-04
KR101319388B1 (ko) 2013-10-22
US9388415B2 (en) 2016-07-12
EP1667522A4 (en) 2011-04-27
JP2012085648A (ja) 2012-05-10
BRPI0414222B1 (pt) 2021-02-09
US20170130225A1 (en) 2017-05-11
US10196641B2 (en) 2019-02-05
CN101293908A (zh) 2008-10-29
JP6758335B2 (ja) 2020-09-23
EP3342425A1 (en) 2018-07-04
JP2023099808A (ja) 2023-07-13
ES2662196T3 (es) 2018-04-05
KR20110091825A (ko) 2011-08-12
US20150376624A1 (en) 2015-12-31
US20050113325A1 (en) 2005-05-26
CA2536015C (en) 2013-12-10
HUE048359T2 (hu) 2020-07-28
WO2005023994A2 (en) 2005-03-17
HK1257622A1 (zh) 2019-10-25
SI1667522T1 (sl) 2018-04-30
JP2018086010A (ja) 2018-06-07
SI3342425T1 (sl) 2020-04-30
PL3342425T3 (pl) 2020-06-15
DK3342425T3 (da) 2020-03-16
BRPI0414222A (pt) 2006-10-31
CN100393209C (zh) 2008-06-11
EP1667522B1 (en) 2018-01-17
ES2775525T3 (es) 2020-07-27
JP4690324B2 (ja) 2011-06-01
JP2014158490A (ja) 2014-09-04
AU2004271215B2 (en) 2009-07-16
JP2021169466A (ja) 2021-10-28
KR20060132802A (ko) 2006-12-22
PT1667522T (pt) 2018-03-20
BRPI0414222B8 (pt) 2021-05-25
JP6158966B2 (ja) 2017-07-05
JP2007504830A (ja) 2007-03-08
JP2016214248A (ja) 2016-12-22
DK1667522T3 (en) 2018-03-05
JP2019170400A (ja) 2019-10-10
JP2016074736A (ja) 2016-05-12
CA2536015A1 (en) 2005-03-17
WO2005023994A3 (en) 2005-08-04
US9388416B2 (en) 2016-07-12
US20090286853A1 (en) 2009-11-19
AU2004271215A1 (en) 2005-03-17
US20150322438A1 (en) 2015-11-12
CN1849069A (zh) 2006-10-18
HUE036593T2 (hu) 2018-07-30
EP3342425B1 (en) 2019-12-18
AU2009222616A1 (en) 2009-10-29
JP5923241B2 (ja) 2016-05-24
KR20130043235A (ko) 2013-04-29
US20120129918A1 (en) 2012-05-24
US20150322437A1 (en) 2015-11-12
CN101293908B (zh) 2015-05-06
US9404112B2 (en) 2016-08-02
IL173747A0 (en) 2006-07-05
US7494982B2 (en) 2009-02-24
PL1667522T3 (pl) 2018-06-29
US20130065950A1 (en) 2013-03-14
CY1120113T1 (el) 2018-12-12
US9657296B2 (en) 2017-05-23
NZ545516A (en) 2009-06-26
JP2011092201A (ja) 2011-05-12
KR101298493B1 (ko) 2013-08-21
CY1122704T1 (el) 2021-03-12

Similar Documents

Publication Publication Date Title
US10196641B2 (en) Modified oligonucleotides for telomerase inhibition
US20120329858A1 (en) Modified oligonucleotides for telomerase inhibition

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN PUBLISHED

AC Divisional application: reference to earlier application

Ref document number: 3342425

Country of ref document: EP

Kind code of ref document: P

Ref document number: 1667522

Country of ref document: EP

Kind code of ref document: P

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20210121

RBV Designated contracting states (corrected)

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 40033707

Country of ref document: HK

RIN1 Information on inventor provided before grant (corrected)

Inventor name: GRYAZNOV, SERGEI

Inventor name: PONGRACZ, KRISZTINA