EP2499497A1 - Contrôle de la fertilité humaine via dpy19l2 - Google Patents

Contrôle de la fertilité humaine via dpy19l2

Info

Publication number
EP2499497A1
EP2499497A1 EP10792991A EP10792991A EP2499497A1 EP 2499497 A1 EP2499497 A1 EP 2499497A1 EP 10792991 A EP10792991 A EP 10792991A EP 10792991 A EP10792991 A EP 10792991A EP 2499497 A1 EP2499497 A1 EP 2499497A1
Authority
EP
European Patent Office
Prior art keywords
seq
dpy19l2
polypeptide
nos
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP10792991A
Other languages
German (de)
English (en)
Inventor
Pierre Ray
Christophe Arnoult
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universite Joseph Fourier Grenoble 1
Original Assignee
Universite Joseph Fourier Grenoble 1
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universite Joseph Fourier Grenoble 1 filed Critical Universite Joseph Fourier Grenoble 1
Publication of EP2499497A1 publication Critical patent/EP2499497A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/689—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to pregnancy or the gonads
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7084—Compounds having two nucleosides or nucleotides, e.g. nicotinamide-adenine dinucleotide, flavine-adenine dinucleotide
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/16—Masculine contraceptives
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/36—Gynecology or obstetrics
    • G01N2800/367—Infertility, e.g. sperm disorder, ovulatory dysfunction

Definitions

  • the present patent application relates to a method of diagnosing infertility, more specifically infertility associated with the DPY19L2 protein, in a male subject, and a method of treating such a subject to restore fertility.
  • the present invention also relates to the use of molecules inhibiting the action of the DPY19L2 polypeptide in a male subject of the wild type, for example of the anti-DPY19L2 interfering nucleic acid type that selectively inhibits the expression of the DPY19L2 polypeptide.
  • Spermatogenesis is a highly specialized function that represents a good target for the development of alternative contraceptive methods. Very few genes have so far been linked to disorders of spermatogenesis. It was demonstrated in the 1970s that microdeletions of the Y chromosome resulted in oligozoospermia (reduction of sperm count) or azoospermia (absence of spermatozoa). The complexity of the region which consists of repeated sequences did not establish a clear role for genes located in this region. Since this discovery and until 2003, no human gene has been formally associated with a defect in spermatogenesis in humans.
  • the inventors of the present invention have demonstrated a new gene involved in spermatogenesis: DPY19L2.
  • a deletion complete homozygote gene leads to a globozoospermia phenotype, phenotype totally incompatible with natural reproduction.
  • DPY-1 9 gene has been described as being involved in the polarity of neuroblasts and their migration along the anteroposterior axis in C. elegans yeast (Honigberg et al., 2000). Nevertheless, to date, DPY19L2 has never been described as being involved in spermatogenesis and human infertility.
  • the DPY19L2 protein is necessary for the formation of the acrosome and the elongation of the spermatozoid head. Indeed, in the absence of DPY19L2 protein, the spermatozoa are devoid of acrosomes and can not penetrate the egg for fertilization. Thus, the subject carrying the mutation, leading to a total absence of DPY19L2 protein or to a mutant DPY19L2 protein, has infertility linked to the absence of the DPY19L2 gene. In addition, patients with such a phenotype do not have any health problems other than infertility, which makes DPY19L2 a prime target in the development of a male contraceptive.
  • the present invention relates to a DPY1 9L2 polypeptide characterized in that it comprises or consists of a polypeptide chosen from:
  • polypeptide comprising a function in the formation of the acrosome of the spermatozoid and a sequence having at least 80% identity with SEQ ID No. 1.
  • the present invention also relates to a polynucleotide encoding a DPY19L2 polypeptide as defined above. According to one embodiment, this polynucleotide is characterized in that it has the sequence SEQ ID NO: 1
  • the invention also relates to a polypeptide encoded by the nucleotide sequence on human chromosome 12 between the nucleotide 63,952,693 and nucleotide 64,062,354, accession number NCBI: NC_000012.1 1, between the AVPR1 A and TMEM5 genes ( Figure 3).
  • the polypeptide is useful in a male human subject for the purpose of restoring functional spermatogenesis.
  • the invention also relates to an antibody specific for the DPY19L2 polypeptide according to the invention.
  • the invention also relates to a method for diagnosis or prognosis of a DPY1 9L2-linked globozoospermia infertility in a male human subject, the DPY19L2 gene being located at 12q14.2, said method comprising a step of detecting, in a biological sample of said subject the presence or absence of a polynucleotide lying on the chro- mosome 1 2 between the nucleotide 63,952,693 and the nucleotide 64,062,354 of the accession number NCBI: NC_000012.1 1.
  • the invention also relates to: an express ion cassette comprising a functional promoter, a polynucleotide according to the invention and a terminator sequence; and a vector comprising the polynucleotide according to the invention and / or an expression cassette according to the invention, for example for its use for treating a male subject having infertility related to DPY19L2.
  • the invention also relates to a molecule inhibiting the expression or the action of the DPY1 9L2 polypeptide according to the invention, in a male subject of the wild type.
  • a molecule inhibiting the expression or the action of the DPY1 9L2 polypeptide according to the invention in a male subject of the wild type.
  • it is an interfering nucleic acid of DNA or RNA type, anti-DPY19L2, which selectively inhibits the expression of the DPY1 9L2 polypeptide in a male subject in the wild type.
  • this molecule is used as a contraceptive means in a male subject of the wild type.
  • the invention relates to a chip-type solid support on which the polypeptide according to the invention or the polynucleotide according to the invention is attached.
  • the objects of the invention are the following: A method of diagnosing infertility in a male human subject, said method comprising a step of detecting, in a biological sample of said subject, the presence or absence of a polynucleotide found on the chro- mosome 1 2, between nucleotide 63,952,693 and nucleotide 64,062,354, accession number NCB I: NC_000012.1 1; according to this method, the homozygous deletion or the heterozygous deletion of said polynucleotide will be detected; in the context of the method of the invention, said polynucleotide is the DPY19L2 gene.
  • a method of diagnosing infertility in a male human subject wherein, in a biological sample of said subject, no nucleotide sequence identical to SEQ ID NO: 2 is detected or a single nucleotide sequence is detected. it is from S EQ ID NO: 2, but is at least 95% identity with SEQ ID NO: 2; in the context of this method of the invention, a preferred nucleotide sequence is a nucleotide sequence differing from SEQ ID NO: 2, but having at least 95% identity with SEQ ID NO: 2, and that it does not encode the DPY19L2 protein.
  • Any of the methods of the invention may comprise a prior amplification step by means of primers selected from the pairs SEQ ID NOS: 3 and 4, SEQ ID NOS: 5 and 6, SEQ ID NOS: 7 and 8, SEQ ID NOS: 9 and 10, SEQ ID NOS: 1 1 and 12, SEQ ID NOS: 13 and 14, SEQ ID NOS: 1 5 and 16 and SEQ ID NOS: 1 7 and 1 8.
  • Negative amplification with at least one of the pairs SEQ ID NOS: 7 and 8, SEQ ID NOS: 9 and 10, SEQ ID NOS: 1 1 and 1 2, and preferably with at least two of these pairs, and more preferably with the three pairs, is characteristic of a homozygous absence of the gene DPY1 9L2.
  • a biological sample is advantageously chosen from peripheral blood leukocytes and saliva.
  • the procedure described above is advantageously coupled with histological analysis of the subject's spermatozoa.
  • Figure 1 images of confocal microscopy (A, D, G), electron microscopy (B, E, H) and microscopy scan (C, F, I) of control spermatozoa (A, B, C), globozocephalic spermatozoa without acrosome (D, E, F) and globozocephalic spermatozoa with atrophied or misplaced acrosomes (G, H, I).
  • Figure 3 schematic representation of the DPY19L2 gene; loci a) and b) are located at approximately 9 and 25 kb from the 3 'end of DPY19L2; loci c), d) and e) respectively show the position of exons 22, 1 1 and 1 of the gene DPY19L2; regions 1 and 2 represent duplicated sequences of 28 kb with 98% homology located on either side of the DPY19L2 gene and suggest that the deletions result from a homologous recombination phenomenon.
  • the diagram at the bottom of the page shows the deletion present in mutated patients.
  • the primers h can amplify only in the deleted patients a fragment of 1450 nt which includes the points of breakage of the deletion.
  • Figure 4 PCR amplification using primers h of 8 patients (P1, P2, P4, P5, P6, P7, P8 and P9) and 7 controls (T1 to T7).
  • SEQ IDN o. 1 Peptide sequence of DPY1 9L2 (accession number NCBI: NC_000012.1 1)
  • SEQ ID No. 2 DPY19L2 cDNA Sequence (NCBI accession number: NC_000012.11)
  • the invention relates to DPY19L2 polypeptides having a function in the formation of the acrosome of the sperm, as well as in the elongation of the head of the spermatozoon.
  • the inventors have demonstrated that the DPY19L2 protein is necessary for the formation of the acrosome and the elongation of the spermatozoa head. Indeed, in the absence of DPY19L2 protein, sperm are devoid of acrosome and can not enter the egg for fertilization. Thus, the subject carrying the mutation, leading to a total absence of DPY19L2 protein or to a mutant DPY19L2 protein, has infertility linked to the absence of the DPY19L2 gene.
  • the DPY19L2 polypeptide of the invention is represented in the sequence SEQ ID No. 1 in the sequence listing.
  • the invention also relates to polypeptides having a function in the formation of the sperm acrosome and having at least 80% identity with the polypeptide of SEQ ID No.1.
  • the subject of the invention is also polypeptides having at least 90%, 95%, 98% and preferably at least 99% identical amino acids with the polypeptide of SEQ ID No.1.
  • identical amino acids is meant amino acids that are invariant between two sequences.
  • These polypeptides may have a deletion, addition or substitution of at least one amino acid relative to the polypeptide of SEQ ID No. 1.
  • the invention also relates to polypeptides having at least 80%, 90%, 95%, 98% and preferably at least 99% similarity with the polypeptide of SEQ ID No. 1.
  • similarity is meant the measurement of the similarity between protein or nucleic sequences.
  • These polypeptides may have a deletion, addition or substitution of at least one amino acid with respect to the polypeptide of SEQ ID No. 1.
  • the degree of similarity between two sequences, quantified by a score, is based on the percentage of conservative identities and / or substitution of the sequences.
  • the invention also relates to a polypeptide encoded by the nucleotide sequence on human chromosome 1 2 between nucleotide 63,952,693 and nucleotide 64,062,354 of accession number NCBI: NC_000012.1 1 between the AVPR1A and TMEM5 genes ( Figure 3).
  • the invention also relates to a DPY1 9L2 polypeptide according to the invention for use in a human male subject for the purpose of restoring functional spermatogenesis.
  • the invention also relates to polynucleotides encoding the DPY1 9L2 polypeptide according to the invention.
  • these polynucleotides encode the polypeptide of the sequence SEQ ID No. 1.
  • polynucleotide is understood to mean a single-stranded nucleotide chain or its complementary, which may be of the type DNA or RNA or a double-stranded nucleotide chain (DNA).
  • the polynucleotides of the invention are of the DNA type, in particular of double-stranded DNA.
  • polynucleotide also refers to modified polynucleotides.
  • the invention relates generally to polynucleotides coding for the use of polynucleotides. Due to the degeneracy of the genetic code, different polynucleotides can encode the same polypeptide.
  • polynucleotides of the present invention are isolated, amplified or purified from their natural environment.
  • the polynucleotides of the present invention may be prepared by standard molecular biology techniques as described by Sambrook et al. (T. Maniatis, E.F. Fritsch, J. Sambrook, Molecular Cloning: A laboratory Handbook, 1982) or by chemical synthesis.
  • the polynucleotide encoding the DPY19L2 polypeptide comprises the sequence SEQ ID No. 2 or the complementary sequence of SEQ ID No. 2.
  • the invention also relates to the nucleotide sequence on human chromosome 1 2 between nucleotide 63,952,693 and nucleotide 64,062,354 of accession number NCBI: NC_000012.1 1 .
  • This nucleotide sequence is located between the AVPR1A and TMEM5 genes ( Figure 3).
  • the present invention also relates to a method of diagnosis or prognosis of a globozoospermia-related infertility related to DPY1 9L2 in a male subject.
  • This method comprises a step of detecting the presence or absence of a polynucleotide on chromosome 12 between nucleotide 63,952,693 and nucleotide 64,062,354 of accession number NCBI: NC_00001 2.1 1.
  • This polynucleotide is located between the AVPR1A and TMEM5 genes ( Figure 3).
  • the method of the invention comprises a step of detecting the presence of the polynucleotide encoding the DPY19L2 polypeptide according to the invention, or a fragment thereof, in a sample. of said subject.
  • the method comprises a step of detecting the absence of the polynucleotide encoding the DPY19L2 polypeptide according to the invention.
  • the method comprises a step of detecting the presence of a mutated DPY19L2 polynucleotide.
  • the method comprises steps and means for determining whether the DPY19L2 gene of a male subject has a complete deletion of the DPY19L2 gene or mutant sequence of the gene relative to the wild-type human DPY19L2 gene sequence.
  • the carrier of the wild-type DPY19L2 gene has a fertile phenotype compatible with natural reproduction.
  • the method of the invention thus makes it possible to detect the presence of the wild-type human DPY19L2 gene, the mutated human DPY19L2 gene or the absence of the human DPY19L2 gene, in a biological sample of a male subject.
  • the diagnosis / prognosis of infertility or insufficient fertility for natural reproduction may be pronounced and the Solutions to remedy the situation can be put in place or anticipated.
  • the diagnosis of infertility is negative, which means that the subject does not have a globozoospermia-related infertility related to DPY1 9L2. In this case, the practitioner will eventually look for the presence or absence of other diagnostic markers.
  • mutated PY1 9L2 molecule or “mutated DPY19L2 polynucleotide” is understood to mean a nucleotide sequence which derives from the wild-type human DPY19L2 gene by deletion, addition or substitution of at least one nucleotide so as to encode a DPY1 protein. 9L2 mutated. This at least one deletion, addition or substitution (or deletions, additions and / or substitutions) will generally take place in at least one of the sequences of the gene. For example, it can take place in one or more of the sequences coding (CDS) of the gene.
  • CDS sequences coding
  • the DPY19L2 gene comprises 22 exons.
  • An example of a mutated gene according to the invention is a fragment of the wild-type human DPY19L2 gene comprising a part but not all of the wild-type human DPY19L2 polynucleotide from which it derives, for example which lacks an exon with respect to the wild-type sequence.
  • mutant DPY19L2 protein or “mutated DPY19L2 polypeptide” is meant an amino acid sequence which derives from the wild-type human DPY19L2 protein by deletion, addition or substitution of at least one amino acid and which, as a result, has lost its function in the formation of the sperm acrosome.
  • the diagnosis is made from a biological sample of a male subject. Detection is done using standard molecular biology techniques known to those skilled in the art as described by Sambrook et al. (T. Maniatis, F. F. Fritsch, J. Sambrook, Molecular Cloning: A laboratory Handbook, 1982). It is generally necessary to use nucleic acid probes, as described in the examples below, more particularly in Table 1. The sequences of these probes SEQ ID Nos. 3-12 are in the sequence listing.
  • the method of the invention comprises a step of detecting, in a biological sample of a subject, the presence of the polynucleotide encoding the DPY1 9L2 polypeptide according to the invention, the presence of a fragment of the polynucleotide encoding the DPY19L2 polypeptide according to the invention, the presence of a mutated polynucleotide having at least one mutation, for example an addition, a deletion or a substitution of at least one nucleotide with respect to the polynucleotide encoding the polypeptide DPY19L2 according to the invention, and / or the absence of the polynucleotide encoding the DPY19L2 polypeptide according to the invention, by using a pair of specific nucleic acid probes.
  • the probes may be specific for the polynucleotide encoding the DPY19L2 polypeptide according to the invention, a fragment thereof or the mutated polynucleotide having at least one mutation, for example an addition, a deletion or a substitution of at least one nucleotide with respect to the polynucleotide encoding the DPY19L2 polypeptide according to the invention. 'invention.
  • the present invention also has a diagnostic reagent, characterized in that it is selected from the group consisting of polynucleotides, polypeptides and antibodies according to the invention.
  • the subject of the present invention is also a method for diagnosis or prognosis of a globozoospermia-related infertility linked to DPY19L2 in a male subject, characterized in that it comprises contacting a biological sample of said subject, with a diagnostic reagent as defined above, for example an antibody, and detecting the formation of an antibody and polypeptide complex present in the biological sample.
  • a diagnostic reagent as defined above, for example an antibody
  • the present invention also relates to a pair of primers specific for the wild-type human DPY19L2 polynucleotide according to the invention, in particular that represented in the sequence SEQ ID No. 1 and allowing its selective amplification under sufficient stringency conditions.
  • a short sequence of oligonucleotides which, hybridized with a nucleic acid template, allows a polymerase to initiate the synthesis of a new strand of protein. DNA.
  • the strand produced from the primer is complementary to the strand used as a template. Repetition of the synthesis by the Polymerase Chain Reaction (PCR) process yields millions of copies of the sequence of interest.
  • a polynucleotide encoding a polypeptide according to the invention is inserted into an expression cassette using cloning techniques well known to humans. of career.
  • This expression cassette comprises the elements necessary for the transcription and translation of the sequences coding for the polypeptides according to the invention.
  • this expression cassette comprises both elements making it possible to produce a polypeptide by a host cell and elements necessary for the regulation of this expression.
  • promoter sequence may be used in the expression cassettes according to the invention.
  • the choice of the promoter will depend in particular on the host organism chosen for the expression of the gene of interest. Some promoters allow constitutive expression whereas other promoters are inducible on the contrary.
  • the present invention also relates to replication or expression vectors comprising at least one polynucleotide or an expression cassette as described above.
  • This vector may in particular be constituted by a plasmid, a cosmid, a bacteriophage or a virus into which is inserted a polynucleotide or an expression cassette according to the invention.
  • the techniques for constructing these vectors and for inserting a polynucleotide of the invention into these vectors are well known to those skilled in the art.
  • the present invention also relates to a molecule inhibiting the expression or action of the DPY19L2 polypeptide according to the invention in a male subject of the wild type.
  • This molecule represents a means of contraception of the male subject.
  • the spermatozoa are devoid of acosome or exhibit a non-functional acrosome under the effect of treatment with the inhibitory molecule.
  • the molecule according to the invention can indeed act to block the transcription or translation of the DPY19L2 gene. It can alternatively block the action of the protein thus leading to either a completely absent acrosome or an acrosome atrophied and misplaced on the spermatozoon.
  • it is an interfering nucleic acid of DNA or RNA type, anti-DPY19L2, which selectively inhibits the expression of the DPY1 9L2 polypeptide in a male subject of the wild type.
  • It can be, for example, siRNA or shRNA.
  • the invention also relates to a molecule according to the invention for its use as a contraceptive means in a subject of mascu l in wild type.
  • the invention relates to the use of the molecule according to the invention in the preparation of a contraceptive medicament in a male subject of the wild type.
  • polynucleotides and polypeptides of the present invention can be immobilized on a solid support.
  • Solid supports suitable for the immobilization of polynucleotides are known, especially for the manufacture of DNA chips. There are many varieties of DNA chips, which are distinguished by the type of medium used, the nature, density and mode of attachment or synthesis of the nucleotide sequences on the support, and the read condititions. These techniques are known to those skilled in the art. Solid support is also understood to mean microsphere-type supports.
  • the present invention also relates to antibodies, characterized in that they are directed against one or more of the DPY19L2 polypeptides of the present invention.
  • said antibodies are selected from monoclonal antibodies and polyclonal antibodies.
  • Globozoospermia is a rare phenotype of primary primary male infertility characterized by the production of acrosome-free sperm (OMIM # 102530).
  • the inventors have recently demonstrated that the strategy of mapping homozygotes using a genome-wide screening applied to infertile patients from the same ethnographic-geographic area led to the localization and identification of genes involved in the genome. spermatogenesis. This genetic strategy was applied to a cohort of Tunisian patients with total globozoospermia. The inventors have demonstrated that 8 of the 10 patients analyzed had a homozygous deletion for DPY19L2.
  • the P7 patient is of Vietnamese origin and lives in France. He does not have family consanguinity.
  • Genomic DNA is extracted from peripheral blood leukocytes using a guanidium chloride or saliva extraction procedure using the Oragene DNA Self-Collection kit (DNAgenotech, Ottawa Canada).
  • 3OPY19L2 F GATTAAAGTTCTGGGGTGAG 444 60
  • DPY19L2 F AAATCTAGACACAGTCACAGCATCATC 1450 60 point of (SEQ ID No. 17)
  • the 250K Sty1 SNP microarrays (Affymetrix, Inc., Santa Clara, CA) were applied to P1-P9 patients according to the manufacturer's recommendations. The analyzes were conducted at NGBMC (Strasbourg). Electron microscopy
  • the spermatozoa were fixed with 2.5% glutaraldehyde in 0.1 M cacodylate buffer pH 7.4 for 2 hours at room temperature. The cells were then washed with buffer, and post-fixed with 1% osmium tetroxide in the same buffer for 1 hour at 4 ° C. After extensive washing with water, the cells were fixed with 0.5% uranil acetate pH 4 overnight at 4 ° C. The cells are then dehydrated using an alcohol gradient (30% -60% -90% -100% -100% -100%) and infiltrated with a 1/1 epon / 100% alcohol mixture for one hour before several washes fresh epon (Flukka) for 3 hours.
  • the cells are centrifuged and immersed in fresh epon and polymerized for 3 days at 60 ° C.
  • Ultrafine sections of the cells are made using an ultra microtome (Leica). The sections are post-fixed with 4% uranil acetate and 1% lead citrate before being observed under the 80 kV electron microscope (JEOL 1200EX).
  • the 10 patients described here exhibit total globozoospermia with 100% round-headed spermatozoa and an increased flagellar defect rate (40%). All patients had a normal sperm volume (4.6ml).sperm concentration was normal in 7 patients (52-126 Million / ml) and patients P5, P7 and P8 had severe oligozoospermia between 0.02-1.5 M / ml. The mean mobility and morbidity of the first 7 patients was 27.5%, above average. The MAY, or "multiple index anomalies,” was high with an average of 2.5. Additional analyzes were performed on patient P1.
  • a double labeling of the nucleus and the acrosome with TOPRO-3 and Pisum savitu m lectins, respectively, show perfectly round nuclei (Figure 1 D, G), without acrosome (labeling done with PSA-FITC, not shown - Figure 1 D) or misplaced acrosome foci, at the periphery of the nucleus (PSA-FITC labeling, not shown - Figure 1 G).
  • Transmission electron microscopy confirmed the presence of round nuclei (Figure 1E, H).
  • the photographs show that the round spermatozoa contour is not smooth (Figure 1F, I).
  • the surface of the sperm appears wrinkled by what might be a too weak plasma membrane or a practically empty acrosome membrane. The irregularity of this outer membrane can be seen in the 1H photograph.
  • Primers c, d and e make it possible to detect the presence of the homozygous deletion of the DPY19L2 gene.
  • PCR in the deleted patients is negative with these primers.
  • the primers are used to delimit and serve as a positive amplification control in patients.
  • the primers h make it possible to amplify the recurrent deletion found in globozocephalic patients. This PCR is therefore positive in men and negative in healthy men.
  • the PCR with the primers f makes it possible to amplify the deleted region in the patients and thus to carry out the diagnosis of heterozygosity and homozygosity.
  • Table 2 summarizes the amplifications at the DPY19L2 locus according to the genotype of the patients (see Figures 2 and 4):
  • DPY19L2 is a membrane protein because it contains 11 transmembrane domains.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Reproductive Health (AREA)
  • Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gynecology & Obstetrics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Pregnancy & Childbirth (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Endocrinology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)

Abstract

La présente demande de brevet concerne un procédé de diagnostic d'une infertilité liée à la protéine DPY19L2, chez un sujet de sexe masculin, ainsi qu'un procédé de traitement d'un tel sujet visant à rétablir la fertilité. La présente invention concerne également l'utilisation de molécules inhibant l'action du polypeptide DPY19L2chez un sujet de sexe masculin de type sauvage, par exemple de type acides nucléiques interférants anti-DPY19L2 inhibant sélectivement l'expression du polypeptide DPY19L2.

Description

Contrôle de la fertilité humaine via DPY19L2
La présente demande de brevet concerne un procédé de diagnostic d'une infertilité, plus précisément une infertilité associée à la protéine DPY19L2, chez un sujet de sexe masculin, ainsi qu'un procédé de traitement d'un tel sujet visant à rétablir la fertilité. La présente invention concerne également l'utilisation de molécules inhibant l'action du polypeptide DPY19L2 chez un sujet de sexe masculin de type sauvage, par exemple de type acides nucléiques interférants anti-DPY19L2 inhibant sélectivement l'expression du polypeptide DPY19L2.
Actuellement, les seuls contraceptifs oraux disponibles sont les contraceptifs féminins hormonaux de type oestro-progestatifs.
La spermatogénèse est une fonction hautement spécialisée qui représente une bonne cible pour le développement de méthodes contraceptives alternatives. Très peu de gènes ont jusqu'à présent pu être mis en rapport avec des troubles de la spermatogénèse. Il a été démontré dans les années 1970 que des microdélétions du chromosome Y entraînaient une oligozoospermie (réduction du nombre de spermatozoïdes) ou une azoospermie (absence de spermatozoïdes). La complexité de la région qui est constituée de séquences répétées n'a pas permis d'établir un rôle clair pour les gènes localisés dans cette région. Depuis cette découverte et jusqu'en 2003, aucun gène humain n'a pu être formellement associé à un défaut de la spermatogénèse chez l'homme.
En 2003, Xu Min et collaborateurs ont identifié un nouveau gène impliqué dans la spermatogénèse : SPATA16/NYD-S P 1 2 (Xu Min et al., 2003). Ce gène, lorsqu'il est muté, donne un phénotype rare d'infertilité : la globozoospermie (Dam et al. 2007 ; WO2009/013405).
Par ailleurs, en 2007, Dieterich et collaborateurs ont démontré que l'absence de protéine fonctionnelle Aurora Kinase C (AURKC) par la mutation c.144delC entraînait une infertilité primaire par production de spermatozoïdes macrocéphales (Dieterich et al., 2007).
Les inventeurs de la présente invention ont mis en évidence un nouveau gène impliqué dans la spermatogénèse : DPY19L2. Une délétion homozygote complète du gène conduit à un phénotype de globozoospermie, phénotype totalement incompatible avec une reproduction naturelle.
Le gène DPY-1 9 a été décrit comme étant impliqué dans la polarité des neuroblastes et leur migration selon l'axe antéro-postérieur chez la levure C. elegans (Honigberg et al., 2000). Néanmoins jusqu'à ce jour, DPY19L2 n'a jamais été décrit comme étant impliqué dans la spermatogénèse et l'infertilité humaine.
Les inventeurs ont démontré que la protéine DPY19L2 est nécessaire à la formation de l'acrosome et à l'élongation de la tête des spermatozoïd es . En effet, en l 'absence de protéine DPY19L2, les spermatozoïdes sont dépourvus d'acrosome et ne peuvent pas pénétrer dans l'ovule en vue de la fécondation. Ainsi le sujet porteur de la mutation, conduisant à une absence totale de protéine DPY19L2 ou à une protéine DPY19L2 mutante, présente une infertilité liée à l'absence du gène DPY19L2. En outre, les patients qui présentent un tel phénotype ne présentent pas de problèmes de santé autre que leur infertilité, ce qui fait de DPY19L2 une cible de choix dans le cadre de la mise au point d'un contraceptif masculin.
Description de l'invention
La présente invention concerne u n polypeptide DPY1 9L2 caractérisé en ce qu'il comprend ou consiste en un polypeptide choisi parmi :
- le polypeptide de la séquence SEQ ID No. 1 ;
- un polypeptide comportant une fonction dans la formation de l'acrosome du spermatozoïde et une séquence présentant au moins 80% d'identité avec SEQ ID No. 1 .
La présente invention concerne aussi un polynucléotide codant pour un polypeptide DPY19L2 tel que défini ci-dessus. Selon un mode de réalisation, ce polynucléotide est caractérisé en ce qu'il a la séquence SEQ ID
No. 2 ou la séquence complémentaire de SEQ ID No. 2.
L'invention concerne également un polypeptide codé par la séquence nucléotidique se trouvant sur le chromosome 12 humain entre le nucléotide 63,952,693 et le nucléotide 64,062,354, du numéro d'accession NCBI : NC_000012.1 1 , entre les gènes AVPR1 A et TMEM5 (Figure 3).
Selon un mode de réal isation de l'invention, le polypeptide est util isé chez un sujet h umain de sexe mascul in en vue de restaurer une spermatogénèse fonctionnelle.
L'invention concerne aussi un anticorps spécifique du polypeptide DPY19L2 selon l'invention.
L'invention concerne également u n procédé de diagnostic ou de pronostic d'une infertilité de type globozoospermie liée à DPY1 9L2 chez un sujet humain du sexe masculin, le gène DPY19L2 étant situé en 12q14.2, ledit procédé comprenant une étape consistant à détecter, dans un échantillon biologique dudit sujet la présence ou l'absence d'un polynucléotide se trouvant su r le ch romosome 1 2 entre le n ucléotide 63,952 ,693 et l e nucl éotide 64,062,354 du numéro d'accession NCBI : NC_000012.1 1 .
L'invention concerne aussi : u n e cassette d ' express ion comprenant un promoteur fonctionnel, un polynucléotide selon l'invention et une séquence terminatrice ; et un vecteur comprenant le polynucléotide selon l'invention et/ou une cassette d'expression selon l'invention, par exemple pour son utilisation pour traiter un sujet de sexe masculin présentant une infertilité lié à DPY19L2.
L'invention concerne aussi une molécule inhibant l'expression ou l'action du polypeptide DPY1 9L2 selon l'invention , chez un sujet de sexe masculin de type sauvage . Selon un mode de réal isation de la présente invention, il s'agit d'un acide nucléique interférant de type ADN ou ARN, anti- DPY19L2 inhibant sélectivement l'expression du polypeptide DPY1 9L2 chez un sujet de sexe mascul in de type sauvage. Selon un mode de réalisation, cette molécule est utilisée en tant que moyen contraceptif chez un sujet de sexe masculin de type sauvage.
Enfin , l'invention concerne un support sol ide de type puce, sur lequel se trouve fixé le polypeptide selon l'invention ou le polynucléotide selon l'invention.
Plus spécifiquement, les objets de l'invention sont les suivants : - Un procédé de diagnostic d'une infertilité chez un sujet humain du sexe masculin, ledit procédé comprenant une étape consistant à détecter, dans un échantillon biologique dudit sujet, la présence ou l'absence d'un polyn ucléotide se trouvant su r l e ch romosome 1 2, entre le nucléotide 63,952,693 et le nucléotide 64,062,354, du numéro d'accession NCB I : NC_000012.1 1 ; selon ce procédé, on détectera la délétion homozygote ou la délétion hétérozygote dudit polynucléotide ; dans le cad re d u procédé de l'invention, ledit polynucléotide est le gène DPY19L2.
- Un procédé de diagnostic d'une infertilité chez un sujet humain de sexe masculin, selon lequel, dans un échantillon biologique dudit sujet, on ne détecte aucune séquence nucléotidique identique à SEQ ID NO : 2 ou on détecte u ne séq uen ce n ucléotid iq ue d ifférant de S EQ ID NO : 2 , ma is présentant au moins 95% d'identité avec SEQ ID NO : 2 ; dans le cadre de ce procédé de l ' i nvention , u ne séq uen ce n ucl éotid iq ue préférée est u ne séquence nucléotidique différant de SEQ ID NO : 2, mais présentant au moins 95% d'identité avec SEQ I D NO : 2, et qu i ne code pas pour la protéine DPY19L2.
L'un quelconque des procédés de l'invention peut comprendre une étape d 'ampl ification préalable au moyen d'amorces choisies parm i les couples SEQ ID NOS : 3 et 4, SEQ ID NOS : 5 et 6, SEQ ID NOS : 7 et 8, SEQ ID NOS : 9 et 10, SEQ ID NOS : 1 1 et 12, SEQ ID NOS : 13 et 14, SEQ ID NOS : 1 5 et 16 et SEQ ID NOS : 1 7 et 1 8. Une amplification négative avec au moins l'un des couples SEQ ID NOS : 7 et 8, SEQ ID NOS : 9 et 10, SEQ ID NOS : 1 1 et 1 2, et de préférence avec au moins deux de ces couples, et mieux encore avec les trois couples, est caractéristique d'une absence homozygote du gène DPY1 9L2. Une amplification positive avec au moins l'un des couples SEQ ID NOS : 7 et 8, SEQ ID NOS : 9 et 10, SEQ ID NOS : 1 1 et 12, de préférence avec au moins deux de ces couples, et mieux encore avec les trois couples, et une amplification positive avec le couple SEQ ID NOS : 17 et 18 est caractéristique d'une absence hétérozygote du gène DPY19L2.
Un échantillon biologique est avantageusement choisi parmi les leucocytes du sang périphérique et la salive. U n p rocéd é d e l ' i n ve n t i o n te l q u e d éc rit c i-dessus est avantageusement couplé à une analyse histologique des spermatozoïdes du sujet.
Description des figures
Figure 1 : images de microscopie confocale (A, D, G), microscopie électronique (B, E, H) et scan de microscopie (C, F, I) de spermatozoïdes contrôles (A, B, C), spermatozoïdes globozoocéphales sans acrosome (D, E, F) et spermatozoïdes globozoocéphales présentant un acrosome atrophié ou mal placé (G, H, I).
Figure 2 : amplification PCR de 7 loci du gène DPY19L2 (bandes a) à g) ) de 10 patients présentant une globozoospermie (P1 -P9 et P6f) et de 4 patients fertiles (T1 -T4) ; les loci situés dans le gène (c, d et e) ne sont pas amplifiés, ainsi que les loci b et f ; la délétion est délimitée par les loci a et g qui donnent une amplification similaire entre les patients et les contrôles.
Figure 3 : représentation schématique du gène DPY19L2 ; les loci a) et b) sont localisés approximativement à 9 et 25 kb de l'extrémité 3' de DPY19L2 ; les loci c), d) et e) montrent respectivement la position des exons 22, 1 1 et 1 du gène DPY19L2 ; les régions 1 et 2 représentent des séquences dupliquées de 28kb avec 98% d'homologie localisées de part et d'autre du gène DPY19L2 et suggèrent que les délétions résultent d'un phénomène de recombinaison homologue. Le schéma en bas de page montre la délétion présente chez les patients mutés. Les amorces h permettent d'amplifier uniquement chez les patients délétés un fragment de 1450 nt qui comprend les points de cassures de la délétion.
Figure 4 : amplification PCR en utilisant les amorces h de 8 patients (P1 , P2, P4, P5, P6, P7, P8 et P9) et 7 témoins (T1 à T7).
Figure 5 : Analyse par CGH (comparative genomic hybridation) du patient P1 Description des séquences
SEQ I D N o . 1 : Séquence peptidique de DPY1 9L2 (numéro d'accession NCBI : NC_000012.1 1 ) SEQ ID No. 2 : Séquence ADNc de DPY19L2 (numéro d'accession NCBI : NC_000012.11)
SEQ ID Nos.3-18 : Amorces pour clonage Polypeptides
L'invention a pour objet des polypeptides DPY19L2 présentant une fonction dans la formation de l'acrosome du spermatozoïde, ainsi que dans l'élongation de la tête du spermatozoïde.
Comme expliqué plus haut, les inventeurs ont démontré que la protéine DPY19L2 est nécessaire à la formation de l'acrosome et à l'élongation de la tête des spermatozoïdes. En effet, en l'absence de protéine DPY19L2, les spermatozoïdes sont dépourvus d'acrosome et ne peuvent pas pénétrer dans l'ovule en vue de la fécondation. Ainsi le sujet porteur de la mutation, conduisant à une absence totale de protéine DPY19L2 ou à une protéine DPY19L2 mutante, présente une infertilité liée à l'absence du gène DPY19L2.
Des expériences d'immunohistochimie ont permis de confirmer que l'acrosome chez les patients présentant une délétion pour DPY19L2 était soit complètement absent, soit atrophié et mal placé sur le spermatozoïde. Les inventeurs ont, en outre, démontré que la globozoospermie de certains patients est liée à l'absence de protéine DPY19L2 sur le chromosome 12 (en 12q14.2 ; plus précisément sur le chromosome 12 entre le nucléotide 63,952,693 et le nucléotide 64,062,354 du numéro d'accession NCBI : NC_000012.11 ) entre les gènes AVPR1 A et TMEM5 (Figure 3).
Le polypeptide DPY19L2 de l'invention est représenté à la séquence SEQ ID No.1 dans le listage de séquences.
L'invention a également pour objet des polypeptides comportant une fonction dans la formation de l'acrosome du spermatozoïde et présentant au moins 80 % d'identité avec le polypeptide de la SEQ ID No.1. L'invention a aussi pour objet des polypeptides présentant au moins 90%, 95%, 98% et préférentiellement au moins 99% d'acides aminés identiques avec le polypeptide de la SEQ ID No.1. Par « acides aminés identiques », on entend des acides aminés invariants entre deux séquences. Ces polypeptides peuvent présenter une délétion, une add ition ou une substitution d'au moins un acide am iné par rapport au polypeptide de la SEQ ID No. 1 .
L'invention a également pour objet des polypeptides présentant au moins 80 %, 90%, 95%, 98% et préférentiel lement au moins 99% de similarité avec le polypeptide de la SEQ ID No. 1 . Par « similarité », on entend la mesure de la ressemblance entre séquences protéiques ou nucléiques. Ces polypeptides peuvent présenter une délétion, une addition ou une substitution d'au moins un acide aminé par rapport au polypeptide de la SEQ ID No. 1 . Le degré de similarité entre deux séquences, quantifié par un score, est basé sur le pourcentage d'identités et/ou de substitution conservatrices des séquences.
Les méthodes de mesure et d'identification du degré d'identité et du degré de similarité entre polypeptides sont connues de l'homme du métier. On peut employer par exemple Vector NTi 9.1 .0, programme d'alignement A l i g n X (Clustal W algorithm) ( I n v i trog e n I N F O R MAX, http://www.invitrogen.com). De préférence, on utilise les paramètres par défaut.
L' invention concerne également u n polypeptide codé par la séquence nucléotidique se trouvant sur le chromosome 1 2 humain entre le nucléotide 63,952,693 et le nucléotide 64,062,354 du numéro d'accession NCBI : NC_000012.1 1 entre les gènes AVPR1A et TMEM5 (Figure 3).
L' invention concerne aussi u n polypeptide DPY1 9L2 selon l'invention pour son utilisation chez un sujet humain de sexe masculin en vue de restaurer une spermatogénèse fonctionnelle.
Polynucléotides
L'invention concerne aussi des polynucléotides codant pour le polypeptide DPY1 9L2 selon l'invention . De préférence, ces polynucléotides codent le polypeptide de la séquence SEQ ID No. 1 .
Selon la présente invention, on entend par « polynucléotide » une chaîne nucléotidique simple brin ou son complémentaire pouvant être de type ADN ou ARN ou une chaîne nucléotidique double brin (ADN). De préférence, les polynucléotides de l'invention sont de type ADN, notamment d'ADN double brin. Le te rm e « polynucléotide » désigne également les polynucléotides modifiés. L'invention se rapporte de manière générale aux polynucléotides cod a n t po u r l es po l ype pt id es se l o n l ' i nve n t io n . E n raison de la dégénérescence du code génétique, différents polynucléotides peuvent coder pour un même polypeptide.
Les polynucléotides de la présente invention sont isolés, amplifiés ou purifiés de leur environnement naturel. De préférence, les polynucléotides de la présente invention peuvent être préparés par les techniques classiques de biologie moléculaire telles que décrites par Sambrook et al. (T. Maniatis, E.F. Fritsch, J . Sambrook, Molecular Cloning: A laboratory Handbook, 1982) ou par synthèse chimique.
Da ns u n mod e d e réal isation d e l a présente i nvention , le polynucléotide codant pour le polypeptide DPY19L2 comporte la séquence SEQ ID No. 2 ou la séquence complémentaire de SEQ ID No. 2.
L'invention concerne également la séquence nucléotid ique se trouvant sur le chromosome 1 2 humain entre le nucléotide 63,952,693 et le nucléotide 64,062,354 du numéro d'accession NCBI : NC_000012.1 1 .Cette séquence nucléotidique se situe entre les gènes AVPR1 A et TMEM5 (Figure 3).
Diagnostic et pronostic
La présente invention concerne également un procédé de diagnostic ou de pronostic d'une infertilité de type globozoospermie liée à DPY1 9L2 chez un sujet de sexe masculin . Ce procédé comprend une étape qu i consiste à détecter la présence o u l'absence d'un polynucléotide se trouvant sur le chromosome 12 entre le nucléotide 63,952,693 et le nucléotide 64,062,354 du numéro d'accession NCBI : NC_00001 2.1 1 . Ce polynucléotide se situe entre les gènes AVPR1 A et TMEM5 (Figure 3).
En d'autres mots, le procédé de l'invention comprend une étape qui consiste à détecter la présence du polynucléotide codant le polypeptide DPY19L2 selon l'invention, ou d'un fragment de celui-ci, dans un échantillon biologique dudit sujet. Alternativement, le procédé comprend une étape qui consiste à détecter l'absence du polynucléotide codant le polypeptide DPY19L2 selon l'invention. Selon une autre alternative, le procédé comprend une étape qui consiste à détecter la présence d'un polynucléotide DPY19L2 muté.
Le procédé comprend des étapes et des moyens pour déterminer si le gène DPY19L2 d'un sujet de sexe masculin présente une délétion complète du gène DPY19L2 ou une séquence mutante du gène par rapport à la séquence du gène DPY19L2 humain sauvage. Le porteur du gène DPY19L2 sauvage présente u n phénotype fertile, compatible avec une reproduction naturelle.
Le procédé de l'invention permet donc de détecter la présence du gène DPY19L2 humain sauvage, du gène DPY19L2 humain muté ou l'absence du gène DPY19L2 humain, dans un échantillon biologique d'un sujet de sexe masculin.
Si le sujet présente une délétion complète du gène DPY19L2 ou une séquence mutée du gène par rapport à la séquence du gène DPY19L2 humain sauvage, le diagnostic/pronostic d'infertilité ou de fertilité insuffisante en vue d'une reproduction naturelle peut être prononcé et les solutions visant à remédier à la situation peuvent être mises en place ou anticipées.
Si le sujet présente un gène DPY19L2 humain sauvage, le diagnostic d'une infertilité est négatif, ce qui signifie que le sujet ne présente pas une infertilité de type globozoospermie liée à DPY1 9L2. Dans ce cas, le practicien cherchera éventuellement la présence ou l'absence d'autres marqueurs diagnostics.
P a r « gène D PY1 9L2 m uté » ou « polynucléotide DPY19L2 muté », on entend une séquence nucléotidique qui dérive du gène DPY19L2 humain sauvage par une délétion, addition ou substitution d'au moins un nucléotide de manière à coder pour une protéine DPY1 9L2 mutée. Cette au moins une délétion, addition ou substitution (ou ces délétions, additions et/ou substitutions) aura généralement lieu dans au moins une des séquences du gène. Par exemple elle peut avoir lieu dans une ou plusieurs des séquences codantes (CDS) du gène. Alternativement, elle peut avoir lieu dans les séquences non codantes du gène (en particulier, les séquences agissant sur l'epissage ou la régulation de l'expression du gène ou les séquences qui bornent les introns-exons) . Le gène DPY19L2 comprend 22 exons. Un exemple de gène muté selon l'invention est un fragment du gène DPY19L2 humain sauvage, comprenant une partie mais pas la totalité du polynucléotide DPY19L2 humain sauvage dont il dérive, par exemple auquel il manque un exon par rapport à la séquence sauvage.
Par « protéine DPY19L2 mutée » o u « polypeptide DPY19L2 muté », on entend une séquence aminoacide qui dérive de la protéine DPY19L2 humaine sauvage par une délétion, addition ou substitution d'au moins un aminoacide et qui, de ce fait a perdu sa fonction dans la formation de l'acrosome du spermatozoïde.
Le diagnostic se fait à partir d'un échantillon biologique d'un sujet de sexe masculin. La détection se fait en utilisant les techniques classiques de biologie moléculaire, connues de l'homme du métier, telles que décrites par Sambrook et al. (T. Maniatis, E.F. Fritsch, J. Sambrook, Molecular Cloning: A laboratory Handbook, 1982). Il est généralement nécessaire d'utiliser des sondes d'acides nucléiques, telles que décrites dans les exemples ci-dessous, plus particulièrement au Tableau 1 . Les séquences de ces sondes SEQ ID Nos. 3-12 se trouvent dans le listage de séquences.
Ainsi, selon un mode de réalisation de la présente invention, le procédé de l'invention comprend une étape consistant à détecter, dans un échantillon biologique d'un sujet la présence du polynucléotide codant le polypeptide DPY1 9L2 selon l 'invention , la présence d'un fragment du polynucléotide codant le polypeptide DPY19L2 selon l'invention, la présence d'un polynucléotide muté présentant au moins une mutation, par exemple une addition, une délétion ou une substitution d'au moins un nucléotide par rapport au polynucléotide codant le polypeptide DPY19L2 selon l'invention, et/ou l'absence du polynucléotide codant le polypeptide DPY19L2 selon l'invention, en utilisant une paire de sondes d'acides nucléiques spécifiques. Les sondes peuvent être spécifiques du polynucléotide codant le polypeptide DPY19L2 selon l 'invention , d'un fragment de celu i-ci ou du polynucléotide muté présentant au moins une mutation, par exemple une addition, une délétion ou une substitution d'au moins un nucléotide par rapport au polynucléotide codant le polypeptide DPY19L2 selon l'invention.
La présente invention a, en outre, pou r objet u n réactif de diagnostic, caractérisé en ce qu'il est sélectionné dans le groupe constitué par les polynucléotides, les polypeptides et les anticorps selon l'invention.
La présente invention a également pour objet un procédé de diagnostic ou de pronostic d'une infertilité de type globozoospermie liée à DPY19L2 chez un sujet de sexe masculin, caractérisé en ce qu'il comprend la mise en contact d'un échantillon biologique dudit sujet, avec un réactif de diagnostic tel que défini ci-dessus, par exemple un anticorps, et la détection de la formation d'un complexe anticorps et polypeptide présent dans l'échantillon biologique.
Amorces
La présente invention concerne également une paire d'amorces spécifiques du polynucléotide DPY19L2 humain sauvage selon l'invention, notamment celui représenté à la séquence SEQ ID No. 1 et permettant son amplification sélective dans des conditions de stringence suffisantes.
O n en ten d pa r « amorce » (o u p a r « sonde »), u n e courte séquence d'oligonucléotides qui, hybridée avec une matrice d'acides nucléiques, permet à une polymérase d'entamer la synthèse d'un nouveau brin de l'ADN. Le brin produit à partir de l'amorce est complémentaire au brin utilisé comme matrice. La répétition de la synthèse par le processus de Poiymerase Chain Reaction (PCR) permet d'obtenir des millions de copies de la séquence d'intérêt.
Cassettes d'expression et vecteurs
Selon un mode de réalisation de l'invention, un polynucléotide codant pour un polypeptide selon l'invention est inséré dans une cassette d'expression en utilisant des techniques de clonage bien connues de l'homme du métier. Cette cassette d'expression comprend les éléments nécessaires à la transcription et à la traduction des séquences codant pour les polypeptides selon l'invention.
Avantageusement, cette cassette d'expression comprend à la fois des éléments permettant de faire produire un polypeptide par une cellule hôte et des éléments nécessaires à la régulation de cette expression.
Ces cassettes d'expression comprennent dans le sens de la transcription:
- un promoteur fonctionnel;
- un polynucléotide selon l'invention; et
- une séquence terminatrice.
Tout type de séquence promotrice peut être utilisée dans les cassettes d'expression selon l'invention. Le choix du promoteur dépendra notamment de l'organisme hôte choisi pour l'expression du gène d'intérêt. Certains promoteurs permettent une expression constitutive alors que d'autres promoteurs sont au contraire inductibles.
La présente invention concerne également des vecteurs de réplication ou d'expression comprenant au moins un polynucléotide ou une cassette d'expression telle que décrit précédemment. Ce vecteur peut notamment être constitué par un plasmide, un cosmide, un bactériophage ou un virus dans lequel est inséré un polynucléotide ou une cassette d'expression selon l'invention. Les techniques de construction de ces vecteurs et d'insertion d'un polynucléotide de l'invention dans ces vecteurs sont bien connues de l'homme du métier.
Les techniques de construction de vecteurs, de transformation d'organismes hôtes et d'expression de protéines hétérologues dans ces organismes sont décrites dans la littérature (Ausubel F. M. et al., "Current Protocols in Molecular Biology" Volumes 1 et 2, Greene Publishing Associates et Wiley -Interscience, 1989; T.Maniatis, E.F.Fritsch, J.Sambrook, Molecular Cloning: A laboratory Handbook, 1982).
Molécules inhibiteurs La présente invention concerne également une molécule inhibant l'expression ou l'action du polypeptide DPY19L2 selon l'invention chez un sujet de sexe masculin de type sauvage. Cette molécule représente un moyen de contraception du sujet de sexe masculin. En effet, les spermatozoïdes sont dépourvus d'acosome ou présentent un acrosome non fonctionnel sous l'effet du traitement par la molécule inhibitrice. Cela résulte de l'action directe de la molécule sur le gène DPY19L2, l'ARNm issu de la transcription du gène DPY19L2 ou la protéine DPY19L2. La molécule selon l'invention peut en effet agir pour bloquer la transcription ou la traduction du gène DPY19L2. Elle peut alternativement bloquer l'action de la protéine conduisant ainsi soit à un acrosome complètement absent, soit un acrosome atrophié et mal placé sur le spermatozoïde.
Dans un mode de réal isation de la présente invention , il s'agit d'une acide nucléique interférant de type ADN ou ARN, anti-DPY19L2 inhibant sélectivement l'expression du polypeptide DPY1 9L2 chez un sujet de sexe masculin de type sauvage. Il peut notamment s'agir de siARN ou de shARN.
L'invention concerne également une molécule selon l'invention pour son util isation en tant que moyen contraceptif chez un sujet de sexe mascu l in de type sauvage . Enfin , l'invention concerne l 'util isation de la molécule selon l'invention dans la préparation d'un médicament contraceptif chez un sujet de sexe masculin de type sauvage.
Support solide
Les polynucléotides et les polypeptides de la présente invention peuvent être immobilisés sur un support solide.
On con naît les supports solides adaptés à l'immobilisation de polynucléotides notamment pour la fabrication des puces à ADN . Il existe de nombreuses variétés de puces à ADN, qui se distinguent par le type de support utilisé, la nature, la densité et le mode de fixation ou de synthèse des séquences nucléotidiques sur le support, et les cond itions de lecture. Ces techniques sont connues de l'homme du métier. On entend également par support solide des supports de type microsphères.
Anticorps
La présente invention a également pour objet des anticorps, caractérisés en ce qu'ils sont dirigés contre l'un ou plusieurs des polypeptides DPY19L2 de la présente invention.
Selon un mode de réalisation de l'invention, lesdits anticorps sont sélectionnés parmi les anticorps monoclonaux et les anticorps polyclonaux.
Exemples
La globozoospermie est un phénotype rare d'infertilité masculine primaire totale caractérisée par la production de spermatozoïdes dépourvus d'acrosome (OMIM #102530).
Les inventeurs ont récemment démontré que la stratégie de cartographie des homozygoties en utilisant un criblage sur l'étendue du génome appliqués à des patients infertiles issus du même milieu ethnico- géograph ique conduisait à la local isation et à l'identification de gènes impliqués dans la spermatogénèse. Cette stratégie génétique a été appliquée à une cohorte de patients tunisiens présentant une globozoospermie totale. Les inventeurs ont démontré que 8 des 10 patients analysés présentaient une délétion homozygote pour DPY19L2.
Patients, matériel et méthode
Patients
Tous les sujets présentent des spermatozoïdes globozoospermiques (Figure 1 ). Toutes les analyses de sperme ont été réalisées au moins deux fois en accord avec les recommandations du World Health Organisation . Tous les sujets comportent un caryotype somatique normal. Les patients P 1 à P6 , P8 et P9 (Fig ure 2 et Figure 4) sont tunisiens traités à Tunis pour infertilité, nés de la même famille, par exemple cousins germains.
Le patient P7 est d'origine turque et réside en France. Il ne présente pas de consanguinité familiale.
Les patients P6 et P6f sont frères.
Analyses moléculaires
L'ADN génomique est extrait des leucocytes du sang périphérique en utilisant une procédure d'extraction sur chlorure de guanidium ou à partir de sal ive en util isant le kit Oragene DNA Self-Collection (DNAgenotech, Ottawa Canada).
Les amorces utilisées et les températures d'hybridation sont indiquées dans le tableau 1 ci-après :
a) 3OPY19L2 F: CCCTCAAGCAATTCTCTTTG 288 60
(SEQ ID No 3)
R: GATTTGATTTGGGGCCTAA
(SEQ ID No 4)
b) 3OPY19L2 F: GATTAAAGTTCTGGGGTGAG 444 60
(SEQ ID No 5)
R: GCAGCCTATTACTTCCGATA
(SEQ ID No 6)
c) exon 22 F: GTGTCTGTTATTAAAGCTTGTG 313 57
(SEQ ID No 7)
R: ATTGTCTCTAGACAGCAATACAT
(SEQ ID No 8)
d) exon 11 F: AACCTCCTCAAGTGACTTAG 516 57
(SEQ ID No 9)
R : TTGGCCAAGAGTCATT
(SEQ ID No 10)
e) exon 1 F: GGCCAACTTCTTTCTACTCGGAC 504 65
(SEQ ID No 11)
R: GACCCAGCTCCACCATACTCCTT
(SEQ ID No 12)
f) 5OPY19L2 F : CTACTATTGTCTCAACCAAATATGT 610 58
(SEQ ID No 13)
R : GGAATTCAAGACTAGCCTAGAA
(SEQ ID No 14)
g) 5OPY19L2 F : GGCATGGAAGTTACCACAAGAA 750 65
(SEQ ID No 15)
R : GTTACACCACTGGCCGTCTC
(SEQ ID No 16)
h) DPY19L2 F : AAATCTAGACACAGTCACAGCATCATC 1450 60 point de (SEQ ID No 17)
cassure R : AGAGGCTTAATAGGTGAAAGAAAGAGA
(SEQ ID No 18)
35 cycles d'amplification PCR ont été réalisés en utilisant la Taq polymérase (Qiagène, Courtaboeuf, France). Le séquençage est réalisé en utilisant BigDye Terminator v3.1 (Applied Biosystems). Les électrophorèses sont réalisées sur ABI 3130XL (Applied Biosystems). Analyses de microarrav
Les microarrays 250K Sty1 SNP (Affymetrix, Inc., Santa Clara, CA) ont été appliqués sur les patients P1 -P9 selon les recommandations du fabricant. Les analyses ont été réalisées à NGBMC (Strasbourg). Microscopie électronique
Les spermatozoïdes ont été fixés avec du glutaraldéhyde à 2.5% dans 0.1 M de tampon cacodylate pH 7.4 pendant 2 heures à température ambiante. Les cellules ont ensuite été lavées avec du tampon, et post-fixées avec du tétroxyde d'osmium à 1 % dans le même tampon pendant 1 heure à 4°C. Après un lavage extensive avec de l'eau, les cellules ont été fixées avec de l'acétate d'uranile à 0,5% pH 4 pendant la nuit à 4°C. Les cellules sont ensuite déshydratées en utilisant un gradient d'alcool (30%-60%-90%-100%- 100%-100%) et infiltrées avec un mélange 1/1 epon/alcool 100% pendant une heure avant plusieurs lavages d'epon frais (Flukka) pendant 3 heures. Enfin, les cellules sont centrifugées et immergées dans de l'epon frais et polymérisées pendant 3 jours à 60°C. Des sections ultrafines des cellules sont réalisées en utilisant un ultra microtome (Leica). Les sections sont post-fixées avec de l'acétate d'uranile à 4% and du citrate de plomb à 1 % avant d'être observées au microscope électronique à 80 kV (JEOL 1200EX).
Résultats
Analyses phénotvpiques détaillées
Les 10 patients décrits ici présentent une globozoospermie totale avec 100% de spermatozoïdes à tête ronde et un taux de défauts flagellaires augmenté (40%). Tous les patients présentaient un volume de sperme normal (4.6ml). La concentration du sperme était normale chez 7 patients (52-126 Million/ml) et les patients P5, P7 and P8 avaient de sévères oligozoospermie comprises entre 0.02-1 .5 M/m l . La mobilité moyenne et morbidité des 7 premiers patients étaient de 27.5%, valeur supérieure à la moyenne. Le MAI, ou « Multiple anomalies index », était élevé avec une moyenne de 2.5. Des analyses additionnelles ont été réalisées sur le patient P1 . Un double marquage du noyau et de l'acrosome avec TOPRO-3 and des lectines de Pisum savitu m respectivement, montrent des noyaux parfaitement ronds (Figure 1 D, G), sans acrosome (marquage réalisé à la PSA-FITC, non montré - Figure 1 D) ou des foyers d'acrosome mal placés, à la périphérie du noyau (marquage réalisé à la PSA-FITC, non montré - Figure 1 G). La microscopie électronique à transmission a confirmé la présence de noyaux ronds (Figure 1 E, H). Les photographies montrent que le contour des spermatozoïdes ronds n'est pas lisse (Figure 1 F, I). La surface du sperme apparaît ridée par ce qui pourrait être une membrane plasmique trop peu tendue ou une membrane d'acrosome pratiquement vide. L'irrégularité de cette membrane externe peut être vue sur la photographie 1 H.
Localisation du gène candidat
Un criblage sur l'étendue du génome de 9 patients atteints a été réalisé en utilisant des puces à SNP Affimetrix (250K Sty1 SNP arrays). Des rég ions d'homozygotie communes ont été recherchées. 7 patients partageaient une région homozygote comprise entre 0.4 et 54 millions de nucléotides (MB) centrée en 1 2q 1 4.2. 4 gènes cand idats étaient présents dans la région d'homozygotie. L'étude in silico du profil d'expression de ces 4 gènes candidats a mis en évidence le fait que DPY19L2 est exprimé de façon prédominante dans les testicules.
Identification de la mutation
Les amorces c, d et e permettent de détecter la présence de la délétion homozygote du gène DPY19L2. La PCR chez les patients délétés est négative avec ces amorces. Les amorces a, f permettent de borner la délétion et servent de contrôle positif d'amplification chez les patients. Les amorces h permettent d'amplifier la délétion récurente retrouvée chez les patients globozoocéphales. Cette PCR est donc positive chez les hommes atteints et négative chez les hommes sains.
Par ailleurs, elles permettent de dépister les individus porteurs d'une délétion présente à l'état hétérozygote : PCR c,d,e positive et PCR h positive.
L'amplification PCR des exons DPY1 9L2 montrait que le gène était délété chez tous les patients sauf P7 et P8, le patient P7 étant le patient d'origine turque. La plus petite région d'homozygotie utilisée pour localiser (et identifier) le gène cand idat était celle du patient P7. De façon logique, le patient P6f, recruté à un stade ultérieur, présentait également une délétion homozygote du gène DPY19L2. Des amplifications subséquentes de chaque côté du gène ont permis de déterminer deux points de ruptures de 15 KB local isés de ch aq u e côté d e DPY19L2 (Figure 3). La délétion inclut approximativement une région de 200KB abritant seu lement l e gèn e DPY19L2.
La PCR avec les amorces f permet d'amplifier la région délétée chez les patients et donc de réaliser le diagnostique d'hétérozygotie et d'homozygotie.
L'amplification PCR de deux exons (1 and 1 1 ) a été réalisée sur
100 patients contrôles fertiles Nord africains. Aucun n'était homozygote délété pour DPY19L2. Par ailleurs, les données épidémiologiques présentées dans l e Ta b l e a u 2 c i-dessous (données publiques obtenues à partir de http://cnv.chop.edu/) montrent que la délétion décrite est présente à l'état hétérozygote dans les trois population étudiées. La fréquence de la délétion pourrait être particulièrement élevée chez les asiatiques.
Tableau 2 récapitulatif des amplifications au locus DPY19L2 en fonction du génotype des patients (voir Figures 2 et 4) :
Analyse par CGH (comparative genomic hybridation)
Une CGH sur Agilent 4x180K a été réalisée sur le patient P1 . L'analyse confirme la présence d'une délétion homozygote de DPY19L2 mais l'analyse ne permet pas de délimiter l'étendue de la délétion du à la rareté de sondes dans cette région particulière du microarray Agilent (Figure 5).
Discussion
Les données épidémiologiques sont présentées dans le Tableau 2 ci-dessous (données publiques obtenues à partir de http://cnv.chop.edu/ ) :
Nombre de Nombre Fréquence Fréquence sujets d' hétérozygotes d'hétérozygotes attendue d' homozygotes
Africains 693 2 1/ 347 1/ 481 636
Européens 1321 13 1/ 102 1/ 41 616
Asiatiques 12 1 1/ 12 1/ 576
TOTAL 2Ô26 Î6 1/ 127 1/ 64 516
La prévalence attendue chez les européens est de 1/41 616. Aucune information n'est disponible sur la fonction de DPY19L2. Chez l'être humain, les seules données disponibles proviennent d'analyse de bibliothèques cDNA qui indiquent que le transcrit DPY19L2 est principalement dans les testicules (données publiques obtenues à partir de http://www.cql.ucsf.edu/Research/qenentech/qenehub-qepis/qenehub-qepis- search.html.showinq).
D'après sa séquence on prédit que DPY19L2 est une protéine membranaire car elle contient 11 domaines transmembranaires.
Références
Xu, M., Xiao, J., Chen, J., Li, J., Yin L, Zhu, H., Zhou, Z., Sha, J. (2003) Identification and charactehzation of a novel human testis-specific Golgi protein, NYD-SP12. Mol Hum Reprod. 2003 Jan;9(1 ):9-17.
Dam, A.H., Koscinski, I., Kremer, J.A., Moutou, C, Jaeger, A.S., Oudakker, A.R., Tournaye, H., Charlet, N., Lagier-Tourenne, C, van Bokhoven, H. and Viville, S. (2007) Homozygous mutation in SPATA16 is associated with male infertility in human globozoospermia. Am J Hum Genet, 81 , 813-820.
Dieterich, K., Soto Rifo, R., Faure, A.K., Hennebicq, S., Ben Amar, B., Zahi, M., Perrin, J., Martinez, D., Sele, B., Jouk, P.S., Ohlmann, T., Rousseaux, S., Lunardi, J. and Ray, P. F. (2007) Homozygous mutation of AURKC yields large-headed polyploid spermatozoa and causes male infertility. Nat Genet, 39, 661 -665.
Honigberg L., Kenyon C. Establishment of left/right asymmetry in neuroblast migration by UNC-40/DCC, UNC-73/Trio and DPY-19 proteins in C. elegans. Development 2000;127(21 ):4655-68.
Carson A.R., Cheung J., Scherer S.W. Duplication and relocation of the functional DPY19L2 gene within low copy repeats. BMC Genomics 2006;7:45.

Claims

REVENDICATIONS
1 . Procédé de diagnostic d'une infertilité chez un sujet humain du sexe masculin, ledit procédé comprenant une étape consistant à détecter, dans un échantillon biologique dudit sujet, la présence ou l'absence d'un polynucléotide se trouvant sur le chromosome 1 2, entre le nucléotide 63,952,693 et le nucléotide 64,062,354, du numéro d'accession NCBI : NC_000012.1 1 .
2. Procédé selon la revendication 1 , caractérisé en ce qu'on détecte la délétion homozygote dudit polynucléotide.
3. Procédé selon la revendication 1 , caractérisé en ce qu'on détecte la délétion hétérozygote dudit polynucléotide.
4. Procédé selon l'une quelconque des revendications 1 à 3, caractérisé en ce que ledit polynucléotide est le gène DPY19L2.
5. Procédé de diagnostic d'une infertilité chez un sujet humain de sexe masculin, caractérisé en ce que, dans un échantillon biologique dudit sujet, on ne détecte aucune séquence nucléotidique identique à SEQ ID NO : 2 ou on détecte une séquence nucléotidique différant de SEQ ID NO : 2, mais présentant au moins 95% d'identité avec SEQ ID NO : 2.
6. Procédé selon la revendication 5, caractérisé en ce que la séquence nucléotidique différant de SEQ ID NO : 2, mais présentant au moins 95% d'identité avec SEQ ID NO : 2, ne code pas pour la protéine DPY19L2.
7. Procédé selon l'une quelconque des revendications 1 à 6, caractérisé en ce qu'on effectue une ampl ification préalable au moyen d'amorces choisies parmi les couples SEQ ID NOS : 3 et 4, SEQ ID NOS : 5 et 6, SEQ ID NOS : 7 et 8, SEQ ID NOS : 9 et 10, SEQ ID NOS : 1 1 et 1 2, SEQ ID NOS : 13 et 14, SEQ ID NOS : 15 et 16 et SEQ ID NOS : 17 et 18.
8. Procédé selon la revendication 7, caractérisé en ce qu'une amplification négative avec au moins l'un des couples SEQ ID NOS : 7 et 8, SEQ ID NOS : 9 et 1 0, SEQ ID NOS : 1 1 et 12, de préférence avec les trois couples, est caractéristique d'une absence homozygote du gène DPY19L2.
9. Procédé selon la revendication 7, caractérisé en ce qu'une amplification positive avec au moins l'un des couples SEQ ID NOS : 7 et 8, SEQ ID NOS : 9 et 10, SEQ ID NOS : 1 1 et 1 2, de préférence les trois couples, et une amplification positive avec le couple SEQ ID NOS : 1 7 et 1 8 est caractéristique d'une absence hétérozygote du gène DPY19L2.
10. Procédé selon l'une quelconque des revendications 1 à 9, caractérisé en ce que l'échantillon biologique est choisi parmi les leucocytes du sang périphérique et la salive.
1 1 . Vecteur comprenant un polynucléotide codant pour un polypeptide DPY19L2 comprenant un polypeptide comportant une fonction dans la formation de l 'acrosome d u spermatozoïde et u ne séq uence présentant au moins 80% d'identité avec SEQ ID No. 1 ou un polypeptide de SEQ ID NO : 1 , et/ou une cassette d'expression comprenant dans le sens de la transcription, un promoteur fonctionnel, un polynucléotide codant pour ledit polypeptide DPY19L2 et une séquence terminatrice, pour son utilisation pour traiter un sujet de sexe masculin présentant une infertilité liée à DPY19L2.
12. Molécule inhibant l'expression ou l'action d'un polypeptide DPY19L2 comprenant ou consistant en un polypeptide comportant une fonction dans la formation de l'acrosome du spermatozoïde et une séquence présentant au moins 80% d'identité avec SEQ ID No. 1 , chez un sujet de sexe masculin de type sauvage, ladite molécule consistant en un acide nucléique interférant de type ADN ou ARN, anti-DPY19L2.
13. Molécule selon la revendication 12, caractérisée en ce que le polypeptide a la séquence SEQ ID No. 1 .
14. Molécule selon la revendication 12 ou 13, pour son utilisation en tant que moyen contraceptif chez un sujet de sexe mascul in de type sauvage.
15. Support sol ide de type puce, sur lequel se trouve fixé un polypeptide DPY19L2 comprenant ou con s ista nt en un polypeptide comportant une fonction dans la formation de l'acrosome du spermatozoïde et une séquence présentant au moins 80% d'identité avec SEQ ID No. 1 , ou un polynucléotide codant pour un tel polypeptide.
16. Anticorps spécifique du polypeptide DPY19L2 comprenant ou consistant en un polypeptide comportant une fonction dans la formation de l'acrosome du spermatozoïde et une séquence présentant au moins 80% d'identité avec SEQ ID No. 1 .
17. Polypeptide DPY1 9L2 comprenant ou consista nt en un polypeptide comportant une fonction dans la formation de l'acrosome du spermatozoïde et une séquence présentant au moins 80% d'identité avec SEQ ID No. 1 , pour son utilisation chez un sujet humain de sexe masculin en vue de restaurer une spermatogénèse fonctionnelle.
EP10792991A 2009-11-12 2010-11-10 Contrôle de la fertilité humaine via dpy19l2 Withdrawn EP2499497A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0957963A FR2952373B1 (fr) 2009-11-12 2009-11-12 Controle de la fertilite humaine via dpy19l2
PCT/FR2010/052416 WO2011058280A1 (fr) 2009-11-12 2010-11-10 Contrôle de la fertilité humaine via dpy19l2

Publications (1)

Publication Number Publication Date
EP2499497A1 true EP2499497A1 (fr) 2012-09-19

Family

ID=42315829

Family Applications (1)

Application Number Title Priority Date Filing Date
EP10792991A Withdrawn EP2499497A1 (fr) 2009-11-12 2010-11-10 Contrôle de la fertilité humaine via dpy19l2

Country Status (4)

Country Link
US (1) US20120283126A1 (fr)
EP (1) EP2499497A1 (fr)
FR (1) FR2952373B1 (fr)
WO (1) WO2011058280A1 (fr)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3850112A1 (fr) 2018-09-11 2021-07-21 Università degli Studi di Foggia Procédé d'identification de la prédisposition à l'infertilité masculine basé sur des polymorphismes du gène du récepteur de la vitamine d

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2007233263A1 (en) * 2006-02-17 2007-10-11 Genentech, Inc. Gene disruptons, compositions and methods relating thereto
FR2918075A1 (fr) * 2007-06-29 2009-01-02 Centre Nat Rech Scient Controle de la fertilite d'un etre humain de sexe masculin via spata16

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2011058280A1 *

Also Published As

Publication number Publication date
US20120283126A1 (en) 2012-11-08
FR2952373A1 (fr) 2011-05-13
FR2952373B1 (fr) 2013-05-17
WO2011058280A1 (fr) 2011-05-19

Similar Documents

Publication Publication Date Title
JP6628226B2 (ja) 痛風発症素因の評価方法
JP6521928B2 (ja) ヒト非小細胞肺癌における転座及び変異体ｒｏｓキナーゼ
US7879544B2 (en) Methods of identifying adipocyte specific genes, the genes identified, and their uses
JPWO2015108180A6 (ja) 痛風発症関連分子、並びに、尿酸関連疾患素因及び炎症関連疾患素因の評価方法及び評価キット、検査体及び薬
FR2892730A1 (fr) Methode pour detecter la presence ou le risque de developper un cancer
US20030065157A1 (en) Genes expressed in lung cancer
US20180066322A1 (en) Biomarkers associated with cdk inhibitors
EP2847356A2 (fr) Compositions et procédés pour la modulation de l'activité d'un support mitochondrial du pyruvate
FR2918075A1 (fr) Controle de la fertilite d'un etre humain de sexe masculin via spata16
WO2008058399A1 (fr) Procédés pour le diagnostic, le pronostic ou le traitement de la migraine et de troubles associés
EP2499497A1 (fr) Contrôle de la fertilité humaine via dpy19l2
FR2759701A1 (fr) Utilisation des proteines ulip dans le diagnostic et la therapie des cancers et des syndromes neurologiques paraneoplasiques
EP2635705B1 (fr) Méthode de dépistage du cancer colorectal
CA2398083C (fr) Gene nphs2 implique dans le syndrome nephrotique cortico-resistant, proteine codee par ce gene et utilisations diagnostiques et therapeutiques
EP1453861A2 (fr) Polynucleotide et proteine impliques dans la synaptogenese, variants de ceux-ci et leurs applications therapeutiques et diagnostiques
EP1712643B9 (fr) Prévention des toxicités dues au 5-fluorouracile
KR20140044329A (ko) Kiaa1456 발현의 결장암 환자 생존에 대한 예측
WO2003006687A2 (fr) Nouveaux genes cibles concernant des maladies cardiaques
FR2804690A1 (fr) Nouvelles famille de proteines, denommees atip, les sequences nucleiques codant pour lesdites proteines et leurs applications
US9079938B2 (en) ASPP2 splicing variant
EP2823067B1 (fr) Utilisation de rbm39 comme biomarqueur
US20030190736A1 (en) Human GAK-related gene variants associated with lung cancer
Class et al. Patent application title: Marker of Prostate Cancer Inventors: Karina Dalsgaard Sorensen (Arhus C, DK) Torben Falck Orntoft (Silkeborg, DK) Torben Falck Orntoft (Silkeborg, DK) Lars Dyrskjot Andersen (Odder, DK) Assignees: REGION MIDTJYLLAND Aarhus Universitet
WO2005017109A2 (fr) Acides nucleiques et polypeptides necessaires a la survie des cellules en l'absence de rb
JP2003334076A (ja) Ｓ−ｉｉタンパク質、ｆｅｓｔａタンパク質、および、それらの利用

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20120509

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

DAX Request for extension of the european patent (deleted)
17Q First examination report despatched

Effective date: 20130515

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20131126