EP2954045A1 - Compositions cellulaires issues de cellules reprogrammées dédifférenciées - Google Patents

Compositions cellulaires issues de cellules reprogrammées dédifférenciées

Info

Publication number
EP2954045A1
EP2954045A1 EP14708981.7A EP14708981A EP2954045A1 EP 2954045 A1 EP2954045 A1 EP 2954045A1 EP 14708981 A EP14708981 A EP 14708981A EP 2954045 A1 EP2954045 A1 EP 2954045A1
Authority
EP
European Patent Office
Prior art keywords
cells
cell
endoderm
human
pancreatic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
EP14708981.7A
Other languages
German (de)
English (en)
Inventor
Alan D. Agulnick
Olivia Kelly
Yuki OHI
Allan Robins
Thomas Schultz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Viacyte Inc
Original Assignee
Viacyte Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from US13/761,078 external-priority patent/US9109245B2/en
Application filed by Viacyte Inc filed Critical Viacyte Inc
Publication of EP2954045A1 publication Critical patent/EP2954045A1/fr
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/0012—Cell encapsulation
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0676—Pancreatic cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/11—Epidermal growth factor [EGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/70—Enzymes
    • C12N2501/72—Transferases [EC 2.]
    • C12N2501/727—Kinases (EC 2.7.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2506/00—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells
    • C12N2506/45—Differentiation of animal cells from one lineage to another; Differentiation of pluripotent cells from artificially induced pluripotent stem cells

Definitions

  • This invention relates generally to the isolation, maintenance, and use of cell cultures. More specifically, it relates to cell compositions derived from induced pluripotent stem cells.
  • Pluripotent stem cells include, but are not limited to, human embryonic stem (hES) cells, human embryonic germ (hEG) cells. Still other types of pluripotent cells exist, for example, dedifferentiated mouse and human stem cells, i.e. differentiated somatic adult cells are dedifferentiated to become pluripotent-like stem cells. These dedifferentiated cells induced to establish cells having pluripotency and growth ability similar to those of ES cells are also called
  • iPS cells induced pluripotent stem (iPS) cells
  • embryonic stem cell-like cells ES-like cells
  • iPS cells are potentially viable alternative pluripotent cells.
  • the therapeutic application of iPS cells will require demonstrating that these cells are stable and show an appropriate safety profile in preclinical studies to treat diabetes and other diseases.
  • Reprogramming of differentiated human somatic cells into a pluripotent state allows for patient- and disease-specific stem cells. See Takahashi, K. et al. Cell, 1-12, 2007 and Ju, J. et al. Science 2007. Takahashi et al. and Ju et al.
  • iPS cells had some characteristics of hES cells including, hES cell morphology, marker expression, prolonged proliferation, normal karyotype, and pluripotency.
  • iPS cells may provide a cell therapy-based regenerative medicine without the associated ethical controversy, the differentiation properties of iPS cells, for example, differentiation potential and efficiency of the differentiation in vitro, are still unclear, and a directed differentiation method for iPS cells has not been demonstrated. Hence, there is a need to determine and demonstrate detailed differentiation properties and the directional differentiation efficiencies of iPS cells.
  • Embodiments described herein provide for cell compositions derived from pluripotent cells, for example, dedifferentiated reprogrammed cells, such as induced pluripotent stem (iPS) cells.
  • pluripotent cells for example, dedifferentiated reprogrammed cells, such as induced pluripotent stem (iPS) cells.
  • iPS induced pluripotent stem
  • One embodiment provides for compositions and methods of making an in vitro cell culture comprising human cells wherein at least about 15% of the human cells are definitive endoderm cells, wherein the definitive cells are derived from dedifferentiated genetically reprogrammed cells.
  • the definitive endoderm cells are multipotent cells that can differentiate into cells of the gut tube or organs derived therefrom.
  • compositions and methods of making an in vitro cell culture comprising human cells wherein at least about 15% of the human cells are pancreatic-duodenal homeobox factor-1 (PDXl) positive foregut endoderm cells, wherein the PDXl positive foregut endoderm cells are derived from dedifferentiated genetically reprogrammed cells.
  • the PDXl positive foregut endoderm cells are PDXl, SOX9, PROX1 and HNF6 co-positive
  • a further embodiment provides for compositions and methods of making an in vitro cell culture comprising human cells wherein at least about 15% of the human cells are pancreatic-duodenal homeobox factor- 1 (PDXl) positive pancreatic progenitor cells, wherein the PDXl positive pancreatic progenitor cells are derived from dedifferentiated genetically reprogrammed cells.
  • the PDXl positive pancreatic progenitor cells are PDXl and NKX6.1 co-positive.
  • Still another embodiment provides for compositions and methods of making an vitro cell culture comprising human cells wherein at least about 15% of the human cells are Neurogenin 3 (NGN3) positive endocrine precursor cells, wherein the NGN3 endocrine precursor cells are derived from dedifferentiated genetically reprogrammed cells.
  • NGN3 positive endocrine precursor cells are NGN3, PAX4 and NKX2.2 co-positive.
  • cell culture compositions described herein include in vitro human pancreatic endoderm cell cultures comprising differentiated cells derived from dedifferentiated genetically reprogrammed cells and an ERBB receptor tyrosine kinase activating agent.
  • the method comprises the steps of (a) contacting at least a foregut endoderm cell culture and/or at least a PDXl negative foregut endoderm cell culture derived from dedifferentiated genetically reprogrammed cells in vitro with an ERBB receptor tyrosine kinase activating agent, thereby producing a pancreatic endoderm cell population comprising endocrine cell and non-endocrine cell sub-populations; and (b) transplanting and maturing the pancreatic endoderm cell population of step (a) or a cell subpopulation of step (a) in vivo, thereby obtaining insulin secreting cells, wherein the insulin secreting cells secrete insulin in response to glucose stimulation.
  • Still other embodiments described herein relate to a method for producing insulin, the method comprising the steps of: (a) contacting dedifferentiated genetically reprogrammed cells in vitro with a first medium comprising an agent that activates a TGF receptor family member; (b) culturing, in vitro, the cells of step (a) in a second medium lacking the agent that activates a TGF receptor family member, thereby generating at least foregut endoderm cells and/or at least PDXl negative foregut endoderm cells; (c) contacting the cells of step (b) with an ERBB receptor tyrosine kinase activating agent, thereby generating a cell population comprising endocrine cell and non-endocrine cell sub-populations; and (d) transplanting and maturing the cell population of step (c) or a cell subpopulation of step (c) in vivo, thereby obtaining insulin secreting cells, wherein the insulin secreting cells secrete insulin in response to glucose stimulation.
  • Still other embodiments described herein relate to contacting a population comprising at least foregut endoderm cells, at least PDXl negative foregut endoderm cells, and/or at least PDXl positive pancreatic endoderm cells with an ERBB receptor tyrosine kinase activating agent, thereby generating a cell population capable of maturing to glucose-responsive insulin-secreting cells in vivo.
  • Still other embodiments described herein relate to contacting a population comprising at least foregut endoderm cells, at least PDXl negative foregut endoderm cells, and/or at least PDXl positive pancreatic endoderm cells with an ERBB receptor tyrosine kinase activating agent and a rho-kinase inhibitor, thereby generating a cell population capable of maturing to glucose-responsive insulin-secreting cells in vivo.
  • the phrases "at least foregut endoderm cells,” at least PDXl negative foregut endoderm cells,” and “at least PDXl positive pancreatic endoderm cells” means that some of or a portion of the cells in the cell population have differentiated from iPSC to foregut endoderm cells or beyond, from iPSC to PDXl negative foregut endoderm cells or beyond and/or from iPSC to PDXl positive pancreatic endoderm cells or beyond in their differentiation toward pancreatic islet cells.
  • the phrases "some of and/or "a portion of,” when drawn to cells in a cell population, means that the cell population comprises at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least more than 95% cells of the specified cell type.
  • Figure 1 is a photographic image of an aggregate suspension culture of dedifferentiated reprogrammed cells or, also referred to herein, as iPS cells.
  • FIGS.2A-L are bar graphs showing the relative gene expression levels of OCT4 (FIG.2A), BRACHYURY (FIG.2B), CER1 (FIG.2C), GSC (FIG.2D), FOXA2 (FIG.2E), FOXA1 (FIG.2F), HNF6 (FIG.2G), PDXl (FIG.2H), PTF1A (FIG.2I), NKX6.1 (FIG.2J), NGN3 (FIG.2K) and INS (FIG.2L).
  • Expression levels are normalized to the average expression levels of housekeeping genes, cyclophilin G and TATA Binding Protein (TBP) expression.
  • TBP TATA Binding Protein
  • Figures 3A-3D are photmicrographs of immunocytochemistry (ICC) of human iPS cell cultures from Stage 4 differentiation using antibodies specific for (3 A) PDX-1 ; (3B) NKX6.1 ; (3C) PTF 1A; and (3D) Dapi.
  • Figures 4A-4D are pictures of immunocytochemistry (ICC) of iPS cell cultures from Stage 4 differentiation using ligands specific for (4A) Glucagon; (4B) Insulin; (4C) Somatostatin; and (4D) Dapi.
  • Figures 5A-B are an array location map and array key provided in the Proteome ProfilerTM human phospho-RTK antibody arrays from R&D Systems.
  • the location map in Figure 5A shows the coordinates or location of the RTK antibodies.
  • the identity or name of the RTK family and antibodies are described in the key, Figure 5B.
  • the positive signals observed on the developed film can therefore be identified by overlaying a transparency as in Figure 5A and identifying the signals by referring to the coordinates on the overlay ( Figure 5A) with the name of the RTK in Figure 5B.
  • Figures 6A-D are an RTK array analyses of iPS cell-derived pancreatic endoderm cells (PEC) under four different conditions (A, B, C and D as described in Example 5. Tyrosine phosphorylation of certain RTKs are observed by the identification of high to low-intensity signals. IGF 1R/IR and ERBB (EGFR) family members are identified or boxed.
  • PEC pancreatic endoderm cells
  • Figures 7A-C are graphs showing the concentrations of human C-peptide and insulin in sera of implanted mice for experiments E2314, E2356 and E2380 (FIG.7A), E2347 (FIG.7B), and E2354 (FIG.7C) as indicated in Table 9.
  • Mice implanted with PEC were analyzed at the indicated post-engraftment times for serum levels of human C-peptide at fasting, and 30 min and 60 min after intraperitoneal glucose administration.
  • PEC was encapsulated with cell encapsulation devices (Encaptra® EN20, or EN20, ViaCyte, San Diego, CA) and in some instances the devices had micro-perforations (pEN20, ViaCyte, San Diego, CA).
  • Encaptra® EN20, or EN20, ViaCyte, San Diego, CA cell encapsulation devices
  • pEN20 ViaCyte, San Diego, CA
  • Such devices have been described in U.S. Patent No. 8,278, 106, the disclosure of which is incorporated herein by reference in its entirety.
  • FIG. 8A and 8B are graphs showing the results of blood glucose analyses of STZ- treated mice for Experiment #2347.
  • FIG.8A shows the blood glucose for each of the 13 mice (baseline with and without heregulin) and
  • FIG.8B shows the combined average measurements for each treatment (baseline with and without heregulin). Measurements of random non-fasting blood glucose levels are shown for the 13 mice implanted with iPEC grafts up to 14 days before they were treated with STZ (day 0), and for the same mice after STZ treatment and after the grafts were explanted. STZ -treated animals were given STZ about 26 weeks post graft transplant (day 0).
  • totipotent stem cells refer to cells having the ability to differentiate into all cells constituting an organism, such as cells that are produced from the fusion of an egg and sperm cell. Cells produced by the first few divisions of the fertilized egg can also be totipotent. These cells can differentiate into embryonic and extraembryonic cell types. Pluripotent stem cells, such as ES cells for example, can give rise to any fetal or adult cell type. However, alone they cannot develop into a fetal or adult animal because they lack the potential to develop extraembryonic tissue.
  • Extraembryonic tissue is, in part, derived from extraembryonic endoderm and can be further classified into parietal endoderm (Reichert's membrane) and visceral endoderm (forms part of the yolk sac). Both parietal and visceral endoderm support developments of the embryo but do not themselves form embryonic structures. There also exist other extraembryonic tissue including extraembryonic mesoderm and extraembryonic ectoderm.
  • a “pluripotent cell” is used as the starting material for differentiation to endoderm-lineage, or more particularly, to pancreatic endoderm type cells.
  • pluripotency or “pluripotent cells” or equivalents thereof refers to cells that are capable of both proliferation in cell culture and differentiation towards a variety of lineage- restricted cell populations that exhibit multipotent properties, for example, both pluripotent ES cells and induced pluripotent stem (iPS) cells can give rise to each of the three embryonic cell lineages.
  • Pluripotent cells may not be capable of producing an entire organism. That is, pluripotent cells are not totipotent.
  • the pluripotent cells used as starting material are stem cells, including hES cells, hEG cells, iPS cells, even parthenogenic cells and the like.
  • stem cells including hES cells, hEG cells, iPS cells, even parthenogenic cells and the like.
  • embryonic refers to a range of developmental stages of an organism beginning with a single zygote and ending with a multicellular structure that no longer comprises pluripotent or totipotent cells other than developed gametic cells.
  • embryos derived by gamete fusion the term “embryonic” refers to embryos derived by somatic cell nuclear transfer.
  • pluripotent cells are not derived or are not immediately derived from embryos, for example, iPS cells are derived from a non-pluripotent cell, e.g., a multipotent cell or terminally differentiated cell.
  • Human pluripotent stem cells can also be defined or characterized by the presence of several transcription factors and cell surface proteins including transcription factors Oct-4, Nanog, and Sox-2, which form the core regulatory complex ensuring the suppression of genes that lead to differentiation and the maintenance of pluripotency; and cell surface antigens, such as the glycolipids SSEA3, SSEA4 and the keratan sulfate antigens, Tra-1-60 and Tra-1-81.
  • transcription factors Oct-4, Nanog, and Sox-2, which form the core regulatory complex ensuring the suppression of genes that lead to differentiation and the maintenance of pluripotency
  • cell surface antigens such as the glycolipids SSEA3, SSEA4 and the keratan sulfate antigens, Tra-1-60 and Tra-1-81.
  • induced pluripotent stem cells refer to a type of pluripotent stem cell artificially prepared from a non-pluripotent cell, typically an adult somatic cell, or terminally differentiated cell, such as a fibroblast, a hematopoietic cell, a myocyte, a neuron, an epidermal cell, or the like, by inserting certain genes or gene products, referred to as reprogramming factors.
  • Induced pluripotent stem cells are substantially similar to natural human pluripotent stem cells, such as hES cells, in many respects including, the expression of certain stem cell genes and proteins, chromatin methylation patterns, doubling time, embryoid body formation, teratoma formation, viable chimera formation, and potency and differentiability.
  • Human iPS cells provide a source of pluripotent stem cells without the associated use of embryos.
  • Various methods can be employed to produce iPS cells, which are described herein in further detail below. However, all the methodologies employ certain reprogramming factors comprising expression cassettes encoding Sox-2, Oct-4, Nanog and optionally Lin-28, or expression cassettes encoding Sox-2, Oct-4, Klf4 and optionally c-myc, or expression cassettes encoding Sox-2, Oct-4, and optionally Esrrb. Nucleic acids encoding these reprogramming factors can be in the same expression cassette, different expression cassettes, the same reprogramming vector, or different reprogramming vectors. Oct-3/4 and certain members of the
  • Sox gene family (Sox-1, Sox-2, Sox-3, and Sox- 15) are crucial transcriptional regulators involved in the induction process whose absence makes induction impossible.
  • Oct-3/4 (Pou5fl) is one of the family of octamer ("Oct") transcription factors, and plays an important role in maintaining pluripotency.
  • Oct octamer
  • the absence of Oct-3/4 in normally Oct-3/4+ cells, such as blastomeres and embryonic stem cells leads to spontaneous trophoblast differentiation; whereas the presence of Oct-3/4 gives rise to the pluripotency and differentiation potential of embryonic stem cells.
  • other genes in the "Oct" family for example, Octl and Oct6, do not induce pluripotency, therefore this pluripotency induction process can be attributed to Oct-3/4.
  • Sox family Another family of genes associated with maintaining pluripotency similar to Oct-3/4, is the Sox family.
  • Sox family is not exclusive to pluripotent cell types but is also associated with multipotent and unipotent stem cells.
  • the Sox family has been found to work as well in the induction process.
  • Klf4 of the Klf family of genes was initially identified by Yamanaka et al. 2006 supra as a factor for the generation of mouse iPS cells. Human iPS cells from S.
  • Klf4 was not required and in fact failed to produce human iPS cells.
  • Other members of the Klf family are capable generating iPS cells, including Klfl, Klf2 and Klf5.
  • the Myc family C-myc, L-myc, and N-myc
  • proto-oncogenes implicated in cancer c-myc was a factor implicated in the generation of mouse and human iPS cells, but Yu et al. (2007 supra reported that c-myc was not required for generation of human iPS cells.
  • multipotency or “multipotent cell” or equivalents thereof refers to a cell type that can give rise to a limited number of other particular cell types. That is, multipotent cells are committed to one or more embryonic cell fates, and thus, in contrast to pluripotent cells, cannot give rise to each of the three embryonic cell lineages as well as to extraembryonic cells. Multipotent somatic cells are more differentiated relative to pluripotent cells, but are not terminally differentiated. Pluripotent cells therefore have a higher potency than multipotent cells.
  • Potency-determining factors that can reprogram somatic cells or used to generate iPS cells include, but are not limited to, factors such as Oct-4, Sox2, FoxD3, UTF1, Stella, Rexl, ZNF206, Soxl5, Mybl2, Lin28, Nanog, DPPA2, ESG1, Otx2 or combinations thereof.
  • ERBB receptor tyrosine kinase activating agent includes, but is not limited to, at least 16 different EGF family ligands that bind ERBB receptors: EGF (epidermal growth factor), AG or AREG (Amphiregulin), and TGF-Alpha (Transforming Growth Factor- Alpha), Btc (Betacellulin), HBEGF (Heparin-Binding EGF), and Ereg (Epiregulin), Neuregulins (or Heregulins) such as Neuregulin-1, -2, -3 and -4 (or Heregulin-1, -2, -3 and -4).
  • the instant invention contemplates any ligand that is capable of binding to any one of the four ERBB receptors or a combination thereof to induce formation of homo- and heterodimer receptor complexes leading to activation of the intrinsic kinase domain and subsequent phosphorylation. See also Table 11.
  • Some embodiments of the methods of producing insulin described herein can include treating an animal having diabetes, or controlling glucose concentration in the blood of an animal, by providing the animal with pancreatic endoderm cells that can mature in vivo into insulin producing cells that secrete insulin in response to glucose stimulation.
  • One aspect described herein includes populations of pluripotent or precursor cells that are capable of selectively, and in some aspects selectively reversibly, developing into different cellular lineages when cultured under appropriate conditions.
  • the term “population” refers to cell culture of more than one cell having the same identifying characteristics.
  • the term “cell lineage” refers to all of the stages of the development of a cell type, from the earliest precursor cell to a completely mature cell (i.e. a specialized cell).
  • a "precursor cell” or “progenitor cell” can be any cell in a cell differentiation pathway that is capable of differentiating into a more mature cell.
  • a precursor cell can be a pluripotent cell, or it can be a partially differentiated multipotent cell, or reversibly differentiated cell.
  • the term "precursor cell population" refers to a group of cells capable of developing into a more mature or differentiated cell type.
  • a precursor cell population can comprise cells that are pluripotent, cells that are stem cell lineage restricted (i.e. cells capable of developing into less than all ectodermal lineages, or into, for example, only cells of neuronal lineage), and cells that are reversibly stem cell lineage restricted. Therefore, the term “progenitor cell” or “precursor cell” may be a "pluripotent cell” or "multipotent cell.”
  • somatic cells are "reprogrammed” to pluripotent cells.
  • somatic cells are reprogrammed when after sufficient proliferation, a measurable proportion of cells, either in vivo or in an in vitro cell culture, display phenotypic characteristics of the new pluripotent cell type.
  • somatic cells Without reprogramming, such somatic cells would not give rise to progeny displaying phenotypic characteristics of the new pluripotent cell type. If, even without reprogramming, somatic cells could give rise to progeny displaying phenotypic characteristics of the new pluripotent cell type, the proportion of progeny from these somatic cells displaying phenotypic characteristics of the new pluripotent cell type is measurably more than before reprogramming.
  • the phrase “differentiation programming” refers to a process that changes a cell to form progeny of at least one new cell type with a new differentiation status, either in culture or in vivo, than it would have under the same conditions without differentiation reprogramming.
  • This process includes differentiation, dedifferentiation and transdifferentiation.
  • the phrase “differentiation” refers to the process by which a less specialized cell becomes a more specialized cell type.
  • the phrase “dedifferentiation” refers to a cellular process in which a partially or terminally differentiated cell reverts to an earlier developmental stage, such as cell having pluripotency or multipotency.
  • the phrase “transdifferentiation” refers to a process of transforming one differentiated cell type into another differentiated cell type.
  • the terms “develop from pluripotent cells”, “differentiate from pluripotent cells”, “mature from pluripotent cells” or “produced from pluripotent cells”, “derived from pluripotent cells”, “differentiated from pluripotent cells” and equivalent expressions refer to the production of a differentiated cell type from pluripotent cells in vitro or in vivo, e.g., in the case of endocrine cells matured from transplanted PDX 1 pancreatic endoderm cells in vivo as described in International Patent Application No. PCT/US2007/015536, entitled METHODS OF PRODUCING PANCREATIC HORMONES, the disclosure of which is incorporated herein by reference in its entirety.
  • feeder cell refers to a culture of cells that grows in vitro and secretes at least one factor into the culture medium, and that can be used to support the growth of another cell of interest in culture.
  • a "feeder cell layer” can be used interchangeably with the term “feeder cell.”
  • a feeder cell can comprise a monolayer, where the feeder cells cover the surface of the culture dish with a complete layer before growing on top of each other, or can comprise clusters of cells.
  • the feeder cell comprises an adherent monolayer.
  • cluster and “clump” or “aggregate” can be used interchangeably, and generally refer to a group of cells that have not been dissociated into single cells.
  • the clusters may be dissociated into smaller clusters. This dissociation is typically manual in nature (such as using a Pasteur pipette), but other means of dissociation are contemplated.
  • Aggregate suspension pluripotent or multipotent cell cultures are substantially as described in International Publications PCT/US2007/062755, titled COMPOSITIONS AND METHODS FOR CULTURTNG DIFFERENTIAL CELLS and PCT/US2008/082356, titled STEM CELL AGGREGATE SUSPENSION COMPOSITIONS AND METHODS OF DIFFERENTIATION THEREOF, which are herein incorporated by reference in their entireties.
  • Feeder-free culture methods increase scalability and reproducibility of pluripotent cell culture and reduces the risk of contamination, for example, by infectious agents from the feeder cells or other animal-sourced culture components. Feeder-free methods are also described in U.S. Patent No. 6,800,480 to Bodnar et al. (assigned to Geron Corporation, Menlo Park, California). However, and in contrast to U.S. Patent No.
  • 6,800,480 patent embodiments described herein, whether they be pluripotent, multipotent or differentiated cell cultures, are feeder- free and do not further contain an endogenous or exogenous extracellular-matrix; i.e. the cultures described herein are extracellular-matrix-free as well as being feeder free.
  • extracellular matrix is prepared by culturing fibroblasts, lysing the fibroblasts in situ, and then washing what remains after lysis.
  • 6,800,480 extracellular matrix can also be prepared from an isolated matrix component or a combination of components selected from collagen, placental matrix, fibronectin, laminin, merosin, tenascin, heparin sulfate, chondroitin sulfate, dermatan sulfate, aggrecan, biglycan, thrombospondin, vitronectin, and decorin.
  • Embodiments described herein neither produce an extracellular-matrix by growth of a feeder or fibroblast layer and lysing the cells to produce the extracellular-matrix; nor does it require first coating the tissue culture vessel with extracellular matrix component or a combination of extracellular-matrix components selected from collagen, placental matrix, fibronectin, laminin, merosin, tenascin, heparin sulfate, chondroitin sulfate, dermatan sulfate, aggrecan, biglycan, thrombospondin, vitronectin, and decorin.
  • the aggregate suspension cultures described herein for pluripotent, multipotent and differentiated cells do not require a feeder layer, a lysed feeder or fibroblast cell to produce an extracellular matrix coating, an exogenously added extracellular matrix or matrix component; rather use of soluble human serum component as described in International Application PCT/US2008/080516, titled METHODS AND COMPOSITIONS FOR FEEDER-FREE PLURIPOTENT STEM CELL MEDIA CONTAINING HUMAN SERUM, which is herein incorporated by reference in its entirety, overcomes the need for either a feeder-cell or feeder monolayer, as well as overcoming the need for an endogenous extracellular-matrix from a feeder or fibroblast cell or from exogenously added extracellular- matrix components.
  • culturing methods are free of animal-sourced products. In another preferred embodiment, the culturing methods are xeno-free. In even more preferred embodiments, one or more conditions or requirements for the commercial manufacture of human cell therapeutics met or exceeded by the culturing methods described herein.
  • the population of pluripotent cells can be further cultured in the presence of certain supplemental growth factors to obtain a population of cells that are or will develop into different cellular lineages, or can be selectively reversed in order to be able to develop into different cellular lineages.
  • supplemental growth factor is used in its broadest context and refers to a substance that is effective to promote the growth of a pluripotent cell, maintain the survival of a cell, stimulate the differentiation of a cell, and/or stimulate reversal of the differentiation of a cell.
  • a supplemental growth factor may be a substance that is secreted by a feeder cell into its media.
  • Such substances include, but are not limited to, cytokines, chemokines, small molecules, neutralizing antibodies, and proteins.
  • Growth factors may also include intercellular signaling polypeptides, which control the development and maintenance of cells as well as the form and function of tissues.
  • the supplemental growth factor is selected from the group consisting of steel cell factor (SCF), oncostatin M (OSM), ciliary neurotrophic factor (CNTF), Interleukin-6 (IL-6) in combination with soluble Interleukin-6 Receptor (IL-6R), a fibroblast growth factor (FGF), a bone morphogenetic protein (BMP), tumor necrosis factor (TNF), and granulocyte macrophage colony stimulating factor (GM-CSF).
  • SCF steel cell factor
  • OSM oncostatin M
  • CNTF ciliary neurotrophic factor
  • IL-6 Interleukin-6
  • IL-6R Interleukin-6
  • FGF fibroblast growth factor
  • BMP bone morphogenetic protein
  • the growth factors are removed from the cell culture or cell population subsequent to their addition.
  • the growth factor such as Activin A, Activin B, GDF-8, or GDF-1 1 can be added and removed within about one day, about two days, about three days, about four days, about five days, about six days, about seven days, about eight days, about nine days or about ten days after their addition.
  • the differentiation factors are not removed from the cell culture.
  • the differentiation procedures described herein can result in about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or greater than about 95% conversion of pluripotent cells, which includes induced pluripotent cells, to multipotent or differentiated cells e.g., definitive endoderm, foregut endoderm, PDXl-positive foregut endoderm, PDXl-positive pancreatic endoderm or PDX1/NKX6.1 co-positive pancreatic endoderm, endocrine precursor or NGN3/NKX2.2 co-positive endocrine precursor, and hormone secreting endocrine cells or INS, GCG, GHRL, SST,
  • a substantially pure preprimitive streak or mesendoderm cell population can be recovered.
  • Various cell compositions derived from pluripotent stem cells are described herein.
  • One embodiment includes iPS cells and cells derived therefrom.
  • Still other processes and compositions related to but distinct from the embodiments described herein can be found in United States Provisional Patent Application No. 60/532,004, entitled DEFINITIVE ENDODERM, filed December 23, 2003; U.S. Provisional Patent Application Number 60/566,293, entitled PDX1 EXPRESSING ENDODERM, filed April 27, 2004; U.S.
  • Patent Application Number 11/773,944 entitled METHODS OF PRODUCING PANCREATIC HORMONES, filed July 5, 2007; U.S. Patent Application Number 60/972, 174, entitled METHODS OF TREATMENT FOR DIABETES, filed September 13, 2007; U.S. Patent Application Number 1 1/860,494, entitled METHODS FOR INCREASING DEFINITIVE ENDODERM PRODUCTION, filed September
  • stage 1 (results in mostly definitive endoderm production), stage 2 (results in mostly PDX1 -negative foregut endoderm production), stage 3 (results in mostly PDX1 -positive foregut endoderm production), stage 4 (results in mostly pancreatic endoderm or pancreatic endocrine progenitor production) and stage 5 (results in mostly hormone expressing endocrine cell production.
  • trophectoderm refers to a multipotent cell having the relative high expression of markers selected from the group consisting of HAND1, Eomes, MASH2, ESXL1, HCG, KRT18, PSG3, SFXN5, DLX3, PSX1, ETS2, and ERRB genes as compared to the expression levels of HAND1, Eomes, MASH2, ESXL1, HCG, KRT18, PSG3, SFXN5, DLX3, PSX1, ETS2, and ERRB in non-trophectoderm cells or cell populations.
  • Extraembryonic endoderm refers to a multipotent cell having relative high expression levels of markers selected from the group consisting of SOX7, SOX 17, THBD, SPARC, DAB1, or AFP genes as compared to the expression levels of SOX7, SOX 17, THBD, SPARC, DAB 1, or AFP in non-extraembryonic endoderm cells or cell populations.
  • Preprimitive streak cells refers to a multipotent cell having relative high expression levels of the FGF8 and/or NODAL marker genes, as compared to BRACHURY low, FGF4 low, SNAI1 low, SOX 17 low, FOXA2 low, SOX7 low and SOX1 low.
  • Mesendoderm cell refers to a multipotent cell having relative high expression levels of brachyury, FGF4, SNAI1 MIXL1 and/or WNT3 marker genes, as compared to SOX 17 low, CXCR4 low, FOXA2 low, SOX7 low and SOX1 low.
  • DE Definitive endoderm
  • the definitive endoderm cells are mammalian cells, and in a preferred embodiment, the definitive endoderm cells are human cells.
  • definitive endoderm cells express or fail to significantly express certain markers. In some embodiments, one or more markers selected from SOX 17, CXCR4, MIXL1, GATA4, HNF3 , GSC, FGF17, VWF, CALCR, FOXQ1, CMKOR1 and CRIP l are expressed in definitive endoderm cells.
  • one or more markers selected from OCT4, alpha-fetoprotein (AFP), Thrombomodulin (TM), SPARC, SOX7 and HNF4alpha are not expressed or significantly expressed in definitive endoderm cells.
  • Definitive endoderm cell populations and methods of production thereof are also described in U.S. Application Number 11/021,618, entitled DEFINITIVE ENDODERM, filed December 23, 2004, which is hereby incorporated in its entirety.
  • Still other embodiments relate to cell cultures termed "PDXl -negative foregut endoderm cells” or “foregut endoderm cells” or equivalents thereof.
  • the foregut endoderm cells express SOX 17, HNF l (HNF1B), HNF4alpha (HNF4A) and FOXA1 markers but do not substantially express PDXl, AFP, SOX7, or SOX1.
  • PDXl -negative foregut endoderm cell populations and methods of production thereof are also described in U.S. Application Number 1 1/588,693, entitled PDXl -expressing dorsal and ventral foregut endoderm, filed October 27, 2006 which is incorporated herein by reference in its entirety.
  • PDXl-positive endoderm cells express one or more markers selected from Table 1 and/or one or more markers selected from Table 2, also described in related U.S. Application 1 1/588,693 entitled PDXl EXPRESSING DOSAL AND VENTRAL FOREGUT ENDODERM, filed October 27, 2006, and also U.S. Application Number 11/115,868, entitled PDXl -expressing endoderm, filed April 26, 2005, which are incorporated herein by reference in their entireties.
  • GABA gamma-aminobutyric acid
  • IL6R Hs.135087 3570 147880 AV700030 interleukin 6 receptor
  • L GAL S3 /// lectin, galactoside -binding, soluble, 3 (galectin 3) /// galectin-3 GALIG Hs.531081 3958/// 153619 BC001120 internal gene
  • CD47 Hs.446414 961 601028 BG230614 CD47 antigen Rh-related antigen, integrin-associated signal transducer
  • EPB41L1 Hs.437422 2036 602879 AA912711 erythrocyte membrane protein band 4.1 -like 1
  • prostaglandin 12 synthase /// prostaglandin 12 (prostacyclin)
  • the PDX1 -positive foregut endoderm cells are progenitors which can be used to produce fully differentiated pancreatic hormone secreting or endocrine cells, e.g., insulin-producing ⁇ -cells.
  • PDX1 -positive foregut endoderm cells are produced by differentiating definitive endoderm cells that do not substantially express PDX1 (PDX1- negative definitive endoderm cells; also referred to herein as definitive endoderm) so as to form PDX1 -positive foregut endoderm cells.
  • pancreatic endoderm As used herein, “pancreatic endoderm,” “pancreatic epithelial,” “pancreatic epithelium” (all can be abbreviated “PE”) "pancreatic progenitor,” “PDX-1 positive pancreatic endoderm or equivalents thereof, such as pancreatic endoderm cells (“PEC”), are all precursor or progenitor pancreatic cells.
  • PEC as described herein is a progenitor cell population after stage 4 differentiation (about day 12-14) and includes at least two major distinct populations: i) pancreatic progenitor cells that express NKX6.1 but do not express CHGA (or CHGA negative, CHGA-); and ii) polyhormonal endocrine cells that express CHGA (CHGA positive, CHGA+).
  • the cell population that expresses NKX6.1 but not CHGA is hypothesized to be the more active or therapeutic component of PEC, whereas the population of CHGA-positive polyhormonal endocrine cells is hypothesized to further differentiate and mature in vivo into glucagon-expressing islet cells.
  • CHGA-positive polyhormonal endocrine cells is hypothesized to further differentiate and mature in vivo into glucagon-expressing islet cells.
  • pancreatic endoderm cells are used without reference to PEC as described just above, but to refer to at least stages 3 and 4 type cells in general.
  • Pancreatic endoderm derived from pluripotent stem cells, and at least hES and MPS cells, in this manner are distinguished from other endodermal lineage cell types based on differential or high levels of expression of markers selected from PDX1, NKX6.1, PTFIA, CPAl, cMYC, NGN3, PAX4, ARX and NKX2.2 markers, but do not substantially express genes which are hallmark of pancreatic endocrine cells, for example, CHGA, INS, GCG, GHRL, SST, MAFA, PCSK1 and GLUT1.
  • some "endocrine progenitor cells” expressing NGN3 can differentiate into other non-pancreatic structures (e.g., duodenum).
  • the NGN3 expressing endocrine progenitor described herein differentiates into mature pancreatic lineage cells, e.g., pancreatic endocrine cells.
  • Pancreatic endoderm or endocrine progenitor cell populations and methods thereof are also described in U.S. Patent Application Number 11/773,944, entitled Methods of producing pancreatic hormones, filed July 5, 2007, and U.S.
  • Patent Application Number 12/107,020 entitled METHODS FOR PURIFYING ENDODERM AND PANCREATIC ENDODERM CELLS DERIVED FORM HUMAN EMBRYONIC STEM CELLS, filed April 21, 2008, the disclosures of which are incorporated herein by reference in their entireties.
  • endocrine precursor cell refers to a multipotent cell of the definitive endoderm lineage that expresses neurogenin 3 (NEUROG3) and which can further differentiate into cells of the endocrine system including, but not limited to, pancreatic islet hormone-expressing cells. Endocrine precursor cells cannot differentiate into as many different cell, tissue and/or organ types as compared to less specifically differentiated definitive endoderm lineage cells, such as PDX1 -positive pancreatic endoderm cell.
  • NEUROG3 neurogenin 3
  • pancreatic islet hormone-expressing cell As used herein, “pancreatic islet hormone-expressing cell,” “pancreatic endocrine cell,” or equivalents thereof refer to a cell, which has been derived from a pluripotent cell in vitro, which can be polyhormonal or singly-hormonal.
  • the endocrine cells can therefore express one or more pancreatic hormones, which have at least some of the functions of a human pancreatic islet cell.
  • Pancreatic islet hormone-expressing cells can be mature or immature. Immature pancreatic islet hormone-expressing cells can be distinguished from mature pancreatic islet hormone-expressing cells based on the differential expression of certain markers, or based on their functional capabilities, e.g., glucose responsiveness.
  • stem cell media culture or growth environments are envisioned in the embodiments described herein, including defined media, conditioned media, feeder-free media, serum-free media and the like.
  • growth environment or “milieu” or equivalents thereof is an environment in which undifferentiated or differentiated stem cells (e. g., primate embryonic stem cells) will proliferate in vitro.
  • undifferentiated or differentiated stem cells e. g., primate embryonic stem cells
  • features of the environment include the medium in which the cells are cultured, and a supporting structure (such as a substrate on a solid surface) if present.
  • cell aggregates in suspension described herein are "essentially or substantially homogenous", “essentially or substantially homo-cellular” or are comprised of "essentially hES cells”, “essentially or substantially definitive endoderm cells”, “essentially or substantially foregut endoderm cells”, “essentially or substantially PDX1 -negative foregut endoderm cells”, “essentially or substantially PDX1 -positive pre-pancreatic endoderm cells”, “essentially or substantially PDX1 -positive pancreatic endoderm or progenitor cells”, “essentially or substantially PDX1 -positive pancreatic endoderm tip cells", “essentially or substantially pancreatic endocrine precursor cells”, “essentially or substantially pancreatic endocrine cells” and the like.
  • the term "substantially free of means that the specified cell type of which the cell culture or cell population is free, is present in an amount of less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2% or less than about 1% of the total number of cells present in the cell culture or cell population.
  • Cell cultures can be grown in medium containing reduced serum or substantially free of serum or no serum.
  • serum concentrations can range from about 0% (v/v) to about 10% (v/v).
  • the serum concentration of the medium can be less than about 0.05% (v/v), less than about 0.1% (v/v), less than about 0.2% (v/v), less than about 0.3% (v/v), less than about 0.4% (v/v), less than about 0.5% (v/v), less than about 0.6% (v/v), less than about 0.7% (v/v), less than about 0.8% (v/v), less than about 0.9% (v/v), less than about 1% (v/v), less than about 2% (v/v), less than about 3% (v/v), less than about 4% (v/v), less than about 5% (v/v), less than about 6% (v/v), less than about 7% (v/v), less than about 8% (v/v), less than about 9% (v/v), less than about 1% (v/v
  • preprimitive streak cells are grown without serum or without serum replacement.
  • preprimitive streak cells are grown in the presence of B27.
  • the concentration of B27 supplement can range from about 0.1% (v/v) to about 20% (v/v).
  • immature pancreatic islet hormone-expressing cells are grown in the presence of B27.
  • concentration of B27 supplement can range from about 0.1% (v/v) to about 20% (v/v) or in concentrations greater than about 20% (v/v).
  • the concentration of B27 in the medium is about 0.1% (v/v), about 0.2% (v/v), about 0.3% (v/v), about 0.4% (v/v), about 0.5% (v/v), about 0.6% (v/v), about 0.7% (v/v), about 0.8% (v/v), about 0.9% (v/v), about 1% (v/v), about 2% (v/v), about 3% (v/v), about 4% (v/v), about 5% (v/v), about 6% (v/v), about 7% (v/v), about 8% (v/v), about 9% (v/v), about 10% (v/v), about 15% (v/v) or about 20% (v/v).
  • the concentration of the added B27 supplement can be measured in terms of multiples of the strength of a commercially available B27 stock solution.
  • B27 is available from Invitrogen (Carlsbad, CA) as a 50X stock solution. Addition of a sufficient amount of this stock solution to a sufficient volume of growth medium produces a medium supplemented with the desired amount of B27. For example, the addition of 10 ml of 50X B27 stock solution to 90 ml of growth medium would produce a growth medium supplemented with 5X B27.
  • the concentration of B27 supplement in the medium can be about 0.1X, about 0.2X, about 0.3X, about 0.4X, about 0.5X, about 0.6X, about 0.7X, about 0.8X, about 0.9X, about IX, about 1.1X, about 1.2X, about 1.3X, about 1.4X, about 1.5X, about 1.6X, about 1.7X, about 1.8X, about 1.9X, about 2X, about 2.5X, about 3X, about 3.5X, about 4X, about 4.5X, about 5X, about 6X, about 7X, about 8X, about 9X, about 10X, about 1 1X, about 12X, about 13X, about 14X, about 15X, about 16X, about 17X, about 18X, about 19X, about 20X and greater than about 20X.
  • exogenously added compounds such as growth factors, differentiation factors, and the like, in the context of cultures or conditioned media, refers to growth factors that are added to the cultures or media to supplement any compounds or growth factors that may already be present in the culture or media.
  • cells cultures and or cell populations do not include an exogenously-added retinoid.
  • retinoid refers to retinol, retinal or retinoic acid as well as derivatives of any of these compounds.
  • the retinoid is retinoic acid.
  • FGF family growth factor By “FGF family growth factor,” “a fibroblast growth factor” or “member of the fibroblast growth factor family” is meant an FGF selected from the group consisting of FGF1, FGF2, FGF3, FGF4, FGF5, FGF6, FGF7, FGF8, FGF9, FGF 10, FGF1 1, FGF 12, FGF13, FGF 14, FGF 15, FGF 16, FGF 17, FGF 18, FGF 19, FGF20, FGF21, FGF22 and FGF23.
  • FGF family growth factor means any growth factor having homology and/or function similar to a known member of the fibroblast growth factor family.
  • expression refers to the production of a material or substance as well as the level or amount of production of a material or substance.
  • determining the expression of a specific marker refers to detecting either the relative or absolute amount of the marker that is expressed or simply detecting the presence or absence of the marker.
  • marker refers to any molecule that can be observed or detected.
  • a marker can include, but is not limited to, a nucleic acid, such as a transcript of a specific gene, a polypeptide product of a gene, a non-gene product polypeptide, a glycoprotein, a carbohydrate, a glycolipid, a lipid, a lipoprotein or a small molecule (for example, molecules having a molecular weight of less than 10,000 amu).
  • the progression of pluripotent cells to various multipotent and/or differentiated cells can be monitored by determining the relative expression of genes, or gene markers, characteristic of a specific cell, as compared to the expression of a second or control gene, e.g., housekeeping genes.
  • the expression of certain markers is determined by detecting the presence or absence of the marker.
  • the expression of certain markers can be determined by measuring the level at which the marker is present in the cells of the cell culture or cell population.
  • the measurement of marker expression can be qualitative or quantitative.
  • One method of quantitating the expression of markers that are produced by marker genes is through the use of quantitative PCR (Q-PCR). Methods of performing Q-PCR are well known in the art. Other methods which are known in the art can also be used to quantitate marker gene expression.
  • the expression of a marker gene product can be detected by using antibodies specific for the marker gene product of interest.
  • the higher expression of the following genes are indicative of certain populations of cells, for example: SOX 17, SOX7, AFP or THBD are indicative of extraembryonic endoderm; NODAL and/or FGF8 are indicative of preprimitive streak; brachyury, FGF4, SNAI1 and/or WNT3 are indicative of mesendoderm; CER, GSC, CXCR4, SOX17 and FOXA2 are indicative of definitive endoderm cells; SOX17, FOXA2, FOXA1, HNF1B and HNF4A are indicative of foregut endoderm (or PDX1 -negative endoderm); PDX1, HNF6, SOX9 and PROX1 are indicative PDX1 -positive endoderm; PDX1, NKX6.1, PTFA1, CPA and cMYC are indicative of pancreatic epithelium (PE or pancreatic progenitor); NGN3, PAX4, ARX and NKX2.2 are indicate of endoc
  • FGF7 fibroblast growth factor 7
  • KGF keratinocyte growth factor
  • Embodiments described herein are not limited to any one type of iPS cell or any one method of producing the iPS cell. Embodiments are not limited or dependent on levels of efficiency of production of the iPS cells, because various methods exist. Embodiments described herein apply to differentiation of iPS cells into endoderm-lineage cells and uses thereof.
  • iPSCs induced pluripotent stem cells
  • methods for generating iPSCs include episomal vectors derived from the Epstein-Barr virus. See Yu, J. et al. Science 324, 797-801 (2009) and U.S. Application 20100003757to Mack, A. et al. published on January 7, 2010, which references are herein incorporated in their entireties. These methods require three separate plasmids carrying a combination of seven factors, including the oncogene SV40.
  • methods for generating iPSCs include protein-based iPSCs from mouse and human fetal and neonatal cells. See Zhou, H. et al. Cell Stem Cell 4, 381-384 (2009); and Kim, D. et al. Cell Stem Cell 4, 472 ⁇ 176 (2009), which are herein incorporated by reference in their entireties. These methodologies are accomplished using a chemical treatment (e.g. valproic acid in the case of Zhou et al. 2009 supra) or many rounds of treatment (Kim et al. 2009, supra).
  • minicircle vectors or plasmids which are supercoiled DNA molecules that lack a bacterial origin of replication and antibiotic resistance genes. See Chen, Z.-Y. et al, Mol. Ther. 8, 495-500 (2003); Chen, Z.-Y. et al., Hum. Gene Ther. 16, 126-131 (2005); and Jia, F. et al, Nature Methods Advance Publication Online 7 February 2010, which are herein incorporated by reference in their entireties. These methodologies generate iPSCs with higher transfection efficiencies and longer ectopic expression because they have lower activation of exogenous silencing mechanisms.
  • iPS cells can be generated from human patients with various diseases including, diabetic patients, ALS, spinal muscular dystrophy and Parkinson patients. See Maehr et al. PNAS USA 106(37): 15768-73 (2009); Dimos et al, Science, 321 : 1218-21 (2008); Ebert et al. Nature 457:277-80 (2009); Park et al. Cell 134:877-886 (2008); and Soldner et al, Cell 136:964-977, which are herein incorporated by reference in their entireties. At least one advantage of producing hIPS cells from patients with specific diseases is that the cell derived would contain the genotype and cellular responses of the human disease.
  • Table 3 listing at least some existing human iPS cell lines. This information was derived from the literature and publically available databases including for example the National Institutes of Health (NIH) Stem Cell Registry, the Human Embryonic Stem Cell Registry and the International Stem Cell Registry located at the University of Massachusetts Medical School, Worcester, Massachusetts, USA. These databases are periodically updated as cell lines become available and registration obtained.
  • NASH National Institutes of Health
  • compositions and methods described herein contemplate the use of various differentiable primate pluripotent stem cells including human pluripotent stem cells such as hESC, including but not limited to, CyT49, CyT212, CyT203, CyT25, (commercially available at least at the time of filing of this instant application from ViaCyte Inc.
  • iPS induced pluripotent stem cells
  • iPSC-482c7 and iPSC-603 Cellular Dynamics International, Inc., Madison, Wisconsin
  • G4 iPSC-G4
  • B7 iPSC-B7
  • NIH National Institutes of Health
  • NIH National Institutes of Health
  • BGOl and BGOlv are sold and distributed to third parties by WiCell ® , an affiliate of the Wisconsin International Stem Cell (WISC) Bank (Catalog name, BG01) and ATCC (Catalog No. SCRC-2002), respectively.
  • WISC Wisconsin International Stem Cell
  • While other cell lines described herein may not be registered or distributed by a biological repository, such as WiCell ® or ATCC, such cell lines are available to the public directly or indirectly from the principle investigators, laboratories and / or institutions. Public requests for cell lines and reagents, for example, are customary for those skilled in the art in the life sciences. Typically, transfer of these cells or materials is by way of a standard material transfer agreement between the proprietor of the cell line or material and the recipient. These types of material transfers occur frequently in a research environment, particularly in the life sciences.
  • Applicant has routinely transferred cells since the time they were derived and characterized, including CyT49 (2006), CyT203 (2005), Cyt212 (2009), CyT25 (2002), BG01 (2001), BG02 (2001), BG03 (2001) and BGOlv (2004), through such agreements with commercial and non-profit industry partners and collaborators.
  • the year in parenthesis next to each cell line in the previous list indicates the year when the cell lines or materials became publically available and immortal (e.g. cell banks were made) and thus destruction of another embryo has not been performed or required since the establishment of these cell lines in order to make the compositions and practice the methods described herein.
  • hESC can be derived from single blastomeres, hence keeping the embryo intact and not causing their destruction.
  • Biopsies were performed from each embryo using micromanipulation techniques and nineteen (19) ES-cell-like outgrowths and two (2) stable hESC lines were obtained. These hESC lines were able to be maintained in an undifferentiated state for over six (6) months, and showed normal karyotype and expression of markers of pluripotency, including Oct-4, SSEA-3, SSEA-4, TRA-1-60, TRA- 1-81, Nanog and Alkaline Phosphatase.
  • hESC can differentiate and form derivatives of all three (3) embryonic germ layers both in vitro and form in teratomas in vivo.
  • These methods to create new stem cell lines without destruction of embryos addresses the ethical concerns of using human embryos. See Klimanskaya et al. (2006) Nature 444:481-5, Epub 2006 Aug 23, the disclosure of which is incorporated herein by reference in its entirety. However, Klimanskaya et al. co-cultured the derived hESC line with other hESC. Later, in 2008, Chung Y. et al., were able to obtain hES cell lines again from a single blastomere but without co-culture with hESC. See Chung Y.
  • compositions and methods described herein, and in particular, the such compositions and methods as related to induced pluripotent stem cells or genetically dedifferentiated pluripotent stem cells do not require the destruction of a human embryo.
  • Tables 3 and 4 are non-exhaustive lists of certain iPSC and hESCs, respectively, which are available worldwide for research and/or commercial purposes, and are suitable for use in the methods and compositions of the present invention.
  • Tables 3 and 4 were derived from the literature and publically available databases including, for example, the National Institutes of Health (NIH) Human Stem Cell Registry, the Human Embryonic Stem Cell Registry and the International Stem Cell Registry located at the University of Massachusetts Medical School, Worcester, Massachusetts, USA. These databases are periodically updated as cell lines become available and registration obtained.
  • NASH National Institutes of Health
  • Human iPSC described herein (at least iPSC-603 and iPSC-482-c7) were provided by Cellular Dynamics International, Inc. (Madison, Wisconsin, USA).
  • IPS-SMA-3.5 Normal; 46XY; Type 1 Spinal Muscular Atrophy; Ebert, A. D., et al. 2009. Induced pluripotent stem cells from a spinal
  • IPS-WT Normal; 46XX; Type 1 Spinal Muscular Atrophy; Ebert, A. D., et al. 2009. Induced pluripotent stem cells from a spinal muscular atrophy patient Nature. 457:277-80
  • IPS-1 (Karumbayaram, S. et al. 2009. Directed Differentiation of California, Los Human-Induced Pluripotent Stem Cells Generates Active Motor Angeles (USA) NeuronsStem Cells. 27:806-811; Lowry, W. E., et al. 2008. Generation of human induced pluripotent stem cells from dermal fibroblasts Proc Natl Acad Sci U S A. 105:2883-8 )
  • IPS-2 (Karumbayaram, S. et al. 2009. Directed Differentiation of Human-Induced Pluripotent Stem Cells Generates Active Motor NeuronsStem Cells. 27:806-811; Lowry, W. E., et al. 2008. Generation of human induced pluripotent stem cells from dermal fibroblastsProc Natl Acad Sci U S A. 105:2883-8 )
  • IPS-7 Lowry, W. E., et al. 2008. Generation of human induced pluripotent stem cells from dermal fibroblasts Proc Natl Acad Sci U S A. 105:2883-8)
  • IPS-18 (Karumbayaram, S. et al. 2009. Directed Differentiation of Human-Induced Pluripotent Stem Cells Generates Active Motor NeuronsStem Cells. 27:806-811; Lowry, W. E., et al. 2008. Generation of human induced pluripotent stem cells from dermal fibroblastsProc Natl Acad Sci U S A. 105:2883-8 )
  • ADA-IPS2 ((ADA-SCID) Adenosine Deaminase Deficiency-related Severe Combined Immunodeficiency (GGG>AGG, exon 7, ADA gene); Park, I. H. et al. 2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):877-86)
  • ADA-IPS3 ((ADA-SCID) Adenosine Deaminase Deficiency-related Severe Combined Immunodeficiency (GGG>AGG, exon 7, ADA gene); Park, I. H. et al. 2008. Disease-Specific Induced Pluripotent Stem Cells Cel 1134(5):877-86)
  • BMD-IPS1 Becker Muscular Dystrophy (Unidentified mutation in dystrophin); Park, I. H. et al. 2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):877-86)
  • BMD-IPS4 Normal; 46XY; (BMD) Becker Muscular Dystrophy (Unidentified mutation in dystrophin); Park, I. H. et al. 2008. Disease- Specific Induced Pluripotent Stem Cells Cell 134(5):877-86)
  • DH1CF16-IPS1 Normal; 46XY; Park, I. H. et al. 2008. Disease- Specific Induced Pluripotent Stem Cells Cell 134(5):877-86)
  • DH1CF32-IPS2 (Male; Park, I. H. et al. 2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):877-86)
  • DMD-IPS1 (Normal; 46XY; DMD) Duchenne Muscular Dystrophy (Deletion of exon 45-52, dystrophin gene; Park, I. H. et al. 2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):877-86)
  • DMD-IPS2 Muscular Dystrophy (Deletion of exon 45-52, dystrophin gene; Park, I. H. et al. 2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):877-86)
  • GD-IPSl(Male; (GD) Gaucher Disease type III AAC > AGC, exon 9, G-insertion, nucleotide 84 of cDNA, GBA gene; Park, I. H. et al. 2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):877-86)
  • GD-IPS3 (Male; (GD) Gaucher Disease type III (AAC > AGC, exon 9, G-insertion, nucleotide 84 of cDNA, GBA gene; Park, I. H. et al. 2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):877-86)
  • JDM-IPS2 Male; Juvenile diabetes mellitus (multifactorial); Park, I. H. et al. 2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):877-86)
  • LNSC-IPS2 Male; Lesch-Nyhan syndrome (carrier, heterozygosity of HPRT1; Park, I. H. et al. 2008. Disease-Specific Induced Pluripotent Stem Cells Cell 134(5):877-86)
  • A29b (46XX; (ALS) Amyotrophic Lateral Sclerosis (L144F [Leul44 > Phe] dominant allele of the superoxide dismutase (SOD1) gene; Caucasian; Dimos, J. T., et al. 2008. Induced pluripotent stem cells generated from patients with ALS can be differentiated into motor neurons Science. 321 : 1218-21)
  • A29c 46XX; (ALS) Amyotrophic Lateral Sclerosis (L144F [Leul44 > Phe] dominant allele of the superoxide dismutase (SOD1) gene; Caucasian; Dimos, J. T., et al. 2008. Induced pluripotent stem cells generated from patients with ALS can be differentiated into motor neurons Science 321 : 1218-21)
  • HAIR-IPS 1 (Aasen, T., et al [Belmonte, J. C] 2008. Efficient and rapid generation of induced pluripotent stem cells from human keratinocytes Nat Biotechnol 26: 1276-84)
  • HAIR-IP S2 (Aasen, T., et al [Belmonte, J. C] 2008. Efficient and rapid generation of induced pluripotent stem cells from human keratinocytes Nat Biotechnol 26: 1276-84)
  • FHC. l .H.iPSC.3 OCT4, Sox2, KLF4, c-Myc; Human fibroblasts
  • TYR.l .H.iPSC.l OCT4, Sox2, LF4, c-Myc; Human fibroblasts
  • HER.l .H.iPSC.l OCT4, Sox2, LF4, c-Myc; Human fibroblasts
  • KiPS4F-l OCT4, Sox2, KLF4, c-Myc; human foreskin keratinocytes; Medicine in Barcelona 46XY
  • KiPS3F-7 OCT4, Sox2, LF4; human foreskin keratinocytes
  • iPS4F-8 OCT4, Sox2, KLF4, c-Myc human foreskin keratinocytes
  • PB04 (Oct4, Sox2, Lin28, Nanog; Primary Amniocytes; B-Thalassemia affected; 46XY; Lentivirus)
  • PB05-1 (Oct4, Sox2, Lin28, Nanog; Primary Amniocytes; B- Thalassemia affected; 46XY; Lentivirus)
  • PB05 (Oct4, Sox2, Lin28, Nanog; Primary Amniocytes; B-Thalassemia affected; 46XY; Lentivirus)
  • PB06 (Oct4, Sox2, Lin28, Nanog; Primary Amniocytes; Down
  • PB06-1 (Oct4, Sox2, Lin28, Nanog; Primary Amniocytes; Down Syndrome; 47XY, +21 ; Lentivirus)
  • PB07 OCT4, Sox2, KLF4, c-Myc; Primary Amniocytes; 46XY; Retrotivirus
  • PB08 OCT4, Sox2, KLF4, c-Myc; Primary Amniocytes; 46XY; Retrotivirus
  • PB09 (Oct4, Sox2, Lin28, Nanog; Primary Amniocytes; 46XY;
  • pluripotent stem cells from adult human fibroblasts by defined factors Cell. 131 :861-72)
  • pluripotent stem cells from adult human fibroblasts by defined factors Cell. 131 :861-72)
  • pluripotent stem cells from adult human fibroblasts by defined factors Cell. 131 :861-72)
  • pluripotent stem cells from adult human fibroblasts by defined factors Cell. 131 :861-72)
  • pluripotent stem cells from adult human fibroblasts by defined factors Cell. 131 :861-72)
  • pluripotent stem cells from adult human fibroblasts by defined factors Cell. 131 :861-72)
  • pluripotent stem cells from adult human fibroblasts by defined factors Cell. 131 :861-72)
  • hIPS cells would be an immunologically matched autologous cell population; and patient-specific cells would allow for studying origin and progression of the disease. Thus, it is possible to understand the root causes of a disease, which can provide insights leading to development of prophylactic and therapeutic treatments for the disease.
  • Some embodiments are directed to methods for deriving definitive endoderm cells and ultimately any endoderm-lineage derived cell type, including but not limited to, foregut endoderm, pancreatic endoderm, endocrine precursor cells and/or pancreatic islet hormone- expressing cells using human embryonic stem (hES) cells as the starting material.
  • hES cells can be cells that originate from the morula, embryonic inner cell mass or those obtained from embryonic gonadal ridges.
  • Human embryonic stem cells can be maintained in culture in a pluripotent state without substantial differentiation using methods that are known in the art. Such methods are described, for example, in US Patent Nos. 5,453,357, 5,670,372, 5,690,926 5,843,780, 6,200,806 and 6,251,671 the disclosures of which are incorporated herein by reference in their entireties.
  • pluripotent stem cells e.g. hES cells
  • any feeder layer which allows pluripotent cell to be maintained in a pluripotent state can be used.
  • One commonly used feeder layer for the cultivation of human embryonic stem cells is a layer of mouse fibroblasts. More recently, human fibroblast feeder layers have been developed for use in the cultivation of pluripotent cell (see US Patent Application Publication No. 2002/00721 17, the disclosure of which is incorporated herein by reference in its entirety).
  • Alternative processes permit the maintenance of pluripotent cells without the use of a feeder layer. Methods of maintaining pluripotent cells under feeder-free conditions have been described in US Patent Application Publication No. 2003/0175956, the disclosure of which is incorporated herein by reference in its entirety.
  • the pluripotent cells described herein can be maintained in culture either with or without serum, with or without extracellular matrix, with or without FGF. In some pluripotent cell maintenance procedures, serum replacement is used.
  • HUES7, HUES8, HUES9, HUES10 HUESl 1, HUES 12, HUES13, HUES14, HUES15, HUES 16, HUES 17, HUES 18, HUES 19, HUES20, HUES21, HUES22, HUES23, HUES24, HUES25, HUES26, HUES27; HUES28; HUES48; HUES49; HUES53; HUES55 & HUES 56
  • NYUESl New York University School of Medicine NYUESl ; NYUES2; NYUES3; NYUES4; NYUES5; (USA) NYUES6 & NYUES7
  • RG-233 HEMOGLOBIN B LOCUS (HBB), affected (HbS/HbS - sickle cell anemia), 46,XX;
  • RG-288 CYSTIC FIBROSIS (CF), affected (deltaF508/deltaF508), 46,XY;
  • RG-316 TUBEROUS SCLEROSIS, TYPE 1(TSC1), affected (N/IVS7+1 G-A);
  • RG-316 TUBEROUS SCLEROSIS, TYPE 1(TSC1), affected (N/IVS7+1 G-A);
  • RG-320 TUBEROUS SCLEROSIS, TYPE 1(TSC1), affected (N/IVS7+1 G-A);
  • RG-356 HEMOGLOBIN ALPHA LOCUS (HBA), affected (-alpha /-), 46,XX; RG-357; EMERY-DREIFUSS MUSCULAR
  • RG-414 MULTIPLE ENDOCRINE NEOPLASIA, TYPE I ( MEN1), affected (N/3036 4bp del);
  • RG-416 CYSTIC FIBROSIS (CF), affected (deltaF508/1717-l G-A);
  • RG-417 CYSTIC FIBROSIS (CF), affected (deltaF508/1717-l G-A);
  • RG-418 HEMOGLOBIN B LOCUS (HBB), affected (cd8+G /619del);
  • RG-420 HEMOGLOBIN B LOCUS (HBB), affected (cd8+G/619del);
  • RG-424 MULTIPLE ENDOCRINE NEOPLASIA, TYPE 2 (MEN2B), affected (M918T/N);
  • RG-428 TUBEROUS SCLEROSIS, TYPE 1 (TSCl), affected (N/IVS7+1 G-A);
  • HAD 1 HAD 2; HAD 3; HAD 4; HAD 5; HAD 6
  • SIVF11 SIVF11 ; SIVF12; SIVF13
  • ES Cell International Pte Ld ES01, ES02, ES03, ES04, ES05, ES06 HES-1, HES-2, HES-3, HES-4, (Singapore) HES-5, HES-6
  • FCNCBS1 FCNCBS2; FCNCBS3
  • pluripotent stem cells or pluripotent-like stem cells are also called induced pluripotent stem (iPS) cells.
  • iPS induced pluripotent stem
  • the present invention describes various iPS cell lines provided by Shinya Yamanaka, Kyoto University. However, other iPS cell lines, for example, those described by James Thomson et al. Al. are by the invention herein. See U.S. Publication 20090047263, International Publication WO2005/80598, U.S. Publication 20080233610 and International Publication WO2008/11882, which are herein incorporated in their entirety by reference.
  • induced pluripotent stem (iPS) cells means cells having properties similar to other pluripotent stem cells, e.g., hES cells, hEG cells, pPS (primate pluripotent stem) cells, parthenogenic cells and the like.
  • Nuclear programming factors are described in U.S. Publication 20090047263, International Publication WO2005/80598, U.S. Publication 20080233610 and International Publication WO2008/1 1882 and were used to induce reprogramming of a differentiated cell without using eggs, embryos, or ES cells.
  • Methods for preparing induced iPS cells from somatic cells by using the nuclear reprogramming factor similar to that used and described in the present invention are not particularly limited.
  • the nuclear reprogramming factor contacts the somatic cells under an environment in which the somatic cells and induced pluripotent stem cells can proliferate.
  • an induced pluripotent stem cell can be prepared by contacting a nuclear reprogramming factor with a somatic cell in the absence of eggs, embryos, or embryonic stem (ES) cells.
  • ES embryonic stem
  • Pluripotent stem cells described herein may express any number of pluripotent cell markers, including but not limited to: alkaline phosphatase (AP); ABCG2; stage specific embryonic antigen-1 (SSEA-1); SSEA-3; SSEA-4; TRA-1-60; TRA-1-81 ; Tra-2-49/6E; ERas/ECAT5, E-cadherin; . ⁇ . ⁇ -tubulin; .alpha.-smooth muscle actin (.alpha.-SMA); fibroblast growth factor 4 (Fgf4), Cripto, Daxl ; zinc finger protein 296 (Zfp296); N-acetyltransferase-1 (Natl); (ES cell associated transcript 1 (ECAT1); ES G 1 /DPP A5/ECAT2 ; ECAT3; ECAT6; ECAT7; ECAT8; ECAT9; ECAT10; ECAT15-1; ECAT15-2
  • ECAT15-2 alkaline phosphatase
  • markers such as cell surface markers, antigens, and other gene products including ESTs, RNA (including microR As and antisense R A), DNA (including genes and cDNAs), and portions thereof.
  • the iPS cell lines used herein contain the following nuclear reprogramming factor genes: an Oct family gene, a Klf family gene, and a Sox family gene.
  • an Oct family gene In one iPS cell line, each of the following three kinds of genes are provided: Oct3/4, Klf4, and Sox2.
  • Other iPS cell lines gene products of each of the following three kinds of genes were employed: an Oct family gene, a Klf family gene, and a Myc family gene, e.g., Oct3/4, Klf4 and c-Myc. Accordingly, it is understood that the nuclear reprogramming factor can be with or without the Myc family gene.
  • the nuclear reprogramming factors described herein and also known in the art can be used to generate iPS cells from differentiated adult somatic cells, and is not limited by the type of somatic cells to be reprogrammed, i.e., any kind of somatic cell may be reprogrammed or dedifferentiated. Because reprogramming a somatic does not require an egg and/or embryo, an iPS cell can be a mammalian cell, therefore, providing an opportunity to generate patient- or disease-specific pluripotent stem cells.
  • embodiments described herein can use cell aggregate suspensions formed from pluripotent stem cell, single cell suspensions or differentiated single cell suspensions derived therefrom. Methods of processing and/or manufacturing of stem cell aggregate suspension and differentiation of cells thereof is described in International Applications PCT/US2007/062755 and PCT/US2008/082356, which are herein incorporated by reference in their entireties.
  • pluripotent stem cell aggregate suspensions from a single cell suspension of pluripotent stem cell cultures, e.g. hES or iPS cell cultures.
  • the pluripotent stem cell can be initially cultured on fibroblast feeders or can be feeder-free. Methods of isolating hES cells and culturing such on human feeder cells is described in U.S. Patent No. 7,432, 104, which is herein incorporated in its entirety by reference.
  • single cell suspension or equivalents thereof refers to a pluripotent, multipotent or terminally differentiated single cell suspension, or a single cell suspension derived from a pluripotent or multipotent cell, by any mechanical or chemical means.
  • a differentiation media e.g., a differentiating media containing an agent, preferably a ⁇ family member, which is capable of activating a ⁇ family of receptor, e.g., Activin A, Activin B, GDF-8, GDF-1 1, and Nodal.
  • an agent preferably a ⁇ family member, which is capable of activating a ⁇ family of receptor, e.g., Activin A, Activin B, GDF-8, GDF-1 1, and Nodal.
  • Activin A Activin A
  • Activin B Activin B
  • GDF-8 GDF-1 1 1 1
  • Nodal Nodal growth factors for production of endoderm is described in International Application No., PCT/US2008/065686, which is herein incorporated by reference in its entirety.
  • Methods of producing cell aggregate suspension in a differentiation media can be distinguished from other methods, also described herein, which provide for production of cell aggregate suspension cultures in a pluripotent stem cell media, e.g., StemPro® hES SFM (Invitrogen) based on the heregulin-based DC-HAIF media described in PCT/US2007/062755.
  • a pluripotent stem cell media e.g., StemPro® hES SFM (Invitrogen) based on the heregulin-based DC-HAIF media described in PCT/US2007/062755.
  • Embodiments described herein relate to methods for generating a pluripotent cell aggregate in suspension from a pluripotent adherent culture, by culturing a pluripotent cell in an adherent growth culture condition which allows for expansion in an undifferentiated state; disassociating the adherent pluripotent cell culture into a single cell suspension culture; contacting the single cell suspension culture with a first differentiating culture condition which allows for formation of hES-derived cell aggregates in suspension by agitating the single cell suspension culture until such a period of time when the single cell suspension culture forms a pluripotent -derived cell aggregate in suspension, and thereby generating a pluripotent -derived cell aggregate in suspension.
  • agitation of the single cell suspension culture is performed by rotation at about 80 rpm to 160 rpm.
  • a rho-kinase inhibitor is used to facilitate pluripotent stem cell aggregation, growth, proliferation, expansion and/or cell mass.
  • Embodiments described herein also relate to methods for generating a pluripotent -derived cell aggregate in suspension from a pluripotent -derived single cell suspension, by culturing a hES cell in an adherent growth culture condition which allows for expansion in an undifferentiated state; contacting the undifferentiated hES cell with a first differentiating culturing condition suitable for differentiating the hES cell and resulting in an adherent pluripotent-derived cell; disassociating the adherent hES-derived cell into a single cell suspension culture; contacting the single cell suspension culture with a second differentiating culture condition which allows for formation of hES-derived cell aggregates in suspension by agitating the single cell suspension culture until such a period of time when the single cell suspension culture forms a pluripotent -derived cell aggregate in suspension, and thereby generating a pluripotent -derived cell aggregate in suspension.
  • agitation of the single cell suspension culture is performed by rotation at about
  • manufacturing-scale suspension cultures utilize continuous perfusion of media as a method for maintaining cell viability while maximizing cell density.
  • media exchange contributes fluid shear to the culture affecting adherent cells and suspended aggregates differently.
  • Immobile adherent cells are subject to fluid shear stress as the media flows tangentially across the cell surface.
  • suspended aggregates experience significantly less shear stress across the aggregate surface, as aggregates are free to tumble in response to applied shear force. It is expected that prolonged shear stress will be detrimental to adherent pluripotent cells and that the suspended aggregate format is preferred for optimal survival and function.
  • embodiments described herein provide, for the first time, methods of manufacturing for the production of pluripotent stem cells and/or multipotent progenitor cells derived from pluripotent stem cells in suspension format, in particular, cell aggregate suspension format.
  • hES cell aggregate suspensions were cultured in a media substantially free of serum and further in the absence of exogenously added fibroblast growth factor (FGF).
  • FGF fibroblast growth factor
  • U.S. Patent No. 7,005,252 to Thomson, J. which requires culturing hES cells in a media without serum but containing exogenously added growth factors, including FGF.
  • iPS cell aggregate suspensions are cultured in a media substantially free of serum and / or further in the absence of exogenously added fibroblast growth factor (FGF).
  • the cell aggregates and methods described herein have a narrow size and shape distribution, i.e., the cell aggregates are substantially uniform in size and/or shape.
  • the size uniformity of the cell aggregates is critical for differentiation performance and the culture homogeneity. Applying basic mass transport analysis to the aggregates, it is expected that diffusion of oxygen and nutrients into the center of large aggregates will be slow compared to diffusion into smaller aggregates, assuming equal permeability.
  • the phrase “substantially uniform” or “substantially uniform in size and shape” or equivalents thereof, refers to the spread in uniformity of the aggregates and is not more than about 20%. In another embodiment, the spread in uniformity of the aggregates is not more than about 15%, 10% or 5%.
  • Cell aggregates may comprise a minimal number of cells (e.g., two or three cells) per aggregate, or may comprise many hundreds or thousands of cells per aggregate. Typically, cell aggregates comprise hundreds to thousands of cells per aggregate.
  • the cell aggregates are typically from about 50 microns to about 600 microns in size, although, depending on cell type, the size may be less or greater than this range. In one embodiment, the cell aggregates are from about 50 microns to about 250 microns in size, or about 75 to 200 microns in size, and preferably they are about 100 to 150 microns in size.
  • embryoid bodies As used herein, the term “embryoid bodies”, “aggregate bodies” or equivalents thereof, refer to aggregates of differentiated and undifferentiated cells that appear when ES cells overgrow in monolayer cultures, or are maintained in suspension cultures in undefined media or are differentiated via non-directed protocols towards multiple germ layer tissues. That is, EBs are not formed from a single cell suspension of pluripotent stem cells as described herein; nor are EBs formed from adherent cultures of pluripotent-derived multipotent cells. These features alone make the present invention clearly distinguished from an embryoid body.
  • the cell aggregates described herein are essentially or substantially homo- cellular, existing as aggregates of pluripotent, multipotent, bipotent, or unipotent type cells, e.g., embryonic cells, definitive endoderm, foregut endoderm, PDX1 positive pancreatic endoderm, pancreatic endocrine cells and the like.
  • Embodiments described herein address the above problems by providing a cost efficient manufacturing process or methods capable of reproducibly producing cell aggregates that are substantially uniform in size and shape using a process that can easily be applied to large-scale manufacturing.
  • the differentiable cells are expanded in a suspension culture, using the cell media of the present invention.
  • the differentiable cells can be maintained and expanded in suspension, i.e., they remain undifferentiated or are prevented from further differentiating.
  • expand in the context of cell culture is used as it is in the art, and refers to cellular proliferation and increase the number of cells, preferably increase in number of viable cells.
  • the cells are expanded in a culture suspension by culturing for more than about one day, i.e., about 24 hours. In a more specific embodiment, the cells are expanded in a suspension culture by culturing for at least 1, 2, 3, 4, 5, 6, 7 days, or at least 2, 3, 4, 5, 6, 7, 8 weeks.
  • Still other embodiments of the invention provide for methods of producing cell aggregate suspensions formed from differentiated pluripotent stem cell cultures e.g., cells produced from the pluripotent cells described herein, and including cells from stages 1, 2, 3, 4 and 5 as described in d'Amour 2005 and 2006, supra.
  • methods for making the cell aggregates described herein are not limited to any one pluripotent or multipotent cell or cell stage, rather the manner of use and need for cell type optimization will dictate which methods are preferred.
  • pluripotent cells e.g., hES or iPS cells
  • cells derived from other pluripotent cell sources for example, embryonic germ or parthenote cells
  • PCT/US2007/062755 filed February 23, 2007, and titled Compositions and methods for culturing differential cells and PCT/US2008/080516, filed October 20, 2008, and titled Methods and compositions for feeder-free pluripotent stem cell media containing human serum, which are herein incorporated by reference in their entireties.
  • the methods described herein in no way require first coating the culturing vessels with an extracellular matrix, e.g., as described in U.S.
  • iPS cells can be cultured in the same way that other pluripotent stem cells, e.g., hES and iPS cells, are cultured using soluble human serum as substantially described in U.S. Application, PCT/US2008/080516, filed October 20, 2008, and titled Methods and compositions for feeder-free pluripotent stem cell media containing human serum, which is herein incorporated by reference in its entirety.
  • FGF fibroblast growth factor
  • Cell compositions produced by the methods described herein include cell cultures comprising pluripotent stem cells, preprimitive streak, mesendoderm, definitive endoderm, foregut endoderm, PDXl-postiive foregut endoderm, PDX1 -positive pancreatic endoderm or PDX1/NKX6.1 co-positive pancreatic endoderm, endocrine precursor or NGN3/NKX2.2 co-positive endocrine precursor, and hormone secreting endocrine cells or INS, GCG, GHRL, SST, PP singly -positive endocrine cells, wherein at least about 5-90% of the cells in culture are the preprimitive streak, mesendoderm, definitive endoderm, foregut endoderm, PDXl-postiive foregut endoderm, PDXl-positive pancreatic endoderm or PDX1/NKX6.1 co- positive pancreatic endoderm, endocrine precursor or NGN3/NKX2.2 co-positive endoc
  • compositions such as cell populations and cell cultures that comprise both pluripotent cells, such as stem cells and iPS cells, and multipotent cells, such as preprimitive streak, mesendoderm or definitive endoderm, as well as more differentiated, but still potentially multipotent, cells, such as PDXl-postiive foregut endoderm, PDXl-positive pancreatic endoderm or PDX1/NKX6.1 co-positive pancreatic endoderm, endocrine precursor or NGN3/NKX2.2 co-positive endocrine precursor, and hormone secreting endocrine cells or INS, GCG, GHRL, SST, PP singly-positive endocrine cells.
  • pluripotent cells such as stem cells and iPS cells
  • multipotent cells such as preprimitive streak, mesendoderm or definitive endoderm, as well as more differentiated, but still potentially multipotent, cells, such as PDXl-postiive foregut endoderm, PDXl-positive pancre
  • compositions comprising mixtures of pluripotent stem cells and other multipotent or differentiated cells can be produced.
  • compositions comprising at least about 5 multipotent or differentiated cells for about every 95 pluripotent cells are produced.
  • compositions comprising at least about 95 multipotent or differentiated cells for about every 5 pluripotent cells are produced.
  • compositions comprising other ratios of multipotent or differentiated cells to pluripotent cells are contemplated.
  • compositions comprising at least about 1 multipotent or differentiated cell for about every 1,000,000 pluripotent cells, at least about 1 multipotent or differentiated cell for about every 100,000 pluripotent cells, at least about 1 multipotent or differentiated cell for about every 10,000 pluripotent cells, at least about 1 multipotent or differentiated cell for about every 1000 pluripotent cells, at least about 1 multipotent or differentiated cell for about every 500 pluripotent cells, at least about 1 multipotent or differentiated cell for about every 100 pluripotent cells, at least about 1 multipotent or differentiated cell for about every 10 pluripotent cells, at least about 1 multipotent or differentiated cell for about every 5 pluripotent cells, and up to about every 1 pluripotent cell and at least about 1,000,000 multipotent or differentiated cell for about every 1 pluripotent cell are contemplated.
  • cell cultures or cell populations comprising from at least about 5% multipotent or differentiated cell to at least about 99% multipotent or differentiated cells.
  • the cell cultures or cell populations comprise mammalian cells.
  • the cell cultures or cell populations comprise human cells.
  • certain specific embodiments relate to cell cultures comprising human cells, wherein from at least about 5% to at least about 99% of the human cells are multipotent or differentiated cell.
  • cell cultures comprising human cells, wherein at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or greater than 99% of the human cells are multipotent or differentiated cells.
  • the above percentages are calculated without respect to the human feeder cells in the cell cultures
  • Pluripotent, multipotent or differentiated cells are capable of differentiating, or further differentiating, into preprimitive streak, mesendoderm, definitive endoderm cells as well as cells, tissues and/or organs derived therefrom.
  • Mesendoderm cells are capable of differentiating into mesoderm cells and/or definitive endoderm cells as well as cells, tissues and/or organs derived from either of these lineages.
  • the preprimitive streak cells are converted, through a mesendoderm intermediate, into terminally differentiated cells of either the mesoderm or definitive endoderm lineages.
  • Such processes can provide the basis for efficient production of human endodermal derived tissues, such as pancreas, liver, lungs, stomach, intestine, thyroid, parathyroid, thymus, pharynx, gallbladder and urinary bladder.
  • production of preprimitive streak cells and/or mesendoderm cells is an early step in differentiation of a pluripotent stem cell to a functional insulin-producing ⁇ -cell.
  • preprimitive streak cell and/or mesendoderm cell differentiation can provide the basis for efficient production of human mesodermal derived tissues, such as blood cells, cardiovascular tissues, skeletal tissues as well as other structural and connective tissues.
  • compositions and methods described herein have several useful features.
  • the cell cultures and cell populations comprising, multipotent cells, e.g., preprimitive streak cells and/or mesendoderm cells as well as the methods for producing such cell cultures and cell populations, are useful for modeling the early stages of human development.
  • the compositions and methods described herein can also serve for therapeutic intervention in disease states, such as diabetes mellitus.
  • preprimitive streak cells and/or mesendoderm cells serve as the source for only a limited number of tissues, they can be used in the development of pure tissue or cell types.
  • the pluripotent cells used as starting material are pluripotent stem cells, e.g., hES, hEG or iPS cells.
  • compositions comprising trophectoderm cells substantially free of other cell types can be produced.
  • the trophectoderm cell populations or cell cultures produced by the methods described herein substantially have high expression of markers selected from the group consisting of HAND1, Eomes, MASH2, ESXL1, HCG, KRT18, PSG3, SFXN5, DLX3, PSX1, ETS2, and ERRB genes as compared to the expression levels of HAND1, Eomes, MASH2, ESXL1, HCG, KRT18, PSG3, SFX 5, DLX3, PSX1, ETS2, and ERRB in non-trophectoderm cells or cell populations.
  • compositions comprising preprimitive streak cells substantially free of other cell types can be produced.
  • the preprimitive streak cell populations or cell cultures produced by the methods described herein are substantially express FGF8 and/or NODAL marker genes as compared to BRACHURYlow, FGF4 low, SNAIl low, SOX 17 low, FOXA2 low, SOX7 low and SOX1 low.
  • compositions comprising extraembryonic cells substantially free of other cell types can be produced.
  • Primitive, visceral and parietal endoderm cells are extraembryonic cells. Primitive endoderm cells give rise to visceral and parietal endoderm cells. Visceral endoderm cells are endoderm cells that form part of the yolk sac. Visceral endoderm cells function in both nutrient uptake and transport. Parietal endoderm cells are contiguous with an extraembryonic tissue known as Reichert's membrane. One of the roles of parietal endoderm cells is to produce basement membrane components.
  • extraembryonic endoderm cells do not give rise to embryonic structures formed during development.
  • definitive endoderm cells and other endoderm-lineage or pancreatic-lineage cells described herein are embryonic or derived from embryonic cells and give rise to tissues that are derived from the gut tube that forms during embryonic development.
  • the extraembryonic cell populations or cell cultures produced by the methods described herein substantially have high expression of markers selected from the group consisting of SOX7, SOX 17, THBD, SPARC, DAB1, HNF4alpha or AFP genes as compared to the expression levels of at least SOX7, SOX17, THBD, SPARC, DAB1, or AFP, which is not expressed in other types of cells or cell populations, for example, definitive endoderm.
  • markers selected from the group consisting of SOX7, SOX 17, THBD, SPARC, DAB1, HNF4alpha or AFP genes as compared to the expression levels of at least SOX7, SOX17, THBD, SPARC, DAB1, or AFP, which is not expressed in other types of cells or cell populations, for example, definitive endoderm.
  • compositions comprising mesendoderm cells substantially free of other cell types can be produced.
  • the mesendoderm cell populations or cell cultures produced by the methods described herein substantially have high expression of markers selected from the group consisting of FGF4, SNAIl MIXL1 and/or WNT3 marker genes, as compared to SOX 17 low, CXCR4 low, FOXA2 low, SOX7 low and SOX1 low. Screening methods
  • screening methods are employed to obtain certain cell populations comprising pluripotent, multipotent and/or differentiated cells, such as human pluripotent stem cells, induced pluripotent stem cells, preprimitive streak cells, mensendoderm cells, definitive endoderm cells, foregut endoderm or PDX1 -negative foregut endoderm cells, PDXl-postiive foregut endoderm or PDX1 -positive pancreatic endoderm cells or pancreatic progenitor cells, endocrine precursor cells, and/or endocrine cells.
  • the cell population is then provided with a candidate differentiation factor.
  • expression of a marker is determined.
  • expression of the marker can be determined after providing the candidate differentiation factor.
  • expression of the same marker is again determined.
  • Whether the candidate differentiation factor is capable of promoting the differentiation of the pancreatic precursor cells is determined by comparing expression of the marker at the first time point with the expression of the marker at the second time point. If expression of the marker at the second time point is increased or decreased as compared to expression of the marker at the first time point, then the candidate differentiation factor is capable of promoting the differentiation of pancreatic progenitor cells.
  • Some embodiments of the screening methods described herein utilize cell populations or cell cultures which comprise human definitive endoderm, PDX-1 negative foregut endoderm, PDX-1 positive foregut endoderm, PDX-1 positive pancreatic endoderm, or pancreatic progenitor or endocrine precursor cells.
  • the cell population can be a substantially purified population of PDX-1 -positivei pancreatic endoderm or pancreatic progenitor cells.
  • the cell population can be an enriched population of human pancreatic progenitor cells, wherein at least about 50% to 97% of the human cells in the cell population are human pancreatic progenitor cells, the remainder comprising of endocrine precursor or endocrine cells and other cell types.
  • the cell population is contacted or otherwise provided with a candidate (test) differentiation factor.
  • the candidate differentiation factor can comprise any molecule that may have the potential to promote the differentiation of any of the above-mentioned cells, e.g.. human pancreatic progenitor cells.
  • the candidate differentiation factor comprises a molecule that is known to be a differentiation factor for one or more types of cells.
  • the candidate differentiation factor comprises a molecule that is not known to promote cell differentiation.
  • the candidate differentiation factor comprises a molecule that is not known to promote the differentiation of human pancreatic progenitor cells.
  • the candidate differentiation factor comprises a small molecule.
  • a small molecule is a molecule having a molecular mass of about 10,000 amu or less.
  • the candidate differentiation factor comprises a large molecule, e.g., a polypeptide.
  • the polypeptide can be any polypeptide including, but not limited to, a glycoprotein, a lipoprotein, an extracellular matrix protein, a cytokine, a chemokine, a peptide hormone, an interleukin or a growth factor.
  • Preferred polypeptides include growth factors.
  • the candidate differentiation factors comprise one or more growth factors selected from the group consisting of Amphiregulin, B-lymphocyte stimulator, IL- 16, Thymopoietin, TRAIL/Apo-2, Pre B cell colony enhancing factor, Endothelial differentiation-related factor 1 (EDF1), Endothelial monocyte activating polypeptide II, Macrophage migration inhibitory factor (MIF), Natural killer cell enhancing factor (NKEFA), Bone morphogenetic protein 2, Bone morphogenetic protein 8 (osteogeneic protein 2), Bone morphogenic protein 6, Bone morphogenic protein 7, Connective tissue growth factor (CTGF), CGI- 149 protein (neuroendocrine differentiation factor), Cytokine A3 (macrophage inflammatory protein 1 -alpha), Gliablastoma cell differentiation-related protein (GBDR1), Hepatoma-derived growth factor, Neuromedin U-25 precursor, Vascular endo
  • the candidate differentiation factor is provided to the cell population in one or more concentrations.
  • the candidate differentiation factor is provided to the cell population so that the concentration of the candidate differentiation factor in the medium surrounding the cells ranges from about 0.1 ng/ml to 10 mg/ml.
  • the concentration of the candidate differentiation factor in the medium surrounding the cells ranges from about 1 ng/ml to about 1 mg/ml.
  • the concentration of the candidate differentiation factor in the medium surrounding the cells ranges from about 10 ng/ml to about 100 ⁇ g/ml.
  • the concentration of the candidate differentiation factor in the medium surrounding the cells ranges from about 100 ng/ml to about 10 ⁇ g/ml. In preferred embodiments, the concentration of the candidate differentiation factor in the medium surrounding the cells ranges from about 5 ng/ml to 1000 ⁇ g/ml.
  • steps of the screening methods described herein comprise determining expression of at least one marker at a first time point and a second time point.
  • the first time point can be prior to or at approximately the same time as providing the cell population with the candidate differentiation factor.
  • the first time point is subsequent to providing the cell population with the candidate differentiation factor.
  • expression of a plurality of markers is determined at a first time point.
  • some embodiments of the screening methods described herein contemplate determining expression of at least one marker at a second time point, which is subsequent to the first time point and which is subsequent to providing the cell population with the candidate differentiation factor.
  • expression of the same marker is determined at both the first and second time points.
  • expression of a plurality of markers is determined at both the first and second time points.
  • expression of the same plurality of markers is determined at both the first and second time points.
  • marker expression is determined at a plurality of time points, each of which is subsequent to the first time point, and each of which is subsequent to providing the cell population with the candidate differentiation factor.
  • marker expression is determined by Q-PCR.
  • marker expression is determined by immunocytochemistry.
  • the marker having its expression determined at the first and second time points is a marker that is associated with the differentiation of pancreatic progenitor cells to cells which are the precursors of terminally differentiated cells which make up pancreatic islet tissues.
  • Such cells can include immature pancreatic islet hormone-expressing cells.
  • sufficient time is allowed to pass between providing the cell population with the candidate differentiation factor and determining marker expression at the second time point.
  • Sufficient time between providing the cell population with the candidate differentiation factor and determining expression of the marker at the second time point can be as little as from about 1 hour to as much as about 10 days.
  • the expression of at least one marker is determined multiple times subsequent to providing the cell population with the candidate differentiation factor.
  • sufficient time is at least about 1 hour, at least about 6 hours, at least about 12 hours, at least about 16 hours, at least about 1 day, at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, at least about 10 days, at least about 11 days, at least about 12 days, at least about 13 days, at least about 14 days, at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 5 weeks, at least about 6 weeks, at least about 7 weeks, or at least about 8 weeks.
  • An increase or decrease in the expression of the at least one marker indicates that the candidate differentiation factor is capable of promoting the differentiation of the endocrine precursor cells.
  • expression of a plurality of markers is determined, it is further determined whether the expression of the plurality of markers at the second time point has increased or decreased as compared to the expression of this plurality of markers at the first time point.
  • An increase or decrease in marker expression can be determined by measuring or otherwise evaluating the amount, level or activity of the marker in the cell population at the first and second time points.
  • the amount of increase is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, at least about 100-fold or more than at least about 100-fold. In some embodiments, the amount of increase is less than 2-fold.
  • the amount of decrease is at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, at least about 100- fold or more than at least about 100-fold. In some embodiments, the amount of decrease is less than 2-fold.
  • the progression of pluripotent cells to multipotent cells to further multipotent cells or differentiated cells, such as pancreatic progenitors or hormone endocrine secreting cells can be monitored by determining the expression of markers characteristic of the specific cells, including genetic markers and phenotypic markers such as, the expression of islet hormones and the processing of proinsulin into insulin and C peptide in endocrine cells.
  • markers characteristic of the specific cells including genetic markers and phenotypic markers such as, the expression of islet hormones and the processing of proinsulin into insulin and C peptide in endocrine cells.
  • the expression of certain markers is determined by detecting the presence or absence of the marker.
  • the expression of certain markers can be determined by measuring the level at which the marker is present in the cells of the cell culture or cell population.
  • the expression of markers characteristic of immature pancreatic islet hormone- expressing cells as well as the lack of significant expression of markers characteristic of pluripotent cells, definitive endoderm, foregut endoderm, PDX1 -positive foregut endoderm, endocrine precursor, extraembryonic endoderm, mesoderm, ectoderm, mature pancreatic islet hormone-expressing cells and/or other cell types is determined.
  • marker expression can be accurately quantitated through the use of technique such as Q-PCR.
  • technique such as Q-PCR.
  • PDX1 is a marker gene that is associated with PDX1 -positive foregut endoderm.
  • the expression of PDX1 is determined.
  • the expression of other markers, which are expressed in PDX1 -positive foregut endoderm including, but not limited to, SOX 17, HNF6, SOX9 and PROX1 is also determined.
  • PDX1 can also be expressed by certain other cell types (that is, visceral endoderm and certain neural ectoderm)
  • some embodiments of the present invention relate to demonstrating the absence or substantial absence of marker gene expression that is associated with visceral endoderm and/or neural ectoderm.
  • the expression of markers, which are expressed in visceral endoderm and/or neural cells including, but not limited to, SOX7, AFP, SOX1, ZIC1 and/or NFM is determined.
  • PDX1 -positive foregut endoderm cell cultures produced by the methods described herein are substantially free of cells expressing the SOX7, AFP, SOX1, ZIC1 or NFM marker genes.
  • the PDX1 -positive foregut endoderm cell cultures produced by the processes described herein are substantially free of visceral endoderm, parietal endoderm and/or neural cells.
  • the developmental progression of the pluripotent cells described herein can be monitored by determining the expression of markers characteristic of each hES-derived or iPS-derived cell type along the developmental pathway.
  • the identification and characterization of a hES-derived or iPS-derived cell type is by expression of a certain marker or different expression levels and patterns of more than one marker. That is, the presence or absence, the high or low expression, of one or more the marker(s) typifies and identifies a cell-type.
  • certain markers can have transient expression, whereby the marker is highly expressed during one stage of development and poorly expressed in another stage of development.
  • the expression of certain markers can be determined by measuring the level at which the marker is present in the cells of the cell culture or cell population as compared to a standardized or normalized control marker. In such processes, the measurement of marker expression can be qualitative or quantitative.
  • One method of quantitating the expression of markers that are produced by marker genes is through the use of quantitative PCR (Q-PCR). Methods of performing Q-PCR are well known in the art.
  • the presence, absence and/or level of expression of a marker is determined by quantitative PCR (Q-PCR).
  • Q-PCR quantitative PCR
  • the amount of transcript produced by certain genetic markers such as SOX 17, CXCR4, OCT4, AFP, TM, SPARC, SOX7, CDX2, MIXL1, GATA4, HNF3 , HNF4alpha, GSC, FGF17, VWF, CALCR, FOXQ 1, CMKOR1, CRIPl and other markers described herein is determined by quantitative Q-PCR.
  • immunohistochemistry is used to detect the proteins expressed by the above-mentioned genes.
  • Q-PCR can be used in conjunction with immunohistochemical techniques or flow cytometry techniques to effectively and accurately characterize and identify cell types and determine both the amount and relative proportions of such markers in a subject cell type.
  • Q-PCR can quantify levels of RNA expression in a cell culture containing a mixed population of cells.
  • Q-PCR cannot provide or qualify whether the subject markers or proteins are co-expressed on the same cell.
  • Q-PCR is used in conjunction with flow cytometry methods to characterize and identify cell types.
  • pancreatic progenitors or pancreatic endoderm or PDX-1 positive pancreatic endoderm expresses at least PDX1, Nkx6.1, PTF1A, CPA and/or cMYC as demonstrated by Q-PCR and / or ICC, but such a cell at least co- expresses PDX1 and Nkx6.1 as demonstrated by ICC and does not express other markers including SOX 17 CXCR4, or CER, to be identified as a PDX1 -positive expressing cell.
  • C-peptide a product of proper processing of pro- insulin in a mature and functioning ⁇ cell
  • insulin are co-expressed by ICC in the insulin secreting cell.
  • marker gene expression can be quantitated by using antibodies specific for the marker gene product of interest (e.g., e.g. Western blot, flow cytometry analysis, and the like).
  • antibodies specific for the marker gene product of interest e.g., e.g. Western blot, flow cytometry analysis, and the like.
  • the expression of marker genes characteristic of hES-derived cells as well as the lack of significant expression of marker genes characteristic of hES-derived cells are described in related applications as indicated above, which are herein incorporated by reference in their entirety.
  • Amplification probe/primer combinations suitable for use in amplification assays include the following: Insulin (INS) (GenBank NM_000207): primers AAGAGGCCATCAAGCAGATCA (SEQ ID NO: 1); CAGGAGGCGCATCCACA (SEQ ID NO: 2); Nkx6.1 (NM_006168): primers CTGGCCTGTACCCCTCATCA (SEQ ID NO: 3); CTTCCCGTCTTTGTCCAACAA (SEQ ID NO: 4); Pdxl (NM_000209): primers AAGTCTACCAAAGCTCACGCG (SEQ ID NO: 5); GTAGGCGCCGCCTGC (SEQ ID NO: 6); Ngn3 (NM_020999): primers GCTCATCGCTCTCTATTCTTTTGC (SEQ ID NO: 7); GGTTGAGGCGTCATCCTTTCT (SEQ ID NO: 8); FOXA2 (HNF3B) (NM_021784): primers GGGAGCGGTGAA
  • CTCATGGCAAAGTTCTTCCAGAA SEQ ID NO: 40
  • SOX1 primers ATGCACCGCTACGACATGG (SEQ ID NO: 41) CTCATGTAGCCCTGCGAGTTG (SEQ ID NO: 42); ZIC1 primers CTGGCTGTGGCAAGGTCTTC (SEQ ID NO: 43) CAGCCCTCAAACTCGCACTT (SEQ ID NO: 44); NFM primers ATCGAGGAGCGCCACAAC (SEQ ID NO: 45) TGCTGGATGGTGTCCTGGT (SEQ ID NO: 46).
  • primers are available through ABI Taqman including FGF17 (Hs00182599_ml), VWF (Hs00169795_ml), CMKOR1 (Hs00604567_ml), CRIP l (Hs00832816_gl), FOXQ1 (Hs00536425_sl), CALCR (Hs00156229_ml) and CHGA (Hs00154441_ml).
  • Stage 1 is the production of definitive endoderm from pluripotent stem cells and takes about 2 to 5 days, preferably 2 or 3 days.
  • Pluripotent stem cells are suspended in media comprising RPMI , a TGF superfamily member growth factor, such as Activin A, Activin B, GDF-8 or GDF-1 1 (lOOng/ml), a Wnt family member or Wnt pathway activator, such as Wnt3a (25ng/ml), and alternatively a rho-kinase or ROCK inhibitor, such as Y-27632 (10 ⁇ ) to enhance growth, survival and proliferation as well as promoting cell-cell adhesion.
  • a TGF superfamily member growth factor such as Activin A, Activin B, GDF-8 or GDF-1 1 (lOOng/ml)
  • Wnt family member or Wnt pathway activator such as Wnt3a (25ng/ml)
  • a rho-kinase or ROCK inhibitor such as Y-27632 (10 ⁇ ) to enhance growth, survival and proliferation as well as promoting cell-cell adhesion.
  • the media is exchanged for media comprising RPMI with serum, such as 0.2% FBS, and a TGFp superfamily member growth factor, such as Activin A, Activin B, GDF-8 or GDF-1 1 (lOOng/ml), and alternatively a rho-kinase or ROCK inhibitor for another 24 (day 1) to 48 hours (day 2).
  • a medium comprising Activin / Wnt3a the cells are cultured during the subsequent 24 hours in a medium comprising Activin alone (i.e., the medium does not include Wnt3a).
  • production of definitive endoderm requires cell culture conditions low in serum content and thereby low in insulin or insulin-like growth factor content.
  • Definitive endoderm cells at this stage co-express SOX 17 and HNF3p (FOXA2) and do not appreciably express at least FTNF4alpha, H F6, PDXl, SOX6, PROX1, PTF1A, CPA, cMYC, NKX6.1, NGN3, PAX3, ARX, NKX2.2, INS, GSC, GHRL, SST, or PP.
  • Stage 2 takes the definitive endoderm cell culture from Stage 1 and produces foregut endoderm or PDXl -negative foregut endoderm by incubating the suspension cultures with RPMI with low serum levels, such as 0.2% FBS, in a 1 : 1000 dilution of ITS, 25ng KGF (or FGF7), and alternatively a ROCK inhibitor for 24 hours (day 2 to day 3) to enhance growth, survival, proliferation and promote cell-cell adhesion. After 24 hours (day 3 to day 4), the media is exchanged for the same media minus a TGFp inhibitor, but alternatively still a ROCK inhibitor to enhance growth, survival and proliferation of the cells, for another 24 (day 4 to day 5) to 48 hours (day 6).
  • TGFp inhibitor can be added to Stage 2 cell cultures, such as 2.5 ⁇ TGFp inhibitor no.4 or 5 ⁇ SB431542, a specific inhibitor of activin receptor-like kinase (ALK), which is a TGFp type I receptor.
  • ALK activin receptor-like kinase
  • Foregut endoderm or PDXl -negative foregut endoderm cells produced from Stage 2 co-express SOX 17, HNFlp and HNF4alpha and do not appreciably co-express at least SOX 17 and HNF3 (FOXA2), nor HNF6, PDX1, SOX6, PROX1, PTF1A, CPA, cMYC, NKX6.1, NGN3, PAX3, ARX, NKX2.2, INS, GSC, GHRL, SST, or PP, which are hallmark of definitive endoderm, PDX1 -positive pancreatic endoderm or pancreatic progenitor cells or endocrine precursors as well as singly or poly hormonal type cells.
  • Stage 3 takes the foregut endoderm cell culture from Stage 2 and produces a PDXl-positive foregut endoderm cell by DMEM or RPMI in 1% B27, 0.25 ⁇ KAAD cyclopamine, a retinoid, such as 0.2 ⁇ retinoic acid (RA) or a retinoic acid analog such as 3nM of TTNPB, and 50ng/mL of Noggin for about 24 (day 7) to 48 hours (day 8).
  • RA ⁇ retinoic acid
  • Noggin for about 24 (day 7) to 48 hours (day 8).
  • Applicants have used DMEM-high glucose since about 2003 and all patent and non-patent disclosures as of that time employed DMEM-high glucose, even if not mentioned as "DMEM-high glucose” and the like.
  • a ROCK inhibitor or rho-kinase inhibitor such as Y-27632 can be used to enhance growth, survival, proliferation and promote cell-cell adhesion.
  • PDXl-positive foregut cells produced from Stage 3 co-express PDX1 and HNF6 as well as SOX9 and PROX, and do not appreciably co-express markers indicative of definitive endoderm or foregut endoderm (PDX1 -negative foregut endoderm) cells or PDXl- positive foregut endoderm cells as described above in Stages 1 and 2.
  • Stage 4 (days 8-14) takes the media from Stage 3 and exchanges it for media containing DMEM in 1% vol/vol B27 supplement, plus 50ng/mL KGF and 50ng/mL of EGF and sometimes also 50ng/mL Noggin.
  • a ROCK inhibitor such as Y-27632 can be used to enhance growth, survival, proliferation and promote cell-cell adhesion.
  • PDXl-positive pancreatic endoderm cells produced from Stage 4 co-express at least PDX1 and Nkx6.1 as well as PTF 1A, and do not appreciably express markers indicative of definitive endoderm or foregut endoderm (PDX1 -negative foregut endoderm) cells as described above in Stages 1, 2 and 3.
  • the cells from Stage 4 can be further differentiated in Stage 5 to produce endocrine precursor or progenitor type cells and / or singly and poly-hormonal pancreatic endocrine type cells from Stage 4 cells in a medium containing DMEM in 1% vol/vol B27 supplement for about 1 to 6 days (days 15-20).
  • Endocrine precursors produced from Stage 5 co-express at least NGN3 and PAX4 as well as Nkx2.2, and do not appreciably express markers indicative of definitive endoderm or foregut endoderm (PDX1 -negative foregut endoderm) or PDXl-positive pancreatic endoderm or progenitor cells as described above in Stages 1, 2, 3and 4.
  • PDXl-positive pancreatic endoderm produced from Stage 4 are loaded and wholly contained in a macro-encapsulation device and transplanted in a patient, and the PDXl- positive pancreatic endoderm cells mature into pancreatic hormone secreting cells, e.g., insulin secreting cells, in vivo.
  • pancreatic hormone secreting cells e.g., insulin secreting cells
  • Activin A a member of the TGF superfamily of growth factors or signaling proteins, is used to produce definitive endoderm from pluripotent cells, e.g., hES cells and iPS cells, however, other TGF super family members can be used, for example GDF- 8 and GDF-11, to produce definitive endoderm such as those described in International Application PCT/US2008/065686, entitled GROWTH FACTORS FOR PRODUCTION OF DEFINITIVE ENDODERM, filed June 3, 2008, which is herein incorporated by reference in its entirety.
  • Retinoic acid is used to differentiate PDXl-negative foregut endoderm cells in Stage 2 to PDXl-positive foregut cells in Stage 3.
  • retinoids or retinoic acid analogues such as 4-[(E)-2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-napthalenyl)-l- propenyljbenzoic acid (or TTNPB) and similar analogs (e.g., 4-HBTTNPB) can be used.
  • TTNPB retinoids or retinoic acid analogues
  • Noggin is a protein for example that inactivates members of the TGFp superfamily signaling proteins, such as bone morphogenetic protein-4 (BMP4).
  • BMP4 bone morphogenetic protein-4
  • BMP4 inhibitors such as Chordin and Twisted Gastrulation (Tsg) or anti-BMP neutralizing antibodies can prevent BMP binding to its cell surface receptors, thereby effectively inhibiting the BMP signaling.
  • Tsg Chordin and Twisted Gastrulation
  • anti-BMP neutralizing antibodies can prevent BMP binding to its cell surface receptors, thereby effectively inhibiting the BMP signaling.
  • the gene for human Noggin has been cloned and sequenced. See U.S. Patent No. 6,075,007, which is herein incorporated by reference. Analysis of the Noggin sequence shows a carboxy terminal region having homology to a Kunitz-type protease inhibitor, indicating that potentially other Kunitz-type protease inhibitors may have a similar effect on inhibiting BMP.
  • differentiation to definitive endoderm is achieved by providing to the pluripotent cell culture a growth factor of the TGFp superfamily in an amount sufficient to promote differentiation to definitive endoderm.
  • Growth factors of the TGFp superfamily which are useful for the production of definitive endoderm are selected from the Nodal/Activin, GDF-8, -9, -10, -1 1 and the like or BMP subgroups.
  • the growth factor is selected from the group consisting of Nodal, Activin A, Activin B, GDF-8, GDF-11 and BMP4.
  • the growth factor Wnt3a, other Wnt family members, and Wnt pathway activators are useful for the production of definitive endoderm cells.
  • combinations of any of the above- mentioned growth factors can be used. This and other methods are described in detail in U.S. Patent No. 7,510.876, which is herein incorporated by reference in its entirety.
  • the above-mentioned growth factors are provided to the cells so that the growth factors are present in the cultures at concentrations sufficient to promote differentiation of at least a portion of the pluripotent cells to definitive endoderm cells.
  • the above-mentioned growth factors are present in the cell culture at a concentration of at least about 5 ng/ml, at least about 10 ng/ml, at least about 25 ng/ml, at least about 50 ng/ml, at least about 75 ng/ml, at least about 100 ng/ml, at least about 200 ng/ml, at least about 300 ng/ml, at least about 400 ng/ml, at least about 500 ng/ml, at least about 1000 ng/ml, at least about 2000 ng/ml, at least about 3000 ng/ml, at least about 4000 ng/ml, at least about 5000 ng/ml or more than about 5000 ng/ml.
  • the above-mentioned growth factors are removed from the cell culture subsequent to their addition.
  • the growth factors can be removed within about one day, about two days, about three days, about four days, about five days, about six days, about seven days, about eight days, about nine days or about ten days after their addition.
  • the growth factors are removed about four days after their addition.
  • definitive endoderm cells are enriched, isolated and/or purified prior to further differentiation.
  • definitive endoderm cells can be enriched, isolated and/or purified using any known method.
  • the definitive endoderm cells are enriched, isolated and/or purified using one or more of the methods described in U.S. Patent Application Number 11/021,618, entitled DEFINITIVE ENDODERM, filed December 23, 2004, and U.S. Provisional Patent Application Number 60/736,598, entitled MARKERS OF DEFINITIVE ENDODERM, filed November 14, 2005, the disclosures of which are incorporated herein by reference in their entireties.
  • the definitive endoderm cells produced and described herein have relatively high levels of CER, GSC, CXCR4, SOX 17 and FOXA2 gene expression when normalized and compared to levels of control genes, such as housekeeping genes.
  • Definitive endoderm cells can be specified toward pancreatic differentiation by further differentiation of these cells to produce PDX1 -negative foregut endoderm cells.
  • cell cultures as well as enriched or purified cell populations comprising definitive endoderm cells can be used for further differentiation to cell cultures and/or enriched cell populations comprising PDX1 -negative foregut endoderm cells.
  • definitive endoderm cells are differentiated to PDX1 -negative foregut endoderm cells by reducing or eliminating or removing TGFp superfamily growth factor signaling in a cell culture or cell population of SOX17-positive definitive endoderm cells.
  • reducing or eliminating TGFp superfamily growth factor signaling is mediated by diluting or removing an exogenously added TGFp superfamily growth factor, such as activin A, from the cell culture or cell population of definitive endoderm.
  • TGFp superfamily growth factor signaling is reduced or eliminated by providing the definitive endoderm cells with a compound that blocks TGFp superfamily growth factor signaling, such as follistatin and/or noggin.
  • TGFp superfamily growth factor signaling can be reduced or eliminated for about one day, about two days, about three days, about four days, about five days, about six days, about seven days, about eight days, about nine days, about ten days or greater than about ten days subsequent to the differentiation of the human pluripotent cells to definitive endoderm cells.
  • differentiation of definitive endoderm cells to foregut endoderm cells is enhanced by providing the definitive endoderm cell culture or cell population with an FGF-family growth factor and/or a hedgehog pathway inhibitor.
  • the FGF-family growth factor and/or hedgehog pathway inhibitor is provided at about one day, about two days, about three days, about four days, about five days, about six days, about seven days, about eight days, about nine days, about ten days or greater than about ten days subsequent to reducing or eliminating TGFp superfamily growth factor signaling in the definitive endoderm cell culture.
  • the FGF-family growth factor and/or hedgehog pathway inhibitor is provided at about the same time as reducing or eliminating TGFp superfamily growth factor signaling in the definitive endoderm cell culture.
  • the FGF-family growth factor provided to the definitive endoderm cell culture or cell population is FGF10 and/or FGF7.
  • FGF10 and/or FGF7 FGF10 and/or FGF7.
  • FGF7 FGF10 and/or FGF7
  • FGF-family growth factor selected from the group consisting of FGF1, FGF2, FGF3, and the like up to and including FGF23 may be provided.
  • the FGF-family growth factor and/or the FGF-family growth factor analog or mimetic is provided to the cells of a cell culture such that it is present at a concentration of at least about 10 ng/ml, at least about 25 ng/ml, at least about 50 ng/ml, at least about 75 ng/ml, at least about 100 ng/ml, at least about 200 ng/ml, at least about 300 ng/ml, at least about 400 ng/ml, at least about 500 ng/ml, or at least about 1000 ng/ml.
  • the hedgehog inhibitor is KAAD- cyclopamine. However, it will be appreciated that other hedgehog inhibitors can be used.
  • Such inhibitors include, but are not limited to, KAAD-cyclopamine analogs, jervine, jervine analogs, hedgehog pathway blocking antibodies and any other inhibitors of hedgehog pathway function known to those of ordinary skill in the art.
  • the hedgehog inhibitor can be provided at a concentration of at least about 0.01 ⁇ to 50 ⁇ .
  • TGF superfamily growth factor signaling is reduced or eliminated for about two day subsequent to the differentiation of a substantial portion of human pluripotent cells to definitive endoderm (for example, after a three day, four or five day differentiation protocol as described in the examples below).
  • the cell culture or cell population of definitive endoderm cells is provided noggin and KAAD-cyclopamine, e.g., 50 ng/ml of Noggin and 0.25 ⁇ KAAD-cyclopamine in DMEM medium in the presence of 2 mM RA or 3nM TTNPB.
  • the PDXl-negative foregut endoderm cells can be further differentiated to PDX1 -positive foregut endoderm cells by contacting the cells with a medium comprising, or otherwise providing to the cells, a retinoid, such as retinoic acid (RA).
  • a retinoid such as retinoic acid (RA).
  • the retinoid is provided to the cells of a cell culture such that it is present at a concentration of at least about 1 nM to 50 ⁇ .
  • the retinoid is provided to the cells at about one day, about two days, about three days, about four days, about five days, about six days, about seven days, about eight days, about nine days, about ten days or greater than about ten days subsequent to reducing or eliminating TGF superfamily growth factor signaling in the definitive endoderm cell culture.
  • from about 0.05 ⁇ RA to about 2 ⁇ RA is provided to the PDX-1 negative foregut endoderm cell culture about 2 to 3 days subsequent to reducing or eliminating TGF superfamily growth factor signaling.
  • the above- mentioned differentiation factors are removed from the cell culture subsequent to their addition.
  • the above-mentioned differentiation factors can be removed within about one day, about two days, about three days, about four days, about five days, about six days, about seven days, about eight days, about nine days or about ten days after their addition.
  • the PDXl-negative foregut endoderm cells produced and described herein have relatively high levels of SOX17, FOXAl, HNF IB and HNF4A gene expression when normalized to levels of control genes, such as housekeeping genes.
  • levels of FTNF4A gene expression does not substantially increase until removal of TGF superfamily growth factor signaling (e.g., Activin) from a, definitive endoderm culture, for example.
  • PDXl -negative foregut endoderm cells can be further specified toward pancreatic differentiation by further differentiation of these cells to produce PDXl -positive foregut endoderm cells or PDXl -positive pancreatic endoderm or equivalents thereof.
  • cell cultures as well as enriched or purified cell populations comprising definitive endoderm cells can be used for further differentiation to cell cultures and/or enriched cell populations comprising PDXl-positive foregut endoderm cells.
  • PDXl -negative foregut endoderm cells are differentiated to PDXl- positive foregut endoderm cells by providing to a cell culture comprising SOX17-positive foregut endoderm cells a retinoid, such as retinoic acid (RA).
  • a retinoid such as retinoic acid (RA)
  • PDXl -negative foregut endoderm cells in culture are also provided with a member of the fibroblast growth factor family either prior to or about the same time as the addition of RA.
  • a preferred fibroblast growth factor is FGF-7.
  • the fibroblast growth factor comprises any fibroblast growth factor or a ligand that stimulates or otherwise interacts with the fibroblast growth factor 2 receptor Illb (FGFR2(IIIb)).
  • the FGF family growth factor is used in conjunction with a hedgehog pathway inhibitor.
  • a preferred hedgehog pathway inhibitor is KAAD-cyclopamine.
  • FGF-10 and/or KAAD-cyclopamine are provided to a cell culture comprising PDXl -negative definitive endoderm cells in the presence of RA.
  • BMP4 may be included with FGF 10 and/or KAAD-cyclopamine in the presence of RA.
  • the retinoid is used in conjunction with a member of the ⁇ superfamily of growth factors and/or Connaught Medical Research Labs medium (CRML medium) (Invitrogen, Carlsbad, CA).
  • the retinoid and/or a combination of the above-mentioned differentiation factors are provided to the cells so that these factors are present in the cell culture or cell population at concentrations sufficient to promote differentiation of at least a portion of the PDXl -negative foregut endoderm cell culture or cell population to PDXl-positive foregut endoderm cells.
  • FGF-10 is provided to the cells of a cell culture such that it is present at a concentration of at least about 1 ng/ml, at least about 2 ng/ml, at least about 5 ng/ml, at least about 10 ng/ml, at least about 25 ng/ml and up to 50 ⁇ .
  • a fibroblast growth factor or a ligand that stimulates or otherwise interacts with the fibroblast growth factor 2 receptor Illb (FGFR2(IIIb) is provided either alone or in combination with the hedgehog pathway inhibitor.
  • a cell culture or an enriched cell population of PDXl -negative foregut endoderm cells is provided with FGF-7, KAAD- cyclopamine and retinoic acid (RA), e.g., 25 ng/ml of FGF-7 and 0.2 ⁇ KAAD-cyclopamine in CMRL medium in the presence of 2 ⁇ RA.
  • FGF-7 FGF-7
  • KAAD- cyclopamine and retinoic acid (RA) e.g., 25 ng/ml of FGF-7 and 0.2 ⁇ KAAD-cyclopamine in CMRL medium in the presence of 2 ⁇ RA.
  • TGF signaling factor e.g., activin A and/or activin B, GDF-8, GDF-11 and the like are provided to the cell culture along with the retinoid and/or the fibroblast growth factor and the hedgehog inhibitor.
  • activin A and/or activin B and/or GDF-8 and/or GDF-1 1 is provided to the cell culture at a concentration of at least about 5 ng/ml, at least about 10 ng/ml, at least about 25 ng/ml, at least about 50 ng/ml, at least about 75 ng/ml, at least about 100 ng/ml, at least about 200 ng/ml, at least about 300 ng/ml, at least about 400 ng/ml, at least about 500 ng/ml, or at least about 1000 ng/ml.
  • the differentiation factors and/or CRML medium is provided to the PDXl -negative foregut endoderm cells at about one day, two days, three days, at about four days, at about five days, at about six days, at about seven days, at about eight days, at about nine days, at about ten days or at about greater than ten days subsequent to the initiation of differentiation from pluripotent cells.
  • differentiation factors and/or CRML medium is provided to the PDXl -negative foregut endoderm cells at about three or four or five days subsequent to the initiation of differentiation from pluripotent stem cells.
  • the above-mentioned differentiation factors are removed from the cell culture subsequent to their addition.
  • the above- mentioned differentiation factors can be removed within about one day, about two days, about three days, about four days, about five days, about six days, about seven days, about eight days, about nine days or about ten days after their addition.
  • the PDXl -positive foregut endoderm cells produced and described herein have relatively high levels of PDXl, NKX6.1, PTF IA, CPA and cMYC gene expression when normalized and compared to levels of control genes, such as housekeeping genes.
  • Patent Application Number 1 1/681,687, entitled ENDOCRINE PRECURSOR CELLS, PANCREATIC HORMONE-EXPRESSING CELLS AND METHODS OF PRODUCTION, filed March 2, 2007. The disclosures of each of these applications are incorporated herein by reference in their entirety.
  • Example 22 of the 12/167,227 application describes in detail various modifications of the cell culture conditions described herein in Stages 1 to 4.
  • Stage 3 PDXl-positive foregut endoderm type cells are cultured in media containing DMEM in 1% vol/vol B27 supplement plus Noggin, or another BMP4 specific inhibitor for about 1 to 3 days, or about 1 to 4 days, or 1 to 5 days, or about 1 to 6 days.
  • a PDXl-positive pancreatic endoderm is produced, which cell at least co-expresses PDXl and Nkx6.1 as well as PTFIA.
  • the cell culture does not appreciably express cells indicative of singly or poly- hormonal endocrine cells of Stage 5, or definitive endoderm cells of Stage 1, or PDXl-negatiave foregut endoderm cells of Stage 2, or PDXl-positive foregut endoderm cells of Stage 3.
  • endocrine precursor cells can be produced by first differentiating pluripotent cells to produce definitive endoderm cells then further differentiating the definitive endoderm cells to produce PDXl-positive foregut endoderm cells.
  • PDXl-positive foregut endoderm cells are further differentiated to multipotent endocrine precursor cells, which are capable of differentiating into human pancreatic islet hormone-expressing cells.
  • PDXl -positive foregut endoderm cells are differentiated to endocrine precursor cells by continuing the incubation of PDXl -positive foregut endoderm cells in the presence of a retinoid, such as retinoic acid, for an amount of time sufficient to produce endocrine precursor cells.
  • a retinoid such as retinoic acid
  • the amount of time sufficient for the production of endocrine precursor cells ranges from about 1 hour to about 10 days subsequent to the expression of the PDXl marker in a portion of the cells in the cell culture.
  • the retinoid is maintained in the cell culture for about 1 hour, about 2 hours, about 4 hours, about 6 hours, about 8 hours, about 10 hours, about 12 hours, about 16 hours, about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days or greater than about 10 days subsequent to the expression of the PDXl marker in a portion of the cells in the cell culture.
  • the concentration of retinoid used to differentiate PDXl -positive foregut endoderm cells in the cell culture or cell population to endocrine precursor cells ranges from about 1 nM to about 100 ⁇ .
  • differentiation from PDXl-positive foregut endoderm cells to pancreatic endocrine precursor cells is mediated by providing a cell culture or cell population comprising human PDXl-positive foregut endoderm cells with a gamma secretase inhibitor.
  • the gamma secretase inhibitor is N-[N-(3,5- Diflurophenacetyl-L-alanyl)]-S-phenylglycine t-Butyl Ester (DAPT).
  • the gamma secretase inhibitor is provided at the start of the differentiation process, for example, at the pluripotent stage, and remains in the cell culture throughout the differentiation to pancreatic islet hormone-expressing cells.
  • the gamma secretase inhibitor is added subsequent to the initiation of differentiation but prior to differentiation to the PDXl-positive foregut endoderm stage.
  • the gamma secretase inhibitor is provided to the cell culture or cell population at about the same time as providing the differentiation factors which promote the conversion of definitive endoderm to PDXl-positive endoderm.
  • the gamma secretase inhibitor is provided to the cell culture or cell population after a substantial portion of the cells in the cell culture or cell population have differentiated to PDXl-positive foregut endoderm cells.
  • the gamma secretase inhibitor is provided to the cells so that it is present in the cell culture or cell population at concentrations sufficient to promote differentiation of at least a portion of the PDX1 -positive cells to endocrine precursor cells.
  • the gamma secretase inhibitor is present in the cell culture or cell population at a concentration ranging from about 0.01 ⁇ to about 1000 ⁇ .
  • the gamma secretase inhibitor is present in the cell culture or cell population at a concentration ranging from about 0.1 ⁇ to about 100 ⁇ .
  • the gamma secretase inhibitor is provided after one or more previously provided differentiation factors have been removed from the cell cultures.
  • the one or more previously provided differentiation factors can be removed about 1 day to 10 days or more than about 10 days prior to the addition of the gamma secretase inhibitor.
  • the gamma secretase inhibitor is provided to cell cultures or cell populations comprising one or more differentiation factors that were previously provided or provided at about the same time as the gamma secretase inhibitor.
  • differentiation factors that were previously provided or provided at about the same time as the gamma secretase inhibitor include, but are not limited to, FGF-10, KAAD-cyclopamine, activin A, activin B, GDF-8, GDF-1 1, BMP4 and/or RA.
  • exendin 4 is provided to the differentiating cell culture or cell population at about the same time as the gamma secretase inhibitor. In certain embodiments, exendin 4 is provided so as to be in present in the cell culture or cell population at a concentration of at least about 0.1 ng/ml, to 1000 ng/ml.
  • a cell culture or cell population of PDX1 -positive foregut endoderm cells is provided with 3 ⁇ DAPT and 40 ng/ml exendin 4.
  • the cells are differentiated in CMRL.
  • a cell culture or cell population of PDX1 -positive foregut endoderm cells is provided with 3 ⁇ DAPT and 40 ng/ml exendin 4 in the presence of 2 ⁇ RA.
  • NGN3, NKX2.2 and/or PAX4 marker expression is induced over a range of different levels in endocrine precursor cells depending on the differentiation conditions.
  • the expression of the NGN3, NKX2.2 and/or PAX4 marker in endocrine precursor cells or cell populations is at least about 2-fold higher to at least about 10,000-fold higher than the expression of the NGN3, NKX2.2 and/or PAX4 marker in non-endocrine precursor cells or cell populations, for example pluripotent stem cells, definitive endoderm cells, PDX1 -positive foregut endoderm cells, immature pancreatic islet hormone-expressing cells, mature pancreatic islet hormone-expressing cells, extraembryonic endoderm cells, mesoderm cells and/or ectoderm cells.
  • the expression of the NGN3, NKX2.2 and/or PAX4 marker in endocrine precursor cells or cell populations is at least about 4-fold higher, at least about 6-fold higher to 10,000-fold higher than the expression of the NGN3, NKX2.2 and/or PAX4 marker in non-endocrine precursor cells or cell populations, for example pluripotent stem cells, definitive endoderm cells, PDX1 -positive foregut endoderm cells, immature pancreatic islet hormone-expressing cells, mature pancreatic islet hormone-expressing cells, extraembryonic endoderm cells, mesoderm cells and/or ectoderm cells.
  • the expression of the NGN3, NKX2.2 and/or PAX4 marker in endocrine precursor cells or cell populations is infinitely higher than the expression of the NGN3, NKX2.2 and/or PAX4 marker in non-endocrine precursor cells or cell populations, for example pluripotent cells like iPS cells and hES cells, definitive endoderm cells, PDX1 -positive foregut endoderm cells, immature pancreatic islet hormone-expressing cells, mature pancreatic islet hormone-expressing cells, extraembryonic endoderm cells, mesoderm cells and/or ectoderm cells.
  • pluripotent cells like iPS cells and hES cells
  • definitive endoderm cells definitive endoderm cells
  • PDX1 -positive foregut endoderm cells immature pancreatic islet hormone-expressing cells
  • mature pancreatic islet hormone-expressing cells extraembryonic endoderm cells
  • mesoderm cells and/or ectoderm cells for example pluripotent cells
  • compositions such as cell cultures or cell populations, comprising human cells, including human endocrine precursor cells, wherein the expression of the NGN3 marker is greater than the expression of the AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, CHGA, INS, GCG, SST, GHRL, and/or PAX6 marker in at least about 2% of the human cells.
  • the expression of the NGN3 marker is greater than the expression of the AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, CHGA, INS, GCG, SST, GHRL, and/or PAX6 marker in at least about 5% to 98% of the human cells.
  • the percentage of human cells in the cell cultures or populations, wherein the expression of NGN 3 is greater than the expression of the AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, CHGA, INS, GCG, SST, GHRL, and/or PAX6 marker, is calculated without regard to feeder cells.
  • compositions such as cell cultures or cell populations, comprising human endocrine precursor cells, wherein the expression of NKX2.2 and/or PAX4 is greater than the expression of the AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, CHGA, INS, GCG, SST, GHRL, and/or PAX6 marker in from at least about 2% to greater than at least about 98% of the human cells.
  • the expression of NKX2.2 and/or PAX4 is greater than the expression of the AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, CHGA, INS, GCG, SST, GHRL, and/or PAX6 marker in at least about 5% of the human cells to 98% of the human cells.
  • the percentage of human cells in the cell cultures or populations, wherein the expression of NKX2.2 and/or PAX4 is greater than the expression of the AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, CHGA, INS, GCG, SST, GHRL, and/or PAX6 marker, is calculated without regard to feeder cells.
  • compositions such as cell cultures or cell populations, comprising mammalian cells differentiated from definitive endoderm in vitro, such as human cells differentiated from definitive endoderm in vitro, wherein the expression of the NGN3, NKX2.2 and/or PAX4 marker is greater than the expression of the AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, CHGA, INS, GCG, SST, GHRL, and/or PAX6 marker in at least about 2% of the cells differentiated from definitive endoderm in vitro.
  • the expression of the NGN3, NKX2.2 and/or PAX4 marker is greater than the expression of the AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, CHGA, INS, GCG, SST, GHRL, and/or PAX6 marker in at least about 5% of the cells differentiated from definitive endoderm in vitro to 98% of the cells differentiated from definitive endoderm in vitro.
  • compositions comprising endocrine precursor cells substantially free of other cell types can be produced.
  • the endocrine precursor cell populations or cell cultures produced by the methods described herein are substantially free of cells that significantly express the AFP, SOX7, SOX1, ZIC1 and/or NFM markers.
  • the endocrine precursor cell populations of cell cultures produced by the methods described herein are substantially free of cells that significantly express the AFP, SOX7, SOX1, ZIC1, NFM, MAFA, SYP, CHGA, INS, GCG, SST, GHRL, and/or PAX6 markers.
  • a description of a endocrine precursor cell based on the expression of markers is, NGN3 high, NKX2.2 high, PAX4 high, AFP low, SOX7 low, SOX1 low, ZIC1 low NFM low, MAFA low; SYP low; CHGA low; INS low, GCG low, SST low, GHRL low and/or PAX6 low.
  • Embodiments described herein relate to methods of producing immature pancreatic islet hormone-expressing cells starting from pluripotent cells.
  • immature pancreatic islet hormone-expressing cells can be produced by first differentiating pluripotent cells to produce definitive endoderm cells, differentiating the definitive endoderm cells to produce foregut endoderm cells, differentiating foregut endoderm to produce PDX1- positive foregut endoderm cells and then further differentiating the PDXl -positive foregut endoderm cells to produce endocrine precursor cells.
  • the process is continued by allowing the endocrine precursor cells to further differentiate to immature pancreatic islet hormone-expressing cells.
  • differentiation from endocrine precursor cells to immature pancreatic islet hormone-expressing cells proceeds by continuing the incubation of a culture of endocrine precursor cells with a gamma secretase inhibitor for a sufficient time that the cells stop substantially expressing NGN3, and start expressing PAX6, and to permit the cells to become competent to express at least one pancreatic islet cell hormone.
  • the gamma secretase inhibitor is removed about 1 day, about 2 days, about 3 days, about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days or more than about 10 days after the induction of endocrine precursor cells.
  • the gamma secretase inhibitor is N-[N-(3,5-Diflurophenacetyl-L-alanyl)]- S-phenylglycine t-Butyl Ester (DAPT).
  • Certain processes for the production of immature pancreatic islet hormone- expressing cells disclosed herein are mediated by providing a cell culture or cell population comprising human endocrine precursor cells with one or more factors selected from the group consisting of nicotinamide, exendin 4, hepatocyte growth factor (HGF), insulin-like growth factor- 1 (IGF1). In some embodiments, all four of the above-described factors are provided together. In some embodiments, one or more of the above-described factors are provided to the cell culture prior to the differentiation of endocrine precursor cells and remain present in the cell culture during the differentiation of at least a portion of the cells in the cell culture to endocrine precursor cells.
  • HGF hepatocyte growth factor
  • IGF1 insulin-like growth factor- 1
  • one or more of the above-described factors are provided to the cell culture at or about the time of differentiation of a substantial portion of the cells to endocrine precursor cells and remain present in the cell culture until at least a substantial portion of the cells have differentiated into immature pancreatic islet hormone-expressing cells.
  • one or more of the above-described factors are provided at the start of the differentiation process, for example, at the pluripotent cell stage, and remain in the cell culture throughout the differentiation to immature pancreatic islet hormone-expressing cells.
  • nicotinamide In some processes for the production of immature pancreatic islet hormone- expressing cells disclosed herein, nicotinamide, nicotinamide-adenine dinucleotide (NAD), or nicotinic acid is provided to the cells so that it is present in the cell culture or cell population at concentrations sufficient to promote differentiation of at least a portion of the endocrine precursor cells to immature pancreatic islet hormone-expressing cells.
  • nicotinamide is present in the cell culture or cell population at a concentration of at least about 0.1 mM, at least about 0.5 mM, to 1000 mM.
  • exendin 4 is provided to the cells so that it is present in the cell culture or cell population at concentrations sufficient to promote differentiation of at least a portion of the endocrine precursor cells to immature pancreatic islet hormone-expressing cells. In some embodiments, exendin 4 is present in the cell culture or cell population at a concentration of at least about 1 ng/ml at least about 5 ng/ml to 1000 ng/ml.
  • HGF is provided to the cells so that it is present in the cell culture or cell population at concentrations sufficient to promote differentiation of at least a portion of the endocrine precursor cells to immature pancreatic islet hormone-expressing cells.
  • HGF is present in the cell culture or cell population at a concentration of at least about 1 ng/ml at least about 5 ng/ml to 1000 ng/ml.
  • IGF1 is provided to the cells so that it is present in the cell culture or cell population at concentrations sufficient to promote differentiation of at least a portion of the endocrine precursor cells to immature pancreatic islet hormone-expressing cells. In some embodiments, IGF1 is present in the cell culture or cell population at a concentration of at least about 1 ng/ml to 1000 ng/ml.
  • one or more of nicotinamide, exendin 4, HGF and IGF1 are provided after one or more previously provided differentiation factors have been removed from the cell cultures.
  • one or more of nicotinamide, exendin 4, HGF and IGF 1 are provided to cell culture or cell population comprising one or more differentiation factors that were previously provided or provided at about the same time as one or more of nicotinamide, exendin 4, HGF and IGF 1.
  • differentiation factors that were previously provided or provided at about the same time as one or more of nicotinamide, exendin 4, HGF and IGF1 include, but are not limited to, DAPT, FGF-10, KAAD- cyclopamine, activin A, activin B, BMP4 and/or RA.
  • compositions such as cell cultures or cell populations, comprising human cells, including human immature pancreatic islet hormone-expressing cells, wherein the expression of the MAFB, SYP, CHGA, NKX2.2, ISL1, PAX6, NEUROD, PDX1, HB9, GHRL, IAPP, INS GCG, SST, PP, and/or C-peptide marker is greater than the expression of the NGN3, MAFA, MOX1, CER, POU5F1, AFP, SOX7, SOX1, ZIC1 and/or NFM marker in at least about 2% of the human cells.
  • the expression of the MAFB, SYP, CHGA, NKX2.2, ISL1, PAX6, NEUROD, PDX1, HB9, GHRL, IAPP INS GCG, SST, PP, and/or C-peptide marker is greater than the expression of the NGN3, MAFA, MOX1, CER, POU5F1, AFP, SOX7, SOX1, ZIC1 and/or NFM marker in at least about 5% of the human cells, in at least about 10% of the human cells to 95% of the human cells or in at least about 98% of the human cells.
  • the percentage of human cells in the cell cultures or populations, wherein the expression of MAFB, SYP, CHGA, NKX2.2, ISL1, PAX6, NEUROD, PDX1, HB9, GHRL, IAPP, INS GCG, SST, PP, and/or C-peptide is greater than the expression of the NGN3, MAFA, MOX1, CER, POU5F1, AFP, SOX7, SOX1, ZIC1 and/or NFM marker, is calculated without regard to feeder cells.
  • cell cultures and/or cell populations comprising immature pancreatic islet hormone-expressing cells also include a medium which comprises one or more secreted hormones selected from ghrelin, insulin, somatostatin and/or glucagon.
  • the medium comprises C-peptide.
  • the concentration of one or more secreted hormones or C-peptide in the medium ranges from at least about 1 pmol of ghrelin, insulin, somatostatin, glucagon or C- peptide ⁇ g of cellular DNA to at least about 1000 picomoles (pmol) of ghrelin, insulin, somatostatin, glucagon or C-peptide ⁇ g of cellular DNA.
  • v3 ⁇ 4ro-derived pancreatic progenitor cells or PDX-1- positive pancreatic endoderm type cells or equivalents thereof described-above are transplanted into a mammalian subject.
  • the mammalian subject is a human subject.
  • Particularly preferred subjects are those that have been identified as having a condition which limits the ability of the subject to produce sufficient levels of insulin in response to physiologically high blood glucose concentrations.
  • a range of blood glucose levels that constitutes a physiologically high blood glucose level for any particular mammalian species can be readily determined by those of ordinary skill in the art. Any persistent blood glucose level that results in a recognized disease or condition is considered to be a physiologically high blood glucose level.
  • Additional embodiments of the present invention relate to an in vivo insulin secreting cell that is derived from an in vitro pluripotent stem cell or progeny thereof, e.g., multipotent cells, such as PDX-1 positive foregut endoderm cell, a PDX-1 positive pancreatic endoderm or pancreatic progenitor cell, an endocrine precursor, such as an NGN3 positive endocrine precursor, or a functional differentiated hormone secreting cell, such as an insulin, glucagon, somatistatin, ghrelin, or pancreatic polypeptide secreting cell.
  • multipotent cells such as PDX-1 positive foregut endoderm cell, a PDX-1 positive pancreatic endoderm or pancreatic progenitor cell, an endocrine precursor, such as an NGN3 positive endocrine precursor, or a functional differentiated hormone secreting cell, such as an insulin, glucagon, somatistatin, ghrelin, or pancreatic polypeptide
  • any of the above- described terminally differentiated or multipotent cells can be transplanted into the host, or mammal, and mature into physiologically functional hormone secreting cells, such as insulin secreting cells, in response to host blood glucose levels.
  • the cell does not form a teratoma in vivo, and if so formed, remains localized to the area of transplant and can be easily excised or removed.
  • the cell does not contain any karyotypic abnormality during the in vitro differentiation process, or when transplanted into the mammal in vivo, or when maturing and developing into functional islets in vivo.
  • inventions described herein relate to an engineered or genetically recombinant pluripotent cell, multipotent or differentiated cell derived from the pluripotent cell, such as a human iPS cell, based on the description provided herein, it is anticipated that because iPS cells demonstrate similar physiology and gene marker expression profiles to that of hES cells and hES-derived cells, they will have similar physiological characteristics in vivo.
  • the pluripotent, multipotent and differentiated cell composition described herein can be encapsulated in a biological and/or non-biological mechanical device, where the encapsulated device separates and/or isolates the cell compositions from the host.
  • the encapsulation device contains the pluripotent derived cells, for example, PDX-1 positive foregut endoderm cell, a PDX-1 positive pancreatic endoderm or progenitor cell, an endocrine precursor, such as an NGN3 positive endocrine precursor, or a functional differentiated hormone secreting cell, such as an insulin, glucagon, somatistatin, ghrelin, or pancreatic polypeptide secreting cell, in a semipermeable membrane that prevents passage of the transplanted cell population, retaining them in the device, while at the same time permitting passage of certain secreted polypeptides, e.g., insulin, glucagon, somatistatin, ghrelin, pancreatic polypeptide and the like.
  • the device has a plurality of membranes, including a vascularizing membrane.
  • Cellular regulation can be affected through the transduction of extracellular signals across the membrane that, in turn, modulates biochemical pathways within the cell.
  • Protein phosphorylation represents one course by which intracellular signals are propagated from molecule to molecule resulting finally in a cellular response.
  • These signal transduction cascades are highly regulated and often overlapping as evidenced by the existence of many protein kinases as well as phosphatases. It has been reported that in humans, protein tyrosine kinases are known to have a significant role in the development of many disease states including diabetes, cancer and have also been linked to a wide variety of congenital syndromes.
  • Rho kinases are a class of enzymes, which if inhibited can have relevance to the treatment of human disease, including diabetes, cancer, and a variety of inflammatory cardiovascular disorders and AIDS.
  • the majority of inhibitors identified to date act at the ATP-binding site.
  • Such ATP-competitive inhibitors have demonstrated selectivity by virtue of their ability to target the more poorly conserved areas of the ATP-binding site.
  • the Rho kinase family of small GTP binding proteins contains at least 10 members including Rho A-E and G, Rac 1 and 2, Cdc42, and TC10.
  • Rho kinase operates as a primary downstream mediator of Rho and exists as two isoforms: a (ROCK2) and ⁇ (ROCK1).
  • Rho kinase family proteins have a catalytic (kinase) domain in their N-terminal domain, a coiled-coil domain in its middle portion, and a putative pleckstrin-homology (PH) domain in their C- terminal region.
  • Rho-binding domain of ROCK is localized in the C-terminal portion of the coiled-coil domain and the binding of the GTP -bound form of Rho results in enhancement of kinase activity.
  • the Rho/Rho-kinase-mediated pathway plays an important role in the signal transduction initiated by many agonists, including angiotensin II, serotonin, thrombin, endothelin- 1 , norepinephrine, platelet-derived growth factor, ATP/ADP and extracellular nucleotides, and urotensin II.
  • Rho kinase plays an important role in various cellular functions including smooth muscle contraction, actin cytoskeleton organization, cell adhesion and motility and gene expression.
  • inhibitors of these kinases may also be useful for the treatment or prevention of various arteriosclerotic cardiovascular diseases and involved in endothelial contraction.
  • agents which promote and/or support cell growth, survival, proliferation and cell-cell adhesion are added to various cell culture media conditions, including but not limited to, Rho-kinase inhibitors Y-27632, Fasudil (also referred to as HA1077), H-1152P and ITS (insulin/transferrin/selenium; Gibco), Wf-536, Y-30141 (described in U.S. Pat. No.
  • ROCK inhibitors which is incorporated herein by reference in its entirety
  • antisense nucleic acid for ROCK RNA interference inducing nucleic acid (for example, siRNA), competitive peptides, antagonist peptides, inhibitory antibodies, antibody-ScFV fragments, dominant negative variants and expression vectors thereof.
  • RNA interference inducing nucleic acid for example, siRNA
  • competitive peptides for example, competitive peptides
  • antagonist peptides for example, antagonist peptides, inhibitory antibodies, antibody-ScFV fragments, dominant negative variants and expression vectors thereof.
  • ROCK inhibitors since other low molecular compounds are known as ROCK inhibitors, such compounds or derivatives thereof can be also used in the present invention (for example, refer to United State Patent Application Nos.
  • agents function, in part, by promoting re-association of dissociated hES cell, iPS or differentiated cell cultures, e.g., definitive endoderm, foregut endoderm, pancreatic endoderm, pancreatic epithelium, pancreatic progenitor populations, endocrine progenitors and populations and the like.
  • the agents can function when cell dissociation is not performed. Increase in growth, survival, proliferation and cell-cell adhesion of the human pluripotent stem cells was achieved independent of whether the cells were produced from cell aggregates in suspension or from adherent plate cultures (with or with no extracellular matrix components, with or without serum, with or without fibroblast feeders, with or without FGF, with or without Activin).
  • Rho kinase inhibitors such as Y27632 may allow for expansion of differentiated cell types as well by promoting their survival during serial passaging dissociated single cells or from cryogenic preservation.
  • Rho kinase inhibitors such as Y27632 have been tested on human pluripotent stem cells (e.g., hES and iPS cells) and differentiated cells thereof, Rho kinase inhibitors can be applied to other cell types, for example, in general, epithelial cells including but not limited to intestinal, lung, thymus, kidney as well as neural cell types like pigmented retinal epithelium.
  • the concentration of the ROCK inhibitor in the cell culture medium is not limited to that described in the examples below so long as the concentration can achieve the desired effects such as enhancing, increasing, and / or promoting growth, survival, proliferation and cell-cell adhesion of cells is achieved.
  • concentration can range from about 0.01 to about 1000 ⁇ , more preferably about 0.1 to about 100 ⁇ , and even more preferably about 1.0 to about 50 ⁇ , and most preferably about 5 to 20 ⁇ .
  • Fasudil/HA1077 it can be used at about two or three-fold the aforementioned Y-27632 concentration.
  • H-1 152 When H-1 152 is used, it can be used at about fraction, e.g., about l/10 th , l/20 th , l/30 th , l/40 th , 1/50* or l/60 th of the amount of the aforementioned Y-27632 concentration.
  • concentration of ROCK-inhibitor used will depend, in part, on the bioactivity and potentcy of the inhibitor and the conditions in which they are used.
  • the time and period for treating with the ROCK inhibitor may or may not be limited depending on the desired effects such as the enhancing, increasing, and / or promoting growth, survival, proliferation (cell mass) and cell-cell adhesion.
  • addition of a ROCK inhibitor may also affect differentiation in surprising ways as better described in Example 7.
  • the Examples below describe human pluripotent stem cell cultures and / or differentiated cell cultures treated for about 12 hours, 24 hours, 48 hours, or more.
  • the density of the human pluripotent stem cell cultures treated with the ROCK inhibitor is also not limited as far as it is a density at which the desired effects such as the enhancing, increasing, and / or promoting growth, survival, proliferation and cell-cell adhesion of cells is achieved.
  • the cell density of the seeded cells may be adjusted depending on a variety of factors, including but not limited to the use of adherent or suspension cultures, the specific recipe of the cell culture media used, the growth conditions and the contemplated use of the cultured cells.
  • cell culture densities include, but are not limited to, 0.01 x 10 5 cells/ml, 0.05 x 10 5 cells/ml, 0.1 x 10 5 cells/ml, 0.5 x 10 5 cells/ml, 1.0 x 10 5 cells/ml, 1.2 x 10 5 cells/ml, 1.4 x 10 5 cells/ml, 1.6 x 10 5 cells/ml, 1.8 x 105 cells/ml, 2.0 x 10 5 cells/ml, 3.0 x 10 5 cells/ml, 4.0 x 10 5 cells/ml, 5.0 x 10 5 cells/ml, 6.0 x 10 5 cells/ml, 7.0 x 10 5 cells/ml, 8.0 x 10 5 cells/ml, 9.0 x 10 5 cells/ml, or 10.0 x 10 5 cells/ml, or more, e.g., up to 5 x 10 7 cells/mL or more, or any value in between, have been cultured with good cell growth, survival, proliferation and
  • agents that activate TGFp receptor family member include members of the TGFp super family of growth factors, are described herein.
  • TGFp superfamily member or equivalents thereof refers to over 30 structurally related proteins including subfamilies including TGFpl, TGFp2, TF-p3, GDF-15, GDF-9, BMP- 15, BMP- 16, BMP-3, GDF-10, BMP-9, BMP- 10, GDF-6, GDF-5, GDF-7, BMP-5, BMP-6, BMP-7, BMP-8, BMP-2, BMP-4, GDF-3, GDF-1, GDF 11, GDF8, Activins pC, pE, pA and pB, BMP- 14, GDF- 14, MIS, Inhibin alpha, Lefty 1, Lefty2, GDNF, Neurteurin, Persephin and Artemin. See Chang et al. (2002) Endocrine Rev. 23(6):787-823.
  • a TGFp family member can be replaced by, or used in conjunction with, a TGFp signaling pathway activator, which is a compound that stimulates one or more of the polypeptides or interactions that participate in transducing or otherwise effectuating changes in the properties of a cell in response to a TGFp family member.
  • a TGFp signaling pathway includes TGFp family members themselves. TGFp super family members transmit signals to the nucleus by signaling through type II and I serine-threonine kinase receptors and intracellular effectors known as Smads.
  • Type I and type II receptors that act cooperatively to bind ligand and transduce signal (Attisano et al, Mol Cell Biol 16 (3), 1066-1073 (1996)).
  • Ligands bind to type I and II receptors on the cell surface, promoting activation of the type I receptor via phosphorylation. This activated complex in turn activates intracellular Smads, which assemble multi-subunit complexes that regulate transcription.
  • TGFbeta super family are divided into two signaling subgroups: those functionally related to TGF /Activin and those related to the BMP/GDF subfamily.
  • TGF ligands are thought to bind first to a type II receptor and this ligand/type II receptor complex then recruits or phosphorylates a type I receptor (Mathews, L S, Endocr Rev 15:310-325 (1994); Massague, Nature Rev: Mol Cell Biol. 1, 169-178 (2000)).
  • the type II receptor kinase by phosphorylating and activating the type I receptor kinase, which then phosphorylates and activates the Smad proteins.
  • the TGF /Activin ligands bind to TGF and Activin type II receptors and can activate Smad-2 and -3. Nodal and Lefty signal through this Activin-type pathway.
  • the BMP/GDF ligands bind to BMP type II receptors and can activate Smads 1, 5, and 8. See Derynck, R et al. Cell 95, 737-740 (1998)). Upon ligand stimulation, Smads move into the nucleus and function as components of transcription complexes.
  • TGF signaling is regulated positively and negatively though various mechanisms. Positive regulation amplifies signals to a level sufficient for biological activity.
  • TGF superfamily ligands bind to a type II receptor, which recruits and phosphorylates a type I receptor.
  • the type I receptor then phosphorylates receptor-regulated SMADs (R-SMADs e.g., SMAD1, SMAD2, SMAD3, SMAD5, and SMAD 8) which can now bind common mediator Smad or co-SMAD.
  • R-SMAD/coSMAD complexes accumulate in the nucleus where they act as transcription factors and participate in the regulation of target gene expression.
  • Growth differentiation factors include 1, 2, 3, 5, 6, 7, 8, 9, 10, 1 1, and 15.
  • GDF8 and GDF1 are TGF family members that are also TGF signaling pathway activators (positive regulation), and act by binding to the extracellular ligand binding domain portion of the ActRII receptor and then forming a complex with ActRI, leading to the inhibition of the Smad7 negative regulator and phosphorylation of the Smad2/Smad3 complex.
  • the Smad2/Smad3 complex associates with Smad4 to regulate expression of certain genes.
  • Negative regulation of TGF signaling occurs at the extracellular, membrane, cytoplasmic and nuclear levels.
  • Signal transduction can be interrupted in order to repress signaling initiated by TGF .
  • This can be accomplished by any means known in the art in which the interaction between the TGF receptor(s) and the SMAD protein is antagonized or prevented, including proteins that block or compete with TGF receptor and SMAD protein interactions.
  • the transcription or translation of TGF receptor or SMAD protein can be altered by any means known in the art in order to prevent signal transmission along the signaling pathway.
  • Positive and negative regulation of various TGF member proteins is further exemplified by a more detail description of some of the factors below.
  • the concentration of any TGF super family member in the cell culture medium is not limited to that described in the examples below so long as the concentration can achieve the desired effects such as to activate a TGF receptor family member, for example.
  • Activins e.g., Activin A and/or B, or GDF8 and GDF-11
  • a preferable concentration can range from about 10 to about 300 nM, more preferably about 50 to about 200 nM, and even more preferably about 75 to about 150 nM, and most preferably about 100 to 125 nM.
  • concentration can readily test any concentration and using standard techniques in the art can determine the efficacy of such concentration, e.g., evaluating differentiation by determining expression and non-expression of a panel of gene makers for any cell type.
  • iPS Human induced pluripotent stem cells were differentiated in suspension aggregates using a four (4) stage procedure over the course of about 2 weeks (or 14 days) to generate a population of pancreatic cell types including pancreatic progenitors, endocrine progenitors and hormone expressing endocrine cells.
  • the iPS cells described herein were first provided by Shinja Yamanaka and later by CDI. Undifferentiated iPS cells were grown on mitotically inactivated mouse embryo fibroblasts or preferably feeder- free (no fibroblast feeder cell layer) in DMEM/F12 containing 20% Knockout serum replacement. Differentiation was initiated by dissociating the undifferentiated iPS cells to single cells using accutase, cell samples were taken for R A isolation & analysis.
  • the cells were resuspended at 1-2 million cells per milliliter in RPMI + 0.2% vol/vol FBS containing 1 :5000 dilution of insulin-transferrin-selenium (ITS), activin A (lOOng/mL), wnt3a (50ng/mL), and rho-kinase or ROCK inhibitor, Y-27632, at 10 uM, placed into an ultra-low attachment 6-well plate, placed on a rotation platform and rotated at about lOOrpm. Cultures were rotated at lOOrpm for the remainder of the differentiation process with daily media exchange. Growth, passaging and proliferation of iPSC is substantially as described in U.S. Patent Nos. 7,961,402 and 8,21 1,699, the disclosures of which are incorporated herein by reference in their entireties.
  • pluripotent cells e.g., hES or iPS cells
  • cells derived from pluripotent cells are as substantially described in PCT/US2007/062755, filed February 23, 2007, and titled Compositions and methods for culturing differential cells and PCT/US2008/080516, filed October 20, 2008, and titled Methods and compositions for feeder-free pluripotent stem cell media containing human serum, which are herein incorporated by reference in their entireties.
  • the methods described herein can be facilitated by first coating the culturing vessels with an extracellular matrix, e.g., as described in U.S. Patent 6,800,480 to Bodnar et al. and assigned to Geron Corporation.
  • the methods as with other methods for culturing other pluripotent stem cells, e.g., hES and iPS cells can be cultured using soluble human serum as substantially described in U.S. Application, PCT/US2008/080516, filed October 20, 2008, and titled Methods and compositions for feeder-free pluripotent stem cell media containing human serum, which is herein incorporated by reference in its entirety.
  • FGF fibroblast growth factor
  • RNA isolation & analysis During about the first 24 hours of rotation, the single cells adhered to each other formed cell aggregates, and sufficient cell samples were taken for RNA isolation & analysis.
  • the cell aggregates ranged from about 60 microns to 120 microns in diameter.
  • the cultures were fed with RPMI + 0.2% vol/vol FBS containing 1 :5000 dilution of ITS, activin A (100- 200ng/mL), and Wnt3a (50-100ng/mL, or about one day (time 0 to day 1) and an additional day or in the same media but without the Wnt3a (day 1 to day 2).
  • Daily cell samples were taken for RNA isolation and analysis.
  • the cultures were fed RPMI + 0.2% vol/vol FBS containing 1 : 1000 dilution of ITS, KGF (or FGF7, 25ng/mL), and TGF inhibitor no.4 (2.5uM) for one day (or 24 hours, day 2 to day 3).
  • the iPS cell aggregate suspensions were fed with the same growth factor cocktail media, with the exception that the TGF inhibitor was removed from the culture media. Again, cell samples were taken for RNA isolation at the end of this stage (stage 2, or day 5).
  • stage 3 day 5 to day 8
  • the cell culture media was changed to DMEM + 1% vol/vol B27 supplement containing TTNPB [4-[E-2-(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-l-propenyl]benzoic acid] (3nM), KAAD-cyclopamine (0.25 ⁇ ) and noggin (50ng/mL).
  • TTNPB 4-[E-2-(5,6,7,8-Tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-l-propenyl]benzoic acid] (3nM)
  • KAAD-cyclopamine (0.25 ⁇
  • noggin 50ng/mL
  • stage 4 days 8 to dayl4
  • the media was changed to DMEM + 1% vol/vol B27 supplement containing Noggin (50ng/mL), KGF (50ng/mL) and EGF (50ng/mL).
  • Noggin 50ng/mL
  • KGF 50ng/mL
  • EGF 50ng/mL
  • Real-time PCR was performed to measure the gene expression for various marker genes during the course of differentiation.
  • Gene expression of the specific markers or genes was first normalized to the average expression levels of housekeeping genes, cyclophilin G and TATA Binding Protein (TBP) expression. Normalized relative gene expression was then displayed in the bar graphs relative to the expression level in the undifferentiated iPS cells and thus represents the fold up-regulation for the various differentiation markers.
  • TBP TATA Binding Protein
  • Figure 2A-L are bar graphs showing the relative gene expression of the identified gene (e.g., Oct4, Brachyury, Cerl, GSC, FOXA2, FOXA1, HNF6, PDX1, PTF1A, NKX6.1, NGN3 and INS) relative to the expression level of the same gene in the undifferentiated iPS cells.
  • the expression level of the genes were normalized to a set of housekeeping genes (control) and comparing the gene expression level at the two different time points indicated whether the there was up- or down-regulation for that gene or expression marker.
  • OCT4 FIG.2A
  • the gene expression was normalized and the lowest level expression sample was set at 1 (day 14).
  • the relative expression levels of OCT4 represent the fold down-regulation (Y axis) during the course of differentiation (X axis, stage 0 to 4, or day 0 to day 14).
  • OCT4 (POU5F 1) is expressed at high levels in the undifferentiated iPS cells and exhibits subsequent down regulation during the course of differentiation (day 0 to day 14).
  • the OCT4 expression levels were more than 3000- fold decreased from the expression levels observed in undifferentiated cells.
  • brachyury gene (BRACHYURY, FIG.2B) expression during the first 2 days (day 1 and day 2).
  • Transient up-regulation of brachyury was a result of the directed differentiation of pluripotent/iPS cell into mesendoderm by the application of activin A and wnt3a.
  • the mesendoderm was further differentiated into definitive endoderm during days 2 and 3 by continued exposure to activin A was indicated by the up-regulation of CERl, GSC and FOXA2 by the end of stage 1 at day 3 (FIG. 2C-E).
  • the definitive endoderm was further directed to differentiate to gut tube endoderm as indicated by the up-regulation of FOXAl, maintenance of FOXA2 expression and down regulation of CERl and GSC by day 6 of differentiation (FIG. 2C-F).
  • the gut tube endoderm was further directed to differentiate to posterior forgut/PDXl -expressing endoderm as indicated by the up-regulation of HNF6 and PDX1 by day 8 (FIG. 2G-H).
  • stage 4 upon exposure to KGF and EGF, the posterior forgut/PDXl -expressing endoderm was further directed to differentiate to pancreatic progenitors, endocrine progenitors and hormone expressing endocrine cells as indicated by the up-regulation of PTF1A, NKX6-1, NGN3 and INS by day 14 (Figure 2I-L).
  • Methods for differentiating various hES and iPS cell lines are substantially as described herein and in Example 1.
  • apoptotic inhibitor and/ or Rho-kinase or ROCK inhibitor was added to the culture media to enhance and promote growth, survival, proliferation and cell-cell adhesion during differentiation.
  • a Rho-kinase inhibitor for example, Y-27632 was added to the cell cultures at each of the stages.
  • a Rho-kinase inhibitor was added to at least Stages 1 and 2 and stages 4 and 5, or any combination thereof.
  • the morphology and gene marker expression profiles of the differentiated iPS suspension (aggregates) cell cultures are substantially similar to that of suspension cell cultures derived from hES cells.
  • Figures 3 and 4 show immunocytochemistry (ICC) of iPS cell cultures from Stages 4 & 5, respectively.
  • Figure 3 shows a cell aggregate from Stage 4 expressing typical gene markers characteristic of PDX1 -positive pancreatic endoderm (also referred to as pancreatic epithelium or pancreatic progenitors) including PDX1 / NKX6.1 co-positive cells.
  • Stage 4 cells do not express hormone secreting proteins or gene markers more typical of Stage 5 cells such as insulin (INS), glucagon (GCG), somatostatin (SST) and pancreatic polypeptide (PP).
  • Figure 4 shows cell aggregate of hormone expressing cells from Stage 5.
  • pancreatic progenitor populations substantially as described in Examples 1 and 2 were loaded into macro- encapsulating devices substantially similar to that described in U.S. Application 12/618,659, entitled ENCAPSULATION OF PANCREATIC LINEAGE CELLS DERIVED FROM HUMAN PLURIPOTENT STEM CELLS, filed November 13, 2009; and U.S. Patent Nos.
  • the encapsulated cells in the device were then prepared for implantation into a mammal, for example an immuno-compromised SCID/Bg mice, but can be implanted in larger animals including rats, pigs, monkey or human patient.
  • Methods of implanting the encapsulated cells and device are substantially as that described U.S. Patent Application No. 12/618,659, U.S. Patent Nos. 7,534,608 and 7,695,965, including pancreatic progenitor cells implanted on a GELFOAM matrix and implanted under the epididymal fat pad (EFP).
  • immunosuppression may be required for certain mammals for an initial interim period until the progenitors inside the device fully mature and are responsive to glucose. In some mammals immuno-suppression regimens may be for about 1, 2, 3, 4, 5, 6 or more weeks, and will depend on the mammal.
  • the transplanted cells were allowed to differentiate and further mature in vivo. To determine whether the transplanted cells had normal physiological function as a naturally occurring beta cell for example, levels of human insulin will be determined by testing levels of human C-peptide. Human C-peptide is cleaved or processed from human pro-insulin, hence, the detection of human C-peptide specifically, and not endogenous mouse C-peptide, indicates that insulin secretion is derived from the grafted (exogenous) cells. The animals with implants will be tested for levels of human C-peptide about every two, three or four weeks by injecting them with a bolus of arginine or glucose, preferably glucose.
  • the then mature beta cells (derived from differentiated pluripotent iPS cells) should be physiologically functional and responsive to glucose not unlike naturally occurring or endogenous beta cells. Typically amounts of human C- peptide above 50 pM or the average basal (thereshold) level, is an indicator of function of the now beta cells from the transplanted progenitors.
  • pancreatic progenitors derived from hIPS cells are expected to mature into functioning pancreatic islet clusters having endocrine, acinar and ductal cells not unlike that in naturally occurring islets. It is also anticipated that purified or enriched pancreatic progenitors derived from hIPS cells before transplantation will also mature and develop into functioning pancreatic islets and produce insulin in vivo.
  • pancreatic progenitor cells derived from hIPS cells in a macro-encapsulating device mature into physiologically functional pancreatic islets and are expected to produce insulin in response to glucose in vivo.
  • hIPS cell populations were analyzed using flow cytometry for their content of PDX1 -positive pancreatic endoderm or pancreatic progenitor cells (at stage 4); and endocrine or endocrine precursor cells (at stage 5) as shown in Tables 5a, 5b and 6, respectively.
  • Table 5b is the same data set as that in Table 5a, but presented similar to that of Table 9 for comparison.
  • Table 5a populations overlap each other, e.g. the total cell number is greater than 100% because the total PDX1+ and NKX6.1+ numbers overlap with that of the NKX6.1+/PDX1+/CHGA- cell population (5 th column of Table 5a).
  • Table 5b includes the PDX1+ only and triple negative (residual) data, which is not shown in Table 5 a. Certain of these iPEC grafts as well as others using substantially similar formulations did get implanted into animals to determine in vivo function, however, levels of human serum C-peptide was not sufficiently robust for any potential therapeutic purpose (data not shown). Values shown are the percentage of total cells which belong to a given population.
  • pancreatic progenitors NKX6.1(+) /PDX1(+) /ChromograninA(-)
  • NKX6.1+/PDX1-/CHGA- The numbers of the pancreatic progenitors (NKX6.1(+) /PDX1(+) /ChromograninA(-)) and a very small population of NKX6.1+/PDX1-/CHGA- are in the suspension cell aggregates were consistent with that observed in pancreatic progenitor cell suspension aggregates derived from hES cells and aggregated at the ESC stage as described in U.S. Application 12/264,760, entitled STEM CELL AGGREGATE SUSPENSIONCOMPOSITIONS AND METHODS OF DIFFERENTIATION THEREOF, filed November 4, 2008 and incorporated herein by reference in its entirety.
  • Levels of endocrine and / or endocrine precursor cells were also substantially consistent with that obtained in hES-derived cell cultures in U.S. Application 12/107,020, entitled METHODS FOR PURIFYING ENDODERM AND PANCREATIC ENDODERM CELLS DERIVED FROM HES CELLS, filed April 8, 2008, which is herein incorporated in its entirety by reference in its entirety. Similar to hES-derived cell suspension aggregates, varying the concentrations of different growth factors in the culture medium at certain stages of differentiation (e.g., stage 4) should increase and/or decrease certain populations of pancreatic endoderm, endocrine, PDX1- positive endoderm or non-pancreatic cell types.
  • hESC Agg. hESC aggregates
  • XF HA DMEM/F12 containing GlutaMAX, supplemented with 10% v/v of Xeno- free KnockOut Serum Replacement, 1% v/v non-essential amino acids, 0.1 mM 2-mercaptoethanol, 1% v/v penicillin/streptomycin (all from Life Technologies), 10 ng/mL heregulin- ⁇ (Peprotech) and 10 ng/mL activin A (R&D Systems); SP: StemPro® hESC SFM (Life Technologies); r0.2FBS: RPMI 1640 (Mediatech); 0.2% FBS (HyClone), lx GlutaMAX-1 (Life Technologies), 1% v/v penicillin/streptomycin; ITS: Insulin-Transferrin- Selenium (Life Technologies) diluted 1 :5000 or 1 : 1000; A100: 100 ng/mL recombinant human Activin A (R&D Systems);
  • iPS cells are human pluripotent stem cells that have the morphology and gene-expression pattern of hESCs and can form both embryoid bodies in vitro and teratomas in vivo, indicating that they can form cells from all three germ layers. See at least for example Yu et al. (2007); U.S. Patent Application Publication No. 2009/0047263, International Patent Application Publication No. WO2005/80598; U.S. Patent Application Publication No.
  • Applicants sought to explore a differentiation media formulation unique to pancreatic progenitors and/or pancreatic endoderm cells (PEC) i.e., stage 4 derived cells from hiPSC (or "iPEC") that are capable of providing substantially similar robust levels of in vivo function which has been consistently observed for PEC derived from hESC.
  • PEC pancreatic progenitors and/or pancreatic endoderm cells
  • endocrine (CHGA+ cells) cells present in PEC are polyhormonal endocrine cells and are not the sub-population of cells in PEC that give rise to islets having glucose-responsive insulin-secreting cells in vivo. See Kelly et. al.(201 1) supra. Rather it is the non-endocrine cell population (CHGA- cells), especially those that co-express NKX6.1 and PDX-1, that are believed to be the PEC that actually give rise to the functioning islets in vivo.
  • CHGA- cells non-endocrine cell population
  • ERBB is a receptor tyrosine kinase (RTK) and RTK are widely expressed transmembrane proteins that act as receptors for growth factors and other extracellular signaling molecules.
  • RTK receptor tyrosine kinase
  • ERBB tyrosine kinase receptors were also known to be expressed throughout the developing fetal human pancreas although specific roles of certain ERBB receptors and their ligands are unknown. See Mari-Anne Huotari et al. (2002) ERRB Signaling Regulates Lineage Determination of Developing Pancreatic Islet Cells in Embryonic Organ Culture, Endocrinology 143(11): 4437-4446.
  • PEC pancreatic endoderm cells
  • a "steady state” sample of PEC aggregates in db-N50 K50 E50 was collected at the end of stage 4 (or dl3).
  • a "starved” sample represented dl2 PEC aggregates that were fed with db (DMEM high-glucose or DMEM high-glucose supplemented with 0.5x B-27 Supplement (Life Technologies)) media alone (no growth factors) and collected on dl3.
  • Two “pulsed” samples were fed and cultured in db media on dl2, then on dl3 fed with either db-K50 E50 media, or db media containing 2% FBS, for 15 minutes prior to harvesting.
  • Such conditions were intended to detect RTKs that were active in stage 4 conditions, and what response could be elicited with a pulse of KGF, EGF and insulin (present in the B27 supplement), or serum.
  • the serum pulse was intended as a broad-spectrum, growth factor stimuli, potentially identifying RTKs that are present on PEC and can be activated, but are not stimulated with the present stage 4 conditions.
  • RTK analysis was performed essentially as described previously in Wang et al, (2007) supra. Briefly, Proteome ProfilerTM human phospho-RTK antibody arrays (R&D Systems) were used according to the manufacturer's instructions. Protein lysates were prepared in 1% NP-40, 20 mM Tris-HCl (pH 8.0), 137 mM NaCl, 10% glycerol, 2.0 mM EDTA, 1.0 mM sodium orthovanadate, 10 ⁇ g/mL Aprotinin, and 10 ⁇ g/ml Leupeptin.
  • Phosphorylated VEGFR3 was also detected in all conditions and was elevated in the pulsed samples. This suggested that PEC produces an endogenous VEGFR3 ligand, possible candidates being VEGF-C and D.
  • the serum pulse appeared to activate additional receptors, including low levels of ERBB3 phosphorylation.
  • the detection of phosphorylated ERBB2/3 is suggestive that a heregulin-like EGF-family member could activate signaling in PEC.
  • TIE-2 is one of two angiopoietin receptors and appeared to be phosphorylated at a low level in response to serum.
  • Angiopoietin 1 and Angiopoietin 4 are known to be activating ligands of Tie-2, whereas Angiopoietin 2 and Angiopoeitin 3 function as context dependent competitive antagonists.
  • the HGF-receptor (HGFR) was also phosphorylated in response to the serum pulse, suggesting that hepatocyte growth factor could also elicit signaling in PEC.
  • HGFR HGF-receptor
  • EHB2 RTK ephrin B2 RTK
  • ERBB4 was not phosphorylated.
  • RTK analysis therefore highlighted several receptors that are phosphorylated in PEC, or can become phosphorylated in response to different conditions, e.g. serum. These results suggest that several soluble ligands may elicit RTK signaling in PEC and potentially impact cell proliferation, differentiation and/or specification, and therefore, potentially affect later maturation into functioning pancreatic islets in vivo.
  • aggregate disk size increased when Hrgl was increased from lOng/mL to 50ng/mL at stage 3. This result was also observed when 50ng/mL of another growth factor, FGF2, was used at stage 3 as compared to cultures in the absence of FGF2. An increase in cell aggregate size was also observed when the stage 3 cultures were exposed to additional days of FGF2 exposure, e.g. 3 days of 50ng/mL FGF2 as compared to 2 days.
  • Table 9 provides a summary of the flow cytometry analysis of PEC cells treated with Hrgl and FGF2 at stage 3 and/or 4.
  • the endocrine cells are denoted as CHGA positive (or CHGA+) cells and the non-endocrine cells are denoted as CHGA negative (or CHGA-) cells.
  • the endocrine (CHGA+) and non-endocrine cells (CHGA-) may stain positive for other markers, e.g., positive for PDX1 and/or NKX6.1. Cells which do not stain with any of the tested markers are denoted as triple negative cells or residual cells (CHGA-/NKX6.1-/PDX1).
  • Table 9 Flow Cytometry Analysis of PEC Derived From hESC and Treated With Heregulin and/or FGF2
  • Hg Heregulin- ⁇
  • FGF2 Fibroblast growth factor 2
  • HrglO lOng/mL Heregulin- 1 ⁇
  • Hrg50 50ng/mL Heregulin- 1 ⁇
  • 2d FGF-50 50ng/mL of FGF2 for 2 days at stage 3
  • 3d FGF2-50
  • the composition of the PEC populations was analyzed by flow cytometry.
  • the PEC non-endocrine sub-population (CHGA-) increased from 54.01% to 61.2% with the addition of lOng/mL Hrgl p at stage 3, and increased from 54.01% to 64.2% with the addition of 50ng/mL Hrgl p at stage 3.
  • the endocrine sub-population (CHGA+) was not significantly affected with the treatment of lOng/mL Hrglp but more so with 50ng/mL.
  • FGF2 in the stage 3 cultures was similar but even more pronounced than that for Hrglp.
  • the PEC non-endocrine sub-population (CHGA-) increased as it did for Hrglp.
  • the major effect of FGF2 in these cultures was the substantial decrease in the endocrine sub-population. In some instances, these cells were almost non-detectable with 3 days of treatment (32.9% to 0.33%).
  • the increase in cell aggregate size for cultures treated with FGF2 was mostly attributed to the increase in non-endocrine, and in some instances, residual cell sub-populations (13.1% to 22.7% for 3 days at stage 3).
  • Table 10 describes the baseline conditions, with and without heregulin, that were demonstrated to differentiate iPSC to iPEC, which later matured to glucose-responsive islet cells in vivo.
  • the baseline conditions were similar to those described in Examples 1, 2 and 5 as well as Table 7 herein, except that heregulin was added at stages 3 and 4. Although 30ng/mL of ⁇ 3 ⁇ 41 ⁇ was used, concentrations ranging from lOng/mL to 50ng/mL, or even greater than 50ng/mL are suitable. Also, addition of a rho-kinase inhibitor, Y-27632, was maintained in the differentiation cultures as described in Example 2.
  • PEC Pancreatic Endoderm Cells
  • r0.2FBS-ITS 1 5000 A100 W100 Y10 r0.2FBS-ITS 1 :5000 A100 W100 Y10 r0.2FBS-ITS 1 :5000 A100 Y10 r0.2FBS-ITS 1 :5000 A100 Y10
  • iPSC Aggs iPSC aggregates; KSR: knock-out serum (Life Technologies); F10: 10 ng/mL bFGF (R&D Systems); A10: 10 ng/mL Activin A (R&D Systems); A100: 100 ng/mL Activin A; r0.2FBS: RPMI 1640 (Mediatech); 0.2% FBS (HyClone), lx GlutaMAX-1 (Life Technologies), 1% v/v penicillin/streptomycin; ITS: Insulin-Transferrin- Selenium (Life Technologies) diluted 1 :5000 or 1 : 1000; A100: 100 ng/mL recombinant human Activin A (R&D Systems); K25: 25 ng/mL recombinant human GF (R&D Systems); CTT3: 0.25 ⁇ KAAD-Cyclopamine (Toronto Research Chemicals) and 3 nM TTNPB (Sigma- Aldrich); N50: 50:
  • Table 1 1 provides a summary of the flow cytometry analysis of various iPEC populations using the formulations set forth in Table 10, as well as such formulations having been modified by increasing the Activin concentration to 200ng/mL.
  • Table 1 1 shows the general conditions used for each set of experiments (baseline with or without heregulin) and the relative percentages of the types of cells in the iPEC population (endocrine, non-endocrine, PDX1 only and triple negative or residual cell sub-populations).
  • Table 11 also discloses data regarding in vivo function of the cells produced in each experiment.
  • Table 11 iPEC Compositions from Heregulin Treated iPS-derived Cell Cultures
  • FIG. 7A Hg30 St 3+4
  • BL baseline conditions
  • hIPSC human induced pluripotent stem cells
  • hESC human embryonic stem cells
  • CHGA chromogranin A
  • the ratio of subpopulations of cells in the PEC (hESC, E2354) and iPEC (E2314, E2344, E2347) populations were altered. For example, sometimes, the percentage of endocrine (CHGA+) cells decreased and the percentage of non-endocrine cells (CHGA-/NKX6.1+/PDX1+) increased as compared to the baseline (no heregulin) conditions. Although it appeared that heregulin was responsible for changing the proportions of endocrine cells relative to non-endocrine cells in these PEC and iPEC populations, in experiment #2380 (E2380), the level of endocrine (CHGA+) cells increased rather than decreased with the addition of heregulin.
  • PEC and iPEC grafts from most of the experiments described in Table 1 1 were transplanted into mice substantially as previously described herein and in Applicant's other patent and non-patent publications, including Schulz et al. (2012) and Kroon et al (2008), supra and U.S. Patents Nos. 7,534,608; 7,695,965; 7,993,920 and 8,278, 106, supra. Briefly, PEC and iPEC populations were wholly encapsulated with a biodegrabale semi-permeable cell encapsulation device, some of which included micro perforations. The devices were manufactured by Applicant and are described in detail in U.S.
  • Patent No. 8,278,106 entitled ENCAPSULATION OF PANCREATIC CELLS FROM HUMAN PLURIPOTENT STEM CELLS, filed November 13, 2009, the disclosure of which is incorporated herein by reference in its entirety.
  • GSIS Glucose stimulated insulin secretion
  • the amount of human C-peptide released into the serum is indicative of the amount of insulin released.
  • C-peptide is a short 31 amino acid peptide connecting or linking A and B- chains of proinsulin and preproinsulin, which is secreted by functioning beta or insulin secreting cells.
  • human C-peptide measurements are appropriate for assessing the release of de wovo-generated insulin by the implanted cells.
  • levels of human C-peptide in the serum of these animals is a measure of the in vivo function of the mature PEC and iPEC grafts. Human C-peptide was detected in the serum by at least 8 weeks post-implant.
  • Figures 7A-C show human C-peptide levels in the serum post glucose administration for all of the experiments indicated in Table 11 except E2344.
  • Figures 7A-C show that as compared to baseline controls, those grafts resulting from heregulin treatment, in general, had higher levels of serum human C-peptide.
  • FIG. 7A in experiment 2380, there is about a 5-fold increase (933pM : 200pM at 60 minutes post glucose administration) in the grafts resulting from the heregulin treatment as compared to those prepared without heregulin (baseline).
  • the mature iPEC grafts were tested to determine whether they alone were able to maintain euglycemia, similar to euglycemia maintained by PEC derived from hESC, if the host animal's beta cells were destroyed. This involved destroying the beta cells of the implanted mouse using the beta cell toxin, streptozotocin (STZ), which exhibits greater cytotoxicity against murine beta cells as compared to human beta cells. Measurements of random non-fasting blood glucose were taken for each mouse before and after STZ-treatment.
  • hyperglycemia resumed (note the spike in blood glucose), which demonstrates the control of glycemia by the iPEC graft rather than the endogenous mouse pancreas(see FIG. 8A and FIG. 8B.
  • the rho-kinase inhibitor and heregulin treated iPEC matured in vivo exhibiting glucose-stimulated insulin secretion, and were able to maintain euglycemia in a diabetes mouse model (see FIG.7A-B and FIG.8A-B).
  • ERBB functionality requires ligand binding, receptor dimerization, and receptor trafficking. Variability in each process may produce differential regulation of the receptors and the downstream signals they control. For example, distinct ERBB ligands bind ERBB receptors with different affinities, thereby altering the patterns and dynamics of ERBB dimer formation. Table 12 shows the many possible different combinations of ligands and receptor binding complexes. Reviews relating to the complexity of this system are provided by Oda, et al. (2005) A comprehensive pathway map of epidermal growth factor receptor signaling, Mol. Syst. Biol, 1 (2005) and Lazzara et al. (2009) Quantitative modeling perspectives on the ERBB system of cell regulatory processes, Experimental Cell Research 315(4):717— 725, the disclosures of which are incorporated herein by reference in their entireties.
  • ERRB Receptor Tyrosine Kinases ErbBl (also named Herl, or epidermal growth factor receptor, EGFR); ErbB2 (also named human epidermal growth factor receptor, or Her2; or Neu); ErbB3 (also named , Her3), ErbB4 (also named Her4), ERBB Ligands: EGF, epidermal growth factor; TGFcc, transforming growth factor a; HB-EGF, heparin-binding EGF-like growth factor; EPR, epiregulin; EPG, Epigen; AR, amphiregulin, Hrgl, heregulin-1 or neuregulin-1; Hrg2, heregulin-2 or neuregulin-2; Hrg3 , heregulin-3 or neuregulin-3; Hrg4,
  • Huotari et al. suggested that neuregulin-4 may modulate the relative levels of the endocrine cell subpopulations by increasing the number of somatostatin (delta) cells at the expense of glucagon (alpha) cells, and that neuregulin-4 did not affect the ratio of exocrine (e.g., amylase) to endocrine (e.g., B-insulin, cc-glucagon, ⁇ -somatostatin, PP-pancreatic polypeptide) cells.
  • exocrine e.g., amylase
  • endocrine e.g., B-insulin, cc-glucagon, ⁇ -somatostatin, PP-pancreatic polypeptide
  • stage 3 PDX1 negative foregut endoderm
  • stage 4 PDX1 positive foregut endoderm
  • Neuregulin-4 only binds to ERBB4 RTK such that only the endocrine sub-population of the whole mount mouse culture can be modulated by neuregulin-4 in this context.
  • Hrgl would not be expected to modulate the relative endocrine subpopulation as in Huotari because Hrgl has already been shown to bind to ERBB3 and induce dimerization of ERBB2/3.
  • ERBB2 and 3 in PEC due to the low-level expression of ERBB2 and 3 in PEC as shown in FIG.6, it was unclear whether stages 3 and 4 type cells would express low or high levels of ERBB2 and 3 to bind to Hrgl.
  • Hrgl bound to ERRB 2/3 and promoted self-renewal of pluripotent stem cells see Wang et al (2007). Although it is possible that Hrgl may act in the same capacity in the context of stage 3 and 4, Applicant has previously described that most of the cell expansion for production of PEC occurs at the pluripotent stem cell stage (stage 0). During stage 0 the hESC are grown, passaged and expanded for about two
  • Embodiment 1 An in vitro human pancreatic endoderm cell culture.
  • Embodiment 2 The cell culture of embodiment 1, wherein the pancreatic endoderm cells are derived from pluripotent cells.
  • Embodiment 3 The cell culture of embodiment 1 or 2, wherein the cell culture is in contact with an ERBB tyrosine kinase receptor activating agent.
  • Embodiment 4 The cell culture of embodiment 3, wherein the ERBB tyrosine kinase receptor activating agent is EGF (epidermal growth factor), AREG (Amphiregulin), TGF- Alpha (Transforming Growth Factor-Alpha), Btc (Betacellulin), HBEGF (Heparin-Binding EGF), Ereg (Epiregulin), Neuregulins or Heregulins.
  • EGF epidermal growth factor
  • AREG Adiregulin
  • TGF- Alpha Transforming Growth Factor-Alpha
  • Btc Betacellulin
  • HBEGF Heparin-Binding EGF
  • Ereg Epiregulin
  • Neuregulins or Heregulins is EGF (epidermal growth factor), AREG (Amphiregulin), TGF- Alpha (Transforming Growth Factor-Alpha), Btc (Betacellulin), HBEGF (Heparin-Binding EGF),
  • Embodiment s The cell culture of any one of embodiments 1-4, wherein the pancreatic endoderm cells comprise pancreatic progenitor cells and polyhormonal endocrine cells.
  • Embodiment 6 The cell culture of embodiment 5, wherein the pancreatic progenitor cells express NKX6.1 but do not express CHGA.
  • Embodiment 7 The cell culture of embodiment 5, wherein the polyhormonal endocrine cells express CHGA.
  • Embodiment 8 The cell culture of any of embodiments 1-4, wherein the pancreatic endoderm cells comprise CHGA-positive and CHGA -negative cells.
  • Embodiment 9 The cell culture of any one of embodiments 1-8, wherein at least 30% of the pancreatic endoderm cells are CHGA-negative cells.
  • Embodiment 10 The cell culture of any of embodiments 1-9, wherein at least 50% of the pancreatic endoderm cells are PDX1 -positive cells.
  • Embodiment 11 The cell culture of embodiment 3, wherein the ERBB tyrosine kinase receptor activating agent is heregulin-4.
  • Embodiment 12 The cell culture of any one of embodiments 1-11, wherein the cell culture is in contact with a fibroblast growth factor (FGF).
  • FGF fibroblast growth factor
  • Embodiment 13 The cell culture of embodiment 12, wherein the FGF is FGF-7.
  • Embodiment 14 The cell culture of any one of embodiments 1-13, wherein the cell culture is in contact with an ERBB tyrosine kinase receptor activating agent and a FGF.
  • Embodiment 15 The cell culture of any one of embodiments 1-15, wherein the cell culture is in contact with an ERBB tyrosine kinase receptor activating agent and a rho-kinase inhibitor.
  • Embodiment 16 The cell culture of any one of embodiments 1-16, wherein the cell culture is in contact with an ERBB tyrosine kinase receptor activating agent, a FGF and a rho- kinase inhibitor.
  • Embodiment 17 An in vitro human pancreatic endoderm population.
  • Embodiment 18 The cell population of embodiment 17, wherein the pancreatic endoderm cells are derived from pluripotent cells.
  • Embodiment 19 The cell population of embodiment 18, wherein the pluripotent cells are human embryonic stem cells or dedifferentiated genetically reprogrammed cells.
  • Embodiment 20 The cell population of any one of embodiments 17-19, wherein the cell culture is in contact with an ERBB tyrosine kinase receptor activating agent.
  • Embodiment 21 The cell population of embodiment 20, wherein the ERBB tyrosine kinase receptor activating agent is EGF (epidermal growth factor), AREG (Amphiregulin), TGF- Alpha (Transforming Growth Factor-Alpha), Btc (Betacellulin), HBEGF (Heparin-Binding EGF), Ereg (Epiregulin), Neuregulins or Heregulins.
  • EGF epidermal growth factor
  • AREG Adiregulin
  • TGF- Alpha Transforming Growth Factor-Alpha
  • Btc Betacellulin
  • HBEGF Heparin-Binding EGF
  • Ereg Epiregulin
  • Neuregulins or Heregulins is EGF (epidermal growth factor), AREG (Amphiregulin), TGF- Alpha (Transforming Growth Factor-Alpha), Btc (Betacellulin), HBEGF (Heparin-Binding EGF),
  • Embodiment 22 The cell population of any one of embodiments 17-21, wherein the pancreatic endoderm cells comprise pancreatic progenitor cells and polyhormonal endocrine cells.
  • Embodiment 23 The cell population of embodiment 22, wherein the pancreatic progenitor cells express NKX6.1 but do not express CHGA.
  • Embodiment 24 The cell population of embodiment 22, wherein the polyhormonal endocrine cells express CHGA.
  • Embodiment 25 The cell population of any of embodiments 17-24, wherein the pancreatic endoderm cells comprise CHGA-positive and CHGA-negative cells.
  • Embodiment 26 The cell population of any one of embodiments 17-25, wherein at least 30% of the pancreatic endoderm cells are CHGA-negative cells.
  • Embodiment 27 The cell population of any of embodiments 17-26, wherein at least 50% of the pancreatic endoderm cells are PDX1 -positive.
  • Embodiment 28 The cell population of embodiment 20, wherein the ERBB tyrosine kinase receptor activating agent is heregulin-4.
  • Embodiment 29 The cell population of any one of embodiments 17-28, wherein the cell culture is in contact with a fibroblast growth factor (FGF).
  • FGF fibroblast growth factor
  • Embodiment 30 The cell population of embodiment 29, wherein the FGF is FGF-7.
  • Embodiment 31 The cell population of any one of embodiments 17-30, wherein the cell culture is in contact with an ERBB tyrosine kinase receptor activating agent and a FGF.
  • Embodiment 32 The cell population of any one of embodiments 17-30, wherein the cell culture is in contact with an ERBB tyrosine kinase receptor activating agent and a rho-kinase inhibitor.
  • Embodiment 33 The cell population of any one of embodiments 17-20, wherein the cell culture is in contact with an ERBB tyrosine kinase receptor activating agent, a FGF and a rho-kinase inhibitor.
  • Embodiment 34 An in vitro cell population comprising human pancreatic endoderm cells in contact with an ERBB tyrosine kinase receptor activating agent.
  • Embodiment 35 The cell population of embodiment 34, wherein the pancreatic endoderm cells are derived from pluripotent cells.
  • Embodiment 36 The cell population of embodiment 35, wherein the pluripotent cells are human embryonic stem cells or dedifferentiated genetically reprogrammed cells.
  • Embodiment 37 The cell population of any one of embodiments 34-36, wherein the ERBB tyrosine kinase receptor activating agent is EGF (epidermal growth factor), AREG (Amphiregulin), TGF-Alpha (Transforming Growth Factor-Alpha), Btc (Betacellulin), HBEGF (Heparin-Binding EGF), Ereg (Epiregulin), Neuregulins or Heregulins.
  • EGF epidermal growth factor
  • AREG Adiregulin
  • TGF-Alpha Transforming Growth Factor-Alpha
  • Btc Betacellulin
  • HBEGF Heparin-Binding EGF
  • Ereg Epiregulin
  • Embodiment 38 The cell population of any one of embodiments 34-37, wherein the pancreatic endoderm cells comprise pancreatic progenitor cells and polyhormonal endocrine cells.
  • Embodiment 39 The cell population of embodiment 38, wherein the pancreatic progenitor cells express NKX6.1 but do not express CHGA.
  • Embodiment 40 The cell population of embodiment 38, wherein the polyhormonal endocrine cells express CHGA.
  • Embodiment 41 The cell population of any of embodiments 34-40, wherein the pancreatic endoderm cells comprise CHGA-positive and CHGA-negative cells.
  • Embodiment 42 The cell population of any one of embodiments 34-41, wherein at least 30% of the pancreatic endoderm cells are CHGA-negative cells.
  • Embodiment 43 The cell population of any of embodiments 34-42, wherein at least 50% of the pancreatic endoderm cells are PDXl-posative.
  • Embodiment 44 The cell population of any one of embodiments 34-36, wherein the ERBB tyrosine kinase receptor activating agent is heregulin-4.
  • Embodiment 45 The cell population of any one of embodiments 34-44, wherein the human pancreatic endoderm cells are in contact with a fibroblast growth factor (FGF).
  • FGF fibroblast growth factor
  • Embodiment 46 The cell population of embodiment 45, wherein the FGF is FGF-7.
  • Embodiment 47 The cell population of any one of embodiments 34-46, wherein the human pancreatic endoderm cells are in contact with an ERBB tyrosine kinase receptor activating agent and a FGF.
  • Embodiment 48 The cell population of any one of embodiments 34-47, wherein the human pancreatic endoderm cells are in contact with an ERBB tyrosine kinase receptor activating agent and a rho-kinase inhibitor.
  • Embodiment 49 The cell population of any one of embodiments 34-48, wherein the human pancreatic endoderm cells are in contact with an ERBB tyrosine kinase receptor activating agent, a FGF and a rho-kinase inhibitor.
  • Embodiment 50 A method for producing insulin, said method comprising the steps of:
  • step (a) transplanting and maturing the pancreatic endoderm of step (a) in vivo, thereby obtaining insulin secreting cells, wherein the insulin secreting cells secrete insulin in response to glucose stimulation.
  • Embodiment 51 A method for producing insulin, said method comprising the steps of:
  • a contacting foregut endoderm cells derived from dedifferentiated genetically reprogrammed cells in vitro with an ERBB tyrosine kinase receptor activating agent, thereby producing a cell population comprising endocrine and non-endocrine sub-populations;
  • step (a) transplanting and maturing the sub-populations of step (a) in vivo, thereby obtaining insulin secreting cells, wherein the insulin secreting cells secrete insulin in response to glucose stimulation.
  • Embodiment 52 A method for producing insulin, said method comprising the steps of:
  • pancreatic endoderm cells transplanting and maturing pancreatic endoderm cells in vivo, thereby obtaining insulin secreting cells, wherein the insulin secreting cells secrete insulin in response to glucose stimulation.
  • Embodiment 53 The method of embodiment 52, wherein the pancreatic endoderm cells are made by contacting foregut endoderm cells with an ERBB tyrosine kinase receptor activating agent.
  • Embodiment 54 The method of any one of embodiments 50-52 and 53, wherein the ERBB tyrosine kinase receptor activating agent is EGF (epidermal growth factor), AREG (Amphiregulin), TGF-Alpha (Transforming Growth Factor-Alpha), Btc (Betacellulin), HBEGF (Heparin-Binding EGF), Ereg (Epiregulin), Neuregulins or Heregulins.
  • EGF epidermal growth factor
  • AREG Adiregulin
  • TGF-Alpha Transforming Growth Factor-Alpha
  • Btc Betacellulin
  • HBEGF Heparin-Binding EGF
  • Ereg Epiregulin
  • Neuregulins or Heregulins Heregulins.
  • FGF fibroblast growth factor
  • Embodiment 56 The method of embodiment 55, wherein the FGF is FGF-7.
  • Embodiment 57 The method of any one of embodiments 50-52 and 53-56, wherein the foregut endoderm cells are further in contact with a rho-kinase inhibitor.
  • Embodiment 58 The method of any one of embodiments 50-52 and 53-57, wherein the foregut endoderm cells are further in contact with rho-kinase inhibitor and a FGF.
  • Embodiment 59 The method of any one of embodiments 57-58, wherein the rho- kinase inhibitor is selected from the group consisting of Y-27632, Fasudil, H-1152P, Wf-536, Y- 30141, antisense nucleic acids for ROCK, RNA interference inducing nucleic acid, competitive peptides, antagonist peptides, inhibitory antibodies, antibody-ScFV fragments, dominant negative variants, derivatives and expression vectors thereof.
  • the rho- kinase inhibitor is selected from the group consisting of Y-27632, Fasudil, H-1152P, Wf-536, Y- 30141, antisense nucleic acids for ROCK, RNA interference inducing nucleic acid, competitive peptides, antagonist peptides, inhibitory antibodies, antibody-ScFV fragments, dominant negative variants, derivatives and expression vectors thereof.
  • Embodiment 60 The method of any one of embodiments 57-59, wherein the rho- kinase inhibitor is selected from the group consisting of Y-27632, Fasudil, H-1152P, Wf-536 and Y-30141 and derivatives thereof.
  • Embodiment 61 The method of any one of embodiments 57-60, wherein the Rho- kinase inhibitor is selected from the group consisting of Y-27632, Fasudil and H-1152P, and derivatives thereof.
  • Embodiment 62 The method of embodiment 50, wherein the pancreatic endoderm comprises endocrine and non-endocrine cell sub-populations.
  • Embodiment 63 The method of embodiment 62 wherein the endocrine cell sub- population is a CHGA positive (CHGA+) cell.
  • Embodiment 64 The method of embodiment 62, wherein the non-endocrine cell sub-population is CHGA negative (CHGA-)
  • Embodiment 65 The method of embodiment 62, wherein the non-endocrine cell sub-population expresses NKX6.1.
  • Embodiment 66 The method of embodiment 50, wherein at least 30% of the pancreatic endoderm is CHGA-negative.
  • Embodiment 67 The method of embodiment 50, wherein at least 50% of the pancreatic endoderm is PDX1 -positive.
  • Embodiment 68 A method for producing insulin, said method comprising the steps of:
  • a contacting dedifferentiated genetically reprogrammed cells in vitro with a first medium comprising an agent that activates a TGF receptor family member; b. culturing, in vitro, the cells of step (a) in a second medium lacking the agent that activates a TGF receptor family member, thereby generating foregut endoderm cells;
  • Embodiment 69 The method of embodiment 68, wherein the non-endocrine cell is a CHGA negative (CHGA-) cell.
  • Embodiment 70 The method of any one of embodiments 68-69, wherein the endocrine cell is a CHGA positive (CHGA+) cell.
  • Embodiment 71 The method of embodiment 69, wherein the CHGA negative (CHGA-) cell expresses NKX6.1.
  • Embodiment 72 The method of embodiment 69, wherein the foregut endoderm cells of (b) are contacted with a rho-kinase inhibitor.
  • Embodiment 73 The method of embodiment 69, wherein the foregut endoderm cells of (b) are contacted with a FGF.
  • Embodiment 74 The method of embodiment 69, wherein the foregut endoderm cells of (b) are contacted with a rho-kinase inhibitor and a FGF.
  • Embodiment 75 The method of any of embodiments 72-74, wherein the rho-kinase inhibitor is selected from the group consisting of Y-27632, Fasudil, H-l 152P, Wf-536, Y-30141, antisense nucleic acids for ROCK, RNA interference inducing nucleic acid, competitive peptides, antagonist peptides, inhibitory antibodies, antibody-ScFV fragments, dominant negative variants, derivatives and expression vectors thereof.
  • the rho-kinase inhibitor is selected from the group consisting of Y-27632, Fasudil, H-l 152P, Wf-536, Y-30141, antisense nucleic acids for ROCK, RNA interference inducing nucleic acid, competitive peptides, antagonist peptides, inhibitory antibodies, antibody-ScFV fragments, dominant negative variants, derivatives and expression vectors thereof.
  • Embodiment 76 A method of increasing the percentage of non-endocrine cells in a pancreatic endoderm cell population compared to endocrine cells comprising.
  • Embodiment 77 The method of embodiment 76, wherein the foregut endoderm cells are contacted with a FGF.
  • Embodiment 78 The method of embodiment 76, wherein the foregut endoderm cells are contacted with a rho-kinase inhibitor.
  • Embodiment 79 The method of embodiment 76, wherein the foregut endoderm cells are further contacted with a FGF and a rho-kinase inhibitor.
  • Embodiment 80 A method for improving the glucose responsiveness of implanted pancreatic endoderm comprising:
  • pancreatic endoderm transplanting and maturing the pancreatic endoderm in vivo, thereby obtaining insulin secreting cells, wherein the insulin secreting cells secrete insulin better than insulin secreting cells derived from pancreatic endoderm made without contacting foregut endoderm cells with an ERBB tyrosine kinase receptor activating agent.
  • Embodiment 81 The method of embodiment 80, wherein the pancreatic endoderm cells are derived from dedifferentiated genetically reprogrammed cells.
  • Embodiment 82 A method for producing insulin comprising (a) contacting live cells with an ERBB tyrosine kinase receptor activating agent and (b) transplanting and maturing the cells at the end of step a, thereby obtaining insulin secreting cells, wherein the insulin secreting cells secrete insulin in response to glucose stimulation.
  • Embodiment 83 The method of embodiment 82, wherein the live cells are foregut endoderm or PDX1 negative foregut endoderm.
  • Embodiment 84 The method of any one of embodiments 82-83, wherein the live cells are derived from dedifferentiated genetically reprogrammed cells.
  • Embodiment 85 A cell population comprising endocrine and non-endocrine cell sub-populations.
  • Embodiment 86 The cell population of embodiment 85, wherein the endocrine and non-endocrine cell sub-populations are derived from pluripotent cells.
  • Embodiment 87 The cell population of embodiment 86, wherein the pluripotent cells are human embryonic stem cells or dedifferentiated genetically reprogrammed cells.
  • Embodiment 88 The cell population of any one of embodiments 85-87, wherein the ERBB tyrosine kinase receptor activating agent is EGF (epidermal growth factor), AREG (Amphiregulin), TGF-Alpha (Transforming Growth Factor-Alpha), Btc (Betacellulin), HBEGF (Heparin-Binding EGF), Ereg (Epiregulin), Neuregulins or Heregulins.
  • EGF epidermal growth factor
  • AREG Adiregulin
  • TGF-Alpha Transforming Growth Factor-Alpha
  • Btc Betacellulin
  • HBEGF Heparin-Binding EGF
  • Ereg Epiregulin
  • Neuregulins or Heregulins is EGF (epidermal growth factor), AREG (Amphiregulin), TGF-Alpha (Transforming Growth Factor-Alpha), Btc (Betacellulin), HBEGF (
  • Embodiment 89 The cell population of any of embodiments 85-88, wherein the non-endocrine cells express NKX6.1 but do not express CHGA.
  • Embodiment 90 The cell population of any of embodiments 85-89, wherein the endocrine cells express CHGA.
  • Embodiment 91 The cell population of any one of embodiments 85-90, wherein at least 30% of the cells are CHGA-negative cells.
  • Embodiment 92 The cell population of any of embodiments 85-91, wherein at least 50% of the cells are PDXl -positive.
  • Embodiment 93 The cell population of any one of embodiments 85-92, wherein the ERBB tyrosine kinase receptor activating agent is heregulin-4.
  • Embodiment 94 The cell population of any one of embodiments 85-93, wherein the cell culture is in contact with a fibroblast growth factor (FGF).
  • FGF fibroblast growth factor
  • Embodiment 95 The cell population of embodiment 94, wherein the FGF is FGF-7.
  • Embodiment 96 The cell population of any one of embodiments 85-95 wherein the cell culture is in contact with an ERBB tyrosine kinase receptor activating agent and a FGF.
  • Embodiment 97 The cell population of any one of embodiments 85-96, wherein the cell culture is in contact with an ERBB tyrosine kinase receptor activating agent and a rho-kinase inhibitor.
  • Embodiment 98 The cell population of any one of embodiments 85-97, wherein the cell culture is in contact with an ERBB tyrosine kinase receptor activating agent, a FGF and a rho-kinase inhibitor.
  • Embodiment 99 A method for producing insulin, the method comprising the steps of: (a) contacting dedifferentiated genetically reprogrammed cells in vitro with a first medium comprising an agent that activates a TGFp receptor family member; (b) culturing, in vitro, the cells of step (a) in a second medium lacking the agent that activates a TGFp receptor family member, thereby generating at least a foregut endoderm or at least a PDXl negative foregut endoderm cells; (c) contacting the cells of (b) with an ERBB tyrosine kinase receptor activating agent, thereby generating a cell population comprising endocrine and non-endocrine cell sub- populations; and (d) transplanting and maturing the cell populations of (c) in vivo, thereby obtaining insulin secreting cells, wherein the insulin secreting cells secrete insulin in response to glucose stimulation.
  • Embodiment 100 A method for producing insulin, the method comprising the steps of: (a) contacting a PDXl -positive cell with an ERBB tyrosine kinase receptor activating agent and (b) transplanting and maturing the cell population of (a) in vivo, thereby obtaining insulin secreting cells, wherein the insulin secreting cells secrete insulin in response to glucose stimulation.
  • Embodiment 101 The method of embodiments 68 or 99, wherein a rho-kinase inhibitor is added at step a, b or c.
  • Embodiment 102 The method of embodiments 68 or 99, wherein a rho-kinase inhibitor is added at step a, b and c.
  • Embodiment 103 The method of any one of embodiments 68 or 99-100, wherein a rho-kinase inhibitor is added at step a and b.
  • Embodiment 104 The method of embodiments 68 or 99, wherein a ERBB tyrosine kinase receptor activating agent is added at step a or c.
  • Embodiment 105 The method of embodiments 68 or 99, wherein a ERBB tyrosine kinase receptor activating agent is added at step a and c.
  • Embodiment 106 A method of generating a cell population capable of maturing to glucose-responsive insulin-secreting cells in vivo comprising: contacting a population of at least foregut endoderm, at least PDX1 negative foregut endoderm, or at least a population of PDX1 positive pancreatic endoderm cells with an ERBB receptor tyrosine kinase activating agent, thereby generating a cell population capable of maturing to glucose-responsive insulin-secreting cells in vivo
  • Embodiment 107 A method for producing pancreatic endoderm, said method comprising the steps of:

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Diabetes (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Obesity (AREA)
  • General Chemical & Material Sciences (AREA)
  • Hematology (AREA)
  • Endocrinology (AREA)
  • Emergency Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne des compositions de culture cellulaire, par exemple des compositions de culture cellulaire pancréatique, issues de cellules souches pluripotentes reprogrammées humaines dédifférenciées, telles que des cellules souches pluripotentes induites (iPS) et des procédés de production et d'utilisation de telles compositions de culture cellulaire.
EP14708981.7A 2013-02-06 2014-02-06 Compositions cellulaires issues de cellules reprogrammées dédifférenciées Pending EP2954045A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US13/761,078 US9109245B2 (en) 2009-04-22 2013-02-06 Cell compositions derived from dedifferentiated reprogrammed cells
PCT/US2014/015156 WO2014124172A1 (fr) 2013-02-06 2014-02-06 Compositions cellulaires issues de cellules reprogrammées dédifférenciées

Publications (1)

Publication Number Publication Date
EP2954045A1 true EP2954045A1 (fr) 2015-12-16

Family

ID=50239931

Family Applications (1)

Application Number Title Priority Date Filing Date
EP14708981.7A Pending EP2954045A1 (fr) 2013-02-06 2014-02-06 Compositions cellulaires issues de cellules reprogrammées dédifférenciées

Country Status (8)

Country Link
EP (1) EP2954045A1 (fr)
JP (4) JP6517702B2 (fr)
AU (4) AU2014214879A1 (fr)
CA (2) CA3212301A1 (fr)
HK (1) HK1218139A1 (fr)
IL (4) IL311689A (fr)
RU (2) RU2754089C2 (fr)
WO (1) WO2014124172A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11471398B2 (en) 2017-06-14 2022-10-18 Vertex Pharmaceuticals Incorporated Devices and methods for delivering therapeutics

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9109245B2 (en) 2009-04-22 2015-08-18 Viacyte, Inc. Cell compositions derived from dedifferentiated reprogrammed cells
CA2957000C (fr) 2014-08-04 2023-08-01 Takeda Pharmaceutical Company Limited Procede de multiplication de cellules progenitrices pancreatiques
MA45479A (fr) * 2016-04-14 2019-02-20 Janssen Biotech Inc Différenciation de cellules souches pluripotentes en cellules de l'endoderme de l'intestin moyen
CN111349604B (zh) 2016-05-18 2023-12-12 学校法人庆应义塾 类器官培养用细胞培养基、培养方法及类器官
WO2018139600A1 (fr) 2017-01-27 2018-08-02 株式会社カネカ Masse cellulaire endodermique, et procédé de production d'une masse cellulaire quelconque parmi trois masses cellulaires de feuillet embryonnaire primaires à partir de cellules pluripotentes
US20210292708A1 (en) * 2018-08-03 2021-09-23 Kyoto University Cell production method
US20210353686A1 (en) * 2018-09-19 2021-11-18 Takeda Pharmaceutical Company Limited Insulin-producing cells
AU2020282355B2 (en) 2019-05-31 2023-11-02 Viacyte, Inc. A biocompatible membrane composite
CA3139590C (fr) 2019-05-31 2024-01-23 W. L. Gore & Associates, Inc. Composite a membrane biocompatible
EP3975926A1 (fr) 2019-05-31 2022-04-06 W.L. Gore & Associates, Inc. Composite à membrane biocompatible
CN114401752B (zh) 2019-05-31 2023-04-04 W.L.戈尔及同仁股份有限公司 具有受控氧扩散距离的细胞封装装置

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IL145674A0 (en) * 1999-04-06 2002-06-30 Genentech Inc USE OF ERbB RECEPTOR LIGANDS IN TREATING DIABETES
US6759039B2 (en) * 2000-06-30 2004-07-06 Amcyte, Inc. Culturing pancreatic stem cells having a specified, intermediate stage of development
CA2435826A1 (fr) * 2001-01-24 2002-08-01 The Government Of The United States Of America Differenciation de cellules souches par rapport aux ilots pancreatiques
EP1941032A2 (fr) * 2005-10-14 2008-07-09 Regents Of The University Of Minnesota Differenciation de cellules souches non-embryonnaires avec des cellules possedant un phenotype pancreatique
WO2007143193A1 (fr) * 2006-06-02 2007-12-13 University Of Georgia Research Foundation, Inc. Cellules et tissu de l'endoderme pancréatique et hépatique obtenus par différenciation de cellules endodermiques définitives issues de cellules souches embryonnaires humaines
EP4176888A1 (fr) * 2008-11-14 2023-05-10 ViaCyte, Inc. Encapsulation de cellules pancréatiques dérivées de cellules souches pluripotentes humaines
DK2421957T3 (da) * 2009-04-22 2021-01-25 Viacyte Inc Cellesammensætninger afledt af dedifferentierede omprogrammerede celler
CN102741396B (zh) * 2009-04-27 2017-10-20 威盛细胞有限公司 支持多能细胞生长的小分子和其方法

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KROON EVERT ET AL: "Pancreatic endoderm derived from human embryonic stem cells generates glucose-responsive insulin-secreting cells in vivo", NATURE BIOTECHNOLOGY, NATURE PUBLISHING GROUP US, NEW YORK, vol. 26, no. 4, 1 April 2008 (2008-04-01), pages 443 - 452, XP002561975, ISSN: 1087-0156, [retrieved on 20080220], DOI: 10.1038/NBT1393 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11471398B2 (en) 2017-06-14 2022-10-18 Vertex Pharmaceuticals Incorporated Devices and methods for delivering therapeutics

Also Published As

Publication number Publication date
IL290717B2 (en) 2024-10-01
RU2018144412A (ru) 2019-03-25
CA2898431A1 (fr) 2014-08-14
JP2016506736A (ja) 2016-03-07
HK1218139A1 (zh) 2017-02-03
JP7250731B2 (ja) 2023-04-03
JP6517702B2 (ja) 2019-05-22
AU2014214879A1 (en) 2015-07-30
AU2022200075B2 (en) 2023-02-02
AU2023202507A1 (en) 2023-05-11
JP2019146578A (ja) 2019-09-05
AU2019201314B2 (en) 2021-10-14
RU2018144412A3 (fr) 2020-02-14
AU2022200075A1 (en) 2022-02-03
IL311689A (en) 2024-05-01
IL283088A (en) 2021-06-30
WO2014124172A1 (fr) 2014-08-14
IL290717A (en) 2022-04-01
JP2023017838A (ja) 2023-02-07
CA2898431C (fr) 2023-10-17
IL239953B (en) 2021-05-31
RU2675928C2 (ru) 2018-12-25
JP6721752B2 (ja) 2020-07-15
RU2015131279A (ru) 2017-03-13
JP7550830B2 (ja) 2024-09-13
IL283088B (en) 2022-04-01
JP2020178694A (ja) 2020-11-05
CA3212301A1 (fr) 2014-08-14
IL290717B1 (en) 2024-06-01
IL239953A0 (en) 2015-08-31
AU2022200075C1 (en) 2023-07-06
RU2754089C2 (ru) 2021-08-26
AU2019201314A1 (en) 2019-03-14

Similar Documents

Publication Publication Date Title
US11905530B2 (en) Cell encapsulation device comprising a pancreatic progenitor cell population
AU2021266324B2 (en) In vitro differentiation of pluripotent stem cells to pancreatic endoderm cells (pec) and endocrine cells
AU2022200075C1 (en) Cell compositions derived from dedifferentiated reprogrammed cells
EP2421957B1 (fr) Compositions cellulaires issues de cellules reprogrammées dédifférenciées

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20150729

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAX Request for extension of the european patent (deleted)
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1218139

Country of ref document: HK

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

17Q First examination report despatched

Effective date: 20170316

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: EXAMINATION IS IN PROGRESS

RAP3 Party data changed (applicant data changed or rights of an application transferred)

Owner name: VIACYTE, INC.

REG Reference to a national code

Ref country code: HK

Ref legal event code: WD

Ref document number: 1218139

Country of ref document: HK