EP1928494A2

EP1928494A2 - Combination therapy for immunostimulation

Info

Publication number: EP1928494A2
Application number: EP05778932A
Authority: EP
Inventors: Ingmar Hoerr; Steve Pascolo
Original assignee: Curevac AG
Current assignee: Curevac SE
Priority date: 2004-09-02
Filing date: 2005-08-31
Publication date: 2008-06-11
Also published as: DE102004042546A1; US20170000870A1; US20080025944A1; WO2006024518A1; US20120213818A1

Abstract

The invention relates to a method for immunostimulation in a mammal, said method consisting of the following steps: a) at least one mRNA containing a region coding for at least one antigen of a pathogen or at least one tumour antigen is administered, and b) at least one cytokine, at least one cytokine-mRNA, at least one CpG DNA or at least one adjuvant RNA is administered. The invention also relates to a product and a kit containing the mRNA and cytokine or cytokine mRNA, or CpG DNA or adjuvant RNA according to the invention.

Description

Combination therapy for immune stimulation

The present invention relates to a method for immunostimulation in a

A mammal, the method comprising administering an mRNA encoding an antigen of a pathogenic microorganism, and administering at least one cytokine, in particular GM-CSF, at least one cytokine mRNA, at least one CpG DNA, at least one adjuvant viral mRNA and / or at least one adjuvant RNA.

Conventional vaccines comprising attenuated or inactivated pathogens, as well as other substances such as sugars or protein moieties, can provide satisfactory results in the context of many diseases. However, such vaccines do not provide adequate protection against a variety of infectious organisms, such as HIV or Plasmodium falciparum, and particularly against tumors. In addition, there is a risk that new pathogens may occur due to unwanted recombination events (as in the case of the SARS epidemic).

Molecular medical procedures such as gene therapy and genetic vaccination play an important role in the therapy and prevention of many diseases. The basis of these methods is the introduction of nucleic acids into the cells or tissue of the patient, followed by the processing of the information encoded by the introduced nucleic acids, ie Expression of the desired polypeptides or proteins. Suitable nucleic acids to be introduced here are both DNA and RNA.

Genetic vaccinations consisting of injection of naked plasmid DNA were first demonstrated in mice in the early 1990's. However, in clinical phase I / II studies, this technology has not been shown to fulfill the human expectations of mouse studies (6). Numerous DNA-based genetic vaccinations have since been developed. In this connection, various methods have been developed for introducing DNA into cells, such as, for example, calcium phosphate transfection, polyprene transfection, protoplast fusion, electroporation, microinjection and lipofection, lipofection in particular having proved to be a suitable method. Also contemplated is the use of DNA viruses as DNA vehicles. Due to their infectious properties, such viruses achieve a very high transfection rate. The viruses used are genetically modified in this process so that no functional infectious particles are formed in the transfected cell. However, despite this precautionary measure, for example due to possible recombination events, a risk of uncontrolled spread of the gene therapy and viral genes introduced can not be ruled out. In addition, DNA vaccination poses further potential safety risks (7, 8). The injected recombinant DNA must first reach the nucleus, this step may already reduce the efficiency of DNA vaccination. In the nucleus, there is a risk that the DNA will be integrated into the host genome. The integration of foreign DNA into the host genome may affect the expression of the host genes and possibly trigger the expression of an oncogene or the destruction of a tumor suppressor gene. Also, a gene essential to the host - and thus the gene product - can be inactivated by the integration of the foreign DNA into the coding region of this gene. A particular danger exists when the integration of the DNA into a Gene is involved, which is involved in the regulation of cell growth. In this case, the host cell can enter a degenerate state and lead to cancer or tumor formation.

Moreover, for the expression of a DNA introduced into the cell, it is necessary for the corresponding DNA vehicles to contain a strong promoter such as the viral CMV promoter. Integration of such promoters into the genome of the treated cell can lead to undesirable changes in the regulation of gene expression in the cell. Another disadvantage is that the DNA molecules remain in the nucleus for a long time, either as an episome or, as mentioned, integrated into the host genome. This leads to a production of the transgenic protein which is not limited in time or can not be limited and to the risk of associated tolerance to this transgenic protein. Furthermore, the injection of DNA can trigger the development of anti-DNA antibodies (9) and the induction of autoimmune diseases.

None of these listed risks associated with genetic vaccination are present when messenger RNA (mRNA) is used instead of DNA. For example, mRNA does not integrate into the host genome, when using RNA as a vaccine, no viral sequences, such as promoters, etc., are required for efficient transcription, etc. While RNA is much less stable towards DNA (RNA is particularly responsible for the instability of the RNA). degrading enzymes, so-called RNases (ribonucleases), but also numerous other processes that destabilize the RNA), but methods for stabilizing RNA are now known in the art. For example, in WO 03/051401, WO 02/098443, WO 99/14346, EP-A-1083232, US 5,580,859 and US 6,214,804. Methods have also been developed for protecting the RNA from degradation by ribonucleases, using liposomes (15) or intra-cytosolic in vivo administration of the nucleic acid with a ballistic device ("gene gun"). carried out (16). An ex vivo method was also presented, which relates to the transfection of dendritic cells (12).

For RNA-based vaccination, i.a. Developed immunization strategies based on self-replicating RNA encoding both an antigen and a viral RNA replicase (13, 14). Although such methods are efficient, there are safety risks associated with the use of viral RNA.

Replicases in genetic vaccines (a recombination between the injected

RNA and the endogenous RNA could lead to the formation of new types of alpha viruses).

Overall, it should be noted that no mRNA vaccine is described in the prior art, which ensures the triggering of an immune response in the organism to which it is administered, this increases and avoids unwanted side effects as far as possible.

Another major disadvantage of the mRNA vaccines known in the prior art is that only a humoral immune response (type Th2) is triggered by mRNA vaccination. However, all viruses and numerous bacteria, such as mycobacteria and parasites, invade the cells, multiply there and are thus protected from antibodies. Therefore, in order to evoke in particular an antitumoral or antiviral immune response, the initiation of a cellular immune response (type Th1) is required.

The object of the present invention is therefore to provide a new system for gene therapy and genetic vaccination, which ensures a more effective immune response and thus a more effective protection in particular against intracellular pathogens and the diseases caused by these pathogens or against tumors. This object is achieved by the embodiments of the present invention characterized in the claims.

An object of the present invention is a method for immunostimulation in a mammal, comprising the following steps: a. Administering at least one mRNA containing a region coding for at least one antigen of a pathogen or at least one tumor antigen, and b. Administering at least one component selected from the group consisting of at least one cytokine, at least one cytokine mRNA, at least one CpG DNA, at least one adjuvant viral mRNA and at least one adjuvant RNA.

In the following, the mRNA which codes for at least one antigen from a pathogen or at least one tumor antigen is referred to as "mRNA according to the invention", which is the mRNA used in step (a) of the method according to the invention modified present.

The invention is based on the finding that the injection of naked stabilized mRNA causes a specific immune response (17). According to the invention, such an antigen-specific immune response has been investigated more closely, in particular in comparison to a DNA-induced immune response. BALB / c mice were injected with nude, stabilized mRNA in one experimental approach and plasmid DNA in the other with another approach. In both experimental approaches, the nucleic acids contained an area coding for β-galactosidase. As a result, it was found that predominantly IgGI antibodies were produced in the case of mRNA vaccination, whereas IgG2a antibodies were predominantly formed during DNA vaccination. According to the invention, it was thus possible to demonstrate that mRNA vaccination induces a humoral immune response (Th2) (production of IgG1), while DNA vaccination causes a cellular immune response (ThI) (production of IgG2a). Surprisingly, it was thus also found by this study that the decision as to whether a humoral or cellular immune response is triggered in a mammal, here in mice, depends neither on the route of administration nor on the antigen encoded by the nucleic acid, but rather on the type of nucleic acid, RNA or DNA. In further experimental approaches, nucleic acids were used which, instead of the β-galactosidase coding region, contained an area which encoded an antigen of a pathogen or a tumor antigen. On such antigen coding areas will be discussed in more detail below. In these experimental approaches, the results described above regarding the induction of a Th1 or Th2 immune response were also shown. The dosage of the mRNA according to the invention depends in particular on the disease to be treated and its progress stage, as well as the body weight, the age and sex of the patient (the terms organism, mammal, human, patient are used synonymously in the context of the invention). The concentration of the mRNA according to the invention may therefore vary within a range of about 1 μg to 100 mg / ml.

Moreover, it has been recognized according to the invention that particularly advantageous properties are obtained when the mRNA according to the invention is combined with at least one component of at least one of the following categories, namely cytokine, cytokine mRNA, CpG DNA, adjuvo viral mRNA and / or adjuvant RNA, is administered. Components of the above categories have adjuvant properties as determined according to the invention, so that the compounds or components falling within these categories are to be regarded as adjuvants. These Adjuvanzeigenschaften based on the effect of the compounds of the above categories to act immunostimulatory. Components from the categories of cytokines or cytokines expressing cytokine mRNAs are as such already directly immuno-stimulatory effective. Compounds of the other abovementioned categories can indirectly have an immunostimulatory effect by stimulating cytokine secretion in the treated animal (human or animal, in particular domestic animals).

Accordingly, the inventors have studied the influence of cytokines on RNA vaccination. Cytokines are an excellent adjuvant in the context of DNA vaccination as known in the art (19, 20, 24, 25). A preferred cytokine is GM-CSF (Granulocyte Macrophage Colony Stimulating Factor), which increases the density of dendritic cells (DCs) in the skin and thus enhances a DNA vaccination-induced immune response. The aim of the investigations according to the invention was to further enhance by cytokine administration an mRNA-induced immune response according to the invention. The administration of cytokines in conjunction with peptides (26) and DNA (27) is well known in the art. However, on the one hand, no satisfactory results have been obtained, presumably due to the fact that a suitable time for the administration of GM-CSF could not be determined, on the other hand, vaccinations performed with peptides or DNA are not based on RNA - based vaccinations transferable. This has already been discussed in detail above.

According to the invention, parallel experiments were carried out in which the addition of a cytokine in protein form, preferably a GM-CSF addition, to different

Time points before, after and at the same time as one mRNA vaccination (the

(inventive) mRNA for β-galactosidase, an antigen of a pathogen or a tumor antigenic coded) was carried out. In the result remained to be determined that one

Administration before vaccination had no significant effect on quality or quantity (type and amount of immunoglobulin IgG1 / IgG2a produced) (see FIG. 3 for β-galactosidase). Surprisingly, it was found according to the invention, however, that upon administration of a cytokine, preferably GM-CSF, after the mRNA vaccination, not only an increased Th2 immune response was present, but also a Th1 immune response was induced (see FIG. 3 and Table 1). Particularly good results were obtained with the administration of a cytokine, preferably GM-CSF, preferably about 24 hours after the administration of the mRNA according to the invention.

In addition, corresponding experiments have also been carried out in which, instead of the cytokine in protein form, the addition of a cytokine mRNA (ie an mRNA which contains the coding region for a functional cytokine, a fragment or a variant thereof), preferably a G-CSF, M-CSF or GM-CSF mRNA addition, at different times before, after and simultaneously with an mRNA vaccination (wherein the mRNA according to the invention encoded β-galactosidase). The result of the administration expressed by the secretion of a cytokine (IFN-γ) can be seen from FIG. Surprisingly, it has also been found according to the invention that when cytokine mRNA is administered, preferably GM-CSF mRNA, before, simultaneously and after mRNA vaccination, a strong increase in IFN-γ secretion takes place, as a result of which an indirect immunostimulatory effect is produced , Particularly good results were obtained in particular with the administration of cytokine mRNA, preferably GM-CSF mRNA, preferably approximately 24 hours after the administration of the mRNA according to the invention.

Corresponding results were obtained with the administration of CpG DNA before, after and simultaneously with the previously described mRNA vaccination. CpG is a relatively rare dinucleotide sequence in DNA, in which the cytosine residue is often methylated to give 5-methylcytosine. The methylation of the cytosine residue has effects on gene regulation, such as the inhibition of the binding of transcription factors, the blockade of promoter sites, etc.). That is, not only was there an increased Th2 immune response, but also a Th1 immune response was induced. Again, particularly good results were obtained when the CpG DNA was administered approximately 24 hours after the administration of the mRNA according to the invention. In particular, CpG DNA was used with the motif CpG DNA 1668 with the sequence 5'-TCC ATG ACG TTC CTG ATG CT-3 'or the motif CpG 1982 5'-TCC AGG ACT TCT CTC AGG TT-3' in the experiments.

The administration of adjuvo-viral mRNA can also trigger an immunostimulatory effect. In this case also becomes one

Cytokine release brought about. Examples of such adjuvo-viral mRNAs mRNAs should be mentioned, which for the influenza matrix protein or the

Encoding HBS surface protein. Overall, adjuvant viral mRNA adjuvant effects are typically those antigens that are viral matrix or surface proteins.

Corresponding results have been obtained with the administration of adjuvant RNA before, after and simultaneously with the previously described mRNA vaccination. The adjuvant RNA is relatively short RNA molecules, for example, from about 2 to about 1000 nucleotides, preferably from about 8 to about 200 nucleotides, more preferably from 15 to about 31 nucleotides exist. According to the invention, the adjuvant RNA may also be present in single or double-stranded form. In particular, double-stranded RNA with a length of 21 nucleotides can also be used as interference RNA in order to specifically switch off genes, for example of tumor cells, and thus specifically kill these cells or inactivate active genes which are responsible for malignant degeneration (Elbashir et al., Nature 2001, 411, 494-498). The adjuvant RNA is used in the method of the invention in step (b.) And is preferably chemically modified, as disclosed below in connection with modifications. The adjuvant RNA activates cells of the immune system (primarily Antigen-presenting cells, in particular dendritic cells (DC), as well as the defense cells, for example in the form of T-cells, are particularly strong and thus stimulate the immune system of an organism. The adjuvant RNA leads in particular to an increased release of immune-controlling cytokines, for example interleukins, such as IL-6, IL-12, etc.

The dosage of the cytokine or of the cytokine mRNA or of the CpG DNA or of the adjuvo viral mRNA or of the adjuvant RNA depends on the mRNA according to the invention which contains a region coding for an antigen from a pathogen or a tumor antigen, the condition to be treated, the condition of the patient to be treated (weight, size, developmental status of the disease, etc.). The dosage range is approximately in a concentration range of 5 to 300 μg / m ² .

"Vaccination" or "vaccination" generally means the introduction of one or more antigens or, in the context of the invention, the introduction of the genetic information for one or more antigen (s) in the form of the mRNA according to the invention coding for the antigen (s) an organism, in particular in a / several cell / cells or tissue of this organism. The mRNA according to the invention thus administered is translated into the antigen in the organism or in its cells, i. the antigen encoded by the mRNA according to the invention (also: antigenic polypeptide or antigenic peptide) is expressed, whereby an immune response directed against this antigen is stimulated.

An "immune stimulation" or "stimulation of an immune response" is usually carried out by the infection of a foreign organism (eg a mammal, especially a human) with a pathogen (or pathogenic organism). For the purposes of the invention, a "pathogen" or "pathogenic organism" is in particular viruses and bacteria, but also all other pathogens (such as, for example, fungi or infection-inducing organisms, such as Trypanosomes, nematodes, etc.). "Antigens" of a pathogen are substances (eg proteins, peptides, nucleic acids or fragments thereof) of the pathogen that are capable of triggering the production of antibodies. Also included in the invention are antigens from a tumor. By this is meant that the antigen is expressed in cells associated with a tumor. Antigens from tumors are especially those that are produced in the degenerate cells themselves. Preferably, these are located on the surface of the cells antigens. Furthermore, the antigens from tumors are also those that are expressed in cells that are not (or were not originally) degenerate themselves, but are associated with the tumor in question. These include, for example, also antigens associated with tumor-supplying vessels or their (re) education, in particular those antigens associated with neovascularization or angiogenesis, for example. Growth factors such as VEGF, bFGF, etc. Furthermore, such include antigens associated with a tumor such as those from cells of the tissue embedding the tumor.

A cytokine is generally a protein that influences the behavior of cells, and cytokines have specific receptors on their target cells, such as monokines, lymphokines or interleukins, interferons, immunoglobulins and chemokines. Particularly preferred according to the invention as cytokine GM-CSF or G-CSF or M-CSF.

"Administering" the mRNA according to the invention and the cytokine or the cytokine mRNA or the adjuvo-viral mRNA or the CpG DNA or the adjuvant RNA means the organism to be treated, preferably mammal, particularly preferably human, a suitable Dose of the mRNA or the cytokine or the cytokine mRNA or the adjuvo-viral mRNA or the CpG DNA or the adjuvant RNA according to the invention. Administration may be by any suitable means, preferably via injection, parenterally, for example, intravenously, intraarterially, subcutaneously, intramuscularly, intraperitoneally or intradermally. Likewise, topical or oral administration is possible. The dosage of the mRNA according to the invention or of the cytokine or of the cytokine mRNA or of the adjuvo-viral mRNA or of the CpG DNA or the adjuvant RNA has already been discussed in more detail above. Typically, the administered mRNA or adjuvant according to the invention is present in liquid form according to method step (b.), Typically in aqueous solution which may be buffered, for example with phosphate buffer, HEPES, citrate, acetate, etc., for example to a pH between 5.0 and 8.0, in particular 6.5 and 7.5, and further advantageous excipients and additives (for example human serum albumin, polysorbate 80, sugar, etc.) or even salts, for example NaCl, KCl etc . may contain.

Consequently, the present invention likewise provides a method for the treatment of diseases, in particular of cancerous or tumor diseases as well as of viral and bacterial infections, such as, for example, hepatitis B, HIV or MDR (multi-drug resistance) infections or vaccination

Prevention of the above diseases, which includes the

Administering the mRNA according to the invention and at least one of the following categories: cytokine, cytokine mRNA, adjuvo viral mRNA, CpG

DNA and / or adjuvant RNA to a subject or to a patient, especially a human or a pet. This is a combination therapy in which mRNA according to the invention and cytokine or

Cytokine mRNA or adjuvo viral mRNA or CpG DNA or adjuvant RNA are administered according to the invention together (in a mixture), separately and simultaneously or separately and in a time-graded manner.

In a preferred embodiment of the method according to the invention, the mRNA according to the invention and cytokine or cytokine mRNA or adjuvo viral mRNA or CpG DNA or the adjuvant RNA are separated or timed Gradually administered. In a particularly preferred embodiment, in the method according to the invention, step b. 1 minute to 48 hours, preferably 20 minutes to 36 hours, also preferably 30 minutes to 24 hours, more preferably 10 hours to 30 hours, most preferably 12 hours to 28 hours, especially preferably 20 to 26 hours, after step a. performed. According to the invention, however, the cytokine or the cytokine mRNA or adjuvo-viral mRNA or the CpG DNA or the adjuvant RNA can also be administered before or simultaneously with the mRNA according to the invention.

In particular, according to process step b. also be administered in any combination, i. e. For example, according to the invention, a cytokine mRNA having an adjuvant RNA and / or a CpG DNA can be administered in a mixture. If the combination of the components according to method step b. do not take place in a mixture, the combined components can also be separated according to process step b. be administered. It is also preferred, in process step b. two or more, preferably 2-4, components of the same category, for example at least two different cytokines or at least two different cytokine mRNAs with each other, optionally also, as disclosed above, with components of other categories, to be combined (in admixture or separately).

In a further preferred embodiment, in the method according to the invention in step a. and / or b. additionally administered at least one RNase inhibitor, preferably RNAsin or aurintricarboxylic acid. This serves to prevent degradation of the DNA by RNases (RNA-degrading enzymes). Such an inhibitor is typically incorporated into the at least one composition administered according to method step (b.).

In a preferred embodiment, an immune response to an mRNA according to the invention is amplified or modulated in the method according to the invention, particularly preferably changed from a Th2 immune response to a Th1 immune response.

In a preferred embodiment of the invention, the at least one mRNA according to the invention from step (a.) Of the method according to the invention contains an area selected for at least one antigen from a tumor selected from the group consisting of 707-AP, AFP, ART-4, BAGE , Catenin / m, Bcr-ab I, CAMEL, CAP-I, CASP-8, CDC27 / m, CDK4 / m, CEA, CMV pp65, CT, Cyp-B, DAM, EGFRI, ELF2M, ETV6-AML1, G250 , GAGE, GnT-V, GpI OO, HAGE, HBS, HER-2 / neu, HLA-A * 0201-R170l, HPV-E7, HSP70-2M, HAST-2, hTERT (or hTRT), influenza matrix protein , in particular influenza A matrix M1 protein or influenza B matrix Ml protein, iCE, K1AA0205, LAGE, eg LAGE-I, LDLR / FUT, MAGE, e.g. MAGE-A, MAGE-B, MAGE-C, MAGE-A1, MAGE-2, MAGE-3, MAGE-6, MAGE-10, MART-1 / Melan-A, MC1R, myosin / m, MUCl, MUM -I, -2, -3, NA88-A, NY-ESO-I, p190 minor bcr-abl, Pml / RAR, PRAME, proteinase 3, PSA, PSM, PTPRZ1, RAGE, RU1 or RU2, SAGE, SART- 1 or SART-3, SEC61G, SOX9, SPCI, SSX, survivin, TEL / AML1, TERT, TNC, TPI / m, TRP-1, TRP-2, TRP-2 / INT2, tyrosinase and VVT1.

The at least one mRNA according to the invention particularly preferably contains a region which is at least one antigen from a tumor selected from the group consisting of MAGE-A1 [accession number (accession number) M77481], MAGE-A6 [accession number NM_005363], melan-A [Accession number NM_005511], GP100 [Accession number M77348], Tyrosinase [Accession number NM_000372], Survivin [Accession number AF077350], CEA [Accession number NM_004363], Her-2 / neu [Accession number M11730], Mucin-1 [Accession number NM_002456], TERT [accession number NM_003219], PR3 [accession number NM_002777], VVT1 [accession number NM_000378], PRAME [accession number NM_006115], TNC (tenascin C) [accession number X78565], EGFRI ("epidermal growth factor receptor 1 ") [Accession number AF288738], S0X9 [Accession number Z46629], SEC61G [Accession number NM_014302], PTPRZ1 (Protein tyrosine phosphatase, Receptor type, Z polypeptide 1) [Accession number NM_002851], CMV pp65 [Accession number M15120], HBS antigen [Accession number E00121 ], Influenza A matrix M1 protein accession number AF348197 and influenza B matrix Ml protein accession number V01099.

For the purposes of the present invention, the cytokine mRNA contains a section which codes for the cytokine or the adjuvo-viral mRNA a section which codes for a viral protein with adjuvant effect. However, in this case as well (as in the case of the mRNA according to the invention), the nucleotide sequence used and designated here as cytokine mRNA or adjuvo viral mRNA can contain at least one further functional segment in addition to the coding segment, for example specific signal or regulatory segments. These signal or regulation sections serve, for example, for better translation of the i. S. of this invention administered mRNA (for example, in a 3'-terminal, untranslated region of the mRNA). However, a signal or regulation section may also be provided in the coding region of the mRNA, for example 3'- or 5'-terminal region of the coding sequence, so that the signal or regulatory effect occurs only at the level of the expressed (fusion) protein. For example, in the coding region of the mRNA, a signal peptide sequence (for example a leader sequence) could be coexpressed which, after administration, cell entry and expression, results in targeted secretion of the mRNA administered by the mRNA according to the invention or an mRNA having adjuvant effect Process step (b.)) Encoded protein from the cell leads. For example. For example, the secretion signal peptides of corresponding peptide or protein hormones (for example of insulin, vasopressin, glucagon, etc.) or, for example, also the secretion signals of antibodies can be used as secretion signals by virtue of the mRNA containing its respective nucleotide sequence. Functional fragments and / or functional variants of an mRNA according to the invention or an antigen or a cytokine or a cytokine mRNA or an adjuvo-viral mRNA or a CpG DNA or an adjuvant RNA of the invention are also included according to the invention. For the purposes of the invention, "functional" means that the antigen or the mRNA according to the invention has immunological or immunogenic activity, in particular an immune response in an organism in which it is foreign Antigen (or a fragment thereof) can be translated.

A "fragment" in the context of the invention is a truncated antigen or a truncated mRNA or a truncated cytokine or a truncated cytokine mRNA or an adjuvo-viral mRNA or a truncated CpG DNA or a truncated adjuvant RNA of the These may be N-terminal, C-terminal or intrasequentially abbreviated amino acid or nucleic acid sequences.

The preparation of fragments of the invention is well known in the art and may be performed by one skilled in the art using standard techniques (see, eg, Maniatis et al., (2001), Molecular Cloning: Laboratory Manual, CoId Spring Harbor Laboratory Press). In general, the preparation of the fragments of the invention may be accomplished by modifying the DNA sequence encoding the wild-type molecule followed by transformation of that DNA sequence into a suitable host and expression of that modified DNA sequence, provided that the modification of the DNA does not destroy the described functional activities. In the case of the mRNA according to the invention or a cytokine mRNA or an adjuvo-viral mRNA, the production of the fragment can also be carried out by modifying the wild-type DNA sequence followed by an in vitro transcription and isolation of the mRNA, also on condition that the modification the DNA does not destroy the functional activity of the respective mRNA. The identification of a fragment according to the invention can be carried out, for example, by sequencing the fragment and subsequently comparing the sequence obtained with the wild-type sequence. The sequencing can be done by standard methods that are numerous and well known in the art.

As "variants" in the sense of the invention, mRNAs or cytokines or cytokine mRNAs according to the invention are in particular called adjuvo-viral mRNAs which have sequence differences from the corresponding wild-type sequences ), Deletion (s) and / or substitution (s) of amino acids or nucleic acids, wherein a sequence homology of at least 60%, preferably 70%, more preferably 80%, also more preferably 85%, even more preferably 90% and am most preferably 97% is present.

To determine the percent identity of two nucleic acid or amino acid sequences, the sequences can be aligned to be compared below. For this purpose, e.g. Gaps in the sequence of the first amino acid or nucleic acid sequence are introduced and the amino acids or nucleic acids are compared at the corresponding position of the second amino acid or nucleic acid sequence. If a position in the first amino acid sequence is occupied by the same amino acid or nucleic acid as it is at a position in the second sequence, then both sequences are identical at that position. The percent identity between two sequences is a function of the number of identical positions shared by the sequences.

The determination of the percentage identity of two sequences can be carried out using a mathematical algorithm. A preferred but not limiting example of a mathematical algorithm used for comparison of two sequences, the algorithm of Karlin et al. (1993), PNAS USA, 90: 5873-5877. Such an algorithm is integrated into the NBLAST program which can identify sequences having a desired identity to the sequences of the present invention. In order to obtain a gapped alignment as described above, the gapped BLAST program can be used, as described in Altschul et al. (1997), Nucleic Acids Res. 25: 3389-3402.

Functional variants within the meaning of the invention may preferably be mRNA molecules according to the invention, cytokine mRNA or adjuvo viral mRNA molecules which have an increased stability and / or translation rate compared to their wild-type molecules. There may also be better transport into the cell of the (host) organism.

The term variants includes in particular those amino acid sequences which have conservative substitution with respect to the physiological sequences. Conservative substitutions refer to those substitutions in which amino acids derived from the same class are interchanged. In particular, there are amino acids with aliphatic side chains, positively or negatively charged side chains, aromatic groups in the side chains or amino acids whose side chains can undergo hydrogen bonding, for example. Side chains which have a hydroxy function. This means that, for example, one amino acid with one polar side chain is replaced by another amino acid with a likewise polar side chain or, for example, an amino acid characterized by a hydrophobic side chain is substituted by another amino acid with likewise hydrophobic side chain (eg serine (threonine) by threonine (Serine) or leucine (isoleucine) by isoleucine (leucine)). Insertions and substitutions are possible in particular at those sequence positions which do not cause any change in the three-dimensional structure or affect the binding region. A change of a three-dimensional structure By insertion (s) or deletion (s), for example, with the help of CD spectra (circular dichroism spectra) easily verifiable (Urry, 1985, absorption, circular dichroism and ORD of polypeptides, in: Modern Physical Methods in Biochemistry, Neuberger et al. (ed.), Elsevier, Amsterdam).

Also included are variants where "codon usage." Each amino acid is encoded by a codon defined by three nucleotides (triplet), and it is possible to have one codon that encodes a particular amino acid for another For example, by selecting suitable alternative codons, the stability of the mRNA according to the invention can be increased.

Suitable methods for producing variants according to the invention with amino acid sequences which have substitutions with respect to the wild-type sequences are disclosed, for example, in the publications ^" US 4,737,462, US 4,588,585, US 4,959,314, US 5,116,943, US 4,879,111 and US 5,017,691 In general, Maniatis et al., (2001), Molecular Cloning: A. Laboratory Manual, Col. Spring Harbor Laboratory Press) also teaches that codons may be omitted, supplemented, or substituted .. Variants within the meaning of the invention may also be prepared by: insertions, deletions, and / or substitutions of one or more nucleotides are introduced into the nucleic acids encoding the variants. [zahlreiche Im] Numerous methods for such alterations of nucleic acid sequences are known in the art One of the most widely used techniques the oligonucleotide court site-specific mutagenesis (see Comack B., Current Protocols in Molecular Biology, 8.01-8.5.9, Ausubel F. et al., ed. 1991). In this technique, an oligonucleotide is synthesized whose sequence has a specific mutation. This oligonucleotide is then hybridized with a template containing the Contains wild-type nucleic acid sequence. Preferably, a single-stranded template is used in this technique. After annealing of the oligonucleotide and template, a DNA-dependent DNA polymerase is used to synthesize the second strand of the oligonucleotide that is complementary to the template DNA strand. As a result, a heteroduplex molecule containing a mismatch caused by the above-mentioned mutation in the oligonucleotide is obtained. The oligonucleotide sequence is introduced into a suitable plasmid, this is introduced into a host cell, and in this host cell, the oligonucleotide DNA is replicated. With this technique one obtains nucleic acid sequences with targeted changes (mutations) which can be used for the production of variants according to the invention.

In a preferred embodiment of the method according to the invention, the at least one cytokine (from the cytokine category) is selected from the group consisting of IL-1 (α / β), 1L-2, 1L-3, IL-4, 1L-5 , 1L-6, 1L-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-15, IL-18, 1L-21, IL-22, IL-23, IFN-α, IFN-β, IFN-γ, LT-α, MCAF, RANTES, TGFα, TGFβi, TGFβ2, TNFα, TNFβ and particularly preferably G-CSF, M-CSF or GM-CSF, in particular (recombinant or not recombinant) of the human forms of the aforementioned cytokines, as well as their variants or fragments. In another preferred embodiment, in a method step b. Cytokine mRNA coding for one of the aforementioned cytokines, their fragments or variants, or contains corresponding coding sections used.

The mRNA from step (a.) And / or step (b.) (Ie, the cytokine or adjuvo viral mRNA according to the invention) or the adjuvant RNA from step (b.) Of the method according to the invention can be described as naked ( m) RNA or complexed with other components.

In a preferred embodiment, the mRNA from step (a.) And / or step (b.) Or the adjuvant RNA from step (b.) Of the invention Method as a modified (m) RNA, in particular stabilized (m) RNA, before. Modifications of the mRNA according to the invention or of the (m) RNA from step (b) serve in particular to increase the stability of the mRNA according to the invention or of the (m) RNA from step (b.) But also to improve the transfer of the mRNA according to the invention or the (m) RNA from step (b.) (ie the cytokine mRNA, the adjuvo viral mRNA and the adjuvant RNA) into a cell or a tissue of an organism. Preferably, the mRNA according to the invention or the (m) RNA from step (b.) Of the method according to the invention has one or more modifications, in particular chemical modifications, which are used to increase the half-life of the mRNA according to the invention or of the (m) RNA from step (b). b.) in the organism or improve the transfer of the mRNA according to the invention or the (m) RNA from step (b.) into the cell or a tissue.

In a particularly preferred embodiment of the present invention, the G / C content of the coding region of the modified mRNA according to the invention consists of step (a.) And / or the cytokine mRNA and / or the adjuvo viral mRNA

Step (b.) Of the method according to the invention increased over the G / C content of the coding region of the respective wild-type RNA, wherein the encoded

Amino acid sequence of the modified mRNA according to the invention or the mRNA from step (b.) Is preferably unchanged from the coded amino acid sequence of the respective wild-type mRNA.

This modification is based on the fact that the sequence of the sequence of the mRNA to be translated is essential for the efficient translation of an mRNA. Significant here is the composition and sequence of the various nucleotides. In particular, sequences with elevated G (guanosine) / C (cytosine) content are more stable than sequences with increased A (adenosine) / U (uracil) content. Therefore, according to the invention, while maintaining the translated amino acid sequence, the codons are varied with respect to the wild-type mRNA in such a way that they increasingly contain G / C nucleotides. Due to the fact, that several codons code for one and the same amino acid (so-called "degeneracy of the genetic code"), the most favorable for the stability codons can be determined (so-called "alternative codon usage" or English: "codon usage").

Depending on the amino acid to be coded by the modified mRNA (from step (a.) Or (b.)), There are different possibilities for modifying the mRNA sequence according to the invention or the cytokine mRNA sequence or the adjuvo-viral mRNA sequence the wild-type sequence possible. In the case of amino acids encoded by codons containing only G or C nucleotides, no modification of the codon is required. Thus, the codons for Pro (CCC or CCG), Arg (CGC or CGG), Ala (GCC or GCG), and Gly (GGC or GGG) require no change since there is no A or U present.

In contrast, codons containing A and / or U nucleotides may be altered by substitution of other codons which encode the same amino acids but do not contain A and / or U. Examples for this are:

- the codons for Pro can be changed from CCU or CCA to CCC or CCG;

the codons for Arg can be changed from CGU or CGA or AGA or AGG to CGC or CGG;

the codons for AIa can be changed from GCU or GCA to GCC or GCG; - The codons for GIy can be changed from GGU or GGA to GGC or GGG.

While in other cases A or U nucleotides can not be eliminated from the codons, it is possible to reduce the A and U contents by: Codons are used which contain a smaller proportion of A and / or U nucleotides. Examples for this are:

the codons for Phe can be changed from UUU to UUC; the codons for Leu can be changed from UUA, UUG, CUU or CUA to CUC or CUG;

the codons for Ser can be changed from UCU or UCA or AGU to UCC, UCG or AGC; the codon for Tyr can be changed from UAU to UAC; the codon for Cys can be changed from UGU to UGC; the codon His can be changed from CAU to CAC;

the codon for GIn can be changed from CAA to CAG;

the codons for He can be changed from AUU or AUA to AUC; the codons for Thr can be changed from ACU or ACA to ACC or ACG;

the codon for Asn can be changed from AAU to AAC; the codon for Lys can be changed from AAA to AAG;

- the codons for VaI can be changed from GUU or GUA to GUC or GUG; the codon for Asp can be changed from GAU to GAC;

the codon for GIu can be changed from GAA to GAG,

- The stop codon UAA can be changed to UAG or UGA.

In the case of the codons for Met (AUG) and Trp (UGG), however, there is no possibility of sequence modification.

The substitutions listed above can be used both individually but also in all possible combinations for increasing the G / C content of the modified mRNA according to the invention or the cytokine mRNA or the adjuvo viral mRNA with respect to the respective wild-type mRNA (the original sequence) become. For example, all the codons occurring in the wild-type sequence for Thr can be changed to ACC (or ACG). However, for example, combinations of the above substitution possibilities are preferably used: Substitution of all codons coding for Thr in the original sequence (wild-type mRNA) to ACC (or ACG) and substitution of all codons originally coding for Ser to UCC (or UCG or AGC);

Substitution of all codons coding for He in the original sequence to AUC and substitution of all codons originally coding for Lys to AAG and substitution of all codons originally coding for Tyr to UAC;

Substitution of all codons coding for VaI in the original sequence to GUC (or GUG) and substitution of all originally coding for GIu codons to GAG and substitution of all originally coding for AIa codons to GCC (or GCG) and substitution of all codons originally coding for Arg to CGC (or CGG); Substitution of all codons coding for VaI in the original sequence to GUC (or GUG) and substitution of all codons originally coding for GIu to GAG and substitution of all codons originally coding for AIa to GCC (or GCG) and substitution of all codons originally coding for GIy GGC (or GGG) and substitution of all codons originally coding for Asn to AAC; Substitution of all codons coding for VaI in the original sequence to GUC (or GUG) and substitution of all codons originally coding for Phe to UUC and substitution of all codons originally coding for Cys to UGC and substitution of all codons originally coding for Leu to CUG (or CUC ) and substitution of all codons originally coding for GIn to CAG and substitution of all codons originally coding for Pro to CCC (or CCG); etc.

Preferably, the G / C content of the antigen coding region of the modified mRNA or cytokine mRNA or adjuvovirus mRNA according to the invention is at least 7%, more preferably at least 15%, most preferably at least 20% % Points to the G / C content of the encoded region of the wild-type mRNA encoding the antigen. In this context, it is particularly preferred to maximally increase the G / C content of the modified mRNA according to the invention or the cytokine mRNA or adjuvo-viral mRNA, in particular in the region coding for the antigen, in comparison to the wild-type sequence.

Another preferred modification of the mRNA from step (a.) And / or step (b.) Of the method according to the invention is based on the finding that the translation efficiency is also determined by a different frequency in the occurrence of tRNAs in cells. Therefore, if so-called "rare" codons are increasingly present in an RNA sequence, the corresponding mRNA is significantly worse translated than in the case where codons coding for relatively "frequent" tRNAs are present.

Thus, in the modified mRNA or cytokine mRNA or cytokine mRNA or adjuvo viral mRNA of the method of the invention, the region coding for the antigen is changed from the corresponding region of the wild-type mRNA such that at least one wild-type codon Sequence coding for a relatively rare tRNA in the cell, exchanged for a codon which codes for a relatively frequent in the cell tRNA, which carries the same amino acid as the relatively rare tRNA. This modification modifies the RNA sequences to insert codons for which common tRNAs are available. In other words, by this modification, according to the invention, all codons of the wild-type sequence which code for a relatively rare tRNA in the cell can each be exchanged for a codon which codes for a relatively frequent tRNA in the cell, which carries the same amino acid like the relatively rare tRNA.

Which tRNAs occur relatively frequently in the cell and which, in contrast, occur relatively rarely, is known to a person skilled in the art; see. eg Akashi, Curr. Opin. Genet. Dev. 2001, 11 (6): 660-666. Particularly preferred are the codons which use the most frequently occurring tRNA for the particular amino acid, ie, for example, the gly codon which uses the tRNA most frequently occurring in the (human) cell.

According to the invention, it is particularly preferable to link the, in particular, the maximum, sequential G / C content in the modified mRNA or cytokine mRNA according to the invention or the adjuvo viral mRNA with the "frequent" codons, without the amino acid sequence of the coding sequence Range of mRNA encoded antigen to change. This preferred embodiment provides a particularly efficiently translated and stabilized mRNA according to the invention, for example, for the method according to the invention.

The determination of a mRNA according to the invention modified as described above (increase in the G / C content, exchange of tRNAs) can be determined on the basis of the computer program explained in WO 02/098443, the disclosure content of which is fully incorporated into the present invention. With this computer program, the genetic code or its degenerative nature, the nucleotide sequence of any mRNA can be modified so that a maximum G / C content in conjunction with the use of codons that occur as frequently as possible in the cell tRNAs , wherein the amino acid sequence encoded by the modified mRNA is preferably unchanged from the unmodified sequence. Alternatively, only the G / C content or only the codon usage can be modified from the original sequence. The source code in Visual Basic 6.0 (development environment used: Microsoft Visual Studio Enterprise 6.0 with Service Pack 3) is also given in WO 02/098443. In a further preferred embodiment of the present invention, the A / U content in the vicinity of the ribosome binding site of the modified mRNA from step (a.) And / or step (b.) Of the method according to the invention over the A / U content in the environment of the ribosome binding site of the respective wild-type mRNA increased. This modification (an increased A / U content around the ribosome binding site) increases the efficiency of ribosome binding to the mRNA of the invention. Effective binding of the ribosomes to the ribosome binding site (Kozak sequence: GCCGCCACCAUGG, the AUG forms the start codon), in turn, effects efficient translation of the mRNA or other mRNAs of the present invention having adjuvant properties.

A likewise preferred embodiment of the present invention relates to a method according to the invention, wherein the coding region and / or the 5 'and / or 3' untranslated region of the mRNA from step (a.) And / or step (b.) ( ie cytokine mRNA or adjuvo viral mRNA) to the respective wild-type mRNA is changed so that it contains no destabilizing sequence elements, wherein the encoded amino acid sequence of the modified mRNA to the respective wild-type mRNA is preferably not changed. It is known that, for example, destabilizing sequence elements (DSE) occur in the sequences of eukaryotic mRNAs, to which signal proteins bind and regulate the enzymatic degradation of the mRNA in vivo. Therefore, for further stabilization of the modified mRNA optionally in the region coding for the antigen, one or more such changes can be made to the corresponding region of the wild-type mRNA so that there are no or substantially no destabilizing sequence elements. By means of such modifications, according to the invention, DSE present in the non-translated regions (3'- and / or 5'-UTR) can also be eliminated from the mRNA according to the invention. Such destabilizing sequences include, for example, AU-rich sequences ("AURES") that occur in 3 'UTR portions of numerous unstable mRNAs (Caput et al., Proc. Natl. Acad., USA, 1986, 83: 1670-1674 ). The inventive or adjuvant mRNA molecules contained in the method according to the invention are therefore preferably modified from the wild-type mRNA in such a way that they have no such destabilizing sequences. This also applies to those Sequenzmptive, which are recognized by possible endonucleases, for example. The sequence GAACAAG, which is contained in the 3 'UTR segment of the gene coding for the transferin receptor gene (Binder et al., EMBO J. 1994, 13: 1969 to 1980). These sequence motifs are also preferably removed in the modified mRNA according to the invention or the adjuvant mRNA (cytokine mRNA or adjuvo-viral mRNA) of the method according to the invention.

In a further preferred embodiment of the present invention, the mRNA from step (a.) And / or step (b.) (For example the cytokine mRNA) of the method according to the invention has a 5'-cap structure. Examples of cap structures which can be used in the present invention are m7G (5 ') ppp (5' (A, G (5 ') ppp (5') A and G (5 ') ppp (5') G) Modifications may also occur with adjuvant RNA from step (b.).

Furthermore, it is preferred that the mRNA from step (a.) And / or step (b.) Of the method according to the invention in a modified form a poly (A) tail, preferably of at least 25 nucleotides, more preferably of at least 50 nucleotides, even more preferably of at least 70 nucleotides, also more preferably of at least 100 nucleotides, most preferably of at least 200 nucleotides.

Likewise preferably, the mRNA from step (a.) And / or step (b.) Of the method according to the invention in a modified form has at least one IRES and / or at least one 5'- and / or 3'-stabilization sequence. According to the invention, one or more so-called IRES ("internal ribosomal entry side") can accordingly be inserted into the mRNA from step (a.) And / or step (b.) An IRES can thus function as the sole ribosome binding site. however, it can also be used to provide an mRNA from step (a.) and / or step (b.) which codes for a plurality of antigens which are to be translated independently of one another by the ribosomes ("multicistronic mRNA"). Sequences are those from picornaviruses (eg FMDV), pestviruses (CFFV), polioviruses (PV), encephalococytitis viruses (ECMV), foot-and-mouth disease viruses (FMDV), hepatitis C viruses (HCV), classical Porcine Fever Viruses (CSFV), Murine Leukoma Virus (MLV), Simean Immunodeficiency Viruses (SLV) or Cricket Paralysis Viruses (CrPV).

Further preferably, the mRNA from step (a.) And / or step (b.) Of the method according to the invention has at least one 5 'and / or 3' stabilization sequence. These stabilization sequences in the 5 ¹ and / or 3 'untranslated regions cause an increase in the half-life of the mRNA according to the invention in the cytosol. These stabilizing sequences may have 100% sequence homology to naturally occurring sequences found in viruses, bacteria and eukaryotes, but may also be partially or wholly synthetic. As an example of stabilizing sequences useful in the present invention, the untranslated sequences (UTR) of the globin gene, for example of Homo sapiens or Xenopus laevis, may be mentioned. Another example of a stabilization sequence has the general formula (C / U) CCAN _x CCC (U / A) Py _x UC (C / U) CC contained in the 3 ¹ UTR of the very stable mRNA coding for globin, - (I) -Col, 15-lipoxygenase or tyrosine hydroxylase encoded (see Holcik et al., Proc Natl Acad., See, USA 1997, 94: 2410-2414). Of course, such stabilizing sequences may be used alone or in combination with each other as well as in combination with other stabilizing sequences known to one skilled in the art. The mRNA from step (a.) And / or step (b.) Of the inventive method therefore as globin UTR (untranslated regions) - stabilized mRNA, especially as ß-globin-UTR-stabilized mRNA, before. It has been found according to the invention that the injection of naked β-globin UTR (untranslated regions) -stabilized adjuvant mRNA according to the invention, optionally in combination with such modified or differently modified mRNA, into the auricle of a mammal (eg from mice) has a specific immune response against the antigen encoded by the mRNA according to the invention induced (17). In other words, the inventors have tracked the course of the injected β-globin UTR-stabilized mRNA and the type of immune response it triggers, thus demonstrating translation in vivo (see Figure 1). This vaccination strategy has been further investigated and a pharmaceutical mRNA has been developed that can be used in human clinical trials.

In a preferred embodiment of the present invention, the modified mRNA from step (a.) And / or step (b.) Or the adjuvant RNA from step (b.) Of the method according to the invention comprises at least one analog of naturally occurring nucleotides. This analogue / analogue serves to further stabilize the modified mRNA according to the invention, this being based on the fact that the RNA-degrading enzymes occurring in the cells preferably recognize naturally occurring nucleotides as substrate. Thus, by incorporating nucleotide analogs into the RNA, RNA degradation can be hampered, and the effect on translation efficiency upon incorporation of these analogs, particularly into the coding region of the mRNA, can have a positive or negative effect on translation efficiency. By way of a non-exhaustive list, examples of nucleotide analogues useful in the present invention include phosphoramidates, phosphorothioates, peptide nucleotides, methylphosphonates, 7-deazaguanosine, 5-methylcytosine, and inosine. The preparation of such analogs is well known to those skilled in the art, for example, from U.S. Patents 4,373,071, 4,401,796, 4,415,732, 4,458,066, 4,500,707, 4,668,777, 4,973,679 and 5,047,524 5,132,418, US 5,153,319, US 5,262,530 and 5,700,642. According to the invention, such analogs can occur in untranslated and translated regions of the modified mRNA.

A person skilled in the art is familiar with various methods for carrying out the modifications described. Some of these methods have already been described in the above section on the variants of the invention. For example, for the substitution of codons in the modified mRNA according to the invention or an mRNA (cytokine mRNA or adjuvo viral mRNA) or adjuvant RNA from step (b.) Or in the case of shorter coding regions, the entire mRNA according to the invention can be synthesized chemically using standard techniques become.

However, substitutions, additions or eliminations of bases using a DNA template for the production of the modified mRNA according to the invention or of a mRNA from step (b.) Are preferably introduced by means of techniques of customary site-directed mutagenesis (see, for example, Maniatis et al., Molecular Cloning : A Laboratory Manual, Colard Spring Harbor Laboratory Press, 3rd ed., CoId Spring Harbor, NY, 2001). In such a method, a corresponding DNA molecule is transcribed in vitro to produce the mRNA according to the invention or an mRNA from step (b.). This DNA template has a suitable promoter, for example a 17 or SP6 promoter, for in vitro transcription, which is followed by the desired nucleotide sequence for the mRNA to be produced and a termination signal for in vitro transcription. According to the invention, the DNA molecule which forms the template of the RNA construct to be produced is prepared by fermentative propagation and subsequent isolation as part of a plasmid replicable in bacteria. . As in the present invention, suitable plasmids may, for example, the plasmids pT7Ts (GenBank accession number U26404; Lai et al, Development, 1995, 121: 2349-2360.), PGEM ^® series, for example, pGEM ^® -1 (GenBank accession number. X65300; from Promega) and pSP64 (GenBank accession number X65327); see. Also, Mezei and Starts, Purification of PCR Products, in: Griffin and Griffin (eds.), PCR Technology: Current Innovation, CRC Press, Boca Raton, FL, 2001.

It is thus possible to clone the desired nucleotide sequence into a suitable plasmid using short synthetic DNA oligonucleotides which have short single-stranded transitions at the resulting interfaces or genes produced by chemical synthesis (see Maniatis et al. supra). The DNA molecule is then excised from the plasmid, in which it may be in single or multiple copy, by digestion with restriction endonucleases.

In addition to the above-mentioned modifications on the level of the nucleotide sequence, further modifications into the mRNA from step a. and / or b. be introduced.

In a further embodiment of the present invention, the mRNA from step (a.) And / or step (b.) Or the adjuvant RNA from step (b.) Of the method according to the invention is complexed or condensed with at least one cationic or polycationic agent, and modified to that extent. Preferably, such a cationic or polycationic agent is an agent selected from the group consisting of protamine, poly-L-lysine, poly-L-arginine and histones.

By virtue of this modification on the basis of the complexing of the mRNA from step (a.) (Inventive mRNA) and / or step (b.) Or the adjuvant RNA from step (b.), The effective transfer of the modified (m) RNA into the cells to be treated or the tissue or the organism to be treated are improved by the fact that the above-mentioned (m) RNA is associated with or bound to a cationic peptide or protein. In particular, the use of protamine as a polycationic, nucleic acid-binding protein is particularly effective. The use of other cationic peptides or proteins, such as poly-L-lysine or histones, is of course also possible. This procedure for stabilizing the abovementioned (m) RNA molecules in a method according to the invention is described, for example, in EP-A-1083232, the relevant disclosure content of which is fully included in the present invention.

In a further embodiment of the present invention, the modified mRNA according to the invention or the adjuvant mRNA or adjuvant RNA from step (b.) Of the method according to the invention is stabilized with polyethyleneimine (PEI) and modified in this respect.

The mRNA according to the invention, the cytokine mRNA, the adjuvo viral mRNA and / or the adjuvant RNA (in each case modified or not) can be present in single or double-stranded form and used as such or as a mixture in a method according to the invention. In the case of a double-strandedness, at least one usually open end of the double strand, preferably both, may also be covalently bonded to one another, for example via a "hairpin" structure.

All of the modifications described above with reference to the mRNA from step (a.) According to the invention (for example introduction of nucleotide analogues, 5'-cap structure, etc.) are likewise based on the adjuvant RNA or on the cytokine in the context of the invention mRNA or adjuvo-viral mRNA from step (b.) of the method according to the invention.

The above-described, all modifications of the mRNA according to the invention or the cytokine mRNA, the adjuvo-viral mRNA or the adjuvant RNA of the method according to the invention can occur individually or in combinations with one another within the meaning of the invention.

The invention further relates to a product comprising at least one mRNA according to the invention, comprising a region coding for at least one antigen of a pathogen or at least one tumor antigen, and at least one component of at least one of the following categories selected from the group consisting of a cytokine, a cytokine mRNA, an adjuvo viral mRNA, a CpG DNA and an adjuvant RNA, as a combined preparation for simultaneous, separate or sequential use in the treatment and / or prophylaxis of tumor diseases (eg lymphoma, pancreatic, melanoma and other skin cancers, solid Tumors of the liver, lung, head, intestine, stomach, sarcoma), allergies, autoimmune diseases such as multiple sclerosis, viral and / or bacterial infections, especially HIV, influenza, rubella, measles, rabies, herpes, dengue fever , Yellow fever, hepatitis, pneumonia, legionnaires' disease, streptococcus kink, enterococcal, staphylococcal infections or infections with protozoan pathogens, for example trypanosomes.

Patients with the aforementioned indications can also be treated with a method according to the invention.

The constituents of the product according to the invention: at least one mRNA according to the invention containing a region coding for at least one antigen of a pathogen or at least one tumor antigen (1 st constituent) and at least one cytokine and / or at least one cytokine mRNA and / or at least one adjuvant viral mRNA and / or at least one CpG DNA and / or at least one adjuvant RNA (second constituent) are in functional unity through their targeted use. The constituents of the product may be those described above, which are advantageous according to the invention Effect do not unfold independently, so that despite the spatial separation of the components 1 and 2 (for simultaneous, separate or time-graduated administration) their application as a new, not described in the prior art combination product is present. Since the component 2 can contain several components, for example cytokine mRNA and CpG DNA or a cytokine and CpG DNA or also 2 different cytokine mRNAs, the component 2 can be used as a mixture (possibly different) components of possibly different ones of the aforementioned categories or but the (possibly different) components of possibly different of the aforementioned categories of ingredient 2 may also be present separately.

A product according to the invention may comprise all constituents, substances and embodiments as used in a method or method for the treatment and / or prophylaxis of diseases or combination therapy methods according to the present invention.

The invention further relates to a kit comprising at least one mRNA according to the invention containing a region coding for at least one antigen of a pathogen or at least one tumor antigen and at least one component from at least one of the following categories selected from the group consisting of a cytokine , a cytokine mRNA, an adjuvo viral mRNA, a CpG DNA and an adjuvant RNA containing the at least one mRNA according to the invention containing a coding for at least one antigen of a pathogen or at least one tumor antigen region, and the at least one Cyokin or at least one cytokine mRNA or at least one adjuvo-viral mRNA or at least one CpG DNA or at least one adjuvant RNA are separated, ie the kit consists of at least two parts. The kit will contain more than two parts if iS of this invention contains two or more adjunctive components such as For example, in method step (b.) Can be administered separately from each other in the kit.

A preferred embodiment of the invention relates to the use of the kit for the treatment and / or prophylaxis of cancer diseases, tumor diseases, in particular of the abovementioned specific tumor species, allergies,

Autoimmune diseases, such as multiple sclerosis, and / or viral and / or bacterial infections, such as hepatitis B, HIV or MDR (multi-drug resistance) infections, influenza, herpes, rubella, measles, rabies, streptococcal, pneumococcal, enterococci , Staphylococcal or Escherichia infections or other infectious diseases mentioned in this application.

The mRNA mentioned in the following description of the figures and in the following examples relates to the mRNA according to the invention.

characters

FIG. 1 shows the in vivo translation of injected mRNA according to the invention.

Mice were injected into the auricle with injection buffer (150 mM NaCl, 10 mM HEPES) ("buffer"), β-galactosidase-encoding β-gliobin UTR-stabilized mRNA diluted in injection buffer ("Lac Z mRNA") or β-galactosidase The mice were sacrificed 16 hours post-injection, the ears were shaved, removed and frozen in embedding medium, then freezing sections were prepared, fixed and stained overnight with X-GaI containing solution The number of blue cells detected in each section is shown in the graphs (left half of Figure 1), and the length of the analyzed ear section is plotted on the x-axis (0 is arbitrary the first Section, associated with blue cells; in the buffer-injected mice, the area lying 2 mm around the injection site was analyzed and the 0 arbitrarily determined): Each section is 50 μm, and thus some successive sections cover a total distance of several millimeters. In each of the diagrams

(Buffer-injected mice, mRNA-injected mice, DNA-injected mice) are the two sections marked by a star and a gray column, the sections shown in the accompanying microscopy images (right half of Figure 1) are. Here, open arrows indicate endogenous expression of β-galactosidase activity mainly in the ear follicles. This endogenous activity is recognizable by a very weak and diffuse blue coloration. Black filled arrows indicate blue cells resulting from the uptake and translation of an exogenous nucleic acid encoding β-galactosidase. Such cells are located at the injection site in the dermis and show a strong blue coloration. Individual sections were photographed. The sections with the most blue cells are displayed (they correspond to the sections marked with an asterisk in the diagrams). The number of blue cells in each successive one

Sections are shown on the Y-axes in the diagrams (left half of Figure 1).

FIG. 2 shows the triggering of an antigen-specific immune response of the Th2 type by the injection of mRNA. Mice were vaccinated and boosted with mRNA or DNA encoding

Galactosidase or injected with injection buffer.

Two weeks later, the mice received a booster injection

(Boost injection). Again, two weeks later, the amount of β-galactosidase-specific antibodies present in the serum were determined by ELISA using isotype-specific reagents. The left half of Figure 2 shows the IgG1 production, the right half of Figure 2 shows the IgG2a production. () shows the curve for DNA-injected mice, () shows the curve for RNA-injected mice and (♦) shows the curve for mice injected with injection buffer.

FIG. 3 shows the polarization of a Th2 immune response into a ThI

Immune response caused by the injection of GM-CSF. All results presented concern mice of the same group in one experiment. The total number of mice that immunoreacted in four independent experiments is shown in Table 1 (Figure 4).

Figure 3a: Mice were injected with either β-galactosidase emulsified in Freund's adjuvant or mRNA encoding β-galactosidase or injection buffer (negative control). GM-CSF (total 2 μg recombinant protein: ca. 10 ⁴ U (units)) was injected once, either 24 hours or 2 hours before the mRNA was injected or 24 hours after the injection of the mRNA (corresponds to the groups GM-CSF T -1, GM-CSF TO and GM-CSF T + 1). The amount of β-galactosidase-specific IgG1 or IgG2a antibodies contained in the blood of the injected mice was determined by ELISA (1:10 serum dilution). The background, mainly by the serum of buffer-injected

Mice were obtained at the same dilution was subtracted. The left half of FIG. 3a shows β-gal-specific IgG1 antibodies (), the right half of FIG. 3a shows β-gal-specific IgG2a antibodies (□, gray). FIG. 3b: The in vitro reactivation of T cells by β-galactosidase was checked by cytokine detection on day 4 of cultivation. The proportion of IFNγ () and IL-4 (Q, gray) in the supernatant of the used splenocyte culture was measured by ELISA.

Figure 3c: The cytotoxic activity of splenocytes cultured in the presence of purified β-galactosidase for six days was examined in a chromium release assay. Were the target cells were P815 (H2 ^d) cells that are either corresponds with the synthetic peptide TPHPARIGL that the H2-L ^d dominant epitope of beta-galactosidase, loaded () or were not loaded ().

Figure 4 shows Table 1, in which the total number of injected mice is shown. The total number of mice whose splenocytes showed detectable cytokine release or β-galactosidase-specific cytotoxic activity in vitro in independent experiments is shown. Mice in which at least 10% more TPHPARIGL-loaded cells were killed compared to the average killed cells of the negative control group (buffer-injected mice) were classified as responding mice. Splenocyte cultures containing at least 100 pg / ml of cytokine more than the total of cytokine in the splenocyte cultures containing negative control mice (buffer-injected mice) were classified as responding cultures (responding mice). The bolded numbers indicate groups in which more than half of the mice showed an immune response to the vaccine according to the parameters examined (cytokine or cytotoxic activity). FIG. 5: shows the polarization of a Th2 immune response in a Th1 immune response caused by the injection of GM-CSF RNA in addition to the mRNA according to the invention. All results presented concern mice of the same group in one experiment. The mice were mRNA coding for β-galactosidase, GM-

Injected CSF RNA or injection buffer. GM-CSF RNA (total 50 μg) was injected once, either 24 hours or 2 hours before the mRNA was injected or 24 hours after the injection of the mRNA (corresponds to the groups GM-CSF RNA T-1, GM-CSF). RNA TO and GM-CSF RNA T + 1). The amount of secreted IFN-γ contained in the blood of the injected mice was determined by ELISA.

The following examples are intended to further illustrate the invention. They are not intended to limit the objects of the invention thereto.

Examples

Example 1: Production of mRNA

The mRNA was obtained by in vitro transcription of suitable template DNA and subsequent extraction and purification of the mRNA. For this purpose, standard methods can be used, which are described in detail in the prior art and are familiar to the expert. For example, Maniatis et al. (2001), Molecular Cloning: Laboratory Manual, CoId Spring Harbor Laboratory Press. The same applies to the sequencing of mRNA, which followed the (described below) purification of the mRNA. Here in particular the NBLAST program was used.

The preparation of the mRNA according to the invention was generally carried out according to the following procedure:

1. Vector

The genes encoded by the respective mRNA were introduced into the plasmid vector pT7TS. pT7TS contains untranslated regions of alpha or beta globin gene and a polyA tail of 70 nucleotides:

T7 promoter Xbal

Xenopus ß-globiα 5TJntranslated region: GCTTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGC

Xenopus ß-globin 3 'untranslated region: GACTGACTAGGATCTGGTTACCACTAAACCAGCCTCAAGAACACCCGA ATGGAGTCTCTAAGCTACATAATACCAACTTACACTTACAAAATGTTG TCCCCCAAAATGTAGCCATTCGTATCTGCTCCTAATAAAAAGAAAGTT TCTTCACATTCTA or human α-globin untranslated region:

CTAGTGACTGATAGCCCGCTGGGCCTCCCAACGGGCCCTCCTCCCCTC

Figure 1: Graphic of the plasmid vector pT7TS

High purity plasmids were obtained with the Qiagen Endo-free Maxipreparation Kit or with the Machery-Nagel GigaPrep Kit. The sequence of the vector was monitored and documented by double-stranded sequencing from the T7 promoter to the PstI or XbaI site. Plasmids whose cloned gene sequence was correct and without mutations were used for in vitro transcription.

2. genes The genes encoded by the mRNA according to the invention were amplified by PCR or extracted from the plasmids (described above). Examples of gene constructs that have been used are

GP100 (accession number M77348):

PCR fragment SpeI in T7TS HinDIII blunt / Spel

MAGE-A1 (Accession number M77481): plasmid fragment HinDIII / Spel in T7TS HinDIII / Spel

MAGE-A6 (Accession number: NM_005363): PCR fragment SpeI in T7TS HinDIIlbluni / Spel

Her2 / neu (Accession number: M1 1730): PCR fragment HinDIII / Spel in T7TS HinDIII / Spel

Tyrosinase (Accession number: NM_000372): Plasmid fragment EcoRI blunt in T7TS HinDIII blunt / Spel blunt

Melan-A (Accession number: NM_005511):

Plasmid fragment Notl blunt in T7TS Hindll blunt / Spel blunt

CEA (Accession number: NM_004363): HinDIII / Spel PCR fragment in T7TS HinDIII / Spel

Tert (Accession number: NM_003219):

PCR fragment HindIII / Spel in T7TS HinDIII / Spel

WT1 (Accession number: NM_000378): Plasmid fragment EcoRV / Kpnl blunt in T7TS HinDIII blunt / Spel blunt PR3 (Accession number: NM_002777):

Plasmid fragment EcoRI blunt / XbaI in T7TS HinDIII bluni / Spel

PRAME (Accession number: NM_0061 15):

Plasmid fragment BamH1 blunt / Xbal in T7TS HinDIII blunt / Spel

Survivin (Accession number AF077350): HinDIll / Spel PCR fragment in T7TS HinDIII / Spel

Mucini (Accession number NM_002456):

Plasmid fragment: SacI blunt / BamHI in T7TS HinDIII blunt / BglII

Tenascin (Accession number X78565): PCR fragment Bglll blunt / Spel in T7TS HindIII blunt / Spel

EGFR1 (Accession number AF288738):

PCR fragment HinDII / Spe1 in T7TS HinDIII / Spe I

Sox9 (Accession number Z46629):

PCR fragment HinDIII / Spel in T7TS HinDII / Spel

Sec61 G (Accession number NM_014302): HinDIII / Spel PCR fragment in T7TS HinDII / Spel

PTRZ1 (accession number NM_002851):

PCR fragment EcoRV / Spel in T7TS HinDIII blunt / Spel 3. in vitro transcription

3.1. Production of protein-free DNA

500 μg of each of the above-described plasmids were linearized in a volume of 2.5 ml by digestion with the restriction enzyme PstI or XbaI in a 15 ml Falcon tube. This cut DNA construct was transferred to the RNA production unit. 2.5 ml of a phenol / chloroform / isoamyl alcohol mixture was added to the linearized DNA. The reaction vessel was vortexed for 2 minutes and centrifuged for 5 minutes at 4,000 rpm. The aqueous phase was lifted off and mixed with 1.75 ml of 2-propanol in a 15 ml Falcon tube. This vessel was centrifuged for 30 minutes at 4,000 rpm, the supernatant discarded and 5 ml of 75% ethanol added. The reaction vessel was centrifuged for 10 minutes at 4,000 rpm and the ethanol was removed. The vessel was again centrifuged for 2 minutes and the remainder of the ethanol was removed with a microliter pipette tip. The DNA pellet was then dissolved in 500 μl of RNase-free water (1 μg / μl).

3.2. enzymatic mRNA synthesis

Materials: - 17 Polymerase: purified from an Eco / Z strain containing a plasmid with the

Contains gene for the polymerase. This RNA polymerase uses as substrate only 17 phage promoter sequences (Fa. Fermentas),

NTPs: chemically synthesized and purified by HPLC. Purity over 96%

(Fa. Fermentas), - CAP analogue: chemically synthesized and purified by HPLC. Purity above 90% (Trilink),

RNase inhibitor: Rnasin, Injectable grade, produced recombinantly (Eco / ή (Fa.

Fermentas) DNase: Distributed as a drug through pharmacies as Pulmozym® (dornase alfa) (Roche).

The following reaction mixture was pipetted into a 15 ml Falcon tube: 100 μg linearized protein-free DNA,

400 μl 5x buffer (Tris-HCl pH 7.5, MgCl ₂ , spermidine, DTT, Inorganic

Pyrophosphate 25 U),

20 μl ribonuclease inhibitor (recombinant, 40 U / μl); 80 μl rNTP mix (ATP, CTP, UTP 10 μM), 29 μl GTP (100 mM); 116 μl Cap Analog (10 mM);

50 μl 17 RNA polymerase (200 U / μl); 1045 μl RNase-free water.

The total volume was 2 ml and was incubated for 2 hours at 37 ⁰ C in the heating block. Thereafter, 300 μl of DNAse: Pulmozyme ™ (1 U / μl) were added and the mixture was incubated at 37 ^° C. for a further 30 minutes. In this case, the DNA template was enzymatically degraded.

5. Purification of mRNAs 5.1. LiCl precipitation (lithium chloride / ethanol precipitation)

Based on 20-40 μg of RNA, it was carried out as follows: LiCl precipitation 25 μl of LiCl solution f8M1

30 μl WFI (water for injection) was added to the transcription batch (20 μl) and mixed gently, 25 μl of LiCl solution was added to the reaction vessel and the solutions were vortexed for at least 10 seconds

-2O ⁰ C incubated for at least 1 hour. The sealed vessel was then centrifuged at 4 ° C at 4,000 rpm for 30 minutes. The supernatant was discarded. To wash

5 μl of 75% ethanol was added to each pellet (under the safety cabinet). The sealed vessels were centrifuged for 20 minutes at 4 ° C at 4,000 rpm. The supernatant was discarded (under the safety cabinet) and it was again centrifuged for 2 minutes at 4 ⁰ C at 4,000 rpm. The supernatant was carefully removed with a pipette (under the safety cabinet). Thereafter, the pellet was dried for about 1 hour (under the safety cabinet).

resuspension

10 μl of WFI were added to the well-dried pellets (under the safety cabinet). The respective pellet was then dissolved in a shaker overnight at 4 ° C.

5.2. Cleaning

The final purification was carried out by phenol-chloroform extraction. However, it can also be carried out by means of anion exchange chromatography (eg MEGAclear ™ from Ambion or Rneasy from Fa. Qiagen). After this purification of the mRNA, the RNA was precipitated against isopropanol and NaCl (1 M NaCl 1:10, isopropanol 1: 1, vortexed, centrifuged for 30 min at 4,000 rpm and 4 ° C and the pellet was washed with 75% ethanol) , The purified by phenol-chloroform extraction RNA was dissolved in RNase free water and incubated at 4 ⁰ C for at least 12 hours. The concentration of each mRNA was measured at OD ₂₆₀ absorbance. (The chloroform-phenol extraction was carried out according to Sambrook J., Fritsch EF, and Maniatis T., in Molecular Cloning: A Laboratory Manual, Colard Spring Harbor Laboratory Press, NY, Vol. 1, 2, 3 (1989)). Example 2: Stabilization of mRNA

An exemplary embodiment of the stabilized mRNA according to the invention relates to a β-globin UTR-stabilized mRNA. Such a stabilized mRNA had the following structure: Cap-ß-globin UTR (80 bases) - ß-galactosidase coding sequence - ß-globin 3'-UTR (about 180 bases) poly A tail _(A30 C ₃₀ ). Instead of the β-galactosidase coding sequence, constructs were also prepared which had a sequence coding for a previously described antigen from a pathogen or tumor.

As a further exemplary embodiment of the stabilized mRNA according to the invention, the nucleic acid sequence of the coding region of the mRNA was optimized with respect to its G / C content. In order to determine the sequence of a modified mRNA according to the invention, the computer program described in WO 02/098443 was used which, with the aid of the genetic code or its degenerative nature, modifies the nucleotide sequence of an arbitrary mRNA in such a way that a maximum G / C Content in conjunction with the use of codons which code for tRNAs occurring as frequently as possible in the cell results, wherein the amino acid sequence encoded by the modified mRNA is preferably identical to the unmodified sequence. Alternatively, only the G / C content or only the codon usage can be modified from the original sequence. The source code in Visual Basic 6.0 (development environment used: Microsoft Visual Studio Enterprise 6.0 with Service Pack 3) is also specified in WO 02/098443, the disclosure of which is the subject of the present invention.

Example 3: Cell cultivation

P815 cells were incubated with 10% Htise inactivated fetal calf serum (PAN Systems, Germany), 2 mM L-glutamine, 100 U / ml penicillin and 100 μg / ml

Streptomycin supplemented and in an RPMI 1640 (Bio-Whittaker, Verviers, Belgium) cultured. CTL culture was performed in RPMI 1640 medium supplemented with 10% FCS, 2mM L-Glutamine, 100 U / ml penicillin ,! 00 μg / ml streptomycin, 50 μM β-mercaptoethanol, 50 μg / ml gentamycin, Ix MEM nonessential amino acids and 1 mM sodium pyruvate. The CTLs were restimulated for one week with 1 μg / ml β-galactosidase (Sigma, Taufkirchen, Germany). On day 4, the supernatants were gently collected and replaced with fresh medium containing 10 U / ml rlL-2 (final concentration).

In parallel experiments, restimulation was carried out with in each case 1, 3 μg / ml survivin, 1 μg MAGE-3 and 0.8 μg Muc-1. All other conditions in these experimental approaches were identical to the conditions described above.

Example 4: Immunization of Mice

6 to 12 week old female BALB / c AnNCrIBR (H-2d) mice were purchased from Charles River (Sulzfeld, Germany). Approval for the genetic (DNA and mRNA) vaccination of the mice was granted by the Animal Ethics Committee in Tübingen (number IM / 200). The BALB mice were anesthetized with 20 mg pentobarbital intraperitoneally. The mice were then injected intradermally into both pinnae with 25 μg of β-globin UTR-stabilized mRNA encoding β-galactosidase diluted with injection buffer (150 mM NaCl, 10 mM HEPES). Subsequently, 5.10 ³ units (1 μg) of GM-CSF (Peprotech, Ine, Rocky Hill, New York, USA) diluted with 25 μl of PBS were injected. This corresponded to a total amount of 2 μg (about 10 ⁴ units) which was injected only once. Such dosage is in the lowest range of dosages normally selected in mice (26). Two weeks after the first injection, the mice were treated under the same conditions (as in the first injection).

In parallel experiments I, II + III performed under the same conditions described above, mice were replaced by 25 μg of β-giobin UTR-stabilized mRNA encoding β-galactosidase and 1 μg of GM-CSF in

Experimental approach 1: 30 μg ß-globin-UTR-stabilized mRNA, coding for

Survivin and 1.2 μg IL-2, in experimental approach II: 23 μg ß-globin-UTR-stabilized mRNA, coding for

MAGE-3 and 2 μg 1L-12 and in

Experimental approach HI: 18 μg ß-globin-UTR-stabilized mRNA, coding for

Muc-1 and 1 μg IFN-α were injected.

GM-CSF (total 2 μg recombinant protein: ca. TO ⁴ U (units)) was injected once, either 24 hours or 2 hours before the mRNA was injected or 24 hours after the injection of the mRNA (corresponds to the groups GM-CSF T - 1, GM-CSF TO and GM-CSF T + 1). The amount of β-galactosidase-specific IgGI or IgG2a antibodies contained in the blood of the injected mice was determined by ELISA (1:10 serum dilution). The background, obtained mainly by serum from buffer-injected mice at the same dilution, was withdrawn.

Example 5: Chromium Release Assay

Splenocytes were stimulated in vitro with purified β-galactosidase (1 mg / ml) and CTL activity was determined after 6 days using a standard ⁵¹ Cr release assay (as described, for example, by Rammensee et al., 1989, Immunogenetics 30) : 296-302). The death rate of the cells was determined by the amount of ⁵¹ Cr (A) released into the medium compared to the amount of spontaneous ⁵¹ Cr release of the target cells (B) and the total ⁵¹ Cr content of 1% Triton X-100 lysed target cells (C) by the formula:

% Zelilyse = (A - B) - f (C - B) x 100. In parallel experiments, stimulation of the splenocytes was performed with survivin, MAGE-3 and Muc-1 (concentration 1 mg / ml each). All other conditions in these experiments were identical to the conditions described above.

Example 6: ELISA

MaxiSorb plates from Nalgene Nunc International (Nalge, Denmark) were coated overnight at 4 ⁰ C with 100 .mu.l .beta.-galactosidase at a concentration of 100 ug / ml (antibody

ELISA) or with 50 μl of anti-mouse anti-IFNγ or IL-4- (cytokine ELISA) "capture"

Antibodies (Becton Dickinson, Heidelberg, Germany) at a concentration of 1 μg / ml in coating buffer (0.02% NaN ₃ , 15 mM Na ₂ CO ₃ , 15 mM NaHCO ₃ , pH 9.6) coated. The plates were then saturated for 2 hours at 37 ^° C. with 200 μl of blocking buffer (PBS-0.05% Tween 20-1% BSA). Subsequently, they were incubated with sera (Antibody ELISA) at 1: incubated for 90 dilutions in wash buffer or l OOμl of the cell culture supernatant (cytokine ELISA) for 4 to 5 days at 37 ⁰ C: 10, 1: 30 and the first Then, 100 μl of 1: 1000 dilutions of goat anti-mouse IgG1 or IgG2a were added.

Antibodies (antibody ELISA) from Caltag (Burlington, CA) or 100 μl / well biotinylated anti-mouse anti-IFN or IL-4 (cytokine ELISA) detection antibody (Becton

Dickinson, Heidelberg, Germany) at a concentration of 0.5 μg / ml in

Blocking buffer was added and the plates incubated for 1 hour at room temperature.

For the cytokine ELISA, streptavidin-HRP (BD Biosciences, Heidelberg, Germany) per well was added after 3 washes with wash buffer, 100 μl of a 1: 1000 dilution. After 30 minutes at room temperature, 100 μl of ABTS (2,2'-

Azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) concentrate at a concentration of 300 mg / l in 0.1 M citric acid, pH 4.35). After another 15 to 30 minutes at

Room temperature, the absorbance at OD _{405 was} measured with a Sunrise ELISA reader from Tecan (Crailsheim, Germany). The amounts of cytokines were determined using a

Calculated standard curve, which was created by titration of certain amounts of recombinant cytokines (BD Pharmingen, Heidelberg, Germany). In parallel experiments, the MaxiSorb plates were coated with Survivin, MAGE-3 and Muc-1 (100 μl each). All other conditions in these parallel runs were identical to the conditions described above.

Example 7: Immunization of mice with GM-CSF RNA (see Fig. 5)

6 to 12 week old, female BALB / c AnNCrIBR (H-2d) mice (Charles River, Sulzfeld, Germany) BALB mice were anesthetized with 20 mg pentobarbital intraperitoneally analogously to Example 4 (see above). Mice were then injected intradermally into both pinnae with 25 μg of β-globin UTR-stabilized mRNA encoding β-galactosidase diluted with injection buffer (150 mM NaCl, 10 mM HEPES). Subsequently, 50 μg of GM-CSF RNA were injected once into the pinnae. Two weeks after the first injection, the mice were treated under the same conditions (as in the first injection).

In parallel experiments I, II, III, IV and V conducted under the same conditions described above, mice were incubated in

Experimental approach 1: injected injection buffer only (control); Experimental approach II: 50 μg GM-CSF RNA injected alone (control); Experimental approach III: 25 μg of β-globin-UTR-stabilized mRNA which is suitable for

Galactosidase and injected 50 μg of GM-CSF RNA, with the GM-CSF RNA administered 24 hours before the β-globin UTR-stabilized mRNA encoding β-galactosidase (corresponding to t-1); Experimental approach V: 25 μg of β-globin-UTR-stabilized mRNA which is suitable for

Galactosidase and 50 μg of GM-CSF RNA injected with the GM-CSF RNA administered 2 hours before the β-galactosidase-encoding β-globin UTR-stabilized mRNA (corresponding to t-0); Experimental approach V 25 μg ß-globin-UTR-stabilized mRNA, which for ß-

Galactosidase and injected 50 μg of GM-CSF RNA, the GM-CSF RNA being incubated 24 hours after Galactosidase-encoding β-globin UTR-stabilized mRNA was administered (corresponding to t + 1).

Maxi Sorb plates from Nalgene Nunc International (Nalge Denmark) were incubated overnight at 4 ° C with 50 ml of an anti-mouse anti-interferon-γ (IFNγ) antibody at 1 mg / ml in a coating buffer (0.02% NaN ₃ , 15 mM Na ₂ CO ₃ , 15 mM NaHCO ₃ , pH 6.6). The plates were then saturated with 200 ml of the blocking buffer (PBS-0.05% Tween 20-1% BSA) for 2 hours at 37 ° C and then with 100 ml of cell culture supernatant (cytokine ELISA) for 4-5 h at 37 ° C incubated. 100 μl of 1: 1000 dilutions of 100 μl per well of the biotinylated anti-mouse anti-IFNγ detection antibody (Becton Dickinson) was added at 0.5 mg / ml in a blocking buffer and incubated for one hour at room temperature. After 3 washes with wash buffer, 100 ml of a 1 to 1000 dilution of streptavidin-HRP (horseradish peroxidase, BD Biosciences, Heidelberg, Germany) was added per well. After 30 minutes at room temperature, 100 ml per well of ABTS (300 mg / l 2,2-azino-bis- (3-ethylbenzthiazoline-6-sulfonic acid) in 0.1 M citrate, pH 4.35) was added to the substrate. After 15 to 30 minutes at room temperature, the extinction at OD405 was measured with a Sunrise ELISA reader from Tecan (Crailsheim, Germany) and the amounts of cytokine were determined according to a standard curve obtained by titration with specific amounts of recombinant cytokines (BD Pharmingen, Heidelberg, Germany). It can be clearly seen that the immunostimulation is significantly increased by administration of GM-CSF mRNA before, approximately at the same time and after the injection of β-galactosidase mRNA.

Bibliography

1. Tang, D.C, DeVit, M. & Johnston, S.A. Genetic immunization is a simple method for eliciting an immune response. Nature 356, 152-154 (1992).

2. UlmerJ.B. et al. Heterologous protection against influenza by injection of DNA encoding a viral protein. Science 259, 1745-1749 (1993).

3. Wang, B. et al. Gene inoculation generates immune responses against human immunodeficiency virus type 1. Proc Natl. Acad. USA 90, 4156-4160 (1993).

4. Robinson, H.L, Hunt, LA. & Webster, R.G. Protection against a lethal influenza virus challenge by immunization with a haemagglutinin-expressing plasmid DNA. Vaccine Λ Λ, 957-960 (1993).

5. Fynan, E.F. et al. DNA vaccines: protective immunizations by parenteral, mucosal, and gene-gun inoculations. Proc Natl Λcad Sei USA 90, 11478-

11482 (1993).

6. UlmerJ.B. An update on the state of the art of DNA vaccines. Curr. Opin. DrugDiscov. Devel. 4, 192-197 (2001).

7. Donnelly, J., Berry, K. & UlmerJ.B. Technical and regulatory hurdles for DNA vaccines. IntJ Parasitol. 33, 457-467 (2003).

8. Klinman, D.M. et al. DNA vaccines: safety and efficaey issues. Springer Semin. Immunopathol. 19, 245-256 (1997).

9. Gilkeson, GS, Pippen, AM & Pisetsky, DS Induction of cross-reactive anti-dsDNA antibodies in preautoimmune NZB / NZW mice by immunization with bacterial DNA. J Clin Invest 95, 1398-1402 (1995). 10. Saenz-Badillos J., Amin, SP & Granstein, RD RNA as a Tumor Vaccine: a review of the literature. Exp Dermatol®, 143-154 (2001).

11. Sullenger, B.A. & Gilboa, E. Emerging clinical applications of RNA. Nature 418, 252-258 (2002).

12. Nair, S.K. et al. Induction of primary carcinoembryonic antigen (CEA) -specific cytotoxic T lymphocytes in vitro using human dendritic cells transfected with RNA. NatBiotechnolΛb, 364-369 (1998).

13. Ying, H. et al. Cancer therapy using a self-replicating RNA vaccine. NaL Med. 5, 823-827 (1999).

14. Schirmacher, V. et al. Intra-pinna anti-tumor vaccination with self-replicating infectious RNA or with DNA encoding a model tumor antigen and a cytokine. Gene Ther. 7, 1137-1147 (2000).

15. Martinon, F. et al. Induction of virus-specific cytotoxic T lymphocytes in vivo by liposome-entrapped mRNA. Eur. ImmunolTi, Mllllllll (1993).

16. Vassilev, V.B, Gil, LH. & Donis, R.O. Microparticle-mediated RNA immunization against bovine viral diarrhea virus. Vaccine 19, 2012-2019 (2001).

17. Hoerr, I., Obst, R., Rammensee, H.G. & Young, G. In vivo application of RNA leads to induction of specific cytotoxic T lymphocytes and antibodies. Eur. J Immunol. 30, 1-7 (2000).

18. Granstein, RD, Ding, W. & Ozawa, H. Induction of anti-tumor immunity with epidermal cells pulsed with tumor-derived RNA or intradermal administration of RNA. J Invest Dermatol 114, 632-636 (2000). 19. Iwasaki, A., Stiernholm, BJ, Chan, AX, Berinstein, NL & Barber, BH Enhanced CTL responses mediated by plasmid DNA immunogens encoding costimulatory molecules and cytokines. J Immunol. S§, 4591 -4601 (1997).

20. Warren, T.L & Weiner, G.J. Uses of granulocyte-macrophage colony-stimulating factor in vaccine development. Curr. Opin. Hematol. 7, 168-173

(2000).

21. Scheel, B. et al. Immunostimulating capacities of stabilized RNA molecules. Eur. J. Immunol. 34, 537-547 (2004).

22. Diebold, S.S., Kaisho, T., Hemmi, H., Akira, S. & Rice E sousa. lnnate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA.

Science 303, 1529-1531 (2004).

23. HeiI, F. et al. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. Sc / ence303, 1526-1529 (2004).

24. Kwissa, M., Kroger, A., Hauser, H. _v. Reimann, J. & Umbrella Beck, R. Cytokine facilitated priming of CD8 (+) T cell responses by DNA vaccination. J Mol.

Med 81, 91-101 (2003).

25. ChoJ.H., Lee, S.W. & Sung, Y.C. Enhanced cellular immunity to hepatitis C nonstructural proteins by codelivery of granulocyte macrophage-colony stimulating factor genes in intramuscular DNA immunization. Vaccine 17, 1136-1144 (1999).

26. WeberJ. et al. Granulocyte-macrophage-colony-stimulating factor added to a multipeptide Vaccine for resected Stage II melanoma. Cancer 97, 186-200 (2003).

27. Kusakabe, K. et al. The timing of GM-CSF expression plasmid administration Influences the Th1 / Th2 response induced by H1V-1 -specific DNA vaccine.

J Immunol 164, 3102-3111 (2000).

Claims

claims

A method of immunostimulating in a mammal comprising the steps of: a. Administering at least one mRNA containing an area coding for at least one antigen of a pathogen or at least one tumor antigen, and b. Administering at least one of at least one of the following categories selected from the group consisting of a cytokine, a cytokine mRNA, an adjuvo viral mRNA, a CpG DNA and an adjuvant RNA.

2. The method of claim 1, wherein step b. 1 minute to 48 hours, preferably 20 minutes to 36 hours, also preferably 30 minutes to 24 hours, more preferably 10 hours to 30 hours, most preferably 12 hours to 28 hours, especially preferably 20 hours to 26 hours, after step a. he follows.

3. The method according to any one of the preceding claims, wherein in step a. additionally at least one RNase inhibitor, preferably RNAsin or

Aurintricarbonsäure, is administered.

4. The method according to any one of the preceding claims, wherein an immune response is amplified or modulated, preferably from a Th2 immune response is changed to a Th1 immune response.

5. The method according to any one of the preceding claims, wherein the at least one mRNA from step (a.) Contains an area selected for at least one antigen from a tumor selected from the group consisting of 707-AP, AFP, ART-4, BAGE , Catenin / m, Bcr-abl, CAMEL, CAP-1, CASP-8,

CDC27 / m, CDK4 / m, CEA, CMV pp65, CT, Cyp-B, DAM, EGFRI, ELF2M, ETV6-AML1, G250, GAGE, GnT-V, GpIO0, HAGE, HBS, HER-2 / neu, HLA-A * O2O1-R17OI, HPV-E7, HSP70-2M, HAST-2, hTERT (or hTRT) , Influenza matrix protein, in particular influenza A matrix M1 protein or influenza B matrix M1 protein, iCE, KIAA0205, LAGE, eg LAGE-1, LDLR / FUT, MAGE, eg MAGE-A, MAGE-B , MAGE-C, MAGE-A1, MAGE-2, MAGE-3,

MAGE-6, MAGE-10, MART-1 / Melan-A, MC1R, myosin / m, MUCl, MUM-1, -

2, -3, NA88-A, NY-ESO-1, p190 minor bcr-abl, Pml / RAR, PRAME, proteinase 3, PSA, PSM, PTPRZ1, RAGE, RU1 or RU2, SAGE, SART-1 or SART- 3, SEC61G, SOX9, SPCI, SSX, survivin, TEL / AML1, TERT, TNC, TPI / m, TRP-I, TRP-2, TRP-2 / INT2, tyrosinase and WTI.

6. The method according to any one of the preceding claims, wherein the at least one cytokine is selected from the group consisting of IL-I (α / ß), IL-2, IL-

3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-15, IL-18, IL-21 , IL-22, IL-23, IFN-α, IFN-β, IFN-γ, LT-α, MCAF, RANTES, TGFα, TGFβ1, TGFβ2,

TNFα, TNFβ, and more preferably G-CSF or GM-CSF or M-CSF.

7. The method according to any one of the preceding claims, wherein the at least one mRNA from step (a.) And / or from step (b.) Is present as naked or complexed mRNA.

8. The method according to any one of the preceding claims, wherein the at least one mRNA from step (a.) And / or from step (b.) Stabilized as globin UTR (untranslated regions) -stabilized mRNA, in particular as ß-globin UTR- mRNA is present.

9. The method according to any one of the preceding claims, wherein the at least one mRNA from step (a.) And / or from step (b.) Is present as a modified mRNA, in particular as a stabilized mRNA.

10. The method according to any one of the preceding claims, wherein the G / C content of the coding region of the modified mRNA from step (a.) And / or from step (b.) Compared to the G / C content of the coding region of the wild-type Is increased, wherein the encoded amino acid sequence of the modified mRNA compared to the encoded amino acid sequence of

Wild-type mRNA is preferably unaltered.

11.A method according to one of the preceding claims, wherein the A / U content in the vicinity of the ribosome binding site of the modified mRNA from step (a.) And / or from step (b.) Compared to the A / U content in the

Environment of the ribosome binding site of wild-type mRNA is increased.

12. The method according to any one of the preceding claims, wherein the coding region and / or the 5 'and / or 3' untranslated region of the modified mRNA from step (a.) And / or from step (b.) Compared to

Wild-type mRNA is modified such that it contains no destabilizing sequence elements, wherein the encoded amino acid sequence of the modified mRNA is preferably unchanged from the wild-type mRNA.

13. The method according to any one of the preceding claims, wherein the modified mRNA from step (a.) And / or from step (b.) A 5'-cap structure and / or a poly (A) tail, preferably of at least 25th Nucleotides, more preferably at least 50 nucleotides, even more preferably at least 70 nucleotides, also more preferably at least

100 nucleotides, most preferably at least 200 nucleotides, and / or at least one IRES and / or at least one 5 'and / or 3' stabilization sequence.

14. The method according to any one of the preceding claims, wherein the modified mRNA from step (a.) And / or from step (b.) Or the adjuvant RNA from step (b.) Has at least one analogous naturally occurring nucleotides.

15. The method according to any one of the preceding claims, wherein the modified mRNA from step (a.) And / or from step (b.) Or the adjuvant RNA from step (b.) Is complexed or condensed with at least one cationic or polycationic agent.

16. A method according to any one of the preceding claims, wherein the cationic or polycationic agent is selected from the group consisting of protamine, poly-L-lysine, poly-L-arginine and histones.

17. The method according to any one of the preceding claims for the treatment of

Tumor diseases, allergies, autoimmune diseases, such as multiple sclerosis, protozoological, viral and / or bacterial infections.

18. A product comprising at least one mRNA containing a coding for at least one antigen of a pathogen or at least one tumor antigen region, and at least one component of at least one of the following categories selected from the group consisting of a cytokine, a CpG DNA, a cytokine mRNA, an adjuvo-viral mRNA and an adjuvant RNA, as a combined preparation for simultaneous, separate or sequential use in the

Treatment and / or prophylaxis of tumor diseases, allergies,

Autoimmune diseases, such as multiple sclerosis, viral and / or bacterial infections.

19. A kit comprising at least one mRNA containing a coding for at least one antigen of a pathogen or at least one tumor antigen region, and at least one component of at least one category selected from the group consisting of a cytokine, a cytokine mRNA, an adjuvo-viral mRNA, a CpG DNA at least and an adjuvant RNA, wherein the at least one mRNA containing a coding for at least one antigen of a pathogen or at least one tumor antigen region, and the at least one cytokine or the at least one cytokine mRNA or the at least one CpG DNA or the at least one adjuvant RNA or the at least one adjuvo-viral mRNA are separated from each other.

20. Use of the kit according to claim 19 for the treatment and / or prophylaxis of tumor diseases, allergies, autoimmune diseases, such as multiple sclerosis, protozoological, viral and / or bacterial

Infections.