EP3452586A1 - Mutants du facteur x - Google Patents
Mutants du facteur xInfo
- Publication number
- EP3452586A1 EP3452586A1 EP17727638.3A EP17727638A EP3452586A1 EP 3452586 A1 EP3452586 A1 EP 3452586A1 EP 17727638 A EP17727638 A EP 17727638A EP 3452586 A1 EP3452586 A1 EP 3452586A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- sequence
- factor
- propeptide
- protein according
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/6432—Coagulation factor Xa (3.4.21.6)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/43—Enzymes; Proenzymes; Derivatives thereof
- A61K38/46—Hydrolases (3)
- A61K38/48—Hydrolases (3) acting on peptide bonds (3.4)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
- C12N2015/8518—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic expressing industrially exogenous proteins, e.g. for pharmaceutical use, human insulin, blood factors, immunoglobulins, pseudoparticles
Definitions
- the present invention relates to factor X mutants, and their use for the treatment of blood coagulation disorders.
- Factor X is a protein found in the blood. This protein plays an important role in the coagulation cascade. Blood clotting is a complex process that prevents the flow of blood through damaged vessels. As soon as a vessel is broken, the elements responsible for coagulation interact with each other to form a plug, the platelet nail, where the vessel is broken. Coagulation factors are required to hold the platelet nail in place and stabilize the clot.
- Step 1 The blood vessel is damaged.
- Step 2 The blood vessel contracts to restrict blood supply to the injured area.
- Step 3 Platelets adhere to the subendothelial space exposed during vessel injury and to the walls of the stimulated blood vessels. Platelets spread out, this is called platelet adhesion. These spread platelets release substances that activate other nearby platelets to agglomerate at the lesion site to form the platelet nail. This is called platelet aggregation.
- Step 4 The surface of the activated platelets thus constitutes a surface on which blood coagulation can take place.
- Coagulation proteins circulating in the blood (including factor X) are activated on the surface of platelets and form a fibrin clot.
- coagulation proteins i.e., factors I, II, V, VIII, IX, X, XI, XII and XIII, as well as von Willebrand factor
- Factor X in activated form (Xa) intervenes more particularly in the activation of prothrombin (factor II) in thrombin (factor Ha), in particular when it is complexed with activated c-factor V to form the prothrombinase complex.
- This factor is an essential element in the coagulation cascade.
- Factor X deficiency is extremely rare. Its transmission is autosomal recessive, and its prevalence is 1: 1,000,000.
- the first 42 amino acids of the factor X light chain represent the "Gla” domain, phospholipid binding domain.
- the "Gla” domain contains 11 residues of glutamic acid (Glu) all or partially post-translational (gamma-carboxylated) to give ⁇ -carboxyglutamic acid (Gla).
- Glu glutamic acid
- Gla ⁇ -carboxyglutamic acid
- Factor X is thus a coagulation protein whose biological activity depends on the degree of gamma-carboxylation of its "Gla” domain.
- Gla proteins or Gla domain proteins are vitamin K-dependent.
- Vitamin K is a fat-soluble vitamin implicated in gamma carboxylation of protein residues of glutamates to form gamma-carboxyglutamate residues.
- Gamma-carboxyglutamate residues are essential for the biological activity of all proteins possessing Gla domains, in particular via a high affinity binding to calcium ions.
- gamma-carboxylated Glu residues also referred to as Gla residues
- Gla residues gamma-carboxylated Glu residues
- the presence of Glu residues on factor X and their level of gamma-carboxylation is essential to the functional activity of activated factor X.
- a modified thrombin-activated factor X having a gamma-carboxylation level which would allow effective coagulation in the absence of factor VIII and / or factor IX by direct use. traces of thrombin generated during the initiation of coagulation.
- factor X-specific mutants also called X variant factors
- factor X-specific mutants identified by the inventors can also restore coagulation in the absence of factor X.
- these factor X mutants can be activated by thrombin, and allow efficient coagulation. even in the absence of factor VIII and / or factor IX and / or endogenous factor X.
- factor X mutants advantageously have a high level of gamma-carboxylation.
- high degree of gamma-carboxylation is meant a gamma-carboxylation level of at least 20%, preferably at least 25%, 30%, 35%, 40%, 45%, 50%, 55%.
- 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% of gamma-carboxylation of plasma factor X considered 100%.
- the present invention relates to a protein which is a variant of factor X comprising a mutated sequence of SEQ ID NO: 1, said protein comprising at its N-terminus the natural signal peptide of factor X represented by the sequence SEQ ID NO: 7 , and a propeptide different from the natural propeptide of factor X.
- the present invention relates to a protein comprising a mutated sequence of SEQ ID NO: 1, said mutated sequence of SEQ ID NO: 1 comprising an A, A ', B, C or C mutation, wherein:
- mutation A consists in the substitution of amino acids 43 to 52 of the sequence SEQ ID NO: 1 by a sequence chosen from DFLAEGLTPR, KATN * ATLSPR and KATXATLSPR,
- mutation A consists of the substitution of amino acids 47 to 52 of the sequence SEQ ID NO: 1 by a sequence chosen from TSKLTR, FNDFTR, LSSMTR, PPSLTR and LSCGQR,
- mutation B consists of the insertion of a sequence chosen from DFLAEGLTPR, KATN * ATLSPR, KATXATLSPR, TSKLTR, FNDFTR, LSSMTR, PPSLTR and LSCGQR, between amino acids 52 and 53 of the sequence SEQ ID NO: 1,
- mutation C consists in the insertion of a sequence chosen from DFLAEGLTPR, KATN * ATLSPR and KATXATLSPR, between amino acids 52 and 53 of the sequence SEQ ID NO: 1, and in the deletion of amino acids 4 to 13 of the sequence SEQ ID NO: 1, mutation C consists in the insertion of a sequence selected from TSKLTR, FNDFTR, LSSMTR, PPSLTR and LSCGQR, between amino acids 52 and 53 of the sequence SEQ ID NO: 1, and in the deletion of amino acids 4 to 9 of the sequence SEQ ID NO: 1,
- N * is an optionally glycosylated asparagine
- the present invention relates to a protein comprising a mutated sequence of SEQ ID NO: 1 , said mutated sequence of SEQ ID NO: 1 comprising a mutation consisting of the insertion of a sequence selected from DFLAEGLTPR, KATN * ATLSPR, KATXATLSPR, TSKLTR, FNDFTR, LSSMTR, PPSLTR and LSCGQR, between amino acids 52 and 53 of the sequence SEQ ID NO: 1 (ie mutation B above),
- N * is an optionally glycosylated asparagine, and said protein comprising at its N-terminal end the signal peptide of sequence SEQ ID NO: 7 fused to a propeptide of a coagulation factor different from factor X.
- a protein according to the invention is a mutated factor X, which is effective in the treatment of coagulation disorders.
- sequence coding for a mutated factor X comprising a combination of sequences from the N-terminus to the C-terminus, namely:
- a mutated sequence of SEQ ID NO: 1 according to the invention makes it possible to directly impact the gamma-carboxylation of the expressed factor X, increased with respect to a factor X comprising a mutated sequence of SEQ ID NO: 1 according to the invention, but not comprising at the N-terminal end the signal peptide of sequence SEQ ID NO: 7 fused to a propeptide of a coagulation factor different from factor X.
- such factor X mutants have a gamma carboxylation of at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% of gamma-carboxylation of plasma factor X, considered 100%.
- Another subject of the invention is a polynucleotide encoding said protein.
- Another subject of the invention is an expression vector comprising said polynucleotide.
- Another subject of the invention is a host cell comprising said expression vector or said polynucleotide.
- said protein may be used for the treatment of blood coagulation disorders, in particular hemorrhagic disorders, such as haemophilia A, B and C (factor XI deficiency), or even deficits in factor X, or even the need for emergency coagulation to replace Factor VIIa.
- hemorrhagic disorders such as haemophilia A, B and C (factor XI deficiency), or even deficits in factor X, or even the need for emergency coagulation to replace Factor VIIa.
- said protein can be used in combination with other hemostatic molecules, such as factor VIIa and / or fibrinogen, or even in combination with procoagulant compounds (platelet transfusion, procoagulant mixture such as FEIBA, Kaskadil, Kanokad etc.), which may enhance the effectiveness of treatment .
- protein refers to an amino acid sequence having more than 100 amino acids.
- the protein consists of an amino acid sequence having between 100 and 1000 amino acids, preferably between 120 and 600 amino acids.
- a factor X variant according to the invention advantageously has a high level of gamma carboxylation.
- high gamma-carboxylation level is meant a gamma-carboxylation level of at least 20%, preferably at least 25%, 30%, 35%, 40%, 45%, 50%, 55%. 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% of gamma-carboxylation of plasma factor X, considered 100%.
- the calculation of said gamma-carboxylation level can be carried out by any conventional technique for detecting and then quantifying Gla residues, such as the ELISA technique using an anti-Gla antibody for the capture of gamma-carboxylated X factors.
- the optical density measurement obtained for a factor X varying according to the invention can be related to the measurement of optical density obtained for the same amount of plasma factor X obtained according to the same production method, considered as the reference measurement. gamma-carboxylation rate at 100%.
- a factor X variant according to the invention comprises at least 2 gamma-carboxylated Glu residues (Le, Gla residues) among 1 1 Glu, at least 3 gamma-carboxylated residues among 11 Glu, at least 4 gamma-carboxylated residues.
- a variant of factor X according to the invention comprises at least 10 of the 11 gamma-carboxylic acid residues mentioned above, present on the Gla domain of the light chain factor X, gamma-carboxylated.
- a factor X variant according to the invention comprises 10 gamma-carboxylated Glu residues (10 Gla residues). More preferentially, a factor X variant according to the invention comprises 11 gamma-carboxylated Glu residues (11 residues). Gla)
- the invention relates to a composition of factor X variants according to the invention, advantageously having a high level of gamma-carboxylation within the composition.
- High level of gamma-carboxylation within the composition means a gamma-carboxylation level of at least 20%, preferably at least 25%, 30%, 35%, 40%, 45%, 50%. %, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% of gamma carboxylation in a plasma factor X composition, considered 100%.
- a factor X variant composition according to the invention may comprise a homogeneous gamma-carboxylated factor X population for the number of Gla residues.
- a factor X variant composition according to the invention comprises a population of gamma-carboxylated X-factors each comprising 10 Gla residues.
- a factor X variant composition according to the invention comprises a population of gamma-carboxylated X-factors each comprising 11 Gla residues.
- a factor X variant composition according to the invention may comprise a heterogeneous gamma-carboxylated factor X population, comprising at least two gamma-carboxylated factor X populations not comprising the same number of gamma-carboxylated Gla residues.
- a factor X variant composition according to the invention may comprise 50% variants comprising 10 Gla residues and 50% variants comprising 11 Gla residues.
- Factor X also called Stuart-Power factor, is encoded by the F10 gene and refers to serine protease EC3.4.21.6.
- Factor X is composed of a heavy chain, 306 amino acids, and a light chain, 139 amino acids.
- Factor X is a 488 amino acid protein consisting of a signal peptide, a propeptide, and light and heavy chains. Human X factor can be found in UniProtKB under accession number P00742. Its primary structure is illustrated in Figure 1.
- the protein is translated as a prepropeptide. After cleavage of the signal peptide, the propeptide is finally cleaved, resulting in a light chain and a heavy chain (142 and 306 amino acids respectively) (zymogen). Following the onset of coagulation, the heavy chain is finally activated by cleavage of the activation peptide, to contain only 254 amino amino acids (the first 52 amino acids are cleaved during treatment): it is the heavy chain of the factor Xa (SEQ ID NO: 6).
- the human factor X prepropeptide corresponds to SEQ ID NO: 4.
- the unactivated human factor X heavy chain corresponds to SEQ ID NO: 1, and the light chain corresponds to SEQ ID NO: 5.
- heavy chain corresponds to SEQ ID NO: 3, and comprises 52 amino acids.
- the signal peptide corresponds to SEQ ID NO: 7, and comprises 31 amino acids.
- the natural propeptide of factor X corresponds to SEQ ID NO: 8, and comprises 9 amino acids.
- SEQ ID NO: 2 is identical to amino acids 1 to 182 of SEQ ID NO: 4.
- SEQ ID NO: 1 is identical to amino acids 183 to 488 of SEQ ID NO: 4.
- the factor Xa heavy chain corresponds to SEQ ID NO: 1, in which the activation peptide represented by SEQ ID NO: 3 was cleaved.
- natural propeptide of factor X preferably refers to a variant of the natural propeptide of human factor X represented by the sequence SEQ ID NO: 9 which comprises 9 amino acids.
- the protein according to the invention is a mutant (or variant) factor X.
- the preferred mutation according to the invention consists in the insertion of a sequence chosen from DFLAEGLTPR, KATN * ATLSPR, KATXATLSPR, TSKLTR, FNDFTR, LSSMTR, PPSLTR and LSCGQR, between amino acids 52 and 53 of the sequence SEQ ID NO: 1 ("mutation B"), where N * is an optionally glycosylated asparagine.
- the mutation according to the invention consists of the insertion of the sequence DFLAEGLTPR between amino acids 52 and 53 of the sequence SEQ ID NO: 1.
- sequence SEQ ID NO: 1 comprising a mutation according to the invention is also called "mutated sequence of SEQ ID NO: 1".
- sequence SEQ ID NO: 1 comprising a mutation according to the invention consists of the sequence SEQ ID NO: 3, fused at its C-terminal end to a sequence chosen from DFLAEGLTPR, KATN * ATLSPR , KATXATLSPR, TSKLTR, FNDFTR, LSSMTR, PPSLTR and LSCGQR ("mutation B"), where N * is an optionally glycosylated asparagine, itself fused at its C-terminus to the sequence SEQ ID NO: 6.
- the mutated sequence of SEQ ID NO: 1 corresponds to SEQ ID NO: 11.
- the propeptide used in the protein according to the invention is different from the natural propeptide of factor X.
- the propeptide used in the protein according to the invention is that of a vitamin K dependent protein.
- the propeptide used in the protein according to the invention is chosen from the propeptide of the protein S, the propeptide of the protein Z, the propeptide of FIX, the propeptide of one of the proteins GAS6, BGP, MGP, and PRGP1, PRGP2, TMG3 and TMG4, the propeptide of thrombin, the propeptide of factor VII, the propeptide of protein C, including their natural isoforms or modified versions thereof.
- modified version is meant that the propeptide used is truncated, and optionally comprises the insertion of one or more amino acids, for example at its N-terminus.
- the propeptide used in the protein according to the invention is that of a coagulation factor different from factor X.
- the propeptide used in the protein according to the invention is preferably the natural propeptide of a different coagulation factor.
- the propeptide is selected from the propeptide of thrombin, the propeptide of factor VII, the propeptide of protein C, their natural isoforms or modified versions thereof.
- the propeptide of factor VII according to the invention corresponds to isoform A of the propeptide of factor VII (or "FVIIvl") and has for sequence SEQ ID NO: 14.
- the propeptide of factor VII according to the invention corresponds to to the isoform B of the factor VII propeptide (or "FVIIv2") and has the sequence SEQ ID NO: 15.
- the propeptide is chosen from the sequences SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16. More preferably, the propeptide has the sequence SEQ ID NO: 14.
- the signal peptide of sequence SEQ ID NO: 7 fused to a propeptide different from the natural propeptide of factor X is chosen from the sequences SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20 and SEQ ID NO: 21 . More preferably, the signal peptide of sequence SEQ ID NO: 7 fused to a propeptide different from the natural propeptide of factor X is represented by the sequence SEQ ID NO: 19.
- sequence SEQ ID NO: 19 makes it possible to directly impact the gamma-carboxylation of the mutated factor X comprising such a combination, with respect to a mutated factor X comprising a mutated sequence of SEQ ID NO: 1 according to the invention, but not comprising at its N-terminal end the sequence SEQ ID NO: 19.
- the protein according to the invention preferably comprises an intermediate sequence, between the signal peptide of sequence SEQ ID NO: 7 fused to a propeptide different from the natural propeptide of factor X and the mutated sequence of SEQ ID NO: 1.
- intermediate sequence is fused at its N-terminus, to the signal peptide of sequence SEQ ID NO: 7 fused to a propeptide different from the natural propeptide of factor X, and at its C-terminus, to the mutated sequence of SEQ ID NO: 1.
- said intermediate sequence is the sequence of the light chain of factor X, preferably the sequence SEQ ID NO: 5.
- the protein according to the invention thus preferably comprises, from the N-terminus to the C-terminus:
- the protein according to the invention comprises, in the N- to C-terminal direction, the signal peptide of sequence SEQ ID NO: 7 fused to a propeptide different from the natural propeptide of factor X, then the sequence SEQ ID NO: 5, then the mutated sequence of SEQ ID NO: 1.
- the protein according to the invention preferably comprises, from the N-terminal to the C-terminal end:
- the protein according to the invention preferably comprises, from the N-terminus to the C-terminal end: the signal peptide of sequence SEQ ID NO: 7 fused to a propeptide different from the natural propeptide of factor X, fused to the sequence SEQ ID NO: 17.
- the protein according to the invention comprises, preferably consists of, a sequence chosen from SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24 and SEQ ID NO: 25. More preferably, the protein according to the invention comprises, preferably consists of, the sequence SEQ ID NO: 23.
- the mutated sequence of SEQ ID NO: 1 comprising an A, A ', B, C or C mutation may further comprise at least one mutation of at least one amino acid that does not alter the functional activity of the protein according to invention.
- the mutated sequence of SEQ ID NO: 1 comprising an A, A ', B, C or C mutation and further comprising at least one additional mutation of at least one amino acid that does not impair the functional activity has at least 80% identity, at least 81% at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% identity with the mutated sequence of SEQ ID NO: 1 comprising only an A, A ', B, C or C mutation.
- the protein according to the invention may also be fused at the C-terminal to at least one wild-type immunoglobulin fragment, optionally mutated.
- wild-type immunoglobulin fragment is meant a fragment selected from wild-type Fc fragments and wild-type scFc fragments, optionally mutated.
- Fc fragment is meant the constant region of a full length immunoglobulin excluding the first immunoglobulin constant region domain (i.e. CH1-CL).
- the Fc fragment refers to a homodimer, each monomer comprising the last two constant domains of IgA, IgD, IgG (ie CH2 and CH3), or the last three constant domains of IgE and IgM (ie CH2, CH3 and CH4), and the flexible N-terminal hinge region of these domains.
- the Fc fragment when it is derived from IgA or IgM, may comprise the J chain.
- the Fc region of an IgG1 is composed of the flexible N-terminal hinge and the CH2-CH3 domains. that is, the portion from amino acid C226 to the C-terminus, the numbering being indicated according to the EU number or equivalent in Kabat.
- scFc fragment ("single chain Fc) is meant a single chain Fc fragment, obtained by genetic fusion of two Fc monomers linked by a polypeptide linker.
- the linker may be - (GGGGS) n-, where n is an integer of 1 to 3.
- the scFc folds naturally into a functional dimeric Fc region.
- the scFc fragment preferably has the sequence SEQ ID NO: 42 (which corresponds to SEQ ID NO: 36 fused to C-terminal at -GGGGS- fused at C-terminal to SEQ ID NO: 37) optionally followed by a lysine .
- the fusion of the protein according to the invention with at least one fragment of wild-type immunoglobulin (in particular a Fc or scFc fragment) at the C-terminal makes it possible to improve the stability and the retention of the protein in the body, and thus its bioavailability; it also improves its half-life in the body.
- the wild-type Fc fragment is chosen from the sequence SEQ ID NO: 36 and the sequence SEQ ID NO: 37 optionally followed by a C-terminal lysine (226 or 227 amino acids respectively for SEQ ID NO: 36, 231 or 232 amino acids respectively for SEQ ID NO: 37).
- the Fc fragment corresponding to the sequence SEQ ID NO: 36 comprises the constant domains CH2 and CH3 of a wild type IgG and the partial hinge region in N-terminal (DKTHTCPPCP, SEQ ID NO: 38).
- the fragment corresponding to the sequence SEQ ID NO: 37 comprises the constant domains CH2 and CH3 of a wild type IgG and the entire hinge region at the N-terminal (sequence EPKSSDKTHTCPPCP, SEQ ID NO: 39, variant of the present natural sequence on a wild-type IgG, sequence EPKSCDKTHTCPPCP, SEQ ID NO: 81).
- the protein according to the invention fused to a C-terminal wild type Fc fragment has the sequence SEQ ID NO: 40 optionally followed by a C-terminal lysine.
- Its corresponding nucleic acid has the sequence SEQ ID NO: 41 optionally followed by a codon coding for a C-terminal lysine.
- nucleic acid was obtained by gene synthesis with codon optimization for Homo sapiens and has the sequence SEQ ID NO: 82.
- the protein according to the invention fused to a C-terminal wild type scFc fragment has the sequence SEQ ID NO: 43 optionally followed by a C-terminal lysine.
- Its corresponding nucleic acid has the sequence SEQ ID NO: 44 optionally followed by a codon coding for a C-terminal lysine.
- the wild-type Fc fragment or the wild-type scFc fragment used according to the invention can be mutated according to the "knobs-into-holes" technology.
- This technology is described in the application WO96 / 27011 of Genentech: it consists in obtaining heterodimers, which comprise and preferably pair at a constant CH3 domain of antibodies.
- These heterodimers preferably 2 Fc fragments or one scFc, comprise various point mutations, which induce a "protuberance-in-cavity" (knobs-into-holes) interface.
- a first mutation on the first monomer induces a protuberance
- a second mutation on the second monomer induces a cavity, so that the heterodimer pairs preferentially.
- the first monomer ie an Fc fragment or Fc monomer of the scFc fragment
- the second monomer ie an Fc fragment or Fc monomer of the scFc fragment
- Nucleic acid encoding the protein SEQ ID NO: 40 optionally followed by a codon encoding a lysine 42 Wild scFc fragment, possibly followed by lysine
- Nucleic acid encoding the protein SEQ ID NO: 43 optionally followed by a codon encoding a lysine
- nucleic acid polynucleotide
- the nucleic acid is chosen from the sequences SEQ ID NO: 32 to 35.
- the expression vectors suitable for use according to the invention may comprise at least one expression control element operably linked to the nucleic acid sequence.
- the expression control elements are inserted into the vector and make it possible to regulate the expression of the nucleic acid sequence.
- expression control elements include lac systems, lambda phage promoter, yeast promoters or viral promoters.
- Other operational elements may be incorporated, as a leader sequence, termination codons, polyadenylation signals and sequences necessary for transcription and subsequent translation of the nucleic acid sequence into the host system. It will be understood by those skilled in the art that the correct combination of expression control elements depends on the chosen host system. It will also be understood that the expression vector should contain the additional elements necessary for the subsequent transfer and replication of the expression vector containing the nucleic acid sequence in the host system.
- the expression vector used is a polycistronic vector comprising a polynucleotide encoding a protein according to the invention, a polynucleotide encoding the enzyme VKOR, preferably for subunit 1 of the vitamin K epoxide reductase complex ( VKORC1) wild-type human, and optionally a polynucleotide encoding furin, and / or a polynucleotide encoding an Fc fragment in the context of the production of variants according to the invention fused to an Fc fragment.
- VKORC1 vitamin K epoxide reductase complex
- the co-expression of furin optimizes the natural cleavage within the cell at the natural cleavage sites present on factor X (RRKR).
- the expression vector used is a bicistronic comprising a polynucleotide encoding a protein according to the invention, and a polynucleotide encoding the enzyme VKOR, preferably for subunit 1 of the vitamin K epoxide reductase complex ( VKORC1) wild human.
- Subunit 1 of the wild-type human vitamin K epoxide reductase (VKORC1) complex is the catalytic subunit of the complex; it is a protein of 163 amino acids.
- the sequence of this wild-type human subunit can be found in UniProt under accession number Q9BQB6 (SEQ ID NO: 45).
- the nucleic acid encoding this protein has the sequence SEQ ID NO: 46.
- This protein is present in the endoplasmic reticulum of the cells.
- the polynucleotide encoding the VKOR enzyme may also be a polynucleotide encoding a mutated VKOR.
- the expression vectors used are as many vectors as polynucleotides to be expressed, one comprising a polynucleotide encoding a protein according to the invention, another comprising a polynucleotide encoding the VKOR enzyme mentioned above, optionally another comprising a polynucleotide encoding furin, and / or another comprising a polynucleotide encoding an Fc or scFc fragment; in the context of the production of variants according to the invention fused to an Fc or scFc fragment.
- Another subject of the invention is a recombinant cell comprising an expression vector as described above, or a polynucleotide as described above.
- host cells that can be used are eukaryotic cells, such as animal, plant, insect and yeast cells; and prokaryotic cells, such as E. coli.
- the means by which the vector carrying the gene can be introduced into the cells include microinjection, electroporation, transduction or transfection using DEAE-dextran, lipofection, calcium phosphate or other procedures. known to those skilled in the art.
- expression vectors for expression in eukaryotic cells are used.
- vectors examples include viral vectors such as retroviruses, adenovirus, herpes virus, vaccinia virus, variola virus, poliovirus, lentivirus, bacterial expression vectors or plasmids such as pcDNA5.
- Preferred eukaryotic cell lines include COS cells, CHO cells, HEK cells including HEK293 (ATCC # CRL1573), YB2 / 0 cells, BHK cells, PerC6 cells, HeLa cells, NIH / 3T3 cells, T2 cells, dendritic cells or monocytes.
- the cells used are HEK cells. More preferably, the cells used are YB2 / 0 cells. More preferably, the cells used are CHO cells.
- Another subject of the invention is a method for producing a protein according to the invention, said protein comprising a light chain (preferably SEQ ID NO: 5), comprising:
- a polycistronic vector preferably bicistronic, in a host cell, preferably an HEK cell, more preferably YB2 / 0, even more preferably a CHO cell, said vector comprising a polynucleotide encoding a protein according to the invention, and a polynucleotide encoding the enzyme VKOR, preferably for subunit 1 of the wild-type human vitamin K epoxide reductase (VKORC1) complex, preferably in the presence of vitamin K;
- concentration of the supernatant optionally carried out in step d) can be carried out by any well-known technique, such as by passing on concentration cassettes, by tangential filtration, or by using chromatography columns to concentrate the product.
- Another subject of the invention is a method for producing a protein according to the invention, said protein comprising a light chain (preferably SEQ ID NO: 5), comprising:
- aptamers used in the methods described above are in particular those described in the patent application WO2011 / 012831.
- the aptamer used has the following sequence:
- this aptamer specifically binds to the biologically active forms of factor X.
- the methods for producing a protein according to the invention comprising a purification step using an aptamer column described above, make it possible to obtaining biologically active forms of factor X.
- the protein according to the invention can be produced in the milk of transgenic animals.
- the expression of the polynucleotide encoding the protein according to the invention is controlled by a mammalian casein promoter or a mammalian whey promoter, said promoter not naturally controlling the transcription of said gene, and the polynucleotide further containing a secretion sequence of the protein.
- the secretion sequence comprises a secretion signal interposed between the gene and the promoter.
- the transgenic animal used is capable not only of producing the desired protein, but also of transmitting this ability to its offspring.
- the secretion of the protein in the milk facilitates purification and avoids the use of blood products.
- the animal can thus be chosen from the mouse, the goat, the rabbit, the sheep or the cow.
- the protein according to the invention can be used as a medicament. Therefore, the protein according to the invention can be introduced into a pharmaceutical composition.
- the protein according to the invention can be used for the treatment of coagulation disorders, in particular hemorrhagic disorders.
- the pharmaceutical composition of the invention may be combined with pharmaceutically acceptable excipients, and optionally extended release matrices, such as biodegradable polymers, to form a therapeutic composition.
- the pharmaceutical composition of the present invention may be administered orally, sublingually, subcutaneously, intramuscularly, intravenously, intraarterially, intrathecally, intraocularly, intracerebrally, transdermally, locally or rectally.
- the active ingredient, alone or in combination with another active ingredient can then be administered in unit dosage form, in admixture with conventional pharmaceutical carriers.
- Unit dosage forms include oral forms such as tablets, capsules, powders, granules and oral solutions or suspensions, sublingual and oral forms of administration, aerosols, subcutaneous implants, transdermal, topical, intraperitoneal, intramuscular, intravenous, subcutaneous, intrathecal, intranasal administration forms and rectal administration forms.
- the pharmaceutical composition contains a pharmaceutically acceptable carrier for a formulation that can be injected.
- a pharmaceutically acceptable carrier for a formulation that can be injected.
- It may be in particular isotonic, sterile, saline solutions (with monosodium or disodium phosphate, sodium chloride, potassium chloride, calcium or magnesium chloride and the like, or mixtures of such salts), or freeze-dried compositions which, when adding sterilized water or physiological saline as appropriate, allow the constitution of injectable solutions.
- Suitable dosage forms for injectable use include sterile aqueous solutions or dispersions, oily formulations, including sesame oil, peanut oil, and sterile powders for the preparation extemporaneous sterile injectable solutions or dispersions.
- the form must be sterile and must be fluid to the extent that it must be injected by syringe. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
- the dispersions according to the invention can be prepared in glycerol, liquid polyethylene glycols or mixtures thereof, or in oils. Under normal conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
- the pharmaceutically acceptable carrier may be a solvent or dispersion medium containing, for example, water, ethanol, a polyol (eg, glycerine, propylene glycol, polyethylene glycol, and the like), suitable mixtures of these, and / or vegetable oils.
- a surfactant such as lecithin.
- Prevention of the action of microorganisms can be caused by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid or thimerosal. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride.
- Prolonged absorption of the injectable compositions may be caused by the use in the compositions of agents delaying absorption, for example, aluminum monostearate or gelatin.
- Sterile injectable solutions are prepared by incorporating the active ingredients in the required amount in the appropriate solvent with several of the other ingredients listed above, if appropriate, followed by sterilization by filtration.
- the dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle that contains the basic dispersion medium and the other required ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and lyophilization.
- the solutions will be administered in a manner compatible with the dosage formulation and in a therapeutically effective amount.
- the formulations are easily administered in a variety of dosage forms, such as the injectable solutions described above, but drug release capsules and the like can also be used.
- parenteral administration in an aqueous solution for example, the solution should be suitably buffered and the liquid diluent rendered isotonic with sufficient saline or glucose.
- aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration.
- sterile aqueous media that can be used are known to those skilled in the art.
- a dose may be dissolved in 1 ml of isotonic NaCl solution and then added to 1000 ml of appropriate liquid, or injected at the proposed site of the infusion. Certain dosage variations will necessarily occur depending on the condition of the subject being treated.
- the pharmaceutical composition of the invention can be formulated in a therapeutic mixture comprising about 0.0001 to 1.0 milligrams, about 0.001 to 0.1 milligrams, about 0.1 to 1.0 milligrams, or about 10 milligrams per dose or more. Multiple doses may also be administered.
- the level of therapeutically effective dose specific for a particular patient will depend on a variety of factors, including the disorder being treated and the severity of the disease, the activity of the specific compound employed, the specific composition used, the age, the body weight, general health, sex and diet of the patient, the time of administration, the route of administration, the rate of excretion of the specific compound used, the duration of treatment, or the drugs used in parallel.
- the protein according to the invention can also be used as a product of a gene or cell therapy.
- the present invention also relates to an expression vector comprising a polynucleotide encoding a protein according to the invention, said polynucleotide being as described above.
- This expression vector can be used as a drug, preferably as a gene therapy drug.
- This expression vector can also be used as a cell therapy drug: in this case, it is intended to be injected ex vivo to a sample of patient cells, before their reinjection.
- a cell therapy drug in this case, it is intended to be injected ex vivo to a sample of patient cells, before their reinjection.
- Figure 1 Primary structure of human factor X
- Figure 2 OptiHEK-VKOR-FX-IIa bicistronic vector
- Figure 3 Final vector FVIIvl-psFX-IIa-F2
- lane 2 SDS-PAGE of the plasma FX (lane 2) and FX-IIa-F2 of aptamopurified HEK (lane 3).
- lane 1 molecular weight markers or MW (values in kDa are indicated on the left of the figure).
- NR unreduced products;
- DTT-R products reduced to DTT.
- Plasma (?), Plasma FX (?), FVIIv1-psFX-IIa-F2 derived from aptamopurified HEK (o), FVIIv1-psFX-IIa-F2-VKOR from aptamopurified HEK ( ⁇ ), FVIIvl- psFX-IIa-F2 from aptamopurified HEK ( ⁇ ).
- FIG. 7 Activation of FVIIa Complex FX / Tissue Factor (FT) FXa Plasma Factor ( ⁇ ), Plasma FX (B), FVIIv1-psFX-IIa-F2-VKOR Aptamopurified FX from HEK ( ⁇ ), FVIIv1-psFX- IIa-F2 aptamopurified from HEK ( ⁇ ).
- Figure 8 Generation of thrombin by FVIII deficient plasma modified FX
- lanes 1 and 10 molecular weight markers or MW (values in kDa are indicated on the left of the figure).
- NR unreduced products;
- DTT-R products reduced to DTT.
- Plasma FX (x), FVIIv1-psFX-IIa-F2-Fc YB2 / 0 supernatant (o) or aptamopurified ( ⁇ ), FVIIv1-psFX-IIa-F2-Fc from HEK supernatant ( ⁇ ) or aptamopurified ( ⁇ ), CHO-F supernatant ( ⁇ ) or aptamopurified (A) FVIIvl-psFX-IIa-F2-Fc.
- Thrombin generation was monitored over time in normal or factor VIII deficient plasma stimulated by 0.5 ⁇ M tissue factor in the presence of phospholipids.
- Signal obtained with a normal plasma ( ⁇ ); in the presence of 0.1 U / ml of Recombinant FVIII ( ⁇ ); in the presence of 1 U / ml of recombinant FVIII ( ⁇ ); in the presence of 4 ⁇ g / ml of aptamopurified FVIIv1-psFX-IIa-F2-Fc of YB2 / 0 ( ⁇ ); in the presence of 4 ⁇ g / ml of aptamopurified FVIIv1-psFX-IIa-F2-Fc of HEK (A); in the presence of 4 ⁇ g / ml of aptamopurified FVIIv1-psFX-IIa-F2-Fc of CHO ( ⁇ ).
- Example 1 Generation of expression vectors containing modified propeptides
- a non-commercial expression vector (OptiCHO) was used to insert, by In fusion ligation at the NheI-SwaI restriction sites, a polynucleotide encoding the modified FX. Briefly, the OptiCHO expression vector was digested with the NheI-SwaI restriction enzymes and then gel-purified using the Nucleospin extract II kit (Macherey Nagel).
- the modified FX polynucleotide was obtained by assembly PCR using as template a vector containing a polynucleotide encoding the wild-type FX.
- the primers used are:
- the fragment of interest obtained by PCR was then cloned by ligation In Fusion into the OptiCHO vector digested beforehand at the NheI and Swal restriction sites.
- the polynucleotide sequence encoding human VKOR obtained by gene synthesis with codon optimization for Homo sapiens. It was extracted from a parental vector (OptiHEK-v3-VKOR) with the whole of the promoter unit (CMV enhancer, RSV promoter, polynucleotide, BGH poly A termination signal by Ascl-SpeI digestion. It was introduced into the vector previously constructed by ligation on the same Ascl-SpeI restriction sites. Human VKOR contained in the C-terminal position a hexahistidine tag.
- the final vector obtained containing 2 transcription units was named OptiHEK-VKOR-FXIIa (FIG. 2).
- the optiHEK-VKOR-FXIIa bicistronic vector which contains the transcription unit (UT) coding for FX-modified on the one hand and for human VKOR on the other hand was digested with Spel-SwaI restriction enzymes allowing obtain 2 fragments of 6904 and 3510 bp respectively.
- the 6904bp fragment (digested vector) was gel purified using the Nucleospin extract II kit (Macherey Nagel).
- the FX promoter unit was amplified by PCR using the primers:
- 5UTFX CCTTGGGCAATAAATACTAGTGGCGTTAC (SEQ ID NO: 55).
- the amplicon obtained with the Kappa Hifi polymerase was then digested with the restriction enzymes NheI and Spel to obtain a final fragment of 1983bp.
- the fragment was purified on agarose gel and extracted using the Nucleospin extract II kit (Macherey
- the signal peptide and the propeptide of interest were obtained by PCR from a vector containing the corresponding nucleotide sequences using respectively the following primers:
- 5PSth primers AAGCTTGCCGCCACCATGGCTCACGTCCGAGGGCTG (SEQ ID NO: 56) and
- CTTCATTTCCTCCAGGAAAGAGTTGGCTCTCCGCACCCGCTGCAGC (SEQ ID NO: 57)
- primers 5PSFVII AAGCTTGCCGCCACCATGGTGTCTCAGGCTCTGCGGC (SEQ ID NO: 58) and
- primers 5PSFVII AAGCTTGCCGCCACCATGGTGTCTCAGGCTCTGCGGC (SEQ ID NO: 60) and
- 3FVIIv2 GTCACGAACACAGCAGCCAGACATCCCTGCAGTC (SEQ ID NO: 61)
- Protein 1 AAGCTTGCCGCCACCATGTGGCAGCTGACCAGCCTGCTGCTGTTC GTGGCCACATG (SEQ ID NO: 62),
- Protein3 TTCAGCAGCTCTGAGCGGGCCCACCAGGTGCTGCGGATCAGAAAG AGAGCCAACTCTTTC (SEQ ID NO: 64)
- the sequence of the modified FX without the signal peptide and without the FX-WT propeptide was obtained by PCR with primers 5FX: GCCAACTCTTTCCTGGAGGAAATGAAG (SEQ ID NO: 65) and 3FXIIa: AGCTCTAGACAATTGATTTAAATGGATCCTCAC (SEQ ID NO: 66) (1142bp amplicon) .
- a recombination ligation (ligation In Fusion) was performed between this assembly PCR product, the promoter UT and the digested final vector, previously prepared. Cloning efficiency was verified by colony PCR with primers 5'EFla: GTGGAGACTGAAGTTAGGCCAG (SEQ ID NO: 67) and 2BGHpA and sequencing with 5'EFla primer:
- GTGGAGACTGAAGTTAGGCCAG (SEQ ID NO: 68) and 5FXseq: GGAGGCACTATCCTGAGCGAG (SEQ ID NO: 69).
- FVIIv2-FX-IIa-F2 PS + propeptide FVII isoform v2-FX modified + human VKOR WT
- protc-FX-IIa-F2 PS + propeptide protein C-FX modified + human VKOR WT
- a recombination ligation (ligation In Fusion) was performed between these assembly PCR products, the promoter UT and the digested final vector, previously prepared. The cloning efficiency was verified by PCR on colonies with the primers:
- 5'EF1A GTGGAGACTGAAGTTAGGCCAG (SEQ ID NO: 79) and 5FXSEQ: GGAGGCACTATCCTGAGCGAG (SEQ ID NO: 80).
- proth-psFX-IIa-F2 PS FXwt + prothrombin propeptide-modified FX + human VKOR WT
- FVIIv1-psFX-IIa-F2 PS FXwt + propeptide FVII modified A-FX isoform + human VKOR WT (FIG. 3)
- protc-psFX-IIa-F2 PS FXwt + propeptide modified protein C-FX + human VKOR WT.
- Wild type factor X and modified FX were produced in HEK-293-Feestyle eukaryotic cells (HEK 293F) in transient expression.
- HEK 293F were cultured in F17 medium, supplemented with 8 mM L-glutamine, under stirring conditions at 135 rpm in a controlled atmosphere (8% CO 2 ) at 37 ° C.
- the cells were seeded at a density of 7 ⁇ 10 5 cells / ml.
- the DNA (30 ⁇ g) and 60 ⁇ l of transfection agent (AT) were preincubated separately in Opti-MEM medium for 5 minutes and then mixed and incubated for 20 minutes to allow the formation of the DNA / AT complex. The whole was added to a cell preparation of 1.10 6 cells / ml in a volume of 30 ml.
- the 2 vectors were added at different ratios to obtain a total amount of DNA of 20-30 ⁇ g.
- vitamin K1 (5 ⁇ g / ml) was added to the medium.
- Transfection rates were assessed the day after transfection with a control plasmid expressing GFP (Green Fluorescent Protein). The productions were made in "batch" mode for 7 days. At the end of production, the cells and the supernatant were separated by centrifugation. The cells were removed and the supernatant was harvested, supplemented with 2mM PMSF and 10mM benzamidine, filtered in 0.22 ⁇ , concentrated 10X and frozen.
- CHO-S cell transfection medium Opti-Pro S FM
- Wild-type factor X and modified FX were produced in CHO-S (Invitrogen) eukaryotic cells in transient expression.
- the CHO-S were cultured in proCH04 medium, supplemented with 4 mM L-glutamine, under stirring conditions at 135 rpm in a controlled atmosphere (8% CO 2 ) at 37 ° C. On the day before transfection, the cells were seeded at a density of 6.10 5 cells / ml.
- the DNA 37.5 ⁇ g
- 37.5 ⁇ of transfection agent AT
- the whole was added to a cell preparation of 1.10 6 cells / ml in a volume of 30 ml.
- the 2 vectors were added at different ratios to obtain a total amount of DNA of 20-45 ⁇ g.
- vitamin K1 (5 ⁇ g / ml) was added to the medium.
- Transfection rates were assessed the day after transfection with a control plasmid expressing GFP.
- the productions were made in "batch" mode for 7 days.
- the cells and the supernatant were separated by centrifugation. The cells were removed and the supernatant was harvested, supplemented with 2mM PMSF and 10mM benzamidine, filtered in 0.22 ⁇ , concentrated 10X and frozen.
- Factor X concentration was measured using the commercial ELISA Zymutest Factor X (HYPHEN BioMed ref RK033A) following the recommendations from the manufacturer. The concentrations were measured in duplicate using antigen values located in the linear detection zone of the assay. To ensure that the introduced mutations do not interfere with the measurement of the concentration, the FX were deposited in identical quantities and revealed by immunoblotting with a polyclonal antibody different from that used in ELISA (Polyclonal anti-human antibody FX (CRYOPEP cat n ° PAHFX-S) or staining after SDS-PAGE (data not shown).
- FX variant concentrations present in supernatants of transfected HEK cells were measured to deposit the same amount of FX on the anti-Gla ELISA.
- the gamma-carboxylation rate was measured using a laboratory-based ELISA using the ELISA assay antibody Zymutest Factor X (Hyphen) and the anti-Gla antibody (Sekisui) as the capture antibody.
- the anti-Gla antibody (200 ⁇ l at 5 ⁇ g / ml) was incubated overnight at room temperature (RT). After incubation, the plate was saturated with PBS + 1% BSA (250 ⁇ l / well) for 2 h at RT. After washing, 200 ⁇ l of sample at 0.2 ⁇ g / ml or standards (consisting of a mixture of different ratios of plasma FX and factor X produced in CHO (non-gamma-carboxylated) were deposited for 2 hours at RT.
- the anti-FX antibody coupled to the peroxidase 200 ⁇ l of the ZYMUTEST kit
- the revelation was made by adding 200 ⁇ l of TMB for 8 minutes.
- revelation was stopped by 50 ⁇ ⁇ of 0.45 M sulfuric acid and the optical density was read at 450 nm.
- HEK cells naturally produce ectopic FX in a non-gamma carboxylated form (not shown).
- the FX was co-transfected in the presence of VKOR. This co-transfection can be done either by treating the cells with two vectors (Opti-HEK-FX-IIa-F2) or by using a bicistronic vector carrying the two cDNAs (Opti-HEK-VKOR-IIa). In both cases, the gamma-carboxylation rate was 11.55% and 10.20% plasma FX respectively (Table 2).
- Integral substitution of the signal peptide of FX and propeptide with those of FVII (v1 and v2), prothrombin or protein C did not significantly increase the level of gamma-carboxylation (6.7 to 24.5%).
- the combination with FVIIv1 is the most effective of the 4 to 24.5%.
- the concentrated culture supernatant from HEK or CHO was thawed at 37 ° C. It was then diluted to 1 ⁇ 2 in equilibration buffer (50 mM Tris HCl, 10 mM CaCl 2 , pH 7.5) and then purified on an anti-Gla aptamer column which had been previously equilibrated in the same buffer. The column was washed with 12 column volumes in equilibration buffer. FX was then eluted with 50 mM Tris-HCl buffer, 10 mM EDTA, pH 7.5. The column was returned to equilibration buffer (25 column volumes) before storage at 4 ° C. FX was treated with 2mM PMSF, concentrated, and stored at -80 ° C. 2. Results
- FX-FIIa-F2 produced from CHO or HEK were purified on an aptamer recognizing the gamma-carboxyl domain.
- the CHO product was purified according to a standard immunopurification protocol or by aptamopurification.
- the purified products were controlled by SDS-PAGE 4-10% (Figure 5A).
- the two recombinant products showed a similar profile following acrylamide separation with or without DTT reduction ( Figure 5 A, lane 4 and 3). Not reduced, the products appeared as a single band at around 60-65 kDa. Their migration was a little slower than that of plasma FX ( Figure 5 A, lane 2) because the products have 10 additional amino acids.
- the product reduction completely separates the heavy chain (48 kDa) from the light chain (17 kDa).
- the recombinant FX showed a similar profile irrespective of their mode of purification.
- the light chain of the three purified X factors migrated in the same way, as expected.
- the aptamopurified HEK product was compared to plasma FX ( Figure 5B).
- the product was pure with homogeneity and appeared as a single migrating band at a molecular weight slightly higher than that of plasma FX as previously seen ( Figure 5B, lane 3).
- the reduction of the product shows that the migration difference is carried by the heavy chain.
- Activation of FX variants produced by HEK cells was measured following the incubation of aptamopurified X factors in the presence of the anti-factor X fraction of venom of the Russell's viper (RVV-X).
- Activated control factor X, venom X moiety (RVV-X) and pNAPEP 1065 substrate were commercially available (e.g. Haematologic Technologies).
- Purified factor X variants were incubated with RVV-X.
- the generation of FXa was measured following this treatment from different concentrations of FX.
- the presence of FXa was quantified by the rate of appearance of the pNAPEP 1065 product in solution (in mUDO / min). This generation is a reflection of the recognition and cleavage of FX by the RVV-X as well as the FXa's ability to recognize the FX substrate.
- the average onset rates were made for the different initial FX concentrations and this value was reduced as a percentage of the FX-WT value.
- Activation of variant FX produced by HEK cells was measured following incubation of the aptamopurified product in the presence of 50 ⁇ M FVIIa and tissue factor.
- FVIIa complex 100 ⁇ to 100 ⁇ M
- tissue factor 50 ⁇ M FVIIa and tissue factor.
- the FVIIa complex 100 ⁇ to 100 ⁇ M
- FT tissue factor
- the mixture (20 ⁇ l) was removed and deposited in 180 ⁇ l of STOP buffer (50 mM Tris, 9 mM EDTA, 475 mM NaCl, pH 8.8).
- the PNAPEP substrate diluted 1 ⁇ 2 in PPI water 50 ⁇ l was added and an immediate reading in kinetic mode every 25 seconds was made for 10 min at 405 nm.
- Plasma FXa control was considered 100%.
- the two variant X factor constructs were activated at 27% FXa for Opti-HEK-VKOR-IIa and 36% for FVIIv1-psFX-IIa-F2. This activity is sensitive to the rate of gamma-carboxylation. Modification of the propeptide allowed FVIIv1-psFX-IIa-F2 to have an activity of 142% of that of the molecule containing the wild-type propeptide.
- Thrombin calibrator PPP reagent low, CK-Perst, Fluca Kit (Fluo-buffer + Fluo- substrate) and PNP were commercially available, for example at Stago.
- FVIII-deficient plasma e.g. Siemens Healthcare
- recombinant human factor VIII control comes from Baxter (Advate).
- the thrombin generation test consists in activating ex vivo coagulation using a mixture of tissue factor and phospholipids (activation of the extrinsic coagulation pathway) and then measuring the thrombin concentration generated over time. .
- the thrombin generation tests were performed on 80 ⁇ l of a pool of plasma containing purified product or controls, in the presence of 20 ⁇ l of PPP reagent containing in the end 1 ⁇ M of Tissue Factor (TF) and 4 ⁇ l of phospholipids. (PL).
- PPP reagent containing in the end 1 ⁇ M of Tissue Factor (TF) and 4 ⁇ l of phospholipids. (PL).
- Different plasmas can be used: normal plasma, deficient factor X, deficient factor VIII, deficient plasma factor IX or deficient plasma FXI
- the reaction was started by the addition of 20 ⁇ ⁇ Fluca-kit (substrate + CaCl 2 ) which constitutes the beginning of the measurement of the appearance of thrombin.
- the appearance of fluorescence was measured on a Fluoroskan Ascent fluorimeter (ThermoLabsystems) at an excitation wavelength of 390 nm and at an emission wavelength of 460 nm.
- Thrombinograms curves representing the fluorescence intensity versus time
- Thrombinoscope TM software which converts the fluorescence value into nM thrombin by comparative calculation.
- the aptamopurified FVIIv1-psFX-IIa-F2 was used at 10 and 20 ⁇ g / ml.
- the FVIII deficient plasma gave the weakest signal, corresponding to the background noise of the experiment ( Figure 8).
- Plasma Unicalibrator provided a weaker signal than FVIII deficient plasma reconstituted by FVIII concentrations (0.1 or 1 U / ml).
- Variant FX with a modified propeptide has the ability to correct a FVIII deficient plasma as effectively as FVIII.
- a dose response was observed with a lag time that is shortened as the dose increases and an amplitude increases. The amplitude of the signal, however, did not completely reach reconstitution with 1 U / ml of FVIII but was much higher than that of normal plasma.
- the modified FX FVIIv1-psFX-IIa-F2-Fc was cloned into a bicistronic vector optimized for expression in the YB2 / 0 line in which a nucleic sequence coding for human furine at the level of the second was introduced. transcription unit. The amount of vector required for transfection was then prepared and linearized at the EcoRV restriction site. After centrifugation, the YB2 / 0 cells were taken up in a volume making it possible to obtain a cell density of 1.10 cells / ml.
- the transfection was carried out by electroporation using a specific kit (ref: EB110, Ozyme) at 5 ⁇ 10 6 cell / ml in the presence of 61 ⁇ g of bicistronic vector containing the sequence FVIIv1-psFX-IIa-F2-Fc. and the sequence of human furin. After transfection, the cells were resuspended in 75 cm 2 flasks. Selection pressure was added three days after transfection by adding G418 at 0.6 g / l. The selection pressure was maintained for 14 days and then the cells were frozen.
- a specific kit ref: EB110, Ozyme
- Productions of the FVIIv1-psFX-IIa-F2-Fc molecule were initiated by seeding the selected YB2 / 0 cells at a density of 3.10 5 cells / ml in Emabprol medium containing 4 mM glutamine. For production, a fed-batch mode was applied for 12 days by adding glucose and glutamine based on pre-determined cell density.
- the cells and the supernatant were separated by centrifugation.
- the cells were removed and the supernatant was harvested, supplemented with 2mM PMSF and 10mM benzamidine, 5X concentrate, filtered in 0.22 ⁇ , and then frozen.
- FVIIv1-psFX-IIa-F2-Fc was produced in HEK293F, CHO-S and YB2 / 0 as described in Examples 2, 3 and 9.
- the concentrated culture supernatant from HEK, YB2 / 0 or CHO-S was thawed at 37 ° C. and then filtered on Nalgene 0.2 ⁇ unit (aPES).
- aPES Nalgene 0.2 ⁇ unit
- QAE Sephadex A50 gel (0.25% w / v; GE Healthcare) was added and the whole was stirred for one hour at + 4 ° C. The gel was loaded into a column body, washed with the equilibration buffer and the molecules of interest were eluted with 50 mM Tris-HCl buffer pH7.5 500 mM NaCl.
- the eluate was then frozen at -80 ° C before aptamopurification.
- the thawed eluate was diluted 1 ⁇ 2 in equilibration buffer (50 mM Tris HCl, 10 mM CaCl 2 , pH 7.5) and then purified on an anti-Gla aptamer column which had been previously equilibrated in the same buffer. .
- the column was washed with 12 column volumes in equilibration buffer.
- FVIIv1-psFX-IIa-F2-Fc was then eluted with 50 mM Tris-HCl buffer, 10 mM EDTA, pH 7.5.
- FVIIv1-psFX-IIa-F2-Fc produced from CHO-S, YB2 / 0 or HEK were purified on an aptamer recognizing the gamma-carboxyl domain.
- the purified products from CHO-S or HEK were controlled by SDS-PAGE 4-10% (Figure 9). They showed a similar profile following acrylamide separation with or without DTT reduction ( Figure 9, lanes 3-5, 7-9). Not reduced, the products appeared in the form of a majority band at about 250 kDa migrating very differently from that of the plasma FX (67 kDa, Figure 9, lane 1) because the products are grafted to an Fc fragment.
- the phopholipids were diluted to 12.5 ⁇ in absolute ethanol and then loaded into 96-wells. They were incubated overnight at room temperature without a lid. The wells were then saturated for 2 h with 50 mM Tris buffer, 150 mM NaCl, CaCl 2.
- Plasma factor X control (x) binds as expected to phospholipids depending on the starting concentration. The signal tends to saturation. Unpurified FVIIvl-psFX-IIa-F2-Fc present in the supernatants of CHO-S, HEK293 and YB2 / 0 and the same aptamopurified products were evaluated. All supernatant, non-purified forms are less well-bound to phospholipids than aptamopurified forms. This signal difference may be due either to the presence of inhibitory molecules or binding competitors in the supernatants or, most likely, that the supernatants contain a fraction of the weakly gamma-carboxylated product and that they bind therefore less well with phospholipids.
- the product from CHO is the one for which the signal has been the most improved, then comes the product YB2 / 0 and then the HEK293.
- all the products bound to the phospholipids giving a signal at least as strong as that of the plasma FX or even higher for the products HEK293 and
- the experiments and dilutions were conducted in the following reaction buffer: 25 mM Hepes, 175 mM NaCl, 5 mg / ml BSA, 5 mM CaCl 2 pH 7.4.
- the standard range was prepared as follows: in a flat-bottomed plate, 100 ⁇ r-Hirudine at 50 nM + 100 ⁇ of each dilution of FXa + 50 ⁇ of PNAPEP substrate diluted 1 ⁇ 2 in PPL water Immediate reading in kinetic mode all 25 seconds for 10 min at 405 nm was performed.
- the tests were carried out by adding to 100 ⁇ l of sample at 200 nM, 100 ⁇ l thrombin at 20 nM final concentrations 100 nM FX / 10 nM Ha.
- the mixture was then incubated at 37 ° C. and then at different times 0, 0.5, 1, 2, 3.5, 6 and 8 h, a 20 ⁇ aliquot was taken and placed in a well of a flat-bottom microplate containing 180 ⁇ l of r-Hirudine at 50 nM.
- the pNAPEP 1065 substrate (50 ⁇ l) diluted 1 ⁇ 2 in PPI water was added and an immediate kinetic reading every 25 seconds was carried out for 10 min at 405 nm.
- factor VIII-deficient plasma reconstituted with 0.1 U / ml of factor VIII ( ⁇ ) or 1 U / ml of factor VIII ( ⁇ ) allow thrombin generation which increases with the level of FVIII.
- Normal plasma gives a median signal between these two conditions ( ⁇ ).
- the presence of the FVIIv1-psFX-IIa-F2-Fc molecule (4 ⁇ g / ml) makes it possible to correct the deficiency of FVIII.
- the factor produced in HEK293 gives a stronger signal than that of normal plasma with identical lagtime. It is, however, a little higher than that of deficient plasma + 1 U / ml factor VIII.
- the product from YB2 / 0 also gives a powerful signal but with an increased lagtime.
- the product from CHO gives a more moderate signal with a lagtime still increased but able to correct the deficiency in FVIII.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
FR1654098A FR3050992A1 (fr) | 2016-05-06 | 2016-05-06 | Mutants du facteur x |
PCT/FR2017/051094 WO2017191424A1 (fr) | 2016-05-06 | 2017-05-05 | Mutants du facteur x |
Publications (1)
Publication Number | Publication Date |
---|---|
EP3452586A1 true EP3452586A1 (fr) | 2019-03-13 |
Family
ID=56411751
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP17727638.3A Withdrawn EP3452586A1 (fr) | 2016-05-06 | 2017-05-05 | Mutants du facteur x |
Country Status (7)
Country | Link |
---|---|
US (1) | US20190338269A1 (fr) |
EP (1) | EP3452586A1 (fr) |
KR (1) | KR20190003742A (fr) |
CN (1) | CN109415713A (fr) |
CA (1) | CA3023337A1 (fr) |
FR (1) | FR3050992A1 (fr) |
WO (1) | WO2017191424A1 (fr) |
Families Citing this family (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
FR3077296A1 (fr) * | 2018-02-01 | 2019-08-02 | Laboratoire Francais Du Fractionnement Et Des Biotechnologies | Dimeres de variants du facteur x |
Family Cites Families (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
AT410216B (de) * | 1999-08-10 | 2003-03-25 | Baxter Ag | Faktor x-analogon mit verbesserter aktivierbarkeit |
FR2948665B1 (fr) * | 2009-07-31 | 2011-09-23 | Lfb Biotechnologies | Procede pour la purification de proteines de la coagulation a domaine gla actives |
IN2015DN01404A (fr) * | 2012-07-25 | 2015-07-03 | Catalyst Biosciences Inc | |
FR3001729B1 (fr) * | 2013-02-04 | 2015-03-06 | Lab Francais Du Fractionnement | Mutants du facteur x |
-
2016
- 2016-05-06 FR FR1654098A patent/FR3050992A1/fr active Pending
-
2017
- 2017-05-05 US US16/099,297 patent/US20190338269A1/en not_active Abandoned
- 2017-05-05 KR KR1020187035120A patent/KR20190003742A/ko unknown
- 2017-05-05 CN CN201780041389.6A patent/CN109415713A/zh active Pending
- 2017-05-05 CA CA3023337A patent/CA3023337A1/fr not_active Abandoned
- 2017-05-05 WO PCT/FR2017/051094 patent/WO2017191424A1/fr unknown
- 2017-05-05 EP EP17727638.3A patent/EP3452586A1/fr not_active Withdrawn
Also Published As
Publication number | Publication date |
---|---|
KR20190003742A (ko) | 2019-01-09 |
FR3050992A1 (fr) | 2017-11-10 |
WO2017191424A1 (fr) | 2017-11-09 |
US20190338269A1 (en) | 2019-11-07 |
CN109415713A (zh) | 2019-03-01 |
CA3023337A1 (fr) | 2017-11-09 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
JP6749836B2 (ja) | 第viii因子キメラタンパク質及びその使用 | |
CA2863328A1 (fr) | Facteur viii chimerique et polypeptides et leurs utilisations | |
JP2015525222A (ja) | キメラ性凝固因子 | |
CA2878679A1 (fr) | Complexe du facteur viii avec une sequence xten et la proteine facteur de von willebrand, et utilisations associees | |
TW201946929A (zh) | 表現因子viii之慢病毒載體之使用 | |
EP2680876B1 (fr) | Facteur xa depourvu de domaine gla pour le traitement des hemophilies a ou b avec ou sans anticorps | |
FR3024453A1 (fr) | Procede de production de variants ayant un fc presentant une sialylation amelioree | |
EP2951297B1 (fr) | Mutants du facteur x | |
EP3806891B1 (fr) | Combinaison de facteur vii et d'un anticorps bispécifique anti-facteurs ix et x | |
EP3452586A1 (fr) | Mutants du facteur x | |
WO2019150050A1 (fr) | Dimères de variants du facteur x | |
EP3532503A1 (fr) | Variants de polypeptide fc presentant une demi-vie augmentee | |
EP3010533B1 (fr) | Facteur x depourvu de domaine gla | |
FR3069540B1 (fr) | Proteine modifiee avec demi-vie amelioree | |
RU2803163C2 (ru) | Применение лентивирусных векторов, экспрессирующих фактор viii | |
JP2019516347A (ja) | 抗アンチトロンビン単一ドメイン抗体及びそれを含むポリペプチド | |
WO2009118460A1 (fr) | Lapins transgeniques producteurs de facteur vii humain | |
CA2691110A1 (fr) | Facteur vii/viia humain modifie et composition pharmaceutique contenant celui-ci |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: UNKNOWN |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE |
|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
17P | Request for examination filed |
Effective date: 20181106 |
|
AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR |
|
AX | Request for extension of the european patent |
Extension state: BA ME |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE |
|
DAV | Request for validation of the european patent (deleted) | ||
DAX | Request for extension of the european patent (deleted) | ||
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20211201 |