EP1797178B1 - Citrobacter freudii phytase et homologues - Google Patents
Citrobacter freudii phytase et homologues Download PDFInfo
- Publication number
- EP1797178B1 EP1797178B1 EP05804336A EP05804336A EP1797178B1 EP 1797178 B1 EP1797178 B1 EP 1797178B1 EP 05804336 A EP05804336 A EP 05804336A EP 05804336 A EP05804336 A EP 05804336A EP 1797178 B1 EP1797178 B1 EP 1797178B1
- Authority
- EP
- European Patent Office
- Prior art keywords
- phytase
- enzyme
- sequence
- amino acid
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Not-in-force
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K20/00—Accessory food factors for animal feeding-stuffs
- A23K20/10—Organic substances
- A23K20/189—Enzymes
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K50/00—Feeding-stuffs specially adapted for particular animals
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K50/00—Feeding-stuffs specially adapted for particular animals
- A23K50/70—Feeding-stuffs specially adapted for particular animals for birds
- A23K50/75—Feeding-stuffs specially adapted for particular animals for birds for poultry
-
- A—HUMAN NECESSITIES
- A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
- A23K—FODDER
- A23K50/00—Feeding-stuffs specially adapted for particular animals
- A23K50/80—Feeding-stuffs specially adapted for particular animals for aquatic animals, e.g. fish, crustaceans or molluscs
Definitions
- the present invention relates to phytases, nucleotide sequences for same, methods of production of phytases and their use.
- the present invention relates to the field of enzymes for additives to feedstuffs. More specifically, the present invention relates to phytases which can be used for enhancing phosphate digestion in foods and animal feeds.
- Phytate is the major storage form of phosphorus in cereals and legumes.
- monogastric animals such as pig, poultry and fish are not able to metabolise or absorb phytate (or phytic acid) and therefore it is excreted leading to phosphorous pollution in areas of intense livestock production.
- phytic acid also acts as an antinutritional agent in monogastric animals by chelating metal agents such as calcium, copper and zinc.
- Phytate is converted by phytases which generally catalyse the hydrolysis of phytate to lower inositol-phosphates and inorganic phosphate.
- Phytases are useful as additives to animal feeds where they improve the availability of organic phosphorus to the animal and decrease phosphate pollution of the environment ( Wodzinski RJ, Ullah AH. Adv Appl Microbiol. 42, 263-302 (1996 )).
- the present invention relates to phytases derived from a bacterium and modified forms thereof.
- the invention relates to wild type phytases derived from the bacterium, Citrobacter freundii, and variant/modified forms thereof showing improved characteristics compared to the wild-type enzyme.
- the present invention is advantageous as it provides for novel phytases that have properties making them particularly useful and efficient as feed enzymes.
- the invention relates to isolated and/or purified novel phytase polypeptide as described herein or functional fragments or variants or modified forms thereof.
- the invention also provides the nucleic acid and amino acid sequences encoding said phytases.
- a phytase To be efficient as an enzyme additive to food or animal feed, a phytase has to combine a number of different properties. In order to be able to degrade phytic acid in the acidic environment of an animal's stomach it has to be active at low pH, preferably over a broad range of pH values. In addition, it has to have high specific activity and preferably high thermostability to enable the protein to withstand high temperatures commonly used in preparation of feedstuffs such as feed pellets.
- the enzyme has broad substrate specificity allowing it to hydrolyse not only phytate but also intermediate products of phytate degradation such as inositol pentaphosphates, tetraphosphates and triphosphates.
- intermediate products of phytate degradation such as inositol pentaphosphates, tetraphosphates and triphosphates.
- inositol-triphosphates generated by the phytase from B. subtilis are essentially resistant to further hydrolysis by this enzyme ( Kerovuo J. et al. Biochem J. (200) 352, 623-628 ).
- a plasmid or a vector system or a transformed or a transgenic organism comprising a novel phytase as described herein or a modified form thereof.
- the present invention relates to transgenic organisms modified to express a novel phytase as described herein or a modified form thereof and therefore being capable of producing a phytase.
- the present invention further provides means and methods for the biotechnological production of phytases and their use as feed supplements.
- expression As used with reference to the present invention, the terms "expression”, “expresses”, “expressed” and “expressable” are synonymous with the respective terms “transcription”, “transcribes”, “transcribed” and “transcribable”.
- transformation and “transfection” refer to a method of introducing nucleic acid sequences into hosts, host cells, tissues or organs.
- the present invention also encompasses methods of expressing the nucleotide sequence for use in the present invention using the same, such as expression in a host cell; including methods for transferring same.
- the present invention further encompasses methods of isolating the nucleotide sequence, such as isolating from a host cell.
- amino acid sequences for use in the present invention include: a construct encoding the amino acid sequences for use in the present invention; a vector encoding the amino acid sequences for use in the present invention; a plasmid encoding the amino acid sequences for use in the present invention; a transformed cell expressing the amino acid sequences for use in the present invention; a transformed tissue expressing the amino acid sequences for use in the present invention; a transformed organ expressing the amino acid sequences for use in the present invention; a transformed host expressing the amino acid sequences for use in the present invention; a transformed organism expressing the amino acid sequences for use in the present invention.
- the present invention also encompasses methods of purifying the amino acid sequences for use in the present invention using the same, such as expression in a host cell; including methods of transferring same, and then purifying said sequence.
- SEQ ID NO: 1 lists the sequence obtained for identification of the bacterial strain.
- SEQ ID NO: 2 lists the sequence comprising the phytase gene from C . freundii P3-42.
- SEQ ID NO: 3 lists the amino acid sequence of the phytase gene C . freundii P3-42.
- the present invention features an enzyme comprising the amino acid sequence corresponding to Citrobacter freundii phytase or a modified form, a variant, a functional equivalent or an effective fragment thereof.
- phytase means a protein or polypeptide which is capable of catalysing the hydrolysis of esters of phosphoric acid including phytate and releasing inorganic phosphate. Phytases are capable to hydrolyse, in addition to phytate, at least some of the inositol-phosphates of intermediate degrees of phosphorylation.
- Citrobacter freundii phytase means that the enzyme need not have been obtained from a source of Citrobacter freundii. Instead, the enzyme has to have essentially the same functional characteristics or sequence as that of Citrobacter freundii phytase.
- the term "functional equivalent thereof” means that the enzyme has to have essentially the same functional characteristics as that of wild-type Citrobacter freundii phytase.
- modified form or “variant” means that the enzyme has been modified from its original form but retains essentially the same enzymatic functional characteristics as that of wild-type Citrobacter freundii phytase.
- variant or “modified form” encompass phytase enzymes with an amino acid sequence derived from the amino acid sequence of the parent/wild-type phytase and having one or more amino acid substitutions, insertions, and/or deletions, which together are referred to as mutations.
- Modified forms or variants may be altered in the enzyme characteristics compared to the parent enzyme.
- modified forms or variants Preferably, modified forms or variants have an increased thermostability, an increased pepsin stability, an increased specific activity, a broader substrate specificity, or other modifications that are beneficial for the application of the enzyme.
- the term "functional" or “effective” fragment means a fragment or portion of the Citrobacter freundii phytase that retains essentially the same enzymatic function or effect.
- the enzyme of this aspect of the present invention has the same sequence or a sequence that is at least 90% identical (homologous) to that of Citrobacter freundii phytase.
- the enzyme comprises the amino acid sequence as shown in SEQ ID NO: 3 or a sequence having at least 90% identity (homology) thereto or a functional fragment thereof.
- the invention provides an isolated and/or purified polypeptide having the amino acid sequence as set out in SEQ ID NO: 3 or a sequence having at least 90% identity (homology) thereto.
- the phytase is characterised in that it is derived from Citrobacter freundii strain P3-42 deposited under accession number NCIMB 41247.
- the description relates to a phytase in accordance with any embodiment of the first aspect of the invention that comprises one or more mutations at the following positions (numbering according to the numbering in SEQ ID No. 3): 22, 23, 24, 28, 46, 53, 57, 67, 74, 75, 77, 78, 79, 82, 88, 95, 96, 97, 98, 101, 102, 103, 105, 109, 112, 122, 126, 136, 140, 142, 143, 148, 151, 152, 154, 156, 160, 161, 164, 168, 170, 176, 177, 195, 199, 203, 204, 205, 206, 207, 215, 224, 225, 229, 233, 235, 274, 279, 288, 301, 307, 308, 322, 343, 358, 360, 362, 365, 366, 367, 370, 383, 384, 3
- Preferred mutations described herein include: A22T, E23K, E23Q, E24D, M28L, K46E, K46R, D53K, D53N, D57Y, G67R, G74R, E75K, E75V, V77I, S78T, E79V, Q82H, Q82K, Q82R, F88Y, N95D, N95P, N96P, N96S, N96Y, Q97T, T98G, T98P, S101F, P102L, G103E, V105I, A109T, D112V, D112Y, F122Y, L126I, Y136N, E140V, K142R, T143I, T143P, N148D, K151G, M152K, M152V, T154I, S156T, L160F, K161N, N164D, E168D, A170T, L176Q, L176V, Y177F, S195T, T199I, T203I
- conservative mutations is meant mutations to amino acid residues that are conservative in terms of the amino acid characteristics compared to the amino acid residue indicated.
- Amino acid characteristics include the size of the residue, hydrophobicity, polarity, charge, pK-value, and other amino acid characteristics known in the art and also described in more detail below.
- the mutations are at one or more of the following positions: 23, 46, 53, 75, 82, 88, 95, 96, 98, 112, 143, 152, 176, 177, 199, 203, 204, 205, 225, 229, 233, 274, 288, 307, 308, 362, 370, 384 and 385
- Preferred mutations at these specific positions include: E23K, E23Q, K46E, K46R, D53K, D53N, E75K, E75V, Q82H, Q82K, Q82R, F88Y, N95D, N95P, N96P, N96S, N96Y, T98G, D112V, D112Y, T143I, T143P, M152K, M152V, L176Q, L176V, Y177F, T199I, T203I, T203L, T203S, T203W, E204A, E204G, E204H, E204I, E204N, E204R, E204V, K205P, K205R, N225D, N225E, P229S, S233C, Q274H, Q274L, R288M, E307Y, N308D, N308T, T362A, T362I, Q370H, I384F, I384L, I384M and Q
- a phytase comprising one mutation selected from the group consisting of: P229S; D112V; Q82R; Q274H; D112Y; F88Y; K46B; S233C; R288M; I384L; Q385R; Q274L; E307Y; T199I; Q82K and T203I.
- a phytase comprising a combination of mutations selected from the group consisting of: K46E/Q82H; Q82K/V105I; N148D/T362I; K46E/L414I; F88Y/Y136N; T154I/P386Q; N95P/N96S; N95P/N96P; Q97T/T98G; D224H/N225E; Y177F/T199I; Q274L/Q370H; K46E/N96Y; N148D/L301S; E24D/R288M; E140V/A322V; K46E/S195T; E75K/N365D; T98P/S235A; L160F/L215F; Q274L/K395T; G67R/Q279R/N308T; K161N/P229S/R288M; D53N/D57Y/M152V
- a phytase comprising a combination of mutations selected from the group consisting of: D57Y/F88Y/N95P/Q97T/N148D/M152V/T154I/Y177F/Q274H/I384L ; D53N/D57Y/F88Y/N95P/N96P/Q97T/M152V/Y177F/Q274H/Q279E/T362I/I384L ; D53N/Q82K/F88Y/N96P/T98G/V105I/N148D/T154I/Q274H/T362I/I384L/P386Q ; Q82R/F88Y/N96P/T98G/V105I/D112V/Y136N/V148D/T154I/Y177F/P386Q/A393P D53N/Q82K/F88Y/N95P/N96
- a preferred phytase in accordance with the present description is a variant consisting of the amino acid sequence listed as SEQ ID NO: 3 and having one or more of the amino acid mutations listed above or one of the combinations of mutations listed above.
- the nomenclature indicates a phytase comprising the amino acid sequence set out in SEQ ID NO: 3 with the mutations indicated by reference to the positions of the amino acids in SEQ ID NO: 3.
- the nomenclature is described in more detail below.
- these variants show improved characteristics with respect to any one of the following: temperature stability, pH range, pepsin stability, specific activity, substrate specificity. Suitable methods for determining these characteristics are disclosed herein.
- the improvements in phytase characteristics are directed to the enzyme stability under food and feed processing conditions, to the enzyme stability during stomach transit, and to the enzyme activity and stability in human or animal stomach and/or intestinal tract making the improved variants particularly suitable for use as feed supplements.
- improvements comprise among other parameters the increase in stability at elevated temperatures, preferably at temperatures above 65 °C, the increase in stability against proteolytic digestion, preferably protease of the digestive tract, the increase in catalytic activity at low pH, preferably catalytic activity below pH 5.5, and the general efficiency of releasing phosphate groups from phytate.
- the phytase or functional equivalent of the present invention is characterised in that said phytase has a specific activity of 1000 U/mg or higher wherein said specific activity is determined by incubating said phytase in a solution containing 2mM phytate, 0.8mM CaCl 2 in 200mM sodium acetate buffer at pH 3.5.
- the phytase of the present invention or functional equivalent thereof may also suitably be characterised in that said phytase has two activity maxima around pH 3 and pH 4 - 4.5 wherein said activity is determined by incubating said phytase in a solution containing 2mM phytate, 0.8mM CaCl 2 in 200mM sodium acetate buffer.
- the description provides a method of preparing a phytase enzyme variant, which method comprises:
- the description provides a method of preparing a phytase enzyme variant, which method comprises:
- the phytase enzyme variant is preferably screened for higher thermal stability.
- the phytase enzyme variant is preferably screened for higher thermal stability and higher proteolytic stability.
- the phytase enzyme variant is preferably screened for higher thermal stability and higher proteolytic stability and higher specific activity.
- the parent phytase enzyme is preferably derived from Citrobacter freundii, more preferably Citrobacter freundii P3-42.
- the DNA sequence encoding a parent phytase enzyme is preferably subjected to random mutagenesis, more preferably error prone PCR, even more preferably error threshold PCR.
- the preferred methods of mutagensis of DNA sequence encoding a parent phytase enzyme is error prone PCR, more preferably error threshold PCR, other methods of mutagensis may be used either in place of error prone/threshold PCR or in conjunction with error prone/threshold PCR. See Example 12 which provides references for suitable error prone PCR and error threshold PCR methods. Other methods are disclosed under the
- the term 'expression in a host cell' when used in the context of the embodiments which refer to 'a method of preparing a phytase enzyme variant' is preferably defined as production of the phytase enzyme variant in a living organism, organ or cell as herein defined.
- the phytase enzyme variants may also be produced via in vitro methods which utilise the transcription and translation machinery isolated from of one or more cells isolated from one or more living organism.
- in vitro production of variant phytases on the invention can also be used for selecting preferred variant phytases.
- In vitro expression can suitable performed using standard techniques. For reference please see ' In vitro Expression Guide' available from Promega Inc (Part# BR053).
- thermo stability difference is preferably determined using the methods disclosed in Example 12.
- the variant phytase enzyme prepared by the method of preparing phytase enzyme variants preferably has a thermal stability difference of at least 1.5, more preferably 2, 2.5, 3, 3.5, 4, 5, 6, 7, 8, 9, most preferably at least 10.
- Variants with higher proteolytic stability is preferably determined by the methods disclosed in Example 12.
- the phytase enzyme variant of the invention has a proteolytic stability of at least 45%, preferably 50%, 55%, more preferably, at least 60%.
- the description provides methods for the preparation of an animal feed comprising a phytase enzyme variant.
- the description provides methods for the preparation of an animal feed comprising a phytase enzyme variant.
- the preferred aspects of the method of preparing a phytase enzyme variant also apply to the above methods of preparing an animal feed comprising a phytase enzyme variant
- the invention provides an isolated and/or purified nucleic acid molecule or nucleotide sequence coding for the enzyme comprising the amino acid sequence corresponding to Citrobacter freundii phytase, or a homologue thereof.
- said isolated and/or purified nucleic acid molecule encodes a polypeptide comprising the amino acid sequence as shown in SEQ ID NO: 3 or a sequence having at least 90% identity (homology) thereto.
- the nucleic acid molecule encodes a polypeptide comprising SEQ ID NO:3 and including mutations at the preferred positions listed herein or any of the specific mutations or combinations of mutations listed herein.
- nucleic acid molecule comprising a nucleotide sequence that is the same as, or is complementary to, or contains any suitable codon substitutions for any of those of SEQ ID NO: 2 or comprises a sequence which has at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with SEQ ID NO: 2.
- nucleotide sequence in a yet further aspect, herein is described a nucleotide sequence and to the use of a nucleotide sequence shown as:
- the nucleotide sequence of the present invention may comprise sequences that encode for SEQ ID No. 3.
- the invention provides a plasmid or vector system comprising a phytase as described herein.
- the plasmid or vector system comprises a nucleic acid sequence as set out in SEQ ID No: 2 or a sequence that is at least 75% homologous thereto.
- the plasmid or vector system is an expression vector for the expression of any of the enzymes encoded by a nucleic acid sequence as set out in any of SEQ ID No: 2 or a sequence that is at least 75% homologous (identical) thereto in a microorganism.
- the invention provides a plasmid or vector system for expression of any of the modified enzymes or variants described herein. Suitable expression vectors are described herein.
- a host cell transformed or transfected with a nucleic acid encoding a phytase as described herein.
- the host cell in accordance with this aspect of the invention comprises a phytase which comprises an amino acid sequence, as set out in SEQ ID NO: 3 or a sequence that is at least 90% homologous thereto.
- said host cell produces a phytase.
- a host cell transformed or transfected with a nucleic acid encoding a phytase in accordance with the invention.
- the phytase is a Citrobacter freundii phytase as described herein or a homologue or derivative thereof.
- said phytase enzyme comprises an amino acid sequence, as set out in any of SEQ ID No: 3 or a sequence that is at least 90% homologous (identical) thereto.
- said host cell produces a phytase.
- nucleotide sequence which can be used in the present invention is obtainable from (though it does not have to be actually obtained from) Citrobacter freundii, although it will be recognised that enzymes isolated and/or purified from equivalent strains may equally be used.
- the host cell is derived from a microorganism including bacteria and fungi, including yeast.
- the host cell is a prokaryotic bacterial cell.
- Suitable bacterial host cells include bacteria from different prokaryotic taxonomic groups including proteobacteria, including members of the alpha, beta, gamma, delta and epsilon subdivision, gram-positive bacteria such as Actinomycetes, Firmicutes, Clostridium and relatives, flavobacteria, cyanobacteria, green sulfur bacteria, green non-sulfur bacteria, and archaea.
- the Enterobacteriaceae such as Escherichia coli proteobacteria belonging to the gamma subdivision and low GC-Gram positive bacteria such as Bacillus.
- Suitable fungal host cells include yeast selected from the group consisting of Ascomycota including Saccharomycetes such as Pichia, Hansenula, and Saccharomyces, Schizosaccharmycetes such as Schizosaccharomyces pombe and anamorphic Ascomycota including Aspergillus.
- Suitable eukaryotic host cells include insect cells such as SF9, SF21, Trychplusiani and M121 cells.
- the polypeptides according to the invention can advantageously be expressed in insect cell systems.
- phytase genes can be expressed in whole insect organisms.
- Virus vectors such as baculovirus allow infection of entire insects. Large insects, such as silk moths, provide a high yield of heterologous protein. The protein can be extracted from the insects according to conventional extraction techniques.
- Expression vectors suitable for use in the invention include all vectors which are capable of expressing foreign proteins in insect cell lines.
- host cells include plant cells selected from the group consisting of protoplasts, cells, calli, tissues, organs, seeds, embryos, ovules, zygotes, etc.
- the invention also provides whole plants that have been transformed and comprise the recombinant DNA of the invention.
- plant generally includes eukaryotic alga, embryophytes including Bryophyta, Pteridophyta and Spermatophyta such as Gymnospermae and Angiospermae.
- said host cell is a microorganism.
- Preferred microorganisms include prokaryotic bacterial cells preferably, E. coli, B. subtilis and other species of the genus Bacillus, yeast, preferably, Hansenula polymorpha and Schizosaccharomyces pombe.
- a bacterial cell strain Citrobacter freundii P3-42 deposited by Danisco Global Innovation, Sokeritehtaantie 20, FIN-02460 Kantvik, Finland under accession number NCIMB 41247. Such a cell can be incorporated directly into feed.
- a method for the production of phytases comprising transfecting a host cell with an expression vector or plasmid in accordance with the invention, culturing said host cell under conditions for the expression of the phytase and extracting said phytase from the host cell culture media.
- said method is for the production of a phytase comprising expressing an amino acid sequence as set out in SEQ ID NO: 3 or a sequence having at least 90% homology thereto or an effective fragment thereof in a host cell and extracting the secreted protein from the host cell culture medium.
- the feed composition comprises a phytase in accordance with the invention.
- the feed composition comprises a phytase at a concentration of 10-10000 U/kg feed, preferably, 200-2000U/kg feed, more preferably, 500-1000 U/kg feed.
- the feed composition comprises a host cell in accordance with the invention.
- the present invention is advantageous as it provides phytases that have a number of properties that make them particularly useful as additives to animal feeds.
- the phytases of the present invention are active at low pH and, preferably in the range pH 2 to 5.5 with activity maxima around pH 3 and 4.5.
- the phytases of the present invention are active at low pHs of the stomach environment.
- the phytases of the present invention are efficiently secreted both in the native host and during heterologous expression thus leading to more efficient production and isolation for addition to feed.
- the phytases of the present invention have a broad substrate specificity including penta- tetra, tri and di- phosphate substrates thereby increasing the total available phosphate to the animal.
- the phytases of the present invention also have a high specific activity in the region of 1000 U/mg +/- approximately 10%.
- the products of the present invention may be used as additives/supplements to foods and feed.
- the products may also be useful in the commercial production of various inositol-phosphates.
- Phytic acid myo -inositol hexaltisphosphate
- the salt form, phytate is the major storage form of phosphorous in these plants.
- Phytases catalyse phosphate monoester hydrolysis of phytic acid which results in the step-wise formation of myo-inositol pentakis-, tetrakis-, tris-, bis- and monophosphates, as well as the liberation of inorganic phosphate.
- wild type phytase or wild type as used herein refer to a phytase enzyme with an amino acid sequence found in nature.
- phytase variant or “variant” or “modified form” refer to a phytase enzyme with an amino acid sequence derived from the amino acid sequence of a parent phytase having one or more amino acid substitutions, insertions, and/or deletions, which together are referred to as "mutations".
- parent phytase or parent enzyme refer to a phytase enzyme from which a phytase variant is derived.
- a parent phytase can be a wild type phytase or another phytase variant.
- a "parent phytase” may be derived from a Citrobacter freundii.
- the "parent phytase” is derived from Citrobacter freundii strain P3-42 as described herein which, preferably has the amino acid sequence set out in SEQ ID NO:3.
- nucleotide or amino acid sequence is in an isolated form.
- isolated means that the sequence is at least substantially free from at least one other component with which the sequence is naturally associated in nature and as found in nature.
- the nucleotide or amino acid sequence is in a purified form.
- purified means that the sequence is in a relatively pure state - e.g. at least about 90% pure, or at least about 95% pure or at least about 98% pure.
- the scope of the present invention encompasses nucleotide sequences encoding enzymes having the specific properties as defined herein.
- nucleotide sequence refers to an oligonucleotide sequence, nucleic acid or polynucleotide sequence, and variant, homologues, fragments and derivatives thereof (such as portions thereof).
- the nucleotide sequence may be of genomic or synthetic or recombinant origin, which may be double-stranded or single-stranded whether representing the sense or anti-sense strand.
- nucleotide sequence or "nucleic acid molecule” in relation to the present invention includes genomic DNA, cDNA, synthetic DNA, and RNA. Preferably it means DNA, more preferably cDNA sequence coding for the present invention.
- the nucleotide sequence when relating to and when encompassed by the per se scope of the present invention does not include the native nucleotide sequence according to the present invention when in its natural environment and when it is linked to its naturally associated sequence(s) that is/are also in its/their natural environment.
- the term "non-native nucleotide sequence" means an entire nucleotide sequence that is in its native environment and when operatively linked to an entire promoter with which it is naturally associated, which promoter is also in its native environment.
- amino acid sequence encompassed by scope the present invention can be isolated and/or purified post expression of a nucleotide sequence in its native organism.
- amino acid sequence encompassed by scope of the present invention may be expressed by a nucleotide sequence in its native organism but wherein the nucleotide sequence is not under the control of the promoter with which it is naturally associated within that organism.
- nucleotide sequence encompassed by scope of the present invention or the nucleotide sequences for use in the present invention are prepared using recombinant DNA techniques (i.e. recombinant DNA).
- the nucleotide sequence could be synthesised, in whole or in part, using chemical methods well known in the art (see Caruthers MH et al., (1980) Nuc Acids Res Symp Ser 215-23 and Hom T et al., (1980) Nuc Acids Res Symp Ser 225-232 ).
- a nucleotide sequence encoding either an enzyme which has the specific properties as defined herein or an enzyme which is suitable for modification may be identified and/or isolated and/or purified from any cell or organism producing said enzyme.
- Various methods are well known within the art for the identification and/or isolation and/or purification of nucleotide sequences. By way of example, PCR amplification techniques to prepare more of a sequence may be used once a suitable sequence has been identified and/or isolated and/or purified.
- a genomic DNA and/or cDNA library may be constructed using chromosomal DNA or messenger RNA from the organism producing the enzyme. If the amino acid sequence of the enzyme or a part of the amino acid sequence of the enzyme is known, labelled oligonucleotide probes may be synthesised and used to identify enzyme-encoding clones from the genomic library prepared from the organism. Alternatively, a labelled oligonucleotide probe containing sequences homologous to another known enzyme gene could be used to identify enzyme-encoding clones. In the latter case, hybridisation and washing conditions of lower stringency are used.
- enzyme-encoding clones could be identified by inserting fragments of genomic DNA into an expression vector, such as a plasmid, transforming enzyme-negative bacteria with the resulting genomic DNA library, and then plating the transformed bacteria onto agar plates containing a substrate for the enzyme (e.g. maltose for a glucosidase (maltase) producing enzyme), thereby allowing clones expressing the enzyme to be identified.
- an expression vector such as a plasmid
- transforming enzyme-negative bacteria with the resulting genomic DNA library
- a substrate for the enzyme e.g. maltose for a glucosidase (maltase) producing enzyme
- the nucleotide sequence encoding the enzyme may be prepared synthetically by established standard methods, e.g. the phosphoroamidite method described by Beucage S.L. et al., (1981) Tetrahedron Letters 22, p 1859-1869 , or the method described by Matthes et al., (1984) EMBO J. 3, p 801-805 .
- the phosphoroamidite method oligonucleotides are synthesised, e.g. in an automatic DNA synthesiser, purified, annealed, ligated and cloned in appropriate vectors.
- the nucleotide sequence may be of mixed genomic and synthetic origin, mixed synthetic and cDNA origin, or mixed genomic and cDNA origin, prepared by ligating fragments of synthetic, genomic or cDNA origin (as appropriate) in accordance with standard techniques. Each ligated fragment corresponds to various parts of the entire nucleotide sequence.
- the DNA sequence may also be prepared by polymerase chain reaction (PCR) using specific primers, for instance as described in US 4,683,202 or in Saiki R K et al., (Science (1988) 239, pp 487-491 ).
- nucleotide sequences may be readily produced in which the triplet codon usage, for some or all of the amino acids encoded by the original nucleotide sequence, has been changed thereby producing a nucleotide sequence with low homology to the original nucleotide sequence but which encodes the same, or a variant, amino acid sequence as encoded by the original nucleotide sequence.
- the degeneracy of the genetic code is at the third position in the triplet codon (wobble position) (for reference see Stryer, Lubert, Biochemistry, Third Edition, Freeman Press, ISBN 0-7167-1920-7 ) therefore, a nucleotide sequence in which all triplet codons have been "wobbled" in the third position would be about 66% identical to the original nucleotide sequence however, the amended nucleotide sequence would encode for the same, or a variant, primary amino acid sequence as the original nucleotide sequence.
- the present invention further relates to any nucleotide sequence that has alternative triplet codon usage for at least one amino acid encoding triplet codon, but which encodes the same, or a variant, polypeptide sequence as the polypeptide sequence encoded by the original nucleotide sequence.
- an enzyme-encoding nucleotide sequence has been isolated and/or purified, or a putative enzyme-encoding nucleotide sequence has been identified, it may be desirable to modify the selected nucleotide sequence, for example it may be desirable to mutate the sequence in order to prepare an enzyme having improved stability characteristics in accordance with the present invention.
- Mutations may be introduced using synthetic oligonucleotides. These oligonucleotides contain nucleotide sequences flanking the desired mutation sites.
- site directed mutagenesis instead of site directed mutagenesis, such as described above, one can introduce mutations randomly for instance using a commercial kit such as the GeneMorph PCR mutagenesis kit from Stratagene, or the Diversify PCR random mutagenesis kit from Clontech.
- a commercial kit such as the GeneMorph PCR mutagenesis kit from Stratagene, or the Diversify PCR random mutagenesis kit from Clontech.
- a third method to obtain novel sequences is to fragment non-identical nucleotide sequences, either by using any number of restriction enzymes or an enzyme such as Dnase I, and reassembling full nucleotide sequences coding for functional proteins.
- mutations or natural variants of a polynucleotide sequence can be recombined with either the wildtype or other mutations or natural variants to produce new variants.
- Such new variants can also be screened for improved functionality of the encoded polypeptide.
- the production of new preferred variants may be achieved by various methods well established in the art, for example the Error Threshold Mutagenesis ( WO 92/18645 ), oligonucleotide mediated random mutagenesis ( US 5,723,323 ), DNA shuffling ( US 5,605,793 ), exo-mediated gene assembly ( WO 0058517 ), or RCR® Recombination Chain Reaction ( EP 1230390 and US 6,821,758 ).
- amino acid sequence is synonymous with the term “polypeptide” and/or the term “protein”. In some instances, the term “amino acid sequence” is synonymous with the term “peptide”. In some instances, the term “amino acid sequence” is synonymous with the term “enzyme”.
- amino acid sequence may be prepared/isolated from a suitable source, or it may be made synthetically or it may be prepared by use of recombinant DNA techniques.
- the enzyme encompassed in the present invention may be used in conjunction with other enzymes.
- a combination of enzymes wherein the combination comprises the enzyme of the present invention and another enzyme, which may be another enzyme according to the present invention. This aspect is discussed in a later section.
- amino acid sequence when relating to and when encompassed by the per se scope of the present invention is not a native enzyme.
- native enzyme means an entire enzyme that is in its native environment and when it has been expressed by its native nucleotide sequence.
- the present invention also encompasses the use of variants, homologues and derivatives of any amino acid sequence of an enzyme or of any nucleotide sequence encoding such an enzyme.
- homologue means an entity having a certain homology with the amino acid sequences and the nucleotide sequences.
- identity can be equated with “identity”.
- homologous in this context refers to the percentage of sequence identity between two enzymes after aligning their sequences using alignment algorithms as described in more detail below.
- a homologous amino acid sequence is taken to include an amino acid sequence which may be at least 90% identical, preferably at least 95, 96, 97, 98 or 99% identical to the sequence.
- the homologues will comprise the same active sites etc. - e.g as the subject amino acid sequence.
- homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.
- a functional fragment is meant a fragment of the polypeptide that retains that characteristic properties of that polypeptide.
- a functional fragment of a phytase enzyme is a fragment that retains the carotenoid cleavage capability of the whole protein.
- an homologous nucleotide sequence is taken to include a nucleotide sequence which may be at least 90% identical, preferably at least 95, 96, 97, 98 or 99% identical to a nucleotide sequence encoding an enzyme of the present invention (the subject sequence).
- the homologues will comprise the same sequences that code for the active sites etc. as the subject sequence.
- homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.
- homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.
- % homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence is directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues.
- GCG Bestfit program A new tool, called BLAST 2 Sequences is also available for comparing protein and nucleotide sequence (see FEMS Microbiol Lett 1999 174(2): 247-50 ; FEMS Microbiol Lett 1999 177(1): 187-8 and tatiana@ncbi.nlm.nih.gov).
- a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance.
- An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the BLAST suite of programs.
- GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). For some applications, it is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.
- percentage homologies may be calculated using the multiple alignment feature in DNASIS TM (Hitachi Software), based on an algorithm, analogous to CLUSTAL ( Higgins DG & Sharp PM (1988), Gene 73(1), 237-244 ).
- % homology preferably % sequence identity.
- the software typically does this as part of the sequence comparison and generates a numerical result
- sequences may also have deletions, insertions or substitutions of amino acid residues which produce a silent change and result in a functionally equivalent substance.
- Deliberate amino acid substitutions may be made on the basis of similarity in amino acid properties (such as polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues) and it is therefore useful to group amino acids together in functional groups.
- Amino acids can be grouped together based on the properties of their side chain alone. However it is more useful to include mutation data as well.
- the sets of amino acids thus derived are likely to be conserved for structural reasons. These sets can be described in the form of a Venn diagram ( Livingstone C.D. and Barton G.J.
- the present invention also encompasses conservative or homologous substitutions or mutations (substitution and replacement are both used herein to mean the interchange of an existing amino acid residue, with an alternative residue) that may occur, i.e. like-for-like substitution.
- conservative mutation refers to an amino acid mutation that a person skilled in the art would consider conservative to a first mutation. "Conservative” in this context means conserving or invariable in terms of the amino acid characteristics. If, for example, a mutation leads at a specific position to a substitution of an aromatic amino acid residue (e.g. Tyr) with an aliphatic amino acid residue (e.g. Leu) then a substitution at the same position with a different aliphatic amino acid (e.g.
- a conservative mutation is referred to as a conservative mutation.
- Further amino acid characteristics include size of the residue, hydrophobicity, polarity, charge, pK-value, and other amino acid characteristics known in the art. Accordingly, a conservative mutation may include substitution such as basic for basic, acidic for acidic, polar for polar etc.
- Non-conservative substitution may also occur i.e. from one class of residue to another or alternatively involving the inclusion of unnatural amino acids such as ornithine (hereinafter referred to as Z), diaminobutyric acid ornithine (hereinafter referred to as B), norleucine ornithine (hereinafter referred to as O), pyriylalanine, thienylalanine, naphthylalanine and phenylglycine.
- Z ornithine
- B diaminobutyric acid ornithine
- O norleucine ornithine
- pyriylalanine pyriylalanine
- thienylalanine thienylalanine
- naphthylalanine phenylglycine
- Replacements may also be made by unnatural amino acids.
- Variant amino acid sequences may include suitable spacer groups that may be inserted between any two amino acid residues of the sequence including alkyl groups such as methyl, ethyl or propyl groups in addition to amino acid spacers such as glycine or ⁇ -alanine residues.
- alkyl groups such as methyl, ethyl or propyl groups
- amino acid spacers such as glycine or ⁇ -alanine residues.
- a further form of variation involves the presence of one or more amino acid residues in peptoid form, will be well understood by those skilled in the art.
- the peptoid form is used to refer to variant amino acid residues wherein the ⁇ -carbon substituent group is on the residue's nitrogen atom rather than the ⁇ -carbon.
- amino acid residue in the parent enzyme position; substituted amino acid residue(s).
- substitution of, for instance, an alanine residue for a glycine residue at position 20 is indicated as Ala20Gly or A20G.
- the deletion of alanine in the same position is shown as Ala20* or A20*.
- the insertion of an additional amino acid residue is indicated as Ala20AlaGly or A20AG.
- the deletion of a consecutive stretch of amino acid residues e.g.
- a parent enzyme sequence contains a deletion in comparison to the enzyme sequence used for numbering an insertion in such a position (e.g. an alanine in the deleted position 20) is indicated as *20Ala or *20A.
- Multiple mutations are separated by a plus sign or a slash. For example, two mutations in positions 20 and 21 substituting alanine and glutamic acid for glycine and serine, respectively, are indicated as A20G+E21S or A20G/B21S.
- substitution of alanine at position 30 with either glycine or glutamic acid is indicated as A20G,E or A20G/E, or A20G, A20E.
- a position suitable for modification is identified herein without any specific modification being suggested, it is to be understood that any amino acid residue may be substituted for the amino acid residue present in the position.
- the alanine may be deleted or substituted for any other amino acid residue (i.e. any one of R,N,D,C,Q,E,G,H,I,L,K,M,F,P,S,T,W,Y,V).
- the nucleotide sequences for use in the present invention may include within them synthetic or modified nucleotides.
- a number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones and/or the addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule.
- the nucleotide sequences described herein may be modified by any method available in the art. Such modifications may be carried out in order to enhance the in vivo activity or life span of nucleotide sequences of the present invention.
- nucleotide sequences that are complementary to the sequences presented herein, or any derivative, fragment or derivative thereof. If the sequence is complementary to a fragment thereof then that sequence can be used as a probe to identify similar coding sequences in other organisms etc.
- Polynucleotides which are not 100% homologous to the sequences of the present invention but fall within the scope of the invention can be obtained in a number of ways.
- Other variants of the sequences described herein may be obtained for example by probing DNA libraries made from a range of individuals, for example individuals from different populations.
- other homologues may be obtained and such homologues and fragments thereof in general will be capable of selectively hybridising to the sequences shown in the sequence listing herein.
- Such sequences may be obtained by probing cDNA libraries made from or genomic DNA libraries from other species, and probing such libraries with probes comprising all or part of any one of the sequences in the attached sequence listings under conditions of medium to high stringency. Similar considerations apply to obtaining species homologues and allelic variants of the polypeptide or nucleotide sequences of the invention.
- Variants and strain/species homologues may also be obtained using degenerate PCR which will use primers designed to target sequences within the variants and homologues encoding conserved amino acid sequences within the sequences of the present invention.
- conserved sequences can be predicted, for example, by aligning the amino acid sequences from several variants/homologues. Sequence alignments can be performed using computer software known in the art. For example the GCG Wisconsin PileUp program is widely used.
- the primers used in degenerate PCR will contain one or more degenerate positions and will be used at stringency conditions lower than those used for cloning sequences with single sequence primers against known sequences.
- polynucleotides may be obtained by site directed mutagenesis of characterised sequences. This may be useful where for example silent codon sequence changes are required to optimise codon preferences for a particular host cell in which the polynucleotide sequences are being expressed. Other sequence changes may be desired in order to introduce restriction enzyme recognition sites, or to alter the property or function of the polypeptides encoded by the polynucleotides.
- Polynucleotides (nucleotide sequences) of the invention may be used to produce a primer, e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. labelled with a revealing label by conventional means using radioactive or nonradioactive labels, or the polynucleotides may be cloned into vectors.
- a primer e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. labelled with a revealing label by conventional means using radioactive or nonradioactive labels, or the polynucleotides may be cloned into vectors.
- primers, probes and other fragments will be at least 15, preferably at least 20, for example at least 25, 3 0 or 40 nucleotides in length, and are also encompassed by the term polynucleotides of the invention as used herein.
- Polynucleotides such as DNA polynucleotides and probes according to the invention may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques.
- primers will be produced by synthetic means, involving a stepwise manufacture of the desired nucleic acid sequence one nucleotide at a time. Techniques for accomplishing this using automated techniques are readily available in the art.
- Longer polynucleotides will generally be produced using recombinant means, for example using a PCR (polymerase chain reaction) cloning techniques.
- the primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector.
- the variant sequences etc. are at least as biologically active as the sequences presented herein.
- biologically active refers to a sequence having a similar structural function (but not necessarily to the same degree), and/or similar regulatory function (but not necessarily to the same degree), and/or similar biochemical function (but not necessarily to the same degree) of the naturally occurring sequence.
- variant sequences or modified forms thereof have a similar enzymatic profile to the profile of the phytase identified herein.
- This profile includes characteristics such as being a secreted protein, having a pH optimum in the range of pH 2 to 5.5, preferably 3.0 to 3.5, retaining at least 50% of the maximum activity over the pH range 2.0-5.5 and/or having a specific activity over 1000 U/mg.
- sequences that are complementary to the nucleic acid sequences of the present invention are described sequences that are complementary to the nucleic acid sequences of the present invention and sequences that are capable of hybridising either to the sequences of the present invention or to sequences that are complementary thereto.
- hybridisation shall include “the process by which a strand of nucleic acid joins with a complementary strand through base pairing” as well as the process of amplification as carried out in polymerase chain reaction (PCR) technologies.
- the present description also discloses the use of nucleotide sequences that are capable of hybridising to the sequences that are complementary to the sequences presented herein, or any derivative, fragment or derivative thereof.
- variant also encompasses sequences that are complementary to sequences that are capable of hybridising to the nucleotide sequences presented herein.
- nucleotide sequences that can hybridise to the nucleotide sequences of the present invention (including complementary sequences of those presented herein).
- nucleotide sequences that are complementary to sequences that can hybridise to the nucleotide sequences of the present invention (including complementary sequences of those presented herein).
- polynucleotide sequences that are capable of hybridising to the nucleotide sequences presented herein under conditions of intermediate to maximal stringency.
- nucleotide sequences that can hybridise to the nucleotide sequence of the present invention, or the complement thereof, under stringent conditions (e.g. 50°C and 0.2xSSC).
- nucleotide sequences that can hybridise to the nucleotide sequence of the present invention, or the complement thereof, under high stringent conditions (e.g. 65°C and 0.1xSSC).
- an enzyme-encoding nucleotide sequence has been isolated and/or purified, or a putative enzyme-encoding nucleotide sequence has been identified, it may be desirable to mutate the sequence in order to prepare an enzyme of the present invention.
- Mutations may be introduced using synthetic oligonucleotides. These oligonucleotides contain nucleotide sequences flanking the desired mutation sites.
- sequence for use in the present invention is a recombinant sequence - i.e. a sequence that has been prepared using recombinant DNA techniques.
- sequence for use in the present invention is a synthetic sequence - i.e. a sequence that has been prepared by in vitro chemical or enzymatic synthesis. It includes, but is not limited to, sequences made with optimal codon usage for host organisms - such as the methylotrophic yeasts Pichia and Hansenula.
- the nucleotide sequence for use in the present invention may be incorporated into a recombinant replicable vector.
- the vector may be used to replicate and express the nucleotide sequence, in enzyme form, in and/or from a compatible host cell.
- Expression may be controlled using control sequences eg. regulatory sequences.
- the enzyme produced by a host recombinant cell by expression of the nucleotide sequence may be secreted or may be contained intracellularly depending on the sequence and/or the vector used.
- the coding sequences may be designed with signal sequences which enhance direct secretion of the substance coding sequences through a particular prokaryotic or eukaryotic cell membrane.
- the enzymes of the present invention are secreted.
- Plasmid means a construct capable of in vivo or in vitro expression.
- these constructs may be used to introduce genes encoding enzymes into host cells.
- the genes whose expression is introduced may be referred to as "expressible transgenes”.
- the expression vector is incorporated into the genome of a suitable host organism.
- the term "incorporated” preferably covers stable incorporation into the genome.
- nucleotide sequences described herein including the nucleotide sequence of the present invention may be present in a vector in which the nucleotide sequence is operably linked to regulatory sequences capable of providing for the expression of the nucleotide sequence by a suitable host organism.
- the vectors for use in the present invention may be transformed into a suitable host cell as described below to provide for expression of a polypeptide of the present invention.
- vector eg. a plasmid, cosmid, or phage vector will often depend on the host cell into which it is to be introduced.
- the vectors for use in the present invention may contain one or more selectable marker genes- such as a gene, which confers antibiotic resistance eg. ampicillin, kanamycin, chloramphenicol or tetracyclin resistance.
- selectable marker genes such as a gene, which confers antibiotic resistance eg. ampicillin, kanamycin, chloramphenicol or tetracyclin resistance.
- the selection may be accomplished by co-transformation (as described in WO91/17243 ).
- Vectors may be used in vitro , for example for the production of RNA or used to transfect, transform, transduce or infect a host cell.
- nucleotide sequences of the present invention by introducing a nucleotide sequence of the present invention into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector.
- the vector may further comprise a nucleotide sequence enabling the vector to replicate in the host cell in question.
- sequences are the origins of replication of plasmids pUC19, pACYC177, pUB110, pE194, pAMB1, pU702 and pET11.
- the nucleotide sequence for use in the present invention is operably linked to a regulatory sequence which is capable of providing for the expression of the nucleotide sequence, such as by the chosen host cell.
- the present invention covers a vector comprising the nucleotide sequence of the present invention operably linked to such a regulatory sequence, i.e. the vector is an expression vector.
- operably linked refers to a juxtaposition wherein the components described are in a relationship permitting them to function in their intended manner.
- a regulatory sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under condition compatible with the control sequences.
- regulatory sequences includes promoters and enhancers and other expression regulation signals.
- promoter is used in the normal sense of the art, e.g. an RNA polymerase binding site.
- Enhanced expression of the nucleotide sequence encoding the enzyme of the present invention may also be achieved by the selection of heterologous regulatory regions, e.g. promoter, secretion leader and terminator regions.
- heterologous regulatory regions e.g. promoter, secretion leader and terminator regions.
- the nucleotide sequence according to the present invention is operably linked to at least a promoter.
- Suitable promoters for directing the transcription of the nucleotide sequence in a bacterial, fungal or yeast host are well known in the art.
- construct which is synonymous with terms such as “conjugate”, “cassette” and “hybrid” - includes a nucleotide sequence for use according to the present invention directly or indirectly attached to a promoter.
- an indirect attachment is the provision of a suitable spacer group such as an intron sequence, such as the Sh1-intron or the ADH intron, intermediate the promoter and the nucleotide sequence of the present invention.
- a suitable spacer group such as an intron sequence, such as the Sh1-intron or the ADH intron, intermediate the promoter and the nucleotide sequence of the present invention.
- the term "fused" in relation to the present invention which includes direct or indirect attachment.
- the terms do not cover the natural combination of the nucleotide sequence coding for the protein ordinarily associated with the wild type gene promoter and when they are both in their natural environment.
- the construct may even contain or express a marker, which allows for the selection of the genetic construct.
- the construct of the present invention comprises at least the nucleotide sequence of the present invention operably linked to a promoter.
- host cell in relation to the present invention includes any cell that comprises either the nucleotide sequence or an expression vector as described above and which is used in the recombinant production of an enzyme having the specific properties as defined herein or in the methods of the present invention.
- a further embodiment of the present invention provides host cells transformed or transfected with a nucleotide sequence that expresses the enzymes described in the present invention.
- the cells will be chosen to be compatible with the said vector and may for example be prokaryotic (for example bacterial), fungal, yeast or plant cells.
- the host cells are not human cells.
- Suitable bacterial host organisms are gram positive or gram negative bacterial species.
- eukaryotic hosts such as yeasts or other fungi may be preferred.
- yeast cells are preferred over fungal cells because they are easier to manipulate.
- some proteins are either poorly secreted from the yeast cell, or in some cases are not processed properly (e.g. hyperglycosylation in yeast). In these instances, a different fungal host organism should be selected.
- suitable host cells - such as yeast, fungal and plant host cells - may provide for post-translational modifications (e.g. myristoylation, glycosylation, truncation, lapidation and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products of the present invention.
- post-translational modifications e.g. myristoylation, glycosylation, truncation, lapidation and tyrosine, serine or threonine phosphorylation
- the host cell may be a protease deficient or protease minus strain.
- the genotype of the host cell may be modified to improve expression.
- host cell modifications include protease deficiency, supplementation of rare tRNA's, and modification of the reductive potential in the cytoplasm to enhance disulphide bond formation.
- the host cell E. coli may overexpress rare tRNA's to improve expression of heterologous proteins as exemplified/described in Kane (Curr Opin Biotechnol (1995), 6, 494-500 "Effects of rare codon clusters on high-level expression of heterologous proteins in E.coli ").
- the host cell may be deficient in a number of reducing enzymes thus favouring formation of stable disulphide bonds as exemplified/described in Bessette (Proc Natl Acad Sci USA (1999), 96, 13703-13708 " Efficient folding of proteins with multiple disulphide bonds in the Escherichia coli cytoplasm ").
- host cells in the context of the present invention include those cells that can be added directly into animal feed.
- organism in relation to the present description includes any organism that could comprise the nucleotide sequence coding for the enzymes as described in the present invention and/or products obtained therefrom, and/or wherein a promoter can allow expression of the nucleotide sequence according to the present invention when present in the organism.
- Suitable organisms may include a prokaryote, fungus, yeast or a plant.
- transgenic organism in relation to the present description includes any organism that comprises the nucleotide sequence coding for the enzymes as described in the present invention and/or the products obtained therefrom, and/or wherein a promoter can allow expression of the nucleotide sequence according to the present invention within the organism.
- a promoter can allow expression of the nucleotide sequence according to the present invention within the organism.
- the nucleotide sequence is incorporated in the genome of the organism.
- transgenic organism does not cover native nucleotide coding sequences in their natural environment when they are under the control of their native promoter which is also in its natural environment.
- the transgenic organism of the present description includes an organism comprising any one of, or combinations of, the nucleotide sequence coding for the enzymes as described in the present invention, constructs according to the present invention, vectors according to the present invention, plasmids according to the present invention, cells according to the present invention, tissues according to the present invention, or the products thereof.
- transgenic organism may also comprise the nucleotide sequence coding for the enzyme of the present invention under the control of a heterologous promoter.
- the host organism can be a prokaryotic or a eukaryotic organism.
- suitable prokaryotic hosts include E. coli and Bacillus subtilis.
- prokaryotic hosts are well documented in the art, for example see Sambrook et al (Molecular Cloning: A Laboratory Manual, 2nd edition, 1989, Cold Spring Harbor Laboratory Press ). Other suitable methods are set out in the Examples herein. If a prokaryotic host is used then the nucleotide sequence may need to be suitably modified before transformation - such as by removal of introns.
- Filamentous fungi cells may be transformed using various methods known in the art - such as a process involving protoplast formation and transformation of the protoplasts followed by regeneration of the cell wall in a manner known.
- Aspergillus as a host microorganism is described in EP 0 238 023 .
- Another host organism can be a plant.
- a review of the general techniques used for transforming plants may be found in articles by Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991] 42:205-225 ) and Christou (Agro-Food-Industry Hi-Tech March/April 1994 17-27 ). Further teachings on plant transformation may be found in EP-A-0449375 .
- a host organism may be a fungus - such as a filamentous fungus.
- suitable such hosts include any member belonging to the genera Thermomyces, Acremonium, Aspergillus, Penicillin, Mucor, Neurospora, Trichoderma and the like.
- the host organism can be of the genus Aspergillus, such as Aspergillus niger.
- a transgenic Aspergillus according to the present description can also be prepared by following, for example, the teachings of Turner G. 1994 (Vectors for genetic manipulation. In: Martinelli S.D., Kinghorn J.R.( Editors) Aspergillus: 50 years on. Progress in industrial microbiology vol 29. Elsevier Amsterdam 1994. pp. 641-666 ).
- the transgenic organism can be a yeast.
- yeast - such as the species Saccharomyces cerevisi or Pichia pastoris (see FEMS Microbiol Rev (2000 24(1):45-66 ), may be used as a vehicle for heterologous gene expression.
- transgenic Saccharomyces For the transformation of yeast, several transformation protocols have been developed. For example, a transgenic Saccharomyces according to the present description can be prepared by following the teachings of Hinnen et al., (1978, Proceedings of the National Academy of Sciences of the USA 75, 1929 ); Beggs, J D (1978, Nature, London, 275, 104 ); and Ito, H et al (1983, J Bacteriology 153, 163-168 ).
- the transformed yeast cells may be selected using various selective markers - such as auxotrophic markers dominant antibiotic resistance markers.
- a host organism suitable for the present invention may be a plant.
- a review of the general techniques may be found in articles by Potrykus (Annu Rev Plant Physiol Plant Mol Biol [1991] 42:205-225 ) and Christou (Agro-Food-Industry Hi-Tech March/April 199417-27 ).
- Host cells transformed with the nucleotide sequence of the present invention may be cultured under conditions conducive to the production of the encoded enzyme and which facilitate recovery of the enzyme from the cells and/or culture medium.
- the medium used to cultivate the cells may be any conventional medium suitable for growing the host cell in questions and obtaining expression of the enzyme.
- the protein produced by a recombinant cell may be displayed on the surface of the cell.
- the enzyme may be secreted from the host cells and may conveniently be recovered from the culture medium using well-known procedures.
- the enzyme may be secreted from the expression host into the culture medium from where the enzyme may be more easily recovered.
- the secretion leader sequence may be selected on the basis of the desired expression host.
- Hybrid signal sequences may also be used with the context of the present invention.
- heterologous secretion leader sequences are those originating from the fungal amyloglucosidase (AG) gene ( gla A - both 18 and 24 amino acid versions e.g. from Aspergillus ), the a-factor gene (yeasts e.g. Saccharomyces, Kluyveromyces and Hansenula ) or the ⁇ -amylase gene ( Bacillus ).
- AG fungal amyloglucosidase
- gla A both 18 and 24 amino acid versions e.g. from Aspergillus
- the a-factor gene e.g. Saccharomyces, Kluyveromyces and Hansenula
- Bacillus e.g. Saccharomyces, Kluyveromyces and Hansenula
- ELISA enzyme-linked immunosorbent assay
- RIA radioimmunoassay
- FACS fluorescent activated cell sorting
- Suitable reporter molecules or labels include those radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles and the like. Patents teaching the use of such labels include US-A-3,817,837 ; US-A-3,850,752 ; US-A-3,939,350 ; US-A-3,996,345 ; US-A-4,277,437 ; US-A-4,275,149 and US-A-4,366,241 .
- recombinant immunoglobulins may be produced as shown in US-A-4,816,567 .
- the amino acid sequence for use according to the present invention may be produced as a fusion protein, for example to aid in extraction and purification.
- fusion protein partners include glutathione-S-transferase (GST), 6xHis, GAL4 (DNA binding and/or transcriptional activation domains) and ( ⁇ -galactosidase). It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest to allow removal of fusion protein sequences.
- the fusion protein will not hinder the activity of the protein sequence.
- the amino acid sequence may be ligated to a heterologous sequence to encode a fusion protein.
- a heterologous sequence for example, for screening of peptide libraries for agents capable of affecting the substance activity, it may be useful to encode a chimeric substance expressing a heterologous epitope that is recognised by a commercially available antibody.
- sequences for use according to the present invention may also be used in conjunction with one or more additional proteins of interest (POIs) or nucleotide sequences of interest (NOIs).
- POIs proteins of interest
- NOIs nucleotide sequences of interest
- Non-limiting examples of POIs include: Xylanase, lipases, acid phosphatases and/or others. These include enzymes that, for example, modulate the viscosity of the feed.
- the NOI may even be an antisense sequence for any of those sequences.
- the POI may even be a fusion protein, for example to aid in extraction and purification or to enhance in vivo phytate metabolism.
- the POI may even be fused to a secretion sequence.
- sequences can also facilitate secretion or increase the yield of secreted POI.
- sequences could code for chaperone proteins as for example the product of Aspergillus niger cyp B gene described in UK patent application 9821198.0 .
- the NOI coding for POI may be engineered in order to alter their activity for a number of reasons, including but not limited to, alterations, which modify the processing and/or expression of the expression product thereof.
- the NOI may also be modified to optimise expression in a particular host cell.
- Other sequence changes may be desired in order to introduce restriction enzyme recognition sites.
- the NOI coding for the POI may include within it synthetic or modified nucleotides-such as methylphosphonate and phosphorothioate backbones.
- the NOI coding for the POI may be modified to increase intracellular stability and half-life. Possible modifications include, but are not limited to, the addition of flanking sequences of the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the backbone of the molecule.
- One aspect of the present description relates to amino acids that are immunologically reactive with the amino acid of SEQ ID No. 3.
- Antibodies may be produced by standard techniques, such as by immunisation with the substance of the invention or by using a phage display library.
- antibody includes but is not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, fragments produced by a Fab expression library, as well as mimetics thereof.
- fragments include fragments of whole antibodies which retain their binding activity for a target substance, Fv, F(ab') and F(ab') 2 fragments, as well as single chain antibodies (scFv), fusion proteins and other synthetic proteins which comprise the antigen-binding site of the antibody.
- the antibodies and fragments thereof may be humanised antibodies. Neutralising antibodies, i.e., those which inhibit biological activity of the substance polypeptides, are especially preferred for diagnostics and therapeutics.
- polyclonal antibodies are desired, a selected mammal (e.g., mouse, rabbit, goat, horse, etc.) is immunised with the sequence of the present invention (or a sequence comprising an immunological epitope thereof). Depending on the host species, various adjuvants may be used to increase immunological response.
- a selected mammal e.g., mouse, rabbit, goat, horse, etc.
- various adjuvants may be used to increase immunological response.
- Serum from the immunised animal is collected and treated according to known procedures. If serum containing polyclonal antibodies to the sequence of the present invention (or a sequence comprising an immunological epitope thereof) contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for producing and processing polyclonal antisera are known in the art. In order that such antibodies may be made, the description also provides polypeptides of the invention or fragments thereof haptenised to another polypeptide for use as immunogens in animals or humans.
- Monoclonal antibodies directed against the sequence of the present invention can also be readily produced by one skilled in the art and include, but are not limited to, the hybridoma technique Koehler and Milstein (1975 Nature 256:495-497 ), the human B-cell hybridoma technique ( Kosbor et al., (1983) Immunol Today 4:72 ; Cote et al., (1983) Proc Natl Acad Sci 80:2026-2030 ) and the EBV-hybridoma technique ( Cole et al., (1985) Monoclonal Antibodies and Cancer Therapy, Alan Rickman Liss Inc, pp 77-96 ).
- Antibody fragments which contain specific binding sites for the substance may also be generated.
- fragments include, but are not limited to, the F(ab') 2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab') 2 fragments.
- Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity ( Huse WD et al., (1989) Science 256:1275-128 1 ).
- the amino acid sequence encoding a C. freundii-derived phytase or the methods of the present invention are used for large scale applications.
- the methods of the present invention may be used for the large scale production of phytases for industrial use as additives/supplements to food or feed compositions.
- amino acid sequence is produced in a quantity of from 5 g per litre to about 10 g per litre of the total cell culture volume after cultivation of the host organism.
- amino acid sequence is produced in a quantity of from 100mg per litre to about 900mg per litre of the total cell culture volume after cultivation of the host organism.
- amino acid sequence is produced in a quantity of from 250mg per litre to about 500mg per litre of the total cell culture volume after cultivation of the host organism.
- the present invention also relates to the production of phytases as described herein.
- the present description also relates to the use of the amino acid sequences as disclosed herein in the production of organic and inorganic phosphate compounds.
- the present invention further relates to the use of the nucleotide sequences encoding phytases in generating expression vectors or systems for the expression of the phytases.
- the present invention relates to the use of such expression vectors or systems in the generation of host cells which express phytases.
- the description further relates to the use of modified host cells in the generation of precursors of organic and inorganic phosphate compounds or in the generation of specific organic phosphate compounds.
- Suitable organic and inorganic phosphate compounds include myo-inositol pentakis-, tetrakis-, tris-, bis- and monophosphates.
- an organic phosphate compound comprising treating a phytate with a phytase derived from Citrobacter freundii .
- the method is characterised in that the enzyme comprises the amino acid sequences shown as SEQ ID NOs: 3 or a sequence having at least 75% identity (homology) thereto or an effective fragment, or modified form thereof.
- the organic phosphate is phytate or all possible stereoisomers of myo-inositol di-, tri-, tetra, and pentaphosphates.
- Other suitable organic phosphates include inositol-tetraphosphates and inositol-oligophosphates.
- the method is an in vivo biotechnological process.
- Such methods for producing an organic phosphate compound may suitably comprise the steps of:
- the compounds can be used for a number of applications including in assays for the characterisation of phytases.
- Some inositol phosphates are involved as signal molecules in intracellular regulation and can be used research chemicals.
- Animal feed is typically produced in feed mills in which raw materials are first ground to a suitable particle size and then mixed with appropriate additives.
- the feed may then be produced as a mash or pellets; the later typically involves a method by which the temperature is raised to a target level and then the feed is passed through a die to produce pellets of a particular size.
- liquid additives such as fat and enzyme may be added.
- the pellets are allowed to cool prior to transportation.
- Production of animal feed may also involve an additional step that includes extrusion or expansion prior to pelleting.
- the invention further provides the use of an amino acid sequence encoding a phytase or a host cell expressing a phytase to produce a phytase for use in the manufacture of a food or feed product.
- an amino acid sequence as described herein in the manufacture of a food or feed product.
- a host cell in accordance with the invention in the manufacture of a food or feed product.
- an expression vector or system in accordance with the invention in the manufacture of a food or feed product.
- the present invention also covers using the enzymes as a component of feed combinations with other components to deliver to animals.
- the enzymes of the present invention may be used in combination with other components or carriers.
- Suitable carriers for feed enzymes include wheat (coarsely ground).
- encapsulation techniques including those based on fat/wax coverage, adding plant gums etc.
- Examples of other components include one or more of: thickeners, gelling agents, emulsifiers, binders, crystal modifiers, sweetners (including artificial sweeteners), rheology modifiers, stabilisers, anti-oxidants, dyes, enzymes, carriers, vehicles, excipients, diluents, lubricating agents, flavouring agents, colouring matter, suspending agents, disintegrants, granulation binders etc.
- These other components may be natural.
- These other components may be prepared by use of chemical and/or enzymatic techniques.
- thickener or gelling agent refers to a product that prevents separation by slowing or preventing the movement of particles, either droplets of immiscible liquids, air or insoluble solids.
- stabiliser as used here is defined as an ingredient or combination of ingredients that keeps a product (e.g. a food product) from changing over time.
- emulsifier refers to an ingredient (e.g. a food product ingredient) that prevents the separation of emulsions.
- binder refers to an ingredient (e.g. a food ingredient) that binds the product together through a physical or chemical reaction.
- crystal modifier refers to an ingredient (e.g. a food ingredient) that affects the crystallisation of either fat or water.
- Carriers or “vehicles” mean materials suitable for compound administration and include any such material known in the art such as, for example, any liquid, gel, solvent, liquid diluent, solubiliser, or the like, which is non-toxic and which does not interact with any components of the composition in a deleterious manner.
- nutritionally acceptable carriers include, for example, grain, water, salt solutions, alcohol, silicone, waxes, petroleum jelly, vegetable oils, and the like.
- excipients include one or more of: microcrystalline cellulose and other celluloses, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate, glycine, starch, milk sugar and high molecular weight polyethylene glycols.
- disintegrants include one or more of: starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates.
- granulation binders include one or more of: polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, maltose, gelatin and acacia.
- lubricating agents include one or more of: magnesium stearate, stearic acid, glyceryl behenate and talc.
- diluents include one or more of: water, ethanol, propylene glycol and glycerin, and combinations thereof.
- the other components may be used simultaneously (e.g when they are in admixture together or even when they are delivered by different routes) or sequentially (e.g they may be delivered by different routes).
- component suitable for animal or human consumption means a compound which is or can be added to the composition of the present invention as a supplement which may be of nutritional benefit, a fibre substitute or have a generally beneficial effect to the consumer.
- the components may be prebiotics such as alginate, xanthan, pectin, locust bean gum (LBG), inulin, guar gum, galacto-oligosaccharide (GOS), fructo-oligosaccharide (FOS), lactosucrose, soybean oligosaccharides, palatinose, isomalto-oligosaccharides, gluco-oligosaccharides and xylo-oligosaccharides.
- prebiotics such as alginate, xanthan, pectin, locust bean gum (LBG), inulin, guar gum, galacto-oligosaccharide (GOS), fructo-oligosaccharide (FOS), lactosucrose, soybean oligosaccharides, palatinose, isomalto-oligosaccharides, gluco-oligosaccharides and xylo-oligosaccharides.
- the compounds may be used as - or in the preparation of - a food or feed substance.
- the term "food” is used in a broad sense - and covers food and food products for humans as well as food for animals (i.e. a feed).
- the term "feed” is used with reference to products that are fed to animals in the rearing of livestock.
- the food or feed is for consumption by monogastric animals such as pig, poultry and fish.
- the food or feed may be in the form of a solution or as a solid - depending on the use and/or the mode of application and/or the mode of administration.
- the compounds may be used as a food or feed ingredient
- food or feed ingredient includes a formulation, which is or can be added to foods or foodstuffs and includes formulations which can be used at low levels in a wide variety of products.
- the food ingredient may be in the form of a solution or as a solid - depending on the use and/or the mode of application and/or the mode of administration.
- the compounds may be - or may be added to - food supplements.
- Feed compositions for monogastric animals typically include compositions comprising plant products which contain phytate. Such compositions include cornmeal, soybean meal, rapeseed meal, cottonseed meal, maize, wheat, barley and sorghum-based feeds.
- the phytases described herein may be - or may be added to - foods or feed compositions.
- the present invention also provides a method of preparing a food or a feed ingredient or supplement, the method comprising admixing phytases produced by the process of the present invention or the composition according to the present invention with another food ingredient.
- the method for preparing or a food ingredient is also another aspect of the present invention.
- Methods for preparing animal feed are set out above.
- the enzyme can be added also in the form of a solid formulation, or as a feed additive, such as a pre-mix. A solid form is typically added before or during the mixing step; and a liquid form is typically added after the pelleting step.
- the phytases of the present description may also be used in pharmaceutical preparations or for combination into food stuffs in order to provide some pharmaceutical effect.
- EP 1,389,915 describes the use of a phytase in a food or drink for increasing the availability of Calcium, Iron and/or Zinc of the food or drink for humans.
- EP 1,392,353 describes a medicament or nutritional supplement containing phytase, which is useful for increasing bioavailability of bioelements, e.g., calcium and iron, and for combating deficiency diseases.
- bioelements e.g., calcium and iron
- the term "pharmaceutical” is used in a broad sense - and covers pharmaceuticals and/or nutracenticals for humans as well as pharmaceuticals and/or nutraceuticals for animals (i.e. veterinary applications).
- the pharmaceutical is for human use and/or for animal husbandry.
- the pharmaceutical can be for therapeutic purposes - which may be curative or palliative or preventative in nature.
- the pharmaceutical may even be for diagnostic purposes.
- the product and/or the compounds of the present description may be used in conjunction with one or more of: a pharmaceutically acceptable carrier, a pharmaceutically acceptable diluent, a pharmaceutically acceptable excipient, a pharmaceutically acceptable adjuvant, a pharmaceutically active ingredient.
- the pharmaceutical may be in the form of a solution or as a solid - depending on the use and/or the mode of application and/or the mode of administration.
- the product and/or the compounds of the present invention may be used as pharmaceutical ingredients.
- the product and/or the composition of the present invention may be the sole active component or it may be at least one of a number (i.e. 2 or more) active components.
- the pharmaceutical ingredient may be in the form of a solution or as a solid - depending on the use and/or the mode of application and/or the mode of administration.
- the pharmaceutical ingredient may be in the form of an effervescent product to improve the dissolving properties of the pharmaceutical.
- the product and/or the compounds of the present invention may be used in any suitable form - whether when alone or when present in a composition.
- phytases produced in accordance with the present invention i.e. ingredients - such as food ingredients, functional food ingredients may be used in any suitable form.
- Suitable examples of forms include one or more of: tablets, pills, capsules, ovules, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed-, modified-, sustained-, pulsed or controlled-release applications.
- the tablets may also contain one or more of: excipients, disintegrants, granulation binders, or lubricating agents.
- nutritionally acceptable carriers for use in preparing the forms include, for example, water, salt solutions, alcohol, silicone, waxes, petroleum jelly and the like.
- Preferred excipients for the forms include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols.
- carotenoid cleavage compounds may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.
- the forms may also include gelatin capsules; fibre capsules, fibre tablets etc.
- the present invention employs, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press ; Ausubel, F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N.Y .); B. Roe, J. Crabtree, and A.
- Example 1 Phytase activity assay.
- Phytase assays were carried out in microtitre plates.
- the reaction mixture (100 ⁇ l) contained: 2 mM phytate and 0.8 mM CaCl 2 in 200 mM sodium acetate buffer, pH 3.5.
- the reaction was allowed to proceed for 1 h at 37°C after which time the released phosphate was measured by a modification of a known procedure ( Heinonen J.K., Lahti RJ. Anal Biochem. 113 (2), 313-317 (1981 )).
- Bacterial strain P3-42 was originally isolated from a mass of decaying birch leaves collected in a wet forest in southern Finland.
- the strain can be aerobically cultivated at 30°C on many simple culture media e.g. LB (1% peptome, 0.5% yeast extract, 1% NaCl, pH 7.4) or low phosphate medium PP1 (1% peptone, 1%, beef extract, 0.5%, yeast extract, CaCl 2 - 0.2M.
- the medium is adjusted to pH 11 with NaOH and boiled for 10 min.
- the precipitate is removed by filtration, pH re-adjusted to 5.5 and the medium sterilised by autoclaving for 15 min at 121°C).
- Example 3 Isolation of chromosomal DNA from the strain P3-42.
- Chromosomal DNA was prepared essentially by the standard procedure ( Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1996 ).
- a 250 ml culture grown overnight at 30 °C in LB medium was centrifuged at 10,000 rpm for 30 min, washed in 20 ml of 50 mM tris-HCl, 5 mM EDTA pH 8 and re-suspended in 10 ml of cold TES (50 mM tris-HCl, 5 mM EDTA, 15 % glucose pH 8).
- Lysozyme was added to 10 mg/ml, and the cell suspension was incubated at 37 °C for 30 - 60 min until lysis occurred, ascertained for by dilution of 100 ⁇ l of the reaction mixture into 1 ml of 1 % SDS and checking for a "slimy" consistency. At this time, SDS and Proteinase K (Sigma) were added to a final concentration of 1% and 0.5 mg/ml respectively. The reaction mixture was incubated for 30 min at 56 °C followed by addition of 2 ml of 5 M NaCl and 1.4 ml 10% cetyltrimethylammonium bromide (Sigma). The incubation was continued for 15 min 65 °C.
- the solution was extracted once with chloroform/isoamyl alcohol (24:1) and once with phenol/chloroform. After the extractions, the water phase was mixed with 0.6 vol of isopropanol, the DNA precipitate collected by centrifugation (10,000 rpm, 15 min), washed with 70 % ethanol, vacuum dried and re-suspended in 2 ml of 10 mM tris-HCl, 1 mM EDTA pH 8, 5 ⁇ g/ml. RNAse.
- Example 4 Taxonomic identification of the bacterial strain P3-42.
- a fragment of the 16S rRNA gene of the strain P3-42 was amplified by the polymerase chain reaction (PCR) with Taq DNA polymerase (Roche) using the primers; 536f (CAGCMGCCGCGGTAATWC) and 1392r (ACGGGCGGTGTGTRC), ( Lane, D. J. In Nucleic acid techniques in bacterial systematics, Stackbrandt, E. and Goodfellow, M. eds, John Wiley & Sons, New York: pp 115-117 (1991 )).
- the following program was used: 1) initial DNA denaturation step of 5 min at 95 °C; 2) 30 cycles of 1 min at 94°C, 1 min at 55°C, 1 min at 72°C; 3) a final extension step of 70 °C for 10 min.
- the PCR products approximately 900 base pairs in size, were purified by electrophoresis in a 0.8 % agarose gel and extracted from the gel using a PCR Purification Kit (Qiagen) according to the manufacturer's instructions.
- the purified PCR products were sequenced by Medprobe (Norway) as a commercial service. The sequenced area is listed as SEQ ID No 1.
- Chromosomal DNA from the Citrobacter freundii strain P3-42 was partially digested with restriction endonuclease Sau3A and the digest fractionated on 1% agarose gel.
- the DNA fragments of 3 to 5 kb were isolated from the gel using a gel purification kit (Qiagen) and ligated with Bam HI digested dephosphorylated ⁇ -ZAP arms (Stratagene).
- Subsequent steps for library construction followed the instructions of Stratagene's ZAP Express Predigested Vector/Gigapack Cloning Kit.
- the phage form of the library was converted into a plasmid form by the "mass excision" procedure as described by the manufacturer (Stratagene).
- Plasmid DNA was isolated this clone, named pBK(P3-42) and characterised by partial DNA sequencing of the insert DNA (sequencing service was obtained from Medprobe (Norway). This sequence comprising the phytase gene is listed as SEQ ID No: 2. The deduced amino acid sequence of the C. freundii phytase is listed as SEQ ID No: 3.
- Example 6 Amplification and expression of phytase gene from C . freundii P3-42.
- Phytase gene was amplified by PCR. Chromosomal DNA of the strain C. freundii P3-42 was used as template and oligonucleotides o42-5 (GGAATTCATATGAGTACATTCATCATTCG) and o42-3 (GGAATT-CGGATCCCTTATTCCGTAACTGCACAC) as primers. The amplification was carried out using the Expand High Fidelity PCR System kit (Roche).
- the following program was used: 1) initial DNA denaturation for 3 min at 94 °C; 2) 35 cycles of 45 sec at 94 °C, 45 sec at 55 °C, 1 min at 68 °C, 1 min at 72 °C, 1 min at 74 °C; 3) a final extension step of 10 min at 72°C.
- the resulting PCR product was purified by electrophoresis in a 0.8 % agarose gel followed by DNA extraction from the gel using a Gel Purification Kit (Qiagen).
- the purified PCR product was digested with the restriction enzymes Nde I and Bam HI and isolated from the reaction mixture by the PCR Purification Kit (Qiagen).
- the vector plasmid pET11a (Novagen) was digested with the restriction endonucleases Nde I and Bam HI, de-phosphorylated using shrimp alkaline phosphatase (Roche) and purified by electrophoresis in a 0.8 % agarose gel.
- the linearised plasmid DNA band was excised from the gel and purified using a Gel Purification Kit (Qiagen).
- the two purified DNA fragment were ligated using T4 DNA ligase (Roche).
- the ligation reaction was precipitated with 70% ethanol, washed with ethanol and re-suspended directly into 50 ⁇ l of electrocompetent E. coli XL1-Blue MRF' cells.
- the suspension was transferred to a 0.1 cm electroporation cuvette (BioRad) and electroporated using a Gene Pulser Xcell (BioRad) set at 1800 V, 25 ⁇ F and 200 ⁇ .
- a Gene Pulser Xcell BioRad
- the cell suspension was transferred to a 15 ml plastic tube (Falcon) and incubated at 37 °C with shaking (200 rpm) for 1 hr.
- the transformed cells were plated onto LB plates containing100 ⁇ g/ml ampicillin and incubated overnight at 37 °C. 24 transformants were grown in liquid culture and the cultures used for assaying phytase activity and isolation of plasmid DNA.
- the plasmid contained by this clone named pET11(P3-42) was used to transform the expression host strain BL21 (DE3)pLysS (Novagen).
- the transformed cell suspension was shaken for 1 h at 37°C in LB containing 2 % glucose and inoculated into 50 ml of LB containing ampicillin (100 ⁇ g/ml) and glucose (2%) and grown overnight at 30 °C with shaking (200 rpm).
- the OD of the resulting culture was measured at 600 nm and the culture was used to inoculate 1 1 of LB + ampicillin (100 ⁇ g/ml) to an OD 600 of 0.04. Growth was continued overnight at 30 °C.
- the phytase activity in such cultures was typically 50-60 U/ml (measured at pH 3.5). Almost all of the phytase was secreted into the culture medium.
- C. freundii phytase is an efficiently secreted enzyme both in its native host and in during heterologous expression in E . coli is in contrast to the intracellular nature of a phytase from C. brakii ( Kim H.W. et al. Biotechnol. Lett. 25, 1231-1234 (2003 )).
- the activity in the culture of a control strain BL21(DE3)pLysS transformed with pET11 grown under the same conditions was below 0.05 U/ml.
- Example 7 Purification of the recombinant phytase from C. freundii P3-42.
- the culture of BL21(DE3)pLysS transformed with pET11(P3-42) was centrifuged to remove the bacterial cells, concentrated using a rotary evaporator to about 1/10 of the original volume and dialysed against water until the conductivity of the solution decreased below 250 ⁇ S/cm.
- the pH of the solution was adjusted to 8.0 with tris base and it was applied to a column (3x20 cm) of DEAE Sepharose Fast Flow (Amersham Biosciences) equilibrated with 25 mM tris-HCl, pH 8.0.
- the column was washed with the equilibration buffer at a flow rate of 3 ml/min for 30 min followed by elution with three successive gradients of NaCl in 25 mM tris-HCl, pH 8.0: 0-50 mM, 50-150 mM and 150-500 mM. Each of the three gradients was programmed for 1h with a constant flow rate of 3 ml/min. 9 ml fractions were collected and assayed for phytase activity. One strong peak of activity was detected. The protein in the peak fraction was concentrated using Centriplus concentrators (Amicon) and analysed SDS PAGE using a 12% gel and the standard Laemmli buffer system.
- Example 8 pH profile of the recombinant phytase from C . freundii P3-42.
- Example 9 Substrate specificity of the recombinant phytase from C freundii P3-42.
- fractions of inositol phosphates containing three, four or five phosphates per inositol residue were isolated by ion-exchange chromatography from a partial hydrolysate of phytic acid treated with fungal phytase (Natuphos). Production and purification of these preparations was a commercial service of BioChemis Ltd (St.Petersburg, Russia). Contamination of each fraction with inositol-phosphates having a different degree of phosphorylation was less that 5% as judged by HPLC ( Sandberg A.S., Ahderinne R. J. Food Sci. 51 (3), 547-550 ).
- fructose 1,6-diphosphate and fructose 6-phosphate were used as model substrates used to estimate the specificity of the C . freundii P3-42 phytase towards di- and monophosphate substrates.
- the activity of the C. freundii phytase purified according to the Example 7 with different substrates was measured by the standard assay (Example 1) at pH 3.5 using 2 mM concentrations of substrates in the final reaction mixture.
- the results ( Fig 3 ) indicate that that the enzyme has maximum activity with inositol pentaphosphate. Activities with inositol tri- and tetraphosphates as well as phytic acid were rather similar while fructose 1,6-diphosphate was a rather poor substrate. Hydrolysis of fructose 6-phosphate was below reliable detection limit.
- Example 10 Specific activity of the recombinant phytase from C. freundii P3-42.
- Specific activity of the C. freundii phytase was estimated using the purified preparation according to the Example 7. The phytase activity was measured at pH 3.5 according to the Example 1. Phytase concentration was calculated by measuring total protein concentration with BCA Protein Assay Kit (Pierce) and correcting it by phytase content estimated by SDS PAGE (Example 7). According to these measurements, the specific activity of the recombinant phytase from C . freundii P3-42 is about 1100 U/mg.
- Example 11 Comparison of C. freundii P3-42 phytase with the phytase from C. brakii YH-15.
- the only phytase from a bacterium belonging to the Citrobacter family described earlier is the intracellular phytase from C. brakii YH-15 ( Kim H.W. et al. Biotechnol. Lett. 25, 1231-1234 (2003 )).
- This enzyme shares some properties with the secreted phytase of C . freundii of the present invention both enzymes are acid phytases of high specific activity. Direct comparison of the amino acid sequences of the two enzymes is impossible because the sequence information regarding the C. brakii enzyme is limited to a stretch of 10 amino acid residues. The deduced amino acid sequence of C.
- freundii phytase contains a fragment sharing 9 out of 10 residues with the sequence from C . brakii enzymes. However, comparison of such short fragments of sequence does not allow any conclusions about the overall homology of the two enzymes to be made.
- the most striking difference between the two enzymes is in cellular location: while the enzyme from C. brakii is intracellular, the C . freundii phytase is clearly a secreted enzyme.
- the enzyme is secreted in its native host, its deduced amino acid sequence does contain a signal peptide (as predicted by the Signal P algorithm: http:/www.cbs.dtu.dk/services/SignalP/) , the enzyme is also very efficiently secreted from E. coli under its native signal peptide. In addition to that, there are a number of significant differences in biochemical properties of the two enzymes (Table 1).Table 1
- Phytase variants were constructed by mutagenesis of the sequence SEQ ID No. 2 using mutagenesis methods as listed above such as the methods disclosed in Morinaga et al (Biotechnology (1984) 2, p 646-649 ), or in Nelson and Long (Analytical Biochemistry (1989), 180, p 147-151 ), or the Error Threshold Mutagenesis protocol described in WO 92/18645 .
- Phytase enzyme variants were characterized after heterologous expression in one or more of the following expression hosts: Escherichia coli K12; Bacillus subtilis; Saccharomyces cerevisiae.
- the thermostability of the variants was characterized by the inactivation temperature of the enzyme.
- the inactivation temperature was determined by measuring the residual activity of the enzyme in an enzyme assay as described in Example 1 after incubation for 10 min at different temperatures and subsequent cooling to room temperature.
- the inactivation temperature is the temperature at which the residual activity is 50% compared to the residual activity after incubation for the same duration under the same conditions at room temperature. Where appropriate interpolations and extrapolations from the measured activity data are done in order to determine the temperature corresponding to 50% residual activity.
- Thermostability differences in °C were calculated by subtracting the inactivation temperatures of two enzymes from each other. (i.e.
- Table 2 lists the thermostability differences for different variants: TABLE 2: Thermostability differences for variants derived from the parent phytase P3-42 having the sequence shown in Seq ID No 3. Variant T.D.
- Thermostability, specific activity, and pepsin stability of selected variants were compared using assays as described above.
- the pepsin incubation was performed for 2 hours at pH 2.0, 0.25 mg/ml pepsin, 1 mM CaCl2 and 5 mg/ml BSA at 37°C.
- Control conditions were 2 hours at pH 5.0, 1 mM CaCl2 and 5 mg/ml BSA at 37°C.
- Table 3 shows properties of selected variants (derived from and compared to wt phytase according to Seq ID No. 3).
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Polymers & Plastics (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Birds (AREA)
- Animal Husbandry (AREA)
- Food Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Marine Sciences & Fisheries (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Insects & Arthropods (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Fodder In General (AREA)
Claims (22)
- Polypeptide de phytase isolé comprenant la séquence d'acides aminés telle que présentée dans la SEQ ID n° : 3, correspondant à une phytase de Citrobacter freundii, ou une séquence ayant au moins 90% d'identité (homologie) avec celle-ci ; ledit polypeptide comprenant une combinaison de mutations choisie dans le groupe constitué par les : R288M ; K46E/Q82H/E168D/Q274L; Q82K/T154I/Q279E/N308T; Q82R/D112V/Q274H/T362A ; D53N/D57Y/T199I/P229S/R288M; K46E/Q82H/N148D/T154I/T362I; D53N/D57Y/P229S/R288M/K358R; D53N/D57Y/T154I/P229S/R288M; K46E/Q82H/N95D/D112V/K142R/D383V, D53N/D57Y/M152V/P229S/R288M/A393P; D53K/D57Y/M152V/P229S/R288M/A393P; D53N/D57Y/F88Y/M152V/P229S/Q279E/N308T; D53N/D57Y/M152V/E204V/P229S/R288M/A393P; D53N/D57Y/M152V/T154I/P229S/R288M/A393P; D53N/D57Y/Q82H/G103E/M152V/P229S/R288M/A393P; K46E/D53N/D57Y/T143I/M152V/L176V/P229S/R288M/A393P; Q82K/F88Y/N96P/Q97T/T98G/V105I/Q274H/Q279E/A393P; Q82R/F88Y/N95P/N96P/Q97T/Q279E/I384L/P3 86Q/A393P; H18Q/D53N/D57Y/E75V/M152V/A170T/P229S/R288M/Q385R/A393P; Q82K/F88Y/N96P/T98G/Y136N/M152V/Y177F/T362I/I384F/A393P/D397N; D53N/D57Y/F88Y/N95P/N96P/V105I/D112V/Y136N/N148D/N164D/Q274H/T362I /I3 84L/A393P; D53N/D57Y/Q82K/F88Y/N95P/P102L/V105I/Y136N/N148D/Y177F/Q274H/Q279E /T362I/A393P; D53N/D57Y/Q82K/F88Y/N96P/T98G/V105I/D112V/Y177F/Q274L/G343A/T362I/I 384L/A393P; E23K/K46E/Q82H; K46E/Q82H/Q385R; D53N/D57Y/E75V/M152V/A170T/P229S/R288M/Q385R/A393P ;
numérotées selon la numérotation dans la SEQ ID n° : 3 et
le polypeptide isolé présentant une thermo-stabilité accrue en comparaison avec un polypeptide ayant la séquence indiquée dans la SEQ ID n° : 3. - Molécule d'acide nucléique isolé comprenant une séquence d'acide nucléique codant pour un polypeptide selon la revendication 1.
- Molécule d'acide nucléique isolé, selon la revendication 2, codant pour le polypeptide isolé ou la phytase selon la revendication 1.
- Système de plasmide ou de vecteur comprenant une séquence d'acide nucléique codant pour un polypeptide isolé ou une phytase selon la revendication 1.
- Système de plasmide ou de vecteur, selon la revendication 4, qui comprend une séquence d'acide nucléique selon l'une quelconque des revendications 2 et 3.
- Système de plasmide ou de vecteur selon la revendication 4 ou 5, ledit système de plasmide ou de vecteur étant un vecteur d'expression destiné à l'expression du polypeptide isolé ou de l'enzyme phytase dans une cellule hôte ou un microorganisme.
- Cellule hôte transformée ou transfectée avec un système de plasmide ou de vecteur selon l'une quelconque des revendications 4 à 6.
- Cellule hôte selon la revendication 7, ladite cellule hôte étant dérivée d'un microorganisme, y compris des bactéries, telles que B. subtilis, E. coli, et des champignons, y compris une levure telle que H. polymorpha, S. pombe, S. cerevisiae.
- Cellule hôte selon la revendication 8, dans laquelle ledit microorganisme est une cellule bactérienne procaryote, de préférence, E. coli.
- Procédé de production d'une phytase comprenant l'expression d'une séquence d'acides aminés, telle qu'indiquée dans la SEQ ID. n° : 3, ou une séquence ayant une homologie d'au moins 90% avec celle-ci dans une cellule hôte, et la séparation de la phytase à partir du milieu de culture de la cellule hôte, ladite séquence d'acides aminés comprenant une mutation, choisie dans le groupe indiqué dans la revendication 1, ou une combinaison de mutations, choisie dans le groupe indiqué dans la revendication 1, et la phytase présentant une thermo-stabilité accrue en comparaison avec un polypeptide ayant la séquence indiquée dans la SEQ ID n° : 3.
- Composition alimentaire ou d'aliments pour animaux comprenant un polypeptide tel que défini dans la revendication 1.
- Utilisation d'un polypeptide ou d'une phytase, selon la revendication 11, dans un aliment ou aliment pour animaux.
- Procédé de production d'un aliment ou aliment pour animaux comprenant une étape de pulvérisation d'un polypeptide ou d'une phytase, selon la revendication 11, sous forme liquide sur ledit aliment ou aliment pour animaux et/ou comprenant une étape de mélange du polypeptide ou de la phytase, selon la revendication 11, sous forme de produit sec avec ledit aliment ou aliment pour animaux.
- Procédé de criblage d'un variant d'une enzyme phytase, lequel procédé comprend les étapes consistant à :a) choisir une enzyme phytase parent, dans laquelle l'enzyme phytase parent est une enzyme phytase parent ayant une homologie d'au moins 90% avec la SEQ ID n° : 3 ;b) réaliser au moins une altération dans l'enzyme phytase parent pour obtenir un variant d'enzyme phytase selon la revendication 1 ; etc) effectuer un criblage d'un variant d'une enzyme phytase lequel, en comparaison avec l'enzyme phytase parent, a une stabilité thermique supérieure et :i. une activité spécifique supérieure ; et/ouii. une stabilité protéolytique supérieure.
- Procédé de criblage d'un variant d'une enzyme phytase, lequel procédé comprend les étapes consistant à :a) soumettre une séquence d'ADN, qui code pour une enzyme phytase parent, à une mutagenèse pour obtenir un variant d'enzyme phytase, selon la revendication 1, dans laquelle l'enzyme phytase parent est une enzyme phytase parent ayant une homologie d'au moins 90% avec la SEQ ID n° : 3 ;b) exprimer la séquence d'ADN mutée, obtenue à l'étape a), dans une cellule hôte ; etc) effectuer un criblage de cellules hôtes exprimant un variant d'enzyme phytase lequel, en comparaison avec l'enzyme phytase parent, a une stabilité thermique supérieure et :i. une activité spécifique supérieure ; et/ouii. une stabilité protéolytique supérieure.
- Procédé de préparation d'un variant d'une enzyme phytase, lequel procédé comprend les étapes consistant à :a) choisir une enzyme phytase parent, dans laquelle l'enzyme phytase parent est une enzyme phytase parent ayant une homologie d'au moins 90% avec la SEQ ID n° : 3 ;b) réaliser au moins une altération dans l'enzyme phytase parent pour obtenir un variant d'enzyme phytase selon la revendication 1 ; etc) préparer le variant d'enzyme phytase.
- Procédé de préparation d'un variant d'une enzyme phytase, lequel procédé comprend les étapes consistant à :a) soumettre une séquence d'ADN, qui code pour une enzyme phytase parent, à une mutagenèse pour obtenir un variant d'enzyme phytase, selon la revendication 1, dans laquelle l'enzyme phytase parent est une enzyme phytase parent ayant une homologie d'au moins 90% avec la SEQ ID n° : 3 ;b) exprimer la séquence d'ADN mutée, obtenue à l'étape a), dans une cellule hôte ; etc) préparer le variant de l'enzyme phytase exprimé par la cellule hôte.
- Polypeptide de phytase isolé, selon la revendication 1, comprenant une séquence d'acides aminés ayant une identité (homologie) d'au moins 95% avec la SEQ ID n° : 3.
- Polypeptide de phytase isolé, selon la revendication 1, comprenant une séquence d'acides aminés ayant une identité (homologie) d'au moins 96% avec la SEQ ID n° : 3.
- Polypeptide de phytase isolé, selon la revendication 1, comprenant une séquence d'acides aminés ayant une identité (homologie) d'au moins 97% avec la SEQ ID n° : 3.
- Polypeptide de phytase isolé, selon la revendication 1, comprenant une séquence d'acides aminés ayant une identité (homologie) d'au moins 98% avec la SEQ ID n° : 3.
- Polypeptide de phytase isolé, selon la revendication 1, comprenant une séquence d'acides aminés ayant une identité (homologie) d'au moins 99% avec la SEQ ID n° : 3.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
PL05804336T PL1797178T3 (pl) | 2004-10-04 | 2005-10-04 | Fitaza pochodząca od Citrobacter freundii i jej homologi |
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
GBGB0422052.1A GB0422052D0 (en) | 2004-10-04 | 2004-10-04 | Enzymes |
PCT/IB2005/000598 WO2006038062A1 (fr) | 2004-10-04 | 2005-02-15 | Phytase microbienne comme complement dans l'alimentation ou le fourrage |
PCT/IB2005/003660 WO2006038128A2 (fr) | 2004-10-04 | 2005-10-04 | Enzymes |
Publications (2)
Publication Number | Publication Date |
---|---|
EP1797178A2 EP1797178A2 (fr) | 2007-06-20 |
EP1797178B1 true EP1797178B1 (fr) | 2012-09-12 |
Family
ID=36096099
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP05804336A Not-in-force EP1797178B1 (fr) | 2004-10-04 | 2005-10-04 | Citrobacter freudii phytase et homologues |
Country Status (4)
Country | Link |
---|---|
EP (1) | EP1797178B1 (fr) |
AU (1) | AU2005290934C1 (fr) |
PL (1) | PL1797178T3 (fr) |
WO (1) | WO2006038128A2 (fr) |
Families Citing this family (29)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1809747B1 (fr) | 2004-10-04 | 2016-12-14 | Novozymes A/S | Polypeptides ayant une activite de phytase et polynucleotides codant ces polypeptides |
WO2007112739A1 (fr) | 2006-04-04 | 2007-10-11 | Novozymes A/S | Variants de phytase |
CN101460612B (zh) * | 2006-04-04 | 2015-05-06 | 诺维信公司 | 肌醇六磷酸酶变体 |
CN103168928A (zh) | 2006-08-07 | 2013-06-26 | 诺维信公司 | 用于动物饲料的酶团粒 |
US9578891B2 (en) | 2006-08-07 | 2017-02-28 | Novozymes A/S | Enzyme granules for animal feed |
EP2617816B1 (fr) * | 2006-09-21 | 2015-11-18 | BASF Enzymes LLC | Phytases, acides nucléiques encodant celles-ci et méthodes pour leur fabrication et leur utilisation |
US8101391B2 (en) | 2007-01-30 | 2012-01-24 | Novozymes A/S | Polypeptides having phytase activity and polynucleotides encoding same |
BR112012023840B1 (pt) | 2010-03-26 | 2021-06-22 | Novozymes A/S | Variante de fitase, métodos para produzir uma variante de fitase, para melhorar o valor nutricional de uma ração animal e para produzir um produto de fermentação, sequência de ácidos nucleicos isolada, construto de ácido nucleico, vetor de expressão recombinante, célula hospedeira recombinante, composição, e, uso da fitase ou da composição |
GB201102857D0 (en) | 2011-02-18 | 2011-04-06 | Danisco | Feed additive composition |
AR084894A1 (es) | 2011-02-18 | 2013-07-10 | Danisco | Composicion de aditivo para pienso |
GB201102865D0 (en) | 2011-02-18 | 2011-04-06 | Danisco | Feed additive composition |
PL2729809T3 (pl) | 2011-07-07 | 2019-04-30 | Dupont Nutrition Biosci Aps | Test oznaczający |
JP6378089B2 (ja) | 2011-12-09 | 2018-08-22 | ダニスコ・ユーエス・インク | 微生物におけるタンパク質産生のための、B.ズブチリス(B.subtilis)からのリボソームプロモーター |
GB201213801D0 (en) | 2012-08-03 | 2012-09-12 | Dupont Nutrition Biosci Aps | Feed additive composition |
EP3160260B1 (fr) | 2014-06-27 | 2020-05-27 | DSM IP Assets B.V. | Procédé d'amélioration de la valeur nutritive des aliments pour animaux |
CN107250365A (zh) | 2015-02-19 | 2017-10-13 | 丹尼斯科美国公司 | 增强的蛋白质表达 |
JP7103948B2 (ja) | 2016-03-04 | 2022-07-20 | ダニスコ・ユーエス・インク | 微生物におけるタンパク質産生のための遺伝子操作されたリボソームプロモーター |
WO2019089898A1 (fr) | 2017-11-02 | 2019-05-09 | Danisco Us Inc | Compositions de matrices solides à point de congélation abaissé pour la granulation à l'état fondu d'enzymes |
CN111867388A (zh) | 2018-02-08 | 2020-10-30 | 丹尼斯科美国公司 | 用于酶包封的耐热蜡基质颗粒 |
CN112367847A (zh) | 2018-04-26 | 2021-02-12 | 丹尼斯科美国公司 | 增加固体组合物中植酸酶的稳定性的方法及包含磷酸盐和植酸酶的颗粒组合物 |
AU2020310162A1 (en) | 2019-07-09 | 2022-02-03 | International N&H Denmark Aps | Fat coated particulate enzyme compositions |
EP4013236A1 (fr) | 2019-08-16 | 2022-06-22 | DuPont Nutrition Biosciences ApS | Compositions pour la santé intestinale comprenant des associations de souches lactobacillus |
WO2021046073A1 (fr) | 2019-09-05 | 2021-03-11 | Dupont Nutrition Biosciences Aps | Composition d'aliment pour animaux |
CN114828642A (zh) | 2019-10-21 | 2022-07-29 | 杜邦营养生物科学有限公司 | 用于消化道健康的组合物 |
EP4099838A1 (fr) | 2020-02-07 | 2022-12-14 | DuPont Nutrition Biosciences ApS | Compositions alimentaires pour la santé animale |
CA3189083A1 (fr) | 2020-08-13 | 2022-02-17 | Novozymes A/S | Variants de phytase et polynucleotides les codant |
CN117241678A (zh) | 2020-10-16 | 2023-12-15 | 杜邦营养生物科学有限公司 | 用于动物健康的饲料组合物 |
WO2022169933A2 (fr) | 2021-02-03 | 2022-08-11 | Dupont Nutrition Biosciences Aps | Compositions pour la santé intestinale |
KR20240060703A (ko) | 2021-09-27 | 2024-05-08 | 인터내셔널 엔&에이치 덴마크 에이피에스 | 사료 첨가제 조성물 및 이의 사용 방법 |
Family Cites Families (9)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0063456B1 (fr) | 1981-04-13 | 1984-08-01 | Takeda Chemical Industries, Ltd. | Pseudoaminosucres, leur préparation et utilisation |
DK122686D0 (da) | 1986-03-17 | 1986-03-17 | Novo Industri As | Fremstilling af proteiner |
KR100225087B1 (ko) | 1990-03-23 | 1999-10-15 | 한스 발터라벤 | 피타아제의 식물내 발현 |
DK0673429T3 (da) | 1992-12-10 | 2002-10-07 | Dsm Nv | Fremstilling af heterologe proteiner i filamentøse svampe |
US5741665A (en) | 1994-05-10 | 1998-04-21 | University Of Hawaii | Light-regulated promoters for production of heterologous proteins in filamentous fungi |
US7078035B2 (en) * | 1997-08-13 | 2006-07-18 | Diversa Corporation | Phytases, nucleic acids encoding them and methods for making and using them |
ES2377519T3 (es) * | 2002-02-08 | 2012-03-28 | Novozymes A/S | Variantes de fitasa |
WO2004024885A2 (fr) * | 2002-09-13 | 2004-03-25 | Cornell Research Foundation, Inc. | Utilisation de mutations pour ameliorer les aspergillus phytases |
WO2004085638A1 (fr) * | 2003-03-25 | 2004-10-07 | Republic Of National Fisheries Research And Development Institute | Phytase obtenue a partir de citrobacter braakii |
-
2005
- 2005-10-04 WO PCT/IB2005/003660 patent/WO2006038128A2/fr active Application Filing
- 2005-10-04 AU AU2005290934A patent/AU2005290934C1/en not_active Ceased
- 2005-10-04 PL PL05804336T patent/PL1797178T3/pl unknown
- 2005-10-04 EP EP05804336A patent/EP1797178B1/fr not_active Not-in-force
Also Published As
Publication number | Publication date |
---|---|
WO2006038128A2 (fr) | 2006-04-13 |
EP1797178A2 (fr) | 2007-06-20 |
AU2005290934B2 (en) | 2010-12-23 |
AU2005290934A1 (en) | 2006-04-13 |
WO2006038128A3 (fr) | 2006-08-24 |
AU2005290934C1 (en) | 2013-05-09 |
PL1797178T3 (pl) | 2013-02-28 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1797178B1 (fr) | Citrobacter freudii phytase et homologues | |
US9273295B2 (en) | Mutant citrobacter freundii phytase polypeptide | |
EP2264156B1 (fr) | Phytases |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20070417 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR |
|
RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: PELLANGAHR, KLAUS Inventor name: LEUTHNER, BIRGITTA Inventor name: KOLTERMANN, ANDRE Inventor name: KETTLING, ULRICH Inventor name: MIASNIKOV, ANDREI Inventor name: KENSCH, OLIVER Inventor name: KUMAR, VIJAY |
|
17Q | First examination report despatched |
Effective date: 20070907 |
|
DAX | Request for extension of the european patent (deleted) | ||
RIC1 | Information provided on ipc code assigned before grant |
Ipc: C12N 1/20 20060101ALI20120131BHEP Ipc: C12N 5/10 20060101ALI20120131BHEP Ipc: A23K 1/18 20060101ALI20120131BHEP Ipc: A23K 1/165 20060101ALI20120131BHEP Ipc: C12N 1/14 20060101ALI20120131BHEP Ipc: C12R 1/01 20060101ALI20120131BHEP Ipc: C12N 15/55 20060101ALI20120131BHEP Ipc: C12N 9/16 20060101AFI20120131BHEP |
|
RTI1 | Title (correction) |
Free format text: CITROBACTER FREUNDII PHYTASE AND HOMOLOGUES |
|
GRAP | Despatch of communication of intention to grant a patent |
Free format text: ORIGINAL CODE: EPIDOSNIGR1 |
|
RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: DUPONT NUTRITION BIOSCIENCES APS |
|
GRAS | Grant fee paid |
Free format text: ORIGINAL CODE: EPIDOSNIGR3 |
|
RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: DUPONT NUTRITION BIOSCIENCES APS |
|
GRAA | (expected) grant |
Free format text: ORIGINAL CODE: 0009210 |
|
AK | Designated contracting states |
Kind code of ref document: B1 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR |
|
REG | Reference to a national code |
Ref country code: GB Ref legal event code: FG4D |
|
REG | Reference to a national code |
Ref country code: CH Ref legal event code: EP |
|
REG | Reference to a national code |
Ref country code: AT Ref legal event code: REF Ref document number: 575113 Country of ref document: AT Kind code of ref document: T Effective date: 20120915 |
|
REG | Reference to a national code |
Ref country code: IE Ref legal event code: FG4D |
|
REG | Reference to a national code |
Ref country code: DE Ref legal event code: R096 Ref document number: 602005036132 Country of ref document: DE Effective date: 20121108 |
|
REG | Reference to a national code |
Ref country code: DK Ref legal event code: T3 |
|
REG | Reference to a national code |
Ref country code: NL Ref legal event code: T3 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: CY Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20120912 Ref country code: LT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20120912 |
|
REG | Reference to a national code |
Ref country code: ES Ref legal event code: FG2A Ref document number: 2394908 Country of ref document: ES Kind code of ref document: T3 Effective date: 20130206 |
|
REG | Reference to a national code |
Ref country code: LT Ref legal event code: MG4D Effective date: 20120912 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: LV Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20120912 Ref country code: GR Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20121213 Ref country code: SE Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20120912 Ref country code: SI Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20120912 |
|
REG | Reference to a national code |
Ref country code: PL Ref legal event code: T3 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: BE Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20120912 Ref country code: RO Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20120912 Ref country code: IS Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20130112 Ref country code: EE Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20120912 Ref country code: CZ Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20120912 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: SK Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20120912 Ref country code: MC Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20121031 Ref country code: PT Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20130114 |
|
REG | Reference to a national code |
Ref country code: CH Ref legal event code: PL |
|
REG | Reference to a national code |
Ref country code: IE Ref legal event code: MM4A |
|
PLBE | No opposition filed within time limit |
Free format text: ORIGINAL CODE: 0009261 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT |
|
REG | Reference to a national code |
Ref country code: HU Ref legal event code: AG4A Ref document number: E016162 Country of ref document: HU |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: IE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20121004 Ref country code: LI Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20121031 Ref country code: CH Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20121031 Ref country code: BG Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT Effective date: 20121212 |
|
26N | No opposition filed |
Effective date: 20130613 |
|
REG | Reference to a national code |
Ref country code: DE Ref legal event code: R097 Ref document number: 602005036132 Country of ref document: DE Effective date: 20130613 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: LU Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20121004 |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: ES Payment date: 20150915 Year of fee payment: 11 |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: PL Payment date: 20150908 Year of fee payment: 11 |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: FI Payment date: 20151012 Year of fee payment: 11 Ref country code: IT Payment date: 20151026 Year of fee payment: 11 |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: AT Payment date: 20150928 Year of fee payment: 11 Ref country code: HU Payment date: 20150914 Year of fee payment: 11 |
|
REG | Reference to a national code |
Ref country code: FR Ref legal event code: PLFP Year of fee payment: 12 |
|
REG | Reference to a national code |
Ref country code: AT Ref legal event code: MM01 Ref document number: 575113 Country of ref document: AT Kind code of ref document: T Effective date: 20161004 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: FI Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20161004 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: AT Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20161004 Ref country code: HU Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20161005 |
|
REG | Reference to a national code |
Ref country code: FR Ref legal event code: PLFP Year of fee payment: 13 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: IT Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20161004 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: PL Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20161004 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: ES Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20161005 |
|
REG | Reference to a national code |
Ref country code: FR Ref legal event code: PLFP Year of fee payment: 14 |
|
REG | Reference to a national code |
Ref country code: ES Ref legal event code: FD2A Effective date: 20181126 |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: FR Payment date: 20200914 Year of fee payment: 16 Ref country code: NL Payment date: 20200915 Year of fee payment: 16 Ref country code: TR Payment date: 20200930 Year of fee payment: 16 Ref country code: GB Payment date: 20200923 Year of fee payment: 16 |
|
PGFP | Annual fee paid to national office [announced via postgrant information from national office to epo] |
Ref country code: DE Payment date: 20200922 Year of fee payment: 16 Ref country code: DK Payment date: 20201012 Year of fee payment: 16 |
|
REG | Reference to a national code |
Ref country code: DE Ref legal event code: R119 Ref document number: 602005036132 Country of ref document: DE |
|
REG | Reference to a national code |
Ref country code: DK Ref legal event code: EBP Effective date: 20211031 |
|
REG | Reference to a national code |
Ref country code: NL Ref legal event code: MM Effective date: 20211101 |
|
GBPC | Gb: european patent ceased through non-payment of renewal fee |
Effective date: 20211004 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: TR Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20211004 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: NL Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20211101 Ref country code: GB Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20211004 Ref country code: DE Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20220503 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: FR Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20211031 |
|
PG25 | Lapsed in a contracting state [announced via postgrant information from national office to epo] |
Ref country code: DK Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES Effective date: 20211031 |