EP2227544A1 - Bakteriophagen und beschichtungsmaterial für oberflächen - Google Patents

Bakteriophagen und beschichtungsmaterial für oberflächen

Info

Publication number
EP2227544A1
EP2227544A1 EP08852931A EP08852931A EP2227544A1 EP 2227544 A1 EP2227544 A1 EP 2227544A1 EP 08852931 A EP08852931 A EP 08852931A EP 08852931 A EP08852931 A EP 08852931A EP 2227544 A1 EP2227544 A1 EP 2227544A1
Authority
EP
European Patent Office
Prior art keywords
fused
peptide
phage
composition according
additional peptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP08852931A
Other languages
English (en)
French (fr)
Inventor
Stefanie Eiden
Axel Eble
Bastian Budde
Sascha Plug
Peter Krüger
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bayer AG
Covestro Deutschland AG
Original Assignee
Bayer Technology Services GmbH
Bayer MaterialScience AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bayer Technology Services GmbH, Bayer MaterialScience AG filed Critical Bayer Technology Services GmbH
Publication of EP2227544A1 publication Critical patent/EP2227544A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries
    • C12N15/1037—Screening libraries presented on the surface of microorganisms, e.g. phage display, E. coli display
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
    • C09D—COATING COMPOSITIONS, e.g. PAINTS, VARNISHES OR LACQUERS; FILLING PASTES; CHEMICAL PAINT OR INK REMOVERS; INKS; CORRECTING FLUIDS; WOODSTAINS; PASTES OR SOLIDS FOR COLOURING OR PRINTING; USE OF MATERIALS THEREFOR
    • C09D5/00—Coating compositions, e.g. paints, varnishes or lacquers, characterised by their physical nature or the effects produced; Filling pastes
    • C09D5/002—Priming paints
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2795/00—Bacteriophages
    • C12N2795/00011—Details
    • C12N2795/00022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes

Definitions

  • the present invention relates to a composition comprising bacteriophages and surface coating material.
  • the present invention further relates to a surface coated with the composition and to the use of the surface coating composition
  • Selective self-assembling adhesion promoters have the advantage of ensuring the adhesion of the paint and adhesive layers to metallic surfaces for very long lifetimes, as is required, for example, in the automotive industry for further improvement of the corrosion protection. They furthermore permit uniform adhesion of a uniform lacquer layer on the increasingly used composite materials with different surfaces such as plastic-metal composites.
  • the selective self-orga- nation of the biological bonding agent on different surfaces eme selective coating in simple work processes possible what new applications of composite materials allows and outlook in the electronics industry a simplified and provides a precise method of manufacturing circuits on semiconductors
  • WO2004 / 035612 mentions the principal possibility of binding drugs to the substrate by this method, but exclusively describes the identification of the polymer-specific phage by so-called biopanning and binding of the phage to the polymer substrate. Further binding to another substance, such as a coating material, is not a biological binding partner of the phage used, is not further described, which binding would also have to be selective and would require close matching of the ligand to the further binding component.
  • the object of the present invention is to provide a composition comprising bacteriophages and coating material for surfaces, which improves the adhesion of the coating material to surfaces to be coated.
  • composition comprising bacteriophages and coating material for surfaces, in which a first additional peptide is fused to proteins of the bacteriophage and, furthermore, a second additional peptide is fused to proteins of the bacteriophage.
  • Coating material for surfaces means a layer of any material that is used as a cover, protection, decoration or finish.
  • proteins of the bacteriophage refer to gene products of the phage genome which, for example, build up the envelope of the bacteriophage.
  • a first additional peptide is a peptide which is not contained in the natural form of the phage but is presented, for example, by means of molecular genetic manipulations of the phage genome on the phage.
  • the peptide is fused to bacteriophage proteins, meaning that it is either N-terminal or C-terminal via a peptide bond to the protein.
  • the first additional peptide has the property that it can bond to the coating material or to the surface to be coated.
  • the type of bond can be, for example, a covalent bond, an electrostatic interaction via charged or partially charged functional groups or a hydrogen bond.
  • the second additional peptide is also a peptide which is not contained on the natural form of the phage, but for example by means of molecular genetic manipulations of the Phage genome is presented on the phage.
  • the peptide is fused to bacteriophage proteins, meaning that it is either N-terminal or C-terminal via a peptide bond to the protein.
  • This peptide also has the property that it can bond to the coating material or to the surface to be coated.
  • the type of bond may be, for example, a covalent bond, an electrostatic interaction via charged or partially charged functional groups or a hydrogen bond.
  • the first additional peptide and / or the second additional peptide independently of one another have a length of> 4 amino acids to ⁇ 100 amino acids, preferably> 5 amino acids to ⁇ 50 amino acids, more preferably> 6 amino acids to ⁇ 20 amino acids .
  • the peptides can be linear but also loop-shaped. Peptides with such a number of amino acids can be well fused to the phage proteins by current molecular biology methods and are suitable for adhering to surfaces. Examples of such peptides are 7 amino acid linear peptides, 12 amino acid linear peptides, or 7 amino acid loop peptides, which are framed by a disulphide bridge between two cysteine residues.
  • the amino acid sequence of the first additional peptide and / or the second additional peptide was determined by panning a combinatorial phage population on a substrate surface.
  • a phage display library For the evolutionary selection of some phage species from a large combinatorial phage population ("phage display library") on a substrate, a phage display library is typically exposed to a substrate in a buffered aqueous environment so that binding of some phage can take place and weakly binding phage are washed off using an aqueous wash buffer, and after-washing binding and therefore specific phages are subsequently eluted (eluted) using another aqueous buffer, called elution buffer hereinafter. This entire procedure is called panning.
  • the eluted phages are propagated and re-exposed to the substrate in further rounds of panning until a population of well-binding phage accumulates.
  • This technique can be found in Sarikaya et al., Nature Materials, 2003, 2, 577-585; O'Neil and Hoess, Current Opinion in Structural Biology, 1995, 5, 443-449; Smith and Scott, Methods in Enzymology 1993, 217, 228-257; Sambrook and Russell (eds), 2001, Molecular cloning: A laboratory manual (third edition), CoId Spring Harbor Press, page 18.115 to 18.122.
  • the amino acid sequence itself, which is responsible for the binding can be determined by genetic engineering or molecular biology methods.
  • Selection of phage species from a combinatorial phage population may involve the following steps:
  • a phage display library is exposed to a substrate in a buffered aqueous environment
  • washing of the substrate can take place with energy input by means of ultrasound.
  • the detachment of the phages by means of ultrasound allows the selection and detection of the particularly well-binding phages.
  • the presence of phages is qualitatively determined, for example by means of a plaque assay spot test.
  • the material of the substrate surface is selected from the group comprising polymers, preferably polyethylene, polypropylene, polyurethane, polystyrene and / or polyurea; Semiconductors and metals, preferably steel, iron, aluminum and / or zinc.
  • M13 phage display libraries which contain a randomized peptide as a GPEU fusion protein, in particular as a linear peptide with a length of 7 amino acids, as a linear peptide with a length of 12 amino acids, or as a loop-like peptide with 7 amino acids, which are framed by a disulfide bridge between two cysteine residues.
  • a combinatorial phage display library constructed by targeted genetic engineering that has a randomized peptide as a gplU fusion protein that has a length other than 7 or 12 amino acids.
  • a combinatorial phage display library can be created that contains randomized peptides fused to the gpVIU protein of the M13 bacteriophage.
  • the elution conditions are also adapted to the respective substrate in order to completely dissolve the well-binding phages from the surface.
  • the elution can be carried out in a gentle manner by adding an aqueous elution buffer to obtain intact phages.
  • pH of the elution buffer usually pH 2 to pH 11.5, wherein the pH of the wash buffer is closer to pH 7 than the pH of the elution buffer, and preferably at least two elution cycles are performed with different elution buffers.
  • Type and concentration of the elution buffer substance such as alkali phosphates (usually in concentrations of 0.005 to 1.5 mol / L), T ⁇ s-HCl (0.005 to 1.5 mol / L), glycine-HCl (0.05 to 0.2 mol / L) or T ⁇ ethylamm (0.05 to 0.2 mol / L)
  • salts in particular alkali or alkaline earth halides, sulfates, carbonates, phosphates or nitrates, are preferred
  • Natnumchlo ⁇ d usually in concentrations of 5 to 500 mmol / L, preferably 25 to 250 mmol / L, particularly preferably 50 to 200 mmol / L
  • Presence, type and concentration of detergents preferably Tween®-20, sodium dodecyl sulfate (SDS), or T ⁇ ton X-100, usually in concentrations of 0.01 to 1% by weight, preferably 0.05 to 0.5% by weight
  • Amount of elution buffer usually from 1 to 10 mL, temperature of the elution buffer usually 4 0 C-55 0 C, preferably from 15 to 40 0 C, duration of elution expediently at least 5 s,
  • Successive elutions may be made with the same or different conditions, as well as the number of these elutions adjusted (eg, elution with 0.1 mol / l glycine pH 2.0 followed by neutralization with 1 mol / l T ⁇ s-HCl pH 8, followed by a second elution with 0.1 mol / l of Tnethylamine pH 11.5 followed by neutralization with 1 mol / l of T ⁇ s-HCl pH 7.5)
  • the eluted phages are propagated and in turn exposed to the substrate or the particle. If further rounds are carried out, preferably under more extensive washing conditions, a population of specifically binding phages characterized by that they present a short peptide to their proteins that are responsible for the binding.
  • the sequence of this peptide chain can be determined by sequencing the phage DNA. This DNA sequence can be used to genetically engineer other phage to present binding peptides as fusion proteins. In this way, bifunctional phages which specifically bind to the particle with one of the peptides and with the other peptide specifically to the substrate are particularly preferably produced.
  • the bacteriophages are of the M13 type. These phages are readily changeable and readily available and readily replicable in culture. They have, for example, the proteins gpi ⁇ , gpV, gpVI, gpVII, gpV ⁇ I and gpEX as gene products. It is possible that the first additional peptide is fused to the protein gpHI or gpVHI and the second additional peptide is fused to the protein gpIH or gpVIH. The extension of these proteins with additional peptides, ie, the fusion, is well feasible on these proteins.
  • the protein gpVÜI is fused N-terminally with a peptide of the sequence STTRLR.
  • the protein gpi ⁇ can also be fused N-terminally with a peptide of the sequence ADKSAHVSLISR, resulting in a bifunctional phage.
  • the former sequence enables the phage to bind to polyurethane surfaces.
  • the latter sequence enables binding to steel surfaces.
  • a system according to the present invention may be constructed with respect to the phage such that on a panning-preselected type M13 phage with a first additional peptide already fused to gpi ⁇ , which mediates binding properties to one surface, to the gpV ⁇ i protein of the same phage clone additional peptide is fused, wherein the gpi ⁇ and gpVHI fused peptides may be the same or different.
  • a system according to the present invention is conceivable in which a second additional peptide which binds to a surface is fused to an Mp3-type phage clone pre-selected by panning with a first additional peptide already fused to gpIH to the gpVÜI protein of the same phage clone whereby the peptides fused to gpITJ and gpVi ⁇ may be the same or different.
  • Such phages can be represented by a method comprising the following steps:
  • Restriction sites are introduced into the gpVHI challenge sequence by performing site-directed mutagenesis on the gpVTJI pro-coat gene located on a plasmid (preferably pUC) between two suitable restriction sites (preferably PagI and KpnI), b
  • the mutations from step a) are transferred by recloning from the plasmid into the replicative form (RF) of the M13 genome, preferably in the form of the Ml 3KE vector,
  • the replicative form of the phage DNA is cut open with those restriction enzymes whose interfaces have been introduced by the mutations of step a), and then serves to accommodate suitable complementary oligonucleotides having at the ends the corresponding overhang for the emulation into the open
  • Binding property whereby the peptides fused to gpIH and gpVHI can be the same or different, so that multiple binding properties can be achieved.
  • restriction enzyme cleavage sites m are the corresponding ones
  • the mutations are first on another plasmid, preferably pUC, the gpVLH Procoatgen between two suitable
  • the inserted restriction sites may be selected from the group comprising
  • These mutations are then transferred by recloning from the plasmid into the replicative form (RF) of the M13 genome, preferably in the form of the Ml 3KE vector (New England Biolabs).
  • the vector is cut open with suitable restriction enzymes, preferably PagI and KpnI, and the resulting fragment is ligated into the similarly cut MlKE vector.
  • suitable restriction enzymes preferably PagI and KpnI
  • the replicative form of the phage DNA can usually be cut open with the two restriction enzymes NcoI and PstI and then serves to accommodate suitable complementary oligonucleotides having at the ends the corresponding overhang for unification into the open Show restriction sites and which encode an interfering peptide sequence.
  • the information for this adhesion-promoting peptide sequence may be from the panning procedure of the gpEU phage display library on a suitable substrate.
  • library oligonucleotides may also be ligated into the appropriately cut M13 genome. These are usually two complementary oligonucleotides, which at the ends show the corresponding overhang for the integration into the open restriction sites. In addition, they have a range of usually 15 bases, which are freely variable. Ligation of the hybridized oligonucleotides into the cut RF DNA and transformation into appropriate host bacteria results in a randomized gpVHI phage library. The phage can then be selected by the panning procedures already described on substrate surfaces.
  • the coating material for surfaces selected from the group comprising adhesion promoter, primer, paint and / or adhesive.
  • Adhesion promoters are bifunctional, low molecular weight compounds whose one functionality is the Adhesion on the surface to be coated or glued causes, while the other functionality is responsible for anchoring in the paint or adhesive layer.
  • Common adhesion promoters used are organosiloxanes or organosilanes which, for example, promote adhesion to glass surfaces, but also to metal surfaces.
  • Another type of coupling agent is represented by derivatives of complexing agents. The complexing group increases adhesion to a metallic surface, while a functional group leads to anchorage in the paint or adhesive layer. Derivatives of hydroquinoline thus increase the adhesion to aluminum surfaces, derivatives of gallic acid the adhesion to steel surfaces.
  • Primers are, for example, polymer-bound, thin layers on the structural part to be coated or bonded, which are similar to the adhesive or paint raw material and others
  • Components for example, for corrosion protection or for improved adhesion included.
  • Primerosion For example, monuron-accelerated epoxy resins are known here as a corrosion-inhibiting primer layer.
  • primer layers may be a pretreatment to protect the surface (plasma treatment of
  • Paints are coating materials that are applied to objects and at least partially form a coherent film.
  • Components of a paint may be: film-forming resin, hardeners, solvents, water, additives, pigments, defoamers, light stabilizers, optical brighteners, corrosion inhibitors, antioxidants, algicides, plasticizers, flow control agents and wetting agents.
  • film-forming resins known in the art of coating technology polymeric compounds such as polyesters, polyethers, polyurethanes, polyacrylates and / or polyureas can be used, which lead after application to a surface to a closed paint film.
  • Such groups may be free or reversibly blocked hydroxy, thio, amino, epoxy and / or isocyanate groups.
  • reversibly blocked isocyanate groups are those which are blocked with acetone oxime, butanone oxime, ⁇ -caprolactam, 3,5-dimethylpyrazole, dimethyl malonate or phenol.
  • the blocking reagent separates only at higher temperatures, whereby the isocyanate group is released. This results in a higher temperature stability.
  • the film-forming resin is a mixture of OH- and / or NH-functional binders, preferably polyols and / or polyamines and hardeners, preferably polyisocyanates, blocked polyisocyanates, and / or epoxy resins. Both the resins and the hardeners can be present both in solvent-free form and in the form of a solution in organic solvents or an aqueous dispersion.
  • the molar ratio of the functional groups of resin and optionally blocked curing agent available for crosslinking is preferably 1,5 1.5 to ⁇ 2.
  • Another object of the present invention is a surface coated with a composition of the present invention.
  • the material of the surface is selected from the group comprising polymers, polyethylene, polypropylene, polyurethane, polystyrene, polyurea, semiconductors, metals, steel, iron, aluminum and / or zinc.
  • a further subject of the present invention is the use of the composition according to the invention for coating surfaces.
  • Example 1 Panning of a combinatorial phage display library (Ph.D.-12 TM, New England Biolabs) on a polyurethane substrate.
  • Polyurethane substrate was prepared by mixing equivalent amounts of Desmophen® 670 BA and Desmodur® N3300 (Bayer Matenal Science AG), the curing was carried out for 16 h at room temperature 20 mg of the substrate were 10 mm in T ⁇ s-Buffered Salme (TBS, consisting of 50 mmol / 1 T ⁇ s-HCl pH 7.5, 150 mmol / 1 NaCl) and incubated for 60 min with 4 ⁇ 10 10 pfu (10 ⁇ l of the onginal library) in 1 ml TBS at room temperature The substrate was incubated ten times with 10 ml TBST (TBS plus 0.1% by volume Tween-20) (by short vortexing, 5 minute rotation plus 5 s ultrasonic bath) The first elution was carried out in acid by immersing the substrate in 1 ml of 0.1 mol / l glycine pH 2.5 for 10 s with subsequent neutralization of the substrate in 1 ml of 0.1 mol / l
  • the first elution solution was neutralized by adding 200 .mu.l of 1 mol / l T ⁇ s-HCl pH 8.
  • the second elution was carried out in the basic by immersing the substrate in 1 ml of 0.1 mol / l Tnethylamin pH 11.5 for 1 mm with subsequent neutralization of the substrate in 1 ml of 0.1 mol / l T ⁇ s-HCl pH 7.5 for 1 min.
  • the second elution solution was neutralized by addition of 200 ⁇ l of 1 mol / l T ⁇ s-HCl pH 7.5.
  • the substrate was subsequently stored in TBST to observe temporal clearance effects of non-eluted phages
  • the elution fractions (elution 1 and 2 and the two Neutralisationslosungen) were combined and amphfiziert For this purpose, 10 ml LB-Tet medium with 100 .mu.l overnight culture ER2738 (m LB-Tet) and the combined elution fractions were inoculated and 4.5 h at 37 ° C. shaken The culture was centrifuged 10 mm at 4500 xg and 4 0 C, and the supernatant then centrifuged again. The upper 4/5 vol. of the supernatant were diluted 1/5 vol.
  • PEG / NaCl (20% (w / v) polyethylene glycol-8000, 2.5 mol / 1 NaCl) and incubated at 4 0 C for 1 h.
  • the phages were spun down for 20 min at 16,000 xg and 4 0 C and resuspended in 1 ml of TBS (50 mM Tris-HCl pH 7.5, 150 mM NaCl). The solution is centrifuged for 5 min at 10,000 xg and 4 0 C, the supernatant with 200 ul PEG / NaCl and incubated for 60 min on ice.
  • the phages were xg for 10 min at 14,000 and centrifuged 4 0 C and resuspended in 200 ul TBS.
  • the titer of the phage solution was determined by a plaque assay.
  • 10 ml LB-Tet medium were inoculated with a single colony ER2738 and shaken up to an OD 6 oo of 0.4 at 37 0 C. 400 ⁇ l of this are pipetted into 3 ml molten LB agar top, mixed with 10 ⁇ l of a suitable dilution of the phage solution and spread on an LB-IPTG / X-gal plate. After curing, the plate was incubated overnight at 37 ° C. By the number of blue plaques, the titre of the phage solution (in pfu / ml) was calculated.
  • polyurethane-binding phage clones whose identity could be determined by sequencing the variable region of their genome, have accumulated in the resulting population.
  • individual phage clones eg from the LB-IPTG / X-gal plate of the titration of the eluate of the third round, were picked with a loop and separately amplified: 2 ml of LB-Tet medium were incubated with 100 ⁇ l of an overnight culture ER2738 (in LB). Tet) and the phage clone and shaken at 37 0 C for 4.5 h.
  • the culture was centrifuged for 10 min at 4500 xg and 4 0 C, and then the supernatant centrifuged again.
  • 1 ml of the phage solution was mixed with 500 ul PEG / NaCl solution and incubated at 4 0 C for 2 h.
  • the phages were 15 min at 14,000 xg and 4 0 C and centrifuged in 100 ul of 10 mM Tris-HCl pH 8.0, 1 mM EDTA, 4 M NaI resuspended.
  • the DNA was ethanol precipitated by 250 ul xg 10 min and 15 min at 14000 and 20 0 C by centrifugation.
  • the pellet was washed with 70% ethanol, 1 min at 14,000 xg and 20 0 C centrifuged, dried and resuspended in 30 ul 10 mM Tris-HCl pH 8.0 resuspended.
  • the sequencing of the DNA was carried out with the primer 5'-CCCTCATAGTTAGCGTAACG-3 ', whereby the anticodon strand of the M 13 DNA is obtained.
  • Example 2 Preparation of a combinatorial gpVTII phage display library
  • a PCR reaction is first carried out with both extension primers, which is used to create the library.
  • the library is then digested with Ncol and PstI and inserted into an NcoI and PstI-tagged M13KE vector in the appropriate restriction sites.
  • restriction sites are first introduced into the corresponding position of the genome of M 13KE.
  • the mutations are first introduced on another plasmid (pUC), which contains the gpVTfl pro-coat gene between the restriction sites PagI and KpnI (pUC-gp8).
  • pUC plasmid
  • the introduction of the new restriction sites into the gpVUI projecting sequence is by site-directed mutagenesis (eg Sambrook and Russell (Eds.), 2001, Molecular cloning: A laboratory manual (third edition), ColD Spring Harbor Press, pp. 8.42 to 8.45) using the following oligonucleotides:
  • M13KE-gp8mut After importing the cleavage sites into the genome of M13KE (M13KE-gp8mut), its RF DNA is cut open with the two restriction enzymes Ncol and PstI and the analogously cut Bibhotheks oligonucleotide is ligated into this vector
  • Each ligation product is different in the 6 NNN positions and therefore encodes other amino acids at these 6 positions.
  • the ligation approaches represent the combinatorial gpVHI library and can be used directly for panning on a substrate analogous to a commercial gpHI phage display library
  • Example 3 Preparation of a bifunctional bacteriophage which has a gpIII fused. 12 amino acid long, specifically binding to steel peptide and a fused to gpVTII. 6 amino acids long, specifically binding to polyurethane peptide
  • the rephkative form of PUROI-I was first cut with the restriction enzymes PagI and KpnI.
  • the insert containing the gpVHI gene with fused polyurethane-binding peptide was inserted into the rephkative form of also cut with PagI and KpnI StIO 1-13 ligated
  • bifunctional phages were generated which present different adhesion promoting peptide sequences on their gpUI and their gpVDI proteins pictures:
  • Figure 1 Plaque assay of panning fractions (round 1), undiluted on an LB-agar top stained with E. coli ER2738 on an LB-IPTG / X-gal plate
  • Wl-10 wash fractions 1-10 (use of ultrasound);
  • TBST Storage of the piece of substrate after panning in TBST.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biophysics (AREA)
  • Virology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Materials Engineering (AREA)
  • Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Die vorliegende Erfindung betrifft eine Zusammensetzung, umfassend Bakteriophagen und Beschichtungsmaterial für Oberflächen, wobei an Proteine des Bakteriophagen ein erstes zusätzliches Peptid fusioniert ist und weiterhin an Proteine des Bakteriophagen ein zweites zusätzliches Peptid fusioniert ist. Weiterhin betrifft die vorliegende Erfindung eine Oberfläche, die mit der Zusammensetzung beschichtet ist sowie die Verwendung der Zusammensetzung zur Beschichtung von Oberflächen.

Description

Bakteriophagen und Beschichtungsmaterial für Oberflächen
Die vorliegende Erfindung betrifft eine Zusammensetzung, umfassend Bakteriophagen und Beschichtungsmatenal für Oberflachen Weiterhin betrifft die vorliegende Erfindung eine Oberflache, die mit der Zusammensetzung beschichtet ist sowie die Verwendung der Zusammensetzung zur Beschichtung von Oberflachen
Im Bereich der Lackierung von Oberflachen sind bekannte Methoden zur Haftvermαttlung zum Beispiel bifunktionelle Organosilanverbmdungen, die eme chemische Bindung zwischen der Polymermatrix des Lackes und dem anorganischen Substrat herstellen Em Nachteil dieser Haftvermittler besteht unter anderem dann, dass eine optimale Haftung nur gewahrleistet ist, wenn sich auf der Oberfläche des Substrates Hydroxid-Gruppen befinden, mit denen das Silan wechselwirken kann In vielen Fallen ist daher eme aufwendige Vorbehandlung des Substrates notwendig Auch die Herstellung von maßgeschneiderten Materialien ist sehr aufwendig und bisher sind mcht für alle Substrate maßgeschneiderten Materialien bekannt
Selektiv selbst-organisierende Haftvermittler haben den Vorteil, die Haftung der Lack- und Klebstoffschichten an metallischen Oberflachen für sehr lange Lebenszeiten zu gewahrleisten, wie es zum Beispiel im Automobilbεreich fαr eme weitere Verbesserung des Korrosionsschutzes erforderlich ist Sie ermöglichen weiterhin eine gleichmaßig gute Haftung einer einheitlichen Lackschicht auf den vermehrt zum Einsatz kommenden Kompositwerkstoffen mit unterschiedlichen Oberflachen wie Kunststoff-Metallverbundwerkstoffe Außerdem wird durch die spezifische Selbstorgamsation des biologischen Haftvermittlers an unterschiedlichen Oberflächen eme selektive Beschichtung in einfachen Arbeitsprozessen möglich, was neue Anwendungen von Kompositwerkstoffen ermöglicht und im Ausblick auch in der Elektronikindustrie ein vereinfachtes und präzises Verfahren zur Herstellung von Schaltungen auf Halbleitern in Aussicht stellt
Die Kopplung emes anorganischen Substrats mit biologischen Komponenten zur Modifikation der Oberflacheneigenschaften ist in der Biomimetik bekannt Aus einer Phagenbibhothek selektierte, kurze Peptide präsentierende Bakteriophagen wurden bisher beispielsweise dazu verwendet, anorgamsche Materialien zu fallen bzw abzuscheiden (WO2003/078451) Auch Hybπdmateπahen aus einem anorganischen Substrat und spezifischen Polypeptid-Liganden werden als potentielle Losung zur Veränderung der Substratoberflache verwendet Die Identifikation des an das Substrat passenden biologischen Liganden (üblicherweise ein Peptid) ist aber zeit- und kostspielig und stand bisher emer konkreten Anwendung im Wege Das Konzept eines bifunktionellen Liganden zur Bindung von zwei anorganischen Komponenten wird im Stand der Technik angesprochen (siehe zum Beispiel Sarikaya et al., Nature Materials, 2003, 2, 577- 585). Konkret wurde die Bindung von Zellen oder Biomolekülen an einem Polymersubstrat, insbesondere an oxidiertem Chlor-angereicherten Polypyrrol (PPyCl) beziehungsweise Poly(lactat- co-glycolat) (PLGA), durch Bakteriophagen mit bifunktionellen Bindungseigenschaften zum Beispiel in WO2004/035612 beschrieben. WO2004/035612 erwähnt die prinzipielle Möglichkeit, Arzneimittel mit dieser Methode an das Substrat zu binden, beschreibt aber ausschließlich die Identifikation des Polymer-spezifischen Phagen durch sogenanntes Biopanning und Bindung des Phagen an das Polymersubstrat. Die weitere Bindung an einen weiteren Stoff, der wie zum Beispiel ein Beschichtungsmaterial kein biologischer Bindungspartner des verwendeten Phagen ist, wird nicht weiter beschrieben, wobei diese Bindung ebenfalls selektiv zu erfolgen hätte und eine genaue Anpassung des Liganden an die weitere Bindungskomponente erfordern würde.
Die vorliegende Erfindung hat sich die Aufgabe gestellt, eine Zusammensetzung, umfassend Bakteriophagen und Beschichtungsmaterial für Oberflächen bereitzustellen, welche die Haftung des Beschichtungsmaterials auf zu beschichtenden Oberflächen verbessert.
Diese Aufgabe wurde erfindungsgemäß durch eine Zusammensetzung, umfassend Bakteriophagen und Beschichtungsmaterial für Oberflächen gelöst, wobei an Proteine des Bakteriophagen ein erstes zusätzliches Peptid fusioniert ist und weiterhin an Proteine des Bakteriophagen ein zweites zusätzliches Peptid fusioniert ist.
Unter Beschichtungsmaterial für Oberflächen wird eine Schicht aus einem beliebigen Material verstanden, die als Abdeckung, Schutz, Dekoration oder Finish verwendet wird.
Im Sprachgebrauch der vorliegenden Erfindung bezeichnen Proteine des Bakteriophagen Genprodukte des Phagengenoms, welche beispielsweise die Hülle des Bakteriophagen aufbauen. Ein erstes zusätzliches Peptid ist ein Peptid, welches nicht auf der natürlichen Form des Phagen enthalten ist, sondern beispielsweise mittels molekulargenetischer Manipulationen des Phagengenoms auf dem Phagen präsentiert wird. Das Peptid ist auf Proteinen des Bakteriophagen fusioniert, was bedeutet, dass es entweder N-terminal oder C-terminal über eine Peptidbindung mit dem Protein verbunden ist. Das erste zusätzliche Peptid hat die Eigenschaft, dass es zu dem Beschichtungsmaterial oder zu der zu beschichtenden Oberfläche eine Bindung aufbauen kann. Die Art der Bindung kann beispielsweise eine kovalente Anbindung, eine elektrostatische Wechselwirkung über geladene oder teilgeladene funktionelle Gruppen oder eine Wasserstoffbrückenbindung sein.
Das zweite zusätzliche Peptid ist ebenfalls ein Peptid, welches nicht auf der natürlichen Form des Phagen enthalten ist, sondern beispielsweise mittels molekulargenetischer Manipulationen des Phagengenoms auf dem Phagen präsentiert wird. Das Peptid ist auf Proteinen des Bakteriophagen fusioniert, was bedeutet, dass es entweder N-terminal oder C-terminal über eine Peptidbindung mit dem Protein verbunden ist. Dieses Peptid hat ebenfalls die Eigenschaft, dass es zu dem Beschichtungsmaterial oder zu der zu beschichtenden Oberfläche eine Bindung aufbauen kann. Die Art der Bindung kann dabei beispielsweise eine kovalente Anbindung, eine elektrostatische Wechselwirkung über geladene oder teilgeladene funktionelle Gruppen oder eine Wasserstoffbrückenbindung sein.
Insgesamt liegt also ein bifunktioneller Phage vor, welcher die Haftung des Beschichtungsmaterials auf der Oberfläche ermöglicht oder verbessert.
In einer Ausführungsform der vorliegenden Erfindung weisen das erste zusätzliche Peptid und/oder das zweite zusätzliche Peptid unabhängig voneinander eine Länge von > 4 Aminosäuren bis < 100 Aminosäuren, vorzugsweise > 5 Aminosäuren bis < 50 Aminosäuren, mehr bevorzugt > 6 Aminosäuren bis < 20 Aminosäuren auf. Die Peptide können linear, aber auch schleifenförmig aufgebaut sein. Peptide mit einer solchen Anzahl von Aminosäuren lassen sich mittels gängiger molekularbiologischer Methoden gut auf die Phagenproteine fusionieren und sind geeignet, um an Oberflächen zu haften. Beispiele für solche Peptide sind lineare Peptide mit einer Länge von 7 Aminosäuren, lineare Peptide mit einer Länge von 12 Aminosäuren oder schleifenformige Peptide mit einer Länge von 7 Aminosäuren, die von einer Disuliϊdbrücke zwischen zwei Cysteinresten eingerahmt werden.
In einer weiteren Ausführungsform der vorliegenden Erfindung wurde die Aminosäuresequenz des ersten zusätzlichen Peptids und/oder des zweiten zusätzlichen Peptids durch Panning einer kombinatorischen Phagenpopulation an einer Substratoberfläche ermittelt. Für die evolutive Selektion von einigen Phagenspezies aus einer großen kombinatorischen Phagenpopulation („Phage-Display Bibliothek") an einem Substrat wird üblicherweise eine Phage-Display Bibliothek in gepufferter wässriger Umgebung einem Substrat ausgesetzt, so dass die Bindung von einigen Phagen stattfinden kann. Unspezifisch bindende und schwach bindende Phagen werden durch Benutzung eines wässrigen Waschpuffers abgewaschen. Nach dem Waschen noch bindende und damit spezifische Phagen werden anschließend durch Benutzung eines anderen wässrigen Puffers, später genannt Elutionspuffer, abgelöst (eluiert). Diese gesamte Prozedur wird „Panning" genannt. Die eluierten Phagen werden vermehrt und in weiteren Panning-Runden erneut dem Substrat ausgesetzt, bis sich eine Population von gut bindenden Phagen anreichert. Beispiele dieser Technik finden sich bei Sarikaya et al., Nature Materials, 2003, 2, 577-585; O'Neil und Hoess, Current Opinion in Structural Biology, 1995, 5, 443-449; Smith und Scott, Methods in Enzymology 1993, 217, 228-257; Sambrook und Russell (Hrsg), 2001, Molecular cloning: A laboratory manual (third edition), CoId Spring Harbor Press, Seite 18.115 bis 18.122. Die Aminosäuresequenz selbst, die für die Bindung verantwortlich ist, kann mittels gentechnischer oder molekularbiologischer Methoden ermittelt werden.
Die Selektion von Phagenspezies aus einer kombinatorischen Phagenpopulation kann die folgenden Schritte umfassen:
a. Eine Phage-Display Bibliothek wird in gepufferter wässriger Umgebung einem Substrat ausgesetzt,
b. Waschen des Substrats,
c. Ablösen der bindenden Phagen durch Benutzung eines wässrigen Elutionspuffers,
wobei das Waschen des Substrats unter Energieeintrag mittels Ultraschall stattfinden kann.
Das Ablösen der Phagen mittels Ultraschall ermöglicht die Selektion und Detektion der besonders gut bindenden Phagen. Vorzugsweise wird in jeder Waschfraktion qualitativ die Anwesenheit von Phagen beispielsweise mittels eines Plaque-Assay Spot-Tests bestimmt. Günstigerweise ist hierbei das Material der Substratoberfläche ausgewählt aus der Gruppe umfassend Polymere, bevorzugt Polyethylen, Polypropylen, Polyurethan, Polystyrol und/oder Polyharnstoff; Halbleiter sowie Metalle, bevorzugt Stahl, Eisen, Aluminium und/oder Zink.
Vorteilhafterweise werden kommerziell erhältliche M13-Phage-Display Bibliotheken eingesetzt, die ein randomisiertes Peptid als gpEÜ-Fusionsprotein, insbesondere als lineares Peptid mit einer Länge von 7 Aminosäuren, als lineares Peptid mit einer Länge von 12 Aminosäuren, oder als schleifenfδrmiges Peptid mit 7 Aminosäuren, die von einer Disulfidbrücke zwischen zwei Cysteinresten eingerahmt werden, besitzen. Ebenfalls vorstellbar ist eine durch gezielte gentechnische Veränderung erstellte kombinatorische Phage-Display-Bibliothek, die ein randomisiertes Peptid als gplU-Fusionsprotein besitzt, das eine andere Länge als 7 oder 12 Aminosäuren aufweist. Alternativ kann durch gezielte gentechnische Veränderung der Phagen- DNA eine kombinatorische Phage-Display-Bibliothek erstellt werden, die randomisierte Peptide fusioniert am gpVIÜ-Protein des M13-Bakteriophagen enthält.
Bevorzugt werden ebenfalls die Elutionsbedingungen dem jeweiligen Substrat angepasst, um die gut bindenden Phagen vollständig von der Oberfläche zu lösen. Die Elution kann auf schonende Art durch Zugabe eines wässrigen Elutionspuffers erfolgen, bei der intakte Phagen erhalten werden. Hierzu können folgende Parameter optimiert werden: pH-Wert des Elutionspuffers üblicherweise pH 2 bis pH 11,5, wobei der pH des Waschpuffers naher an pH 7 liegt als der pH des Elutionspuffers, und vorzugsweise mindestens zwei Elutionsgange mit unterschiedlichen Elutionspuffern durchgeführt werden Vorzugsweise wird mindestens ein saurer und mindestens ein basischer Elutionsgang durchgeführt
Art und Konzentration der Elutionspuffersubstanz, wie z B Alkaliphosphate (üblicherweise in Konzentrationen von 0,005 bis 1,5 mol/L), Tπs-HCl (0,005 bis 1,5 mol/L), Glycin-HCl (0,05 bis 0,2 mol/L) oder Tπethylamm (0,05 bis 0,2 mol/L)
Anwesenheit, Art und Konzentration von Salzen, insbesondere Alkali- oder Erdalkalihalogenide, -sulfate, -carbonate, -phosphate oder -nitrate, bevorzugt
Natπumchloπd üblicherweise in Konzentrationen von 5 bis 500 mmol/L, bevorzugt 25 bis 250 mmol/L, besonders bevorzugt 50 bis 200 mmol/L
Anwesenheit, Art und Konzentration von Detergentien, bevorzugt Tween®-20, Natπumdodecylsulfat (SDS), oder Tπton X-100, üblicherweise in Konzentrationen von 0,01 bis 1 Gew %, bevorzugt 0,05 - 0,5 Gew %
Menge des Elutionspuffers üblicherweise von 1 bis 10 mL, Temperatur des Elutionspuffers üblicherweise 4 0C- 55 0C, vorzugsweise von 15 bis 40 0C, Dauer der Elution zweckmaßigerweise mindestens 5 s,
Aufeinanderfolgende Elutionen können mit gleichen oder unterschiedlichen Bedingungen durchgeführt werden, sowie die Anzahl dieser Elutionen angepasst werden (z B eine Elution mit 0,1 mol/1 Glycin pH 2,0 gefolgt von einem Neutralisationsschπtt mit 1 mol/1 Tπs-HCl pH 8, gefolgt von einer zweiten Elution mit 0,1 mol/1 Tnethylamin pH 11,5 gefolgt von einem Neutralisationsschntt mit 1 mol/1 Tπs-HCl pH 7,5)
Dieses Verfahren der oben aufgeführten Anpassung der Wasch- und Elutionsbedingungen an das Substrat bzw den Partikel resultiert in gut bindenden gentechnisch veränderten Phagen, die m kürzerer Zeit aus emer kombmatoπschen Phagenbibhothek selektiert werden können als bei bisher verwendeten Pannmg-Prozeduren
Die eluierten Phagen werden vermehrt und wiederum dem Substrat bzw dem Partikel ausgesetzt Fuhrt man weitere Panmng-Runden, bevorzugt unter stnngenteren Waschbedingungen, durch, erhalt man eine Population von spezifisch bindenden Phagen, die dadurch gekennzeichnet sind, dass sie ein kurzes Peptid an ihren Proteinen präsentieren, die für die Bindung verantwortlich sind. Die Sequenz dieser Peptidkette kann durch Sequenzierung der Phagen-DNA bestimmt werden. Diese DNA-Sequenz kann dazu benutzt werden, andere Phagen gentechnisch so zu modifizieren, dass sie bindungsfähige Peptide als Fusionsproteine präsentieren. Besonders bevorzugt werden auf diese Weise bifunktionelle Phagen hergestellt, die mit einem der Peptide spezifisch an den Partikel binden, und mit dem anderen Peptid spezifisch an das Substrat.
In einer weiteren Ausfuhrungsform der vorliegenden Erfindung sind die Bakteriophagen vom Typ M13. Diese Phagen sind gut veränderbar und leicht erhältlich und in Kultur leicht vermehrbar. Sie weisen als Genprodukte beispielsweise die Proteine gpiπ, gpV, gpVI, gpVII, gpVΗI und gpEX auf. Es ist möglich, dass das erste zusätzliche Peptid an das Protein gpHI oder gpVHI fusioniert ist und das zweite zusätzliche Peptid an das Protein gpIH oder gpVIH fusioniert ist. Die Verlängerung dieser Proteine mit zusätzlichen Peptiden, also das Fusionieren, ist an diesen Proteinen gut durchführbar. Besonders bevorzugt ist, wenn das Protein gpVÜI N-terminal mit einem Peptid der Sequenz STTRLR fusioniert ist. Zusätzlich kann auch das Protein gpiπ N-terminal mit einem Peptid der Sequenz ADKSAHVSLISR fusioniert ist, so dass ein bifunktioneller Phage entsteht. Die erstgenannte Sequenz befähigt den Phagen zur Bindung an Polyurethan-Oberflächen. Letztere Sequenz befähigt zur Bindung an Stahloberflächen.
Ein System nach der vorliegenden Erfindung kann bezüglich des Phagen so aufgebaut sein, dass an einer durch Panning vorselektierten Phage vom Typ M13 mit einem bereits an gpiπ fusionierten ersten zusätzlichen Peptid, das Bindungseigenschaften an eine Oberfläche vermittelt, an das gpVπi-Protein desselben Phagenklons ein zweites zusätzliches Peptid fusioniert wird, wobei die an gpiπ und gpVHI fusionierten Peptide gleich oder unterschiedlich sein können.
Ebenso ist auch ein System nach der vorliegenden Erfindung denkbar, wobei an einer durch Panning vorselektierten Phage vom Typ M 13 mit einem bereits an gpIH fusionierten ersten zusätzlichen Peptid an das gpVÜI-Protein desselben Phagenklons ein zweites zusätzliches Peptid fusioniert wird, das Bindungseigenschaften an eine Oberfläche vermittelt, wobei die an gpITJ und gpViπ fusionierten Peptide gleich oder unterschiedlich sein können.
Solche Phagen sind darstellbar durch ein Verfahren, das die folgenden Schritte umfasst:
a. Restriktionsschnittstellen werden in die gpVHI-Procoatsequenz eingeführt, indem ortsgerichtete Mutagenese am gpVTJI-Procoatgen, das sich auf einem Plasmid (bevorzugt pUC) zwischen zwei geeigneten Restriktionsschnittstellen (bevorzugt PagI und Kpnl) befindet, durchgeführt wird, b Die Mutationen aus Schritt a) werden durch Umklonierung aus dem Plasmid in die rεplikativc Form (RF) des M13-Genoms, bevorzugt in Form des Ml 3KE- Vektors, überfuhrt,
c die replikative Form der Phagen-DNA wird mit denjenigen Restriktionsenzymen aufgeschnitten, deren Schnittstellen durch die Mutationen aus Schritt a) eingeführt wurden, und dient dann zur Aufnahme von geeigneten komplementären Ohgonukleotiden, die an den Enden den entsprechenden Überhang für die Emligierung in die offenen
Restπkitionsstellen zeigen und die für eine zweite zusatzliche Peptidsequenz codieren
Bevorzugt befindet sich durch den Panning- und Selektionsprozess bereits ein an gpül fusioniertes Peptid, das Bindungseigenschaften vermittelt Um die Bifunktionalitat zu erreichen, wird üblicherweise an das gpVHI-Protein desselben Phagenklons durch molekularbiologische
Manipulation des Phagengenoms ein weiteres Peptid fusioniert, das ebenfalls eine
Bindungseigenschaft vermittelt, wobei die an gpIH und gpVHI fusionierten Peptide gleich oder unterschiedlich sein können, so dass multiple Bindungseigenschaften erreicht werden können Um diese Fusion zu erreichen, werden zunächst Restnktionsschnittstellen m die entsprechende
Position des Phagengenoms eingeführt Zu Klonierungszwecken werden die Mutationen zunächst auf einem anderen Plasmid, bevorzugt pUC, das das gpVLH-Procoatgen zwischen zwei geeigneten
Restnktionsschnittstellen (bevorzugt PagI und Kpnl) beinhaltet, eingebracht Die Einführung der neuen Restnktionsschnittstellen in die gpVHI-Procoatsequenz erfolgt mittels ortsgenchteter Mutagenese (z B Sambrook und Russell (Hrsg), 2001, Molecular cloning A laboratory manual
(third edition), CoId Spring Harbor Press, Seite 8 42 bis 8 45) durch Verwendung von
Ohgonukleotiden mit geeigneten Sequenzen wie z B
Mutagene Qhgonukleotide
Nco-A 5'-CGGCGTTCCCATGGTGTCTTTCGCTGC-S'
Nco-B S'-GCAGCGAAAGACACCATGGGAACGCCG-a'
Pst-A 5•-GCTGTCTTTCGCTGCAGAGGGTGACGATCCC-31
Pst-B S'-GGGATCGTCACCCTCTGCAGCGAAAGACAGC-S'
Die eingeführten Restnktionsschnittstellen können ausgewählt sein aus der Gruppe umfassend
Aar I, Aat D, Acc I, Acu I, AfI π, Age I, Ahd I, Apa I, ApaL I, Asc I, AsiS I, Aw π, BamH I, Bbs I, Bcg I, BciV I, Bei I, BfrB I, BIp I, BmgB I, Bmt I, Bsa I, Bsg I, BsiW I, BspE I, BssH π, BssS I,
BstAP I, BstB I, BstE π, BstX I, BstZ17 I, CspC I, EcoN I, EcoR V, Fse I, FspA I, Hinc π, Hpa I, I-Ceu I, I-Sce I, Mfe I, MIu I, Nco I, Nhe I, Not I, Nru I, Nsi I, PI-Psp I, PI-Sce I, PaeR7 I, PfIF I, PfIM I, Pme I, Pmi I, PshA I, PspOM I, Pst I, Rsr π, Sac I, Sac II, SaI I, SanD I, Sap I, Sca I, SexA I, Sfi I, SgrA I, Sma I, Spe I, Srf I, Stu I, Sty I, TIi I, Tthl 11 I, Xba I, Xcm I, Xho I, Xma I, Zra I. Bevorzugt wird eine Ncol-Schnittstelle in der Signalsequenz von gpVHI und eine Pstl-Schnittstelle in der maturen Region eingefügt. Diese Mutationen werden anschließend durch Umklonierung aus dem Plasmid in die replikative Form (RF) des M13-Genoms, bevorzugt in Form des Ml 3KE- Vektors (New England Biolabs), überfuhrt. Dazu wird der Vektor mit geeigneten Restriktionsenzymen, bevorzugt PagI und Kpnl, aufgeschnitten und das erhaltene Fragment in den ebenso geschnittenen Ml 3KE- Vektor ligiert. Für die Durchführung von Restriktions- und Ligationsschritten bei doppelsträngigen Plasmiden siehe z.B. Sambrook und Russell (Hrsg), 2001, Molecular cloning: A laboratory manual (third edition), CoId Spring Harbor Press, Seite 1.84 bis 1.87. Für die Durchführung von Transformationen von Plasmiden in E. coli-Bakterien siehe Sambrook und Russell (Hrsg), 2001, Molecular cloning: A laboratory manual (third edition), CoId Spring Harbor Press, Seite 1.105-1.122.
Nach Einführen der Schnittstellen in das M13-Genom kann die replikative Form der Phagen-DNA üblicherweise mit den beiden Restriktionsenzymen Ncol und PstI aufgeschnitten werden und dient dann zur Aufnahme von geeigneten komplementären Oligonukleotiden, die an den Enden den entsprechenden Überhang für die Einligierung in die offenen Restriktionsstellen zeigen und die für eine hafrverrnittelnde Peptidsequenz codieren. Die Information für diese haftvermittelnde Peptidsequenz kann aus der Panning-Prozedur der gpEU-Phage-Display-Bibliothek an einem geeigneten Substrat stammen. Durch Ligation der DNA und Transformation in geeignete Wirtsbakterien können bifunktionelle Phagen erzeugt werden, die sowohl an ihren gpIH- als auch an ihren gpVTJI-Proteinen ggf. unterschiedliche haftvermittelnde Peptidsequenzen präsentieren.
Alternativ können anstelle von Oligonukleotiden, die für eine haftvermittelnde Peptidsequenz codieren, auch Bibliotheks-Oligonukleotide in das geeignet geschnittene M13-Genom ligiert werden. Diese sind üblicherweise zwei komplementäre Oligonukleotide, die an den Enden den entsprechenden Überhang für die Einligierung in die offenen Restrikitionsstellen zeigen. Zudem haben sie einen Bereich von üblicherweise 15 Basen, die frei variabel sind. Durch Ligation der hybridisierten Oligonukleotide in die geschnittene RF-DNA und Transformation in geeignete Wirtsbakterien erhält man eine randomisierte gpVHI-Phagenbibliothek. Die Phagen können dann durch die bereits beschriebenen Panning-Prozeduren an Substrat-Oberflächen selektioniert werden.
Vorteilhafterweise ist das Beschichtungsmaterial für Oberflächen ausgewählt aus der Gruppe umfassend Haftvermittler, Primer, Lack und/oder Klebstoff.
Haftvermittler sind bifunktionelle, niedermolekulare Verbindungen, deren eine Funktionalität die Haftung auf der zu beschichtenden oder zu klebenden Oberfläche bewirkt, während die andere Funktionalität für die Verankerung in der Lack- oder Klebstoffschicht zuständig ist. Als gängige Haftvermittler werden Organosiloxane oder Organosilane eingesetzt, die beispielsweise eine Haftung auf Glasoberflächen, aber auch auf Metalloberflächen unterstützen. Einen weiteren Typus von Haftvermittler stellen Derivate von Komplexbildnern dar. Die komplexbildende Gruppe erhöht die Adhäsion mit einer metallischen Oberfläche, während eine funktionelle Gruppe zur Verankerung in der Lack- oder Klebstoffschicht fuhrt. Derivate des Hydrochinolins erhöhen so die Adhäsion zu Aluminiumoberflächen, Derivate der Gallussäure die Adhäsion zu Stahloberflächen.
Primer sind beispielsweise polymergebundene, dünne Schichten auf dem zu beschichtenden oder zu verklebenden Gefügeteil, die dem Klebstoff oder Lackrohstoff ähnlich sind und weitere
Bestandteile, zum Beispiel für den Korrosionsschutz oder für eine verbesserte Haftung, enthalten.
Die Aufgabe von Primerschichten sind verbesserte Haftung und der Schutz der Oberfläche vor
Korrosion. Bekannt sind hier zum Beispiel monuronbeschleunigte Epoxidharze als korrosionshemmende Primerschicht. Durch den Einsatz von Primerschichten kann unter Umständen eine Vorbehandlung zum Schutz der Oberfläche (Plasmabehandlung von
Kunststoffoberflächen, Phosphatierung bei Metallen) umgangen werden.
Lacke sind Beschichtungsstoffe, die auf Gegenstände aufgetragen werden und zumindest teilweise einen zusammenhängenden Film ausbilden. Bestandteile eines Lackes können sein: filmbildendes Harz, Härter, Lösungsmittel, Wasser, Additive, Pigmente, Entschäumer, Lichtschutzmittel, optische Aufheller, Korrosionsinhibitoren, Antioxidantien, Algizide, Weichmacher, Verlaufsmittel und Benetzungsmittel. Als filmbildende Harze können die dem Fachmann der Beschichtungstechnologie bekannten polymeren Verbindungen wie Polyester, Polyether, Polyurethane, Polyacrylate und/oder Polyharnstoffe eingesetzt werden, welche nach Aufbringen auf eine Oberfläche zu einem geschlossenen Lackfilm führen.
Bevorzugt werden solche filmbildenden Harze eingesetzt, welche für eine chemische Vernetzung zur Verfügung stehende funktionelle Gruppen aufweisen. Solche Gruppen können freie oder reversibel blockierte Hydroxy-, Thio-, Amino-, Epoxy- und/oder Isocyanatgruppen sein. Beispiele für reversibel blockierte Isocyanatgruppen sind solche, die mit Acetonoxim, Butanonoxim, ε- Caprolactam, 3,5-Dimethylpyrazol, Dimethylmalonat oder Phenol blockiert sind. Das Blockierungsreagenz spaltet sich erst bei höheren Temperaturen ab, wodurch die Isocyanatgruppe freigesetzt wird. Hieraus resultiert eine höhere Temperaturstabilität.
Besonders bevorzugt ist, wenn das filmbildende Harz eine Mischung aus OH- und/oder NH- funktionellen Bindemitteln, vorzugsweise Polyolen und/oder Polyaminen sowie Härtern, vorzugsweise Polyisocyanate, blockierte Polyisocyanate, und/oder Epoxydharzen darstellt. Sowohl die Harze als auch die Härter können sowohl in lösemittelfreier Form als auch in Form einer Lösung in organischen Lösemitteln oder einer wässrigen Dispersion vorliegen.
Bevorzugt beträgt das molare Verhältnis der zur Vernetzung zur Verfügung stehenden funktionellen Gruppen von Harz und gegebenenfalls blockiertem Härter > 1,5 bis < 2.
Ein weiterer Gegenstand der vorliegenden Erfindung ist eine Oberfläche, die mit einer Zusammensetzung nach der vorliegenden Erfindung beschichtet ist. In einer vorteilhaften Ausgestaltung ist das Material der Oberfläche ausgewählt aus der Gruppe umfassend Polymere, Polyethylen, Polypropylen, Polyurethan, Polystyrol, Polyharnstoff, Halbleiter, Metalle, Stahl, Eisen, Aluminium und/oder Zink.
Ein weiterer Gegenstand der vorliegenden Erfindung ist die Verwendung der erfindungsgemäßen Zusammensetzug zur Beschichtung von Oberflächen.
Die vorliegende Erfindung wird nachfolgend anhand der nachfolgenden Beispiele 1 und 2 erläutert.
Beispiele:
Beispiel 1: Panning einer kombinatorischen Phage Display Bibliothek (Ph.D.-12™, New England Biolabs) an einem Polyurethan-Substrat.
Polyurethan-Substrat wurde aus Vermischung äquivalenter Mengen Desmophen® 670 BA und Desmodur® N3300 (Bayer MatenalScience AG) hergestellt, die Aushärtung erfolgte über 16 h bei Raumtemperatur 20 mg des Substrates wurden 10 mm in Tπs-Buffered Salme (TBS, bestehend aus 50 mmol/1 Tπs-HCl pH 7,5, 150 mmol/1 NaCl) äquilibriert und 60 min mit 4*1010 pfu (10 μl der onginal-Bibliothek) in 1 ml TBS bei Raumtemperatur mkubiert Das Substrat wurde zehnmal mit je 10 ml TBST (TBS plus 0,1 vol -% Tween-20) gewaschen (mittels kurzem Vortexen, funfminutiger Rotation plus 5 s Ultraschallbad) Die erste Elution erfolgte im Sauren durch Eintauchen des Substrats m 1 ml 0,1 mol/1 Glycin pH 2,5 für 10 s mit anschließender Neutralisation des Substrats in 1 ml 0,1 mol/1 Tπs-HCl pH 8 für 1 min Die erste Elutionslosung wurde durch Zugabe von 200 μl 1 mol/1 Tπs-HCl pH 8 neutralisiert Die zweite Elution erfolgte im Basischen durch Emtauchen des Substrats in 1 ml 0,1 mol/1 Tnethylamin pH 11,5 für 1 mm mit anschließender Neutralisation des Substrats in 1 ml 0,1 mol/1 Tπs-HCl pH 7,5 für 1 min Die zweite Elutionslosung wurde durch Zugabe von 200 μl 1 mol/1 Tπs-HCl pH 7,5 neutralisiert Das Substrat wurde anschließend in TBST aufbewahrt, um zeitliche Ablosungseffekte nicht eluierter Phagen zu beobachten
In jeder Fraktion konnte nun qualitativ die Anwesenheit von Phagen mittels eines Plaque- Assay Spot-Tests bestmimt werden (siehe Abbildung 1) Dazu wurden Baktenen des Stamms E coli ER2738 (New England Biolabs) auf einer LB-Tet Agarplatte (15 g/l Agar, 10 g/l Bacto-Trypton, 5 g/l Hefeextrakt, 5 g/l NaCl, 20 mg/1 Tetracyclin) ausgestochen und über Nacht bei 37 0C inkubiert 10 ml LB-Tet Medium (10 g/l Bacto-Trypton, 5 g/l Hefeextrakt, 5 g/l NaCl, 20 mg/1 Tetracyclm) wurden mit einer Einzelkolonie ER2738 angeimpft und bis zu einer OD600 von 0,4 bei 37 0C geschüttelt 400 μl davon wurden in 3 ml geschmolzenen LB-Agar-Top (7 g/l Agar, 10 g/l Bacto- Trypton, 5 g/l Hefeextrakt, 5 g/l NaCl) pipettiert und auf einer LB-EPTG/X-gal Platte (15 g/l Agar, 10 g/l Bacto-Trypton, 5 g/l Hefeextrakt, 5 g/l NaCl, 1,25 mg/1 Isopropyl-ß-D-thiogalactopyranosid, 1 mg/1 5-Brom-4-chlor-3-indoxyl-ß-D-galactopyranosid) ausgebracht Nach dem Ausharten wurden 3 μl jeder Fraktion auf die Platte aufgetropft und diese über Nacht bei 37 0C mkubiert Die Anwesenheit von Phagen in jeder Fraktion wurde durch blaue Plaques angezeigt
Die Elutionsfraktionen (Elution 1 und 2 sowie die beiden Neutralisationslosungen) wurden vereinigt und amphfiziert Dazu wurden 10 ml LB-Tet Medium mit 100 μl emer Ubernachtkultur ER2738 (m LB-Tet) sowie den vereinigten Elutionsfraktionen angeimpft und 4,5 h bei 37 °C geschüttelt Die Kultur wurde 10 mm bei 4500 x g und 4 0C zentπfugiert, und der Überstand anschließend erneut zentrifugiert. Die oberen 4/5 vol. des Überstandes wurden mit 1/5 vol. PEG/NaCl (20 % (w/v) Polyethylenglykol-8000, 2,5 mol/1 NaCl) versetzt und 1 h bei 4 0C inkubiert. Die Phagen wurden 20 min bei 16000 x g und 4 0C abzentrifugiert und in 1 ml TBS (50 mM Tris-HCl pH 7,5, 150 mM NaCl) resuspendiert. Die Lösung wird 5 min bei 10000 x g und 4 0C zentrifugiert, der Überstand mit 200 μl PEG/NaCl versetzt und 60 min auf Eis inkubiert. Die Phagen wurden 10 min bei 14000 x g und 40C abzentrifugiert und in 200 μl TBS resuspendiert.
Der Titer der Phagenlösung wurde durch einen Plaque- Assay bestimmt. Dazu wurden 10 ml LB- Tet Medium mit einer Einzelkolonie ER2738 angeimpft und bis zu einer OD6oo von 0,4 bei 37 0C geschüttelt. 400 μl davon werden in 3 ml geschmolzenen LB-Agar-Top pipettiert, mit 10 μl einer geeigneten Verdünnung der Phagenlösung versetzt und auf einer LB-IPTG/X-gal Platte verteilt. Nach dem Aushärten wurde die Platte über Nacht bei 37 0C inkubiert. Durch die Anzahl der blauen Plaques ließ sich der Titer der Phagenlösung (in pfu/ml) errechnen.
In den nun folgenden Runden wurde die gesamte Prozedur des Pannings wiederholt, allerdings werden 1-2 x 1011 pfu des amplifizierten Eluats als neue Bibliothek eingesetzt, außerdem wird die Tween-20-Konzentration auf 0,5 % (v/v) erhöht.
Insgesamt wurden drei Panning-Runden durchgeführt. In der resultierenden Population haben sich spezifisch Polyurethan-bindende Phagenklone angereichert, deren Identität durch Sequenzierung des variablen Bereichs ihres Genoms bestimmt werden konnte. Dazu wurden einzelne Phagenklone, z.B. von der LB-IPTG/X-gal-Platte der Titration des Eluats der dritten Runde, mit einer Impföse gepickt und separat amplifiziert: 2 ml LB-Tet Medium wurden mit 100 μl einer Übernachtkultur ER2738 (in LB-Tet) sowie dem Phagenklon angeimpft und 4,5 h bei 37 0C geschüttelt. Die Kultur wurde 10 min bei 4500 x g und 4 0C zentrifugiert, und der Überstand anschließend erneut zentrifugiert. 1 ml der Phagenlösung wurde mit 500 μl PEG/NaCl-Lsg versetzt und 2 h bei 4 0C inkubiert. Die Phagen wurden 15 min bei 14000 x g und 4 0C abzentrifugiert und in 100 μl 10 mM Tris-HCl pH 8,0, 1 mM EDTA, 4 M NaI resuspendiert. Die DNS wurde durch 250 μl Ethanol 10 min gefällt und 15 min bei 14000 x g und 20 0C abzentrifugiert. Das Pellet wurde mit 70 %igem Ethanol gewaschen, 1 min bei 14000 x g und 20 0C zentrifugiert, getrocknet und in 30 μl 10 mM Tris-HCl pH 8.0 resuspendiert. Die Sequenzierung der DNS erfolgte mit dem Primer 5'-CCCTCATAGTTAGCGTAACG-3', wobei der Anticodon-Strang der M 13-DNS erhalten wird.
Beispiel 2: Herstellung einer kombinatorischen gpVTII-Phage Display Bibliothek
Um in das M13-Genom eine Oligonukleotidbank für das Gen VIII (Haupthüllprotein) einzuführen, werden drei Primer benötigt: 1. Bibliotheksoligonukleotid
5'CGTCACCCTCTGCAGCCNNN)6AGCAGCGAAAGACACCATGGGAAGC
2. Extension primer I
5' CGTTCCCATGGTGTCTTTC
3. Extension primer II
5' ATCGTCACCCTCTGCA
Auf dem Bibliotheksoligonukleotid wird zunächst mit beiden Extensionprimer eine PCR-Reaktion durchgeführt, die zum Erstellen der Bibliothek verwendet wird. Die Bibliothek wird sodann mit Ncol und PstI verdaut und in einen mit Ncol und Pstl-Schnittstellen versehenen M13KE-Vektor in die entsprechenden Restriktionsstellen eingefügt.
Um die Bibliothek in das Ml 3 Genom einführen zu können, werden zunächst Restriktionsschnittstellen in die entsprechende Position des Genoms von M 13KE eingeführt. Zu Klonierungszwecken werden die Mutationen zunächst auf einem anderen Plasmid (pUC), weiches das gpVTfl-Procoatgen zwischen den Restriktionsschnittstellen PagI und Kpnl beinhaltet, eingebracht (pUC-gp8). Die Einführung der neuen Restriktionsschnittstellen in die gpVUI- Procoatsequenz erfolgt mittels ortsgerichteter Mutagenese (z.B. Sambrook und Russell (Hrsg), 2001, Molecular cloning: A laboratory manual (third edition), CoId Spring Harbor Press, Seite 8.42 bis 8.45) durch Verwendung der folgenden Oligonukleotide:
Mutagene Oligonukleotide
Nco-A 5'-CGGCGTTCCCATGGTGTCTTTCGCTGC-S'
Nco-B 5'-GCAGCGAAAGACACCATGGGAACGCCG-3'
Pst-A 5'-GCTGTCTTTCGCTGCAGAGGGTGACGATCCC-S'
Pst-B 5'-GGGATCGTCACCCTCTGCAGCGAAAGACAGC-S'
Dadurch wird eine Ncol-Schnittstelle in der Signalsequenz von gpVm und eine Pstl-Schnittstelle in der maturen Region eingefügt (pUC-gp8mut). Diese Mutationen werden anschließend durch
Umklonierung aus pUC-gp8mut in die replikative Form (RF) des M13KE-Genoms überführt. Dazu wird pUC-gp8mut mit PagI und Kpnl aufgeschnitten und das erhaltene Fragment in den ebenso geschnittenen Ml 3KE- Vektor ligiert Für die Durchführung von Restnktions- und Ligationsschπtten bei doppelstrangigen Plasmiden siehe z B Sambrook und Russell (Hrsg), 2001, Molecular clonrng A laboratory manual (third edition), CoId Spπng Harbor Press, Seite 1 84 bis 1 87 Für die Durchführung von Transformationen von Plasmiden in E coh-Baktenen siehe Sambrook und Russell (Hrsg), 2001, Molecular clorung A laboratory manual (third edition), CoId Spπng Harbor Press, Seite 1 105-1 122
Nach Einfuhren der Schnittstellen in das Genom von M 13KE (M13KE-gp8mut) wird dessen RF- DNA mit den beiden Restriktionsenzymen Ncol und PstI aufgeschnitten und das analog geschnittene Bibhotheks-Oligonukleotid in diesen Vektor ligiert
Jedes Ligationsprodukt ist in den 6 NNN Positionen unterschiedlich und codiert daher für andere Aminosäuren an diesen 6 Positionen Die Ligationsansatze stellen die kombinatorische gpVHI- Bibhothek dar und können direkt für das Panning an einem Substrat, analog zu einer kommerziellen gpHI-Phage Display Bibliothek, eingesetzt werden
Beispiel 3: Herstellung eines bifunktionellen Bakteriophagen, der ein an gpIII fusioniertes. 12 Aminosäuren langes, spezifisch an Stahl bindendes Peptid sowie ein an gpVTII fusioniertes. 6 Aminosäuren langes, spezifisch an Polyurethan bindendes Peptid besitzt
Durch das Panning emer kommerziellen Phagenbibhothek (Ph -D -12™, New England Biolabs) an Stahl lag m einem Phagenklon („StlOl-13") ein an gpDI fusioniertes, 12 Aminosäuren langes Peptid (ADKSAHVSLISR) vor, das Stahl-Bindungseigenschaften besitzt Um die Bifunktionalitat zu erreichen, wurde an das gpVHI-Protein desselben Phagenklons em weiteres, 6 Aminosäuren langes Peptid fusioniert (STTRLR), das Polyurethan-Bindungseigenschaften besitzt Der Klon mit dieser Sequenz (,JPUROl-I") wurde durch das Panning einer randomisierten gpVÜI-Phage Display-Bibliothek (s o ) an Polyurethan gefunden
Um die Kombination zu erreichen, wurde zunächst die rephkative Form von PUROl-I mit den Restπktionsenzymen PagI und Kpnl geschnitten Das Insert, das das gpVHI-Gen mit fusioniertem Polyurethan-bindenden Peptid enthalt, wurde in die ebenfalls mit PagI und Kpnl geschnittene rephkative Form von StIO 1-13 ligiert Durch Transformation m kompetente E coli ER2738- Baktenen (New England Biolabs) wurden bifunktionelle Phagen erzeugt, die an ihren gpUI- und an ihren gpVDI-Proteinen unterschiedliche haftvermittelnde Peptidsequenzen präsentieren Abbildungen:
Abbildung 1: Plaque-Assay von Panning-Fraktionen (Runde 1), unverdünnt aufgetxopft auf einen mit E. coli ER2738 versetzten LB-Agar-Top auf einer LB-IPTG/X-gal-Platte
Es bedeuten die Beschriftungen der Felder:
0. Bibliothek von Runde 1 nach der Substrat-Inkubation;
Wl-10:Waschfraktionen 1-10 (Benutzung von Ultraschall);
El: Elution 1 (sauer);
Nl: Neutralisation 1;
E2: Elution 2 (basisch);
N2: Neutralisation 2;
TBST: Aufbewahrung des Substratstücks nach dem Panning in TBST.

Claims

Patentanspruche:
1) Zusammensetzung, umfassend Bakteriophagen und Beschichtungsmatenal für Oberflachen, dadurch gekennzeichnet, dass an Proteine des Bakteriophagen ein erstes zusatzliches Peptid fusioniert ist und dass weiterhin an Proteine des Bakteriophagen ein zweites zusätzliches Peptid fusioniert ist
2) Zusammensetzung nach Anspruch 1 , wobei das erste zusatzliche Peptid und/oder das zweite zusätzliche Peptid unabhängig voneinander eine Lange von > 4 Aminosäuren bis < 100 Aminosäuren, vorzugsweise > 5 Aminosäuren bis < 50 Aminosäuren, mehr bevorzugt > 6 Aminosäuren bis < 20 Aminosäuren aufweisen
3) Zusammensetzung nach einem der Ansprüche 1 oder 2, wobei die Aminosauresequenz des ersten zusatzlichen Peptids und/oder des zweiten zusatzlichen Peptids durch Panning emer kombinatorischen Phagenpopulation an einer Substratoberflache ermittelt wurde
4) Zusammensetzung nach Anspruch 3, wobei das Material der Substratoberflache ausgewählt ist aus der Gruppe umfassend Polymere, bevorzugt Polyethylen,
Polypropylen, Polyurethan, Polystyrol und/oder Polyharnstoff, Halbleiter sowie Metalle, bevorzugt Stahl, Eisen, Aluminium und/oder Zink
5) Zusammensetzung nach einem der Ansprache 1 bis 4, wobei die Bakteriophagen vom Typ Ml 3 sind
6) Zusammensetzung nach Anspruch 5, wobei das erste zusatzliche Peptid an das Protein gpHI oder gpVHI fusioniert ist und das zweite zusätzliche Peptid an das Protein gpül oder gpViπ fusioniert ist
7) Zusammensetzung nach Ansprach 6, wobei das Protein gpVHl N-terminal mit einem Peptid der Sequenz STTRLR fusioniert ist und zusatzlich das Protem gpiπ N-terminal mit einem Peptid der Sequenz ADKSAHVSLISR fusioniert ist, so dass em bifunktioneller Phage entsteht
8) Zusammensetzung nach einem der Ansprache 1 bis 7, wobei das Beschichtungsmatenal für Oberflachen ausgewählt ist aus der Gruppe umfassend Haftvermittler, Pπmer, Lack und/oder Klebstoff
9) Zusammensetzung nach Ansprach 8, wobei das Beschichtungsmatenal für Oberflächen ein filmbildendes Harz umfasst, das ausgewählt ist aus der Gruppe umfassend Polyester, Polyether, Polyurethane, Polyacrylate und/oder Polyharnstoffe.
10) Zusammensetzung nach Anspruch 9, wobei das fϊlmbildende Harz für eine chemische Vernetzung zur Verfügung stehende funktionelle Gruppen aufweist, die vorzugsweise ausgewählt sind aus der Gruppe umfassend freie oder reversibel blockierte Hydroxy-,
Thio-, Amino-, Epoxy- und/oder Isocyanatgruppen.
11) Zusammensetzung nach Anspruch 10, wobei das filmbildende Harz eine Mischung aus OH- und/oder NH-funktionellen Bindemitteln, vorzugsweise Polyolen und/oder Polyaminen sowie Härtern, vorzugsweise Polyisocyanate, blockierte Polyisocyanate, und/oder Epoxydharzen darstellt.
12) Oberfläche, dadurch gekennzeichnet, dass sie mit einer Zusammensetzung nach einem der Ansprüche 1 bis 11 beschichtet ist.
13) Oberfläche nach Anspruch 12, wobei das Material der Oberfläche ausgewählt ist aus der Gruppe umfassend Polymere, Polyethylen, Polypropylen, Polyurethan, Polystyrol, Polyharnstoff, Halbleiter, Metalle, Stahl, Eisen, Aluminium und/oder Zink.
14) Verwendung der Zusammensetzung nach einem der Ansprüche 1 bis 11 zur Beschichtung von Oberflächen.
EP08852931A 2007-11-23 2008-11-20 Bakteriophagen und beschichtungsmaterial für oberflächen Withdrawn EP2227544A1 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
DE102007056818A DE102007056818A1 (de) 2007-11-23 2007-11-23 Bakteriophagen und Beschichtungsmaterial für Oberflächen
PCT/EP2008/009787 WO2009065573A1 (de) 2007-11-23 2008-11-20 Bakteriophagen und beschichtungsmaterial für oberflächen

Publications (1)

Publication Number Publication Date
EP2227544A1 true EP2227544A1 (de) 2010-09-15

Family

ID=40404031

Family Applications (1)

Application Number Title Priority Date Filing Date
EP08852931A Withdrawn EP2227544A1 (de) 2007-11-23 2008-11-20 Bakteriophagen und beschichtungsmaterial für oberflächen

Country Status (4)

Country Link
US (1) US20100279894A1 (de)
EP (1) EP2227544A1 (de)
DE (1) DE102007056818A1 (de)
WO (1) WO2009065573A1 (de)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE102012110664A1 (de) 2012-11-07 2014-05-08 Henkel Ag & Co. Kgaa In Beschichtungsmitteln, Haftvermittlern oder Klebstoffen für oxidische Oberflächen einsetzbare Peptide

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1488011A4 (de) 2002-03-13 2006-04-05 New Century Pharmaceuticals Verfahren zur isolierung von bindungspeptiden aus einer kombinatorischen phagen-display-bibliothek und damit produzierte peptide
US7598344B2 (en) 2002-09-04 2009-10-06 Board Of Regents, The University Of Texas System Composition, method and use of bi-functional biomaterials
CA2499318A1 (en) * 2002-09-18 2004-04-22 Angela M. Belcher Peptide mediated synthesis of metallic and magnetic materials
WO2004036992A2 (en) * 2002-09-24 2004-05-06 Board Of Regents, University Of Texas System Fabricated biofilm storage device
EP1682568A4 (de) * 2003-10-15 2009-10-28 Univ Texas Multifunktionelle biologische materialien als gerüste für elektronische, optische, magnetische, halbleitdende und biotechnologische anwendungen
JP5142458B2 (ja) * 2005-06-30 2013-02-13 キヤノン株式会社 標的物質捕捉分子、標的物質捕捉用の素子、これらを用いた標的物質検出用の装置及びキット、並びに、標的物質の検出方法
DE102007036866A1 (de) * 2007-08-06 2009-02-12 Bayer Technology Services Gmbh System, umfassend Wirkstoffe umfassende Partikel und Bakteriophagen

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2009065573A1 *

Also Published As

Publication number Publication date
WO2009065573A1 (de) 2009-05-28
US20100279894A1 (en) 2010-11-04
DE102007056818A1 (de) 2009-05-28

Similar Documents

Publication Publication Date Title
EP2917740B1 (de) In beschichtungsmitteln, haftvermittlern oder klebstoffen für oxidische oberflächen einsetzbares peptid
DE19646372C1 (de) Genotyp und Phänotyp koppelnde Verbindung
DE69830497T2 (de) Bibliothek für die in-vitro Expression von Peptiden oder Proteinen
DE3630667C2 (de)
DE112006003608T5 (de) Verfahren zur Präsentation von Zielproteinen an der Zelloberfläche unter Verwendung von Bacillus Anthracis-Exosporium
WO2004024837A1 (de) Metallpigmente enthaltende, wässrige pigmentpasten und ihre verwendung zur herstellung von effektgebenden wässrigen beschichtungsstoffen
CN103154257A (zh) 重组大分子生成方法
DE3715410A1 (de) Verfahren zur beschichtung eines metallsubstrats
DE102021133427A1 (de) Substratspezifische adhäsive peptide
CN104447956A (zh) 聚氨酯界面特异性亲和多肽及其筛选方法
EP2393610B1 (de) Beschichtungsmittel für korrosionsstabile lackierungen
EP2227544A1 (de) Bakteriophagen und beschichtungsmaterial für oberflächen
EP1668126A1 (de) Verfahren zur in vitro evolution von polypeptiden
WO2004050871A1 (de) Gemisch mindestens zweier fusionsproteine sowie ihre herstellung und verwendung
EP3336099B1 (de) Verfahren zur selektiven bindung von zellen an einen bindungspartner und zellen umfassende vorrichtungen
EP2190982A2 (de) System, umfassend wirkstoffe umfassende partikel und bakteriophagen
EP3455301B1 (de) Korrosionsschutz
EP1863837B1 (de) Ligation synthetischer zinkfinger-peptide zu seriellen bindeproteinen für die spezifische adressierung doppelsträngiger dna-bereiche (zinkfinger-sonden)
Niide et al. Organic crystal-binding peptides: morphology control and one-pot formation of protein-displaying organic crystals
EP1504068B1 (de) Micapigmente enthaltende, wässrige pigmentpasten und ihre verwendung zur herstellung von effektgebenden wässrigen beschichtungsstoffen
DE102015006187A1 (de) Klonierungssystem und Verfahren zur Identifizierung von Interaktionspartnern in Proteinkomplexen
EP1305626A2 (de) Biosonden und deren verwendung
DE102012214202B4 (de) Verfahren zum Charakterisieren oberflächenadhäsiver Eigenschaften von Peptiden und Proteinen
DE102004040259A1 (de) Verfahren zum Schützen eines Bauteils vor Korrosion
DE10024053A1 (de) Verfahren zur Herstellung metallischer Schichten

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20100623

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL BA MK RS

17Q First examination report despatched

Effective date: 20101130

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20120501