EP2632931A2 - Compositions et procédés de clivage spécifique d'arn exogène dans une cellule - Google Patents

Compositions et procédés de clivage spécifique d'arn exogène dans une cellule

Info

Publication number
EP2632931A2
EP2632931A2 EP11835735.9A EP11835735A EP2632931A2 EP 2632931 A2 EP2632931 A2 EP 2632931A2 EP 11835735 A EP11835735 A EP 11835735A EP 2632931 A2 EP2632931 A2 EP 2632931A2
Authority
EP
European Patent Office
Prior art keywords
sequence
rna
interest
nucleotides
exogenous
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP11835735.9A
Other languages
German (de)
English (en)
Other versions
EP2632931A4 (fr
Inventor
Guy Abitbol
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
NANODOC Ltd
Original Assignee
NANODOC Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by NANODOC Ltd filed Critical NANODOC Ltd
Publication of EP2632931A2 publication Critical patent/EP2632931A2/fr
Publication of EP2632931A4 publication Critical patent/EP2632931A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07HSUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
    • C07H21/00Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
    • C07H21/04Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with deoxyribosyl as saccharide radical
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering N.A.

Definitions

  • the present invention relates to compositions for cleaving an exogenous RNA of interest only in the presence of an endogenous signal RNA sequence, thereby activating expression of a polynucleotide of interest only in the presence of the endogenous signal RNA sequence.
  • the invention further relates to uses of the compositions in treatment and diagnosis of various conditions and disorders, as exemplified by selectively activating expression of a toxin only in target cell populations.
  • the Dicer enzyme which is an endoribonuclease of the RNase III family, recognizes the stem in the pre-miRNA as dsRNA and cleaves and releases a 21 bp dsRNA (miRNA duplex) from the 3' and 5' end of the pre-miRNA.
  • the two strands of the duplex are separated from each other by the Dicer- TRBP complex and the strand that has thermodynamically weaker 5' end is incorporated into the RNA induced silencing complex (RISC) [3].
  • RISC RNA induced silencing complex
  • the mature miRNA guides RISC to a target site within mRNAs. If the target site is near perfect complementarity to the mature miRNA, the mRNA will be cleaved at a position that is located about 10 nucleotides upstream from the 3' end of the target site [3]. After the cleavage, the RISC- mature miRNA strand complex is recycled for another round of activity [4]. If the target site has lower complementarity to the mature miRNA the mRNA will not be cleaved at the target site but the translation of the mRNA will be suppressed. Although about 530 miRNAs have been identified so far in humans, it is estimated that vertebrate genomes encode up to 1,000 unique miRNAs, which are predicted to regulate expression of at least 30% of the genes [5]. See FIG. 1.
  • RNA polymerase III U6 promoter is a very strong promoter for transcribing small RNA (sRNA)
  • RNA polymerase II CMV promoter is a strong promoter for transcribing protein-coding genes.
  • H2ac human HIST1H2AC
  • Transcripts from this gene lack poly(A) tails but instead contain a palindromic termination element (5'- GGCUCUUUUCAGAGCC-3') that forms a conserved stem-loop structure at the 3'-UTR, which plays an important role in mRNA processing and stability [11].
  • a palindromic termination element (5'- GGCUCUUUUCAGAGCC-3') that forms a conserved stem-loop structure at the 3'-UTR, which plays an important role in mRNA processing and stability [11].
  • Ribosome inactivating proteins are protein toxins that are of plant or microbial origin. RIPs inhibit protein synthesis by inactivating ribosomes. Recent studies suggest that RIPs are also capable of inducing cell death by apoptosis.
  • Type II RIPs contain a toxic A-chain and a lectin like subunit (B-chain) linked together by a disulfide bond. The B chain is catalytically inactive, but serves to mediate entry of the A-B protein complex into the cytosol.
  • Ricin, Abrin and Diphtheria toxin are very potent Type II RIPs. It has been reported that a single molecule of Ricin or Abrin reaching the cytosol can kill the cell [12, 13]. In addition, a single molecule of Diphtheria toxin fragment A introduced into a cell can kill the cell [14].
  • compositions for the selective killing of only those cells that contain a specific signal sequence have been proposed.
  • One approach, developed by Intronn Company, is to build an inactive Toxin that is activated by trans- splicing between the inactive Toxin to the signal sequence [17, 18 and 19].
  • This approach has several inherent problems: The first problem is that the RNA molecule that comprises the signal sequence must be present in the cell at very high copy number, since trans- splicing events are very rare. The second problem is that in most cases this approach is not suitable for a signal sequence that is of cancer origin, since in cancer, mutations spread over a short region. The third problem is that the trans-splicing events can also occur at random and may thus cause harmful side effects.
  • RNA molecule that comprises the signal sequence must include an intron at a very specific site.
  • Another approach which won the 2004 World Technology Award in Biotechnology, suggested using small dsDNA, ssDNA, hairpin DNA and restriction enzyme, however this approach can work only in cell extracts under very unique and not under physiological conditions in living cells [20].
  • Other approach such as disclosed, for example, in WO 07/00068 are directed to a gene vector and comprising a miRNA sequence target and its use to prevent or reduce expression of transgene in a cell which comprises a corresponding miRNA.
  • an exogenous RNA of interest which is an RNA sequence that comprises a specific sequence that is of sufficient complementarity to the predetermined signal sequence.
  • a functional RNA that is capable of effecting the cleavage of the endogenous signal RNA at the 5' or 3 ' end of the predetermined signal sequence; and
  • a carrier RNA that is an RNA molecule that is capable of binding to the cleaved signal RNA portion that comprises the predetermined signal sequence at the predetermined signal sequence end, in such a way that the RNA duplex that formed is 14-31 nucleotides long and it comprises 3' or 5' overhang of 0-5 nucleotides, such that the RNA duplex is a substrate for a Dicer.
  • the composition of the invention may also comprise or encode an additional functional RNA that is capable of effecting the cleavage of the endogenous signal RNA at the opposite end of the predetermined signal sequence to that cleaved by the first functional RNA.
  • the carrier RNA that is encoded by the composition may be driven by a polymerase I based promoter or polymerase III based promoter.
  • the exogenous RNA of interest may further comprise:
  • an inhibitory sequence that is capable of inhibiting the expression of the exogenous protein of interest; such that the specific target/cleavage site is located between the inhibitory sequence and the sequence encoding the exogenous protein of interest, whereby, following introduction of the composition into a cell comprising the endogenous signal RNA, the exogenous RNA of interest may be transcribed and cleaved at the specific cleavage/target site so that the inhibitory sequence is detached from the sequence encoding the exogenous protein of interest and the exogenous protein of interest is capable of being expressed.
  • the predetermined signal sequence may be located at the 5' or 3 ' end of the endogenous signal RNA and the composition does not necessarily encode the functional RNA.
  • the present invention provides a composition for expressing an exogenous protein of interest only in the presence of an endogenous signal RNA in a cell, the exogenous protein of interest being encoded from the composition, the endogenous signal RNA being an RNA molecule which comprises a predetermined signal sequence, the predetermined signal sequence being a predetermined sequence that is at least 18 nucleotides in length and the composition comprising one or more polynucleotide molecules that comprise:
  • a first sequence which is of sufficient complementarity to an edge sequence to hybridize therewith, the edge sequence being located 0-5 nucleotides upstream from the predetermined cleavage site and extending upstream in the signal RNA, wherein the first sequence comprises one or more initiation codon(s), wherein each of the initiation codons consists essentially of 5'-AUG-3';
  • the exogenous RNA of interest molecule comprises a sequence encoding an exogenous protein of interest at least 21 nucleotides downstream from the 5' end of said exogenous RNA of interest molecule; whereby following introduction of the composition into a cell comprising the endogenous signal RNA, the functional RNA effects the cleavage, directly or indirectly, of the endogenous signal RNA at the 3' end of the predetermined signal sequence and thereby the exogenous RNA of interest molecule is hybridized to the edge sequence at the cleaved endogenous signal RNA and may direct the predetermined signal sequence to a Dicer processing that may cleave the exogenous RNA of interest molecule, whereby each of the initiation codon(s) is detached from the sequence encoding the exogenous protein of interest and the exogenous protein of interest is capable of being expressed.
  • the edge sequence may be 25-30 nucleotides in length and may be located 2 nucleotides upstream from the predetermined cleavage site and extends upstream in the endogenous signal RNA, wherein the second sequences is 0 nucleotides in length.
  • each of the initiation codon(s) may be located 0-21 nucleotides downstream from the 5' end of the exogenous RNA of interest molecule, such that each of the initiation codon(s) and the sequence encoding the exogenous protein of interest are not in the same reading frame.
  • at least one of the initiation codon(s) may be located within a Kozak consensus sequence or any other translation initiation motif/element.
  • the functional RNA may be selected from, but is not limited to: microRNA (miRNA), short-hairpin RNA (shRNA), 1 000827 small-interfering RNA (siRNA) and/or ribozyme.
  • miRNA microRNA
  • shRNA short-hairpin RNA
  • siRNA 1 000827 small-interfering RNA
  • ribozyme RNA sequence
  • the exogenous protein of interest may be, for example, but is not limited to Diphtheria toxin A chain, RIP protein, and any other protein toxin.
  • compositions of the invention may be used in various methods and applications, such as, for example, but not limited to: regulation of gene expression, targeted cell death, treatment of a disease or a condition including, for example, proliferative disorders (such as cancer), infectious diseases, and the like, diagnosis of a disease or a condition, formation of transgenic organisms, suicide gene therapy, and the like.
  • a composition comprising one or more polynucleotides for directing specific cleavage of an exogenous RNA of interest at a specific target site, the cleavage taking place only in the presence of an endogenous signal RNA in a cell, the endogenous signal RNA being an RNA molecule which comprises a signal sequence, the signal sequence being any predetermined sequence of from 18 to 25 nucleotides in length, whereby introduction of said composition into a cell comprising said endogenous signal RNA, directs the cleavage of said exogenous RNA of interest at the specific target site that is located within a specific sequence, which is of sufficient complementarity to hybridize with the predetermined signal sequence.
  • the one or more polynucleotides may comprise a first polynucleotide sequence encoding said exogenous RNA of interest; a second polynucleotide sequence encoding a functional RNA capable of mediating the cleavage of the endogenous signal RNA at a predetermined cleavage site; and a third polynucleotide sequence encoding a carrier RNA.
  • the edge sequence is 23-28 nucleotides in length and is located starting from the predetermined cleavage site to about 23-28 nucleotides downstream, wherein the second sequence is 2 nucleotides in length and wherein said third sequence is 0 nucleotides in length.
  • the edge sequence is 25-30 nucleotides in length and is located 2 nucleotides upstream from the predetermined cleavage site and extends upstream in said endogenous signal RNA, wherein said second sequence is 0 nucleotides in length and wherein said third sequence is 0 nucleotides in length.
  • the carrier RNA may be processed from a polynucleotide sequence comprising a carrier sequence that is at least about 18 nucleotides in length, said carrier sequence consisting essentially of: a first sequence of from 14 to 31 nucleotides in length which is of sufficient complementarity to an edge sequence to hybridize therewith, said edge sequence is 14-31 nucleotides in length and is located 0-5 nucleotides downstream from said predetermined cleavage site and extends downstream in said endogenous signal RNA; a second sequence downstream from said first sequence, wherein said second sequence is a random sequence that is 0-5 nucleotides in , length; and a third sequence upstream from said first sequence, wherein said third sequence is 0-7000 nucleotides in length; wherein the polynucleotide sequence is cleaved within the cell at a carrier cleavage site that is a 3' end of said carrier sequence; wherein the cleavage at the carrier cleavage site is
  • the endogenous signal RNA is a cellular mRNA, viral RNA, or both.
  • the predetermined signal sequence is unique to neoplastic cells, viral infected cells, or both.
  • sufficient complementarity is at least 3,0% complementarity. In further embodiments, sufficient complementarity is at least 90%.
  • the functional RNA may be selected from the group consisting of: microRNA (miRNA), lariat-form RNA, short-hairpin RNA (shRNA), siRNA expression domain, antisense RNA, double-stranded RNA (dsRNA), small -interfering RNA (siRNA) and ribozyme.
  • miRNA microRNA
  • shRNA short-hairpin RNA
  • siRNA expression domain siRNA expression domain
  • antisense RNA antisense RNA
  • dsRNA double-stranded RNA
  • siRNA small -interfering RNA
  • ribozyme ribozyme
  • the exogenous protein of interest is a toxin. In some embodiments, the exogenous protein of interest is selected from the group consisting of: Ricin, Ricin A chain, Abrin, Abrin A chain, Diphtheria toxin A chain and modified forms thereof.
  • the inhibitory sequence in the exogenous RNA of interest sequence is located upstream from the specific target site.
  • the inhibitory sequence comprise one or more initiation codons, wherein each of the initiation codons and the sequence encoding the exogenous protein of interest are not in the same reading frame, and wherein said inhibitory sequence, directly or indirectly, reduces the efficiency of translation of said exogenous protein of interest.
  • the one or more initiation codons is consisting essentially of 5'-AUG-3'
  • the exogenous RNA of interest may further comprise a stop codon that is located between the initiation codon and the start codon of the sequence encoding the exogenous protein of interest, wherem the stop codon and the initiation codon are in the same reading frame.
  • the stop codon may be selected from the group consisting of: 5'-UAA-3', 5'-UAG-3' and 5'-UGA-3'.
  • the inhibitory sequence may further comprise a nucleotide sequence downstream from the initiation codon, wherein said nucleotide sequence and said initiation codon are in the same reading frame, and wherein the nucleotide sequence encodes a sorting signal for subcellular localization.
  • the subcellular localization may be selected from the group consisting of: mitochondria, nucleus, endosome, lysosome, peroxisome and endoplastic reticulum (ER).
  • the inhibitory sequence may further comprise a nucleotide sequence downstream from the initiation codon, wherein the nucleotide sequence and the initiation codon are in the same reading frame; and wherein said nucleotide sequence encodes a protein degradation signal.
  • the inhibitory sequence may further comprise a nucleotide sequence downstream from the initiation codon, wherein the nucleotide sequence and the initiation codon are in the same reading frame; wherein said nucleotide sequence and said sequence encoding the exogenous protein of interest are in the same reading frame; and wherein said nucleotide sequence encodes an amino acid sequence; whereby when the amino acid sequence is fused to the exogenous protein of interest the biological function of the exogenous protein of interest is inhibited.
  • the inhibitory sequence may be located upstream from the sequence encoding the exogenous protein of interest, wherein the inhibitory sequence is capable of forming a secondary structure, having a folding free energy of lower than -30 kcal/mol, whereby said secondary structure is sufficient to block scanning ribosomes from reaching the start codon of said exogenous protein of interest.
  • the exogenous RNA of interest may further comprise an internal ribosome entry site (IRES) sequence downstream from the specific cleavage site and upstream from the sequence encoding the exogenous protein of interest, wherein the IRES sequence is more functional within the cleaved exogenous RNA of interest than within the intact exogenous RNA of interest.
  • IRES internal ribosome entry site
  • the composition may further comprise an additional polynucleotide sequence that encodes for an additional RNA molecule, said additional RNA molecule comprises at the 3' end a nucleotide sequence that is capable of binding to a sequence that is located upstream of said specific target site and downstream from the sequence encoding the exogenous protein of interest, wherein the additional RNA molecule, directly or indirectly, increases the efficiency of translation of said exogenous protein of interest in the cleaved exogenous RNA of interest.
  • the composition may further comprise an additional polynucleotide sequence that encodes a cleaving component that is capable of effecting the cleavage, of said exogenous RNA of interest at a position that is located upstream from the inhibitory sequence, wherein said cleaving component(s) is selected from the group consisting of: a) a nucleic acid sequence that is located within said exogenous RNA of interest, wherein said nucleic acid sequence is selected from the group consisting of: a) endonuclease recognition site, endogenous miRNA binding site, cis acting ribozyme and miRNA sequence, wherein said nucleic acid sequence, directly or indirectly, reduces the efficiency of translation of said exogenous protein of interest in the exogenous RNA of interest; and b) an inhibitory RNA, wherein said inhibitory RNA is selected from the group consisting of: microRNA (miRNA), lariat-form RNA, short-hairpin RNA (shRNA), siRNA expression
  • miRNA micro
  • the exogenous RNA of interest and the functional RNA are capable of being located on the same or different polynucleotide molecules. In some embodiments, the exogenous RNA of interest, the functional RNA and the functional nucleic acid are capable of being located on one or more polynucleotide molecules.
  • the one or more polynucleotides of the composition may be integrated into the cell genome.
  • the cell may be selected from a group consisting of: human cell, animal cell, cultured cell and plant cell. In some embodiments, the cell may be present in an organism.
  • a composition comprising one or more polynucleotides for directing specific expression of an exogenous protein of interest in a cell, wherein the exogenous protein of interest is expressed only in the presence of an endogenous signal RNA in a cell, the endogenous signal RNA being an RNA molecule which comprises a signal sequence, the signal sequence being any predetermined sequence of from 18 to 25 nucleotides in length, whereby introduction of said composition into a cell comprising said endogenous signal RNA directs the cleavage of an exogenous RNA of interest at a specific target site that is located within a specific sequence, which is of sufficient complementarity to hybridize with the predetermined signal sequence, wherein only after the cleavage of said exogenous RNA of interest in the cell, the exogenous protein of interest, which is encoded by said cleaved exogenous RNA of interest is capable of being expressed in the cell.
  • FIG. 1 is a general scheme of a model for biogenesis and activity of microRNAs (miRNAs) in a cell.
  • miRNAs microRNAs
  • the composition of the invention encodes for: an exogenous RNA of interest that comprises a specific sequence which is complementary to the predetermined signal sequence of the endogenous signal RNA, a functional RNA which is shRNA that is capable of effecting the cleavage of the endogenous signal RNA at the 5' end of the predetermined signal sequence, a carrier sequence that is of 27 nucleotides long and a functional nucleic acid which is cis acting ribozyme that is capable of effecting the cleavage of the carrier RNA at the 3' end of the carrier sequence.
  • FIG. 5 is a schematic drawing showing an example for cleaving exogenous RNA of interest in response to the presence of an endogenous signal RNA in a cell, according to some embodiments.
  • the composition of the invention encodes for: an exogenous RNA of interest that comprises a specific sequence which is complementary to the predetermined signal sequence of the endogenous signal RNA, a functional RNA which is shRNA that is capable of effecting the cleavage of the endogenous signal RNA at the 3' end of the predetermined signal sequence, a carrier sequence that is of 27 nucleotides long and a functional nucleic acid which is cis acting ribozyme that is capable of effecting the cleavage of the carrier RNA at the 5' end of the carrier sequence.
  • FIG. 6B is a schematic drawing showing an example for inhibitory RNA that is capable of effecting the cleavage of the endogenous signal RNA at the 3' end of the predetermined signal sequence, according to some embodiments.
  • FIG. 7A is a schematic drawing showing an example for inhibitory RNA that is capable of effecting the cleavage of the carrier RNA at the 3' end of the carrier sequence, according to some embodiments.
  • FIG. 7B is a schematic drawing showing an example for inhibitory RNA that is capable of effecting the cleavage of the carrier RNA at the 5' end of the carrier sequence, according to some embodiments.
  • FIG. 8A is a schematic drawing showing an example for inhibitory RNA which, according to some embodiments, is an RNA duplex that may be a substrate for Dicer.
  • FIG. 8B is a schematic drawing showing an example for inhibitory RNA which, according to some embodiments, is an RNA duplex that may be a substrate for Dicer.
  • FIG. 9A is a schematic drawing showing an example, according to some embodiments, for hammerhead-type ribozyme (SEQ ID NO. 89) that is capable of effecting the cleavage of the endogenous signal RNA or the carrier RNA at the predetermined cleavage site or at the carrier cleavage site of, respectively.
  • SEQ ID NO. 89 hammerhead-type ribozyme
  • FIG. 9B is a schematic drawing showing an example, according to some embodiments, for hairpin-type ribozyme that is capable of effecting the cleavage of the endogenous signal RNA or the carrier RNA at the predetermined cleavage site or at the carrier cleavage site, respectively.
  • the exemplary hairpin-type ribozyme is composed of SEQ ID NO. 90, preceded by a sequence complementary to the target RNA, the tetra-nucleotide AAGA (SEQ ID NO. 1 14) and an additional sequence complementary to the target RNA (at the 5' end of the ribozyme).
  • FIG. 11 is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid that is the very efficient cis-acting hammerhead ribozyme - Ni l 7 (SEQ ID NO. 92) [23] which is capable of effecting the cleavage of the carrier RNA (SEQ ID NO. 93) at the 5' end of the carrier sequence.
  • a functional nucleic acid that is the very efficient cis-acting hammerhead ribozyme - Ni l 7 (SEQ ID NO. 92) [23] which is capable of effecting the cleavage of the carrier RNA (SEQ ID NO. 93) at the 5' end of the carrier sequence.
  • FIG. 12A is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid that is an endonuclease recognition site or an endogenous miRNA binding site, such that the functional nucleic acid is capable of effecting the cleavage of the carrier RNA at the 3' end of the carrier sequence.
  • FIG. 12B is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid that is an endonuclease recognition site or an endogenous miRNA binding site, such that the functional nucleic acid is capable of effecting the cleavage of the carrier RNA at the 5' end of the carrier sequence.
  • FIG. 12C is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid that is a miR A sequence, such that the miRNA sequence is capable of effecting the cleavage of the carrier RNA at the 3' end of the carrier sequence.
  • FIG. 12D is a schematic drawing showing an example, according to some embodiments, of a functional nucleic acid that is a miRNA sequence, such that the miRNA sequence is capable of affecting the cleavage of the carrier RNA at the 5' end of the carrier sequence.
  • FIG. 15 A is a schematic drawing showing an example, according to some embodiments, of a carrier sequence that is located in the same RNA duplex with the functional RNA, such that the double strand region is located downstream from the carrier sequence and such that when the double strand region is processed by Dicer, the carrier sequence is detached from the RNA duplex and the siRNA duplex thus formed is the functional RNA ans is capable of effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site.
  • FIG. 15B is a schematic drawing showing an example, according to some embodiments, for a carrier sequence that is located in the same RNA duplex with the functional RNA, such that the double strand region is located upstream from the carrier sequence and such that when the double strand region is processed by Dicer the carrier sequence is detached from the RNA duplex and the siRNA duplex thus formed is the functional RNA which is capable of effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site.
  • FIG. 17A is a schematic drawing showing an example, according to some embodiments, for the carrier sequence that is located in the same RNA duplex with the functional RNA, such that the double strand region is located upstream from the carrier sequence and such that when the double strand region is processed by Dicer, the siRNA duplex that is formed is the functional RNA, which is capable of effecting the cleavage of the endogenous signal RNA at the predetermined cleavage site.
  • FIG. 18A is a schematic drawing showing an example, according to some embodiments, of a carrier sequence that is located in the same RNA duplex with the functional nucleic acid, such that the double strand region is located upstream from the carrier sequence and such that when the double strand region is processed by Dicer, the siRNA duplex that is formed is the functional nucleic acid which is capable of effecting the cleavage of the carrier RNA at the carrier cleavage site.
  • FIG. 18B is a schematic drawing showing an example, according to some embodiments, for carrier sequence that is located in the same RNA duplex with the functional nucleic acid, such that the double strand region is located downstream from the carrier sequence and such that when the double strand region is processed by Dicer, the siRNA duplex that is formed is the functional nucleic acid, which and is capable of effecting the cleavage of the carrier RNA at the carrier cleavage site.
  • FIG. 19A is a schematic drawing illustrating an example, according to some embodiments, of a carrier sequence that is located in the same RNA duplex with the functional nucleic acid and with the functional RNA, such that the double strand region is located upstream from the carrier sequence, and such that when the double strand region is processed by Dicer, the siRNA duplexes that are formed are the functional nucleic acid and the functional RNA.
  • FIG. 19B is a schematic drawing illustrating an example, according to some embodiments, of a carrier sequence that is located in the same RNA duplex with the functional nucleic acid and with the functional RNA, such that the double strand region is located downstream from the carrier sequence and such that when the double strand region is processed by Dicer the siRNA duplexes that are formed are the functional nucleic acid and the functional RNA.
  • FIG. 22A is a schematic drawing showing an example, according to some embodiments, of the schematic structure of an exogenous RNA of interest that is activated by its cleavage, such that the specific sequence is located downstream from the inhibitory sequence and upstream from the sequence encoding the exogenous protein of interest.
  • FIG. 22B is a schematic drawing showing an example, according to some embodiments, of the schematic structure of an exogenous RNA of interest that is activated by its cleavage, such that the specific sequence is located upstream from the inhibitory sequence and downstream from the sequence encoding the exogenous protein of interest.
  • FIG. 23A is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises an AUG that is not in the same reading frame with the sequence encoding exogenous protein of interest.
  • FIG. 23B is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises a Kozak consensus sequence (5'-ACCAUGG-3' - SEQ ID NO. 25) that is not in the same reading frame with the sequence encoding exogenous protein of interest.
  • FIG. 23 C is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises 2 Kozak consensus sequences that are not in the same reading frame with the sequence encoding exogenous protein of interest.
  • FIG. 24A is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises an AUG and a downstream stop codon that are in the same reading frame.
  • FIG. 24B is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest, and comprises an AUG and a downstream: sorting signal for subcellular localization or protein degradation signal.
  • FIG. 24D is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target cleavage site of the exogenous RNA of interest, and comprises an AUG, a downstream stop codon that is in the same reading frame with the AUG and a downstream intron, such that the exogenous RNA of interest is a target for nonsense-mediated decay (NMD).
  • NMD nonsense-mediated decay
  • FIG. 25A is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest and comprises a binding site for translation repressor.
  • FIG. 25B is a schematic drawing showing an example, according to some embodiments, for inhibitory sequence that is located upstream from the specific target/cleavage site of the exogenous RNA of interest and comprises an RNA localization signal for subcellular localization.
  • FIG. 26 is a schematic drawing showing an example, according to some embodiments, for the activation of the exogenous RNA of interest by its cleavage, such that the inhibitory sequence creates a secondary structure that blocks translation and such that the cleavage creates an IRES (Internal ribosome entry site).
  • IRES Internal ribosome entry site
  • FIG. 27A is a schematic drawing showing an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest, that is cleaved at the 5' end, wherein the additional structure is an IRES (Internal ribosome entry site).
  • IRES Internal ribosome entry site
  • FIG. 27D is a schematic drawing showing an example, according to some embodiments, of additional structures that may increase the efficiency of translation of the exogenous RNA of interest, which is cleaved at the 5' end, wherein the additional structures are nucleotide sequences that are capable of binding to each other and by this force the exogenous RNA of interest to form a circular structure, particularly when the exogenous RNA of interest is cleaved at the specific target/cleavage site.
  • FIG. 28 A is a schematic drawing showing an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest, that is cleaved at the 5' end, such that the additional structure is a polypeptide that is encoded from the composition of the invention, wherein the polypeptide is capable of binding to the poly- A tail of the exogenous RNA of interest, and to a sequence within the exogenous RNA of interest of the invention and by this force the exogenous RNA of interest to form a circular structure, particularly when the exogenous RNA of interest is cleaved at the specific target/cleavage site.
  • additional structure is a polypeptide that is encoded from the composition of the invention, wherein the polypeptide is capable of binding to the poly- A tail of the exogenous RNA of interest, and to a sequence within the exogenous RNA of interest of the invention and by this force the exogenous RNA of interest to form a circular structure, particularly when the exogenous RNA of
  • FIG. 28B is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may reduce the efficiency of translation of the intact exogenous RNA of interest, such that the additional structure is a cis acting ribozyme that removes the CAP structure from the intact exogenous RNA of interest.
  • FIG. 29A is a schematic drawing illustrating an example, according to some embodiments, of inhibitory sequence that is located downstream from the specific target/cleavage site and comprises an intron, such that the exogenous RNA of interest is a target for nonsense- mediated decay (NMD) .
  • NMD nonsense- mediated decay
  • FIG. 29B is a schematic drawing illustrating an example, according to some embodiments, of inhibitory sequence that is located downstream from the specific target/cleavage site and comprises a binding site for translation repressor.
  • FIG. 29C is a schematic drawing illustrating an example, according to some embodiments, of inhibitory sequence that is located downstream from the specific target/cleavage site and comprises an RNA localization signal for subcellular localization.
  • FIG. 29D is a schematic drawing illustrating an example, according to some embodiments, of an inhibitory sequence that is located downstream from the specific target/cleavage site and comprises an RNA destabilizing element that is an AU-rich element or an endonuclease recognition site.
  • FIG. 29E is a schematic drawing illustrating an example, according to some embodiments, of an inhibitory sequence that is located downstream from the specific target/cleavage site and comprises a secondary structure.
  • FIG. 3 OA is a schematic drawing illustrating an example, according to some embodiments, for inhibitory sequence that is located downstream from the sequence encoding exogenous protein of interest, such that the inhibitory sequence creates a secondary structure that may block translation.
  • FIG. 30B is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest that is cleaved at the 3' end, such that the additional structure is IRES (Internal ribosome entry site).
  • FIG. 30C is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest, that is cleaved at the 3 ' end, such that the additional structure is a stem loop structure.
  • FIG. 30D is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest that is cleaved at the 3' end, such that the additional structure is a cytoplasmic polyadenylation element.
  • FIG. 31 A is a schematic drawing illustrating an example, according to some embodiments, of additional structures that may increase the efficiency of translation of the exogenous RNA of interest, that is cleaved at the 3' end, such that the additional structures are nucleotide sequences that are capable of binding to each other and consequently force the exogenous RNA of interest to form a circular structure, particularly when the exogenous RNA of interest is cleaved at the specific target/cleavage site.
  • FIG. 3 IB is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest, that is cleaved at the 3' end, such that the additional structure is a polypeptide that is encoded from the composition, wherein the polypeptide is capable of binding to the CAP and to a sequence within the exogenous RNA of interest and consequently force the exogenous RNA of interest to form a circular structure, particularly when the exogenous RNA of interest is cleaved at the specific target/cleavage site.
  • FIG. 31 C is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may increase the efficiency of translation of the exogenous RNA of interest that is cleaved at the 3' end, such that the additional structure is an additional RNA molecule that is encoded from the composition and is capable of binding to the exogenous RNA of interest an consequently provide it with a poly-A tail, particularly when the exogenous RNA of interest is cleaved at the specific target/cleavage site.
  • FIG. 3 ID is a schematic drawing illustrating an example, according to some embodiments, of additional structure that may reduce the efficiency of translation of the intact exogenous RNA of interest, such that the additional structure is a cis acting ribozyme that removes the poly-A from the intact exogenous RNA of interest.
  • FIG. 32A is a schematic drawing illustrating an example, according to some embodiments, of the structure of the exogenous RNA of interest, which comprises 2 specific sequences, such that the inhibitory sequence is located upstream from the specific target/cleavage sites.
  • FIG. 33 is a schematic drawing illustrating an example, according to some embodiments, for expressing exogenous protein of interest in response to the presence of an endogenous signal RNA in a cell.
  • the composition includes polynucleotide molecule/s that encode for an exogenous RNA of interest molecule that comprises a first sequence of 27 nucleotides at the 5' end that is 100% complementary to the predetermined signal sequence and to a sequence that is upstream from the predetermined signal sequence, the first sequence also comprises an 5'-AUG-3' sequence that is not in the same reading frame with the downstream sequence encoding the exogenous protein of interest and the composition further encodes a functional RNA which is shRNA that is capable of effecting the cleavage of the endogenous signal RNA at the 3' end of the predetermined signal sequence.
  • FIG. 35 is a schematic drawing illustrating an example, according to some embodiments, for expressing an exogenous protein of interest in response to the presence of an endogenous signal RNA in a cell.
  • the composition encodes for an exogenous RNA of interest molecule that comprises at the 5' end a first strand of siR A, such that composition further transcribes the second strand of the siRNA by polymerase I or III based promoter.
  • the first sequence of the exogenous RNA of interest molecule is 27 nucleotides in length and is complementary to the predetermined signal sequence and to the sequence that is upstream from the predetermined signal sequence, the first sequence also comprises an 5'-AUG-3' sequence that is not in the same reading frame with the downstream sequence encoding the exogenous protein of interest, such that the 5'-AUG-3' is located within a ozak consensus sequence.
  • FIG. 36A is a schematic drawing illustrating an example, according to some embodiments, of an exogenous RNA of interest that comprises a cis acting ribozyme at the 5' end, which removes the CAP structure from the exogenous RNA of interest. This removal reduces the efficiency of translation of the exogenous protein of interest in the intact exogenous RNA of interest molecule.
  • FIG. 36B is a schematic drawing illustrating an exemplary exogenous RNA of interest that comprises two nucleotide sequences that are capable of binding to each other and by this force the exogenous RNA of interest to form a circular structure that increases the efficiency of translation of the protein of interest particularly in the cleaved RNA of interest.
  • FIG. 37A is a schematic drawing illustrating an example, according to some embodiments, for cleaving exogenous RNA of interest in the presence of an endogenous signal RNA in a cell.
  • the composition encodes for: a carrier RNA of 27 nucleotides and an exogenous RNA of interest that comprises a specific sequence which is complementary to the predetermined signal sequence.
  • FIG. 37B is a schematic drawing illustrating an example, according to some embodiments, for cleaving exogenous RNA of interest in the presence of an endogenous signal RNA in a cell.
  • the composition encodes for: an exogenous RNA of interest that comprises a specific sequence which is complementary to the predetermined signal sequence; a carrier sequence that is of 27 nucleotides long and a functional nucleic acid which is a cis acting ribozyme that is capable of effecting the cleavage of the carrier RNA sequence at the 3' end of the carrier sequence.
  • FIG. 38A is a schematic drawing illustrating an example, according to some embodiments, for cleaving exogenous RNA of interest in the presence of an endogenous signal RNA in a cell.
  • the composition of the invention encodes for a carrier RNA of 27 nucleotides and an exogenous RNA of interest that comprises a specific sequence which is complementary to the predetermined signal sequence.
  • FIG. 38B is a schematic drawing illustrating an example, according to some embodiments, for cleaving exogenous RNA of interest in the presence of an endogenous signal RNA in a cell.
  • the composition encodes for: an exogenous RNA of interest that includes a specific sequence which is 100% complementary to the predetermined signal sequence, a carrier sequence that is of 27 nucleotides long and a functional nucleic acid which is a cis acting ribozyme that is capable of effecting the cleavage of the carrier RNA sequence at the 5' end of the carrier sequence.
  • FIG. 39 A is a schematic drawing illustrating an example, according to some embodiments, of an exogenous RNA of interest having its inhibitory sequence located downstream from the specific target/cleavage site and theinhibitory sequence is capable of inhibiting the function of an RNA localization signal for subcellular localization.
  • FIG. 39B is a schematic drawing illustrating an example, according to some embodiments, of an exogenous RNA of interest having its inhibitory sequence located upstream from the specific target/cleavage site and it's the inhibitory sequence is capable of inhibiting the function of an RNA localization signal for subcellular localization.
  • FIG. 39D is a schematic drawing illustrating an example, according to some embodiments, of inhibitory sequence that is located downstream from the specific sequence, such that the exogenous RNA of interest does not comprise a stop codon downstream from the start codon of the sequence encoding the exogenous protein of interest, and such that the inhibitory sequence encodes an amino acid sequence that is capable of inhibiting the cleavage of a peptide sequence that is encoded upstream, wherein the peptide sequence is capable of being cleaved by a protease in a mammalian cell.
  • FIG. 40 is a schematic drawing illustrating an example for using the composition of the invention to kill cancer cells of a specific patient, according to some embodiments.
  • FIG. 42 is a schematic drawing illustrating an example for using the composition of the invention to kill HIV-1 infected cells, according to some embodiments.
  • FIG. 44 is a schematic drawing illustrating an example for using the composition of the invention to kill cancer cells of a specific patient, according to some embodiments.
  • polynucleotide molecules As referred to herein, the terms “polynucleotide molecules”, “oligonucleotide”, “polynucleotide”, “nucleic acid” and “nucleotide” sequences may interchangeably be used herein.
  • the terms are directed to polymers of deoxyribonucleotides (DNA), ribonucleotides (RNA), and modified forms thereof in the form of a separate fragment or as a component of a larger construct, linear or branched, single stranded, double stranded, triple stranded, or hybrids thereof.
  • the term also encompasses RNA/DNA hybrids.
  • the polynucleotides may comprise sense and antisense oligonucleotide or polynucleotide sequences of DNA or RNA.
  • the DNA or RNA molecules may be, for example, but are not limited to: complementary DNA (cDNA), genomic DNA, synthesized DNA, recombinant DNA, or a hybrid thereof or an RNA molecule such as, for example, mRNA, shRNA, siR A, miRNA, and the like.
  • cDNA complementary DNA
  • RNA molecules such as, for example, mRNA, shRNA, siR A, miRNA, and the like.
  • the terms "polynucleotide molecules”, “oligonucleotide”, “polynucleotide”, “nucleic acid” and “nucleotide” sequences are meant to refer to both DNA and RNA molecules.
  • the terms further include oligonucleotides composed of naturally occurring bases, sugars, and covalent internucleoside linkages, as well as oli
  • polypeptide peptide
  • protein protein
  • amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • the term "complementarity" is directed to base pairing between strands of nucleic acids.
  • each strand of a nucleic acid may be complementary to another strand in that the base pairs between the strands are non- covalently connected via two or three hydrogen bonds.
  • Two nucleotides on opposite complementary nucleic acid strands that are connected by hydrogen bonds are called a base pair.
  • adenine (A) forms a base pair with thymine (T) and guanine (G) with cytosine (C).
  • thymine is replaced by uracil (U).
  • the degree of complementarity between two strands of nucleic acid may vary, according to the number (or percentage) of nucleotides that form base pairs between the strands. For example, “100% complementarity” indicates that all the nucleotides in each strand form base pairs with the complement strand. For example, “95% complementarity” indicates that 95% of the nucleotides in each strand from base pair with the complement strand.
  • the term sufficient complementarity may include any percentage of complementarity from about 30% to about 100%.
  • construct refers to an artificially assembled or isolated nucleic acid molecule which may be one or more nucleic acid sequences, wherein the nucleic acid sequences may comprise coding sequences (that is, sequence which encodes an end product), regulatory sequences, non-coding sequences, or any combination thereof.
  • construct encompases, for example, vector but should not be seen as being limited thereto.
  • Expression vector refers to vectors that have the ability to incorporate and express heterologous nucleic acid fragments (such as, for example, DNA), in a foreign cell.
  • an expression vector comprises nucleic acid sequences/fragments (such as DNA, mRNA, tRNA, rRNA), capable of being transcribed.
  • nucleic acid sequences/fragments such as DNA, mRNA, tRNA, rRNA
  • Many prokaryotic and eukaryotic expression vectors are known and/or commercially available. Selection of appropriate expression vectors is within the knowledge of those having skill in the art.
  • Upstream and Downstream refers to a relative position in a nucleotide sequence, such as, for example, a DNA sequence or an RNA sequence.
  • a nucleotide sequence has a 5' end and a 3' end, so called for the carbons on the sugar (deoxyribose or ribose) ring of the nucleotide backbone.
  • downstream relates to the region towards the 3' end of the sequence.
  • upstream relates to the region towards the 5' end of the strand.
  • promoter element refers to a nucleotide sequence that is generally located at the 5' end (that is, precedes, located upstream) of the coding sequence and functions as a switch, activating the expression of a coding sequence. If the coding sequence is activated, it is said to be transcribed. Transcription generally involves the synthesis of an RNA molecule (such as, for example, a mRNA) from a coding sequence.
  • the promoter therefore, serves as a transcriptional regulatory element and also provides a site for initiation of transcription of the coding sequence into mRNA.
  • Promoters may be derived in their entirety from a native source, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic nucleotide segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions, or at various expression levels. Promoters which cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters”. Promoters that control gene expression in a specific tissue are called “tissue specific promoters”. As referred to herein, the terms "RNA of interest”, “exogenous RNA of interest”, and “ROI” may interchangeably be used. The terms refer to a nucleotide sequence which is introduced into a target cell and may encode for an RNA molecule within the target cell.
  • protein of interest As referred to herein, the terms “protein of interest”, “exogenous protein of interest”, and “POI” may interchangeably be used.
  • the terms refer to a peptide sequence which is translated from the exogenous RNA of interest.
  • the peptide sequence can be one or more separate proteins or a fusion protein.
  • the terms “signal RNA” and “endogenous signal RNA” may interchangeably be used.
  • the terms refer to an intracellular RNA molecule/sequence which comprises a predetermined signal sequence.
  • the endogenous signal RNA molecule may be encoded by the genome of the cell, and/or from a foreign genome residing within the cell, such as, for example, from a virus residing within the cell.
  • the endogenous signal RNA is a mature mRNA molecule.
  • the endogenous signal RNA is a viral RNA. The signal RNA is present within the target cell prior to introduction of an exogenous RNA of interest into the cell.
  • predetermined signal sequence As referred to herein, the terms “predetermined signal sequence” and “signal sequence” may interchangeably be used.
  • predetermined cleavage site and “an additional cleavage site”, refer to a cleavage site within the sequence of the endogenous signal RNA.
  • specific target/cleavage sites may interchangeably be used. The terms relate to one or more cleavage sites within the sequence of the exogenous RNA of interest.
  • ORF Open Reading Frame
  • ozak sequence is well known in the art and is directed to a sequence on an mRNA molecule that is recognized by the ribosome as the translational start site.
  • the terms "Kozak consensus sequence”, “Kozak consensus” or “Kozak sequence” is a sequence which occurs on eukaryotic mR A and has the consensus (gcc)gccRccAUGG (SEQ ID NO. 24), where R is a purine (adenine or guanine), three bases upstream of the start codon (AUG), which is followed by another 'G'.
  • the Kozak sequence has the sequence RNNAUGG, wherein N is any nucleotide of A, G, C or U (SEQ ID NO. 112).
  • introducing and “transfection” may interchangeably be used and refer to the transfer of molecules, such as, for example, nucleic acids, polynucleotide molecules, vectors, and the like into a target cell(s), and more specifically into the interior of a membrane-enclosed space of a target cell(s).
  • the molecules can be "introduced” into the target cell(s) by any means known to those of skill in the art, for example as taught by Sambrook et al. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York (2001), the contents of which are incorporated by reference herein.
  • Means of "introducing" molecules into a cell include, for example, but are not limited to: heat shock, calcium phosphate transfection, PEI transfection, electroporation, lipofection, transfection reagent(s), viral -mediated transfer, and the like, or combinations thereof.
  • the transfection of the cell may be performed on any type of cell, of any origin, such as, for example, human cells, animal cells, plant cells, and the like.
  • the cells may be, for example, but not limited to: isolated cells, tissue cultured cells, cell lines, cells present within an organism body, and the like.
  • the term "Kill" with respect to a cell/cell population is directed to include any type of manipulation that will lead to the death of that cell/cell population.
  • Treating a disease or “treating a condition” is directed to administering a composition, which includes at least one reagent (which may be, for example, one or more polynucleotide molecules, one or more expression vectors, one or more substance/ingredient, and the like), effective to ameliorate symptoms associated with a disease, to lessen the severity or cure the disease, or to prevent the disease from occurring.
  • Administration may be any administration route.
  • Detection refers to methods of detection of a disease, symptom, disorder, pathological or normal condition; classifying a disease, symptom, disorder, pathological condition; determining a severity of a disease, symptom, disorder, pathological condition; monitoring disease, symptom, disorder, pathological condition progression; forecasting an outcome and/or prospects of recovery thereof.
  • a composition for directing cleavage of exogenous RNA of interest in response to the presence of an endogenous signal RNA in a cell is provided.
  • the exogenous RNA of interest is encoded from the composition.
  • the endogenous signal RNA is an RNA molecule which comprises a predetermined signal sequence, such that the predetermined signal sequence is a random sequence of from 18 to 25 nucleotides in length.
  • the composition comprises one or more polynucleotide molecules that comprise:
  • RNA sequence (a) a polynucleotide sequence encoding the exogenous RNA of interest, such that the exogenous RNA of interest is an RNA sequence that comprises a specific sequence which is of sufficient complementarity to the predetermined signal sequence to direct target- specific RNA interference;
  • RNA RNA molecule that is at least about 18 nucleotides in length and is consisting essentially of:
  • the functional RNA effects the cleavage, directly or indirectly, of the endogenous signal RNA at the 5' end of the predetermined signal sequence and then the carrier RNA is hybridized to the edge sequence at the cleaved endogenous signal RNA and directs the processing of the predetermined signal sequence and then the processed predetermined signal sequence directs the cleavage of the exogenous RNA of interest at a specific target/cleavage site that is located within the specific sequence. For example, see FIG. 2.
  • RNA sequence (a) a polynucleotide sequence encoding the exogenous RNA of interest, such that the exogenous RNA of interest is an RNA sequence that comprises a specific sequence which is of sufficient complementarity to the predetermined signal sequence to direct target- specific RNA interference;
  • RNA RNA molecule that is at least about 18 nucleotides in length and is consisting essentially of:
  • At least one RNA duplex from the one or more RNA duplex(es) comprises the nucleic acid sequence and the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the endogenous signal RNA at the predetermined cleavage site via RNA interference. For example, see FIG. 14A.
  • the first nucleotide sequence or the second nucleotide sequence described in the former embodiment is the nucleic acid sequence, such that the carrier RNA sequence is consisting essentially of: the first nucleotide sequence and the second nucleotide sequence and the carrier sequence.
  • the first nucleotide sequence is 18-25 nucleotides in length and the second nucleotide sequence is 18-25 nucleotides in length.
  • the stem loop structure forms 3 '-overhang of 2 nucleotides and may be a substrate for a Dicer and such that the expression of the carrier RNA polynucleotide sequence is driven by polymerase I based promoter or polymerase III based promoter. For example, see FIG. 14B.
  • the use of functional RNA and a carrier sequence that are located in the same RNA molecule may require less transcriptional units, which may yield advantageous results. Additional advantage of the proximity of the functional RNA and the carrier sequence is that they are synthesized in the same location in the cell at the same time and at a constant ratio.
  • the functional nucleic acid described in embodiments of section 1 may comprise:
  • the functional nucleic acid described in embodiments in section 1 may comprise:
  • nucleotide sequence that is located immediately upstream from the 5' end of the carrier sequence in the carrier RNA, such that the carrier RNA is consisting essentially of: the carrier sequence and the nucleotide sequence; and (ii) one or more RNA molecule(s) that are capable of binding to the nucleotide sequence; such that the nucleotide sequence and at least one of the RNA molecules from the one or more RNA molecule(s) form 3'- overhang or 5 '-overhang of 0-5 nucleotides on one end of the duplex formed when each of the nucleotide sequence and the one RNA molecule is hybridized with the other.
  • At least one RNA duplex of the one or more RNA duplex(es) comprises the nucleic acid sequence, and the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the endogenous signal RNA at the predetermined cleavage site via, for example, RNA interference.
  • the region described in the former embodiment is located from about 11 nucleotides downstream from the predetermined cleavage site to about 12 nucleotides upstream from the predetermined cleavage site.
  • the one or more RNA molecule(s) that are described in any of the previous 2 embodiments is one RNA molecule, consisting essentially of the nucleic acid sequence, such that the nucleotide sequence is 18-25 nucleotides in length and the one RNA molecule is 18-25 nucleotides in length.
  • the nucleotide sequence and the one RNA molecule form 3 '-overhang of 2 nucleotides on one end of the duplex formed when each of the nucleotide sequence and the one RNA molecule is hybridized with the other, the expressions of the carrier RNA and the one RNA molecule are driven by polymerase I or III based promoter. For example, see FIG. 15A and l5B.
  • nucleotide sequence that is located at the 5' end of the carrier RNA; and (ii) one or more RNA molecule(s) that are capable of binding to the nucleotide sequence; such that the nucleotide sequence and at least one RNA molecule form 3'-overhang or 5'-overhang of 0-5 nucleotides on one end of the duplex, which is formed when each of the nucleotide sequence and the at least one RNA molecule is hybridized with the other.
  • the nucleotide sequence and the one or more RNA molecule(s) may be hybridized with the other and the nucleotide sequence may be processed, such that the processing of the nucleotide sequence is capable of forming one or more RNA duplex(es).
  • the processing of the nucleotide sequence may include Dicer processing and the RNA duplex(es) may be siRNA duplex(es) and/or miRNA duplex(es), such that at least one RNA duplex from the one or more RNA duplex(es) comprises the nucleic acid sequence and such that the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the endogenous signal RNA at the predetermined cleavage site via RNA interference.
  • the functional RNA described in embodiments in section 1 may comprise:
  • nucleotide sequence that is located at the 3' end of the carrier RNA; and (ii) one or more RNA molecule(s) that are capable of binding to the nucleotide sequence; such that the nucleotide sequence and at least one RNA molecule form 3 '-overhang or 5 '-overhang of 0-5 nucleotides on one end of the duplex which is formed when each of the nucleotide sequence and the one RNA molecule is hybridized with the other.
  • the nucleotide sequence or at least one RNA molecule from the one or more RNA molecule(s) comprises a nucleic acid sequence of from 18 to 25 nucleotides in length that is of sufficient complementarity to a target sequence to direct target-specific RNA interference, such that the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the endogenous signal RNA, wherein the region is located from about 25 nucleotides downstream from the predetermined cleavage site to about 25 nucleotides upstream from the predetermined cleavage site.
  • the nucleotide sequence and the one or more RNA molecule(s) are hybridized with each other and the nucleotide sequence is processed, such that the processing of the nucleotide sequence is capable of forming one or more RNA duplex(es).
  • the region that is described in any of the previous 2 embodiments is located from about 11 nucleotides downstream from the predetermined cleavage site to about 12 nucleotides upstream from the predetermined cleavage site.
  • the one or more RNA molecule(s) that is described in any of the previous 3 embodiments is one RNA molecule, such that the nucleotide sequence or the one RNA molecule is consisting essentially of the nucleic acid sequence.
  • the nucleotide sequence is 18-25 nucleotides in length and the one RNA molecule is 18-25 nucleotides in length, such that the nucleotide sequence and the RNA molecule form 3 '-overhang of 2 nucleotides on one end of the duplex, which is formed when each of the nucleotide sequence and the one RNA molecule is hybridized with the other.
  • the expression of the carrier RNA and the one RNA molecule are driven by polymerase I or III based promoter. For example, see FIG. 16A and 16B.
  • the carrier RNA may bring the functional RNA into proximity with the predetermined signal sequence of the endogenous signal RNA and by this may also bring the components of the RNA interference pathway (for example, Dicer and Rise) into proximity with the predetermined signal sequence.
  • the RNA interference pathway for example, Dicer and Rise
  • the functional RNA described in embodiments in section 1 may comprise:
  • nucleotide sequence that is located at the 5' end of the carrier RNA; and; (ii) one or more RNA molecule(s) that are capable of binding to the nucleotide sequence; such that the nucleotide sequence and at least one RNA molecule form 3 '-overhang or 5'-overhang of 0-5 nucleotides on one end of the duplex formed, when each of the nucleotide sequence and the RNA molecule is hybridized with each other.
  • the nucleotide sequence or at least one RNA molecule may comprise a nucleic acid sequence of from 18 to 25 nucleotides in length, such that the nucleic acid sequence is of sufficient complementarity to a target sequence to direct target-specific RNA interference.
  • the processing of the nucleotide sequence may include, for example, Dicer processing and the RNA duplex(es) may be siRNA duplex(es) and/or miRNA duplex(es), such that at least one RNA duplex from the one or more RNA duplex(es) includes the nucleic acid sequence and such that the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the endogenous signal RNA at the predetermined cleavage site via RNA interference.
  • Dicer processing and the RNA duplex(es) may be siRNA duplex(es) and/or miRNA duplex(es), such that at least one RNA duplex from the one or more RNA duplex(es) includes the nucleic acid sequence and such that the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the endogenous signal RNA at the predetermined cleavage site via RNA interference.
  • the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the endogenous signal RNA, such that the region is located from about 25 nucleotides downstream from the predetermined cleavage site to about 25 nucleotides upstream from the predetermined cleavage site.
  • the nucleotide sequence and the one or more RNA molecule(s) are hybridized with each other and the nucleotide sequence is processed, such that the processing of the nucleotide sequence is capable of forming one or more RNA duplex(es).
  • the functional nucleic acid described in embodiments in section 1 may comprise:
  • the nucleotide sequence or at least one RNA molecule from the one or more RNA molecule(s) comprises a nucleic acid sequence of from 18 to 25 nucleotides in length, such that the nucleic acid sequence is of sufficient complementarity to a target sequence to direct target-specific RNA interference, such that the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the carrier RNA and such that the region is located from about 25 nucleotides downstream from the carrier cleavage site to about 25 nucleotides upstream from the carrier cleavage site.
  • the processing of the nucleotide sequence may include, for example, Dicer processing and the RNA duplex(es) may be siRNA duplex(es) and/or miRNA duplex(es), such that at least one RNA duplex from the one or more RNA duplex(es) comprises the nucleic acid sequence and such that the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the carrier RNA at the carrier cleavage site via RNA interference.
  • Dicer processing and the RNA duplex(es) may be siRNA duplex(es) and/or miRNA duplex(es), such that at least one RNA duplex from the one or more RNA duplex(es) comprises the nucleic acid sequence and such that the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the carrier RNA at the carrier cleavage site via RNA interference.
  • RNA molecule(s) that are capable of binding to the nucleotide sequence, such that the nucleotide sequence and one RNA molecule from the one or more RNA molecule(s) form 3 '-overhang or 5 '-overhang of 0-5 nucleotides on one end of the duplex formed when each of the nucleotide sequence and the one RNA molecule is hybridized with the other.
  • the nucleotide sequence or at least one RNA molecule from the one or more RNA molecule(s) comprises a nucleic acid sequence of from 18 to 25 nucleotides in length, wherein the nucleic acid sequence is of sufficient complementarity to a target sequence to direct target-specific RNA interference, such that the target sequence is a sequence of from 18 to 25 nucleotides in length that is located in a region within the carrier RNA sequence and such that the region is located from about 25 nucleotides downstream from the carrier cleavage site to about 25 nucleotides upstream from the carrier cleavage site.
  • the nucleotide sequence and the one or more RNA molecule(s) are hybridized with each other and the nucleotide sequence is processed, such that the processing of the nucleotide sequence is capable of forming one or more RNA duplex(es).
  • the processing of the nucleotide sequence may include, for example, Dicer processing and the RNA duplex(es) may comprise siRNA duplex(es) and/or miRNA duplex(es), such that at least one RNA duplex from the one or more RNA duplex(es) comprises the nucleic acid sequence and such that the RNA duplex that comprises the nucleic acid sequence directs the cleavage of the carrier RNA at the carrier cleavage site via RNA interference.
  • the region described in any of the previous 2 embodiments may be located from about 11 nucleotides downstream from the carrier cleavage site to about 12 nucleotides upstream from the carrier cleavage site.
  • the one or more RNA molecule(s) described in any of the previous 3 embodiments is one RNA molecule, such that the nucleotide sequence or the one RNA molecule is consisting essentially of the nucleic acid sequence.
  • the nucleotide sequence is 18-25 nucleotides in length, such that the one RNA molecule is 18-25 nucleotides in length, and the nucleotide sequence and the one RNA molecule form 3 '-overhang of 2 nucleotides on one end of the duplex formed, when each of the nucleotide sequence and the one RNA molecule is hybridized with the other.
  • the expression of the carrier RNA and the one RNA molecule may be driven by polymerase I or III based promoter. For example, see FIG. 18A and 18B.
  • At least one RNA duplex from the one or more RNA duplex(es) include the specific nucleotide sequence and such that the RNA duplex that comprises the specific nucleotide sequence directs the cleavage of the endogenous signal RNA at the predetermined cleavage site via RNA interference.
  • RNA interference For example, see FIG. 19A and 19B. 5 STRUCTURE OF A CARRIER RNA SEQUENCE THAT COMPRISES AT LEAST 3 CONTIGUOUS CARRIER SEQUENCES
  • This section describes the structure of the carrier RNA described in section 1 , such that the carrier RNA comprises at least 3 contiguous carrier sequences.
  • the carrier RNA described in the embodiments in section 1 may further comprise at least 2 contiguous carrier sequences immediately upstream from the carrier sequence. For example, see FIG. 20B.
  • the carrier RNA may further comprise 100 contiguous carrier sequences, that may be identical or different, immediately upstream from the carrier sequence, such that the edge sequence is 25-30 nucleotides in length and is located 2 nucleotides upstream from the predetermined cleavage site and extends upstream in the endogenous signal RNA; the second sequence is 0 nucleotides in length; the third sequence is 0 nucleotides in length; and such that the expression of the polynucleotide sequence the carrier RNA is driven by CMV-IE promoter.
  • the functional nucleic acid is, for example, microRNA (miRNA), lariat-form RNA, short-hairpin RNA (shR A), siRNA expression domain, small-interfering RNA (siRNA) and/or trans acting ribozyme, since with such functional nucleic acids, many carrier sequences can be generated from one carrier RNA and from one functional nucleic acid.
  • miRNA microRNA
  • shR A short-hairpin RNA
  • siRNA expression domain siRNA expression domain
  • siRNA small-interfering RNA
  • trans acting ribozyme since with such functional nucleic acids, many carrier sequences can be generated from one carrier RNA and from one functional nucleic acid.
  • This section describes embodiments of the structure of the polynucleotide molecule(s) (such as, for example, DNA molecules), described in embodiments of section 1, such that the polynucleotide molecule(s) together further transcribe an additional functional RNA that is capable of effecting the cleavage of the endogenous signal RNA at the opposite end of the predetermined signal sequence, which is not cleaved.
  • the polynucleotide molecule(s) such as, for example, DNA molecules
  • the polynucleotide molecule(s) described in some embodiments of section 1 further comprise a polynucleotide sequence encoding an additional functional RNA that is capable of effecting the cleavage, directly or indirectly, of the endogenous signal RNA at an additional cleavage site, such that the additional cleavage site may be located 0-1000 nucleotides downstream from the 3' end of the predetermined signal sequence.
  • the additional cleavage site may be located 0-5 nucleotides downstream from the 3' end of the predetermined signal sequence. For example, see FIG. 21 A.
  • the polynucleotide molecule(s) described in some embodiments in section 1 may further comprise a polynucleotide sequence encoding an additional functional RNA that is capable of effecting the cleavage, directly or indirectly, of the endogenous signal RNA at an additional cleavage site, such that the additional cleavage site may be located 0-1000 nucleotides upstream from the 5' end of the predetermined signal sequence.
  • the additional cleavage site may be located 0-5 nucleotides upstream from the 5' end of the predetermined signal sequence. For example, see FIG. 2 IB.
  • the previous 4 embodiments may be advantageous since in these embodiments the predetermined signal sequence may be cleaved at both of its ends and thus with the carrier RNA/sequence it may be a better substrate for endogenous enzymes, such as, for example, Dicer and/or Rise.
  • the exogenous RNA of interest described in embodiments in section 1 may further comprise:
  • an inhibitory sequence that is capable of inhibiting the expression of the exogenous protein of interest
  • the exogenous RNA of interest is transcribed and cleaved at the specific target/cleavage site whereby the inhibitory sequence is detached from the sequence encoding the exogenous protein of interest and the exogenous protein of interest is capable of being expressed.
  • the exogenous RNA of interest may further comprise a carrier RNA sequence and/or a Functional RNA sequence.
  • mRNAs without cap or poly A tail are still capable of translating proteins.
  • an addition of a cap increases the translation of an mRNA by 35-50 fold and an addition of a poly(A) tail increases the translation of an mRNA by 1 14-155- fold [10].
  • the poly(A) tail in mammalian cells increases the functional mRNA half-life only by 2.6-fold and the cap increases the functional mRNA half-life only by 1.7- fold [10].
  • the exogenous protein of interest of the invention can be any protein or peptide.
  • the exogenous protein of interest may be any type of toxin (such as, for example, Ricin, Abrin, Diphtheria toxin (DTA), botulinium toxin); an enzyme; a reporter gene; a structural gene, and the like.
  • the exogenous protein of interest may be a polypeptide which is a fusion product of two proteins, that may be have a cleavage site there between, allowing the separation of the two proteins within the cell.
  • the exogenous protein of interest may be a fusion protein of Ricin and DTA, whereby cleavage of the fusion protein by, for example, a specific protease, can result in the formation of separate DTA and Ricin proteins in the cell.
  • the exogenous protein of interest may include two separate proteins, that may be expressed by the composition.
  • the exogenous RNA of interest may encode for two separate exogenous proteins of interest, such as, for example, Ricin and DTA. 7.1. STRUCTURE OF AN EXOGENOUS RNA OF INTEREST HAVING AN INHIBITORY SEQUENCE LOCATED UPSTREAM FROM THE SPECIFIC TARGET/CLEAVAGE SITE
  • the inhibitory sequence in the exogenous RNA of interest described in embodiments of Section 7 may be located upstream or downstream from the specific target/cleavage site.
  • This section describes the structure of the inhibitory sequence that is located upstream from the specific target/cleavage site in the exogenous R A of interest, according to some embodiments. For example, see FIG. 22A.
  • the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in embodiments in section 7 may comprise, for example, but is not limited to an initiation codon, whereby the initiation codon and the sequence encoding for the exogenous protein of interest are not in the same reading frame, such that the initiation codon causes a frameshift mutation to the protein of interest that is encoded downstream.
  • the initiation codon is located within a Kozak consensus sequence.
  • modified Kozak consensus sequences that maintain the ability to function as initiator of translation may be also used.
  • any initiator of translation element may be used. For example, see FIG. 23B.
  • the Kozak consensus sequence in human is 5'-ACCAUGG-3' (SEQ ID NO. 25) and the initiation codon is 5'-AUG-3'.
  • the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises a plurality of initiation codons, whereby each of the initiation codons and the sequence encoding exogenous protein of interest are not in the same reading frame, such that the initiation codons cause a frameshift mutation to the exogenous protein of interest that is encoded downstream.
  • each of the initiation codons is located within a Kozak consensus sequence or a modified Kozak consensus sequences that maintain the ability to function as initiator of translation. For example, see FIG. 23C.
  • the initiation codon may be located within or may comprise one or more TISU motifs.
  • a TISU (Translation Initiator of Short 5'UTR) motif is distinguished from a Kozak consensus in its unique ability to direct efficient and accurate translation initiation from mRNAs with a very short 5'UTR. [39].
  • the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in the specific embodiment in section 7 comprises an initiation codon and the exogenous RNA of interest further comprises a stop codon located between the initiation codon and the start codon of the sequence encoding the exogenous protein of interest, such that the stop codon and the initiation codon are in the same reading frame.
  • strong stems and loops may be located downstream to upstream ORF(s) at a location that is upstream or downstream to the target sequence for the miRNA (cleavage site).
  • the creation of such stems and loops may aid in conditions, wherein despite having reached a stop codon, the small subunit of the ribosome does not detach from the mRNA continue to scan the mRNA.
  • the small subunit of the ribosome is not capable of opening strong RNA secondary structures.
  • these stems and loops when these stems and loops are located downstream to the target sequence they may also block the degradation of the cleaved mRNA which may be performed, for example, by XRN1 exorinonuclease.
  • the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in the specific embodiment in section 7 comprises an initiation codon and a nucleotide sequence downstream from the initiation codon that encodes a sorting/localization/targeting signal for subcellular localization, such that the nucleotide sequence and the initiation codon are in the same reading frame and such that the subcellular localization of the protein of interest inhibits its biological function.
  • the sorting/localization signal for the subcellular localization includes, but is not limited to sorting localization signal for mitochondria, nucleus, endosome, lysosome, peroxisome, ER, or any subcellular localization or organelle.
  • the sorting signal for the subcellular localization may be selected from, for example, but is not limited to: a peroxisomal targeting signal 2 [(R7K)(L/V/I)X5(Q/H)(L/A)] (SEQ ID NO. 26) or H2N-— RLRVLSGHL (SEQ ID NO. 27) (of human alkyl dihydroxyacetonephosphate synthase) [30].
  • a peroxisomal targeting signal 2 [(R7K)(L/V/I)X5(Q/H)(L/A)]
  • H2N-— RLRVLSGHL SEQ ID NO. 27
  • the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in the specific embodiment in section 7 comprises an initiation codon and a nucleotide sequence downstream from the initiation codon that encodes a protein degradation signal, such that the nucleotide sequence and the initiation codon are in the same reading frame.
  • the protein degradation signal includes, but is not limited to ubiquitin degradation signal. For example, see FIG. 24B.
  • the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 is designed to comprise an initiation codon and a nucleotide sequence downstream from the initiation codon that is in the same reading frame with the initiation codon and with the sequence encoding the exogenous protein of interest, such that when the amino acid sequence, which is encoded by the nucleotide sequence, is fused to the protein of interest the biological function of the protein of interest is inhibited. For example, see FIG. 24C.
  • the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises an initiation codon
  • the exogenous RNA of interest further comprises a stop codon downstream from the initiation codon, such that the stop codon and the initiation codon are in the same reading frame.
  • the exogenous RNA of1 ⁇ 2terest may further comprise an intron downstream from the stop codon, such that the exogenous RNA of interest is a target for nonsense-mediated decay (NMD) that degrades the exogenous RNA of interest. For example, see FIG. 24D.
  • NMD nonsense-mediated decay
  • the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises a sequence that is capable of binding to a translation repressor protein, such that the translation repressor protein is an endogenous translation repressor protein or is encoded from the composition and such that the translation repressor protein, directly or indirectly, reduces the efficiency of translation of the protein of interest within the exogenous RNA of interest [26].
  • the sequence that is capable of binding to a translation repressor protein includes, for example, but is not limited to a sequence that binds the smaug repressor protein (5'-UGGAGCAGAGGCUCUGGCAGCUUUUGCAGCG-3') (SEQ ID NO. 28) [27]. For example, see FIG. 25A.
  • the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises an RNA localization signal for subcellular localization (including cotranslational import) or an endogenous miRNA binding site, such that the subcellular localization of the exogenous RNA of interest of the invention inhibits the translation of the protein of interest and decreases the exogenous RNA of interest half-life.
  • the RNA localization signal may be, for example, but is not limited to RNA localization signal for: myelinating periphery, mitochondria, myelin compartment, leading edge of the lamella or Perinuclear cytoplasm [24].
  • RNA localization signal for myelinating periphery is 5'- GCCAAGGAGCCAGAGAGCAUG-3' (SEQ ID NO. 29) or 5'-GCCAAGGAGCC-3' (SEQ ID NO. 30) [29]. For example, see FIG. 25B.
  • the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises an RNA destabilizing element that stimulates degradation of the exogenous RNA of interest, such that the RNA destabilizing element is an AU-rich element (ARE) or an endonuclease recognition site.
  • the AU-rich element may be, for example, but is not limited to AU-rich elements that are at least about 35 nucleotides long.
  • the AU-rich element may be, for example, but is not limited to:- 5'-AUUUA-3' (SEQ ID NO. 31), 5'-UUAUUUA(U/A)(U/A)- 3' (SEQ ID NO. 32) or 5'-AUUU-3' (SEQ ID NO. 33) [28].
  • SEQ ID NO. 31 sequence of the RNA destabilizing element
  • SEQ ID NO. 32 5'-UUAUUUA(U/A)(U/A)- 3'
  • the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises a sequence that is capable of forming a secondary structure that reduces the efficiency of translation of the downstream exogenous protein of interest.
  • the free energy of folding of the secondary structure that described in the former embodiment may be lower than -30 kcal/mol (for example,. -50 kcal/mol, -80 kcal/mol) and thus the secondary structure is sufficient to block scanning ribosomes to reach the start codon of the downstream protein of interest. For example, see FIG. 25D.
  • the inhibitory sequence that is located upstream from the specific target/cleavage site and that is described in section 7 comprises a sequence immediately upstream from the specific target/cleavage site that is capable of binding to the nucleotide sequence that is located immediately downstream from the specific target/cleavage site for the formation of a secondary structure, such that the secondary structure, directly or indirectly, reduces the efficiency of translation of the downstream exogenous protein of interest.
  • the free energy of the folding of the secondary structure that is described in the former embodiment may be lower than -30 kcal/mol (for example, -50 kcal/mol and -80 kcal/mol) and thus this secondary structure is sufficient to block scanning ribosomes to reach the start codon of the protein of interest.
  • the specific target/cleavage site is located within the single stranded region or within the loop region in the secondary structure that is described in the former embodiment, such that the single stranded region or the loop region includes, but is not limited to region that is at least about 15 nucleotides long.
  • the exogenous RNA of interest in another embodiment, comprises an internal ribosome entry site (IRES) sequence downstream from the specific target/cleavage site and upstream from the sequence encoding protein of interest, such that the IRES sequence is more functional within the cleaved exogenous RNA of interest than within the intact exogenous RNA of interest.
  • IRES internal ribosome entry site
  • at least part of the IRES sequence is located within the nucleotide sequence that is located immediately downstream from the specific target/cleavage site. For example, see FIG. 26.
  • the IRES sequence includes, for example, but is not limited to a picornavirus IRES, a foot-and-mouth disease virus IRES, an encephalomyocarditis virus IRES, a hepatitis A virus IRES, a hepatitis C virus IRES, a human rhinovirus IRES, a poliovirus IRES, a swine vesicular disease virus IRES, a turnip mosaic potyvirus IRES, a human fibroblast growth factor 2 mRNA IRES, a pestivirus IRES, a Leishmania RNA virus IRES, a Moloney murine leukemia virus IRES a human rhinovirus 14 IRES, an aphthovirus IRES, a human immunoglobulin heavy chain binding protein mRNA IRES, a Drosophila Antennapedia mRNA IRES, a human fibroblast growth factor 2 mRNA IRES, a hepatitis G virus IRES, a tob
  • This section describes further embodiments of additional structures of the composition of the invention that are described in embodiments in section 7, such that the additional structures may increase the efficiency of translation of the cleaved exogenous RNA of interest, wherein the cleaved exogenous RNA of interest is cleaved at the specific target/cleavage site at the 5' end.
  • the exogenous RNA of interest described in section 7 may comrise, for example, a sequence that comprises a unique internal ribosome entry site (IRES) sequence immediately upstream from the sequence encoding the exogenous protein of interest, such that the unique IRES sequence increases the efficiency of translation of the protein of interest in the cleaved exogenous RNA of interest.
  • IRES internal ribosome entry site
  • the exogenous RNA of interest that is described in section 7 may comprise a unique nucleotide sequence immediately downstream from the sequence encoding the protein of interest, such that the unique nucleotide sequence comprises a unique stem loop structure and such that the unique stem loop structure, directly or indirectly, increases the efficiency of translation of the protein of interest and the cleaved exogenous RNA of interest half-life.
  • the unique stem loop structure may be, for example, but is not limited to the conserved stem loop structure of the human histone gene 3'-UTR or a functional derivative thereof.
  • the conserved stem loop structure of the human histone gene 3'-UTR is 5'-GGCUCUUUUCAGAGCC-3 * (SEQ ID NO. 34). For example, see FIG. 27B.
  • the exogenous RNA of interest that is described in the specific embodiment in section 7 may comprise a unique nucleotide sequence immediately downstream from the sequence encoding the protein of interest, such that the unique nucleotide sequence comprises a cytoplasmic polyadenylation element that, directly or indirectly, increases the efficiency of translation of the protein of interest and the half-life of the cleaved exogenous R A of interest.
  • the cytoplasmic polyadenylation element may be, for example, but is not limited to 5'-UUUUAU-3'(SEQ ID NO. 35 5 - UUUUAU-3'(SEQ ID NO. 36), 5'-UUUUAAU-3'(SEQ ID NO.
  • composition of the invention may also include, for example, a polynucleotide sequence that encodes a human cytoplasmic polyadenylation element binding protein (hCPEB), and/or a homologue thereof, for expressing hCPEB in any cell.
  • hCPEB human cytoplasmic polyadenylation element binding protein
  • the exogenous RNA of interest that is described in section 7 comprises a unique nucleotide sequence that is located downstream from the specific target cleavage site and upstream from the sequence encoding the exogenous protein of interest, such that the unique nucleotide sequence is capable of binding to a sequence that is located downstream from the sequence encoding protein of interest.
  • the cleaved exogenous RNA of interest may create a circular structure that increases the efficiency of translation of the protein of interest in the cleaved exogenous RNA of interest. For example, see FIG. 27D.
  • the exogenous RNA of interest that is described in section 7 comprises a unique nucleotide sequence that is located downstream from the specific target/cleavage site and upstream from the sequence encoding protein of interest.
  • the unique nucleotide sequence may be capable of binding to a unique polypeptide that is, directly or indirectly, capable of binding to the poly(A) tail in the cleaved exogenous RNA of interest, and the unique polypeptide may be encoded from the composition of the invention.
  • the unique polypeptide and the cleaved exogenous RNA of interest may create a circular structure that increases the efficiency of translation of the protein of interest in the cleaved exogenous RNA of interest. For example, see FIG. 28A.
  • composition that is described in section 7 may further comprise a particular cleaving component(s) that is capable of effecting the cleavage, directly or indirectly, of the exogenous RNA of interest of the invention at a position that is located upstream from the inhibitory sequence, wherein the inhibitory sequence is located upstream from the specific target/cleavage site.
  • the particular cleaving component(s) may comprise:
  • RNA a particular inhibitory RNA that is encoded from the composition of the invention, such that the particular inhibitory RNA may be, for example, but is not limited to: microRNA (miRNA), lariat-form RNA, short-hairpin RNA (shRNA), siRNA expression domain, antisense RNA, double-stranded RNA (dsRNA), small- interfering RNA (siRNA) and/or ribozyme.
  • miRNA microRNA
  • shRNA short-hairpin RNA
  • siRNA expression domain siRNA expression domain
  • antisense RNA antisense RNA
  • dsRNA double-stranded RNA
  • siRNA small- interfering RNA
  • ribozyme ribozyme
  • a first sequence which is of sufficient complementarity to an edge sequence to hybridize therewith the edge sequence is located 0-5 nucleotides upstream from the predetermined cleavage site and extends upstream in the endogenous signal RNA, such that the first sequence comprises one or more initiation codon(s), such that each of the initiation codons is consisting essentially of 5'-AUG-3';
  • the carrier RNA is hybridized to the edge sequence and directs the processing of the predetermined signal sequence and then the processed predetermined signal sequence directs the cleavage of the exogenous RNA of interest at a specific cleavage/target site that is located within the specific sequence. For example, see FIG. 38 A.
  • the inhibitory sequence described above may be located upstream from the specific target/cleavage site, such that the inhibitory sequence comprises a plurality of initiation codons, such that each of the initiation codons and the sequence encoding the exogenous protein of interest are not in the same reading frame, such that each of the initiation codons is consisting essentially of 5'-AUG-3', such that at least one of the initiation codons is located within a Kozak sequence.
  • the endogenous signal RNA may be, for example, but is not limited to: viral RNA, cellular RNA, such as, for example, mRNA, and the like, that comprises the predetermined signal sequence.
  • the predetermined signal sequence may be, for example, signal sequence that is unique to neoplastic cells, signal sequence that is from viral origin, and the like, or combinations thereof.
  • the predetermined signal sequence does not comprise any other type of an endogenous RNA molecule (such as, for example, miRNA, shRNA, ribozyme, stRNA, and the like), that is able to direct or effect cleavage of an RNA molecule within the cell.
  • the edge sequence that is described in embodiments in section 1 is 25-30 nucleotides in length and is located 2 nucleotides upstream from the predetermined cleavage site and extends upstream in the endogenous signal RNA, such that the second sequence is 0 nucleotides in length and such that the third sequence is 0 nucleotides in length.
  • sufficient complementarity may include, but is not limited to: being capable of binding, or at least partially complementary.
  • the term sufficient complementarity is in the range of about 30-100%.
  • the term sufficient complementarity is at least about 30% complementarity.
  • the term sufficient complementarity is at least about 50% complementarity.
  • the term sufficient complementarity is at least about 70% complementarity.
  • the term sufficient complementarity is at least about 90% complementarity.
  • the term sufficient complementarity is about 100% complementarity.
  • the exogenous protein of interest may be, for example, but is not limited to: Ricin A chain, Abrin A chain, Diphtheria toxin fragment A or modified forms thereof.
  • the exogenous protein of interest may be, for example, but is not limited to, an enzyme (such as, for example, Luciferase), a fluorescent protein, a structural protein, and the like.
  • Such as enzyme may be, for example, but is not limited to: HSV1 thymidine kinase, such that the composition of the invention further comprises the prodrug - ganciclovir; or Escherichia coli cytosine deaminase, such that the composition of the invention further comprises the prodrug - 5- fluorocytosine (5-FC).
  • the RNA molecule(s) that are encoded from the compositions of the invention are encoded from a viral vector that is capable of being reproduced in a way that may kill the cell during the process of reproduction.
  • the predetermined signal sequence is not present in, for example, cancer cells, and is present in most of the healthy or nonmetastatic tumourigenic cells of the body of a specific patient and such that the exogenous protein of interest that is described in any of sections 7, 8 or 9 is a toxin that may be, for example, but is not limited to: Ricin A chain, Abrin A chain, Diphtheria toxin fragment A or modified forms thereof.
  • This viral vector may also comprise, for example, a gene that is capable of stopping the viral vector reproduction when a specific molecule is present in the cell (e.g. TetR-VP16 / Doxycycline).
  • a gene that is capable of stopping the viral vector reproduction when a specific molecule is present in the cell e.g. TetR-VP16 / Doxycycline.
  • This viral vector may also comprise, for example, a gene that is capable of killing the cell when a specific prodrug is present (e.g. thymidine kinase / ganciclovir), such that when the viral vector is presumed to get enough mutations for reproduction in cells that comprise the endogenous signal RNA the specific prodrug can be administered for killing all the viral vectors in the body and then new viral vectors can be administered again.
  • a specific prodrug e.g. thymidine kinase / ganciclovir
  • the specific sequence that is located within the exogenous RNA of interest that is described in section 1 or 9 is a plurality of specific sequences and the specific target/cleavage site is a plurality of specific target/cleavage sites.
  • the specific sequence that is located within the exogenous RNA of interest that is described in section 1 or 9 is one or more specific sequence(s) and the specific target/cleavage site is one or more specific target/cleavage site(s) and the exogenous RNA of interest further comprises: a sequence encoding exogenous protein of interest downstream from the specific target/cleavage site(s), one or more unique sequence(s), such that each of the unique sequence(s) is of sufficient complementarity to the predetermined signal sequence to direct target-specific RNA interference, such that each of the unique sequence(s) is located downstream from the sequence encoding the exogenous protein of interest and 2 inhibitory sequences one at the 5' end of the exogenous RNA of interest and other at the 3' end of the exogenous RNA of interest, such that each of the inhibitory sequences is capable of inhibiting the expression of the exogenous protein of interest.
  • the two inhibitory sequences are detached from the sequence encoding
  • the polynucleotide molecule(s) (such as DNA molecules and/or RNA molecules) of the composition that are described in any of sections 1, 8 or 9 may further comprise a polynucleotide sequence encoding Dicer, or a homologue thereof.
  • the polynucleotide molecule(s) of the composition that are described in section 1 or 9 together further comprise a polynucleotide sequence encoding one or more RISC components, or a homologue thereof.
  • the polynucleotide molecule(s) of the composition may further comprise a polynucleotide sequence encoding one or more RNA molecules that are capable of unwinding the secondary structure of the endogenous signal RNA at the predetermined signal sequence.
  • the inhibitory sequence that is described in any of the embodiments above may be a sequence or a part of a sequence such that when it is detached from the sequence encoding the exogenous protein of interest, the exogenous protein of interest is capable of being expressed, and when it is not detached from the sequence encoding the exogenous protein of interest, it is capable of inhibiting the expression of the exogenous protein of interest, when it is within its specific context in the exogenous RNA of interest.
  • the inhibitory sequence may also be, only a part of any of the inhibitory sequences that described above within its specific context.
  • the inhibitory sequence may also be only the A or the 5'-AU-3' part in the context of --UG-3' or --G-3' respectively (in other words, the exogenous RNA of interest comprises an out of reading frame 5'-AUG-3' at the 5' end, however the sequence that will be detached is only the 5'-AU-3' part).
  • the carrier RNA that is described in section 1 can also be 14-18 nucleotides long.
  • the first sequence and the edge sequence that are described in any of sections 1, 8 or 9 can also be 29-200 nucleotides long, as long as the duplex that is formed when they are hybridized does not activate the PKR in the cell.
  • the cells that are described in any of the previous embodiments in any of the previous sections to which the composition of the invention is inserted/introduced may further be, cells extract or in vitro mixture that comprises cellular proteins (such as, for example, Dicer, Rise).
  • the exogenous RNA of interest that is described in section 7 may further comprise an RNA localization signal for subcellular localization (including cotranslational import) between the specific target/cleavage site and the sequence encoding for the exogenous protein of interest, such that the inhibitory sequence is capable of inhibiting the function of the RNA localization signal for subcellular localization such that the subcellular localization of the exogenous RNA of interest is necessary for the proper expression of the protein of interest.
  • FIG. 39 A, 39B see FIG. 39 A, 39B.
  • the exogenous RNA of interest that is described in section 7 does not comprise a stop codon downstream from the start codon of the sequence encoding the exogenous protein of interest, such that the inhibitory sequence is located downstream from the sequence encoding the exogenous protein of interest within the exogenous RNA of interest, such that the inhibitory sequence and the sequence encoding the exogenous protein of interest are in the same reading frame, such that the inhibitory sequence encodes an amino acid sequence that is selected from the group consisting of:
  • an amino acid sequence that is a protein degradation signal (c) an amino acid sequence that is capable of inhibiting the function of the sorting signal for subcellular localization of the protein of interest; and (e) an amino acid sequence that is capable of inhibiting the cleavage of a peptide sequence that is encoded by a nucleotide sequence that is located between the specific target/cleavage site and the start codon of the sequence encoding the exogenous protein of interest, such that the nucleotide sequence and the sequence encoding the exogenous protein of interest are in the same reading frame and such that the peptide sequence is capable of being cleaved by a protease in a mammalian cell.
  • the exogenous RNA of interest and the functional RNA, that are described in embodiments in section 1 are capable of being located on the same or different RNA molecules.
  • the exogenous RNA of interest and/or the functional RNA, that are described in embodiments in section 1 are capable of being located within a third sequence.
  • the exogenous RNA of interest, the functional RNA, the carrier RNA and the functional nucleic acid, that are described in embodiments in section 1 are capable of being located on one or more RNA molecules.
  • the polynucleotide molecule(s) (such as DNA molecules and/or RNA molecules) of the composition of the invention may be recombinantly engineered, by any of the methods known in the art, into a variety of host vector systems that may also provide for replication of the polynucleotide molecule(s) in large scale and which contain the necessary elements for directing the transcription of the RNA molecule(s) that are encoded from the composition of the invention.
  • the use of such vectors to transfect target cells in the patient may result in the transcription of sufficient amounts of the RNA molecule(s) that are encoded from the composition of the invention.
  • a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of these RNA molecule(s).
  • a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired RNA molecule(s) that encoded from the composition of the invention.
  • Such vectors can be constructed by recombinant DNA technology methods well known in the art or can be prepared by any method known in the art for the synthesis of DNA molecules.
  • RNA molecule(s) which are encoded from the composition of the invention
  • RNA molecule(s) may be, for example, a plasmid, vector, viral construct, or others known in the art, used for replication and expression in the appropriate target cell (which may be, for example, mammalian cells).
  • expression of these RNA molecule(s) can be regulated by any promoter known in the art to act in the target cell (such as, for example, mammalian cells, which include, for example, human cells).
  • promoters can be inducible or constitutive.
  • Such promoters include, for example, but are not limited to: the SV40 early promoter region, the promoter contained in the 3' long terminal repeat of Rous sarcoma virus, the herpes thymidine kinase promoter, the regulatory sequences of the metallothionein gene, the viral CMV promoter, the human chorionic gonadotropin-beta promoter, and the like.
  • the promoter may be an RNA Polymerase I promoter (i.e., a promoter that is recognized by RNA Pol. I), such as, for example, the promoter of ribosomal DNA (rDNA) gene.
  • the termination signal of the exogenous RNA of interest molecule may be a RNA Pol. I termination signal or a RNA polymerase II termination signal (such as, for example, a polyA signal).
  • a RNA polymerase II termination signal such as, for example, a polyA signal.
  • Any type of plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant polynucleotide constructs which can be introduced directly into the target tissue/cell site.
  • viral vectors can be used which selectively infect the desired target cell.
  • anti-metabolic resistance can be used as the basis of selection for dihydrofolate tranferase (dhfr), which confers resistance to methotrexate; xanthine-guanine phosphoribosyl transferase (gpt), which confers resistance to mycophenolic acid; neomycin (neo), which confers resistance to aminoglycoside G-418; and hygromycin B phosphotransferase (hygro) which confers resistance to hygromycin.
  • dihydrofolate tranferase dhfr
  • methotrexate methotrexate
  • gpt xanthine-guanine phosphoribosyl transferase
  • neomycin which confers resistance to aminoglycoside G-418
  • hygromycin B phosphotransferase hygromycin
  • the composition of the invention may comprise the RNA molecule(s) that is encoded from this composition, or derivatives or modified versions thereof, single-stranded or double-stranded.
  • RNA molecule(s) that are encoded from the composition of the invention may be, for example, but are not limited to deoxyribonucleotides, ribonucleosides, phosphodiester linkages, modified linkages or bases other than the five biologically occurring bases (adenine, guanine, thymine, cytosine and uracil).
  • RNA molecule(s) that are encoded from the composition of the invention can be prepared by any method known in the art for the synthesis of RNA molecules.
  • these RNA molecule(s) may be chemically synthesized using commercially available reagents and synthesizers by methods that are well known in the art.
  • these RNA molecule(s) can be generated by in vitro and in vivo transcription of DNA sequences that encoding these RNA molecule(s).
  • DNA sequences can be incorporated into a wide variety of vectors which incorporate suitable RNA polymerase promoters such as the T7 or SP6 polymerase promoters.
  • These RNA molecule(s) may be produced in high yield via in vitro transcription using plasmids such as SPS65.
  • RNA amplification methods such as Q-beta amplification can be utilized to produce these RNA molecule(s).
  • polynucleotide molecules such as, the DNA molecule(s) and/or the RNA molecule(s), and/or the RNA molecules encoded by the composition can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, in order to improve stability of the molecule, hybridization, transport into the cell, etc. In addition, modifications can be made to reduce susceptibility to nuclease degradation.
  • the polynucleotide molecule(s) of the composition of the invention and/or the RNA molecules encoded by the composition may include any other appended groups such as, for example, peptides (for example, for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane or the blood-brai barrier, hybridization-triggered cleavage agents or intercalating agents.
  • peptides for example, for targeting host cell receptors in vivo
  • agents facilitating transport across the cell membrane or the blood-brai barrier hybridization-triggered cleavage agents or intercalating agents.
  • Various other well known modifications can be introduced as a means of increasing intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences of ribo- or deoxy-nucleotides to the 5' and/or 3' ends of the molecule.
  • nucleic acids having modified intenucleoside linkages such as 2'-0-methylation may be preferred.
  • Nucleic acids containing modified intenucleoside linkages may be synthesized using reagents and methods that are well known in the art.
  • polynucleotide molecule(s) of the composition and/or the RNA molecule(s) that encoded from the composition of the invention may be purified by any suitable means, as are well known in the art (for example, reverse phase chromatography or gel electrophoresis).
  • Cells that produce viral vectors that together encode the RNA molecule(s) that are encoded from the composition of the invention can also be used for transplantation in a patient for continuous treatment. These cells can further carry a specific gene that can kill them if a specific molecule is introduced to the patient's circulating system (for example: HSV1 Thymidine kinase / Ganciclovir).
  • each one of the RNA molecule(s) that are encoded from the composition of the invention can be an RNA molecule or a reproducing RNA molecule.
  • the reproducing RNA molecule is an RNA molecule that comprises a sequence that is complementary to any of these RNA molecule(s) such that the reproducing RNA molecule is capable of being replicated in the cell for the formation of any of these RNA molecule(s).
  • each of the RNA molecule(s) that are encoded from the composition of the invention can be prepared from various types, including, but are not limited to: synthetic RNA, synthetic RNA with modified bases, RNA that is produced by in vitro transcription, DNA molecule that encodes the RNA molecule, vector or viral vector that encodes the RNA molecule or DNA with modified bases that encodes the RNA molecule.
  • the functional RNA can be a synthetic siRNA while the exogenous RNA of interest can be encoded from a viral vector and while the Carrier RNA can be encoded from a plasmid.
  • composition of the present invention may be used in various applications including, but not limited to: regulation of gene expression, targeted cell death, treatment, and/or prevention of various diseases and health related conditions (such as, for example, proliferative disorders (for example, cancer), infectious diseases and the like), diagnosis of various health related conditions, formation of transgenic organisms, suicide gene therapy, and the like.
  • diseases and health related conditions such as, for example, proliferative disorders (for example, cancer), infectious diseases and the like
  • diagnosis of various health related conditions formation of transgenic organisms, suicide gene therapy, and the like.
  • the composition of the present invention can be used to activate toxic gene in cells that comprise viral RNA, in order to kill these cells.
  • the composition of the present invention can be used to activate toxic gene in cells that include an endogenous mRNA which comprises a predetermined signal sequence that is unique to cancer cells, for the targeted and specific killing of these cells.
  • a method for killing a specific cell/cell population wherein the cell population comprises an endogenous signal RNA, comprising a predetermined signal sequence, which is unique and specific for these cells; the method includes introducing the cells with the composition of the invention, wherein the composition comprises one or more polynucleotides for directing the specific cleavage of an exogenous RNA of interest at a specific target site that is located within a specific sequence, which is of sufficient complementarity to hybridize with the predetermined signal sequence, wherein the cleavage of the exogenous RNA of interest leads to the expression of an exogenous protein of interest, capable of killing the cells.
  • the exogenous protein of interest may be selected from, but not limited to: any type of protein that can damage the cell function and as a result lead to the death of the cell.
  • the protein may be selected from such types of proteins as, but not limited to: toxins, cell growth inhibitors, modulators of cellular growth, inhibitors of cellular signaling pathways, modulators of cellular signaling pathways, modulators of cell permeability, modulators of cellular processes, and the like.
  • compositions and methods of the present invention may provide a specific and targeted "all or none" response in a cell.
  • compositions and methods of the present invention are such that the exogenous RNA of interest is cleaved (and consequently, the protein of interest is expressed and activated) only in those target cells, which include a specific endogenous signal RNA, whereas cells that do not include the endogenous signal RNA will not be effected by the composition of the invention.
  • the composition and methods of the present invention may thus provide enhanced safety and control, since no leakiness in the expression of the exogenous protein of interest is observed in cells which do not include the endogenous signal RNA, which comprises the predetermined signal sequence.
  • the composition of the present invention can be used to activate reporter gene in the presence of viral RNA for the diagnosis of viral infection diseases.
  • the composition of the present invention may be used to stably transfect cells for the formation of transgenic organism that is resistant to viral infection.
  • the composition of the present invention can be used to stably transfect cells for the formation of transgenic organism that is able to activate reporter gene in the presence of viral RNA for the diagnosis of viral infection diseases.
  • the composition of the present invention can be used to monitor in real time the changes in RNA sequence in the cell.
  • the delivery systems and methods include, for example, use of various transfecting agents, encapsulation in liposomes, microparticles, microcapsules, recombinant cells that are capable of expressing the composition, receptor-mediated endocytosis, construction of the composition of the invention as part of a viral vector or other vector, viral vectors that are capable of being reproduced without killing the cell during the process of reproduction and that comprise the composition of the invention, viral vectors that are not capable of reproduction and that comprise the composition of the invention, injection of cells that produce viral vectors that comprise the composition of the invention, injection of DNA, electroporation, calcium phosphate mediated transfection, and the like, or any other suitable delivery system known or to be developed in the future.
  • the present invention also provides for pharmaceutical compositions comprising an effective amount of the composition of the invention, and a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • Carrier in the phrase “Pharmaceutically acceptable carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
  • the pharmaceutical compositions of the invention may be administered locally to the target area in need of treatment. This may be achieved by, for example, and not limited to: local infusion during surgery, topical application, e.g. in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non- porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers.
  • the local administration may be also achieved by control release drug delivery systems, such as nanoparticles, matrices such as controlled-release polymers or hydrogels.
  • the composition of the invention can be administered in amounts which are effective to produce the desired effect in the targeted cell.
  • Effective dosages of the composition of the invention can be determined through procedures well known to these in the art which address such parameters as biological half-life, bioavailability and toxicity.
  • the amount of the composition of the invention which is effective depend on the nature of the disease or disorder being treated, and may be determined by standard clinical techniques. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges.
  • the administered means may also include, but are not limited to permanent or continuous injection of the composition of the invention to the patient blood stream.
  • the present invention also provides for pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human or animal administration.
  • the composition of the invention is designed to specifically kill the cancer cells of a specific patient.
  • the first step in the designing of the composition of the invention for a specific patient is to identify the predetermined signal sequence, which is a sequence of 18-25 nucleotides long of an endogenous RNA molecule that is present in the cancer cells of this specific patient, such that the predetermined signal sequence is not present in any endogenous RNA molecule in the healthy or nonmetastatic tumourigenic cells of the body of the specific patient. Therefore, the predetermined signal sequence is an RNA sequence of a gene that is mutated in the cancer cells.
  • each tumor comprises mutations in 90 protein-coding genes [16] and each tumor initiated from a single founder cell [38], therefore there is a need to identify only one of them that it is transcribed into RNA molecule in the cancer cells.
  • Various methods can be used for the identification of this predetermined signal sequence; these methods include, but are not limited to DNA microarray, Tilling (Targeting Induced Local Lesions in Genomes) and large-scale sequencing of cancer genomes. Furthermore the identification of the predetermined signal sequence can utilize the Cancer Genome Atlas project that has been cataloguing all the genetic mutations responsible for cancer by their genes.
  • the predetermined signal sequence that is unique to the cancer cells of the specific patient is: 5'-UAUUAUUAUCUUGGCCGCCCG-3' (SEQ ID NO. 41) and is located in an endogenous mRNA (SEQ ID NO. 42). Therefore, in this example the composition of the invention is designed to kill cells that comprise mRNA that comprises the sequence 5'-UAUUAUUAUCUUGGCCGCCCG-3' (SEQ ID NO. 41).
  • the functional RNA in this example (SEQ ID NO. 43) is shRNA that is designed to effect the cleavage of the 5' end of the predetermined signal sequence.
  • the sequence of the cleaved shRNA portion formed after processing by Dicer that hybridizes with the endogenous mRNA is set forth as SEQ ID NO. 44.
  • the functional RNA is transcribed under the control of the very strong U6 promoter of RNA polymerase III.
  • the G at the 5' end and the UU at the 3' end of the shRNA are necessary for the transcription by U6 promoter of RNA polymerase III.
  • FIG. 40 It has been reported that in the cell the functional half-life of each of the two portions of a cleaved mRNA is reduced from the intact mRNA only by 2.6-1.7 fold [10]. It has also been reported that two portions of an mRNA that has been cleaved by RISC-RNA complex in a cell can be easily detected by Northern analysis [6].
  • the carrier RNA in this example is designed to be transcribed under the control of the very strong U6 promoter of RNA polymerase III and is designed to include the sequence: 3'-UUAUAAUAAUAGAACCGGCGGGCGGUG-5' (SEQ ID NO. 45), the G at the 5' end and the UU at the 3' end of the carrier RNA are necessary for the transcription by U6 promoter of RNA polymerase III.
  • the carrier RNA is hybridized to the cleaved mRNA portion that includes the predetermined signal sequence and after processing by Dicer (SEQ ID NO. 46), the duplex that is formed is thermodynamically weaker at the 5' end of the predetermined signal sequence, thus the predetermined signal sequence is be the strand that is loaded into Rise [3].
  • the sequence of the cleaved carrier RNA portion formed after processing by Dicer is set forth as SEQ ID NO. 47.
  • RNA transcripts of about 23 nucleotides in length that have a complementary region of about 19 nucleotides in length at the 5' end are hybridized with each other and are capable of directing target specific RNA interference [7]. It has also been reported that a dsRNA of 52 nucleotides long that further comprises 20 nucleotides long ssR A at one of the 3' ends is a substrate for a Dicer at the blunt end [8]. Furthermore it has also been reported that in mammal Rise is coupled to Dicer [9].
  • the specific sequence in the exogenous RNA of interest of this example is designed to comprise the sequence: 5 ' -CGGGCGGCC AAG AUAAUAAUA-3 ' (SEQ ID NO. 48) that is 100% complementary to the predetermined signal sequence. For example, see FIG. 40.
  • the exogenous RNA of interest is also designed to comprise a sequence encoding Diphtheria toxin fragment A (DT-A) downstream from the specific sequence.
  • DT-A Diphtheria toxin fragment A
  • the exogenous RNA of interest is designed to be transcribed under the control of the strong viral CMV promoter. For example,, see FIG. 40.
  • the viral vector transcribes: the functional RNA, the carrier RNA and the exogenous RNA of interest.
  • the cis acting ribozyme Nl 17 in the exogenous RNA of interest removes the CAP structure from the 5' end for reducing any translation by the exogenous RNA of interest and the out of reading frame initiation codons prevent translation of DT-A.
  • the functional RNA (shRNA) effects the cleavage of the 5' end of the predetermined signal sequence.
  • the carrier RNA is hybridized to the cleaved mRNA portion that comprises the predetermined signal sequence and the predetermined signal sequence is processed by Dicer and loaded into Rise.
  • the Rise-signal sequence complex cleaves the exogenous RNA of interest at the specific sequence and the out of reading frame initiation codons are detached, so that DT-A is expressed at least one time, which enough to cause cell death.
  • the sequence of the cleaved exogenous RNA of this example is set forth as SEQ ID NO. 50.
  • EXAMPLE 2 use of the composition of the invention to kill EBV-associated gastric carcinomas cancer cells, nasopharyngeal carcinoma cancer cells, Burkitt's lymphoma cancer cells and Hodgkin's lymphoma cancer cells
  • Epstein-Barr virus is a ubiquitous human gamrnaherpesvirus that establishes life-long latent infections in B lymphocytes following the primary infection. EBV infects the majority of the population worldwide and has been implicated in the pathogenesis of several human malignancies including Burkitt's and Hodgkin's lymphomas, gastric carcinoma and nasopharyngeal carcinoma (NPC) [32]. EBV infection is mainly characterized by the expression of latent genes including EBNAl , LMPl, LMP2 and EBER [32].
  • LMPl latent membrane protein 1
  • LMPl latent membrane protein 1
  • LMPl LMPl (latent membrane protein 1) was the first EBV latent gene found to be able to transform cell lines and alter the phenotype of cells due to its oncogenic potential [32]. In human epithelial cells, LMPl alters many functional properties that are involved in tumor progression and invasions [32].
  • the composition of the invention is designed to kill cancer cells of Burkitt's lymphomas, Hodgkin's lymphomas, gastric carcinoma and nasopharyngeal carcinoma, which are latently infected with EBV, by using the LMPl mRNA as the endogenous signal RNA and by using the sequence: 5'- CUCUGUCCACUUGGAGCCCUU-3' (SEQ ID NO. 51 - nucleotides 269-289 of LMPl mRNA) as the predetermined signal sequence.
  • SEQ ID NO. 51 nucleotides 269-289 of LMPl mRNA
  • This predetermined signal sequence is chosen because it is located in a region that does not have RNA secondary structure and because it is located in a region that has been shown to be a good target for siRNA [33]. Furthermore, this predetermined signal sequence is also chosen because its cleavage creates a relatively short RNA molecule of 289 nucleotides long.
  • the carrier sequence and the functional RNA are located in the same RNA duplex that is hybridized in the cell, such that the double strand region is located at the 5' end of the carrier sequence and such that when the double strand region is processed by Dicer, the carrier sequence is detached from the RNA duplex and the siRNA duplex that is formed is the functional RNA and is capable of effecting the cleavage of the mRNA of LMP-1 at the 3' end of the predetermined signal sequence.
  • the 2 strands of the RNA duplex are: 3 - UUCUCUGGAAGAGACAGGUGAACCUCGGGAACCUCGGGAAACAUAUGAGG-5' (SEQ ID NO.
  • RNA duplex 5'-GGAGCCCUUUGUAUACUCCUU-3'
  • SEQ ID NO. 54 5'-GGAGCCCUUUGUAUACUCCUU-3'
  • the 2 strands of the RNA duplex are transcribed under the control of the very strong U6 promoter of RNA polymerase III, thus their 5' end is G and their 3' end is UU.
  • the sequence of the cleaved strand (after Dicer processing) capable of hybridizing to the mRNA of LMP-1 and affecting its cleavage at the 3' end of the predetermined signal sequence is set forth as SEQ ID NO. 55.
  • the carrier sequence (SEQ ID NO. 56) directs the predetermined signal sequence to Dicer processing and the duplex that is formed is thermodynamically weaker at the 5' end of the predetermined signal sequence, thus the predetermined signal sequence will be the strand that will be loaded into Rise [3].
  • the sequence of the second strand namely the cleaved carrier sequence after processing by Dicer is set forth as SEQ ID NO. 57.
  • the specific sequence in the exogenous RNA of interest of the example is designed to comprise the sequence: 3 '-GAGACAGGUGAACCUCGGGAA-5 ' (SEQ ID NO. 58) that is 100% complementary to the predetermined signal sequence.
  • the exogenous RNA of interest is also designed to comprise a sequence encoding Diphtheria toxin (DT) downstream from the specific sequence.
  • the exogenous RNA of interest is designed to be transcribed under the control of the strong viral CMV promoter.
  • the exogenous RNA of interest is also designed to comprise an inhibitory sequence upstream from the specific sequence.
  • the inhibitory sequence comprises 2 initiation codons that are located within the human Kozak consensus sequence: 5'-ACCAUGG-3' (SEQ ID NO.
  • the exogenous RNA of interest is also designed to comprise the very efficient cis-acting hammerhead ribozyme - snorbozyme [22] at the 5' end for reducing the efficiency of translation of the exogenous RNA of interest of the invention before it is cleaved.
  • the cis-acting hammerhead ribozyme - snorbozyme also comprises 2 initiation codons however each one of them is not in the same reading frame with the start codon of DT.
  • the exogenous RNA of interest is also designed to comprise a nucleotide sequence of 23 nucleotides downstream from the specific sequence and upstream from the sequence encoding DT, such that the nucleotide sequence is capable of binding to a sequence of 23 nucleotides that is located downstream from the sequence encoding DT, such that the exogenous RNA of interest forms a circular structure that increases the efficiency of translation of DT particularly when the exogenous RNA of interest is cleaved.
  • the entire sequence of the exogenous RNA of this example is set forth as SEQ ID NO. 59.
  • the two strands of the RNA duplex and the exogenous RNA of interest are transcribed by a viral vector (see FIG. 41).
  • the viral vector transcribes: the two strands of the RNA duplex and the exogenous RNA of interest.
  • the cis acting ribozyme, snorbozyme, in the exogenous RNA of interest removes the CAP structure from the 5' end for reducing any translation by the exogenous RNA of interest and the out of reading frame initiation codons prevent translation of DT.
  • the two strands of the RNA duplex are hybridized with each other and with the predetermined signal sequence at the LMP-1 mRNA, the double strand region of the RNA duplex is cleaved by Dicer and forms the functional RNA that is siRNA and the carrier sequence.
  • the siRNA cleaves the predetermined signal sequence at the 3' end and the carrier sequence directs the cleaved predetermined signal sequence to Dicer processing.
  • the processed predetermined signal sequence is loaded into Rise and then the Rise-signal sequence complex cleaves the exogenous RNA of interest at the specific sequence and the out of reading frame initiation codons are detached, so that DT is capable of being expressed.
  • the sequence of the cleaved exogenous RNA of this example is set forth as SEQ ID NO. 60.
  • the RNA portion that comprises the sequence encoding DT forms a circular structure that increases DT translation for killing the cancer cell and the neighboring cells. For example, see FIG. 41.
  • the functional RNA and the carrier sequence are located in the same RNA duplex, thus the carrier sequence may bring the functional RNA into proximity with the predetermined signal sequence and by this may also bring the components of the RNA interference pathway (e.g. Dicer and Rise) into proximity with the predetermined signal sequence.
  • EXAMPLE 3 use of the composition of the invention to kill HIV-1 infected cells
  • HIV Human immunodeficiency virus
  • AIDS acquired immunodeficiency syndrome
  • HIV-1 and HIV-2 Two species of HIV infect humans: HIV-1 and HIV-2. HIV-1 is more virulent, relatively easily transmitted, and is the cause of the majority of HIV infections globally. HIV-2 is less transmittable than HIV-1 and is largely confined to West Africa.
  • the composition of the invention is designed to kill HIV-1 infected cells by using the HIV-1 mRNA as the endogenous signal RNA and by using the sequence: 5'-UACCAAUGCUGCUUGUGCCUG-3 * (SEQ ID NO. 61 - nucleotides 8492-8512 of HIV-1 mRNA) as the predetermined signal sequence.
  • the predetermined signal sequence is chosen because it is located in a region that does not include an RNA secondary structure and because it is located in a region that has been shown to be a good target for siRNA [34].
  • the exogenous RNA of interest of this example is transcribed under the control of the strong viral CMV promoter and is designed to comprise 2 specific sequences, such that each one of them is: 3'-AUGGUUACGACGAACACGGAC-5' (SEQ ID NO. 63) that is 100% complementary to the predetermined signal sequence.
  • the exogenous RNA of interest is also designed to comprise a sequence encoding Diphtheria toxin fragment A (DT- A) between the 2 specific sequences. In mammal cells single molecule of Diphtheria toxin fragment A introduced into a cell can kill the cell [14].
  • the exogenous RNA of interest is also designed to comprise two inhibitory sequences one at the 5' end and other at the 3' end.
  • the inhibitory sequence that is located at the 5' end of the exogenous RNA of interest is designed to include 3 initiation codons, such that one of them is located within the human Kozak consensus sequence: 5'-ACCAUGG-3' (SEQ ID NO. 25), such that each one of them is not in the same reading frame with the start codon of DT-A and such that all the 3 initiation codons are in the same reading frame.
  • the inhibitory sequence that is located at the 3' end of the exogenous RNA of interest is designed to include an intron downstream from the 2 specific sequences, such that the exogenous RNA of interest is a target for nonsense-mediated decay (NMD) that degrades RNA molecule that comprises an intron downstream from the coding sequence [31].
  • the intron comprises 2 artificial microRNAs that are designed to affect the cleavage of the predetermined signal sequence at the 5' end and at the 3' end (SEQ ID NOs. 64 and 65, respectively) [35].
  • the inhibitory sequence that is located at the 3' end of the exogenous RNA of interest also comprises an AU-rich element (ARE) at the 3' end that stimulates degradation of the exogenous RNA of interest.
  • ARE AU-rich element
  • the AU-rich elements is 47 nucleotides long and it comprises the sequences: 5'-AUUUA-3' (SEQ ID NO. 31) and 5'- UUAUUUA(U/A)(U/A)-3'(SEQ ID NO. 32) [28].
  • the entire sequence of the exogenous RNA of this example is composed of SEQ ID NO. 66, SEQ ID NO. 1 13 and an intron comprising the two artificial microRNAs described above in between.
  • the carrier RNA in this example is designed to be transcribed under the control of the very strong U6 promoter of RNA polymerase III and is designed to include the sequence: 3'- UUAUGGUUACGACGAACACGG-5 ' (SEQ ID NO.
  • the G at the 5' end and the UU at the 3' end of the carrier RNA are necessary for the transcription by U6 promoter of RNA polymerase III.
  • the carrier RNA of the invention may be hybridized to the cleaved predetermined signal sequence and the duplex that is formed is thermodynamically weaker at the 5' end of the predetermined signal sequence, thus the predetermined signal sequence is the strand that is loaded into Rise [3]. For example, see FIG. 42.
  • the carrier RNA and the exogenous RNA of interest are transcribed by a viral vector.
  • the viral vector transcribe: the carrier RNA and the exogenous RNA of interest.
  • the out of reading frame initiation codons prevent translation of DT- A
  • the Peroxisomal targeting signal 2 sends the erroneous protein and the exogenous RNA of interest to the peroxisome.
  • the intron targets the exogenous RNA of interest to degradation by the nonsense-mediated decay (NMD) and the AU-rich element also stimulates degradation of the exogenous RNA of interest.
  • the predetermined signal sequence is cleaved from both of its ends and thus with the carrier RNA it is a better substrate for Dicer or Rise.
  • the viral vector may also encode transcriptional factors that are capable of enhancing the transcription of HIV-1 mRNA in HIV-1 infected cell (e.g. NF- ⁇ ).
  • the viral vector may also encode genes that are capable of preventing new HIV-1 particles production (e.g. Rev, which prevents HIV-1 mRNA splicing).
  • EXAMPLE 4 use of the composition of the invention to kill hsv-1 infected cells
  • HSV-1 herpes simplex virus-1
  • HSV-1 herpes simplex virus-1
  • LAT The latency- associated transcript ⁇ LAT of herpes simplex virus-1 (HSV-1) is the only viral gene that is expressed during latent infection in neurons. LAT inhibits apoptosis and maintains latency by promoting the survival of infected neurons. No protein product has been attributed to the L AT gene.
  • the composition of the invention is designed to kill HSV-1 infected cells by using the latency-associated transcript ⁇ LAT) as the endogenous signal RNA and by using the sequence: 5'-AAGCGCCGGCCGGCCGCUGGU-3' (SEQ ID NO. 69 - nucleotides 108-128 of the latency-associated transcript - LAT of HSV-1) as the predetermined signal sequence.
  • the predetermined signal sequence is chosen because its cleavage creates a relatively short RNA molecule of 128 nucleotides long. For example, see FIG. 43.
  • the carrier sequence and the functional RNA are located in the same stem loop structure (SEQ ID NO. 71) that is transcribed by the RNA polymerase III U6 promoter.
  • the carrier sequence SEQ ID NO. 72
  • the siRNA duplex that is formed is the functional RNA, which is capable of effecting the cleavage of LAT at the 3' end of the predetermined signal sequence.
  • the sequences of the strands of the siRNA duplex that is formed are set forth as SEQ ID NOs. 73 and 74.
  • the sequence of the cleaved LAT portion that comprises the predetermined signal sequence is set forth as SEQ ID NO. 75.
  • the G at the 5' end and the UU at the 3' end of the stem loop structure are necessary for the transcription by U6 promoter of RNA polymerase III.
  • the carrier sequence is hybridized to the cleaved LAT portion that comprises the predetermined signal sequence and after processing by Dicer, the duplex that is formed is thermodynamically weaker at the 5' end of the predetermined signal sequence, thus the predetermined signal sequence will be the strand that will be loaded into Rise [3], For example, see FIG. 43.
  • the exogenous RNA of interest of this example is transcribed under the control of the strong viral CMV promoter and is designed to comprise 2 specific sequences, such that each one of them is: 5'-ACCAGCGGCCGGCCGGCGCUU-3' (SEQ ID NO. 76) that is 100% complementary to the predetermined signal sequence.
  • the exogenous RNA of interest is also designed to comprise a sequence encoding Diphtheria toxin (DT) between the 2 specific sequences.
  • DT Diphtheria toxin
  • the exogenous RNA of interest is also designed to comprise 2 inhibitory sequences one at the 5' end and other at the 3' end of the exogenous RNA of interest.
  • the inhibitory sequence that is located at the 5' end of the exogenous RNA of interest is designed to include 3 initiation codons, such that 2 of them are located within the human Kozak consensus sequence: 5'-ACCAUGG-3' (SEQ ID NO. 25), such that each one of them is not in the same reading frame with the start codon of DT.
  • the inhibitory sequence that is located at the 3' end of the exogenous RNA of interest is designed to comprise the translational repressor smaug recognition elements (SRE): 5 - UGGAGCAGAGGCUCUGGCAGCUUUUGCAGCG-3' (SEQ ID NO. 28) downstream from the 2 specific sequences. For example, see FIG. 43.
  • Smaug 1 is encoded in human chromosome 14 and is capable of repressing translation of SRE-containing messengers [26, 27].
  • Murine Smaug 1 is expressed in the brain and is abundant in synaptoneurosomes, a subcellular region where translation is tightly regulated by synaptic stimulation [26].
  • the inhibitory sequence that is located at the 3' end of the exogenous RNA of interest also comprises an RNA localization signal for myelinating periphery (A2RE - Nuclear Ribonucleoprotein A2 Response Element): 5'-GCCAAGGAGCCAGAGAGCAUG-3' (SEQ ID NO. 29) at the 3' end [29]. For example, see FIG. 43.
  • A2RE is a cw-acting sequence that is located at the 3 '-untranslated region of MBP (Myelin basic protein) mRNA and is sufficient and necessary for MBP mRNA transport to the myelinating periphery of oligodendrocytes [29].
  • MBP Myelin basic protein
  • the hnRNP (Heterogeneous Nuclear Ribonucleoprotein) A2 binds the A2RE and mediates transport of MBP [29] .
  • the exogenous RNA of interest of this example also comprises a cytoplasmic polyadenylation element (CPE) immediately downstream from the sequence encoding DT.
  • CPE comprises the sequence 5'-UUUUUUAUU-3' (SEQ ID NO. 38) immediately downstream from the sequence encoding DT and the sequence 5'-UUUUAUU-3' (SEQ ID NO. 39) 91 nucleotides downstream from the sequence encoding DT [25].
  • SEQ ID NO. 38 sequence 5'-UUUUUAUU-3'
  • CPEB cytoplasmic polyadenylation element binding protein
  • hippocampus the portion of the brain that is responsible for long-term memory
  • CPEB appears to stimulate the translation of a-CaMKII mRNA, which comprises CPE, by polyadenylation-induced translation [36].
  • SEQ ID NO. 77 The entire sequence of the exogenous RNA of this example is set forth as SEQ ID NO. 77.
  • the exogenous RNA of interest and the stem loop structure are transcribed by a viral vector.
  • the out of reading frame initiation codons prevent translation of DT
  • the Smaugl translational repressor
  • the hnRNP A2 binds the A2RE and mediates the transport of the RNA molecule to the myelinating periphery.
  • the stem loop structure is processed by Dicer such that the carrier sequence is detached from the stem loop structure and the siR A duplex that is formed is the functional RNA, and then the functional RNA effects the cleavage of LAT at the 3 ' end of the predetermined signal sequence. Then the carrier sequence is hybridized to the LAT portion that comprises the predetermined signal sequence and the predetermined signal sequence is processed by Dicer and loaded into Rise.
  • the Rise-signal sequence complex cleaves the exogenous RNA of interest at the 2 specific sequences and all the inhibitory sequences are detached, so that the CPEB (cytoplasmic polyadenylation element binding protein) binds to the CPE and stimulates the extension of the poly-A tail in the cleaved exogenous RNA of interest, such that DT is capable of being expressed and kills the cell and the neighboring cells.
  • CPEB cytoplasmic polyadenylation element binding protein
  • the functional RNA and the carrier sequence are located in the same RNA molecule, which requires less transcriptional units.
  • the major advantage of this proximity of the functional RNA and the carrier sequence is that they are created in the same place in the cell and in the same time and also at a constant ratio.
  • EXAMPLE 5 use of the composition of the invention to kill cancer cells of a specific patient.
  • composition of the invention is designed to kill the cancer cells of a specific patient.
  • the first step in the designing of the composition of the invention for a specific patient is to identify the predetermined signal sequence, which is a sequence of 18-25 nucleotides long of an RNA molecule that present in the cancer cells of this specific patient, such that the predetermined signal sequence is not present in any RNA molecule in the healthy or nonmetastatic tumourigenic cells of the body of this specific patient. Therefore, the predetermined signal sequence is an RNA sequence of a gene that is mutated in the cancer cells. On average each tumor comprises mutations in 90 protein-coding genes [16] and each tumor initiated from a single founder cell [38], therefore there is a need to identify only one of them that it is transcribed into an RNA molecule in the cancer cells.
  • Various methods can be used for the identification of this predetermined signal sequence; these methods include, but are not limited to DNA microarray, Tilling (Targeting Induced Local Lesions in Genomes) and large-scale sequencing of cancer genomes. Furthermore the identification of the predetermined signal sequence can utilize the Cancer Genome Atlas project that has been cataloguing all the genetic mutations responsible for cancer by their genes.
  • the predetermined signal sequence that is unique to the cancer cells of the specific patient is: 5'-AAUUAAGUUUAUGAACGGGUC-3 ' (SEQ ID NO. 79) and is located in an endogenous mRNA. Therefore, in this example the composition of the invention is designed to kill cells that comprise endogenous mRNA (as the endogenous signal RNA) that comprises the sequence 5'-AAUUAAGUUUAUGAACGGGUC-3' (SEQ ID NO. 79).
  • An exemplary endogenous mRNA comprising said predetermined signal sequence is shown in FIG. 44 and set forth as SEQ ID NO. 80.
  • the functional RNA in this example is Rz-B, a hammerhead-type ribozyme (SEQ ID NO. 81) [21] that is designed to effect the cleavage of the 3' end of the predetermined signal sequence.
  • the sequence of the exemplary endogenous mRNA comprising the predetermined signal sequence after cleavage is set forth as SEQ ID NO. 82.
  • the hammerhead-type ribozyme Rz-B is transcribed under the control of the very strong U6 promoter of RNA polymerase III.
  • the G at the 5' end and the UU at the 3' end of the hammerhead-type ribozyme Rz-B are necessary for the transcription by U6 promoter of RNA polymerase III. For example, see FIG.
  • siRNA+ or siRNA- 10 pmole of siRNA double stranded molecule that can induce cleavage (siRNA+) or does not induce cleavage (siRNA-) of the mRNA encoded by the tested plasmid. (detailed below).
  • the transfection was performed using lipofectamine 2000 transfection reagent (Invitrogen) according to manufacturer protocol. 48 hrs post transfection the Renilla luciferase gene expression was measured using the dual luciferase reported assay kit (Promega) and luminometer (glomax 20/20 promega), and the relative light units (RLU) were determined.
  • the tested plasmid may be any type of the following plasmids:
  • Negative control Plasmid that does not encode for a diphtheria toxin (DTA);
  • DTA diphtheria toxin
  • Test plasmid plasmid of the composition of the invention, i.e. plasmid comprising target sites for siRNA+ between an inhibitory sequence and a downstream sequence encoding for diphtheria toxin (DTA).
  • DTA diphtheria toxin
  • the tested plasmid was tested with 2 different siRNAs+ and with 2 different siRNAs-, separately, and each in triplicate.
  • Fold of Activation Average of measured RLU (Relative light unit) in the presence of each of the 2 siRNA- with the test plasmid (6 wells) divided by the average of RLU using one of the siRNA+ with the test plasmid (3 wells).
  • Anti pGal siRNA-1 (target site: Tlacz (SEQ ID NO. 71), Dharmacon, Cat. No. P- 002070-01-20) (SEQ ID NO. 72 (sense strand) and SEQ ID NO. 73 (antisense strand)).
  • GFPDuplex I ((target site: TD1, (SEQ ID NO. 77), Dharmacon, Cat. No. P-002048-01- 20), (SEQ ID NO. 78 (sense strand) and SEQ ID NO. 79 (antisense strand)).
  • E34 (SEQ ID NO. 10) - Pcmv-40RF A -TD1 -Tfluc— Psv40-TGFP.
  • E38 - 3CARZ-4S&L The insert of E38 (SEQ ID. NO. 19) was ligated into a PMK shuttle vector (GeneArt) at pad and Xhol restriction sites.
  • E4 (SEQ ID. NO. 18) - Pcmv-KDTA— Psv40-Hygro 8.
  • E10 (SEQ ID. NO. 20) - Pefl-DTA24— ZEO::GFP-Pcmv
  • TISU sequences and 57 kozak sequences with 57, 57, 36, 36, 21 , 21 , 21, and 21nt between adjacent ATG codons, in 4 consecutive ORFs (nt 1027-3547 of SEQ ID NO. 1).
  • the first ORF (nt. 1031 -1651 of SEQ ID NO. 1) is 621nt & is translated from TISU (nt. 1027-1038 of SEQ ID NO. 1), and the next 30RF A (nt. 1662-2996, nt. 2306-2941 and nt 2951-3547 of SEQ ID NO. 1) are translated from Kozak sequence,
  • the last ORF (nt 2951-3547 of SEQ ID NO.
  • the plasmid further comprises target sites TD1 (SEQ ID NO. 77) and Tfluc (SEQ ID NO. 74).
  • the plasmid further comprises target sites TDl (SEQ ID NO. 77) and Tfluc (SEQ ID NO. 74).
  • the plasmid further comprises target sites TDl (SEQ ID NO. 77) and Tfluc (SEQ ID NO. 74).
  • E112 (SEQ ID. NO. 5) - Pcmv-40RF A -2xTLacZinINTRON-8X[TCTL+TDl]-PK- D5 A TA— Psv40-TGFP (pCMV promoter (nts. 420-938 of SEQ ID NO. 5), 40RF A (nt.
  • the plasmid further comprises 8 copies of target sites TDl (SEQ ID NO. 77), TCTL (SEQ ID NO. 80) and 2 copies of TLacZ (SEQ ID NO. 71).
  • the plasmid further comprises TDl (SEQ ID NO. 77), 3 copies of TLacz (SEQ ID NO. 71) and TCTL target sites (SEQ ID NO. 80).
  • the plasmid further comprises 3 copies of TDl (SEQ ID NO. 77) and TLacz target sites (SEQ ID NO. 71).
  • E30 (SEQ ID. NO. 8) - Pcmv-40RF A -TDl-Tfluc-incDTAWT— Psv40-TGFP (pCMV promoter (nts. 420-938 of SEQ ID NO. 8); 40RF A 9 TISU sequences and 57 kozak sequences, with 57, 57, 36, 36, 21, 21, 21, and 21nt between adjacent ATG codons, in 4 consecutive ORFs (nt 1027-3547 of SEQ ID NO. 8).
  • the first ORF (nt. 1031-1651 of SEQ ID NO. 8) is translated from TISU (nt. 1027-1038 of SEQ ID NO. 8), and the next 30RF A (nt.
  • E142 SEQ ID. NO. 9 - 3PolyA-Prpll9-40RF A -TDl-Tfluc-S-cDTAWT— Phsvtk-FIuc.
  • 3PolyA HSV poly A, SV40 poly A, synthetic poly A (nt. 60-247 of SEQ ID NO. 9);
  • Prpll9 promoter of RPL19 (ribosomal protein LI 9) taken with its first intron (nt. 248- 1941 of SEQ ID NO.
  • results are presented in following tables 1-5 and 6A-C.
  • the results show the RLU measured in cells transfected with the indicated plasmids and siRNA molecules under various experimental conditions.
  • the siRNA+ molecules used are the siRNA molecules that can bind their corresponding target sequence(s) within the tested plasmid.
  • E123 (SEQ ID. NO. 7) - Psv40-INTRON-4ORF A - 3.37 1.8 3.7M 12.5M 3X[TDl-TLacZ]-4PTE-SV40intron-HBB-DTA—
  • Tfrac-S- (SEQ ID. 586K* 347K* 2.1M* cDTAWT— NO. 1)
  • ** co-transfected also with 155ng of plasmid E38 (SEQ ID NO. 19).
  • Gallie DR 1991, The cap and poly(A) tail function synergistically to regulate mRNA translational efficiency. Genes Dev 5, 11 : 2108-16.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne des compositions pour le clivage d'un ARN exogène d'intérêt uniquement en présence d'une séquence-signal d'ARN endogène, ce qui active l'expression d'un polynucléotide d'intérêt uniquement en présence de la séquence-signal d'ARN endogène. L'invention concerne également des procédés de préparation de la composition et ses utilisations dans le traitement et le diagnostic de divers états et troubles, par exemple, par activation sélective de l'expression d'une toxine uniquement dans des populations cellulaires cibles spécifiques.
EP11835735.9A 2010-10-28 2011-10-27 Compositions et procédés de clivage spécifique d'arn exogène dans une cellule Withdrawn EP2632931A4 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
PCT/IL2010/000895 WO2012056441A1 (fr) 2010-10-28 2010-10-28 Compositions et procédés pour le clivage spécifique d'arn exogène dans une cellule
PCT/IL2011/000827 WO2012056449A2 (fr) 2010-10-28 2011-10-27 Compositions et procédés de clivage spécifique d'arn exogène dans une cellule

Publications (2)

Publication Number Publication Date
EP2632931A2 true EP2632931A2 (fr) 2013-09-04
EP2632931A4 EP2632931A4 (fr) 2014-06-18

Family

ID=45993240

Family Applications (1)

Application Number Title Priority Date Filing Date
EP11835735.9A Withdrawn EP2632931A4 (fr) 2010-10-28 2011-10-27 Compositions et procédés de clivage spécifique d'arn exogène dans une cellule

Country Status (7)

Country Link
US (1) US20130225660A1 (fr)
EP (1) EP2632931A4 (fr)
JP (1) JP2013544510A (fr)
CN (1) CN103282372A (fr)
AU (1) AU2011322106A1 (fr)
CA (1) CA2815632A1 (fr)
WO (2) WO2012056441A1 (fr)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2056845B1 (fr) 2006-08-08 2017-10-11 Rheinische Friedrich-Wilhelms-Universität Bonn Structure et utilisation d'oligonucléotides 5'-phosphate
JP5689413B2 (ja) 2008-05-21 2015-03-25 ライニッシュ フリードリッヒ−ウィルヘルムズ−ユニバーシタット ボン 平滑末端を有する5’三リン酸オリゴヌクレオチドおよびその使用
EP2508530A1 (fr) 2011-03-28 2012-10-10 Rheinische Friedrich-Wilhelms-Universität Bonn Purification d'oligonucléotides triphosphorylés au moyen d'étiquettes de capture
EP2712870A1 (fr) 2012-09-27 2014-04-02 Rheinische Friedrich-Wilhelms-Universität Bonn Nouveaux ligands de RIG-I et procédés pour les produire
US11517583B2 (en) * 2016-04-01 2022-12-06 National University Of Singapore Trans-splicing RNA (tsRNA)
DE102017103383A1 (de) * 2017-02-20 2018-08-23 aReNA-Bio GbR (vertretungsberechtigter Gesellschafter: Dr. Heribert Bohlen, 50733 Köln) System und Verfahren zur Zelltyp-spezifischen Translation von RNA-Molekülen in Eukaryoten
WO2022182697A1 (fr) * 2021-02-23 2022-09-01 Board Of Regents, The University Of Texas System Nouvelle approche à base d'arn pour le traitement du cancer

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005112620A2 (fr) * 2004-05-18 2005-12-01 Massachusetts Institute Of Technology Procédé à base de cre-lox pour interférence arn conditionnelle
WO2006042112A2 (fr) * 2004-10-05 2006-04-20 California Institute Of Technology Acides nucleiques a regulation d'aptameres et leurs utilisations
WO2008058291A2 (fr) * 2006-11-09 2008-05-15 California Institute Of Technology Ribosymes modulaires régulés par les aptamères
US20090143327A1 (en) * 2007-08-28 2009-06-04 Smolke Christina D General composition framework for ligand-controlled regulatory systems

Family Cites Families (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5869248A (en) * 1994-03-07 1999-02-09 Yale University Targeted cleavage of RNA using ribonuclease P targeting and cleavage sequences
ES2279531T3 (es) * 1995-12-15 2007-08-16 Intronn, Inc. Moleculas terapeuticas generadas por corte y empalme en trans.
CA2357709A1 (fr) * 1999-01-26 2000-08-03 Vlaams Interuniversitair Instituut Voor Biotechnologie Vzw Site d'entree ribosomique interne (ires), vecteur le contenant et utilisations correspondantes
JP2005536231A (ja) * 2002-05-08 2005-12-02 イントロン,インコーポレーテッド アデノウイルスに細胞選択的複製をもたらすための、スプライセオソーム媒介型rnaトランススプライシングの使用
US20030219407A1 (en) * 2002-05-15 2003-11-27 The Regents Of The University Of California RNA silencing in animals as an antiviral defense
AU2003247696A1 (en) * 2002-07-01 2004-01-19 E.I. Du Pont De Nemours And Company Method of controlling gene silencing using site-specific recombination
EP2000160A3 (fr) * 2002-10-30 2009-03-11 Gambro Lundia AB Procédé et appareils pour déterminer l'efficacité de la dialyse
EP1560931B1 (fr) * 2002-11-14 2011-07-27 Dharmacon, Inc. Arnsi fonctionnel et hyperfonctionnel
AU2005326784B2 (en) * 2004-10-08 2012-03-15 Virxsys Corporation Use of RNA trans-splicing for antibody gene transfer and antibody polypeptide production
JP2008537551A (ja) * 2005-03-31 2008-09-18 カランド ファーマシューティカルズ, インコーポレイテッド リボヌクレオチドレダクターゼサブユニット2の阻害剤およびその使用
CN101184840A (zh) * 2005-03-31 2008-05-21 卡兰朵医药公司 核糖核苷酸还原酶亚基2的抑制剂及其用途
WO2007149246A2 (fr) * 2006-06-12 2007-12-27 Massachusetts Institute Of Technology Constructions permettant l'immobilisation d'un gène basée sur la technique cre-lox et leurs procédés d'utilisation
US8318921B2 (en) * 2007-03-01 2012-11-27 California Institute Of Technology Triggered RNAi
US9029524B2 (en) * 2007-12-10 2015-05-12 California Institute Of Technology Signal activated RNA interference

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005112620A2 (fr) * 2004-05-18 2005-12-01 Massachusetts Institute Of Technology Procédé à base de cre-lox pour interférence arn conditionnelle
WO2006042112A2 (fr) * 2004-10-05 2006-04-20 California Institute Of Technology Acides nucleiques a regulation d'aptameres et leurs utilisations
WO2008058291A2 (fr) * 2006-11-09 2008-05-15 California Institute Of Technology Ribosymes modulaires régulés par les aptamères
US20090143327A1 (en) * 2007-08-28 2009-06-04 Smolke Christina D General composition framework for ligand-controlled regulatory systems

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
See also references of WO2012056449A2 *
SILVERMAN S K: "Rube Goldberg goes (ribo)nuclear ? Molecular switches and sensors made from RNA", RNA, COLD SPRING HARBOR LABORATORY PRESS, US, vol. 9, no. 4, 1 April 2003 (2003-04-01), pages 377-383, XP002374942, ISSN: 1355-8382, DOI: 10.1261/RNA.2200903 *

Also Published As

Publication number Publication date
CN103282372A (zh) 2013-09-04
WO2012056449A3 (fr) 2012-07-19
JP2013544510A (ja) 2013-12-19
EP2632931A4 (fr) 2014-06-18
WO2012056441A1 (fr) 2012-05-03
WO2012056449A2 (fr) 2012-05-03
AU2011322106A1 (en) 2013-05-30
US20130225660A1 (en) 2013-08-29
CA2815632A1 (fr) 2012-05-03

Similar Documents

Publication Publication Date Title
US20130245096A1 (en) COMPOSITIONS AND METHODS FOR ACTIVATING EXPRESSION BY A SPECIFIC ENDOGENOUS miRNA
ES2969371T3 (es) Interferencia por ARN para el tratamiento de trastornos de ganancia de función
JP5986928B2 (ja) 遺伝子発現の特異的阻害のためのダイサー基質剤及び方法
CA2524569C (fr) Procede de regulation de l'expression genique
US20130225660A1 (en) Compositions and methods for specific cleavage of exogenous rna in a cell
Pendergraff et al. Single-stranded silencing RNAs: hit rate and chemical modification
Goyani et al. TRIM-NHL as RNA Binding Ubiquitin E3 Ligase (RBUL): Implication in development and disease pathogenesis
KR20190129903A (ko) 압타머-조정된 RNase P 절단에 의한 유전자 발현의 조절
EP2502997A1 (fr) Molécule d'acide nucléique à inhibition micro ARN
WO2019112489A1 (fr) Procédés et agents pour le traitement du vieillissement et des états et maladies liés au vieillissement
US20240117350A1 (en) Use of mirna-485 inhibitor to regulate psd95, synaptophysin, and caspase-3 expression
JP7364198B2 (ja) iPS細胞の生成に使用される新規RNA組成物およびその製造方法
Meganck Engineering Elements for Improved RNA Stability
Gutierrez Aguirregabiria Using synthetic oligonucleotides to modify cellular IRES structures and control gene expression
EP4118436A1 (fr) Méthodes de diagnostic utilisant l'expression de sirt1
WO2021181364A1 (fr) Méthodes diagnostiques utilisant l'expression de pgc-1a

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20130524

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20140520

RIC1 Information provided on ipc code assigned before grant

Ipc: C07H 21/00 20060101AFI20140514BHEP

Ipc: C12N 15/63 20060101ALI20140514BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20160503