EP1976862A2 - Nouveaux peptides et leurs applications biologiques - Google Patents

Nouveaux peptides et leurs applications biologiques

Info

Publication number
EP1976862A2
EP1976862A2 EP06841902A EP06841902A EP1976862A2 EP 1976862 A2 EP1976862 A2 EP 1976862A2 EP 06841902 A EP06841902 A EP 06841902A EP 06841902 A EP06841902 A EP 06841902A EP 1976862 A2 EP1976862 A2 EP 1976862A2
Authority
EP
European Patent Office
Prior art keywords
seq
nef
peptides
ahx
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06841902A
Other languages
German (de)
English (en)
Inventor
Daniel Baty
Yves Collette
Françoise GUERLESQUIN
Xavier Morelli
Isabelle Parrot
Stephan Arold
Serge Benichou
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Centre National de la Recherche Scientifique CNRS
Original Assignee
Centre National de la Recherche Scientifique CNRS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre National de la Recherche Scientifique CNRS filed Critical Centre National de la Recherche Scientifique CNRS
Publication of EP1976862A2 publication Critical patent/EP1976862A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/08Linear peptides containing only normal peptide links having 12 to 20 amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/001Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof by chemical synthesis
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K7/00Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
    • C07K7/04Linear peptides containing only normal peptide links
    • C07K7/06Linear peptides containing only normal peptide links having 5 to 11 amino acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the subject of the invention is new isolated, purified peptides which bind in particular the HIV-I protein Nef. It also targets their applications as inhibitors of Nef interactions with its partners in infected cells and, as such, as anti-retroviral drugs.
  • HIV acquired immunodeficiency syndrome
  • Nef constitutes a target of interest. Numerous cellular partners of Nef have been identified, including cellular proteins with an SH3 domain. Nef's involvement in the viral cycle and its important role therefore make it a prime target against which there is currently no known inhibitor. All of these arguments led the inventors to propose the protein Nef as a viral target of major importance, and to develop inhibitors capable of interfering with its biological functions, and by extension, with the replication and pathogenicity of the virus. HIV-I, on the one hand, and with the immunogenicity of infected cells, on the other.
  • the demonstration of a consensus sequence in peptides obtained by the phage-display technique and characterized makes it possible to have high value Nef inhibitor compounds and provides the means for developing a drug modeling approach targeting the complementary molecular surfaces between the Nef protein and the peptides.
  • the invention therefore aims to provide new peptides capable of specifically targeting regions of Nef involved in HIV-I infection.
  • the invention also aims to take advantage of the Nef inhibitory properties of these peptides and targets their therapeutic applications, more specifically for the treatment of HIV-I infections.
  • the isolated, purified peptides of the invention are characterized in that they contain an amino acid sequence corresponding to SEQ ID N 0 I:
  • a_ is chosen from W, A, S or D.
  • Peptides of the invention having this sequence respond to the sequence of amino acids SEQ ID No. 2:
  • Peptides of this group are decameric peptides and correspond to the following sequences SEQ ID No. 3 to SEQ ID No. 0 7: SEQ ID No. 3: NTWPWWLPTL
  • these peptides bind to Nef with an affinity of the order of a micromolar.
  • Other peptides correspond to the following sequences SEQ ID No. 8 to SEQ ID No. 13:
  • the peptides defined above can contain an amino acid sequence, comprising, where appropriate, amino acid derivatives facilitating their penetration into cells.
  • Peptides derived from this type contain, for example, at one of their ends, a sequence chosen from:
  • the invention relates in particular to peptides derived from the sequence ID N 0 II, corresponding to the following sequences SEQ ID No. 16 to SEQ ID No. 21:
  • the peptides of the invention which bind the Nef protein are easily obtained by implementing conventional techniques of peptide synthesis and constitute pure products.
  • the peptides of the invention bind to a molecular surface of Nef involved in the interaction of the latter with the SH3 domain of Hck and the kinase PAK, and required for the functions of modulation of the expression of surface area of MHC class I molecules and increased viral infectivity by Nef.
  • peptides are then the tools of choice to be used as inhibitors of the interaction between Nef and some of its cellular partners, including the SH3 domain proteins. They can also be used to develop chemical molecules from their amino acid sequences and / or their structural data and, in this application, said peptides are used directly or fused to elements facilitating their penetration into cells.
  • the peptides of the invention are particularly suitable for constituting active principles of anti-viral drugs.
  • the invention therefore also relates to pharmaceutical compositions characterized in that they comprise a therapeutically effective amount of at least one peptide as defined above, associated with pharmacologically acceptable excipients.
  • compositions are in forms suitable for their administration for anti-HIV treatment.
  • injectable compositions containing said peptides in solution or in suspension.
  • Such compositions contain for example 10 ⁇ g to 50 mg of peptide.
  • FIGS. 1 to 7 representing, respectively: FIG. 1: the alignment of the peptides binding Nef ⁇ 1 _ 57 / .
  • FIG. 2 performing ELISA tests to measure the interaction between Nef and the different partners, the phage-SH3Hck or the phage-peptide from a peptide bank,
  • FIG. 3 the displacement of the phage-peptide by Nef ⁇ i-5 7 and GST-SH3,
  • FIG. 4 the displacement of phages by synthetic peptides
  • FIG. 5 the cellular activity of the peptides
  • FIG. 6 the 1 H- 15 N HSQC spectrum
  • Nef protein (Nef HIV-I LAI) used is a recombinant protein purified from a GST-Nef ⁇ i- 57 fusion protein after cleavage by thrombin (Arold et al., 1997).
  • the protein Nef ⁇ i- 57 has been deleted from residues 1 to 57 because this region is not structured in solution and had to be cleaved to allow crystals to be obtained in order to resolve the structure of the protein.
  • the Nef protein is enriched in 15N by producing it in E. coli cultivated on minimum medium M9 where the ammonium chloride is substituted with 15NH4C1 (Eurisotop).
  • the DNA region coding for residues 62 to 118 of the Hck SH3 domain was amplified, by PCR, from the plasmid pBindHckSH3 and cloned into the phagemid vector pHenl (Hoogenboom et al., 1991) between the restriction enzyme sites. PstI and EagI.
  • This phagemid allows, in the presence of a helper phage, to express the SH3 domain fused to the N-terminal of protein 3 (p3) at the head of phage M13.
  • the fragment coding for the Hck SH3 domain was amplified by PCR using 0.1 ⁇ l of the plasmid pBindHckSH3, with 0.5 U of Dynazyme Extend DNA polymerase (Finnzymes), 10 pmoles of the 5 'primer SH3 / PstI and 10 pmoles of 3 'primer
  • the 196 bp fragment was purified on 2% agarose gel (kit
  • Two ⁇ g of phaenoid pHenl are cut in a volume of 30 ⁇ l with 5 ⁇ of PstI and 5 ⁇ of EagI in the presence of BSA, 16 h at
  • the cut phagemid is purified on 0.7% agarose gel
  • One ⁇ l of pHenl cut with PstI and EagI is ligated with 1 ⁇ l of fragment cut with PstI and EagI in a volume of 10 ⁇ l with 200U of T4 DNA ligase (Biolabs) at 16 ° C., 17 h.
  • the ligase is inactivated at 65 ° C., 15 min, and the ligation product is cut with 5U of Xhol at 37 ° C. for 4 h to remove the residual non-ligated vector, then extracted with phenol / chloroform, precipitated in the presence of 1 ⁇ g of glycogen and taken up in 10 ⁇ l of ultrapure H 2 O.
  • One ⁇ l is used to transform E. coli TGl cells made competent by the CaCl 2 - technique
  • the presence of the fragment inserted into the pHen1 plasmid is verified from the colonies isolated after transformation of the TG1 cells by making mini DNA preparations.
  • the recombinant plasmid pHenlSH3Hck is cut with PstI and EagI to verify the size of the inserted fragment.
  • a few clones having the inserted fragment are sequenced on an ABI 310 sequencer using the oligonucleotide Fuse3p of sequence SEQ ID No. 24 (5 'CCCTCATAGTTAGCGTAACG) hybridizing in the region coding for the protein p3.
  • a clone having the correct sequence is selected to verify the production of the SH3-p3 fusion protein.
  • an isolated colony is inoculated in 3 ml of 2YT / ampicillin 100 ⁇ g / ml / 2% glucose 'and incubated at 30 ° C with shaking.
  • the culture reaches an OD ⁇ OOnm of 0.5, the cells are induced with 0.1 ⁇ M final of IPTG (isopropyl- ⁇ -D-thiogalactopyranoside) and the culture is continued at 30 ° C. for 16 h. An aliquot of the culture is removed and deposited on a 10% SDS / PAGE gel.
  • the presence of the SH3-p3 fusion protein is revealed by Western blotting with the 9E10 monoclonal antibody recognizing the c-myc label located between the SH3 domain and the p3 protein.
  • This control phage called phage-SH3, is used as a positive control in ELISAs where the biotinylated protein GST-Nef ⁇ 1 _ 57 or Nef ⁇ i_ 57 is adsorbed in wells of microplates.
  • a decameric library of a diversity of 10 8 clones was constructed by insertion of degenerate oligonucleotides into a phage vector. To this end, the vector fd-tet-dogl
  • the cloning site is located between the signal sequence of the p3 protein and the p3 protein of the phage.
  • the insert was chosen so as to conserve the nucleotide sequences coding for the amino acids located downstream of the signal sequence in order to optimize the enzymatic cleavage by the endogenous peptidase.
  • the randomized part (NNK) io was chosen so as to limit the presence of STOP codons.
  • the replicative form (RF) of the phage fd-tet-dog was purified on a cesium gradient according to the protocol described in Maniatis et al. (1982). Five hundred micrograms of RF were cleaved with 700U of restriction enzymes Apal and NotI (NE Biolabs, MA, USA) and purified by extraction with phenol then precipitation with ethanol.
  • ligase NE BioLabs, MA, USA
  • the ligation product is extracted with phenol, precipitated with ethanol and taken up with 300 ⁇ l of TE.
  • Forty ⁇ l of XLl-blue cells are electroported with 2 ⁇ l of the ligation product using a micropulser (Bio-Rad, CA, USA) at 1700 volts / cm, 200 ohms, 25 ⁇ F for 5 msec and tanks of 0.1 cm. The cells are then incubated for 1 h at 37 ° C.
  • the diversity of the library was verified by DNA sequencing of a hundred clones using the oligonucleotide primer Fuse-3p SEQ ID No. 24 (CCCTCATAGTTAGCGTAACG) using an ABI Prism sequencer (Applied Biosystems, CA , USA).
  • the bank obtained is approximately 10 8 different clones.
  • Nef ⁇ 1 _ 57 binding peptides by phage-display
  • the Nef ⁇ i- 57 binding peptides were selected by the "phage display" technique from the decameric peptide library constructed as indicated above.
  • Biotinylation of the protein Nef ⁇ 1 - 57 Five hundred ⁇ g of the protein Nef ⁇ i_ 57 are dialyzed against PBS for 16 h at 4 ° C. and biotinylated with biotin according to the manufacturer's recommendations (Biotin Protein
  • the culture supernatant containing the phage-peptide is precipitated with 1.5 vol of 16.7% (weight / volume) of PEG 8000 / 3.3 M NaCl for 16 h at 4 ° C., then centrifuged at 12000 g, 20 min at 4 ° C and the pellet is taken up in 50 ml of PBS (0.14 M NaCl; 0.01 M Phosphate buffer, pH 7.4). A second precipitation is carried out under the same conditions, but for 1 h. The base is taken up with •! ml of PBS. The solution is filtered on a 0.45 ⁇ m filter and stored at 4 ° C. It contains approximately 10 13 phage peptides.
  • Three or 4 rounds of selection and amplification are carried out to isolate the phage-peptide specific for Nef ⁇ i_ 57 .
  • the beads are washed 5 times with PBS / milk, 5 times with PBS / 0.1% Tween-20 and 5 times with PBS and finally resuspended with 100 ⁇ l of PBS.
  • Phages-peptide are amplified by infecting bacterial cells
  • the isolated colonies are cultured in microplate wells
  • the solid support used is a Rink-Amide 100-200 mesh resin allowing automatic synthesis by a conventional strategy of the fmoc type.
  • the first fmoc-amino acid aai is first attached to the solid support (100 to 200 mg of resin per well).
  • the robot distributes the following solutions in each well: (i) a solution of 0.5 M HBTU in DMF, (ii) a solution of N-methylmorpholine IM in DMF, and (iii) a solution of AA at 0.5M in NMP.
  • the reaction mixture is stirred for 90 minutes, then a series of washing (DMF, MeOH, DCM, DMF) is carried out automatically before proceeding to a double coupling with the same amino acid.
  • the side chain of the first amino acid as well as that of all the amino acids which will be incorporated during the synthesis are protected by various conventional acid-protecting protective groups permanently, and this until the final release of the peptide.
  • the first grafted amino acid is deprotected in the I ⁇ 7-terminal position of its fmoc function by a solution of piperidine 20% in dichloromethane. After various successive washings, the first amino acid is then coupled to the next amino acid, the terminal amino part of which is protected by an fmoc group.
  • the robot distributes in each well the following solutions: (i) a solution of HBTU 0.5 M in DMF, (ii) a solution of N-methylmorpholine IM in DMF, and (iii) a solution of I ' aa 2 to 0.5M in NMP.
  • reaction mixture is stirred for 90 minutes, then a new series of washing is carried out before carrying out a double coupling with the same amino acid.
  • the cycles of deprotection of the fmoc group, of coupling of the next amino acid are then repeated automatically until the coupling and deprotection of the last amino acid aa n .
  • the cleavage is carried out semi-automatically with a TFA / H 2 0 / TIS 95 / 2.5 / 2.5 solution. with stirring for 2 hours.
  • the peptides are then precipitated with ether, centrifuged, and the supernatant is then removed. The operation is repeated 3 times, then the ether is evaporated.
  • the peptide is then dissolved in a solution of H2 ⁇ / Acetonitrile 50/50 before being lyophilized.
  • biotinylated peptides which can then be detected by an appropriate probe (for example streptavidin-FITC) have been synthesized. These peptides are first of all synthesized semi-automatically on solid phase by the fmoc strategy previously described.
  • N-terminal is deprotected and a conventional manual coupling of peptide type is carried out with biotin (Sigma-Aldrich ® , ref. 86,164-2).
  • biotin Sigma-Aldrich ® , ref. 86,164-2.
  • the cleavage of the resin corresponds to the final step, making it possible to unhook the labeled peptide from the solid support.
  • the purity of the biotinylated peptide is analyzed by HPLC,
  • Nef ⁇ i- 57 protein cleaved from the GST protein by thrombin is biotinylated, then adsorbed in microplate wells coated with streptavidin ( Figure 2).
  • a first positive control consisted of incubating the well with an anti-Nef monoclonal antibody (MATG0020) and revealing the interaction Nef ⁇ l-57 / anti-Nef with a secondary anti-mouse antibody labeled with peroxidase.
  • a second positive control uses phage-SH3.
  • the phage-SH3 was incubated with an anti-phage mAb (phage p8 protein), then the interaction revealed with a secondary anti-mouse antibody labeled with alkaline phosphatase .
  • the competitors Nef ⁇ i_ 57 , GST-SH3 or the synthetic peptides are added at different concentrations to the phages.
  • the phage-peptide 07B2S3 (") and 08B2S3 ( ⁇ ) from the decameric library and the control phage SH3-Hck (•) linked on Nef ⁇ i- 57 are similarly characterized by a competitive ELISA ( Figure 3) .
  • the wells adsorbed with biotinylated Nef ⁇ i_ 57 (Fig. 3A) or GST-Nef ⁇ i- 57 (Fig. 3B) are incubated with 10 11 unit phages, then with different quantities of Nef ⁇ i_ 57 or the SH3 domain of Hck fused to the GST protein, used as a competitor.
  • Nef ⁇ i_ 57 Very small amounts of Nef ⁇ i_ 57 are sufficient to displace the Nef ⁇ i_ 57 / phage-peptide interaction and reveals IC50s of the order of a micromolar. Equivalent results are obtained with the other phage-peptide.
  • the affinity and specificity of the phage-peptide were also determined by a competitive ELISA using synthetic peptides ( Figure 4).
  • the phage-peptide 08B2S3 ( ⁇ ) from the decameric library and the control phage SH3-Hck (•) linked on Nef ⁇ 1 _ 57 are displaced in an ELISA by competition with the synthetic peptide 2.
  • Equivalent results are obtained with the other phage-peptide and the other peptides.
  • the other peptides described in FIG. 1 have a curve entirely equivalent to that obtained with peptide 2.
  • IC50s of the order of a micromolar have indeed been measured.
  • the specificity of the peptides can also be determined directly from cell extracts.
  • COS-7 cell lysates expressing Nef are incubated with the GST-SH3 Hck fusion protein in the presence of increasing amounts of the peptide. The mixture is then deposited on a specific affinity column of the GST. The column is then washed and the eluted extract is analyzed by SDS-PAGE and anti-Nef immunoblotting. We thus deduce an IC50 value for the peptides inhibiting the interaction Nef-SH3 in a cellular context of native Nef protein.
  • a cell test based on the principle of the double hybrid adapted to mammalian cells has been developed, making it possible to evaluate the cellular activity of peptides capable of penetrating the plasma membrane. This test makes it possible to integrate the parameters of cellular toxicity and bioavailability thanks to a quantitative and functional reading of the interaction between two protein partners.
  • the CheckMate TM commercial system (Promega) was adapted to the Nef HIV-I (Lai) / SH3-Hck pair in culture of COS-7 cells (FIG. 5).
  • This system combines the expression of firefly luciferase under the dependence of the interaction between • Nef and the SH3 domain of Hck, and that, independent, of renilla luciferase, witnessing cell viability.
  • the intensity ratio of these two luciferases makes it possible to quantify the activity of a competitor of the Nef-SH3 interaction capable of penetrating inside the cell and whose half-life is sufficient in the time interval. of the analysis.
  • the cells are transfected using Fugene ⁇ (Roche), according to the distributor's protocol. Briefly, the plasmids PG5 (300 ng), pAct or pActNef (400 ng), pBindHckmuté or pBindHck (100 ng) and pbcks (200 ng) are mixed, then Fugene 6 (3 ⁇ l diluted in 100 ⁇ l of DMEM culture medium ) is added. The plasmids mixture / Fugene ⁇ is left 'in the reaction for a period of 15 min at room temperature and then was introduced dropwise into the cell culture well.
  • Fugene ⁇ Fugene ⁇
  • the cells are harvested by treatment with trypsin (Gibco, ref 25300-054), washed, then distributed in 96-well plates (reference 353072, Beckton Dickinson). 50 ⁇ l of DMEM culture medium are then added to each well.
  • the activity of a candidate inhibitor compound is tested by adding 25 ⁇ l of this diluted compound to the well already containing 50 ⁇ l of the cell culture, and the luciferase activity is determined 24 hours later in each well using the assay kit. DualGlo according to the supplier's recommendations (Promega).
  • the peptide of sequence ID N 0 Il does not exhibit any significant biological activity at low concentration by comparison with a control molecule and this for concentrations varying from 10 to 50 ⁇ M of the peptide (FIG. 5B), and under different experimental conditions, notably alternating the time and duration of addition of the peptide.
  • This peptide synthesized in a biotinylated form did not allow visualization of cell penetration in a test using secondary labeling using a probe coupled to a fluorochrome, followed by an analysis by confocal microscopy, suggesting that the peptide does not penetrate spontaneously the plasma membrane and / or is rapidly degraded or exported to the extra-cellular medium.
  • New peptides have been synthesized by incorporating in the N-terminal position of the sequence ID N 0 II various peptide sequences or sequences of amino acid derivatives
  • 15 N- 1 H HSQC spectra of the 15 N-Nef protein were recorded on a 500 MHz NMR spectrometer (DRX 500 Bruker) at 308K.
  • the conditions for sample preparation are identical to those used by Grzesiek et al. in 1997, for the allocation of heteronuclear NMR spectra.
  • the concentration of Nef in the samples is 0, ImM ( Figure 6), tris 5mM pH 8.0, 5mM DTT.
  • the soaking method is used to determine the structure of peptides in complex with Nef. For this, crystals of Nef ⁇ i- 56 and Nef ⁇ i_ 57 were produced as previously described (Arold et al., 1997). After reaching a sufficient size for a crystallographic analysis
  • Nef The study of the positive influence of Nef on viral replication is carried out by standard techniques for measuring the infectious capacities of HIV-I (Craig et al., 1998; Madrid et al., 2005). Initial analyzes are • performed using a prototype laboratory provirus, HIV-I pNL4-3. Briefly, the effect of the Nef inhibitor peptides will be evaluated on the virions produced by transient transfection of 293T cells by the wild provirus and used to infect HeLa-CD4 target cells (clone P4) containing an integrated copy of the LacZ gene dependent on the HIV-I LTR. 48 h after infection, the infectious power of the viruses is evaluated by counting the cells expressing ⁇ -galactosidase activity.
  • Nef-induced alteration of the early / recycling endosomal compartment correlates with enhancement of HIV-I infectivity. J. Biol. Chem. , 280: 5032- 5044.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Virology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • AIDS & HIV (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention a pour objet de nouveaux peptides isolés, purifiés, possédant notamment des propriétés de liaison à la protéine Nef, caractérisés en ce qu'ils renferment une séquence en acides aminés répondant à SEQ ID N°1 : W-P-a-W-L-P dans laquelle a est choisi parmi W, A, S ou D.

Description

Nouveaux peptides et leurs applications biologiques
L'invention a pour objet de nouveaux peptides isolés, purifiés, liant en particulier la protéine Nef de VIH-I. Elle vise également leurs applications comme inhibiteurs des interactions de Nef avec ses partenaires dans les cellules infectées et, à ce titre, comme médicaments anti-rétroviraux.
La virulence du VIH résulte de son importante capacité réplicative ainsi que de son caractère pathogène mis en évidence dans des modèles animaux non permissifs à la réplication virale. Plusieurs produits de gènes viraux contribuent directement et indirectement à la pathogénicité, et sont impliqués dans le développement d'un syndrome d' immunodéficience acquise (SIDA).
Parmi ces protéines, Nef constitue une cible d'intérêt. De nombreux partenaires cellulaires de Nef ont été identifiés dont les protéines cellulaires à domaine SH3. L'implication de Nef dans le cycle viral et son rôle important en font donc une cible de choix contre laquelle il n'existe aujourd'hui aucun inhibiteur connu. L'ensemble de ces arguments a conduit les inventeurs à proposer la protéine Nef comme une cible virale d'importance majeure, et à développer des inhibiteurs susceptibles d'interférer avec ses fonctions biologiques, et par extension, avec la réplication et la pathogénicité du virus VIH-I, d'une part, et avec l' immunogénicité des cellules infectées, d'autre part.
En particulier, la mise en évidence d'une séquence consensus chez des peptides obtenus par la technique de phage- display et caractérisés, permet de disposer de composés inhibiteurs de Nef de grande valeur et fournit les moyens pour développer une approche de modélisation de drogues ciblant les surfaces moléculaires complémentaires entre la protéine Nef et les peptides . L'invention a donc pour but de fournir de nouveaux peptides capables de cibler spécifiquement des régions de Nef impliquées dans l'infection par le VIH-I.
Elle vise également à fournir des moyens permettant d'obtenir de tels peptides.
L'invention a également pour but la mise à profit des propriétés inhibitrices de Nef de ces peptides et vise leurs applications thérapeutiques, plus spécialement pour le traitement d'infections par le VIH-I.
Les peptides isolés, purifiés, de l'invention sont caractérisés en ce qu'ils renferment une séquence en acides aminés répondant à SEQ ID N0I :
W-P-a-W-L-P
dans laquelle
a_ est choisi parmi W, A, S ou D.
Des peptides de l'invention présentant cette séquence répondent à l'enchaînement en acides aminés SEQ ID N°2 :
b - W - P - a - W - L -P -c - d -f dans lequel
b = R/T ou est absent
a est tel que défini ci-dessus
c = Q , T, L, G, H ou est absent
d = L, W, A ou est absent
f = P ou est absent.
Des peptides de ce groupe sont des peptides décamériques et répondent aux séquences SEQ ID N°3 à SEQ ID N07 suivantes : SEQ ID N°3 : N T W P W W L P T L
SEQ ID N°4 : Y R W P A W L P L W
SEQ ID N°5 : N W R W P W W I P G
SEQ ID N°6 : T W P W W L P H A P
SEQ ID N°7 : W P S W L P Q L P F
De manière avantageuse, ces peptides se lient à Nef avec une affinité de l'ordre du micromolaire. D'autres peptides répondent aux séquences SEQ ID N°8 à SEQ ID N°13 suivantes :
SEQ ID N°8 : W P S W L P Q
SEQ ID N°9 : W P S W L P
SEQ ID N0IO : W P W W L P
SEQ ID N0Il : W P A W L P
SEQ ID N°12 : W P D W L P
SEQ ID N°13 : W P S W L P Q L P
Selon un mode de réalisation de l'invention, les peptides définis ci-dessus peuvent renfermer une séquence d' acides aminés, comportant, le cas échéant, des dérivés d'acides aminés facilitant leur pénétration dans les cellules.
Des peptides dérivés de ce type contiennent par exemple, à l'une de leurs extrémités, une séquence choisie parmi :
(R)n avec n= 6 à 8 ; R (Λ R R) ni, avec nl= 1 à 3 ;R(Ahx R) n2, avec n2= 1 à 6 ; SEQ ID N°14 :K K R R Q R R R ; et SEQ ID N°15 : R Q I K I W F Q N R Nie K W K K.
Dans ces séquences, "Ahx" représente un motif acide amino- hexanoïque et « Nie» , la nor-leucine.
L'invention vise en particulier des peptides dérivés de la séquence ID N0Il, répondant aux séquences SEQ ID N°16 à SEQ ID N°21 suivantes :
SEQ ID N°16 R R R R R RW PAW L P
SEQ ID N°17 RR R R R R R RW PAW L P
SEQ ID N°18 RA R RA R RAR RW PAW L P
SEQ ID N°19 R Ahx R Ahx R Ahx R Ahx R Ahx R Ahx R W P A W L P SEQ ID N°20 K K R R Q R R RW P AW L P
SEQ ID N°21 R Q I K I W F Q N R Nie K W K K W P AW L P
Les peptides de 1 ' invention qui lient la protéine Nef sont aisément obtenus en mettant en œuvre les techniques classiques de synthèse peptidique et constituent des produits purs.
Les peptides de 1 ' invention se fixent sur une surface moléculaire de Nef impliquée dans l'interaction de cette dernière avec le domaine SH3 de Hck et la kinase PAK, et requise pour les fonctions de modulation de l'expression de surface des molécules du CMH de classe I et l'augmentation de 1 ' infectivité virale par Nef.
Ces peptides sont alors des outils de choix pour être utilisés comme inhibiteurs de l'interaction entre Nef et certains de ses partenaires cellulaires, dont les protéines à domaine SH3. Ils sont également utilisables pour développer des molécules chimiques à partir de leurs séquences en acides aminés et/ou de leurs données structurales et, dans cette application, lesdits peptides sont utilisés directement ou fusionnés à des éléments facilitant leur pénétration dans les cellules .
Ils permettent en effet d'élaborer des molécules (peptides modifiés ou molécules chimiques) inhibant l'interaction de Nef avec certains de ses partenaires " cellulaires, dont les protéines à domaine SH3, et ayant donc des effets sur les fonctions cellulaires et virales modulées par Nef via ces interactions, en particulier la propagation du virus VIH-I chez l'hôte infecté.
Compte tenu de leurs propriétés, les peptides de 1 ' invention sont particulièrement appropriés pour constituer des principes actifs de médicaments anti-viraux.
L'invention vise donc également des compositions pharmaceutiques caractérisées en ce qu'elles comprennent une quantité thérapeutiquement efficace d'au moins un peptide tel que défini ci-dessus, associé à des excipients pharmacologiquement acceptables .
Ces compositions se présentent sous des formes appropriées pour leur administration en vue d'un traitement anti-HIV. Il s'agit avantageusement de compositions injectables renfermant lesdits peptides en solution ou en suspension. De telles compositions' renferment par exemple de lOμg à 50 mg de peptide . D'autres caractéristiques et avantages de l'invention sont donnés dans les exemples qui suivent qui comportent des références aux figures 1 à 7, représentant, respectivement : la figure 1 : l'alignement des peptides liant NefΔ1_57/ . - la figure 2 : la réalisation de tests ELISA pour mesurer l'interaction entre Nef et les différents partenaires, le phage-SH3Hck ou les phages-peptide issus d'une banque de peptides,
la figure 3 : le déplacement des phages-peptide par NefΔi- 57 et GST-SH3,
la figure 4 : le déplacement des phages par des peptides de synthèse,
la figure 5 : l'activité cellulaire des peptides,
- la figure 6 : le spectre 1H-15N HSQC, et
- la figure 7 : les spectres HSQC de Nef.
La protéine Nef
La protéine Nef (Nef HIV-I LAI) utilisée est une protéine recombinante purifiée à partir d'une protéine de fusion GST- NefΔi-57 après clivage par la thrombine (Arold et al., 1997) . La protéine NefΔi-57 a été délétée des résidus 1 à 57 car cette région n' est pas structurée en solution et a dû être clivée pour permettre l'obtention de cristaux afin de résoudre la structure de la protéine.
Afin de réaliser les expériences de RMN hétéronucléaire, la protéine Nef est enrichie en 15N en la produisant dans E. coli cultivée sur milieu minimum M9 où le chlorure d' ammonium est substitué par du 15NH4C1 (Eurisotop) .
1. Construction d' un phage contrôle exprimant à sa surface la région RT du domaine SH3 de Hck
La région d'ADN codant pour les résidus 62 à 118 du domaine SH3 de Hck a été amplifiée, par PCR à partir du plasmide pBindHckSH3 et clonée dans le vecteur phagemidique pHenl (Hoogenboom et al., 1991) entre les sites des enzymes de restriction PstI et EagI . Ce phagemide permet, en présence d'un phage helper, d'exprimer le domaine SH3 fusionné en N- terminal de la protéine 3 (p3) à la tête du phage M13.
Séquences SEQ ID N°22 et 23 des oligonucléotides utilisés : 5' SH3/PstI
SEQ ID N°22: AATGCAAAACTGCAGGTGGTTGCCCTGTATG
3' SH3/EagI
SEQ ID N023 : TTTGTTCTGCGGCCGCGTCAACGCGGGCGAC
Conditions de PCRl
Le fragment codant pour le domaine SH3 de Hck a été amplifié par PCR en utilisant 0,1 μl du plasmide pBindHckSH3, avec 0,5 U de Dynazyme Extend DNA polymerase (Finnzymes) , 10 pmoles de l'amorce 5' SH3/PstI et 10 pmoles de l'amorce 3'
SH3/EagI, dans un volume de 50 μl (94°C, 3 min; 940C, 1 min;
600C, 1 min ; 72°C, 1min ; 37 cycles puis 72°C, 10 min) . Le fragment de 196 pb a été purifié sur gel d' agarose 2% ( kit
« Qiaquick gel extraction », Qiagen) , puis coupé dans un volume de 30 μl avec 5U de PstI et 5U de EagI en présence de
BSA, 16 h à 37°C. Les enzymes sont détruites 15 min à 65°C et le fragment d'ADN coupé (168 pb) est extrait au phénol/chloroforme puis précipité à l'éthanol. Le fragment d'ADN est repris avec 10 μl d'H2θ ultrapure, puis contrôlé sur gel d' agarose 2%.
Préparation du vecteur :
Deux μg de phagemide pHenl sont coupés dans un volume de 30 μl avec 5ϋ de PstI et 5ϋ de EagI en présence de BSA, 16 h à
37 °C. Le phagemide coupé est purifié sur gel d' agarose 0,7%
(kit « Qiaquick gel extraction », Qiagen) . Les enzymes sont détruites 15 min à 650C et l'ADN est extrait au phénol/chloroforme, puis précipité à l'éthanol. Le pHenl coupé est contrôlé sur gel d' agarose 0,7%, quantifié et repris dans
10 μl d'H2O ultrapure. Ligature :
Un μl de pHenl coupé par PstI et EagI est ligaturé avec 1 μl de fragment coupé par PstI et EagI dans un volume de 10 μl avec 200U de T4 DNA ligase (Biolabs) à 160C, 17 h. La ligase est inactivée à 650C, 15 min, et le produit de ligature est coupé par 5U de Xhol à 370C pendant 4 h pour éliminer le vecteur résiduel non ligaturé, puis extrait au phénol/chloroforme, précipité en présence de 1 μg de glycogène et repris dans 10 μl d'H2O ultrapure. Un μl est utilisé pour transformer des cellules d' E. coli TGl rendues compétentes par la technique au CaCl2-
Vérification des clones exprimant le domaine SH3 :
La présence du fragment inséré dans le plasmide pHenl est vérifiée à partir des colonies isolées après transformation des cellules TGl en réalisant des minipréparations d'ADN. Le plasmide recombinant pHenlSH3Hck est coupé par PstI et EagI pour vérifier la taille du fragment inséré. Quelques clones possédant le fragment inséré sont séquences sur séquenceur ABI 310 en utilisant l' oligonucléotide Fuse3p de séquence SEQ ID N°24 (5' CCCTCATAGTTAGCGTAACG) hybridant dans la région codant pour la protéine p3. Un clone possédant la bonne séquence est sélectionné pour vérifier la production de la protéine fusion SH3-p3. Pour cela, une colonie isolée est inoculée dans 3 ml de 2YT / ampicilline 100 μg/ml / 2% glucose' et incubée à 30 °C avec agitation. Lorsque la culture atteint une DOβOOnm de 0,5, les cellules sont induites avec 0,lμM final d'IPTG (isopropyl- α-D-thiogalactopyranoside) et la culture est poursuivie à 300C pendant 16 h. Un aliquot de la culture est prélevé et déposé sur un gel SDS/PAGE 10%. La présence de la protéine fusion SH3-p3 est révélée par Western blot avec l'anticorps monoclonal 9E10 reconnaissant l'étiquette c-myc localisée entre le domaine SH3 et la protéine p3. Ce phage contrôle, appelé phage-SH3, est utilisé comme témoin positif dans des ELISA où la protéine GST-NefΔ1_57 ou NefΔi_57 biotinylée est adsorbée dans des puits de micoplaques.
2. Construction d/ une banque de peptides décamériques
Une banque décamérique d'une diversité de 108 clones a été construite par insertion d' oligonucléotides dégénérés dans un vecteur phagique . A cette fin, le vecteur fd-tet-dogl
(Hoogenboom et al., 1991) a été utilisé, ce vecteur présentant une résistance à la tétracycline et comportant tout le support génétique nécessaire à la synthèse de bactériophages . Des inserts dégénérés codant pour 10 acides aminés ont été introduits en amont de la séquence codant pour la protéine mineure de la capside du phage, la protéine p3.
Le site de clonage est situé entre la séquence signal de la protéine p3 et la protéine p3 du phage. L' insert a été choisi de manière à conserver les séquences nucléotidiques codant pour les acides aminés situés en aval de la séquence signal afin d' optimiser le clivage enzymatique par la peptidase endogène. La partie randomisée (NNK) io a été choisie de manière à limiter la présence de codons STOP.
Préparation du vecteur de clonage :
La forme réplicative (RF) du phage fd-tet-dog a été purifiée sur gradient de césium selon le protocole décrit dans Maniatis et al. (1982) . Cinq cents microgrammes de RF ont été clivés avec 700U d'enzymes de restriction Apal et Notl (NE Biolabs, MA, USA) et purifiés par extraction au phénol puis précipitation à l ' éthanol .
Préparation des fragments à insérer :
séquences des oligonucléotides SEQ ID N°25 et 26:
SEQ ID N° 25 : 5' CGTCATACCTTCGATCAAGCACAGTGCACAG
SEQ ID N°2β :
5 ' CTTCAACAGTTTCTGCGGCCGCACCACC (MNN) 10CTGTGCACTGTGCTTGAT
Deux cents picomoles de chacun des oligonucléotides de SEQ ID N°25 et 26 sont hybrides dans un volume final de lOOμl contenant 1 mM de dNTP et 20 U de Dynazyme (Finn-zymes, Helsinki, Finland) , puis dénaturés à 950C pendant 3 min. Une élongation est réalisée par 30 cycles successifs (48°C 1 min et 720C 1 min) . Le produit d'élongation est traité 2 fois au phénol/chloroforme précipité à l'éthanol et clivé avec les 10 U de chacune des enzymes Apal et Notl pendant 16 h à 370C. Les fragments d'ADN sont ensuite purifiés par électrophorèse sur gel de polyacrylamide 15%. A cette fin, la bande correspondant au poids moléculaire attendu est excisée et purifiée par diffusion dans du PBS pendant 16 h à 200C sous agitation.
Ligature :
Cinq microgrammes de fragments sont ensuite ligaturés avec 300 microgrammes de vecteur en présence de 6 U de ligase (NE BioLabs, MA, USA) dans un volume final de 200 μl pendant 16 h à 20 °C. Le produit de ligature est extrait au phénol, précipité à l'éthanol et repris avec 300 μl de TE. Quarante μl de cellules XLl-blue sont électroportées avec 2 μl du produit de ligature en utilisant un micropulseur (Bio-Rad, CA, USA) à 1700 volts/cm, 200 ohms, 25 μF pendant 5 msec et des cuves de 0,1 cm. Les cellules sont ensuite incubées pendant 1 h à 370C dans 1 ml de 2YT contenant 20 μg/ml de tetracycline, puis étalées sur des boîtes agar/2YT/tetracycline et incubées 16 h à 370C. Cent cinquante électroporations sont ainsi réalisées.
La diversité de la banque a été vérifiée par séquençage de l'ADN d'une centaine de clones en utilisant l'amorce oligonucléotidique Fuse-3p SEQ ID N°24 (CCCTCATAGTTAGCGTAACG) au moyen d'un séquenceur ABI Prism (Applied Biosystems, CA, USA). La banque obtenue est d'environ 108 clones différents.
3. Sélection de peptides liant NefΔ1_57 par phage-display Les peptides liant NefΔi-57 ont été sélectionnés par la technique du « phage display » à partir de la banque de peptides décamérique construite comme indiqué ci-dessus.
Biotinylation de la protéine NefΔ1-57. Cinq cents μg de la protéine NefΔi_57 sont dialyses contre du PBS pendant 16 h à 40C et biotinylés avec de la biotine selon les recommandations du fabricant (Biotin Protein
Labeling Kit, Roche Diagnostic, Baie, Suisse) . La concentration de la protéine biotinylée est mesurée par colorimétrie (Kit Biorad, CA, USA). L'efficacité de la biotinylation est vérifiée par ELISA en utilisant des microplaques adsorbées avec de la streptavidine
(ThermoLabsystem, Helsinki, Finlande) et en révélant la protéine avec un anticorps monoclonal anti-NEF (MATG0020, Transgène) et un anticorps secondaire anti-anticorps de souris couplé à la phosphatase alcaline.
Production des phages-peptide.
Un aliquot de la banque (cellules XLl-blue contenant les phages-peptide) est incubé 16 h à 370C dans 500 ml de 2YT/ tetracycline 20 μg/ml avec agitation, puis centrifugé 2 fois à 6000 g pendant 10 min à 40C. Le surnageant de culture contenant les phages-peptide est précipité avec 1,5 vol de 16,7% (poids/volume) de PEG 8000/NaCl 3,3 M pendant 16 h à 40C, puis centrifugé à 12000 g, 20 min à 4°C et le culot est repris avec 50 ml de PBS (0,14 M NaCl ; 0,01 M tampon Phosphate, pH 7,4). Une deuxième précipitation est réalisée dans les mêmes conditions, mais pendant I h. Le culot est repris avec •! ml de PBS. La solution est filtrée sur filtre 0,45 μm et conservée à 4°C. Elle contient environ 1013 phages- peptide.
Sélection des phages-peptide .
Trois ou 4 tours de sélection et d' amplification sont réalisés pour isoler les phages-peptide spécifique de NefΔi_57.
A chaque tour, 20 μg de NefΔ1_57 biotinylée sont incubées avec 1011 phages (10 μl) dans 500 μl de PBS contenant 4% (poids/volume) de poudre de lait écrémé (PBS/lait) pendant 1 h à 200C avec agitation. Un mg" de billes magnétiques recouvertes de streptavidine (Dynabeads M-280 Streptavidin ; Dynal Biotech, Oslo, Norvège) sont préalablement incubées 1 h à 2O0C avec du PBS/lait est ensuite ajouté pendant 30 min à 200C avec agitation. Les billes sont lavées 5 fois avec du PBS/lait, 5 fois avec du PBS/0,1% Tween-20 et 5 fois avec du PBS et finalement resuspendues avec 100 μl de PBS. Les phages-peptide sont amplifiés en infectant des cellules bactériennes
TGl (Δ(lac-pro) , supE, thi, hsdD5/F' , traD3β, proAB, lacl^, lac ZΔM15) dans 100 ml de 2YT/ tetracycline 20μg/ml pendant 16 h à 37°C. Une portion est étalée sur des boîtes agar/2YT/tetracycline pour obtenir des colonies isolées.
Après 3 ou 4 tours de sélection/amplification les colonies isolées sont mises en culture dans des puits de microplaques
(Nunclon, Milian, Genève, Suisse) pendant 16 h à 370C. Les plaques sont ensuite centrifugées (1000 g) et les surnageants contenant les phages-peptide sont analysés par ELISA pour déterminer leur spécificité. Les régions des ADN des phages positifs en ELISA correspondant à la région codant pour les peptides ont été séquencées. Cinq séquences différentes SEQ ID N°3 à 7 ont été obtenues et ont permis de définir une séquence consensus SEQ ID N° 2 (Figure 1) .
4. Synthèse des peptides
Les cinq peptides décamériques SEQ ID N°3 à 7 les plus affins pour Nef sélectionnés par la technique de phage-display précédemment décrite, ont été synthétisés. Puis, d'autres peptides de tailles variées SEQ ID N°8 et 21, analogues ou homologues au motif consensus découvert, ont également été synthétisés en utilisant la méthode générale suivante.
Des peptides de type " H2N-aan-... aaχ~ CONH2 " ont ainsi été préparés de manière semi-automatique sur phase solide, grâce à un robot de synthèse en chimie parallèle ACT 400 possédant des plaques 40 et 96 puits.
Le support solide utilisé est une résine Rink-Amide 100- 200 mesh permettant une synthèse automatique par une stratégie conventionnelle de type fmoc. De manière totalement automatique, le premier fmoc- aminoacide aai est dans un premier temps accroché sur le support solide (100 à 200 mg de résine par puit) . Pour le couplage le robot distribue dans chaque puit les solutions suivantes : (i) une solution de HBTU 0.5 M dans du DMF, (ii) une solution de N-méthylmorpholine IM dans du DMF, et (iii) une solution de l'aaχ à 0.5M dans du NMP. Le mélange réactionnel est agité pendant 90 minutes, puis une série de lavage (DMF, MeOH, DCM, DMF) est effectuée automatiquement avant de procédé à un double couplage avec le même aminoacide. La chaîne latérale du premier aminoacide ainsi que celle de tous les aminoacides qui seront incorporés au cours de la synthèse sont protégées par différents groupements protecteurs conventionnels acidolabiles de manière permanente, et ce jusqu'au décrochage final du peptide.
Dans un deuxième temps, et de manière toujours automatique, le premier aminoacide greffé est déprotégé en position I\7-terminale de sa fonction fmoc par une solution de pipéridine 20% dans le dichlorométhane. Après différents lavages successifs, le premier aminoacide est ensuite couplé à 1' aminoacide suivant dont la partie aminée terminale est protégée par un groupement fmoc. Pour le couplage, le robot distribue dans chaque puit les solutions suivantes : (i) une solution de HBTU 0.5 M dans du DMF, (ii) une solution de N- méthylmorpholine IM dans du DMF, et (iii) une solution de I'aa2 à 0.5M dans du NMP. Le mélange réactionnel est agité pendant 90 minutes, puis une nouvelle série de lavage est effectuée avant de procéder à un double couplage avec le même aminoacide. Les cycles de déprotection du groupement fmoc, de couplage de l' aminoacide suivant sont alors répétés de manière automatique jusqu'au couplage et à la déprotection du dernier aminoacide aan.
Dans une dernière étape, le clivage s'effectue de manière semi-automatique avec une solution de TFA/H20/TIS 95/2.5/2.5 sous agitation pendant 2 heures. Les peptides sont ensuite précipités à l'éther, centrifugés, et le surnageant est ensuite éliminé. L'opération est renouvelée 3 fois, puis l'éther est évaporé. Le peptide est alors dissous dans une solution de H2θ/Acétonitrile 50/50 avant d'être lyophilisé.
Cette synthèse automatisée a permis de concevoir des peptides amides. Si souhaité par l'utilisation d'une résine de type PS-2-Chlorotrityle les analogues acides sont préparés. La pureté des peptides synthétisés est évaluée par un couplage LC-MS. Si besoin les peptides sont purifiés par HPLC préparative .
Afin d'évaluer la pénétration cellulaire des peptides et leur localisation sub-cellulaire, des peptides biotinylés qui pourront ensuite êtres détectés par une sonde appropriée (par exemple streptavidine-FITC) ont été synthétisés. Ces peptides sont tout d' abord synthétisés de manière semi-automatique sur phase solide par la stratégie fmoc précédemment décrite.
Cependant, avant clivage de la résine, la fonction aminée
N-terminale est déprotégée et un couplage manuel conventionnel de type peptidique est réalisé avec la biotine (Sigma-Aldrich®, réf. 86,164-2) . Le clivage de la résine correspond à l'étape finale, permettant de décrocher le peptide marqué du support solide. La pureté du peptide biotinylé est analysée par HPLC,
LC-MS. Une étape de purification par HPLC préparative peut être ensuite réalisée en fonction de la pureté observée.
5. Spécificité des peptides
Des ELISA ont été développés selon lesquels :
• soit la protéine NefΔi-57 fusionnée à la GST est directement adsorbée dans les puits de microplaques,
• soit la protéine NefΔi-57 clivée de la protéine GST par la thrombine est biotinylée, puis adsorbée dans des puits de microplaques recouverts de streptavidine (Figure 2) . Un premier contrôle positif a consisté à incuber le puit avec un anticorps monoclonal anti-Nef (MATG0020) et à révéler l'interaction NefΔl-57/anti-Nef avec un anticorps secondaire anti-anticorps de souris marqué à la peroxydase. Un deuxième contrôle positif utilise le phage-SH3. Après addition dans des puits adsorbés avec NefΔl-57, le phage- SH3 a été incubé avec un mAb anti-phage (protéine p8 du phage) , puis l'interaction révélée avec un anticorps secondaire anti-anticorps de souris marqué à la phosphatase alcaline.
Pour les ELISA de compétition, les compétiteurs NefΔi_57, GST-SH3 ou les peptides de synthèse sont ajoutés à différentes concentrations aux phages.
Les phages-peptide 07B2S3 (») et 08B2S3 (φ) issus de la banque décamérique et le phage contrôle SH3-Hck (•) liés sur NefΔi-57 sont caractérisés de la même façon par un ELISA de compétition (Figure 3) . Les puits adsorbés avec NefΔi_57 biotinylée (Fig. 3A) ou GST-NefΔi-57 (Fig. 3B) sont incubés avec 1011 phages unitaires, puis avec différentes quantités de NefΔi_ 57 ou le domaine SH3 de Hck fusionné à la protéine GST, utilisés comme compétiteur. De très faibles quantités de NefΔi_ 57 sont suffisantes pour déplacer l'interaction NefΔi_57/phage- peptide et révèle des IC50 de l'ordre du micromolaire. Des résultats équivalents sont obtenus avec les autres phages- peptide .
L'affinité et la spécificité des phages-peptide ont aussi été déterminées par un ELISA de compétition en utilisant des peptides de synthèse (Figure 4) . Le phage-peptide 08B2S3 (^) issus de la banque décamérique et le phage contrôle SH3-Hck (•) liés sur NefΔ1_57 sont déplacés dans un ELISA par compétition avec le peptide 2 de synthèse. Des résultats équivalents sont obtenus avec les autres phages-peptide et les autres peptides. Les autres peptides décrits dans la figure 1 présentent une courbe tout à fait équivalente à celle obtenue avec le peptide 2. Des IC50 de l'ordre du micromolaire ont en effet été mesurées . La spécificité des peptides peut aussi être déterminée directement à partir d'extraits cellulaires. Des lysats de cellules COS-7 exprimant Nef sont incubés avec la protéine de fusion GST-SH3Hck en présence de quantités croissantes du peptide. Le mélange est ensuite déposé sur une colonne d'affinité spécifique de la GST. La colonne est ensuite lavée et l'extrait élue est analysé par SDS-PAGE et immunoblotting anti-Nef. On déduit ainsi une valeur d'IC50 pour les peptides inhibiteurs de l'interaction Nef-SH3 dans un contexte cellulaire de protéine Nef native.
6. Activité cellulaire des peptides : double-hybride en cellules de mammifère et FACS
Un test cellulaire reposant sur le principe du double- hybride adapté aux cellules de mammifère a été développé, permettant d'évaluer l'activité cellulaire des peptides capables de pénétrer la membrane plasmique. Ce test permet d'intégrer les paramètres de toxicité cellulaire et de biodisponibilité grâce à une lecture quantitative et fonctionnelle de l'interaction entre deux partenaires protéiques.
Le système commercial CheckMate™ (Promega) a été adapté au couple Nef VIH-I (Lai) / SH3-Hck en culture de cellules COS-7 (Figure 5). Ce système combine l'expression de la luciférase firefly sous la dépendance de l'interaction entre Nef et le domaine SH3 de Hck, et celle, indépendante, de la luciférase renilla, témoin de la viabilité cellulaire. Le ratio d'intensité de ces deux luciférases permet de quantifier l'activité d'un compétiteur de l'interaction Nef- SH3 capable de pénétrer à 1 ' intérieur de la cellule et dont la demi-vie est suffisante dans l'intervalle de temps de l'analyse. D'autres interactions protéiques sont également reconstituées dans ce test : l'une, non-SH3 (entre Id et MyoD) , afin d'exclure les composés présentant une activité non-spécifique sur l'expression de la luciférase, et l'autre entre le SH3 de Hck et la protéine SAM68, afin d'identifier les composés qui interagissent via le domaine SH3 et non via Nef.
Les cellules sont transfectées en utilisant le Fugeneβ (Roche), selon le protocole du distributeur. Brièvement, les plasmides PG5 (300 ng) , pAct ou pActNef (400 ng) , pBindHckmuté ou pBindHck (100 ng) et pbcks (200 ng) sont mélangés, puis le Fugene 6 (3 μl dilué dans 100 μl du milieu de culture DMEM) est ajouté. Le mélange plasmides/Fugeneβ est laissé' en réaction pour une durée de 15 min à température ambiante, puis est déposé goutte à goutte dans le puit de culture cellulaire.
Après 24H d'expression, les cellules sont récoltées par un traitement à la trypsine (Gibco, réf 25300-054), lavées, puis réparties dans des plaques 96 puits (référence 353072, Beckton Dickinson) . 50 μl de milieu de culture DMEM sont ensuite rajoutés dans chaque puit.
L'activité d'un composé inhibiteur candidat est testée en ajoutant 25 μl de ce composé dilué dans le puit contenant déjà 50 μl de la culture cellulaire, et l'activité luciférase est déterminée 24H plus tard dans chaque puit en utilisant la trousse de dosage DualGlo selon les recommandations du fournisseur (Promega).
Dans ce test, le peptide de séquence ID N0Il (W P A W L P) ne présente pas d'activité biologique notable à faible concentration par comparaison avec une molécule contrôle et ceci pour des concentrations variant de 10 à 50 μM du peptide (Figure 5B) , et dans différentes conditions expérimentales alternant notamment le temps et la durée d'ajout du peptide.
Ce peptide synthétisé sous une forme biotinylée n' a pas permis de visualiser de pénétration cellulaire dans un test utilisant un marquage secondaire à l'aide d'une sonde couplée à un fluorochrome, suivi d'une analyse par microscopie confocale, suggérant que le peptide ne pénètre pas spontanément la membrane plasmique et/ou est rapidement dégradé ou exporté dans le milieu extra-cellulaire.
De nouveaux peptides ont été synthétisés en incorporant en position N-terminale de la séquence ID N0Il diverses séquences peptidiques ou séquences de dérivés d'acides aminés
(SEQ ID N° 14 à SEQ ID N°19) riches en résidus basiques et connues pour permettre la translocation de séquences de fusion à travers la membrane plasmique cellulaire (Figure
5B) .
Plusieurs de ces séquences modifiées (SEQ ID N°15, SEQ ID N°17 et SEQ ID N°19) répriment l'interaction Nef-SH3 telle que mesurée dans le test cellulaire, de façon dose- dépendante, montrant que ces dernières pénètrent effectivement à travers la membrane plasmique cellulaire (Figure 5B) .
7. Cartographie de la zone d' interaction des peptides sur Nef
Des spectres 15N-1H HSQC de la protéine 15N-Nef ont été enregistrés sur un spectromètre RMN 500MHz (DRX 500 Bruker) à 308K. Les conditions de la préparation d'échantillon sont identiques à celles utilisées par Grzesiek et al. en 1997, pour l'attribution des spectres RMN hétéronucléaires . La concentration de Nef dans les échantillons est 0,ImM (Figure 6), tris 5mM pH 8.0, 5mM DTT.
L'attribution des corrélations correspondant au groupement de chacun des NH de la protéine est indiquée sur le spectre. Les peptides 2, 4, 5 et 9c sont repris dans 20μl d' éthanol deutéré à une concentration de 5mM. L'ajout de peptides est réalisé avec deux excès de peptides (lOμl) par rapport à Nef (Figures 7A à 7D) . Le peptide non marqué n'est pas observable dans le spectre, seuls les pics de corrélation 1HZ15N des groupements amides de chacun des acides aminés de la protéine sont observables. Le spectre de référence est le spectre de Nef en présence de lOμl d' éthanol deutéré. L'ajout de peptide va entraîner une modification de la fréquence de résonance du proton et/ou 15N des groupements amides situés dans la zone d'interaction. L'attribution de ces résonances étant connue, on peut alors déduire les acides aminés impliqués dans la zone d'interaction. La nature de ces variations spectrales permet de vérifier si la zone d' interaction correspond bien à celle du domaine SH3 de Hck. L'analyse de ces données confirme que les peptides testés interagissent bien sur Nef dans la zone d'interaction de SH3, de plus les différences observées entre les spectres en présence des différents peptides indiquent des géométries de fixation légèrement différentes .
8. Etudes structurales par cristallographie.
La méthode de "trempage" est utilisée pour déterminer la structure des peptides en complexe avec Nef. Pour cela, des cristaux de NefΔi-56 et NefΔi_57 ont été produits comme précédemment décrit (Arold et al., 1997). Après avoir atteint une taille suffisante pour une analyse crystallographique
> 100 μM) , ces cristaux sont trempés pendant l-24h dans une solution contenant entre 1-5 mM de peptide. La présence de canaux de solvant ainsi que l'arrangement des molécules NefΔi-56 et NefΔi-57 dans cette forme cristalline permettent en effet l'accès de petites molécules à la zone d'interaction Nef peptide cartographiée par RMN (décrite ci-dessus) . Les cristaux ainsi préparés sont analysés par diffraction des rayons X.
9. Virologie
L'étude de l'influence positive de Nef sur la réplication virale est effectuée par des techniques classiques permettant de mesurer les capacités infectieuses du VIH-I (Craig et al., 1998; Madrid et al., 2005). Les analyses initiales sont réalisées à l'aide d'un provirus prototype de laboratoire, VIH-I pNL4-3. Brièvement, l'effet des peptides inhibiteurs de Nef sera évalué sur les virions produits par transfection transitoire de cellules 293T par le provirus sauvage et utilisés pour infecter des cellules cibles HeLa-CD4 (clone P4) contenant une copie intégrée du gène LacZ sous la dépendance du LTR du HIV-I. 48 h après infection, le pouvoir infectieux des virus est évalué par comptage des cellules exprimant une activité β-galactosidase.
Références bibliographiques
Arold S., Franken P, Strub M. P., Hoh F., Benichou, S.
Benarous, R., and Dumas, C. (1997). The crystal structure of HIV-I Nef protein bound to the Fyn Kinase SH3 domain
suggests a rôle for this complex in altered T cell receptor signalling. Structure 5, 1361-72.
Craig, H. M., Reddy, T. R., Riggs, N. L., Dao, P. P., and
Guatelli, J. C. (2000) . Interactions of HIV-I nef with the mu subunits of adaptor protein complexes 1, 2, and 3: rôle of the dileucine-based sorting motif. Virology 272, 9-17.
Grzesiek, S. Bax, A., Hu, J, Kaufman, J., Palmer, I., Stahl, S., Tjandra, N. and Wingfield, P. T. (1997) Refined solution structure and backbone dynamics of HIV-I Nef. Protein science, 6, 1248-1263.
Hoogenboom HR, Griffiths AD, Johnson KS, Chiswell DJ, Hudson P, Winter G. Multi-subunit proteins on the surface of filamentous phage : méthodologies for displaying antibody (Fab) heavy and light chains. Nucleic Acids Res, 1991, 19 : 4133-4137.
Madrid, R., Janvier, K., Hitchin, D., Day, J., Coleman, S., Noviello, C, Bouchet, J., Benmerah, A., Guatelli, J. and Benichou, S. (2005) Nef-induced altération of the early/recycling endosomal compartment correlates with enhancement of HIV-I infectivity. J. Biol . Chem. , 280: 5032- 5044.
Maniastis T., Fritsch E. F., and Sambrook J. (1982 ), Molecular Cloning : A Laboratory Manual, CoId Spring Harbor Laboratory Press, CoId Spring Harbor, NY.
McLoughlin, P, Ehler, E., Carlile, G., Licht, J. D., and B. W.
Schâfer. The LIM-only Protein DRAL/FHL2 Interacts with and Is a Corepressor for the Promyelocytic Leukemia Zinc Finger Protein. J. Biol. Chem. 2002, 277 : 37045-53.

Claims

Revendications
1 - Peptides isolés, purifiés, possédant notamment des propriétés de liaison à la protéine Nef, caractérisés en ce qu'ils renferment une séquence en acides aminés répondant à SEQ ID N0I :
W-P-a-W-L-P
dans laquelle
a_ est choisi parmi W, A, S ou D. 2 - Peptides selon la revendication 1, caractérisés en ce qu'ils répondent à l'enchaînement en acides aminés SEQ
ID N°2 :
b - W - P - a - W - L -P -c - d -f
dans lequel
b = R/T ou est absent
a est tel que défini ci-dessus
c = Q , T, L, G, H ou est absent
d = L, W, A ou est absent
f = P ou est absent.
3 - Peptides selon la revendication 1 ou 2, caractérisés en ce qu'il s'agit de peptides décamériques répondant aux séquences SEQ ID N°3 à SEQ ID N°7 suivantes :
SEQ ID N°3 : N T W P W W L P T L
SEQ ID N°4 : Y R W P A W L P L W
SEQ ID N°5 : N W R W P W W I P G
SEQ ID N°6 : T W P W W L P H A P
SEQ ID N°7 : W P S W L P Q L P F 4 - Peptides selon la revendication 1 ou 2, caractérisés en ce qu'ils répondent aux séquences SEQ ID N°8 à SEQ ID N°13 suivantes :
SEQ ID N°8 : W P S W L P Q
SEQ I-D N°9 : W P S W L P SEQ ID N0IO : W P W W L P
SEQ ID N0Il : W P A W L P
SEQ ID N°12 : W P D W L P
SEQ ID N°13 : W P S W L P Q L P - Peptides selon l'une quelconque des revendications 1 à 4, caractérisés en ce qu'ils renferment une séquence d'acides aminés, comportant le cas échéant des dérivés d'acides aminés, facilitant leur pénétration dans les cellules, ladite séquence étant choisie parmi :
(R)n avec n= 6 à 8 ; R (A R R) nl, avec nl= 1 à 3 ;R (Ahx R) n2/ avec n2= 1 à β ; SEQ ID N014 :K K R R Q R R R ; et SEQ ID N°15 : R Q I K I W F Q N R Nie K W K K, Ahx" représentant un motif acide amino-hexanoïque et « Nie» , la nor-leucine. - Peptides selon la revendication 5, caractérisés en ce qu'il s'agit de dérivés de la séquence ID N0Il, et qu'ils répondent aux séquences SEQ ID N°lβ à SEQ ID N°21 suivantes :
SEQ ID N°16 : R R R R R R W P A W L P
SEQ ID N°17 : R R R R R R R R W P A W L P
SEQ ID N°18 : R A R R A R R A R R W P A W L P
SEQ ID N°19 : R Ahx R Ahx R Ahx R Ahx R Ahx- R Ahx R W P A W L P
SEQ ID N°20 : K K R R Q R R R W P A W L P
SEQ ID N°21 : R Q I K I W F Q N R Nie K W K K W P A W L
P Utilisation des peptides selon l'une quelconque des revendications 1 à 6, comme inhibiteurs de l'interaction entre Nef et certains de ses partenaires cellulaires, dont les protéines à domaine ' SH3. - Utilisation des peptides selon l'une quelconque des revendications 1 à 6, pour développer des molécules chimiques à partir de leurs séquences en acides aminés et/ou de leurs données structurales. -Compositions pharmaceutiques caractérisées en ce qu'elles comprennent une quantité thérapeutiquement efficace d' au moins un peptide tel que défini ci-dessus associé à des excipients pharmacologiquement acceptables .
EP06841902A 2005-12-09 2006-12-11 Nouveaux peptides et leurs applications biologiques Withdrawn EP1976862A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
FR0512524A FR2894584A1 (fr) 2005-12-09 2005-12-09 Nouveaux peptides et leurs applications biologiques
PCT/FR2006/002697 WO2007066018A2 (fr) 2005-12-09 2006-12-11 Peptides qui peuvent se lier a la proteine nef et leurs applications pharmaceutiques

Publications (1)

Publication Number Publication Date
EP1976862A2 true EP1976862A2 (fr) 2008-10-08

Family

ID=36570518

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06841902A Withdrawn EP1976862A2 (fr) 2005-12-09 2006-12-11 Nouveaux peptides et leurs applications biologiques

Country Status (5)

Country Link
US (1) US20090163410A1 (fr)
EP (1) EP1976862A2 (fr)
CA (1) CA2632708A1 (fr)
FR (1) FR2894584A1 (fr)
WO (1) WO2007066018A2 (fr)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
FR2879605B1 (fr) 2004-12-16 2008-10-17 Centre Nat Rech Scient Cnrse Production de formats d'anticorps et applications immunologiques de ces formats
EP2062578A1 (fr) 2007-11-12 2009-05-27 Institut National De La Sante Et De La Recherche Medicale (Inserm) Utilisation de composés chimiques pour traiter le SIDA
EP3560509B1 (fr) 2011-12-22 2024-01-31 Children's Medical Center Corporation Peptides dérivés de la saposine-a et leurs utilisations
JP6457999B2 (ja) 2013-03-14 2019-01-23 ザ チルドレンズ メディカル センター コーポレーション 処置に関してがんの対象を識別するためのcd36の使用

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6551795B1 (en) * 1998-02-18 2003-04-22 Genome Therapeutics Corporation Nucleic acid and amino acid sequences relating to pseudomonas aeruginosa for diagnostics and therapeutics
DE19820224A1 (de) * 1998-05-06 1999-12-09 Markus Schott Bindungspartner und Verfahren zur kompetitiven Hemmung der Bindung zwischen NEF-Protein und Calmodulin, sowie Mittel und Verwendung bei HIV-Erkrankungen
JP2000000097A (ja) * 1998-06-15 2000-01-07 Nippon Zoki Pharmaceut Co Ltd Nef結合蛋白質、該蛋白質をコードするDNA並びに該蛋白質に対するモノクローナル抗体
US20090087878A9 (en) * 1999-05-06 2009-04-02 La Rosa Thomas J Nucleic acid molecules associated with plants
US20110131679A2 (en) * 2000-04-19 2011-06-02 Thomas La Rosa Rice Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement
US7834146B2 (en) * 2000-05-08 2010-11-16 Monsanto Technology Llc Recombinant polypeptides associated with plants
US20030229906A1 (en) * 2002-04-15 2003-12-11 Gelman Irwin H. Methods and compositions for the treatment of disorders of HIV infection
AU2003298014A1 (en) * 2002-12-04 2004-06-23 Diadexus, Inc. Compositions, splice variants and methods relating to colon specific genes and proteins

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2007066018A2 *

Also Published As

Publication number Publication date
WO2007066018A3 (fr) 2007-07-26
FR2894584A1 (fr) 2007-06-15
US20090163410A1 (en) 2009-06-25
WO2007066018A2 (fr) 2007-06-14
CA2632708A1 (fr) 2007-06-14

Similar Documents

Publication Publication Date Title
EP1497467B1 (fr) Oligonucleotide issus des sequences codant pour la composante de surface des proteines d'enveloppe des ptlv et leurs utilisations
Stetsenko et al. Efficient conjugation of peptides to oligonucleotides by “native ligation”
Martinez-Fabregas et al. Kinetics of cytokine receptor trafficking determine signaling and functional selectivity
Waheed et al. HIV type 1 Gag as a target for antiviral therapy
Bryson et al. Toward targeting RNA structure: Branched peptides as cell-permeable ligands to TAR RNA
US20150359843A1 (en) P53 activating peptides
Zhang et al. Targeting folded RNA: a branched peptide boronic acid that binds to a large surface area of HIV-1 RRE RNA
Pal et al. RNA-binding macrocyclic peptides
Dai et al. Molecular recognition of a branched peptide with HIV-1 Rev Response Element (RRE) RNA
EP1976862A2 (fr) Nouveaux peptides et leurs applications biologiques
FR2968663A1 (fr) Peptides et medicament antiviral
CA2540520A1 (fr) Polypeptide d'interaction comprenant un motif heptapeptidique et un domaine de penetration cellulaire
Shvadchak et al. Rationally designed peptides as efficient inhibitors of nucleic acid chaperone activity of HIV-1 nucleocapsid protein
Hampton Development and Advancement of Phage Display Techniques for the Identification of Therapeutic Peptides
Chen Development of Phage Display Techniques with Genetic Code Expansion for Peptide Drug Discovery
Dawodu et al. Bacterial Display of Genetically Encoded Macrocyclic Peptide Libraries using Cysteine-Reactive Unnatural Amino Acids
Wang Developing Functional Peptides as Synthetic Receptors, Binders of Protein and Probes for Bacteria Detection
Antilla Improving Cardiac Delivery of Antisense Oligonucleotides With Peptidomimetic Targeting Agents
Haberman Discovery of Protein-Protein Interaction Inhibitors Using mRNA Display
Birkmose et al. Suppression of nonsense mutations by small, cyclic peptides
JPWO2005007686A1 (ja) Rna結合ペプチド
Yavorova Engineering constrained peptides to target nucleic acids: G-quadruplex recognition and imaging
Wynn Functionalizing Branched Peptides with Unnatural Amino Acids Toward Targeting HIV-1 RRE RNA and Microbials
Qi Unnatural amino acid incorporation to rewrite the genetic code and RNA-peptide interactions
EP4722228A1 (fr) Nouveau composé ciblant musc et son utilisation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20080718

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

17Q First examination report despatched

Effective date: 20090119

RIN1 Information on inventor provided before grant (corrected)

Inventor name: BATY, DANIEL

Inventor name: BENICHOU, SERGE

Inventor name: MORELLI, XAVIER

Inventor name: AROLD, STEPHAN

Inventor name: GUERLESQUIN, FRANCOISE

Inventor name: COLLETTE, YVES

Inventor name: PARROT, ISABELLE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090901