EP2788381A2 - Antibodies for epidermal growth factor receptor 3 (her3) directed to domain iii and domain iv of her3 - Google Patents

Antibodies for epidermal growth factor receptor 3 (her3) directed to domain iii and domain iv of her3

Info

Publication number
EP2788381A2
EP2788381A2 EP12816130.4A EP12816130A EP2788381A2 EP 2788381 A2 EP2788381 A2 EP 2788381A2 EP 12816130 A EP12816130 A EP 12816130A EP 2788381 A2 EP2788381 A2 EP 2788381A2
Authority
EP
European Patent Office
Prior art keywords
her3
seq
antibody
fragment
ligand
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP12816130.4A
Other languages
German (de)
English (en)
French (fr)
Inventor
Winfried Elis
Seth Ettenberg
Andrew Paul Garner
Nicole Haubst
Heather Huet
Christian Carsten Silvester KUNZ
Elizabeth Anne REISINGER SPRAGUE
Qing SHENG
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis AG
Original Assignee
Novartis AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis AG filed Critical Novartis AG
Publication of EP2788381A2 publication Critical patent/EP2788381A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/08Drugs for disorders of the urinary system of the prostate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/10Drugs for disorders of the urinary system of the bladder
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P21/00Drugs for disorders of the muscular or neuromuscular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • A61K2039/507Comprising a combination of two or more separate antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/34Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/55Fab or Fab'
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • the present invention relates to antibodies or fragments thereof that bind to a non-linear epitope within domain 3 of the HER3 receptor and inhibit both ligand-dependent and ligand- independent signal transduction.
  • the invention also relates antibodies or fragments thereof that bind to amino acid residues within domains 3-4 of HER3 and inhibit both ligand- dependent and ligand-independent signal transduction; and compositions and methods of use of such antibodies or fragments thereof.
  • the human epidermal growth factor receptor 3 (ErbB3, also known as HER3) is a receptor protein tyrosine kinase and belongs to the epidermal growth factor receptor (EGFR) subfamily of receptor protein tyrosine kinases, which also includes EGFR (HER1, ErbBl), HER2 (ErbB2, Neu), and HER4 (ErbB4) (Plowman et al, (1990) Proc. Natl. Acad. Sci. U.S.A.
  • EGFR epidermal growth factor receptor
  • the transmembrane receptor HER3 consists of an extracellular ligand- binding domain (ECD), a dimerization domain within the ECD, a transmembrane domain, an intracellular protein tyrosine kinase-like domain (TKD) and a C-terminal phosphorylation domain.
  • ECD extracellular ligand- binding domain
  • TKD intracellular protein tyrosine kinase-like domain
  • C-terminal phosphorylation domain Unlike the other HER family members, the kinase domain of HER3 displays very low intrinsic kinase activity.
  • the ligands neuregulin 1 (NRG) or neuregulin 2 bind to the extracellular domain of HER3 and activate receptor-mediated signaling pathway by promoting dimerization with other dimerization partners such as HER2. Heterodimerization results in activation and
  • HER3 heterodimerization can also occur in the absence of activating ligands and this is commonly termed ligand-independent HER3 activation.
  • HER2 when HER2 is expressed at high levels as a result of gene amplification (e.g. in breast, lung, ovarian or gastric cancer) spontaneous HER2/HER3 dimers can be formed. In this situation the HER2/HER3 is considered the most active ErbB signaling dimer and is therefore highly transforming.
  • Increased HER3 has been found in several types of cancer such as breast, lung,
  • the invention is based on the surprising discovery of antibodies or fragments thereof that bind to a non- linear epitope of HER3 receptor comprising amino acid residues within domain 3 of HER3 and block both ligand-dependent (e.g. neuregulin) and ligand-independent HER3 signaling pathways.
  • the invention is also based on the discovery of antibodies or fragments thereof that bind to amino acid residues within domains 3-4 of HER3 and block both ligand- dependent (e.g. neuregulin) and ligand-independent HER3 signaling pathways.
  • the invention pertains to an isolated antibody or fragment thereof that recognizes a non-linear epitope of a HER3 receptor, wherein the non-linear epitope comprises amino acid residues within domain 3 of the HER3 receptor, wherein the antibody or fragment thereof binds to binding surface B, and wherein the antibody or fragment thereof blocks both ligand-dependent and ligand-independent signal transduction.
  • binding surface B comprises at least one amino acid residue selected from a group consisting of amino acid residues 335-342, 398,400, 424-428, 431, 433-434 and 455.
  • the antibody or fragment thereof further binds to binding surface A.
  • binding surface A comprises at least one amino acid residue selected from a group consisting of amino acid residues 362-376.
  • the invention pertains to an isolated antibody or fragment thereof that recognizes a non-linear epitope of a HER3 receptor, wherein the non-linear epitope comprises amino acid residues within domain 3 of the HER3 receptor, wherein the antibody or fragment thereof binds to a binding surface comprising at least one amino acid residue selected from binding surface A and at least one amino acid residue selected from binding surface B, and wherein the antibody or fragment thereof blocks both ligand-dependent and ligand- independent signal transduction.
  • the antibody or fragment thereof blocks HER3 ligand binding on the HER3 receptor.
  • the HER3 ligand is selected from the group consisting of neuregulin 1 (NRG), neuregulin 2, betacellulin, heparin-binding epidermal growth factor, and epiregulin.
  • the antibody or fragment thereof has any one of the characteristics selected from the group consisting of binding to the inactive state of the HER3 receptor, preventing HER3 adopting an active conformation due to steric hindrance between the antibody or fragment thereof and domains of HER3, preventing HER3 adopting an active conformation by reducing the degree of flexibility in domain 3, inducing a conformational change in domain 3 residues 371-377 that prevents HER3 from adopting an active
  • binding surface A comprises amino acid residues 362-376.
  • binding surface B comprises amino acid residues 335-342, 398,400, 424-428, 431, 433-434 and 455.
  • the non-linear epitope comprises amino acid residues 335-342, 362-376, 398,400, 424-428, 431, 433-434 and 455 (within domain 3), or a subset thereof.
  • the VH of the antibody or fragment thereof binds to at least one of the following HER3 residues: Ile365, Thr366, Asn369, Gly370, Asp371, Pro372, Trp373, His374, Lys375, Gln400, and Lys434.
  • the VL of the antibody or fragment thereof binds to at least one of the following HER3 residues: Gly335, Ser336, Gly337, Ser338, Phe340, Gln341, Asp362, Leu364, Ile365, Thr366, His374, Ile376, Asn398, Gln400, Tyr424, Asn425, Arg426, Phe428, Leu431, Met433, Lys434, Tyr455.
  • binding of the antibody or fragment thereof to the HER3 receptor in the absence of a HER3 ligand reduces ligand-independent formation of a HER2-HER3 protein complex in a cell which expresses HER2 and HER3.
  • the antibody or fragment thereof inhibits
  • the HER3 ligand-independent phosphorylation assay uses HER2 amplified cells, wherein the HER2 amplified cells are SK-Br-3 cells and BT-474.
  • binding of the antibody or fragment thereof to the HER3 receptor in the presence of a HER3 ligand reduces ligand-dependent formation of a HER2-HER3 protein complex in a cell which expresses HER2 and HER3.
  • the antibody or fragment thereof inhibits phosphorylation of HER3 as assessed by HER3 ligand-dependent phosphorylation assay.
  • the HER3 ligand-dependent phosphorylation assay uses stimulated MCF7 cells in the presence of neuregulin (NRG).
  • the antibody is selected from the group consisting of a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a humanized antibody, and a synthetic antibody.
  • the invention pertains to isolated antibody or fragment thereof that recognizes an epitope of a HER3 receptor, wherein the epitope comprises amino acid residues within domains 3-4 of the HER3 receptor, and wherein the antibody or fragment thereof blocks both ligand-dependent and ligand-independent signal transduction.
  • the epitope comprises at least one amino acid residue selected from the group consisting of amino acid residues: 329-498 (domain 3) of SEQ ID NO: 1, and at least one amino acid residue selected from the group consisting of amino acid residues 499-642 (domain 4) of SEQ ID NO: 1.
  • the epitope comprising amino acid residues within domains 3-4 is selected from the group consisting of a linear epitope, a non-linear epitope, and a conformational epitope.
  • binding of the antibody or fragment thereof to the HER3 receptor in the absence of a HER3 ligand reduces ligand- independent formation of a HER2-HER3 protein complex in a cell which expresses HER2 and HER3.
  • the antibody or fragment thereof inhibits phosphorylation of HER3 as assessed by a HER3 ligand-independent phosphorylation assay.
  • the HER3 ligand-independent phosphorylation assay uses HER2 amplified cells, wherein the HER2 amplified cells are SK-Br-3 cells and BT-474.
  • binding of the antibody or fragment thereof to the HER3 receptor in the presence of a HER3 ligand reduces ligand-dependent formation of a HER2-HER3 protein complex in a cell which expresses HER2 and HER3.
  • the antibody or fragment thereof inhibits
  • the HER3 ligand-dependent phosphorylation assay uses stimulated MCF7 cells in the presence of neuregulin (NRG).
  • NGF neuregulin
  • the invention pertains to an isolated antibody or fragment thereof to a HER3 receptor, having a dissociation (K D ) of at least 1 x 10 7 M “1 , 10 8 M “1 , 10 9 M “1 , 10 10 M “1 , 10 11 M “ 10 12 M “1 , 10 13 M “1 , wherein the antibody or fragment thereof blocks both ligand-dependent and ligand-independent signal transduction.
  • the antibody or fragment thereof inhibits phosphorylation of HER3 as measured by an in vitro phosphorylation assay selected from the group consisting of phospho-HER3 and phospho-Akt.
  • the invention pertains to an isolated antibody or fragment thereof binds to the same non- linear epitope within domain 3 of HER3 as an antibody described in Table 1. In another aspect, the invention pertains to an isolated antibody or fragment thereof, binds to the same amino acid residues within domains 3-4 of HER3 as an antibody described in Table 2.
  • the invention pertains to a fragment of an antibody that binds to HER3 selected from the group consisting of; Fab, F(ab 2 )', F(ab) 2 ', scFv, VHH, VH, VL, dAbs, wherein the fragment of the antibody blocks both ligand-dependent and ligand-independent signal transduction.
  • the invention pertains to a pharmaceutical composition
  • a pharmaceutical composition comprising an antibody or fragment thereof and a pharmaceutically acceptable carrier.
  • the pharmaceutical composition further comprises an additional therapeutic agent.
  • the additional therapeutic agent is selected from the group consisting of an HERl inhibitor, a HER2 inhibitor, a HER3 inhibitor, a HER4 inhibitor, an mTOR inhibitor and a PI3 Kinase inhibitor.
  • the additional therapeutic agent is a HERl inhibitor selected from the group consisting of Matuzumab (EMD72000),
  • HER2 inhibitor selected from the group consisting of Pertuzumab, Trastuzumab, MM-111, neratinib, lapatinib or lapatinib ditosylate /Tykerb®; a HER3 inhibitor selected from the group consisting of, MM- 121, MM-111, IB4C3, 2DID12 (U3 Pharma AG), AMG888 (Amgen), AV-203(Aveo), MEHD7945A
  • the additional therapeutic agent is a HER3 inhibitor, wherein the HER3 inhibitor is MORI 0703.
  • the additional therapeutic agent is an mTOR inhibitor selected from the group consisting of Temsirolimus/Torisel®, ridaforolimus / Deforolimus, AP23573, MK8669, everolimus /Affinitor®.
  • the additional therapeutic agent is a PI3 Kinase inhibitor selected from the group consisting of GDC 0941, BEZ235, BKM120 and BYL719.
  • the invention pertains to a method of treating a cancer comprising selecting a subject having an HER3 expressing cancer, administering to the subject an effective amount of a composition comprising an antibody or fragment thereof disclosed in Table 1 or Table 2.
  • the subject is a human and the cancer is selected from the group consisting of breast cancer, colorectal cancer, lung cancer, multiple myeloma, ovarian cancer, liver cancer, gastric cancer, acute myeloid leukemia, chronic myeloid leukemia,
  • osteosarcoma squamous cell carcinoma, peripheral nerve sheath tumors , schwannoma, head and neck cancer, bladder cancer, esophageal cancer, Barretts esophageal cancer, glioblastoma, clear cell sarcoma of soft tissue, malignant mesothelioma, neurofibromatosis, renal cancer, and melanoma, prostate cancer, benign prostatic hyperplasia (BPH), gynacomastica, and endometriosis.
  • the cancer is breast cancer.
  • the invention pertains to use of the antibody or fragment thereof for use as a medicament. In one aspect, the invention pertains to use of the antibody or fragment thereof for use in treating a cancer mediated by a HER3 ligand-dependent signal transduction or ligand-independent signal transduction pathway.
  • the invention pertains to use of the antibody or fragment thereof for the manufacture of a medicament for the treatment of a cancer mediated by a HER3 ligand-dependent signal transduction or ligand-independent signal transduction pathway selected from the group consisting of of breast cancer, colorectal cancer, lung cancer, multiple myeloma, ovarian cancer, liver cancer, gastric cancer, pancreatic cancer, acute myeloid leukemia, chronic myeloid leukemia, osteosarcoma, squamous cell carcinoma, peripheral nerve sheath tumors , schwannoma, head and neck cancer, bladder cancer, esophageal cancer, Barretts esophageal cancer, glioblastoma, clear cell sarcoma of soft tissue, malignant mesothelioma, neurofibromatosis, renal cancer, melanoma, prostate cancer, benign prostatic hyperplasia (BPH), gynacomastica, and endometriosis.
  • BPH benign prostatic hyper
  • Figure 1 Representative MORI 2615 SET curves obtained with human HER3;
  • Figure 2 SK-Br-3 cell binding determination by FACS titration;
  • Figure 3 HER3 domain binding ELISA;
  • Figure 4 (A) Surface representation of the HER3/MOR 12604 x-ray crystal structure.
  • HER3 (labeled by domains: D2, D3 & D4) is in the closed conformation, and MOR12604 binds to domain 3.
  • B Ca-superposition of HER3 from the HER3 /MORI 2064 structure (dark gray) with an unbound HER3 structure (light gray; Cho et ah, (2003) Nature 421 :756-760) aligned by domain 3.
  • C View of the domain 3 epitope recognized by 12604. Highlighted HER3 residues are within 5 A of MORI 2604 in the x-ray crystal structure.
  • D View of domain 3/MOR12604 interaction. The MOR12604 binding surface is highlighted in dark gray with surface A (solid line) and surface B (dashed line) indicated;
  • Figure 10 Inhibition of ligand-independent proliferation of BT474 cells;
  • Figure 11 Data showing inhibition of tumor growth in vivo in BxPC3 (A) and BT474 (B) using MOR12606 and MOR13655; and
  • Figure 12 Data showing improved inhibition of tumor growth in vivo in BxPC3 using a combination of MORI 2606 (Dili binder) and MORI 0703 (DII + IV binder).
  • signal transduction or “signaling activity” as used herein refers to a biochemical causal relationship generally initiated by a protein-protein interaction such as binding of a growth factor to a receptor, resulting in transmission of a signal from one portion of a cell to another portion of a cell.
  • the transmission involves specific phosphorylation of one or more tyrosine, serine, or threonine residues on one or more proteins in the series of reactions causing signal transduction.
  • Penultimate processes typically include nuclear events, resulting in a change in gene expression.
  • HER3 or "HER3 receptor” also known as "ErbB3” as used herein refers to mammalian HER3 protein and "her3” or “erbB3” refers to mammalian her3 gene.
  • the preferred HER3 protein is human HER3 protein present in the cell membrane of a cell.
  • the human her3 gene is described in U.S. Pat. No. 5,480,968 and Plowman et ah, (1990) Proc. Natl. Acad. Sci. USA, 87:4905-4909.
  • Human HER3 as defined in Accession No. NP 001973 (human), and represented below as SEQ ID NO: 1. All nomenclature is for full length, immature HER3 (amino acids 1-1342). The immature HER3 is cleaved between positions 19 and 20, resulting in the mature HER3 protein (20-1342 amino acids).
  • HER3 ligand refers to polypeptides which bind and activate HER3.
  • HER3 ligands include, but are not limited to neuregulin 1 (NRG) and neuregulin 2, betacellulin, heparin-binding epidermal growth factor, and epiregulin.
  • NRG neuregulin 1
  • neuregulin 2 betacellulin
  • betacellulin betacellulin
  • epiregulin epiregulin
  • the term includes biologically active fragments and/or variants of a naturally occurring polypeptide.
  • the "HER2-HER3 protein complex” is a noncovalently associated oligomer containing HER2 receptor and the HER3 receptor. This complex can form when a cell expressing both of these receptors is exposed to a HER3 ligand e.g., NRG or when HER2 is active/overexpressed
  • HER3 activity or "HER3 activation” as used herein refers to an increase in oligomerization (e.g. an increase in HER3 containing complexes), HER3 phosphorylation, conformational rearrangements (for example those induced by ligands), and HER3 mediated downstream signaling.
  • stabilization refers to an antibody or fragment thereof that directly maintains (locks, tethers, holds, preferentially binds, favors) the inactive state or conformation of HER3 without blocking ligand binding to HER3, such that ligand binding is no longer able to activate HER3.
  • ligand-dependent signaling refers to the activation of HER3 via ligand. HER3 activation is evidenced by increased heterodimerization and/ or HER3 phosphorylation such that downstream signaling pathways (e.g. PI3K) are activated.
  • the antibody or fragment thereof can statistically significantly reduce the amount of
  • HER3 in a stimulated cell exposed to an antibody or fragment thereof relative to an untreated (control) cell, as measured using the assays described in the Examples.
  • the cell which expresses HER3 can be a naturally occurring cell line (e.g. MCF7) or can be recombinantly produced by introducing nucleic acids encoding HER3 protein into a host cell. Cell stimulation can occur either via the exogenous addition of an activating HER3 ligand or by the endogenous expression of an activating ligand.
  • the antibody or fragment thereof which "reduces neregulin-induced HER3 activation in a cell” is one which statistically significantly reduces HER3 tyrosine phosphorylation relative to an untreated (control) cell, as measured using the assays described in the Examples. This can be determined based on HER3 phosphotyrosine levels following exposure of HER3 to NRG and the antibody of interest.
  • the cell which expresses HER3 protein can be a naturally occurring cell or cell line (e.g. MCF7) or can be recombinantly produced.
  • ligand-independent signaling refers to cellular HER3 activity (e.g phosphorylation) in the absence of a requirement for ligand binding.
  • ligand- independent HER3 activation can be a result of HER2 overexpression or activating mutations in HER3 heterodimer partners such as EGFR and HER2.
  • the antibody or fragment thereof can statistically significantly reduce the amount of phosphorylated HER3 in a cell exposed to an antibody or fragment thereof relative to an untreated (control) cell.
  • the cell which expresses HER3 can be a naturally occurring cell line (e.g. SK-Br-3) or can be recombinantly produced by introducing nucleic acids encoding HER3 protein into a host cell.
  • blocks refers to stopping or preventing an interaction or a process, e.g., stopping ligand-dependent or ligand-independent signaling.
  • recognition refers to an antibody or fragment thereof that finds and interacts (e.g., binds) with its epitope in domain 3 of HER3; domain 4 of HER3; or both domain 3 and domain 4 of HER3.
  • the epitope can be a linear, non- linear, or conformational epitope.
  • an antibody or fragment thereof interacts with amino acid residues: 335-342, 362-376, 398,400, 424-428, 431, 433-434 and 455 (within domain 3), or a subset thereof of HER3.
  • the antibody or fragment thereof interacts with at least one amino acid residue selected from amino acid residues: 329-498 (domain 3), or a subset thereof.
  • the antibody or fragment thereof interacts with at least one amino acid residue selected from amino acid residues: 499-642 (domain 4), or a subset thereof.
  • the antibody or fragment thereof interacts with at least one amino acid residue selected from domain 3 of HER3 (amino acid residues 329-498 of SEQ ID NO: 1), and at least one amino acid residue selected from domain 4 (amino acid residues 499-642 of SEQ ID NO: 1), or a subset thereof.
  • the phrase "concurrently binds" as used herein refers to a HER3 ligand that can bind to a ligand binding site on the HER3 receptor along with the HER3 antibody or fragment thereof. This means that both the antibody and ligand can bind to the HER3 receptor together.
  • the HER3 ligand NRG can bind to the HER3 receptor along with the HER3 antibody.
  • Assay to measure concurrent binding of the ligand and antibody are described in the Examples section.
  • the term “fails” as used herein refers to an antibody or fragment thereof that does not do a particular event.
  • an antibody or fragment thereof that “fails to activate signal transduction” is one that does not trigger signal transduction.
  • the term “antibody” as used herein refers to whole antibodies that interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) an HER3 epitope and inhibit signal transduction.
  • a naturally occurring "antibody” is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
  • Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region.
  • the heavy chain constant region is comprised of three domains, CHI, CH2 and CH3.
  • Each light chain is comprised of a light chain variable region
  • VL light chain constant region
  • the light chain constant region is comprised of one domain, CL.
  • CL complementarity determining regions
  • FR framework regions
  • Each VH and VL is composed of three CDRs and four FRs arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
  • the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
  • antibody includes for example, monoclonal antibodies, human antibodies, humanized antibodies, camelised antibodies, chimeric antibodies, single-chain Fvs (scFv), disulfide-linked Fvs (sdFv), Fab fragments, F (ab') fragments, and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), and epitope-binding fragments of any of the above.
  • the antibodies can be of any isotype (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass.
  • IgG, IgE, IgM, IgD, IgA and IgY class
  • IgGl, IgG2, IgG3, IgG4, IgAl and IgA2 subclass.
  • Both the light and heavy chains are divided into regions of structural and functional homology.
  • the terms "constant” and “variable” are used functionally.
  • the variable domains of both the light (VL) and heavy (VH) chain portions determine antigen recognition and specificity.
  • the constant domains of the light chain (CL) and the heavy chain (CHI, CH2 or CH3) confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, complement binding, and the like.
  • CL light chain
  • CHI heavy chain
  • CH2 or CH3 constant domains of the heavy chain
  • CH3 and CL domains actually comprise the carboxy-terminus of the heavy and light chain, respectively.
  • antibody fragment refers to one or more portions of an antibody that retain the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) an HER3 epitope and inhibit signal transduction.
  • binding fragments include, but are not limited to, a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; a F(ab) 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment consisting of the VH and CHI domains; a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; a dAb fragment (Ward et al, (1989) Nature 341 :544- 546), which consists of a VH domain; and an isolated complementarity determining region (CDR).
  • a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
  • F(ab) 2 fragment a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region
  • a Fd fragment consisting of the VH and CHI domains
  • the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al, (1988) Science 242:423-426; and Huston et al, (1988) Proc. Natl. Acad. Sci. 85:5879-5883).
  • single chain Fv single chain Fv
  • Such single chain antibodies are also intended to be encompassed within the term "antibody fragment”.
  • Antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
  • Antibody fragments can also be incorporated into single domain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, (2005) Nature Biotechnology 23: 1126-1136).
  • Antibody fragments can be grafted into scaffolds based on polypeptides such as Fibronectin type III (Fn3) (see U.S. Pat. No. 6,703,199, which describes fibronectin polypeptide monobodies).
  • Fn3 Fibronectin type III
  • Antibody fragments can be incorporated into single chain molecules comprising a pair of tandem Fv segments (VH-CH1-VH-CH1) which, together with complementary light chain polypeptides, form a pair of antigen binding regions (Zapata et al., (1995) Protein Eng.
  • epitope includes any protein determinant capable of specific binding to an immunoglobulin or otherwise interacting with a molecule.
  • Epitopic determinants generally consist of chemically active surface groupings of molecules such as amino acids or carbohydrate or sugar side chains and can have specific three-dimensional structural characteristics, as well as specific charge characteristics.
  • An epitope may be "linear,” “nonlinear” or “conformational.”
  • linear epitope refers to an epitope with all of the points of interaction between the protein and the interacting molecule (such as an antibody) occur linearly along the primary amino acid sequence of the protein (continuous).
  • An epitope can comprises those residues to which the antibody binds.
  • non-linear epitope refers to epitope with non-contiguous amino acids that form a three-dimensional structure within a particular domain (e.g., within domain 1, within domain 2, within domain 3, or within domain 4). In one embodiment, the non-linear epitope is within domain 2. The non-linear epitope may also occur between two or more domains (e.g., the interface between domains 3-4). Non-linear epitope also refers to non-contiguous amino acids that are a result of a three-dimensional structure within a particular domain.
  • formational epitope refers to an epitope in which discontinuous amino acids come together in a three dimensional configuration..
  • the points of interaction occur across amino acid residues on the protein that are separated from one another in the sequence.
  • the space that is occupied by a residue or side chain that creates the shape of a molecule helps to determine what an epitope is.
  • the epitope is within domain 3 of HER3. In one embodiment, the epitope is a non- linear epitope comprising amino acids residues within domain 3 of HER3. In one embodiment, the non-linear epitope compises amino acid residues: 335-342, 362-376, 398,400, 424-428, 431, 433-434 and 455 (within domain 3), or a subset thereof of SEQ ID NO: l .
  • the epitope is within domain 4 of HER3.
  • the epitope comprises at least one amino acid residue selected from domain 4 (amino acid residues 499-642 of SEQ ID NO: 1), or a subset thereof.
  • the epitope is a linear epitope within domain 4 of HER3.
  • the epitope is a non-linear epitope within domain 4 of HER3.
  • the epitope is a conformational epitope within domain 4 of HER3.
  • the epitope is within domains 3-4 of HER3. In one embodiment, the epitope comprises at least one amino acid residue selected from domain 3 (amino acid residues 329-498 of SEQ ID NO: 1), or a subset thereof. In one embodiment, the epitope comprises at least one amino acid residue selected from domain 4 (amino acid residues 499- 642 of SEQ ID NO: 1), or a subset thereof. . In one embodiment, the epitope comprises at least one amino acid residue selected from domain 3 (amino acid residues 329-498 of SEQ ID NO: 1) and least one amino acid residue selected from domain 4 (amino acid residues 499-642 of SEQ ID NO: 1) or a subset thereof. In one embodiment, the epitope is a linear epitope. In one embodiment, the epitope is a non-linear epitope. In another embodiment, the epitope is a conformational epitope.
  • antibodies specific for a particular target antigen will preferentially recognize an epitope on the target antigen in a complex mixture of proteins and/or macromolecules.
  • Regions of a given polypeptide that include an epitope can be identified using any number of epitope mapping techniques, well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E.Morris, Ed., 1996) Humana Press, Totowa, New Jersey.
  • linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports.
  • Such techniques are known in the art and described in, e.g., U.S. Patent No. 4,708,871 ; Geysen et al, (1984) Proc. Natl. Acad. Sci. USA 8:3998-4002; Geysen et al, (1985) Proc. Natl. Acad. Sci. USA 82:78-182; Geysen et al, (1986) Mol. Immunol. 23:709-715.
  • non-linear and conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g.,
  • Antigenic regions of proteins can also be identified using standard antigenicity and hydropathy plots, such as those calculated using, e.g., the Omiga version 1.0 software program available from the Oxford Molecular Group. This computer program employs the Hopp/Woods method, Hopp et al, (1981) Proc. Natl. Acad. Sci USA 78:3824-3828; for determining antigenicity profiles, and the Kyte-Doolittle technique, Kyte et al, (1982) J.MoI. Biol. 157: 105-132; for hydropathy plots.
  • binding surface refers to multiple contiguous or non-contiguous surfaces in a 3D configuration on HER3, e.g., domain 3 of HER3. These surfaces form part of the epitope and interact with an antibody or fragment thereof.
  • a binding surface can comprise at least two surfaces (e.g., surface A and surface B, see Figure 4D), at least three surfaces (e.g., surface A, surface B, and surface C), at least four surfaces surfaces (e.g., surface A, surface B, surface C, and surface D), at least five surfaces (e.g., surface A, surface B, surface C, surface D, and surface E), at least six surfaces (e.g., surface A, surface B, surface C, surface D, surface E, and surface F), at least seven surfaces (e.g., surface A, surface B, surface C, surface D, surface E, surface F, and surface G), at least eight surfaces (e.g., surface A, surface B, surface C, surface D, surface E, surface F, surface G, and surface H), at least nine surfaces (e.g., surface A, surface B, surface C, surface D, surface E, surface F, surface G, surface H, and surface I), or at least ten surfaces (e.g., surface A, surface B, surface C, surface D
  • binding surface A refers to a surface on domain 3 of HER3 comprising at least one amino acid residue selected from a group consisting of amino acid residues 362-376.
  • binding surface B refers to a surface on domain 3 of HER3 comprising at least one amino acid residue selected from a group consisting of amino acid residues 335-342, 398,400, 424-428, 431, 433-434 and 455.
  • monoclonal antibody or “monoclonal antibody composition” as used herein refers to polypeptides, including antibodies, antibody fragments, bispecific antibodies, etc. that have substantially identical to amino acid sequence or are derived from the same genetic source. This term also includes preparations of antibody molecules of single molecular composition.
  • a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
  • human antibody includes antibodies having variable regions in which both the framework and CDR regions are derived from sequences of human origin. Furthermore, if the antibody contains a constant region, the constant region also is derived from such human sequences, e.g., human germline sequences, or mutated versions of human germline sequences or antibody containing consensus framework sequences derived from human framework sequences analysis, for example, as described in Knappik et al, (2000) J Mol Biol 296:57-86).
  • immunoglobulin variable domains e.g., CDRs
  • CDRs may be defined using well known numbering schemes, e.g., the Kabat numbering scheme, the Chothia numbering scheme, or a combination of Kabat and Chothia (see, e.g., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services (1991), eds. Kabat et al; Lazikani et al, (1997) J. Mol. Bio. 273:927-948); Kabat et al, (1991) Sequences of Proteins of Immunological Interest, 5th edit., NIH Publication no. 91-3242 U.S.
  • the human antibodies of the invention may include amino acid residues not encoded by human sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo, or a conservative substitution to promote stability or manufacturing) .
  • human monoclonal antibody refers to antibodies displaying a single binding specificity which have variable regions in which both the framework and CDR regions are derived from human sequences.
  • the human monoclonal antibodies are produced by a hybridoma which includes a B cell obtained from a transgenic nonhuman animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell.
  • recombinant human antibody includes all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human
  • immunoglobulin genes or a hybridoma prepared therefrom antibodies isolated from a host cell transformed to express the human antibody, e.g., from a transfectoma, antibodies isolated from a recombinant, combinatorial human antibody library, and antibodies prepared, expressed, created or isolated by any other means that involve splicing of all or a portion of a human immunoglobulin gene, sequences to other DNA sequences.
  • Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences.
  • such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the V H and V L regions of the recombinant antibodies are sequences that, while derived from and related to human germline V H and V L sequences, may not naturally exist within the human antibody germline repertoire in vivo.
  • Specific binding between two entities means a binding with an equilibrium constant (KA) (k on /k off ) of at least 10 2 M _1 , at least 5xl0 2 M _1 , at least 10 3 M -1 , at least 5xl0 3 M _1 , at least 10 4 M " at least 5xl0 4 M _1 , at least 10 5 M -1 , at least 5xl0 5 M _1 , at least 10 6 M _1 , at least 5xl0 6 M _1 , at least 10 7 M _1 , at least 5xl0 7 M _1 , at least 10 8 M _1 , at least 5xl0 8 M _1 , at least 10 9 M _1 , at least 5xl0 9 M _1 , at least 10 10 M _1 , at least 5xl0 9 M _1 , at least 10 10 M _1 , at least 5xl0 9 M _1 , at least 10 10
  • an HER3 binding antibody of the invention typically also has a dissociation rate constant (K D ) (k 0ff /k on ) of less than 5xlO "2 M, less than 10 "2 M, less than 5xlO "3 M, less than 10 "3 M, less than 5xlO "4 M, less than 10 "4 M, less than 5xlO "5 M, less than 10 "5 M, less than 5xlO "6 M, less than 10 "6 M, less than 5xlO ⁇ 7 M, less than 10 "7 M, less than 5xlO "8 M, less than 10 "8 M, less than 5xlO ⁇ 9 M, less than 10 " 9 M, less than 5xlO ⁇ 10 M, less than 10 "10
  • the antibody or fragment thereof has dissociation constant (Ka) of less than 3000 pM, less than 2500 pM, less than 2000 pM, less than 1500 pM, less than 1000 pM, less than 750 pM, less than 500 pM, less than 250 pM, less than 200 pM, less than 150 pM, less than 100 pM, less than 75 pM, less than 10 pM, less than 1 pM as assessed using a method described herein or known to one of skill in the art (e.g., a BIAcore assay, ELISA, FACS, SET) (Biacore International AB, Uppsala, Sweden).
  • Ka dissociation constant
  • K a ⁇ c or "K a ", as used herein, refers to the association rate of a particular antibody-antigen interaction
  • K d i s or "K d ,” as used herein, refers to the dissociation rate of a particular antibody-antigen interaction
  • KD refers to the dissociation constant, which is obtained from the ratio of Ka to K a (i.e. Kj/K a ) and is expressed as a molar concentration (M).
  • KD values for antibodies can be determined using methods well established in the art. A method for determining the K D of an antibody is by using surface plasmon resonance, or using a biosensor system such as a Biacore® system.
  • affinity refers to the strength of interaction between antibody and antigen at single antigenic sites. Within each antigenic site, the variable region of the antibody “arm” interacts through weak non-covalent forces with antigen at numerous sites; the more interactions, the stronger the affinity.
  • the term "avidity” as used herein refers to an informative measure of the overall stability or strength of the antibody-antigen complex. It is controlled by three major factors: antibody epitope affinity; the valence of both the antigen and antibody; and the structural arrangement of the interacting parts. Ultimately these factors define the specificity of the antibody, that is, the likelihood that the particular antibody is binding to a precise antigen epitope.
  • valency refers to the number of potential target binding sites in a polypeptide. Each target binding site specifically binds one target molecule or specific site (i.e, epitope) on a target molecule. When a polypeptide comprises more than one target binding site, each target binding site may specifically bind the same or different molecules (e.g., may bind to different molecules, e.g., different antigens, or different epitopes on the same molecule).
  • inhibitorting antibody refers to an antibody that binds with HER3 and inhibits the biological activity of HER3 signaling, e.g., reduces, decreases and/or inhibits HER3 induced signaling activity, e.g., in a phospho-HER3 or phospho-Akt assay. Examples of assays are described in more details in the examples below. Accordingly, an antibody that "inhibits" one or more of these HER3 functional properties (e.g., biochemical,
  • an antibody that inhibits HER3 activity effects such a statistically significant decrease by at least 10% of the measured parameter, by at least 50%>, 80%> or 90%>, and in certain embodiments an antibody of the invention may inhibit greater than 95%, 98% or 99% of HER3 functional activity as evidenced by a reduction in the level of cellular HER3 phosphorylation.
  • isolated antibody refers to an antibody that is substantially free of other antibodies having different antigenic specificities (e.g. , an isolated antibody that specifically binds HER3 is substantially free of antibodies that specifically bind antigens other than HER3).
  • An isolated antibody that specifically binds HER3 may, however, have cross- reactivity to other antigens.
  • an isolated antibody may be substantially free of other cellular material and/or chemicals.
  • conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
  • nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
  • each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
  • TGG which is ordinarily the only codon for tryptophan
  • the following eight groups contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
  • the term "conservative sequence modifications” are used to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody containing the amino acid sequence.
  • cross-compete and “cross-competing” are used interchangeably herein to mean the ability of an antibody or fragment thereof to interfere with the binding of other antibodies or fragments thereof to HER3 in a standard competitive binding assay.
  • the ability or extent to which an antibody of fragment thereof is able to interfere with the binding of another antibody or fragment thereof to HER3 , and therefore whether it can be said to cross-compete according to the invention, can be determined using standard competition binding assays.
  • One suitable assay involves the use of the Biacore technology (e.g. by using the BIAcore 3000 instrument (Biacore, Uppsala, Sweden)), which can measure the extent of interactions using surface plasmon resonance technology.
  • Another assay for measuring cross-competing uses an ELISA-based approach.
  • the term "optimized” as used herein refers to a nucleotide sequence has been altered to encode an amino acid sequence using codons that are preferred in the production cell or organism, generally a eukaryotic cell, for example, a cell of Pichia, a cell of Trichoderma, a Chinese Hamster Ovary cell (CHO) or a human cell.
  • the optimized nucleotide sequence is engineered to retain completely or as much as possible the amino acid sequence originally encoded by the starting nucleotide sequence, which is also known as the "parental" sequence.
  • Standard assays to evaluate the binding ability of the antibodies toward HER3 of various species are known in the art, including for example, ELISAs, western blots and RIAs.
  • Suitable assays are described in detail in the Examples.
  • the binding kinetics (e.g., binding affinity) of the antibodies also can be assessed by standard assays known in the art, such as by Biacore analysis, or FACS relative affinity (Scatchard).
  • Assays to evaluate the effects of the antibodies on functional properties of HER3 are described in further detail in the Examples.
  • percent identical in the context of two or more nucleic acids or polypeptide sequences, refers to two or more sequences or subsequences that are the same.
  • Two sequences are “substantially identical” if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 60% identity, optionally 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity over a specified region, or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
  • the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
  • sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
  • a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
  • Methods of alignment of sequences for comparison are well known in the art.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, (1970) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol.
  • BLAST and BLAST 2.0 algorithms Two examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al, (1977) Nuc. Acids Res. 25:3389-3402; and Altschul et al, (1990) J. Mol. Biol. 215:403-410, respectively.
  • Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al, supra).
  • initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
  • the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached.
  • the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
  • the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787).
  • One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
  • P(N) the smallest sum probability
  • a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
  • the percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller, (1988) Comput. Appl. Biosci. 4: 11-17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (1970) J. Mol. Biol. 48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package (available at www.gcg.com), using either a Blossom 62 matrix or a
  • PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
  • nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid, as described below.
  • a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
  • Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below.
  • Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
  • nucleic acid is used herein interchangeably with the term “polynucleotide” and refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form.
  • the term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
  • Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
  • nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g. , degenerate codon substitutions) and
  • degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., (1991) Nucleic Acid Res. 19:5081; Ohtsuka et al., (1985) J. Biol. Chem. 260:2605-2608; and Rossolini et al., (1994) Mol. Cell. Probes 8:91-98).
  • the phrase "operably linked” refers to a functional relationship between two or more polynucleotide (e.g., DNA) segments.
  • a promoter or enhancer sequence is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system.
  • promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis- acting.
  • some transcriptional regulatory sequences, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose
  • polypeptide and “protein” are used interchangeably herein to refer to a polymer of amino acid residues.
  • the terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer. Unless otherwise indicated, a particular polypeptide sequence also implicitly encompasses conservatively modified variants thereof.
  • subject as used herein includes human and non-human animals.
  • Non-human animals include all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dog, cow, chickens, amphibians, and reptiles. Except when noted, the terms “patient” or “subject” are used herein interchangeably.
  • anti-cancer agent refers to any agent that can be used to treat a cell proliferative disorder such as cancer, including cytotoxic agents, chemotherapeutic agents, radiotherapy and radiotherapeutic agents, targeted anti-cancer agents, and immunotherapeutic agents.
  • tumor refers to neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
  • anti-tumor activity refers to a reduction in the rate of tumor cell proliferation, viability, or metastatic activity. A possible way of showing anti-tumor activity is show a decline in growth rate of abnormal cells that arises during therapy or tumor size stability or reduction. Such activity can be assessed using accepted in vitro or in vivo tumor models, including but not limited to xenograft models, allograft models, MMTV models, and other known models known in the art to investigate anti-tumor activity.
  • malignancy refers to a non-benign tumor or a cancer.
  • cancer refers to a malignancy characterized by deregulated or uncontrolled cell growth.
  • exemplary cancers include: carcinomas, sarcomas, leukemias, and lymphomas.
  • carcinomas e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original tumor
  • secondary malignant tumors e.g., those arising from metastasis, the migration of tumor cells to secondary sites that are different from the site of the original tumor.
  • HER receptors have an extracellular ligand-binding domain, a single trans-membrane domain and a cytoplasmic tyrosine kinase-containing domain.
  • the intracellular tyrosine kinase domain of HER receptors is highly conserved, although the kinase domain of HER3 contains substitutions of critical amino acids and therefore lacks kinase activity (Guy et al., (1994): PNAS 91, 8132-8136).
  • Ligand-induced dimerisation of the HER receptors induces activation of the kinase, receptor transphosphorylation on tyrosine residues in the C-terminal tail, followed by recruitment and activation of intracellular signalling effectors (Yarden and Sliwkowski, (2001) Nature Rev 2, 127-137; Jorissen et al, (2003) Exp Cell Res 284, 31-53.
  • the crystal structures of the extracellular domains of HERs have provided some insight into the process of ligand-induced receptor activation (Schlessinger, (2002) Cell 110, 669-672).
  • each HER receptor consists of four subdomains: Subdomain I and III cooperate in forming the ligand-binding site, whereas subdomain II (and perhaps also subdomain IV) participates in receptor dimerisation via direct receptor-receptor interactions.
  • subdomain II and perhaps also subdomain IV participates in receptor dimerisation via direct receptor-receptor interactions.
  • a ⁇ hairpin (termed the dimerisation loop) in subdomain II interacts with the dimerisation loop of the partner receptor, mediating receptor dimerisation (Garrett et al, (2002) Cell 110, 763-773; Ogiso et al, (2002) Cell 110, 775-787).
  • HER2 has a conformation that resembles the ligand-activated state of HER 1 with a protruding
  • HER receptor crystal structures provide a model for HER receptor homo- and heterodimerisation, the background for the prevalence of some HER homo- and heterodimers over others (Franklin et al, (2004) Cancer Cell 5, 317-328) as well as the role of each of the domain in receptor dimerisation and autoinhibition (Burgess et al, (2003) Mol Cell 12, 541- 552; Mattoon et al, (2004) PNAS101, 923-928) remains somewhat unclear.
  • the present invention provides an additional class of antibodies or fragments thereof that bind a non-linear epitope within domain 3 of HER3. These antibodies or fragments thereof bind with HER3 to inhibit both ligand dependent and ligand independent signal transduction.
  • the present invention further provides a class of antibodies or fragments thereof that bind within domains 3-4 of HER3 to inhibit both ligand dependent and ligand independent signal transduction.
  • the class of antibodies or fragments thereof binds to domain 3 or domain 4 of HER3 to inhibit both ligand dependent and ligand independent signal transduction.
  • the class of antibodies or fragments thereof binds to domain 3 and domain 4 of HER3 to inhibit both ligand dependent and ligand independent signal transduction.
  • the present Examples present the crystal structure of HER3 bound to the Fab fragment of MOR12604 determined at 3.38 A resolution.
  • HER3- MOR12604 Fab complex was determined at 3.38 A resolution, and shown in Figure 4.
  • HER3 typically exists in an inactive (closed, tethered) or active (open) state.
  • Ligand binding induces a conformational change such that HER3 exists in the active (open) state which is capable of binding heterodimer partners resulting in activation in downstream signaling.
  • Antibodies such as MORI 2604 bind the inactive (tethered) state of HER3 and apparently block the ligand binding site.
  • MORI 2604 could function by a mechanisms selected from the group consisting of blocking HER3 residues required for ligand binding, preventing HER3 adopting the active conformation due to steric hindrance between the antibody and domains of HER3, preventing HER3 adopting the active conformation by reducing the degree of flexibility in HER3 hinge regions (e.g.
  • domain 3 inducing a conformational change in domain 3 loop 371-377 that prevents HER3 from transitioning to the open conformation, destabilizing HER3 such that it is prone to degradation, acting as a partial agonist to accelerate the down regulation of HER3, and by each arm of MORI 2604 binding a molecule of HER3 such that the antibody generates an un-natural HER3 dimer that is either prone to proteolytic degradation or cannot dimerize with other receptor tyrosine kinases
  • crystals of HER3 were prepared by expressing a nucleotide sequence encoding HER3 or a variant thereof in a suitable host cell, and then crystallising the purified protein(s) in the presence of the relevant HER3 targeted Fab.
  • the HER3 polypeptide contains the extracellular domain (amino acids 20 to 640 of the human polypeptide (SEQ ID NO: 1) or a truncated version thereof, preferably comprising amino acids 20-640) but lacks the extracellular domain (amino acids 20 to 640 of the human polypeptide (SEQ ID NO: 1) or a truncated version thereof, preferably comprising amino acids 20-640) but lacks the extracellular domain (amino acids 20 to 640 of the human polypeptide (SEQ ID NO: 1) or a truncated version thereof, preferably comprising amino acids 20-640) but lacks the extracellular domain (amino acids 20 to 640 of the human polypeptide (SEQ ID NO: 1) or a trun
  • HER3 polypeptides may also be produced as fusion proteins, for example to aid in extraction and purification.
  • fusion protein partners include glutathione-S-transferase (GST), histidine (HIS), hexahistidine (6HIS), GAL4 (DNA binding and/or transcriptional activation domains) and beta-galactosidase. It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest to allow removal of fusion protein sequences.
  • the proteins may be purified and/or concentrated, for example by
  • the protein(s) may be crystallised using techniques described herein. Commonly, in a crystallisation process, a drop containing the protein solution is mixed with the crystallisation buffer and allowed to equilibrate in a sealed container. Equilibration may be achieved by known techniques such as the "hanging drop” or the “sitting drop” method. In these methods, the drop is hung above or sitting beside a much larger reservoir of crystallization buffer and equilibration is reached through vapor diffusion.
  • equilibration may occur by other methods, for example under oil, through a semi-permeable membrane, or by free- interface diffusion (See e.g., Chayen et al., (2008) Nature Methods 5, 147 - 153.
  • the structure may be solved by known X-ray diffraction techniques.
  • Many techniques use chemically modified crystals, such as those modified by heavy atom derivatization to approximate phases.
  • a crystal is soaked in a solution containing heavy metal atom salts, or organometallic compounds, e.g., lead chloride, gold thiomalate, thimerosal or uranyl acetate, which can diffuse through the crystal and bind to the surface of the protein.
  • the location(s) of the bound heavy metal atom(s) can then be determined by X-ray diffraction analysis of the soaked crystal.
  • the patterns obtained on diffraction of a monochromatic beam of X-rays by the atoms (scattering centres) of the crystal can be solved by mathematical equations to give mathematical coordinates.
  • the diffraction data are used to calculate an electron density map of the repeating unit of the crystal.
  • Another method of obtaining phase information is using a technique known as molecular replacement. In this method, rotational and translational alogrithms are applied to a search model derived from a related structure, resulting in an approximate orientation for the protein of interest (See Rossmann, (1990) Acta Crystals A 46, 73-82).
  • the electron density maps are used to establish the positions of the individual atoms within the unit cell of the crystal (Blundel et al., (1976) Protein Crystallography, Academic Press).
  • the present disclosure describes the three-dimensional structure of HER3 and a Fab of an anti-HER3 antibody.
  • the approximate domain boundaries of extracellular domain of HER3 are as follows; domain 1 : amino acids 20-207; domain 2: amino acids 208-328; domain 3: amino acids 329-498; and domain 4: amino acids 499-642.
  • the three-dimensional structure of HER3 and the antibody allows the identification of target binding sites for potential HER3 modulators.
  • Preferred target binding sites are those involved in the activation of HER3.
  • the target binding site is located within domain 3 of HER3.
  • an antibody or fragment thereof which binds to domain 3 can, for example, modulate HER3 activation by modifying the relative position of the domain relative to itself or other HER3 domains.
  • binding an antibody or fragment thereof to amino acid residues within domain 3 may cause the protein to adopt a configuraton that prevents activation.
  • a binding surface comprises multiple contiguous or non-contiguous surfaces in a 3D configuration that form part of the epitope which interacts with the antibody or fragment thereof.
  • a binding surface can comprise at least two surfaces (e.g., surface A and surface B, see Figure 4D), at least three surfaces (e.g., surface A, surface B, and surface C), at least four surfaces surfaces (e.g., surface A, surface B, surface C, and surface D), at least five surfaces (e.g., surface A, surface B, surface C, surface D, and surface E), at least six surfaces (e.g., surface A, surface B, surface C, surface D, surface E, and surface F), at least seven surfaces (e.g., surface A, surface B, surface C, surface D, surface E, surface F, and surface G), at least eight surfaces (e.g., surface A, surface B, surface C, surface D, surface E, surface F, surface G, and surface
  • binding surface A comprises at least one amino acid residue selected from amino acid residues 362-376.
  • binding surface B comprises at least one amino acid residue selected from amino acid residues 335-342, 398,400, 424-428, 431, 433-434 and 455.
  • the antibody or fragment thereof binds to binding surface A, wherein at least one amino acid residue is selected from amino acid residues 362-376; and binding surface B, wherein at least one amino acid residue is selected from amino acid residues 335-342, 398,400, 424-428, 431, 433-434 and 455.
  • the antibody or fragment thereof binds to human HER3 protein having a non-linear epitope comprising HER3 amino acid residues residues 335-342, 362-376, 398,400, 424-428, 431, 433-434 and 455 (within domain 3), of SEQ ID NO: 1, or a subset thereof. In some embodiments, the antibody or fragment thereof binds to amino acids within or overlapping amino acid residues 335-342, 362-376, 398,400, 424-428, 431, 433-434 and 455 (within domain 3), of SEQ ID NO: 1, or a subset thereof.
  • the antibody or fragment thereof binds to amino acids within (and/or amino acid sequences consisting of) amino acids 335-342, 362-376, 398,400, 424-428, 431, 433-434 and 455 (within domain 3), of SEQ ID NO: 1, or a subset thereof.
  • the antibody or fragment thereof binds to human HER3 protein having an epitope (linear, non-linear, conformational) comprising HER3 amino acid residues 499-642 (of domain 4) of SEQ ID NO: 1, or a subset thereof. In some embodiments, the antibody or fragment thereof binds to amino acids within or overlapping amino acid residues 499-642 (of domain 4) of SEQ ID NO: 1, or a subset thereof. In some embodiments, the antibody or fragment thereof binds to amino acids within (and/or amino acid sequences consisting of) amino acids residues 499-642 (of domain 4) of SEQ ID NO: 1, or a subset thereof, or a subset thereof.
  • the antibody or fragment thereof binds to human HER3 protein having a non-linear epitope comprising HER3 amino acid residues residues 335-342, 362-376, 398,400, 424-428, 431, 433-434 and 455 (within domain 3) and an epitope (linear, non-linear, conformational) comprising HER3 amino acid residues 499-642 (of domain 4) of SEQ ID NO: 1, or a subset thereof.
  • the antibody or fragment thereof binds to amino acids within or overlapping amino acid residues 335-342, 362-376, 398,400, 424-428, 431, 433-434 and 455 (within domain 3), of SEQ ID NO: 1 and an epitope (linear, non-linear, conformational) comprising HER3 amino acid residues 499-642 (of domain 4) of SEQ ID NO: 1 or a subset thereof.
  • the antibody or fragment thereof binds to amino acids within (and/or amino acid sequences consisting of) amino acids 335-342, 362- 376, 398,400, 424-428, 431, 433-434 and 455 (within domain 3), and an epitope (linear, nonlinear, conformational) comprising HER3 amino acid residues 499-642 (of domain 4) of SEQ ID NO : 1 of SEQ ID NO : 1 , or a subset thereof.
  • the antibody or fragment thereof binds to human HER3 protein having a epitope (linear, non-linear, conformational) comprising HER3 amino acid residues within domain 3 and an epitope (linear, non-linear,conformational) comprising HER3 amino acid residues within of domain 4 of SEQ ID NO: 1, or a subset thereof.
  • the antibody or fragment thereof binds to amino acids within or overlapping amino acid residues of domain 3 and amino acids of domain 4 of SEQ ID NO: 1, or a subset thereof.
  • the antibody or fragment thereof binds to the inactive state of the HER3 receptor, thereby preventing HER3 adopting an active conformation. In some embodiments, the antibody or fragment thereof prevents HER3 adopting an active
  • the antibody or fragment thereof prevents HER3 adopting an active
  • the antibody or fragment thereof induces a conformational change in domain 3 loop 371-377 of SEQ ID NO: l that prevents HER3 from adopting an active conformation.
  • the antibody or fragment thereof destabilizes HER3 such that it is susceptible to degradation.
  • the antibody or fragment thereof accelerates down regulation of cell surface HER3.
  • the antibody or fragment thereof generates an un-natural HER3 dimer that is susceptible to proteolytic degradation or unable to dimerize with other receptor tyrosine kinases.
  • the antibody or fragment thereof can bind to either the active or inactive state of HER3. In some embodiments, the antibody or fragment thereof stabilizes the HER3 receptor in an inactive state such that the HER3 receptor fails to dimerize with a co- receptor to form a receptor-receptor complex. The failure to form a receptor-receptor complex prevents activation of both ligand-dependent and ligand-independent signal transduction.
  • the antibody or fragment thereof induces dimerization of HER3 with HER3 to form an inactive receptor-receptor complex.
  • the formation of the inactive receptor- receptor complex prevents activation of HER3 mediated signal transduction since HER3 is sequestered in inactive receptor-receptor complexes.
  • the depicted structure also allows one to identify specific HER3 amino acid residues for the interaction interface of an antibody or fragment thereof (e.g., MOR12604) with HER3. This was defined as residues that are within 5 A of the MORI 2604 protein VH chain. The residues are as follows: Ile365, Thr366, Asn369, Gly370, Asp371, Pro372, Trp373, His374, Lys375, Gln400, and Lys434.
  • the depicted structure also allows one to identify specific HER3 amino acid residues for the interaction interface of an antibody or fragment thereof (e.g.,
  • MORI 2604 from interacting with any of the above residues can be employed to bind to or neutralize HER3.
  • the antibodies or fragments thereof binds to or interacts with at least one of the following HER3 residues (SEQ ID NO: 1): Ile365, Thr366, Asn369, Gly370, Asp371, Pro372, Trp373, His374, Lys375, Gln400, and Lys434.
  • the antibodies and fragments thereof binds to or interacts with at least one of the following HER3 residues (SEQ ID NO: 1): Gly335, Ser336, Gly337, Ser338, Phe340, Gln341, Asp362, Leu364, Ile365, Thr366, His374, Ile376, Asn398, Gln400, Tyr424, Asn425, Arg426, Phe428, Leu431, Met433, Lys434, Tyr455.
  • SEQ ID NO: 1 Gly335, Ser336, Gly337, Ser338, Phe340, Gln341, Asp362, Leu364, Ile365, Thr366, His374, Ile376, Asn398, Gln400, Tyr424, Asn425, Arg426, Phe428, Leu431, Met433, Lys434, Tyr455.
  • the antibodies or fragments thereof binds to or interacts with at least one of the following HER3 residues (SEQ ID NO: 1): Ile365, Thr366, Asn369, Gly370, Asp371, Pro372, Trp373, His374, Lys375, Gln400, Lys434, Gly335, Ser336, Gly337, Ser338, Phe340, Gln341, Asp362, Leu364, Ile365, Thr366, His374, Ile376, Asn398, Gln400, Tyr424, Asn425, Arg426, Phe428, Leu431, Met433, Lys434, Tyr455.
  • SEQ ID NO: 1 Ile365, Thr366, Asn369, Gly370, Asp371, Pro372, Trp373, His374, Lys375, Gln400, Lys434, Gly335, Ser336, Gly337, Ser338, Phe340, Gln341, Asp362, Leu364, Ile365, Thr366,
  • the antibodies or fragments thereof binds to or interacts with a combination of the following HER3 residues (SEQ ID NO: 1): Ile365, Thr366, Asn369, Gly370, Asp371, Pro372, Trp373, His374, Lys375, Gln400, Lys434, Gly335, Ser336, Gly337, Ser338, Phe340, Gln341, Asp362, Leu364, Ile365, Thr366, His374, Ile376, Asn398, Gln400, Tyr424, Asn425, Arg426, Phe428, Leu431, Met433, Lys434, Tyr455.
  • SEQ ID NO: 1 Ile365, Thr366, Asn369, Gly370, Asp371, Pro372, Trp373, His374, Lys375, Gln400, Lys434, Gly335, Ser336, Gly337, Ser338, Phe340, Gln341, Asp362, Leu364, Ile365, Thr366,
  • the antibodies or fragments thereof binds to or interacts with all of the following HER3 residues (SEQ ID NO: 1): Ile365, Thr366, Asn369, Gly370, Asp371, Pro372, Trp373, His374, Lys375, Gln400, Lys434, Gly335, Ser336, Gly337, Ser338, Phe340, Gln341, Asp362, Leu364, Ile365, Thr366, His374, Ile376, Asn398, Gln400, Tyr424, Asn425, Arg426, Phe428, Leu431, Met433, Lys434, Tyr455.
  • the antibody or fragment thereof is within 5 angstroms of one or more of the above residues.
  • the antibody or fragment thereof is 5 to 8 angstroms from one or more of the above residues. In some embodiments, the antibody or fragment thereof interacts, blocks, or is within 8 angstroms of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 25, 28, 30, 35, 40, 45, or 50 of the above residues.
  • MORI 2604 provides the framework to explore other HER3 antibodies in more detail. The 3D structure of HER3 allows the epitopes for monoclonal antibodies to be mapped and their mode of action inferred, since some inhibit, some stimulate and others have no effect on cell growth.
  • the non-linearepitope for MORI 2604 has been located to the domain 3 of HER3.
  • the availability of the 3D structures of this receptor will facilitate the determination of the precise mechanism of action of these inhibitory agents and the design of new approaches to interfering with HER3 receptor function.
  • the antibodies of the invention bind to the same non- linear epitope as MORI 2604.
  • the non-linear epitope bound by any of the antibodies listed in Table 1 is especially useful.
  • a HER3 non-linear epitope can be utilized to isolate antibodies of fragments thereof that bind to HER3.
  • a HER3 non-linear epitope can be utilized to generate antibodies or fragments thereof which bind to HER3.
  • a HER3 non- linear epitope can be utilized as an immunogen to generate antibodies of fragments thereof that bind to the HER3 non-linear epitope.
  • a HER3 non-linear epitope can be administered to an animal, and antibodies that bind to HER3 can subsequently be obtained from the animal.
  • the present invention also provides a class of antibodies that bind to an epitope (linear, non- linear, or conformational) within domains 3-4 of HER3.
  • Examples of such antibodies or framents thereof that bind within domains 3-4 are shown in Table 2.
  • Table 2 The above methodology and the methods described in the Example section below, can be also used to generate domain 3-4 antibodies or fragments thereof complexed to HER3.
  • the domain(s)/region(s) containing residues that are in contact with or are buried by an antibody can be identified by mutating specific residues in HER3 (e.g., a wild-type antigen) and determining whether antibody or fragment thereof can bind the mutated or variant HER3 protein or measure changes of affinity from wild-type.
  • residues that play a direct role in binding or that are in sufficiently close proximity to the antibody such that a mutation can affect binding between the antibody and antigen can be identified. From a knowledge of these amino acids, the domain(s) or region(s) of the antigen (HER3) that contain residues in contact with the antibody or covered by the antibody can be elucidated.
  • Mutagenesis using known techniques such as alanine-scanning can help define functionally relevant epitopes.
  • Mutagenesis utilizing an arginine/glutamic acid scanning protocol can also be employed (see, e.g., Nanevicz et ah, (1995), J. Biol. Chem. 270(37):21619-21625 and Zupnick et al, (2006), J. Biol. Chem.
  • arginine and glutamic acids are substituted (typically individually) for an amino acid in the wild-type polypeptide because these amino acids are charged and bulky and thus have the potential to disrupt binding between an antigen binding protein and an antigen in the region of the antigen where the mutation is introduced.
  • Arginines that exist in the wild-type antigen are replaced with glutamic acid.
  • a variety of such individual mutants can be obtained and the collected binding results analyzed to determine what residues affect binding.
  • a series of mutant HER3 antigens can be created, with each mutant antigen having a single mutation. Binding of each mutant HER3 antigen with various HER3 antibodies or fragments thereof can be measured and compared to the ability of the selected an antibody or fragments thereof to bind wild-type HER3 (SEQ ID NO: 1).
  • an alteration (for example a reduction or increase) in binding between an antibody or fragment thereof and a mutant or variant HER3 as used herein means that there is a change in binding affinity (e.g., as measured by known methods such as Biacore testing or the bead based assay described below in the examples), EC50, and/or a change (for example a reduction) in the total binding capacity of the antigen binding protein (for example, as evidenced by a decrease in B max in a plot of antigen binding protein concentration versus antigen concentration).
  • a significant alteration in binding indicates that the mutated residue is involved in binding to the antibody or fragment thereof.
  • a significant reduction in binding means that the binding affinity, EC50, and/or capacity between an antibody or fragments thereof and a mutant HER3 antigen is reduced by greater than 10%, greater than 20%, greater than 40%, greater than 50%, greater than 55%, greater than 60%, greater than 65%, greater than 70%, greater than 75%, greater than 80%, greater than 85%, greater than 90% or greater than 95% relative to binding between the an antibody or fragment thereof and a wild type HER3 (e.g., SEQ ID NO: 1).
  • a wild type HER3 e.g., SEQ ID NO: 1
  • binding of an antibody or fragments thereof is significantly reduced or increased for a mutant HER3 protein having one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) mutations as compared to a wild-type HER3 protein (e.g., SEQ ID NO: 1).
  • variant forms are referenced with respect to the wild-type sequence shown in SEQ ID NO: 1, it will be appreciated that in an allelic or splice variants of HER3 the amino acids could differ. Antibodies or fragments thereof showing significantly altered binding (e.g., lower or higher binding) for such allelic forms of HER3 are also contemplated.
  • the structure of the CDRs contribute to a paratope, through which an antibody is able to bind to an epitope.
  • the shape of such a paratope may be determined in a number of ways.
  • Traditional structural examination approaches can be used, such as NMR or x-ray crystallography. These approaches can examine the shape of the paratope alone, or while it is bound to the epitope.
  • molecular models may be generated in silico.
  • a structure can be generated through homology modeling, aided with a commercial package, such as Insightll modeling package from Accelrys (San Diego, Calif).
  • one is able to predict which residues are the most important in the interaction between the epitope and the paratope.
  • one is able to readily select which residues to change in order to alter the binding characteristics of the antibody. For instance, it may be apparent from the docking models that the side chains of certain residues in the paratope may sterically hinder the binding of the epitope, thus altering these residues to residues with smaller side chains may be beneficial.
  • One can determine this in many ways. For example, one may simply look at the two models and estimate interactions based on functional groups and proximity. Alternatively, one may perform repeated pairings of epitope and paratope, as described above, in order to obtain more favorable energy interactions.
  • the models determined above can be tested through various techniques. For example, the interaction energy can determined with the programs discussed above in order to determine which of the variants to further examine. Also, coulumbic and van der Waals interactions are used to determine the interaction energies of the epitope and the variant paratopes. Also site directed mutagenesis is used to see if predicted changes in antibody structure actually result in the desired changes in binding characteristics. Alternatively, changes may be made to the epitope to verify that the models are correct or to determine general binding themes that may be occurring between the paratope and the epitope.
  • any modification may also have additional side effects on the activity of the antibody. For instance, while any alteration predicted to result in greater binding, may induce greater binding, it may also cause other structural changes which might reduce or alter the activity of the antibody. The determination of whether or not this is the case is routine in the art and can be achieved in many ways. For example, the activity can be tested through an ELISA test. Alternatively, the samples can be tested through the use of a surface plasmon resonance device.
  • the present invention provides a class of antibodies that recognize a non-linear epitope within domain 3 of HER3 and inhibit both ligand-dependent and ligand-independent HER3 signal transduction pathways as shown in Table 1.
  • the present invention also provides a class of antibodies that recognize an epitope (linear, non-linear, conformational) within domains 3-4 of HER3 that inhibit both ligand-dependent and ligand-independent HER3 signal transduction pathways, as shown in Table 2. Examples of HER3 antibodies that bind to a non-linear epitope within domain 3 of
  • SEQ ID NO: 70 (Kabat) LCDR3 QQFRRKSNT
  • SEQ ID NO: 216 DNA VH TACTTCGATGTTTGGGGCCAAGGCACCCTGGTGACTGTTAGCTCA
  • SEQ ID NO: 220 Chain AGCAGTACAACAGCACGTACCGGGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGA ATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATCGAGAAAACCAT

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Urology & Nephrology (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Neurology (AREA)
  • Oncology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pulmonology (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • Biomedical Technology (AREA)
  • Dermatology (AREA)
  • Neurosurgery (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Endocrinology (AREA)
  • Reproductive Health (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
EP12816130.4A 2011-12-05 2012-12-04 Antibodies for epidermal growth factor receptor 3 (her3) directed to domain iii and domain iv of her3 Withdrawn EP2788381A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201161566912P 2011-12-05 2011-12-05
PCT/IB2012/056956 WO2013084151A2 (en) 2011-12-05 2012-12-04 Antibodies for epidermal growth factor receptor 3 (her3) directed to domain iii and domain iv of her3

Publications (1)

Publication Number Publication Date
EP2788381A2 true EP2788381A2 (en) 2014-10-15

Family

ID=47561692

Family Applications (1)

Application Number Title Priority Date Filing Date
EP12816130.4A Withdrawn EP2788381A2 (en) 2011-12-05 2012-12-04 Antibodies for epidermal growth factor receptor 3 (her3) directed to domain iii and domain iv of her3

Country Status (16)

Country Link
EP (1) EP2788381A2 (https=)
JP (1) JP2015500830A (https=)
KR (1) KR20140099315A (https=)
CN (1) CN104093742A (https=)
AR (1) AR089085A1 (https=)
AU (1) AU2012349739A1 (https=)
BR (1) BR112014013495A2 (https=)
CA (1) CA2857939A1 (https=)
EA (1) EA201491120A1 (https=)
IL (1) IL232950A0 (https=)
IN (1) IN2014CN04374A (https=)
MX (1) MX2014006731A (https=)
SG (1) SG11201402784WA (https=)
TW (1) TW201331225A (https=)
UY (1) UY34488A (https=)
WO (1) WO2013084151A2 (https=)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015130173A1 (en) * 2014-02-28 2015-09-03 Merus B.V. Antibody that binds erbb-2 and erbb-3
JP6771385B2 (ja) 2014-02-28 2020-10-21 メルス ナムローゼ フェンノートシャップ 二重特異性抗体および医薬組成物
EP3539990B1 (en) 2014-07-16 2021-09-08 Dana-Farber Cancer Institute, Inc. Her3 inhibition in low-grade serous cancers
CN104530237B (zh) * 2014-12-31 2017-09-05 百泰生物药业有限公司 抗Her1的治疗性抗体
SMT202100230T1 (it) 2015-10-23 2021-07-12 Fundacio Inst De Recerca Biomedica Irb Barcelona Molecole di legame che inibiscono la crescita tumorale
JP6729926B2 (ja) * 2016-05-12 2020-07-29 国立大学法人神戸大学 ErbB3活性化に伴うシグナルの伝達抑制物質及びそのスクリーニング方法
BR112019005001A2 (pt) * 2016-09-15 2019-06-04 Universität Stuttgart proteína de ligação ao antígeno, proteína de fusão, ácido nucleico, vetor recombinante, célula hospedeira recombinante, composição farmacêutica, uso médico da proteína de ligação ao antígeno e método de inibição do crescimento tumoral
KR101923641B1 (ko) * 2016-11-25 2018-11-29 재단법인 목암생명과학연구소 항her3 항체 및 이를 포함하는 암 예방 또는 치료용 조성물
IL269656B2 (en) 2017-03-31 2024-06-01 Merus Nv Bispecific antibodies that bind ERBB-2 and ERBB3 for use in the treatment of cells with NRG1 fusion gene
JP7296891B2 (ja) 2017-05-17 2023-06-23 メルス ナムローゼ フェンノートシャップ 乳癌のためのErbB-2/ErbB-3二重特異性抗体と内分泌療法との組み合わせ
SG11202001050PA (en) 2017-08-09 2020-03-30 Merus Nv Antibodies that bind egfr and cmet

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AR056857A1 (es) * 2005-12-30 2007-10-24 U3 Pharma Ag Anticuerpos dirigidos hacia her-3 (receptor del factor de crecimiento epidérmico humano-3) y sus usos
EP2425009A4 (en) * 2009-04-29 2013-01-23 Trellis Bioscience Llc Improved antibodies immunoreactive with heregulin-coupled her3
EP2896632B1 (en) * 2009-11-13 2017-10-25 Daiichi Sankyo Europe GmbH Material and methods for treating or preventing HER-3 associated diseases
MX343227B (es) * 2010-04-09 2016-10-28 Aveo Pharmaceuticals Inc Anticuerpos anti-erbb3.
TW201302793A (zh) * 2010-09-03 2013-01-16 Glaxo Group Ltd 新穎之抗原結合蛋白
NO2707391T3 (https=) * 2011-05-13 2018-04-07
EP2736928B1 (en) * 2011-07-28 2019-01-09 i2 Pharmaceuticals, Inc. Sur-binding proteins against erbb3

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "Competitive inhibition", INTERNET CITATION, 13 September 2011 (2011-09-13), pages 1 - 5, XP002660444, Retrieved from the Internet <URL:http://en.wikipedia.org/wiki/Competitive_inhibition> [retrieved on 20111003] *
GERSHONI JONATHAN M ET AL: "Epitope mapping - The first step in developing epitope-based vaccines", BIODRUGS: CLINICAL IMMUNOTHERAPEUTICS, BIOPHARMACEUTICALS AND GENE THERAPY, ADIS INTERNATIONAL, FR, vol. 21, no. 3, 1 January 2007 (2007-01-01), pages 145 - 156, XP009103541, ISSN: 1173-8804, DOI: 10.2165/00063030-200721030-00002 *

Also Published As

Publication number Publication date
KR20140099315A (ko) 2014-08-11
UY34488A (es) 2013-07-31
BR112014013495A8 (pt) 2017-06-13
JP2015500830A (ja) 2015-01-08
SG11201402784WA (en) 2014-06-27
AU2012349739A1 (en) 2014-06-26
IL232950A0 (en) 2014-07-31
IN2014CN04374A (https=) 2015-09-04
TW201331225A (zh) 2013-08-01
AR089085A1 (es) 2014-07-30
WO2013084151A3 (en) 2014-01-03
CA2857939A1 (en) 2013-06-13
EA201491120A1 (ru) 2015-07-30
WO2013084151A2 (en) 2013-06-13
MX2014006731A (es) 2015-06-04
CN104093742A (zh) 2014-10-08
BR112014013495A2 (pt) 2017-06-13

Similar Documents

Publication Publication Date Title
AU2018201967B2 (en) Antibodies for epidermal growth factor receptor 3 (HER3)
US10077317B2 (en) Antibodies for epidermal growth factor receptor 3 (HER3)
US20130273029A1 (en) Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3
WO2013084151A2 (en) Antibodies for epidermal growth factor receptor 3 (her3) directed to domain iii and domain iv of her3
HK1182118B (en) Antibodies for epidermal growth factor receptor 3 (her3)
HK1182118A (en) Antibodies for epidermal growth factor receptor 3 (her3)

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20140707

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20151217

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20160429