EP1766029A1 - Transformationsvektoren - Google Patents

Transformationsvektoren

Info

Publication number
EP1766029A1
EP1766029A1 EP05757541A EP05757541A EP1766029A1 EP 1766029 A1 EP1766029 A1 EP 1766029A1 EP 05757541 A EP05757541 A EP 05757541A EP 05757541 A EP05757541 A EP 05757541A EP 1766029 A1 EP1766029 A1 EP 1766029A1
Authority
EP
European Patent Office
Prior art keywords
plant
sequence
derived
dna
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP05757541A
Other languages
English (en)
French (fr)
Other versions
EP1766029A4 (de
Inventor
Anthony John Conner
Philippa Jane Barrell
Johanna Maria Elisabeth Jacobs
Samantha Jane Baldwin
Annemarie Suzanne Lokerse
Jan-Peter Hendrik Nap
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
New Zealand Insitiute for Plant and Food Research Ltd
Original Assignee
New Zealand Institute for Crop and Food Research Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from NZ533371A external-priority patent/NZ533371A/en
Application filed by New Zealand Institute for Crop and Food Research Ltd filed Critical New Zealand Institute for Crop and Food Research Ltd
Publication of EP1766029A1 publication Critical patent/EP1766029A1/de
Publication of EP1766029A4 publication Critical patent/EP1766029A4/de
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205—Agrobacterium mediated transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination

Definitions

  • An option provided by genetic engineering is the ability to extend the germplasm base available for crop improvement to any source of DNA, including that from other plants, microbes or animals.
  • This cross-species transformation has raised ethical concerns with the public, especially when associated with food.
  • Agrobacterium- aediated transformation is the preferred method and requires the construction of modified T-DNA (transferred-DNA) on a vector (usually a binary vector).
  • the transformation requires the use of vector systems based on DNA sequences from other species (e.g. the T-DNA border regions, the DNA region into which target genes are inserted, selectable markers genes and sequences allowing such vectors to replicate in additional host systems); sequences that have been usually derived from bacterial systems.
  • other species e.g. the T-DNA border regions, the DNA region into which target genes are inserted, selectable markers genes and sequences allowing such vectors to replicate in additional host systems
  • sequences that have been usually derived from bacterial systems e.g. the T-DNA border regions, the DNA region into which target genes are inserted, selectable markers genes and sequences allowing such vectors to replicate in additional host systems.
  • T-DNA border region The minimum requirement of a vector to perform Agrob ⁇ cterium-X ⁇ QdiatQd plant transformation is at least one T-DNA border region, although in practice transformation vector systems include other vector sequences as described above.
  • Two T-DNA border regions are usually used flanking the sequence of interest to be integrated into the plant genome. However in most instances such border sequences or parts thereof also become integrated into the genome of the transformed plant.
  • T-DNA sequences have been identified as naturally occurring in the genomes of plants (White et al 1983, Nature 301: 348-350; Furner et al 1986, Nature 319: 422-427; Aoki et al 1994, Molecular and General Genetics 243: 706-710; Susuli et al 2002, Plant Journal 32: 775-787). Plant transformation vectors in which the Agrob ⁇ cterium borders are replaced with plant derived T-DNA border-like sequences have also been reported (WO 03/069980). If the T- DNA border-like sequences are chosen from a plant of the species to be transformed, this allows for the possibility of production of plants transformed with only their own DNA.
  • the invention provides a plant transformation vector comprising: a) T-DNA-like sequence including at least one T-DNA border-like sequence, the T- DNA border-like sequence comprising two polynucleotide sequence fragments, wherein all of the sequences of the T-DNA-like sequence are derived from plant species. Also possible but less preferred is use of a similar T-DNA border-like sequence containing three or more polynucleotide sequence fragments derived from plant species.
  • the invention provides a plant transformation vector comprising a) a T-DNA-like sequence including at least one T-DNA border-like sequence b) additional plant polynucleotide sequence on one or both sides of the T-DNA-like sequence in which all of said sequences are derived from plants, preferably from the same plant species.
  • the additional plant polynucleotide sequence is 5' to the left border when two T- DNA border-like sequences are used, or 5' to the single T-DNA border-like sequence when a single T-DNA border-like sequence is used.
  • the said additional plant polynucleotide sequence is at least about lbp in length, preferably at least about 5 bp, preferably at least about 10 bp, preferably at least about 50 bp, preferably at least about 100 bp, preferably at least about 200 bp, preferably at least about 500 bp, more preferably at least about 1 kb.
  • the T-DNA-like sequence includes two T-DNA border-like polynucleotide sequences flanking the T-DNA-like sequence, both T-DNA border-like polynucleotide sequences being derived from plants, preferably from the same plant species.
  • the T-DNA-like sequence further comprises additional base polynucleotide sequence(s), the additional base polynucleotide sequence(s) being derived from plants preferably from the same plants species as the T-DNA border-like sequences.
  • the T-DNA-like sequence includes first and second recombinase recognition site sequences, wherein all of said sequences are derived from plants, preferably from the same plant species.
  • first recombinase recognition site and the second recombinase recognition site are lox P-like sites derived from a plant species, preferably from the same plant species as the T-DNA border-like sequences.
  • first recombinase recognition site and the second recombinase recognition site are ⁇ rt-like sites derived from a plant species, preferably from the same plant species as the T-DNA border-like sequences.
  • the vector comprises a selectable marker sequence flanked by the first and second recombinase recognition site sequences.
  • the selectable marker is operably linked to a constitutive promoter sequence.
  • the selectable marker and/or the constitutive promoter sequences are derived from plants, preferably from the same plant species as the T-DNA border-like sequences.
  • the vector comprises a recombinase sequence flanked by the first and second recombinase recognition site sequences.
  • the recombinase is operably linked to an inducible promoter sequence.
  • the recombinase and/or inducible promoter sequences are derived from plants, preferably from the same plant species as the T- DNA border-like sequences.
  • the recombinase sequence when the recombinase recognition sites are a / ⁇ P-like sequences, the recombinase sequence is Cre and when the recombinase recognition sites are an ⁇ f-like sequences, the recombinase sequence is FLP.
  • a negative selection marker may be flanked by the first and second recombinase recognition site sequences.
  • the negative selection marker is CodA.
  • neither the T-DNA border-like polynucleotide sequences, nor any base polynucleotide sequence of the T-DNA-like sequence, nor the first or second recombinase recognition site sequences, nor the plant polynucleotide sequence additional to the T-DNA-like sequence contain regulatory elements, such as promoters, which may influence the expression of inserted genes of interest.
  • T-DNA border-like polynucleotide sequences nor any base polynucleotide sequence of T-DNA-like sequence, nor the first or second recombinase recognition site sequences, nor the plant polynucleotide sequence additional to the T-DNA- like sequence are derived from heterochromatic regions of the genome from which they are derived.
  • the polynucleotide encompassing the T-DNA border-like sequences, the base polynucleotide sequence of the T-DNA-like sequence and the plant polynucleotide sequence additional to the T-DNA-like sequence are constructed from fewer than 10, preferably fewer than 9, preferably fewer than 8, preferably fewer than 7, preferably fewer than 6, preferably fewer than 5, preferably fewer than 4, preferably fewer than 3, most preferably 2 or 1 sequence fragments derived from plants.
  • the plant transformation vector of the invention further comprises an origin of replication sequence.
  • the origin of replication sequence is derived from a plant, preferably from the same plant species as the T-DNA border-like sequences and/or the base polynucleotide sequence of the T-DNA-like sequence, and/or the sequence additional to the T-DNA-like sequence.
  • the T-DNA-like sequence of the plant transformation vector of the invention comprises a selectable marker polynucleotide sequence for selection of a plant cell or plant harbouring the T-DNA-like sequence.
  • the selectable marker sequence is derived from a plant, more preferably from the same plant species as the T-DNA border-like sequences and/or the base polynucleotide sequence of the T-DNA-like sequence, and/or the sequence additional to the T-DNA-like sequence.
  • the plant transformation vector of the invention further comprises a selectable marker polynucleotide sequence for selection of a bacterium harbouring the vector.
  • the selectable marker sequence is derived from a plant, more preferably from the same plant species as the T-DNA border-like sequences and/or the base polynucleotide sequence of the T-DNA-like sequence, and/or the sequence additional to the T-DNA-like sequence.
  • the selectable marker polynucleotide sequence for selection of a plant harbouring the T-DNA-like sequence also functions in selection of a bacterium harbouring the vector.
  • the T-DNA-like sequence further comprises a genetic construct as herein defined.
  • the genetic construct comprises a promoter polynucleotide sequence operably linked to a polynucleotide sequence of interest and a terminator polynucleotide sequence, wherein all of said polynucleotide sequences are derived from plants, preferably from the same plant species as the T-DNA border-like sequences.
  • polynucleotide sequence of the entire vector is derived from plant species, preferably from the same plant species.
  • the T-DNA-like sequence includes, 5' to the chimeric T-DNA border- like sequence, first and second recombinase recognition sequences, wherein the recombinase recognition sequences are derived from plant species.
  • first recombinase recognition site and the second recombinase recognition sequence are /o P-like sequences.
  • first recombinase recognition sequence and the second recombinase recognition sequences arejrt-like sequences.
  • the plant transformation vector comprises a selectable marker sequence flanked by the first and second recombinase recognition sequences.
  • the selectable marker sequence is derived from plants.
  • the polynucleotide of at least 20 bp in length and any recombinase recognition site sequences are constructed from fewer than 10 fragments, preferably fewer than 9, preferably fewer than 8, preferably fewer than 7, preferably fewer than 6, preferably fewer than 5, preferably fewer than 4, preferably fewer than 3, most preferably 2 or 1 sequence fragments derived from plants.
  • the plant transformation vector further comprises an origin of replication polynucleotide sequence derived from plant species.
  • the T-DNA-like sequence includes, 5' to the chimeric T-DNA border-like sequence, a selectable marker polynucleotide sequence capable of functioning in selection of a plant cell or plant harbouring the T-DNA-like sequence, wherein the selectable marker sequence is derived from plant species.
  • the plant transformation vector comprises a selectable marker polynucleotide sequence capable of functioning in selection of a bacterium harbouring the vector, wherein the selectable marker sequence is derived from " a plant.
  • the selectable marker polynucleotide sequence capable of functioning in selection of a plant harbouring the T-DNA-like sequence is also capable of functioning in selection of a bacterium harbouring the vector.
  • the T-DNA-like sequence of the plant transformation vector further comprises a genetic construct as herein defined, wherein all polynucleotide sequences of the genetic construct are derived from plant species.
  • polynucleotide sequence of the the plant transformation vector is derived from plant species.
  • polynucleotide sequence of the the plant transformation vector is derived from plant species which are interfertile.
  • the plant-derived sequence of at least 20 bp in length is at least about 50bp in length, more preferably at least about lOObp in length, more preferably at least about 200bp in length, more preferably at least about 500bp in length, most preferably at least about lkb in length.
  • the plant transformation includes, 5' to the border sequence, first and second recombinase recognition sequences derived from plant species.
  • first recombinase recognition site and the second recombinase recognition sequence are loxP-like sequences.
  • first recombinase recognition sequence and the second recombinase recognition sequences axefrt-like sequences.
  • the plant transformation vector comprises a selectable marker sequence flanked by the first and second recombinase recognition sequences.
  • the selectable marker sequence is derived from plants.
  • polynucleotide of at least 20 bp in length and any recombinase recognition site sequences, of the plant transformation vector are constructed from fewer than 10 fragments, preferably fewer than 9, preferably fewer than 8, preferably fewer than 7, preferably fewer than 6, preferably fewer than 5, preferably fewer than 4, preferably fewer than 3, most preferably 2 or 1 polynucleotide sequence fragments derived from plant species.
  • the plant transformation vector further comprises an origin of replication polynucleotide sequence derived from plant species.
  • the plant transformation vector includes, 5' to the border sequence, a selectable marker polynucleotide sequence capable of functioning in selection of a plant cell or plant harbouring the selectable marker polynucleotide sequence, wherein the selectable marker sequence is derived from plant species.
  • the plant transformation vector comprises a selectable marker polynucleotide sequence capable of functioning in selection of a bacterium harbouring the vector, wherein the selectable marker sequence is derived from a plant.
  • the selectable marker polynucleotide sequence capable of functioning in selection of a plant harbouring the selectable marker polynucleotide sequence is also capable of functioning in selection of a bacterium harbouring the vector.
  • the plant transformation vector further comprises a genetic construct as herein defined, wherein all polynucleotide sequences of the genetic construct are derived from plant species.
  • all of the polynucleotide sequence of the plant transformation vector, except for the border sequence, is derived from plant species.
  • all of the polynucleotide sequence of the plant transformation vector, except for the border sequence, is derived from plant species which are interfertile.
  • all of the polynucleotide sequence of the plant transformation vector, except for the border sequence, is derived from the same plant species.
  • the invention provides a plant transformation vector comprising a selectable marker polynucleotide sequence capable of functioning in selection of a plant cell or plant harbouring the selectable marker polynucleotide, wherein the selectable marker sequence is derived from plant species.
  • the invention provides a plant transformation vector comprising first and second recombinase recognition sequences, wherein the recombinase recognition sequences are derived from plant species.
  • first recombinase recognition sequence and the second recombinase recognition sequence are loxP-like sequences derived from a plant species.
  • first recombinase recognition sequence and the second recombinase recognition sequences are ⁇ rt-like sequences derived from plant species.
  • the plant transformation vector comprises a selectable marker sequence flanked by the first and second recombinase recognition sequences.
  • the selectable marker sequence is derived from plants.
  • the plant transformation vector further comprises an origin of replication polynucleotide sequence derived from plant species.
  • the plant transformation vector further comprises a selectable marker polynucleotide sequence capable of functioning in selection of a bacterium harbouring the vector, wherein the selectable marker sequence is derived from plant species.
  • the selectable marker polynucleotide sequence capable of functioning in selection of a bacterium harbouring the vector is also capable of functioning in selection of a plant cell or plant harbouring the selectable marker polynucleotide.
  • the invention provides a plant transformation vector comprising: a) an origin of replication polynucleotide sequence, and b) a selectable marker polynucleotide sequence capable of functioning in selection of a bacterium harbouring the vector in which all of said sequences are derived from plant species.
  • the plant transformation vector further comprises additional base polynucleotide sequence, the additional base polynucleotide sequence being derived from plant species.
  • the plant transformation vector is constructed from fewer than 10, preferably fewer than 9, preferably fewer than 8, preferably fewer than 7, preferably fewer than 6, preferably fewer than 5, preferably fewer than 4, preferably fewer than 3, most preferably 2 or 1 polynucleotide sequence fragments derived from plants.
  • the plant transformation vector further comprises a genetic construct as herein defined, wherein all polynucleotide sequences of the genetic construct are derived from plants.
  • all of the polynucleotide sequence of the plant transformation vector is derived from plant species, more preferably from plant species which are interfertile and most preferably from the same plant species.
  • the invention provides a plant transformation vector comprising a selectable marker polynucleotide sequence for selection of a bacterium harbouring the vector.
  • the selectable marker sequence is derived from a plant.
  • the vector also comprises an origin of replication sequence functional in bacteria, preferably in E. coli.
  • the origin of replication sequence is derived from a plant, more preferably from the same plant species as the selectable marker polynucleotide sequence for selection of a • bacterium harbouring the vector. Yet more preferably the.
  • vector further comprises a genetic construct as herein defined.
  • the genetic construct sequence is derived from a plant, more preferably from the same plant species as the selectable marker polynucleotide sequence for selection of a bacterium harbouring the vector.
  • the polynucleotide sequence of the entire vector are derived from plant species, most preferably from the same plant species.
  • the invention provides a method of producing a transformed plant cell or plant, the method comprising the step of transformation of the plant cell or plant using a transformation vector of the invettion.
  • any polynucleotide stably integrated into the plant cell or plant is derived from a plant.
  • any polynucleotide stably integrated into the plant cell or plant is derived from a plant interfertile with the plant or plant cell to be transformed.
  • Most preferably any polynucleotide stably integrated into the plant cell or plant is derived from a plant of the same species as the plant or plant cell to be transformed.
  • the invention also provides a method of modifying a trait in a plant cell or plant comprising: (a) transforming of a plant cell or plant with a vector of the invention, the vector comprising a genetic construct capable of altering expression of a gene which influences the trait; and (b) obtaining a stably transformed plant cell or plant modified for the trait.
  • transformation is vir gene-mediated.
  • transformation is Agrobacterium-me ⁇ iate ⁇ .
  • transformation involves direct DNA uptake.
  • the invention provides a method for modifying a plant cell or plant, comprising: (a) transforming a plant cell or plant with the vector of the invention comprising a selectable marker flanked by /oxP-like recombinase recognition sites; (b) selecting a plant cell or plant expressing the selectable marker flanked by loxP-like recombinase recognition sites; (c) inducing the expression of the Cre gene in the plant cell or plant; (d) culturing the plant cell or plant for sufficient time to allow excision of the selectable marker.
  • the invention provides a method for modifying a plant cell or plant, comprising: (a) transforming a plant cell or plant with the vector of the invention comprising a selectable marker flanked b ⁇ frt-like recombinase recognition sites; (b) selecting a plant cell or plant expressing the selectable marker flanked byfrt-hke recombinase recognition sites; (c) inducing the expression of the FLP gene in the plant cell or plant; (d) culturing the plant cell or plant for sufficient time to allow excision of the selectable marker.
  • the invention provides a plant modified by a method of the invention.
  • the plant cell or plant modified is of the same species as the vector sequence used to modify it.
  • the invention also provides a plant cell or plant produced by a method of the invention
  • the plant cell or plant produced is of the same species as the vector sequence used to produce it.
  • the invention also provides a plant tissue, organ, propagule or progeny of the plant cell or plant of the invention.
  • polynucleotide(s), means a single or double-stranded deoxyribonucleotide or ribonucleotide polymer of any length, and include as non-limiting examples, coding and non-coding sequences of a gene, sense and antisense sequences, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polynucleotides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers, fragments, genetic constructs, vectors and modified polynucleotides.
  • variant refers to polynucleotide or polypeptide sequences different from the specifically identified sequences, wherein one or more nucleotides or amino acid residues is " deleted, substituted, or added. Variants may be naturally occurring allelic variants, or non-naturally occurring variants. Variants may be from the same or from other species and may encompass homologues, paralogues and orthologues. In certain embodiments, variants of the inventive polypeptides and polynucleotides possess biological activities that are the same or similar to those of the inventive polypeptides or polynucleotides.
  • variants of the inventive polypeptides and polynucleotides possess biological activities that are the same or similar to those of the inventive polypeptides or polynucleotides.
  • variant with reference to polynucleotides and polypeptides encompasses all forms of polynucleotides and polypeptides as defined herein.
  • Variant polynucleotide sequences preferably exhibit at least 50%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%, more preferably at least 95%o, more preferably at least 98%, and most preferably at least 99% identity to a sequence of the present invention. Identity is found over a comparison window of at least 5 nucleotide positions, preferably at least 10 nucleotide positions, preferably at least 20 nucleotide positions, preferably at least 50 nucleotide positions, more preferably at least 100 nucleotide positions, and most preferably over the entire length of a polynucleotide of the invention.
  • Polynucleotide sequence identity can be determined in the following manner.
  • the subject polynucleotide sequence is compared to a candidate polynucleotide sequence using BLASTN (from the BLAST suite of programs, version 2.2.5 [Nov 2002]) in bl2seq (Tatiana A. Tatusova, Thomas L. Madden (1999), "Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett. 174:247-250), which is publicly available from NCBI (ftp://ftp.ncbi.nih. gov/blast/). The default parameters of bl2seq may be utilized.
  • Polynucleotide sequence identity may also be calculated over the entire length of the overlap between a candidate and subject polynucleotide sequences using global sequence alignment programs (e.g. Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48, 443-453).
  • Needleman- Wunsch global alignment algorithm is found in the needle program in the EMBOSS package (Rice, P. Longden, I. and Bleasby, A. EMBOSS: The European Molecular Biology Open Software Suite, Trends in Genetics June 2000, vol 16, No 6. ⁇ p.276-277) which can be obtained from http://www.hgmp.mrc.ac.uk/Software/EMBOSS/.
  • the European Bioinformatics Institute server also provides the facility to perform EMBOSS-needle global alignments between two sequences on line at http:/www.ebi.ac.uk/emboss/align/.
  • GAP Global Sequence Alignment. Computer Applications in the Biosciences 10, 227-235.
  • BLASTN as described above is preferred for use in the determination of sequence identity for polynucleotide variants according to the present invention.
  • variant polynucleotides of the present invention hybridize to the polynucleotide sequences disclosed herein, or complements thereof under stringent conditions.
  • hybridize under stringent conditions refers to the ability of a polynucleotide molecule to hybridize to a target polynucleotide molecule (such as a target polynucleotide molecule immobilized on a DNA or RNA blot, such as a Southern blot or Northern blot) under defined conditions of temperature and salt concentration.
  • a target polynucleotide molecule such as a target polynucleotide molecule immobilized on a DNA or RNA blot, such as a Southern blot or Northern blot
  • the ability to hybridize under stringent hybridization conditions can be determined by initially hybridizing under less stringent conditions then increasing the stringency to the desired stringency.
  • Tm melting temperature
  • Typical stringent conditions for polynucleotide molecules of greater than 100 bases in length would be hybridization conditions such as prewashing in a solution of 6X SSC, 0.2% SDS; hybridizing at 65°C, 6X SSC, 0.2% SDS overnight; followed by two washes of 30 minutes each in IX SSC, 0.1% SDS at 65° C and two washes of 30 minutes each in 0.2X SSC, 0.1% SDS at 65°C.
  • exemplary stringent hybridization conditions are 5 to 10° C below Tm.
  • Tm of a polynucleotide molecule of length less than 100 bp is reduced by approximately (500/oligonucleotide length) 0 C.
  • Variant polynucleotides of the present invention also encompasses polynucleotides that differ from the sequences of the invention but that, as a consequence of the degeneracy of the genetic code, encode a polypeptide having similar activity to a polypeptide encoded by a polynucleotide of the present invention.
  • a sequence alteration that does not change the amino acid sequence of the polypeptide is a "silent variation". Except for ATG (methionine) and TGG (tryptophan), other codons for the same amino acid may be changed by art recognized techniques, e.g., to optimize codon expression in a particular host organism.
  • Polynucleotide sequence alterations resulting in conservative substitutions of one or several amino acids in the encoded polypeptide sequence without significantly altering its biological activity are also included in the invention.
  • a skilled artisan will be aware of methods for making phenotypically silent amino acid substitutions (see, e.g., Bowie et al, 1990, Science 247, 1306).
  • Variant polynucleotides due to silent variations and conservative substitutions in the encoded polypeptide sequence may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.5 [Nov 2002]) from NCBI (ftp ://ftp .ncbi .nih. go v/blast/) via the tblastx algorithm as previously described.
  • a "fragment" of a polynucleotide sequence provided herein is a subsequence of contiguous nucleotides that is at least 5 nucleotides in length.
  • the fragments of the invention comprise at least 5 nucleotides, preferably at least 10 nucleotides, preferably at least 15 nucleotides, preferably at least 20 nucleotides, more preferably at least 30 nucleotides, more preferably at least 50 nucleotides, more preferably at least 50 nucleotides and most preferably at least 60 nucleotides of contiguous nucleotides of a polynucleotide of the invention.
  • primer refers to a short polynucleotide, usually having a free 3 'OH group, that is hybridized to a template and used for priming polymerization of a polynucleotide complementary to the target.
  • probe refers to a short polynucleotide that is used to detect a polynucleotide sequence, that is complementary to the probe, in a hybridization-based assay.
  • the probe may consist of a "fragment" of a polynucleotide as defined herein.
  • polypeptide encompasses amino acid chains of any length, including full-length proteins, in which amino acid residues are linked by covalent peptide bonds.
  • Polypeptides of the present invention may be purified natural products, or may be produced partially or wholly using recombinant or synthetic techniques.
  • the term may refer to a polypeptide, an aggregate of a polypeptide such as a dimer or other multimer, a fusion polypeptide, a polypeptide fragment, a polypeptide variant, or derivative thereof.
  • isolated as applied to the polynucleotide sequences disclosed herein is used to refer to sequences that are removed from their natural cellular environment.
  • An isolated molecule may be obtained by any method or combination of methods including biochemical, recombinant, and synthetic techniques.
  • the term “genetic construct” refers to a polynucleotide molecule, usually double-stranded DNA, which may have inserted into it another polynucleotide molecule (the insert polynucleotide molecule) such as, but not limited to, a cDNA molecule.
  • a genetic construct may contain the necessary elements that permit transcribing the insert polynucleotide molecule, and, optionally, translating the transcript into a polypeptide.
  • the insert polynucleotide molecule may be derived from the host cell, or may be derived from a different cell or organism and/or may be a recombinant or synthetic polynucleotide. Once inside the host cell the genetic construct may become integrated in the host chromosomal DNA.
  • the term “genetic construct” includes "expression construct” as herein defined. The genetic construct may be linked to a vector.
  • expression construct refers to a genetic construct that includes the necessary elements that permit transcribing the insert polynucleotide molecule, and, optionally, translating the transcript into a polypeptide.
  • An expression construct typically comprises in a 5' to 3' direction: a) a promoter functional in the host cell into which the construct will be transformed, b) the polynucleotide to be transcribed and/or expressed, and c) a terminator functional in the host cell into which the construct will be transformed.
  • vector refers to a polynucleotide molecule, usually double stranded DNA, which may include a genetic construct and be used to transport the genetic construct into a host cell.
  • the vector may be capable of replication in at least one additional host system, such as Escherichia coli or Agrobacterium tumefaciens.
  • coding region or "open reading frame” (ORF) refers to the sense strand of a genomic DNA sequence or a cDNA sequence that is capable of producing a transcription product and/or a polypeptide under the control of appropriate regulatory sequences.
  • the coding sequence is identified by the presence of a 5' translation start codon and a 3' translation stop codon.
  • a "coding sequence" is capable of being expressed when it is operably linked to promoter and terminator sequences.
  • “Operably-linked” means that the sequence to be expressed is placed under the control of regulatory elements that include promoters, tissue-specific regulatory elements, temporal regulatory elements, chemical-inducible regulatory elements, environment-inducible regulatory elements, enhancers, repressors and terminators.
  • noncoding region refers to untranslated sequences that are upstream of the translational start site and downstream of the translational stop site. These sequences are also referred to respectively as the 5' UTR and the 3' UTR. These regions include elements required for transcription initiation and termination and for regulation of translation efficiency.
  • Terminators are sequences, which terminate transcription, and are found in the 3' untranslated ends of genes downstream of the translated sequence. Terminators are important determinants of mRNA stability and in some cases have been found to have spatial regulatory functions.
  • promoter refers to nontranscribed cis-regulatory elements upstream of the coding region that regulate gene transcription. Promoters comprise cis-initiator elements which specify the transcription initiation site and conserved boxes such as the TATA box, and motifs that are bound by transcription factors.
  • a “transformed plant” refers to a plant which contains new genetic material as a result of genetic manipulation or transformation.
  • the new genetic material may be derived from a plant of the same species or from a different species in which case it can also be known as a "transgenic plant”.
  • An "inverted repeat” is a sequence that is repeated, where the second half of the repeat is in the complementary strand, e.g., (5')GATCTA TAGATC(3') (3')CTAGAT ATCTAG(5')
  • Read-through transcription will produce a transcript that undergoes complementary base- pairing to form a hairpin structure provided that there is a 3-5 bp spacer between the repeated regions.
  • the terms "to alter expression of and “altered expression” of a polynucleotide or polypeptide of the invention are intended to encompass the situation where genomic DNA corresponding to a polynucleotide of the invention is modified thus leading to altered expression of a polynucleotide or polypeptide of the invention. Modification of the genomic DNA may be through genetic transformation or other methods known in the art for inducing mutations.
  • the "altered expression” can be related to an increase or decrease in the amount of messenger RNA and/or polypeptide produced and may also result in altered activity of a polypeptide due to alterations in the sequence of a polynucleotide and polypeptide produced.
  • oxp-like sequence refers to a sequence derived from the genome of a plant which can perform the function of a Cre recombinase recognition site.
  • the loxP-like sequence may be comprised of one contiguous sequence derived from the genome of a plant or may be formed by combining two sequences derived from the genome of a plant.
  • a oxP-like sequence is between 24-100 bp in length, preferably 24-80 bp in length, preferably 24-70 bp in length, preferably 24-60 bp in length, preferably 24-50 bp in length, preferably 24-40 bp in length, preferably 24-34 bp in length, preferably 26-34 bp in length, preferably 28-34 bp in length, preferably 30-34 bp in length, preferably 32-34 bp in length, preferably 34 bp in length.
  • a /oxP-like sequence preferably comprises the consensus motif
  • frt-like sequence refers to a sequence derived from the genome of a plant which can perform the function of an FLP recombinase recognition site.
  • the frt-like sequence may be comprised of one contiguous sequence derived from the genome of a plant or may be formed by combining two sequences derived from the genome of a plant.
  • An frt-like sequence is between 28-100 bp in length, preferably 28-80 bp in length, preferably 28-70 bp in length, preferably 28-60 bp in length, preferably 28-50 bp in length, preferably 28-40 bp in length, preferably 28-34 bp in length, preferably 30-34 bp in length, preferably 32-34 bp in length, preferably 34 bp in length.
  • Afii-like sequence preferably comprises the consensus motif 5' GAAGTTCCTATACNNNNNNNNGWATAGGAACTTC 3'
  • T-DNA border-like sequence refers to a sequence derived from the genome of a plant which can perform the function of an Agrobacterium T-DNA border sequence in integration of a polynucleotide sequence into the genome of a plant.
  • the T-DNA border-like sequence may be comprised of one contiguous sequence derived from the genome of a plant or may be formed by combining two or more sequences derived from the genome of a plant.
  • a T-DNA border-like sequence is between 10-100 bp in length, preferably 10-80 bp in length, preferably 10-70 bp in length, preferably 15-60 bp in length, preferably 15-50 bp in length, preferably 15-40 bp in length, preferably 15-30 bp in length, preferably 20-30 bp in length, preferably 21-30 bp in length, preferably 22-30 bp in length, preferably 23-30 bp in length, preferably 24-30 bp in length, preferably 25-30 bp in length, preferably 26-30 bp in length.
  • the T-DNA border-like sequence of the invention is preferably at least 50%, more preferably at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 99% identical to any Agrobacterium-de ⁇ ved T-DNA border sequence.
  • a T-DNA border-like sequence of the invention may include a sequence naturally occurring in a plant which is modified or mutated to change the efficiency at which it is capable of integrating a linked polynucleotide sequence into the genome of a plant.
  • T-DNA-like sequence refers to a sequence derived from a plant genome which includes at one or both ends a T-DNA border-like sequence, or a chimeric T-DNA-border-like sequence as herein defined.
  • a T-DNA-like sequence may include additional base sequence between the T-DNA border-like sequences, or to one side of a T-DNA border-like sequence.
  • the base sequence of the T-DNA-like sequences of the invention preferably includes restriction sites or alternative cloning sites to facilitate insertion of further polynucleotide sequences.
  • chimeric T-DNA border-like sequence refers to a sequence which can perform the function of an Agrobacterium T-DNA border sequence in integration of a polynucleotide sequence into the genome of a plant, wherein part of the sequence is derived from a plant and part of the sequence is derived from another source, such as Agrobacterium.
  • T-DNA integration from the right border is very precise.
  • Molecular cloning and sequencing across T-DNA/plant genomic DNA junctions has repeatedly established that T-DNA integration at the right border is highly conserved, with only the first few nucleotides of the right border being integrated into plant genomes (Gheysen, G., Angenon, G., van Montagu, M., Agrobacterium- ediated plant transformation: a scientifically interesting story with significant applications, pp. 1-33, in Transgenic Plant Research, editor Lindsey, K., Harwood Academic Publishers, Amsterdam, 1998).
  • border sequence refers to a sequence derived from a plant which can perform the function of an Agrobacterium T-DNA border sequence for integration of a polynucleotide sequence into the genome of a plant.
  • a "border sequence” is between 10-100 bp in length, preferably 10-80 bp in length, preferably 10-70 bp in length, preferably 15-60 bp in length, preferably 15-50 bp in length, preferably 15-40 bp in length, preferably 15-30 bp in length, preferably 20-30 bp in length, preferably 21-30 bp in length, preferably 22-30 bp in length, preferably 23-30 bp in length, preferably 24-30 bp in length, preferably 25-30 bp in length, preferably 26-30 bp in length.
  • a "border sequence” preferably comprises the consensus motif:
  • border sequence includes known Agrobacterium borders, including those disclosed herein.
  • border sequence also includes modified versions of known Agrobacterium sequences, which have been modified, for example by substitution, addition or deletion, to improve the efficiency at which they are capable of performing function of an Agrobacterium T-DNA border sequence for integration of a polynucleotide sequence into the genome of a plant.
  • plant-derived origin of replication refers to a sequence derived from a plant which can support replication of a vector in which it is included in a bacterium.
  • plant-derived origins of replication may be composed of one, two or more sequence fragments derived from plants.
  • plant-derived origins of replication are composed of two sequence fragments derived from plants.
  • the plant-derived origin of replication may comprise the consensus motif:
  • selectable marker derived from a plant or “plant-derived selectable marker” or grammatical equivalents thereof refers to a sequence derived from a plant which can enable selection of a plant cell harbouring the sequence or a sequence to which the selectable marker is linked.
  • the "plant-derived selectable markers” may be composed of one, two or more sequence fragments derived from plants.
  • the “plant-derived selectable markers” are composed of two sequence fragments derived from plants.
  • the plant-derived selectable marker is at least 50%, more preferably at least 55%), more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%>, more preferably at least 95%>, more preferably at least 99% identical to the sequence of SEQ ID NO: 10.
  • the plant-derived selectable marker is at least 90%, preferably at least 95%, and most preferably 100% identical to SEQ ID NO:39 or SEQ ID NO:40.
  • the invention provides novel plant derived loxP-like and frt-like recombinase recognition sequences, novel T-DNA border-like sequences, T-DNA-like sequences, transformation vectors, methods for producing transformed plant cells and plants, and plant cells and plants produced by the methods.
  • marker genes are no longer required. Moreover it is desirable to remove the promoter and enhancer elements used to drive the expression of the marker genes as these may interfere with the expression of neighboring endogenous genes.
  • Two such recombination systems are the Escherichi ⁇ coli bacteriophage PI Cre// ⁇ xP system and the Saccharomyces cerevisiae FLP//rt systems, which require only a single-polypeptide recombinase, Cre or FLP and minimal 34bp DNA recombination sites, lox? oxfrt.
  • the recombinase enzyme can either be located next to the selectable marker gene so that it is in effect auto excised (Mlynarova, L and Nap J-P, A self-excising Cre recombinase allows efficient recombination of multiple ectopic heterospecific lox sites in transgenic tobacco, Transgenic Research, 12: 45-57, 2003), or it can be transiently expressed (Gleave, A.P, Mitra, D.S, Mudge, S.R and Morris, B.A.M. Selectable marker-free transgenic plants without sexual crossing: transient expression of cre recombinase and use of a conditional lethal dominant gene, Plant Molecular Biology, 40: 223-235, 1999).
  • the invention provides T-DNA border-like sequences, T-DNA-like sequences, transformation vectors, methods for transforming plant cells and plants, and the plant cells and plants produced by the methods.
  • the applicants have also identified novel plant derived loxP-like and frt-like recombinase recognition sequences from plant genomes and devised further improved methods for transformation which minimise or eliminate transfer of foreign DNA to the transformed plant.
  • the invention provides methods which allow for within-species or "intragenic" as opposed to transgenic transformation of plants.
  • Vectors useful for this approach can therefore be described as intragenic vectors.
  • the invention provides such intragenic vectors and methods of using them to produce intragenic transformed plants without any foreign DNA.
  • DNA sequences used to construct such "intragenic vectors” are preferentially derived from DNA sequences (ESTs or cDNAs) known to be expressed in plant genomes. In this manner sequences derived from heterochromatic regions, promoters or introns can be avoided.
  • the use of such sequences for the construction of intragenic vectors may influence the subsequent expression of genes of interest following their transfer to plants via intragenic vectors.
  • the invention provides novel T-DNA border-like sequences from several plant species (as shown in Example 1) formed by combining two to three fragments of genomic DNA, with all fragments being from a single plant species of interest or a closely related species. The common nature of such sequences in plant genomes is shown in Example 1.
  • the invention further provides isolated T-DNA-like sequences from several plant species as shown in Example 2.
  • the T-DNA-like region sequences in Example 2 include the T-DNA-like sequences flanked (and delineated) by T-DNA border-like sequences (high-lighted) and additional sequence on either one or both sides of the T-DNA-like sequence.
  • Plant-derived selectable marker sequences which are useful for selecting transformed plant cells and plants harbouring a particular T-DNA-like sequence include PPga22 (Zuo et al, Curr Opin BiotechnoL 13: 173-80, 2002), Ckil (Kakimoto, Science 274: 982-985, 1996), Esrl (Banno et al, Plant Cell 13: 2609-18, 2001), and dhdps-rl (Ghislain et al, Plant Journal, 8: 733-743, 1995).
  • pigmentation markers to visually select transformed plant cells and plants, such as the R and CI genes (Lloyd et al, Science, 258: 1773-1775, 1992; Bodeau and Walbot, Molecular and General Genetics, 233: 379-387, 1992).
  • a preferred plant-derived selectable marker is the acetohydroxyacid synthase gene as shown in Example 6 and Example 7. Non-plant derived selectable markers are also described herein.
  • Preferred intragenic vectors of the invention contain a plant-derived selectable marker which function in selection of bacteria harbouring the marker as described in Example 3 and Example 5.
  • the preferred intragenic vectors of the invention consist entirely of plant-derived polynucleotide sequence from the species to be transformed, or from closely related species, such as species interfertile with the plant to be transformed, considered to be within the germplasm pool accessible to traditional plant breeding.
  • Such vectors preferably include a plant-derived origin of replication which is functional in bacteria, particularly in Agrobacterium species and preferably also in E. coli.
  • the invention provides plant transformation vectors comprising such sequences.
  • Preferred origin of replication sequences include those shown in Example 4.
  • the invention provides novel loxV-like and ⁇ rt-like recombinase recognition sequences from several plant species as shown in Example 9 and Example 10.
  • Example 6 Construction of a vector of the invention is described in Example 6 and Example 8. Plant transformation using these vectors is described in Example 7 and Example 8.
  • Example 6 and Example 7 also illustrate the construction and successful use of a vector with a chimeric T-DNA border-like sequence.
  • the "right border” is composed of 5'GAC3' from the end of a sequence isolated from Arabidopsis thaliana, with the remainder of the chimeric T-DNA border-like sequence, 5 ⁇ GGATATATTGGCGGGTAAAC3', being derived from the binary vector pART27 (see sequence of pTCl in Example 6).
  • Such chimeric T-DNA border-like sequences are preferably used as the right border when two border-like sequences are used to flank the T-DNA-like sequence.
  • the plant derived end (e.g. 5'GRC3') end of the T-DNA border-like sequence must be contiguous with the plant derived sequence(s) destined for integration into a plant genome.
  • polynucleotide molecules of the invention can be isolated by using a variety of techniques known to those of ordinary skill in the art.
  • such polynucleotides can be isolated through use of the polymerase chain reaction (PCR) described in Mullis et al, Eds. 1994 The Polymerase Chain Reaction, Birkhauser, incorporated herein by reference.
  • PCR polymerase chain reaction
  • the polynucleotides of the invention can be amplified using primers, as defined herein, derived from the polynucleotide sequences of the invention.
  • Further methods for isolating polynucleotides of the invention include use of all, or portions of, the disclosed polynucleotide sequences as hybridization probes.
  • the technique of hybridizing labeled polynucleotide probes to polynucleotides immobilized on solid supports such as nitrocellulose filters or nylon membranes, can be used to screen the genomic or cDNA libraries.
  • Exemplary hybridization and wash conditions are: hybridization for 20 hours at 65°C in 5. 0 X SSC, 0. 5% sodium dodecyl sulfate, 1 X Denhardt's solution; washing (three washes of twenty minutes each at 55°C) in 1.
  • polynucleotide fragments of the invention may be produced by techniques well-known in the art such as restriction endonuclease digestion and oligonucleotide synthesis.
  • a partial polynucleotide sequence may be used, in methods well-known in the art to identify the corresponding further contiguous polynucleotide sequence. Such methods would include PCR-based methods, 5'RACE (Frohman MA, 1993, Methods Enzymol. 218: 340-56) and hybridization- based method, computer/database-based methods. Further, by way of example, inverse PCR permits acquisition of unknown sequences, flanking the polynucleotide sequences disclosed herein, starting with primers based on a known region (Triglia et ah, 1998, Nucleic Acids Res 16, 8186, incorporated herein by reference). The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene.
  • the fragment is then circularized by intramolecular ligation and used as a PCR template.
  • Divergent primers are designed from the known region.
  • standard molecular biology approaches can be utilized (Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987).
  • Variant polynucleotides may be identified using PCR-based methods (Mullis et al, Eds. 1994 The Polymerase Chain Reaction, Birkhauser).
  • the polynucleotide sequence of a primer useful to amplify variants of polynucleotide molecules of the invention by PCR, may be based on a sequence encoding a conserved region of the corresponding amino acid sequence.
  • Further methods for identifying variant polynucleotides of the invention include use of all, or portions of, the polynucleotides disclosed herein as hybridization probes to screen plant genomic or cDNA libraries as described above. Typically probes based on a sequence encoding a conserved region of the corresponding amino acid sequence may be used. Hybridisation conditions may also be less stringent than those used when screening for sequences identical to the probe.
  • variant polynucleotide sequences of the invention may also be identified by computer- based methods well-known to those skilled in the art, using public domain sequence alignment algorithms and sequence similarity search tools to search sequence databases (public domain databases include Genbank, EMBL, Swiss-Prot, PIR and others). See, e.g., Nucleic Acids Res. 29: 1-10 and 11-16, 2001 for examples of online resources. Similarity searches retrieve and align target sequences for comparison with a sequence to be analyzed (i.e., a query sequence). Sequence comparison algorithms use scoring matrices to assign an overall score to each of the alignments.
  • An exemplary family of programs useful for identifying variants in sequence databases is the BLAST suite of programs (version 2.2.5 [Nov 2002]) including BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX, which are publicly available from (ftp ://ftp .ncbi .nih. gov/blast/) or from the National Center for Biotechnology Information (NCBI), National Library of Medicine, Building 38 A, Room 8N805, Bethesda, MD 20894 USA.
  • NCBI National Center for Biotechnology Information
  • the NCBI server also provides the facility to use the programs to screen a number of publicly available sequence databases.
  • BLASTN compares a nucleotide query sequence against a nucleotide sequence database.
  • BLASTP compares an amino acid query sequence against a protein sequence database.
  • BLASTX compares a nucleotide query sequence translated in all reading frames against a protein sequence database.
  • tBLASTN compares a protein query sequence against a nucleotide sequence database dynamically translated in all reading frames.
  • tBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.
  • the BLAST programs may be used with default parameters or the parameters may be altered as required to refine the screen.
  • BLAST family of algorithms including BLASTN, BLASTP, and BLASTX, is described in the publication of Altschul et al, Nucleic Acids Res. 25 : 3389-3402, 1997.
  • the "hits" to one or more database sequences by a queried sequence produced by BLASTN, BLASTP, BLASTX, tBLASTN, tBLASTX, or a similar algorithm align and identify similar portions of sequences.
  • the hits are arranged in order of the degree of similarity and the length of sequence overlap. Hits to a database sequence generally represent an overlap over only a fraction of the sequence length of the queried sequence.
  • the BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX algorithms also produce "Expect" values for alignments.
  • the Expect value (E) indicates the number of hits one can "expect” to see by chance when searching a database of the same size containing random contiguous sequences.
  • the Expect value is used as a significance threshold for determining whether the hit to a database indicates true similarity. For example, an E value of 0.1 assigned to a polynucleotide hit is interpreted as meaning that in a database of the size of the database screened, one might expect to see 0.1 matches over the aligned portion of the sequence with a similar score simply by chance.
  • the probability of finding a match by chance in that database is 1% or less using the BLASTN, BLASTP, BLASTX, tBLASTN or tBLASTX algorithm.
  • Pattern recognition software applications are available for finding motifs or signature sequences.
  • MEME Multiple Em for Motif Elicitation
  • MAST Motif Alignment and Search Tool
  • the MAST results are provided as a series of alignments with appropriate statistical data and a visual overview of the motifs found.
  • MEME and MAST were developed at the University of California, San Diego.
  • PROSITE (Bairoch and Bucher, 1994, Nucleic Acids Res. 22, 3583; Hofmann et al, 1999, Nucleic Acids Res. 27, 215) is a method of identifying the functions of uncharacterized proteins translated from genomic or cDNA sequences.
  • the PROSITE database www.expasy.org/prosite
  • Prosearch is a tool that can search SWISS-PROT and EMBL databases with a given sequence pattern or signature.
  • the function of a variant of a polynucleotide of the invention may be assessed by replacing the corresponding sequence in an intragenic vector with the variant sequence and testing the functionality of the vector in a host bacterial cell or in a plant transformation procedure as herein defined.
  • Such methods may involve the transformation of plant cells and plants, using a vector of the invention including a genetic construct designed to alter expression of a polynucleotide or polypeptide which modulates such a trait in plant cells and plants.
  • Such methods also include the transformation of plant cells and plants with a combination of the construct of the invention and one or more other constructs designed to alter expression of one or more polynucleotides or polypeptides which modulate such traits in such plant cells and plants.
  • a number of plant transformation strategies are available (e.g. Birch, 1997, Ann Rev Plant Phys Plant Mol Biol, 48, 297).
  • strategies may be designed to increase expression of a polynucleotide/polypeptide in a plant cell, organ and/or at a particular developmental stage where/when it is normally expressed or to ectopically express a polynucleotide/polypeptide in a cell, tissue, organ and/or at a particular developmental stage which when it is not normally expressed.
  • the expressed polynucleotide/polypeptide may be derived from the plant species to be transformed or may be derived from a different plant species.
  • Transformation strategies may be designed to reduce expression of a polynucleotide/polypeptide in a plant cell, tissue, organ or at a particular developmental stage which/when it is normally expressed. Such strategies are known as gene silencing strategies.
  • Direct gene transfer involves the uptake of naked DNA by cells and its subsequent integration into the genome (Conner, A.J. and Meredith, C.P., Genetic manipulation of plant cells, pp. 653-688, in The Biochemistry of Plants: A Comprehensive Treatise, Vol 15, Molecular Biology, editor Marcus, A., Academic Press, San Diego, " 1989; Petolino, J. Direct DNA delivery into intact cells and tissues, pp.137-143, in Transgenic Plants and Crops, editors Khachatourians et al., Marcel Dekker, New York, 2002,.
  • the cells can include those of intact plants, pollen, seeds, intact plant organs, in vitro cultures of plants, plant parts, tissues and cells or isolated protoplasts.
  • methods to effect direct DNA transfer may involve, but not limited to: passive uptake; the use of electroporation; treatments with polyethylene glycol and related chemicals and their adjuncts; electrophoresis, cell fusion with liposomes or spheroplasts; microinjection, silicon carbide whiskers, and microparticle bombardment.
  • Genetic constructs for expression of genes in transgenic plants typically include promoters for driving the expression of one or more cloned polynucleotide, terminators and selectable marker sequences to detect presence of the genetic construct in the transformed plant.
  • the promoters suitable for use in the constructs of this invention are functional in a cell, tissue or organ of a monocot or dicot plant and include cell-, tissue- and organ-specific promoters, cell cycle specific promoters, temporal promoters, inducible promoters, constitutive promoters that are active in most plant tissues, and recombinant promoters. Choice of promoter will depend upon the temporal and spatial expression of the cloned polynucleotide, so desired.
  • the promoters may be those normally associated with a transgene of interest, or promoters which are derived from genes of other plants, viruses, and plant pathogenic bacteria and fungi.
  • promoters that are suitable for use in modifying and modulating plant traits using genetic constructs comprising the polynucleotide sequences of the invention.
  • constitutive promoters used in plants include the CaMV 35S promoter, the nopaline synthase promoter and the octopine synthase promoter, and the Ubi 1 promoter from maize.
  • Plant promoters which are active in specific tissues, respond to internal developmental signals or external abiotic or biotic stresses are also described in the scientific literature. Exemplary promoters are described, e.g., in WO 02/00894, which is herein incorporated by reference.
  • Exemplary terminators that are commonly used in plant transformation genetic constructs include, e.g., the cauliflower mosaic virus (CaMV) 35S terminator, the Agrobacterium tumefaciens nopaline synthase or octopine synthase terminators, the Zea mays zein gene terminator, the Oryza sativa ADP-glucose pyrophosphorylase terminator and the Solanum tuberosum PI- II terminator.
  • CaMV cauliflower mosaic virus
  • Agrobacterium tumefaciens nopaline synthase or octopine synthase terminators the Zea mays zein gene terminator
  • the Oryza sativa ADP-glucose pyrophosphorylase terminator the Solanum tuberosum PI- II terminator.
  • NPT II neomycin phophotransferase II gene
  • aadA gene which confers spectinomycin and streptomycin resistance
  • phosphinothricin acetyl transferase bar gene
  • Ignite AgrEvo
  • Basta Hoechst
  • hpt hygromycin phosphotransferase gene
  • non-plant derived regulatory elements described above may be used in the intragenic vectors of the invention operably linked to selectable markers placed between the recombinase recognition sites.
  • Gene silencing strategies may be focused on the gene itself or regulatory elements which effect expression of the encoded polypeptide. "Regulatory elements” is used here in the widest possible sense and includes other genes which interact with the gene of interest.
  • Genetic constructs designed to decrease or silence the expression of a polynucleotide/polypeptide of the invention may include an antisense copy of a polynucleotide of the invention.
  • the polynucleotide is placed in an antisense orientation with respect to the promoter and terminator.
  • An "antisense" polynucleotide is obtained by inverting a polynucleotide or a segment of the polynucleotide so that the transcript produced will be complementary to the mRNA transcript of the gene, e.g.,
  • Genetic constructs designed for gene silencing may also include an inverted repeat as herein defined.
  • the preferred approach to achieve this is via RNA-interference strategies using genetic constructs encoding self-complementary "hairpin” RNA (Wesley et al., 2001, Plant Journal, 27: 581-590).
  • the transcript formed may undergo complementary base pairing to form a hairpin structure.
  • a spacer of at least 3-5 bp between the repeated region is required to allow hairpin formation.
  • Another silencing approach involves the use of a small antisense RNA targeted to the transcript equivalent to an miRNA (Llave et al, 2002, Science 297, 2053). Use of such small antisense RNA corresponding to polynucleotide of the invention is expressly contemplated.
  • genetic construct as used herein also includes small antisense RNAs and other such polynucleotides effecting gene silencing.
  • Transformation with an expression construct, as herein defined, may also result in gene silencing through a process known as sense suppression (e.g. Napoli et al, 1990, Plant Cell 2, 279; de Carvalho Niebel et al, 1995, Plant Cell, 7, 347).
  • sense suppression may involve over-expression of the whole or a partial coding sequence but may also involve expression of non-coding region of the gene, such as an intron or a 5' or 3' untranslated region (UTR).
  • Chimeric partial sense constructs can be used to coordinately silence multiple genes (Abbott et al, 2002, Plant Physiol. 128(3): 844-53; Jones et al, 1998, Planta 204: 499- 505).
  • polynucleotide inserts in genetic constructs designed for gene silencing may correspond to coding sequence and/or non-coding sequence, such as promoter and/or intron and/or 5' or 3' UTR sequence, or the corresponding gene.
  • Pre-transcriptional silencing may be brought about through mutation of the gene itself or its regulatory elements.
  • Such mutations may include point mutations, frameshifts, insertions, deletions and substitutions.
  • the plant-derived sequences in the vectors of the invention may be derived from any plant species.
  • the plant-derived sequences in the vectors of the invention are from gymnosperm species.
  • Preferred gymnosperm genera include Cycas, Pseudotsuga, Pinus and Picea.
  • Preferred gymnosperm species include Cycas rumphii, Pseudotsuga menziesii, Pinus radiata, Pinus taeda, Pinus pinaster, Picea engelmannia x sitchensis, Picea sitchensis and Picea glauca.
  • the plant-derived sequences in the vectors of the invention are from bryophyte species.
  • Preferred bryophyte genera include Marchantia, Tortula, Physcomitrella and Ceratodon.
  • Preferred bryophyte species include Marchantia polymorpha, Tortula ruralis, Physcomitrella patens and Ceratodon purpureous.
  • the plant-derived sequences in the vectors of the invention are from algae species.
  • Preferred algae genera include Chlamydomonas.
  • Preferred algae species include Chlamydomonas reinhardtii.
  • the plant-derived sequences in the vectors of the invention are from angiospemi species.
  • Preferred angiosperm genera include Aegilops, Allium, Amborella, Anopterus, Apium, Arabidopsis, Arachis, Asparagus, Atropa, Avena, Beta, Betula, Brassica, Camellia, Capsicum, Chenopodium, Cicer, Citrus, Citrullus, Coffea, Cucumis, Elaeis, Eschscholzia, Eucalyptus, Fagopyrum, Fragaria, Glycine, Gossypium, Helianthus, Hevea, Hordeum, Humulus, Ipomoea, Lactuca, Limonium, Linum, Lolium, Lotus, Lycopersicon, Lycoris, Malus, Manihot, Medicago, Mesembryanthemum, Musa, Nicotiana, Nuphar, Olea, Oryza, Persea, Petunia, Pet
  • Preferred angiosperm species include Aegilops speltoides, Allium cepa, Amborella trichopoda, Anopterus macleayanus, Apium graveolens, Arabidopsis thaliana, Arachis hypogaea, Asparagus officinalis, Atropa belladonna, Avena sativa, Beta vulgar is, Brassica napus, Brassica rapa, Brassica oleracea, Capsicum annuum, Capsicum fi'utescens, Cicer arietinum, Citrullus lanatus, Citrus Clementina, Citrus reticulata, Citrus sinensis, Coffea arabica, Coffea canephora, Cucumis sativus, Elaeis guineesis, Eschscholzia californica, Eucalyptus tereticornis, Fagopyrum esculentum, Fragaria x ananassa, G
  • Particularly preferred angiosperm genera include Solanum, Petunia and Allium.
  • Particularly preferred angiosperm species include Solanum tuberosum, Petunia hybrida and Allium cepa.
  • the plant cells and plants of the invention may be derived from any plant species.
  • the plant cells and plants of the invention are from gymnosperm species.
  • Preferred gymnosperm genera include Cycas, Pseudotsuga, Pinus and Picea.
  • Preferred gymnosperm species include Cycas rumphii, Pseudotsuga menziesii, Pinus radiata, Pinus taeda, Pinus pinaster, Picea engelmannia x sitchensis, Picea sitchensis and Picea glauca.
  • the plant cells and plants of the invention are from bryophyte species.
  • Preferred bryophyte genera include Marchantia, Tortula, Physcomitrella and Ceratodon.
  • Preferred bryophyte species include Marchantia polymorpha, Tortula ruralis, Physcomitrella patens and Ceratodon purpureous.
  • the plant cells and plants of the invention are from algae species.
  • Preferred algae genera include Chlamydomonas.
  • Preferred algae species include Chlamydomonas reinhardtii.
  • the plant cells and plants of the invention are from angiosperm species.
  • Preferred angiosperm genera include Aegilops, Allium, Amborella, Anopterus, Apium, Arabidopsis, Arachis, Asparagus, Atropa, Avena, Beta, Betula, Brassica, Camellia, Capsicum, Chenopodium, Cicer, Citrus, Citrullus, Coffea, Cucumis, Elaeis, Eschscholzia, Eucalyptus, Fagopyrum, Fragaria, Glycine, Gossypium, Helianthus, Hevea, Hordeum, Humulus, Ipomoea, Lactuca, Limonium, Linum, Lolium, Lotus, Lycopersicon, Lycoris, Malus, Manihot, Medicago, Mesembryanthemum, Musa, Nicotiana, Nuphar, Olea, Oryza, Persea, Petunia, Phaseolus, Pisum
  • Preferred angiosperm species include Aegilops speltoides, Allium cepa, Amborella trichopoda, Anopterus macleayanus, Apium graveolens, Arabidopsis thaliana, Arachis hypogaea, Asparagus officinalis, Atropa belladonna, Avena sativa, Beta vulgaris, Brassica napus, Brassica rapa, Brassica oleracea, Capsicum annuum, Capsicum frutescens, Cicer arietinum, Citrullus lanatus, Citrus Clementina, Citrus reticulata, Citrus sinensis, Coffea arabica, Coffea canephora, Cucumis sativus, Elaeis guineesis, Eschscholzia californica, Eucalyptus tereticornis, Fagopyrum esculentum, Fragaria x ananassa, Gly
  • Particularly preferred angiosperm genera include Solanum, Petunia and Allium.
  • Particularly preferred angiosperm species include Solanum tuberosum, Petunia hybrida and Allium cepa.
  • the cells and plants of the invention may be grown in culture, in greenhouses or the field. They may be propagated vegetatively, as well as either selfed or crossed with a different plant strain and the resulting hybrids, with the desired phenotypic characteristics, may be identified. Two or more generations may be grown to ensure that the subject phenotypic characteristics are stably maintained arid inherited. Plants resulting from such standard breeding approaches also form an aspect of the present invention.
  • Figure 1 shows PCR verification the propagation of plasmid pPOTCOLE2SPEC in E. coli mediated by a potato-derived COLE2-like origin of replication.
  • Lanes 1 and 2 are plasmid preparations restricted with a BamWEco I double digest from two independent transformation events of pPOTCOLE2SPEC into E. coli DH5 ⁇ already possessing pBX243; they show 3.9 kb, 2.5 kb, and 1.5 kb fragments, representing the pBX243 backbone, linearised pPOTCOLE2SPEC, and the pBX243 Rep gene respectively.
  • Lane 3 is a plasmid preparation restricted with a BamHl/EcoRI double digest from a culture transformed with only pBX243 and shows 3.9 kb and 1.5 kb fragments, representing the pBX243 backbone and the ⁇ BX243 Rep gene.
  • Lane 4 is the GeneRuler DNA ladder mix #SM0331 (Fermentas, Hanover, Maryland) size marker.
  • Figure 2 shows PCR verification the potato-derived LacOl-like sequences functioning as a plasmid selectable element by operator-repressor titration.
  • Lane 1 is the GeneRuler DNA ladder mix #SM0331 (Fermentas, Hanover, Maryland) size marker.
  • Lanes 2-6 are plasmid preparations restricted with Pstl from five independent transformation events of pBR322POTLACOl into E. coli strain DHllacdapD using repressor titration selection; they show the expected 1.3 kb and 3.8 kb fragments.
  • Lane 7 is a plasmid preparation restricted with Pstl following transformation of pBR322POTLACOl into E. coli strain DH5 ⁇ using ampillicin selection and also shows the expected 1.3 kb and 3.8 kb fragments.
  • Lane 8 is linearised pBR322 visualised as a 4.4 kb fragment.
  • Figure 3 shows PCR verification of Arabidopsis thaliana 'Columbia' transformed with the intragenic vector pTCAHAS.
  • Lanes 1&2, 3&4 and 5&6 are three A.
  • thaliana lines transformed with the intragenic vector, lanes 1,3,5 using primers E+F, lanes 2,4,6 using primers G+H; lanes 8&9 are untransfoimed A.
  • Figure 4 shows PCR verification of potato cultivar Twa' transformed with the intragenic vector pPOTLNV. This involved a multiplexed PCR using primers I+J to amplify the 570 bp fragment from the pPOTLNV T-DNA-like region and primers K+L to amplify the 1069 bp product from the endogenous actin gene of potato.
  • Lanes 1&7 are the 1 kb plus molecular ruler 10787-018 (Invitrogen, Carlsbad, California), lane 2 is the co-transformed hairy root line #18, lane 3 is the co-transformed hairy root line #74, lane 4 is a control hairy root line transformed with Agrobacterium strain A4T without the binary vector pPOTLNV, lane 5 is the intragenic vector pPOTLNV, lane 6 is a no template control.
  • Figure 5 shows PCR verification of the absence of Agrobacterium DNA in the samples used for PCR analysis in Figure 4. This involved a PCR using primers M+N to amplify the 590 bp of the Agrobacterium virG gene.
  • Lanes 1&7 are the 1 kb plus molecular ruler 10787-018 (Invitrogen, Carlsbad, California)
  • lane 2 is the co-transformed hairy root line #18,
  • lane 3 is the co-transformed hairy root line #74
  • lane 4 is a control hairy root line transformed with Agrobacterium strain A4T without the binary vector pPOTLNV
  • lane 5 is Agrobacterium strain A4T, lane 6 is a no template control.
  • Figure 6 shows PCR verification of potato cultivar 'Iwa' transformed with the intragenic vector pPETINV. This involved PCR using primers O+P to amplify the 447 bp fragment from the pPETINV T-DNA-like region (lanes 2-5) and primers K+L to amplify the 1069 bp product from the endogenous actin gene of potato (lanes 6-8).
  • Lane 1 is the 1 kb plus molecular ruler 10787-018 (Invitrogen, Carlsbad, California); lanes 2 and 6 are the co- transformed hairy root line #24; lanes 3 and 7 are a control hairy root line transformed with Agrobacterium strain A4T without the binary vector pPETINV; lane 4 is the intragenic vector pPETINV; lanes 5 and 8 are a no template controls.
  • Figure 7 shows PCR verification of the absence of Agrobacterium DNA in the samples used for PCR analysis in Figure 6. This involved a PCR using primers M+N to amplify the 590 bp of the Agrobacterium virG gene.
  • Lane 1 is the 1 kb plus molecular ruler 10787-018 (Invitrogen, Carlsbad, California)
  • lane 2 is the co-transformed hairy root line #18,
  • lane 3 is a control hairy foot line transformed with Agrobacterium strain A4T without the binary vector pPOTLNV
  • lane 4 is Agrobacterium strain A4T
  • lane 5 is a no template control.
  • Figure 8 illustrates recombination between the POTLOXP sites mediated by Cre recombinase. Plasmid was isolated from E. coli strain 294-Cre transformed with pPOTLOXP2 and restricted with Sail. Expression of Cre recombinase was induced by raising the temperature from 23 °C to 37 °C.
  • Lane 1 is the 1 kb plus molecular ruler 10787-018 (Invifrogen, Carlsbad, California); lane 2 illustrates the expected 3.0 kb and 2.3 kb Sail fragments of unrecombined pPOTLOXP2 isolated from a culture maintained at 23 °C; lanes 3-8 illustrate the 3.0 kb and 1.5 kb Sail fragments expected from Cre-mediated recombination between the POTLOXP sites in six different colonies cultured at 37 °C.
  • Figure 9 illustrates recombination between the POTFRT sites mediated by FLP recombinase.
  • Plasmid was isolated from E. coli strain 294-FLP transformed with pPOTFRT2 and restricted with Sail. Expression of FLP recombinase was induced by raising the temperature from 23 °C to 37 °C.
  • Lanes 1 and 8 are the GeneRuler DNA ladder mix #SM0331 (Fermentas, Hanover, Maryland) size marker; lane 2 illustrates the expected 3.0 kb and 1.4 kb Sail fragments of unrecombined pPOTFRT2 isolated from a culture maintained at 23 °C; lanes 3-7 illustrate the 3.0 kb and 1.4 kb fragments, and the 1.1 kb Sail fragments expected from FLP- mediated recombination between the POTFRT sites in five different colonies cultured at 37 °C.
  • NCBI GenBank http://www.ncbi.nlm.nih.gov/BLAST/
  • TIGR database htt ://tigrblast.ti r . or g/tgi ⁇ using the BLAST tool "search for short, nearly exact matches" and searching within the EST databases, yielded multiple accession numbers for each motif 5'GACAGGATATAT3' and 5'GGCAGGATATAT3' as shown in Table 1.
  • the search was limited to Viridiplanteae and the expect value was 10000. Searches were also conducted in the EST Database of Japan carried out using Expect values of 10000 and the gap tool off (http://www.ddbi .nig.ac.ip .
  • the initial 5'GRCAGGATATAT3' of the T-DNA border-like motif is less likely to be identified in database searches than the shorter sequence 5'KSTMAWN3'. If the entire border sequence is formed using 2 EST sequences as shown in Example 2 of the patent application, then a second BLAST search is undertaken using 5'KSTMAWN3' from known T-DNA border sequences.
  • a list of such sequences are: 5'TGTCATG3' 5'TGTAAAC3', 5'GGTAAAC3' 5 5 GTAAAA3', 5OGTAAAA3'; which correspond to the following border sequences: 5'gacaggatatatgttcttgtcatg3' (pRi), 5'gacaggatatattggcgggtaaac3' (pTiT37 andpTiC58), 5'ggcaggatatatcgaggtgtaaaa3' (pTil5955), 5'ggcaggatatattgtggtgtaaac3' ( ⁇ ART27 lb) and 5'gacaggatatattggcgggtaaac3' ( ⁇ ART27 rb).
  • BLAST searches using these sequences produce multiple matches. For example just within Solanum tuberosum (a plant whose genome has not been completely sequenced) , a search (BLAST "search for short, nearly exact matches" Expect 20000 and descriptions 1000) for only 5'TGTAAAC3' in NCBI GenBank yields 997 exact matches of which 985 are S. tuberosum ESTs (search performed 2 June 2004).
  • T-DNA- like regions for possible intragenic vectors was undertaken by searching plant EST databases for Agrobacterium border-like sequences. Limiting searches to EST sequences facilitates the design of intragenic vectors by:
  • the base DNA making up the T-DNA-like region does not involve regulatory elements such as promoters that may influence expression of inserted target genes; and 2.
  • the DNA on which the T-DNA-like region is based is not derived from heterochromatic regions (non coding, non expressed, condensed DNA) as this may suppress activity of the genes intended for transfer.
  • BLAST searches were conducted as described by Altschul et al. (Gapped BLAST and PSI- BLAST: a new generation of protein database search programs, Nucleic Acids Res. 25: 3389- 3402, 1997).
  • NCBI BLAST www.ncbi.nlm.nih.gov/BLAST/ "blastn” and “search for short, nearly exact matches” was used to search the EST database. Expect values of 10000 or 20000 (dependent on word size) were used and the search was limited by entrez query, potato (Solanum), tomato (Lycopersicon), or Petunia. All Petunia EST sequences from the NCBI site were also downloaded in FASTA format and searched using the "find" tool in Microsoft Notepad.
  • Solanaceae genomics network http://soldb.cit.cornell.edu/cgi-bin/tools/blast/simple.pl BLAST settings included expect values of 10,000 (due to short sequences) and the default settings. All searches were done in EST databases. Unigene sequences were identified using the EST searches.
  • BLAST was carried out as above with an Expect value of 10,000 and limited by entrez query to Pinus, Nicotiana, Medicago, apple or onion (Allium).
  • NCBI BLAST www.ncbi.nlm.nih.gov/BLAST/. Settings were as above but limited by entrez query rice or Oryza.
  • TIGR - htt ://tigrblast .ti r . or g/tgi searched unique gene indices. Used an expect value of 10,000 and matrix blosum62 or blosumlOO. All other values were the default settings. The searches identified some TC# sequences (tentative consensus sequences) and ESTs containing the region of interest were identified from these.
  • the RGP EST database was used to search for ESTs containing the sequences of interest, using Expect values of 10000 and the remaining options at default settings.
  • ESTs were identified that showed sequence identity to parts of ' the Agrobacterium border-like sequences. These identified EST sequences were then assessed for homology, length of sequence flanking the borders and unique restriction sites. This was carried out using DNAMAN (version 3.2, Lynnon BioSoft. co ⁇ yright ⁇ 1994-1997). ESTs were adjoined (usually 3 ESTs) to give a T-DNA-like region containing two border sequences, unique restriction sites between the border sequences (that can be used as cloning sites) and extra plant EST sequence beyond the borders to minimize the opportunity for non-intragenic vector backbone sequences being transferred with the T-DNA-like region into plant genomes. Multiple intragenic T-DNA-like regions were designed and compared. Those designed to have the optimum sequence and useful unique restriction sites are presented below.
  • T-DNA-like region of a potato intragenic vector This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) backbone using the Sa l sites that are underlined.
  • the nucleotides in italics are not part of the potato genome sequence.
  • Nucleotides 6 - 334 are the reverse complement of nucleotides 315 - 643 of sgn-U179068.
  • Nucleotides 335 - 974 are nucleotides 131 - 770 of sgn-Ul 74278.
  • Nucleotides 975 - 1265 are nucleotides 117 - 407 of CN216800.
  • T-DNA border-like sequences are shown in bold.
  • the left border is nucleotides 314 - 337 and the right border is nucleotides 957 - 980.
  • Unique restriction sites in the resulting binary vector that are located within the T-DNA-like region are:
  • This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) backbone using the Sail sites that are underlined.
  • the nucleotides in italics are not part ofthe petunia genome sequence.
  • Nucleotides 6-399 are the complete sequence ofthe 394 nucleotide fragment from sgn- e521144.
  • Nucleotides 400-855 are the reverse complement of nucleotides 85-540 from sgn-e534315.
  • Nucleotides 856-1071 are the reverse complement of nucleotides 121-336 from sgn-u207691.
  • T-DNA border-like sequences are shown in bold.
  • the left border is nucleotides 347-370 and right border is nucleotides 844-867.
  • Unique restriction sites in the resulting binary vector that are located within the T-DNA-like region are: Acc ⁇ ll at 392 Agel at 788 Bbvl at 453 BspM ⁇ l at 392 -9,st71I at 453 C/H0I at 788 CM site at 398 FnuAYll at 442 ⁇ el at 665 ⁇ f ⁇ l at 752 P AI at 788
  • Nspl sites within the T-DNA-like region (616 and 755) that could be used as cloning sites.
  • the most useful restriction site for cloning into the T-DNA-like region is the CM site which is shown in underlined bold.
  • T-DNA-like region of a tomato (Lycopersicon esculentum) intragenic vector This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) backbone using the Sail sites that are underlined.
  • the nucleotides in italics are not part of the tomato genome sequence.
  • Nucleotides 5 - 537 are nucleotides 2-534 of SGN-E260320.
  • Nucleotides 538 - 976 are the reverse complement of nucleotides 79 - 517 of SGN-E291502
  • Nucleotides 977 - 1188 are the reverse complement of nucleotides 1 - 212 of CK575027.
  • the T-DNA border-like sequences are shown in bold.
  • the left border is nucleotides 375 - 398 and the right border nucleotides 960 - 983.
  • the restriction sites and positions that could be used for cloning within the T-DNA are shown below (as calculated by DNAMAN):
  • T-DNA-like region of a Nicotiana benthamiana intragenic vector This sequence can be ligated into pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-
  • Nucleotides 5 - 853 are nucleotides 111 - 959 of CK292156
  • Nucleotides 854 - 1469 are the reverse complement of nucleotides 81-696 of CK286377.
  • Nucleotides 1470 - 1787 are nucleotides 285 - 602 of CN748849.
  • T-DNA border-like sequences are shown in bold.
  • the left border is nucleotides 566 - 589 and the right border is nucleotides 1455 - 1478.
  • Unique restriction sites in the resulting binary vector that are located within the T-DNA-like region are: ocelli at 611 4/711 at 654 -4fom at l l60 BamRl at 61 A Bsil at 1362 BspM ⁇ l at 611 Oral at 1160 EcoNI at 622 ⁇ ell at 840 Nspl at 726 Seal at 921 &pl at l420 Kspl at l085 J ⁇ II at 614
  • This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) backbone using the Sail sites that are underlined.
  • the nucleotides in italics are not part of the apple genome sequence.
  • Nucleotides 5 - 246 are nucleotides 1 - 242 of CN862631.
  • Nucleotides 247 - 644 are the reverse complement of nucleotides 28 - 425 of CN942531.
  • Nucleotides 645 - 943 are the reverse complement of nucleotides 1 - 299 of CO541348.
  • the T-DNA border-like sequences are shown in bold.
  • the left border is nucleotides 229 -
  • nucleotides 6-357 are nucleotides 2- 353 of CA921810.
  • Nucleotides 358 - 694 are nucleotides 112 - 448 of AL375389.
  • Nucleotides 695 - 1055 are the reverse complement of nucleotides 2-362 of CF069972.
  • the T-DNA border-like sequence is shown in bold.
  • the left border is nucleotides 339 - 362 and the right border is nucleotides 677 - 700.
  • Unique restriction sites in the resulting binary vector that are located within the T-DNA-like region are:
  • This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) backbone using the Sail sites that are underlined.
  • the nucleotides in italics are not part of the onion genome sequence.
  • Nucleotides 5 - 537 are nucleotides 4 - 536 of CF449263.
  • Nucleotides 538 - 1186 are nucleotides 94 - 742 of CF441521.
  • Nucleotides 1187 - 1503 are nucleotides 162 - 478 of CF452730.
  • the T-DNA border-like sequences are shown in bold.
  • the left border is nucleotides 520 -
  • This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) backbone using the Sail sites that are underlined. This requires a partial digest due to a Sail site within the T-DNA like region.
  • the nucleotides in italics are not part of the rice genome sequence.
  • Nucleotides 6 - 634 are nucleotides 1 - 629 of CR287857.
  • Nucleotides 635 - 1258 are nucleotides 156 - 779 of AK100350.
  • Nucleotides 1259 - 1740 are nucleotides 222 - 703 of CB619781.
  • the T-DNA border-like sequences are shown in bold.
  • the left border is nucleotides 616 —
  • T-DNA-like region of Pinus taeda intragenic vector This sequence can be ligated to the pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) backbone using the Sail sites that are underlined.
  • the nucleotides in italics are not part of the P. taeda genome sequence.
  • Nucleotides 1 - 333 are nucleotides 114 - 446 of BM133642.
  • Nucleotides 334 - 914 are nucleotides 81 - 661 of CF392877.
  • Nucleotides 915 - 1172 are nucleotides 138 - 395 of CX715693.
  • the T-DNA border-like sequences are shown in bold.
  • the left border is nucleotides 314 -
  • the complete vector is made up entirely of plant-derived sequences.
  • One desirable component for effective vector manipulation is a bacterial selectable marker.
  • Preferred marker sequences include plant genes that complement bacterial mutants deficient in genes essential for their growth, such as amino acid biosynthesis genes.
  • One such gene is acetohydroxyacid synthase.
  • Acetohydroxyacid synthase is an enzyme which catalyses the formation of acetolactate pyruvate, the first step in valine, leucine and isoleucine biosynthesis.
  • plants with mutant forms of AHAS can confer resistance to sulfonylurea herbicides and related compounds (Mazur and Falco, Annual Review of Plant Physiology and Plant Molecular Biology, 40: 441-470, 1989).
  • the Arabidopsis thaliana mutant AHAS gene confers resistance to the herbicide chlorsulfuron upon transformation into tobacco (Haughan et al, Molecular and General Genetics, 211: 266-271, 1988).
  • AHAS genes from Arabidopsis thaliana (Smith et ⁇ 7., Proceedings of the National Academy of Science, USA, 86: 4179-4183, 1989), Nicotiana tabacurn (Kim and Chang, Journal of Biochemistry and Molecular Biology, 28: 265-270, 1995), and Brassica napus (Wiersma et ⁇ 7., Molecular and General Genetics, 224: 155-159, 1990) have been used to complement AHAS -deficient bacteria such as Escherichia coli and Salmonella typhimurium.
  • plant-derived sequences such as AHAS known to complement bacterial deficiencies can be placed under the control of plant promoters known to be transcriptionally active in bacteria.
  • Jacob et a Transgenic Research, 11 : 291-303, 2002
  • the potato (Solanum tuberosum) AHAS gene This gene can be used in the manner described above to provide a bacterial selectable marker gene to maintain vectors in bacteria.
  • Primer R 5'CAACGGCAAACTAGACAGATAGAA3'
  • a polymerase chain reaction was then performed with high fidelity Pwo polymerase with primers Q and R to amplify a fragment using genomic DNA from potato cultivar Twa' as a template.
  • This product was A-tailed, and ligated into pGemT (Promega) following the manufacturers' instructions.
  • the cloned AHAS allele was then sequenced using primers based on the consensus sequence anchored about every 400 bp along the cloned fragment.
  • the following sequence for the coding region of a potato cultivar Twa' AHAS allele was obtained:
  • Preferred intragenic vectors of the invention comprise an origin of replication that functions in E. coli and Agrobacterium tumefaciens.
  • Plant derived bacterial origins of replication in this example are based on the smallest known prokaryotic replication origins of Colicin E plasmids (ColE plasmids), specifically ColE2-P9 (from Shigella sp.) and ColE3-CA38 (from E. coli).
  • the minimal replication origins of these plasmids, named COLE2 and COLE3 require only 1 specific factor (Rep) to be provided in trans.
  • Plasmids pBX243 and pBX343 provide Rep in trans for ColE2 and ColE3 respectively.
  • ColE2 and ColE3 origin sequences There are 2 differences between ColE2 and ColE3 origin sequences, one mismatch and a deletion of a single nucleotide in ColE2 (or an insertion in ColE3).
  • the deletion/insertion not the mismatch, is responsible for determining the plasmid specificity in the interaction of the origins with the trans-acting factors.
  • Characteristic features of these sequences are two direct repeat sequences of 7 bp (5'CAPuATAA) or of 9 bp (APyCAPuATAA) which are separated from each other by 7 bp or 5 bp in ColE2 and by 8 bp or 6 bp in ColE3.
  • ColE2 AGACCAGATAAGCCT TATCAGATAACAGCGCC (SEQ ID NO:l l)
  • ColE3 AGACCAAATAAGCCTATATCAGATAACAGCGCC (SEQ ID NO: 12)
  • Consensus ColE2 AGAgCAJATAAGCCT TA CAJATAACAGCgCC
  • Consensus ColE3 AGAg ⁇ CA
  • the ColE2 consensus sequence was used to search publicly available potato (Solanum tuberosum) DNA sequences.
  • the potato COLE2-like replication sequence POTCOLE2 was constructed in silico from two sequences, accessions: SGN U254575 nucleotides 359-721 correspondto POTCOLE21-363 TIGR EST494490 nucleotides 248-693 correspond to POTCOLE2362-807
  • the POTCOLE2 replication sequence is underlined.
  • the 807 bp POTCOLE2 sequence was synthesised by Genscript Corporation (Piscatawa, NJ, www. enscript. com) and supplied cloned into the Smal site of pUC57 (pUC57POTCOLE2).
  • Primer S 5 ' GTGTCGAC AACTACGATACGG3 ' (SEQ ID NO:14)
  • Primer T 5 'CGTAAGCTTGAACGAATTCTTAG3 ' (SEQ ID NO: 15)
  • Nucleotides underlined represent a S ⁇ TI site in primer S and represent Hmdlll and EcoRI sites in primer T.
  • a 1661 bp fragment with the spectinomycin resistance gene was PCR amplified from pART27 using high fidelity Pwo polymerase. This fragment was ligated as a Sail to H dIII region into pUC57POTCOLE2 to give pUC57POTCOLE2SPEC and position the spectinomycin resistance gene immediately adjacent to the POTCOLE2 fragment.
  • the fragment corresponding to the spectinomycin resistance gene and the POTCOLE2 was isolated as a 2.5 kb EcoRI fragment from pUC57POTCOL ⁇ 2SP ⁇ C and self-circularised to generate pPOTCOLE2SPEC.
  • the ligation was transformed into E. coli D ⁇ 5 ⁇ harbouring helper plasmid pBX243 (with an ampicillin resistance gene) and transformation selected on L plates supplemented with ampicillin and spectinomycin (100 ⁇ g/mL). Resulting colonies were picked, plasmid DNA isolated and analysed by restriction enzyme digest using BamHl and EcoRI. A i? ⁇ /r ⁇ HI/EcoRI double digest will release the Rep gene from ⁇ BX243 and will linearise pPOTCOL ⁇ 2SP ⁇ C.
  • Beta vulgaris AGGCCAAATAAGCCT/TATCAGATAACAGCGCC (SEQ ID NO:
  • Theobroma cacao AGACCAAATAAGACTTA/TCAGATAACAGCACG (SEQ ID NO: 1
  • Vitis vinifera AGATCAGATAAGCCTTTA/TCAGATAACAGCCCC (SEQ ID NO:30) CF207293 /CF515867
  • ORT Operator-Repressor Titration
  • E. coli ORT strain OHllacdapD (genotype recA endAl gyrA96 thil hsdrl 7 supE44 relAl ⁇ (dapD):;kan hipAr.lac-dapD) contains a chromosomal conditionally essential gene dapD under the control of the lac operator/promoter system. Under normal conditions, a repressor protein encoded by a second chromosomal gene binds to the chromosomal 7 ⁇ c operator and prevents transcription of dapD, and cells lyse. Growth is permitted when an inducer (IPTG) is provided i.e. on a nutrient agar plate.
  • IPTG inducer
  • growth is also permitted when a plasmid containing a 7 ⁇ c operator sequence is introduced into the cell.
  • the repressor protein binds to the plasmid-borne operator sequence, derepressing the chromosomal operator and allowing dapD expression.
  • E ⁇ cOl is 21 bp and is derived from the wild-type E. coli lac operon.
  • E ⁇ cO is 20 bp and is an 'ideal' version of Z ⁇ cOl, being a perfect palindrome of the first 10 bp of ⁇ cOl.
  • Z ⁇ cOl AATTGTGAGCGGATAACAATT (SEQIDNO:39)
  • Z ⁇ cO AATTGTGAGCGCTCACAATT (SEQ ID NO:40)
  • NCBI accession numbers that have sequences identical to at least 10 bp that comprise one of the two inverted repeats that make up Z ⁇ cO:
  • NCBI GenBank http ://www.ncbi.nlm.nih. gov/BLAST/
  • TIGR database http://tigrblast. tigr.org/tgi/
  • the 21 bp Z ⁇ cOl sequence is identical in its first 10 bp to Z ⁇ cO.
  • the following list gives accession numbers where at least the last 11 bp of the Z ⁇ cOl sequence, GGATAACAATT, are found: Dicotyledonous plants Chenopodiaceae Beta vulgaris CX779649 CF542856 Compositae Lactuca sativa BU004821 BU008839 Helianthus annuus BU671786 BQ965452 Convolvulaceae Ipomoea nil BJ567255 Cruciferae Brassica rapa CV433907 CV432343 Brassica napus CX195012 CD838296 Raphanus sativus AF051115 Cucurbitaceae Citrullus lanatus AI563425 Leguminosae Cicer arietinum CK148974 Glycine max CO036432 CX709893 Medicago trunculata BQ 144942 Phaseolus
  • Potato LacOl sequence as a recombinant plasmid selectable element
  • the 21 bp Z ⁇ cOl sequence was used to search publicly available potato (Solanum tuberosum) EST sequences. Sequences were found in NCBI accessions CV501815 and CK259105 joined in silico with Bglfl restriction enzyme recognition sites (agatct) added to termini to make 693 bp POTLACOl: agatctAATATTTACTTCTCCACTTAAACAAATACCCCAATCAGAATCACTAGCTGGCAGAT TCCTTGTCCTCTATTGACAGCAAACATAGACGTACATTATAGAGCCACCACAACATTAGACA ⁇ AACATTCTTTAAACAAGAGGTGGATACTGCTTAGACTGCAGGCACCCTCTTTCGGTACTC CAGAACATCCTGAATAAACATATGATACCCTTCAGTTTGGGCAGGATCAGCAGGGTTTGGCT GATCTAACAAGTCCTGGATACCAACCAGTATCTGTTTCACGGTG
  • Z ⁇ cOl sequence is underlined. First nucleotide of CK259105 underlined and in bold. Terminal Bgl ⁇ l restriction enzyme sites (agatct in lowercase) are not of potato sequence origin.
  • the 693 bp POTLACOl sequence was synthesised by Genscript Corporation (Piscatawa, NJ, www. enscript. com) and supplied cloned into the Smal site of pUC57 (pUC57POTLACOl).
  • POTLACOl was excised from pUC57POTLACOl with Bgl ⁇ l and ligated into pBR322 previously linearised with f ⁇ r ⁇ HI.
  • the resulting plasmid pBR322POTLACOl was transformed into E. coli strain DHllacdapD and colonies were selected using repressor titration. Plasmid DNA was isolated from selected colonies and digested with restriction enzyme Pstl (see Figure 2).
  • Linearised pBR322 is visualised as a band at 4.4 kb.
  • Pstl digested pBR322POTLACOl is visualised as two bands, one at 1.3 kb and one at 3.8 kb. The results indicate that POTLACOl functions as plasmid selectable element.
  • ALLLACO and ALLLACO 1 have also been made in silico.
  • NCBI accessions CF448121 and CF450773 were used to generate a 756 bp ALLLACO (Z ⁇ cO sequence underlined):
  • NCBI accessions CF448121 and CF449604 were used to generate a 662 bp ALLLACO1 (Z ⁇ cOl sequence underlined):
  • Z ⁇ cOl -like sequences will also function as plasmid selectable elements. For example, the following sequence was also found.
  • Example 6 Design and construction of an intragenic vector for Arabidopsis thaliana
  • the consensus T-DNA border sequence can be defined as: 5 GGCAGGATATATXXXXXTGTAAXX 3' Although other variants can include:
  • T-DNA border is remarkably similar to authentic T-DNA borders from Agrobacterium
  • the A. thaliana "T-DNA border” is from an open reading frame (nucleotides 59676-63206 from AL138652) for a putative protein of unknown function [i.e. no promoters and presumably not a heterochromatic region]. Examination of sequences flanking this "T-DNA border” reveal a 2838 bp fragment (nucleotides 59735-62572 from AL138652) with several unique restriction sites suitable as potential insertion sites for other genes and Southern analysis of plants transformed using this vector.
  • T-DNA border found at nucleotides 60629-60606 is considered the "left border” of a binary vector there are several unique restriction sites, including Xbal, between this left border and the first three nucleotides equivalent to a right border at positions 59735-59737.
  • the right border beyond these three nucleotides can be provided by authentic right border sequences of non-plant origin, thereby resulting in a "chimeric right border'.
  • Primer A 5'CCGAGGAGGTGCTAGAGC7C7 ⁇ G4GCGTAAAGGAATGTCC3' (SEQ ID NO:
  • Primer B 5'AAAGGCZCG ⁇ GGTTTACCCGCCAATATATCCTGTCTATGTTTC ACATGAACACGTGAATCTTC3' (SEQ ID NO:51)
  • Primer C 5 ⁇ AAGGGZCG.4CTAGATCTTTCGGTTGTGTGAATGATTCCGATGA GAGAAGAAGAC3' (SEQ ID NO:52)
  • Primer D 5'GK3ACATTCCTTTACGC7TC2 ⁇ 5 ⁇ GCTCTAGCACCTCCTCGG3' (SEQ ID NO: 1
  • the 2864 bp Sail to Xhol fragment of pPROEX-AtTD was ligated to the 8004 bp S ⁇ /I backbone of the binary vector pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203- 1207) to form pTCl.
  • the orientation of the two fragments was determined by restriction patterns and confirmed by DNA sequencing.
  • the full sequence of pTCl is shown below and comprises a 2838 bp DNA fragment derived from Arabidopsis thaliana (nucleotides 59735- 62572 from AL138652) presented in italics.
  • the right and left T-DNA borders are in bold and the unique Xbal site used for subsequent cloning is in bold and underlined.
  • CTTGGTGTAT CCAACGGCGT CAGCCGGGCA GGATAGGTGA AGTAGGCCCA CCCGCGAGCG 181 GGTGTTCCTT CTTCACTGTC CCTTATTCGC ACCTGGCGGT GCTCAACGGG AATCCTGCTC
  • SEQ ID NO:54 A mutant form of the Arabidopsis thaliana acetohydroxyacid synthase gene conferring resistance to sulfonylurea herbicides such as chlorsulfuron was inserted into the T-DNA of pTCl.
  • the 5.8 kb Xbal fragment from pGHl (Haughn et al. 1988, Molecular and General Genetics 211 :266-271) was ligated into the unique Xbal site between the left and right T- DNA borders of pTCl to produce pTCAHAS. The orientation of the two fragments was determined by restriction patterns and confirmed by DNA sequencing.
  • the pTCAHAS binary vector was transformed into the disarmed Agrobacterium tumefaciens strain EHA105 (Hood et al 1993, Transgenic Research, 2:208-218), using the freeze-thaw method (Hofgen & Willmitzer 1988, Nucleic Acids Research, 16: 9877).
  • Agrobacterium was cultured overnight in LB broth supplemented with 300 mg/L spectinomycin and used to transform Arabidopsis thaliana 'Columbia' using the floral dip method (Clough and Bent, Plant Journal 16: 735-743, 1998).
  • the resulting self pollinated seed was screened in vitro on half-strength MS salts (Murashige and Skoog 1962, Physiologia Plantarum, 15: 473-497) supplemented with 10 ⁇ g/L chlorsulfuron. Seeds were also sown on a standard potting mix in a greenhouse and the germinated seedlings at the 3-4 true leaf stage were sprayed with a standard application of Glean (active ingredient chlorsulfuron) at a rate equivalent to 20 g/ha.
  • Glean active ingredient chlorsulfuron
  • Genomic DNA from the recovered chlorsulfuron-resistant seedlings were confirmed as being transformed with the intragenic vector pTCAHAS by polymerase chain reactions across the junctions of the two Xbal sites adjoining the original T-DNA of pTCl and the inserted 5.8 kb Xbal fragment to form pTCAHAS.
  • the following primers were used:
  • Primer E 5'CATCCACTGCATAGTTCCC3' (SEQ ID NO:55)
  • Primer F 5'GATGCGTTGATCTCTTCATCA3' (SEQ ID NO:56)
  • Primer G 5'TCAACATCAATCCGAGTACG3' (SEQ ID NO:57)
  • Primer H 5 'AGAGATTGTGGACCGAGGAG3 ' (SEQ ID NO:58)
  • the expected 643 bp DNA fragment was PCR amplified from the binary vector pTCAHAS and three A. thaliana lines transformed with pTCAHAS using primers E+F designed to flank the Xbal site inside the right T-DNA border.
  • the expected 149 bp DNA fragment was PCR amplified from the same DNA sources using primers G+H designed to flank the Xbal site inside the left T-DNA border.
  • Example 2 The 1268 bp sequence illustrated in Example 2 as a T-DNA-like region of a potato (Solanum tuberosum) intragenic vector was synthesised by Genscript Corporation (Piscatawa, NJ, www.genscript.com) and supplied cloned into pUC57 (pUC57POTINV).
  • the Sail fragment encompassing the T-DNA composed of potato DNA from pUC57POTINV was isolated by restriction, then ligated to the 8004 bp Sail backbone of the binary vector ⁇ ART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) to form the binary vector pPOTINV.
  • the orientation of the two fragments was determined by PCR analysis across the junctions of the two Sail sites and DNA sequencing.
  • the pPOTINV binary vector was transformed into the Agrobacterium strain A4T, also known as C58C1 (pArA4b) (Petit et al 1983, Molecular and General Genetics, 190:204-214), using the freeze-thaw method (Hofgen & Willmitzer 1988, Nucleic Acids Research, 16: 9877).
  • the Agrobacterium was cultured overnight in LB broth supplemented with 300 mg/L spectinomycin for co-cultivation with leaves from in vitro cultured potato plants.
  • Virus-free potato plants of cultivar Iwa were multiplied in vitro on MS salts and vitamins (Murashige and Skoog, 1962, Physiologia Plantarum, 15: 473-497), plus 30g l "1 sucrose, 40 mg l “1 ascorbic acid, 500 mg l "1 casein hydrolysate and 7 g l "1 agar, adjusted to pH 5.8 with 0.1 M KOH. Plants were routinely subcultured as 2-3 node segments every three to four weeks and incubated at 26 °C under cool white fluorescent lamps (80-100 ⁇ mol m "2 sec "1 ; 16 h photoperiod).
  • Leaves were excised from the in vitro plants, cut in half, dipped for about 30 sec in the liquid culture of Agrobacterium strain A4T harbouring pPOTINV, then blotted dry on sterile filter paper. These leaf segments were then cultured on potato medium defined above and incubated under reduced light intensity (5-10 ⁇ mol m "2 sec "1 ). Two days later, the leaf segments were transferred to the same medium supplemented with 200 mg l "1 Timentin to prevent Agrobacterium overgrowth.
  • Hairy roots were selected on MS medium without growth regulators. Genomic DNA isolated from these hairy roots was screened via PCR to identify those derived from co-transformation with pArA4b and pPOTINV. The following primers were used:
  • Primer I 5'GCTCACCTTGCAGCTTCACT3' (SEQ ID NO:59)
  • Primer J 5'CAGAGCTGGATTTGCATCAG3' (SEQ ID NO:60) to amplify an expected 570 bp DNA fragment from the T-DNA-like region of pPOTINV
  • Primer K 5'GATGGCAGAAGGCGAAGATA3' (SEQ ID NO:61)
  • Primer L 5'GAGCTGGTCTTTGAAGTCTCG3' (SEQ ID NO:62) as an internal control to amplify an expected 1069 bp fragment from the endogenous potato actin gene.
  • the expected 1069 bp fragment was amplified using primers K and L from all hairy root lines, including control hairy root line transformed with Agrobacterium strain A4T without the binary vector pPOTINV.
  • the expected 570 bp DNA fragment was PCR amplified from the binary vector pPOTINV and from two of 80 hairy root lines tested using primers I and J ( Figure 4).
  • Primer N 5'GCGTCAAAGAAATA3' (SEQ ID NO:64)
  • a binary vector with a T-DNA composed of petunia DNA The 1507 bp sequence illustrated in Example 2 as a T-DNA-like region of a petunia (Petunia hybrida) intragenic vector was synthesised by Genscript Corporation (Piscatawa, NJ, www. enscript. com) and supplied cloned into pUC57 (pUC57PETINV).
  • the Sail fragment encompassing the T-DNA composed of petunia DNA from pUC57PETINV was isolated by restriction, then ligated to the 8004 bp Sa l backbone of the binary vector pART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) to form the binary vector pPETINV.
  • the orientation of the two fragments was determined by PCR analysis across the junctions of the two Sail sites and DNA sequencing.
  • the pPETINV binary vector was transformed into the Agrobacterium strain A4T, also known as C58C1 (pArA4b) (Petit et al 1983, Molecular and General Genetics, 190:204-214), using the freeze-thaw method (Hofgen & Willmitzer 1988, Nucleic Acids Research, 16: 9877).
  • the Agrobacterium was cultured overnight in LB broth supplemented with 300 mg/L spectinomycin for co-cultivation with leaves from in vitro cultured potato plants.
  • Virus-free potato plants of cultivar Iwa were multiplied in vitr-o on MS salts and vitamins (Murashige arid Skoog, 1962, Physiologia Plantarum, 15: 473-497), plus 30g l "1 sucrose, 40 mg l “1 ascorbic acid, 500 mg l "1 casein hydrolysate and 7 g l "1 agar, adjusted to pH 5.8 with 0.1 M KOH. Plants were routinely subcultured as 2-3 node segments every three to four weeks and incubated at 26 °C under cool white fluorescent lamps (80-100 ⁇ mol m "2 sec "1 ; 16 h photoperiod).
  • Leaves were excised from the in vitro plants, cut in half, dipped for about 30 sec in the liquid culture of Agrobacterium strain A4T harbouring pPETINV, then blotted dry on sterile filter paper. These leaf segments were then cultured on potato medium defined above and incubated under reduced light intensity (5-10 ⁇ mol m "2 sec "1 ). Two days later, the leaf segments were transferred to the same medium supplemented with 200 mg l "1 Timentin to prevent Agrobacterium overgrowth.
  • Hairy roots were selected on MS medium without growth regulators. Genomic DNA isolated from these hairy roots was screened via PCR to identify those derived from co-transformation with pArA4b and pPETINV. The following primers were used:
  • Primer O 5'GAGATAAACAAATAGTCCGGATCG3' (SEQ ID NO:65)
  • Primer P 5OGGAGCATTTGGTGGAAATAG3' (SEQ ID NO:66) to amplify an expected 447 bp DNA fragment from the T-DNA-like region of pPETINV.
  • the same DNA samples were also used in a PCR using primers K and L designed to amplify an expected 1069 bp fragment from the endogenous potato actin gene as an internal control.
  • the expected 1069 bp fragment was amplified using primers K and L from all hairy root lines, including control hairy root line transformed with Agrobacterium strain A4T without the binary vector pPETINV.
  • the expected 447 bp DNA fragment from the T-DNA-like region of pPETINV was PCR amplified from the binary vector pPETINV and from one of 85 hairy root lines tested using primers O and P ( Figure 6).
  • the DNA sample from the hairy root line positive for the T-DNA from pPETINV failed to amplify a PCR product using primers M and N designed for the Agrobacterium virQ gene ( Figure 7).
  • a culture of this hairy root line failed to grow bacteria when incubated in LB medium.
  • Example 2 The 1075 bp sequence illustrated in Example 2 as a T-DNA-like region of an onion (Allium cepa) intragenic vector was synthesised by Genscript Corporation (Piscatawa, NJ, www. genscript. com) and supplied cloned into pUC57 (pUC57ALLINV).
  • the Sail fragment encompassing the T-DNA composed of onion DNA from pUC57ALLINV was isolated by restriction, then ligated to the 8004 bp Sail backbone of the binary vector ⁇ ART27 (Gleave 1992, Plant Molecular Biology, 20: 1203-1207) to form the binary vector pALLINV.
  • the orientation of the two fragments was determined by PCR analysis across the junctions of the two Sail sites and DNA sequencing.
  • BLAST searches were conducted of publicly available plant DNA sequences from NCBI, SGN and TIGR databases.
  • a fragment containing a loxV-like sequence was designed from two EST sequences from potato ⁇ Solanum tuberosum) (NCBI accessions BQl 11407 and BQ045786). This fragment, named POTLOXP, is illustrated below. Restriction enzyme sites used for DNA cloning into the potato intragenic T-DNA described in Example 8 are shown in bold and the loxP-like sequence shown in bold and light grey.
  • Nucleotides 4-402 nucleotides 17-415 of NCBI accession BQl 11407
  • Nucleotides 403-653 nucleotides 298-548 of NCBI accession BQ045786 Nucleotides 654-655 part of EcoRV restriction enzyme site (from the potato intragenic T-DNA)
  • the designed potato /oxP-like sequence has 6 nucleotide mismatches from the native loxV sequence as illustrated in bold below.
  • loxP sequence ATAACTTCGTATAGCATACATTATACGAAGTTAT SEQ ID NO:68
  • the 655 bp POTLOXP sequence illustrated above was synthesised by Genscript Corporation (Piscatawa, NJ, www. enscript. com) and supplied cloned into pUC57. All plasmid constructions were performed using standard molecular biology techniques of plasmid isolation, restriction, ligation and transformation into Escherichia coli strain DH5 ⁇
  • the DNA sequence of the 2316 bp Sail fragment comprising the potato derived T-DNA region in pPOTLOXP2 is illustrated below. Only the nucleotides in italics are not part of potato genome sequences. The POTLOXP regions are shaded. The T-DNA borders are shown in bold, with the left border positioned at 314-337 and the right border positioned at 2005-2028. Restriction sites illustrated in bold represent those used in cloning the POTLOXP regions into pGEMTPOTINV. Unique restriction sites in pPOTLOXP2 for cloning between POTLOXP sites are:
  • Plasmid was isolated from colonies of E. coli strain 294-Cre transformed with pPOTLOXP2 and cultured at 37 °C, then DNA sequenced across the Sail region inserted into pGEMT. The resulting sequence from two independent cultures is illustrated below and confirms that recombination is base pair faithful through the remaining POTLOXP site in plasmid preparations. Only the nucleotides in italics are not part of the potato genome sequences. The remaining POTLOXP region is shaded. The T-DNA borders are shown in bold, with the left border positioned at 314-337 and the right border positioned at 1169-1192. Restriction sites illustrated in bold represent those remaining from cloning the POTLOXP regions into pPOTINV.
  • Medicago trunculata (barrel medic) foxP-like sequence designed from 2 ESTs
  • the barrel medic loxP-like site has 4 nucleotide mismatches from the native loxV sequence (illustrated above in bold). Picea (spruce) / ⁇ P-like sequence designed from 2 ESTs
  • the spruce loxP-like site has 4 nucleotide mismatches from the native loxP sequence (illustrated above in bold)
  • the maize /oxP-like site has 6 nucleotide mismatches from the native loxP sequence (illustrated above in bold)
  • BLAST searches were conducted of publicly available plant DNA sequences from NCBI, SGN and TIGR databases.
  • a fragment containing a frt-like sequence was designed from two EST sequences from potato (Solanum tuberosum) (NCBI accessions BQ513657 and BG098563). This fragment, named POTFRT, is illustrated below. Restriction enzyme sites used for DNA cloning into the potato intragenic T-DNA described in Example 8 are shown in bold and the ⁇ t-like sequence shown in bold and light grey.
  • the designed potato frt-like sequence has 5 nucleotide mismatches from the native frt sequence as illustrated in bold below.
  • the 185 bp POTFRT sequence illustrated above was synthesised by Genscript Corporation (Piscatawa, NJ, www. genscript. com) and supplied cloned into pUC57. All plasmid constructions were performed using standard molecular biology techniques of plasmid isolation, restriction, ligation and transformation into Escherichia coli strain DH5 ⁇ (Sambrook et al, Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987).
  • POTFRT was cloned into the T-DNA composed of potato DNA residing in the plasmid pGEMTPOTINV (described in Example 9) twice, firstly as a EcoRI to Avrll fragment, then subsequently as a Bfrl to BamEl fragment. Confirmation of the POTFRT inserts was verified using restriction enzyme analysis and DNA sequencing. The resulting plasmid was named pPOTFRT2.
  • the DNA sequence of the 1432 bp Sail fragment comprising the potato derived T-DNA region in the resulting pPOTFRT2 is illustrated below. Only the nucleotides in italics are not part of potato genome sequences. The POTFRT regions are shaded. The T-DNA borders are shown in bold, with the left border positioned at 314-337 and the right border positioned at
  • Restriction sites illustrated in bold represent those used to clone the POTFRT regions into pGEMTPOTINV.
  • POTFRT sites are:

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
EP05757541A 2004-06-08 2005-06-08 Transformationsvektoren Ceased EP1766029A4 (de)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
NZ533371A NZ533371A (en) 2004-06-08 2004-06-08 Vectors for plant transformation contaning mostly or exclusively genetic material from plants useful with Agrobacterium transformation system
NZ53337204 2004-06-08
NZ53833105 2005-02-18
NZ53833005 2005-02-18
PCT/NZ2005/000117 WO2005121346A1 (en) 2004-06-08 2005-06-08 Transformation vectors

Publications (2)

Publication Number Publication Date
EP1766029A1 true EP1766029A1 (de) 2007-03-28
EP1766029A4 EP1766029A4 (de) 2008-07-23

Family

ID=35503070

Family Applications (1)

Application Number Title Priority Date Filing Date
EP05757541A Ceased EP1766029A4 (de) 2004-06-08 2005-06-08 Transformationsvektoren

Country Status (3)

Country Link
EP (1) EP1766029A4 (de)
AU (2) AU2005252598B8 (de)
WO (1) WO2005121346A1 (de)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8137961B2 (en) 2004-09-08 2012-03-20 J.R. Simplot Company Plant-specific genetic elements and transfer cassettes for plant transformation
US20120137389A1 (en) * 2004-09-08 2012-05-31 J.R. Simplot Company Plant-specific genetic elements and transfer cassettes for plant transformation
US20070250948A1 (en) * 2006-03-07 2007-10-25 J.R. Simplot Company Plant-specific genetic-elements and transfer cassettes for plant transformation
AU2007275313B2 (en) 2006-07-19 2012-08-16 Monsanto Technology Llc Use of multiple transformation enhancer sequences to improve plant transformation efficiency
EP2387613A4 (de) * 2009-01-15 2012-06-06 Nz Inst Plant & Food Res Ltd Pflanzentransformation mithilfe von dna-minicircles
AU2018253628B2 (en) * 2016-04-27 2019-07-25 Nexgen Plants Pty Ltd Construct and vector for intragenic plant transformation
EP3448994A4 (de) * 2016-04-27 2019-05-29 Nexgen Plants Pty Ltd Konstrukt und vektor zur intragenen pflanzentransformation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040107455A1 (en) * 2002-02-20 2004-06-03 J.R. Simplot Company Precise breeding

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001059086A2 (en) * 2000-02-08 2001-08-16 Sakata Seed Corporation Methods and constructs for agrobacterium-mediated plant transformation
US7303909B2 (en) * 2000-06-28 2007-12-04 Sungene Gmbh & Co. Kgaa Binary vectors for the improved transformation of plants systems
WO2002081711A1 (en) * 2001-04-06 2002-10-17 Cropdesign N.V. The use of double and opposite recombination sites for the single step cloning of two dna segments
WO2003069980A2 (en) * 2002-02-20 2003-08-28 J.R. Simplot Company Precise breeding

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040107455A1 (en) * 2002-02-20 2004-06-03 J.R. Simplot Company Precise breeding

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
RAJASEKARAN KANNIAH ET AL: "Herbicide-resistant Acala and Coker cottons transformed with a native gene encoding mutant forms of acetohydroxyacid synthase" MOLECULAR BREEDING, vol. 2, no. 4, 1996, pages 307-319, XP009094663 ISSN: 1380-3743 *
RATHINASABAPATHI B ET AL: "METABOLIC ENGINEERING OF GLYCINE BETAINE SYNTHESIS: PLANT BETAINE ALDEHYDE DEHYDROGENASES LACKING TYPICAL TRANSIT PEPTIDES ARE ARGETED TO TOBACCO CHLOROPLASTS WHERE THEY CONFER BETAINE ALDEHYDE RESISTANCE" PLANTA, SPRINGER VERLAG, DE, vol. 193, 1994, pages 155-162, XP002034434 ISSN: 0032-0935 *
See also references of WO2005121346A1 *

Also Published As

Publication number Publication date
AU2005252598B2 (en) 2010-10-28
AU2010257316B2 (en) 2013-03-21
EP1766029A4 (de) 2008-07-23
AU2010257316A1 (en) 2011-01-27
AU2005252598B8 (en) 2011-05-12
AU2005252598A1 (en) 2005-12-22
WO2005121346A1 (en) 2005-12-22

Similar Documents

Publication Publication Date Title
US20020178463A1 (en) Method for transforming monocotyledons
AU2005252598B2 (en) Transformation vectors
WO2001006844A1 (fr) Procede de transformation ultrarapide de monocotyledon
CN109722439B (zh) 烟草mlo2、mlo6和mlo12基因在制备抗白粉菌烟草品种中的应用及其方法
JP2023156474A (ja) 遺伝子改変された植物体の再生
WO2018220929A1 (ja) 植物細胞でのタンパク質発現システム及びその使用
AU2010211450B2 (en) Plant transformation using DNA minicircles
BR112020002321A2 (pt) novas estirpes de agrobacterium tumefaciens reivindicação de prioridade
US11649465B2 (en) Methods and compositions for increasing expression of genes of interest in a plant by co-expression with p21
NZ579038A (en) Vectors for transformation
NZ533371A (en) Vectors for plant transformation contaning mostly or exclusively genetic material from plants useful with Agrobacterium transformation system
US20100257632A1 (en) Methods for generating marker-free transgenic plants
JP4543161B2 (ja) タバコのレトロトランスポゾンを利用した遺伝子破壊法
JP3605633B2 (ja) 新規植物遺伝子、該遺伝子を利用した植物改変方法および該方法により得られる植物体
WO2023212556A2 (en) Compositions and methods for somatic embryogenesis in dicot plants
NZ585926A (en) Methods for generating marker free transgenic plants using Agrobacterium strains and virE2 protein
CN113490747A (zh) 用于提高基因组工程化效率的方法
NZ574191A (en) Plant transformation using DNA minicircles
MXPA06002799A (en) Methods and compositions for enhanced plant cell transformation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20070105

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR

RIN1 Information on inventor provided before grant (corrected)

Inventor name: CONNER, ANTHONY, JOHN

Inventor name: BALDWIN, SAMANTHA, JANE

Inventor name: LOKERSE, ANNEMARIE, SUZANNE

Inventor name: JACOBS, JOHANNA, MARIA, ELISABETH

Inventor name: BARRELL, PHILIPPA, JANE

Inventor name: NAP, JAN-PETER, HENDRIK

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20080619

RIC1 Information provided on ipc code assigned before grant

Ipc: A01H 5/00 20060101ALI20080613BHEP

Ipc: C12N 15/82 20060101AFI20060109BHEP

17Q First examination report despatched

Effective date: 20090914

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: THE NEW ZEALAND INSTITUTE FOR PLANT AND FOOD RESEA

REG Reference to a national code

Ref country code: DE

Ref legal event code: R003

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20110404