EP1623012A2 - Antisense-antivirusmittel und verfahren zur behandlung einer ssrna-virusinfektion - Google Patents

Antisense-antivirusmittel und verfahren zur behandlung einer ssrna-virusinfektion

Info

Publication number
EP1623012A2
EP1623012A2 EP04775901A EP04775901A EP1623012A2 EP 1623012 A2 EP1623012 A2 EP 1623012A2 EP 04775901 A EP04775901 A EP 04775901A EP 04775901 A EP04775901 A EP 04775901A EP 1623012 A2 EP1623012 A2 EP 1623012A2
Authority
EP
European Patent Office
Prior art keywords
oligomer
virus
sequence
antisense
viral
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04775901A
Other languages
English (en)
French (fr)
Other versions
EP1623012A4 (de
Inventor
David A. Stein
Douglas E. Skilling
Patrick L. Iversen
Alvin W. Smith
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sarepta Therapeutics Inc
Original Assignee
AVI Biopharma Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by AVI Biopharma Inc filed Critical AVI Biopharma Inc
Publication of EP1623012A2 publication Critical patent/EP1623012A2/de
Publication of EP1623012A4 publication Critical patent/EP1623012A4/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/314Phosphoramidates
    • C12N2310/3145Phosphoramidates with the nitrogen in 3' or 5'-position
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/323Chemical structure of the sugar modified ring structure
    • C12N2310/3233Morpholino-type ring
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/20011Coronaviridae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/24011Flaviviridae
    • C12N2770/24111Flavivirus, e.g. yellow fever virus, dengue, JEV
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This invention relates to antisense oligomers for use in treating a picornavirus, calicivirus, togavirus, coronavirus, or flavivirus infection, antiviral treatment methods employing the oligomers, and methods for monitoring binding of antisense oligomers to a viral genome target site.
  • the virus is an RNA virus from the coronavirus family or a West Nile, Yellow Fever or Dengue virus from the flavivirus family.
  • RNA viruses cause many diseases in wildlife, domestic animals and humans. These viruses are genetically and antigenically diverse, exhibiting broad tissue tropisms and a wide pathogenic potential. The incubation periods of some of the most pathogenic viruses, e.g. the caliciviruses, are very short. Viral replication and expression of virulence factors may overwhelm early defense mechanisms (Xu, 1991) and cause acute and severe symptoms. There are no specific treatment regimes for many viral infections. The infection may be serotype specific and natural immunity is often brief or absent (Murray et al, 1998). Immunization against these virulent viruses is impractical because of the diverse serotypes.
  • RNA virus replicative processes lack effective genetic repair mechanisms, and current estimates of RNA virus replicative error rates are such that each genomic replication can be expected to produce one to ten errors, thus generating a high number of variants (Hollan, 1993).
  • the serotypes show no cross protection, such that infection with any one serotype does not protect against infection with another.
  • vaccines against the vesivirus genus of the caliciviruses would have to provide protection against over 40 different neutralizing serotypes (Smith et al, 1998a), and vaccines for the other genera of the Caliciviridae are expected to have the same limitations.
  • Antisense agents have been proposed for treating various types of viral infection.
  • the specific proposals to date can be classified according to the type of virus targeted, the viral-genome target, and the type of oligonucleotide backbone employed in the antisense compound.
  • viruses that have been targeted are vesicular stomatitis virus (Robbins and Lebleu, 1999), influenza virus (Mizuta et al, 1999), hepatitis B virus (Wu and Wu, 1992), human papilloma virus (Alvarez- S alas et al, 1999), herpes simplex virus (Aurelian and Smith, 2000), HIV (Kusunoki et al, Wei et al, 2000) and foot-and-mouth disease virus (Gutierrez et al, 1993).
  • Viral genome targets that have been proposed include the IE-2 gene of cytomegalovirus (Green et al, 2000), a stem-loop structure at the 5' non-coding region, the translation initiation codon, a core protein coding sequence of the hepatitis C virus, and the second functional initiator AUG of the foot-and-mouth disease virus (Hanecak et al, 1996; Alt et al, 1995; Gutierrez et al, 1993).
  • antisense backbone structures including the negatively charged phosphorothioate (PSO) backbone oligomers, particularly the phosphorothioate oligodeoxynucleotides (Hanecak et al, 1996; Alt et al, 1995; Gutierrez et al, 1993) and uniformly modified 2'-methoxyethoxy phosphodiester oligonucleotide (Hanecak et al, 1996).
  • PSO phosphorothioate
  • Discovery and development generally involves demonstration of antiviral activity in cell culture. A compilation of antiviral experiments in cell culture is provided in Table 1 below. ' TABLE 1. In vitro -Antiviral Antisense Studies
  • an antisense agent must be substantially stable against nuclease degradation, able to be taken up readily by virus-infected host cells following compound administration, and targeted against an effective region of the viral genome, that is, able to shut down viral replication.
  • the invention provides an antiviral compound directed against an R ⁇ A virus from the picornavirus, calicivirus, togavirus, coronavirus, or flavivirus families having a single-stranded, positive sense genome of less than 12 kb and a first open reading frame that encodes a polyprotein containing multiple functional proteins.
  • the virus is an R ⁇ A virus from the coronavirus family or a West Nile, Yellow Fever or Dengue virus from the flavivirus family.
  • the antiviral compound comprises a substantially uncharged oligomer having (a) a sequence of 12 to 40 subunits, supporting a targeting base sequence that is substantially complementary to a viral target sequence which spans the translation initiation region of said first open reading frame, and (b) a substantially uncharged backbone.
  • the oligomer is a morpholino oligomer, having a sequence or morpholino subunits.
  • the subunits are generally connected by uncharged, morpholino nitrogen of one subunit to the 5' exocyclic carbon of an adjacent subunit.
  • these linkages are phosphorodiamidate linkages.
  • a morpholino subunit and phosphorodiamidate linkage may be represented by the structure:
  • Y ⁇ O, Z O
  • Pj is a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding,, to a base in a polynucleotide (where base-pairing moieties on different subunits may be the same or different)
  • X is alkyl, alkoxy, thioalkoxy, or alkyl amino.
  • X NR 2 , where each R is independently hydrogen or methyl.
  • the substantially uncharged oligomer will typically have a T m , with respect to binding to the viral target sequence, of greater than about 50 °C, as well as an ability to be actively taken up by mammalian cells, hi addition, the compound can generally be recovered, in a heteroduplex form consisting of the oligomer and a complementary portion of the viral genome of the RNA virus, from the serum or urine of a mammalian subject, several hours after being administered to the subject.
  • the antiviral compounds are directed against specific viruses or families.
  • selected embodiments include antiviral compounds directed against a picornavirus.
  • Exemplary compounds include those having a targeting sequence having at least 90% homology to a sequence selected from the group consisting of:
  • SEQ ID NO. 17 for a hepatitis A virus
  • SEQ ID NO. 18 for a rhinovirus 14
  • SEQ ID NO. 19 for a rhinovirus 16
  • SEQ ID NO. 20 for a rhinovirus IB
  • SEQ ID NOs. 21 and 22 for an Aphthovirus
  • SEQ ID NOs. 21 and 22, for an Aphthovirus for an Aphthovirus
  • SEQ ID NOs 23, 24 and 25, for a coxsackie virus are SEQ ID NOs 23, 24 and 25, for a coxsackie virus.
  • Other embodiments include antiviral compounds directed against a calicivirus.
  • Exemplary compounds include those having a targeting sequence having at least 90% homology to a sequence selected from the group consisting of:
  • SEQ ID NO. 32 for a feline vesivirus.
  • Other embodiments include antiviral compounds directed against a flavivirus.
  • Exemplary compounds include those having a targeting sequence having at least 90% homology to a sequence selected from the group consisting of:
  • SEQ ID NO. 39 for a Dengue virus.
  • Other embodiments include antiviral compounds directed against a coronavirus .
  • Exemplary compounds include those having a targeting sequence having at least 90% homology to a sequence selected from the group consisting of: (i) SEQ ID NOs. 40 for murine hepatitis virus,
  • SEQ ID NO. 41 for SARS virus.
  • Other embodiments include antiviral compounds directed against a togavirus.
  • the compound comprises an oligomer having a targeting sequence having at least 90% homology to a sequence selected from the group consisting of SEQ ID NOs: 33 and 34.
  • Still other embodiments include antiviral compounds directed against a togavirus.
  • the virus is an RNA virus from the coronavirus family or a
  • the targeting sequence has at least 90% homology to a sequence selected from the group consisting of SEQ ID NO. 37 for a West Nile virus, SEQ ID NO. 38 for a yellow Fever virus, SEQ ID NO.
  • the compounds have the exact targeting sequences shown, and/or comprise phosphorodiamidate-linked morpholino oligomers.
  • the invention provides a method of inhibiting replication of an RNA virus from the picornavirus, calicivirus, togavirus, coronavirus, or flavivirus families, having a single-stranded, positive sense genome of less than 12 kb, and a first open reading frame that encodes a polyprotein containing multiple functional proteins.
  • the virus is an RNA virus from the coronavirus family or a West Nile, Yellow Fever or Dengue virus from the flavivirus family.
  • the method comprises exposing the virus, or, typically, a cell infected with the virus, to a substantially uncharged morpholino oligomer having (a) a sequence of 12 to 40 subunits, supporting a targeting base sequence that is substantially complementary to a viral target sequence which spans the translation initiation region of the first open reading frame, and (b) a substantially uncharged backbone.
  • the oligomer is administered to a mammalian subject infected with the virus.
  • Preferred embodiments of the antisense compounds, with respect to properties and structure, are as described above.
  • the invention provides a method of confirming the presence of an effective interaction between a picornavirus, calicivirus, togavirus, coronavirus, or flavivirus infecting a mammalian subject, and a substantially uncharged antisense oligomer targeted against the infecting virus.
  • the virus is an RNA virus from the coronavirus family or a West Nile, Yellow Fever or Dengue virus from the flavivirus family.
  • the method comprises: (a) administering the oligomer to the subject, (b) at a selected time after said administration, obtaining a sample of a body fluid from the subject; and (c) assaying the sample for the presence of a nuclease-resistant heteroduplex comprising the antisense oligomer and a complementary portion of the viral target sequence.
  • the oligomer has a sequence of 12 to 40 subunits, supporting a targeting base sequence that is substantially complementary to a viral target sequence which spans the translation initiation region of the first open reading frame (ORF1) of the infecting virus.
  • the oligomer is a morpholino oligomer, and has uncharged, phosphorus-containing intersubunit linkages, one to three atoms long, joining the morpholino nitrogen of one subunit to the 5' exocyclic carbon of an adjacent subunit.
  • the linkages are phosphorodiamidate linkages. This method can be used in determining the effectiveness of treating a picornavirus, calicivirus, togavirus, coronavirus, or flavivirus infection by administering the oligomer, by carrying out the described steps of administering, obtaining a sample, and assaying for heteroduplex at periodic intervals throughout a treatment period.
  • the virus is an RNA virus from the coronavirus family or a West Nile, Yellow Fever or Dengue virus from the flavivirus family.
  • the method can be used in determining the identity of an infecting picornavirus, calicivirus, togavirus, coronavirus, or flavivirus.
  • the virus is an RNA virus from the coronavirus family or a West Nile, Yellow Fever or Dengue virus from the flavivirus family.
  • the family or genus of such a virus can be determined by: (a) providing a plurality of antisense oligomers, each having a base sequence that is substantially complementary to a viral target sequence of a plurality of known viruses selected from picornaviruses, caliciviruses, togaviruses, coronaviruses, or flaviviruses, wherein each said viral target sequence is (i) common to a virus family or genus, and (ii) not found in humans; (b) administering at least one oligomer of the plurality to the subject, (c) at a selected time after said administering, obtaining a sample of a body fluid from the subject; (d) assaying the sample for the presence of a nuclease-resistant heteroduplex comprising the antisense oligomer and a complementary portion of the viral target sequence, and (e) identifying the family or genus of the infecting virus, based on the presence or absence of a heteroduplex comprising an administered
  • the plurality of antisense oligomers of step (a) each has a base sequence that is substantially complementary to a viral target sequence of a plurality of known viruses selected from coronaviruses and flaviviruses, wherein each said viral target sequence is (i) common to a virus family or genus, and (ii) not found in humans.
  • the following further steps can be carried out: (a) providing a second plurality of antisense oligomers, each having a base sequence that is substantially complementary to a viral target sequence of one of a plurality of known viruses from the family or genus identified in step (e) above, wherein each said viral target sequence is (i) specific to one of said known viruses, and (ii) not found in humans; (b) administering at least one oligomer of the plurality to the subject, (c) at a selected time after said administering, obtaining a sample of a body fluid from the subject; (d) assaying the sample for the presence of a nuclease-resistant heteroduplex comprising the antisense oligomer and a complementary portion of the viral target sequence, and (e) identifying the infecting virus, based on the presence or absence of a heteroduplex comprising an administered antisense
  • the specific infecting virus is an RNA virus from the coronavirus family or a West Nile, Yellow Fever or Dengue virus from the flavivirus family
  • the second plurality of antisense oligomers of step (a) each has a base sequence that is substantially complementary to a viral target sequence of a plurality of known viruses selected from coronaviruses and flaviviruses, wherein each said viral target sequence is (i) common to a virus family or genus, and (ii) not found in humans.
  • FIGS. 1 A-1E show several preferred morpholino-type subunits having 5-atom (A), six-atom (B) and seven-atom (C-E) linking groups suitable for forming polymers;
  • Figs. 2A-E show the repeating subunit segment of exemplary morpholino oligonucleotides, designated A through E, constructed using subunits A-E, respectively, of Figure 1;
  • Figs. 3A-3D are schematic diagrams of genomes of exemplary viruses and viral target sites;
  • Figs. 4A-4H show examples of uncharged linkage types in oligonucleotide analogs;
  • FIG. 5 shows percent inhibition of human rhinovirus in vitro in the presence of an antisense oligomer of the invention, having three base mismatches with the viral sequence, as described in Example 1; and Fig. 6 shows dose response data for an antisense oligomer of the invention in treating
  • HCN infection in mice as described in Example 4; doses are given in mg/mouse/day.
  • ORF open reading frame
  • polynucleotide refers to a polymeric molecule having a backbone which supports bases capable of hydrogen bonding to typical polynucleotides, where the polymer backbone presents the bases in a manner to permit such hydrogen bonding in a sequence specific fashion between the polymeric molecule and a typical polynucleotide (e.g., single- stranded R ⁇ A, double-stranded R ⁇ A, single-stranded D ⁇ A or double-stranded D ⁇ A).
  • a typical polynucleotide e.g., single- stranded R ⁇ A, double-stranded R ⁇ A, single-stranded D ⁇ A or double-stranded D ⁇ A.
  • Polynucleotides include polymers with nucleotides which are an ⁇ - or C-glycoside of a purine or pyrimidine base, and polymers containing non-standard nucleotide backbones, for example, backbones formed using phosphorodiamidate morpholino chemistry, polyamide linkages (e.g., peptide nucleic acids or P ⁇ As) and other synthetic sequence- specific nucleic acid molecules.
  • a first sequence is an "antisense sequence" with respect to a second sequence if a polynucleotide with a first sequence specifically binds to, or specifically hybridizes with, a polynucleotide which has a second sequence, under physiological conditions.
  • antisense oligonucleotide and “antisense oligomer” refer to a sequence of subunits bearing nucleotide base-pairing moieties, linked by a subunit-to-subunit backbone, that is effective to hybridize to a target sequence of a viral, positive-sense ssRNA.
  • oligomer is from 8 to about 40 nucleotide subunits long, more typically about 12 to 40 nucleotide subunits long, and preferably about 12 to 30, or 12 to 25, subunits in length.
  • the oligomer may have exact sequence complementarity to the target sequence or near complementarity, as defined below.
  • Such an antisense oligomer may block or inhibit the translation of a polyprotein encoded by the target open reading frame (ORF).
  • a "subunit" of an oligonucleotide or oligonucleotide analog refers to one nucleotide (or nucleotide analog) unit of the oligomer. The term may refer to the nucleotide unit with or without the attached intersubunit linkage, although, when referring to a "charged subunit", the charge typically resides within the intersubunit linkage (e.g. a phosphate or phosphorothioate linkage).
  • a "morpholino oligomer” is an oligonucleotide analog composed of morpholino subunit structures of the form shown in Figs.
  • the subunit and linkage shown in Figure IB are used for six-atom repeating-unit backbones, as shown in Figure 2B (where the six atoms include: a morpholino nitrogen, the connected phosphorus atom, the atom (usually oxygen) linking the phosphorus atom to the 5' exocyclic carbon, the 5' exocyclic carbon, and two carbon atoms of the next morpholino ring).
  • the atom Yi linking the 5' exocyclic morpholino carbon to the phosphorus group may be sulfur, nitrogen, carbon or, preferably, oxygen.
  • the X moiety pendant from the phosphorus is any stable group which does not interfere with base-specific hydrogen bonding.
  • Preferred X groups include fluoro, alkyl, alkoxy, thioalkoxy, and alkyl amino, including cyclic amines, all of which can be variously substituted, as long as base-specific bonding is not disrupted.
  • Alkyl, alkoxy and thioalkoxy preferably include 1-6 carbon atoms.
  • Alkyl amino preferably refers to lower alkyl (Ct to C ⁇ ) substitution, and cyclic amines are preferably 5- to 7-membered nitrogen heterocycles optionally containing 1-2 additional heteroatoms selected from oxygen, nitrogen, and sulfur.
  • Z is sulfur or oxygen, and is preferably oxygen.
  • a preferred morpholino oligomer is a phosphorodiamidate-linked morpholino oligomer, referred to herein as a PMO.
  • PMO phosphorodiamidate-linked morpholino oligomer
  • Fig. 4H Such a structure is also shown in Fig. 4H.
  • Also preferred are structures having an alternate phosphorodiamidate linkage, where, in Fig.
  • X lower alkoxy, such as methoxy or ethoxy
  • Y NH or NR, where R is lower alkyl, and Z-O.
  • substituted particularly with respect to an alkyl, alkoxy, thioalkoxy, or alkylamino group, refers to replacement of a hydrogen atom on carbon with a heteroatom-containing substituent, such as, for example, halogen, hydroxy, alkoxy, thiol, alkylthio, amino, alkylamino, imino, oxo (keto), nitro, cyano, or various acids or esters such as carboxylic, sulfonic, or phosphonic.
  • Polynucleotides are described as "complementary" to one another when hybridization occurs in an antiparallel configuration between two single-stranded polynucleotides.
  • a double-stranded polynucleotide can be "complementary" to another polynucleotide, if hybridization can occur between one of the strands of the first polynucleotide and the second.
  • Complementarity (the degree that one polynucleotide is complementary with another) is quantifiable in terms of the proportion (i.e., the percentage) of bases in opposing strands that are expected to form hydrogen bonds with each other, according to generally accepted base-pairing rules.
  • An antisense oligomer may have "near" or “substantial” complementarity to the target sequence and still functional for the purpose of the present invention.
  • the antisense oligomers employed have at most one mismatch with the target sequence out of 10 nucleotides, and preferably at most one mismatch out of 20, when compared to the exemplary oligomers having SEQ ID NOs: 16-35 as designated herein.
  • the antisense oligomers employed have at least 90%) sequence homology, and preferably at least 95% sequence homology, with the exemplary oligomers having SEQ ID NOs: 16-35 as designated herein.
  • An oligonucleotide or antisense oligomer "specifically hybridizes" to a target polynucleotide if the oligomer hybridizes to the target under physiological conditions, with a T m substantially greater than 37°C, preferably at least 50°C, and typically 60°C- 80°C or higher. Such hybridization preferably corresponds to stringent hybridization conditions.
  • the T m is the temperature at which 50% of a target sequence hybridizes to a complementary polynucleotide. Again, such hybridization may occur with "near” or “substantial” complementary of the antisense oligomer to the target sequence, as well as with exact complementarity.
  • a “nuclease-resistant” oligomeric molecule refers to one whose backbone is substantially resistant to nuclease cleavage, in non-hybridized or hybridized form; by common extracellular and intracellular nucleases in the body; that is, the oligomer shows little or no nuclease cleavage under normal nuclease conditions in the body to which the oligomer is exposed.
  • a “heteroduplex” refers to a duplex between an antisense oligomer and the complimentary portion of a target RNA.
  • nuclease-resistant heteroduplex refers to a heteroduplex formed by the binding of an antisense oligomer to its complementary target, such that the heteroduplex is substantially resistant to in vivo degradation by intracellular and extracellular nucleases, such as RNAseH, which are capable of cutting double- stranded RNA/RNA or RNA/DNA complexes.
  • target relative to the viral genomic RNA or an mRNA, refers to an mRNA or viral genomic RNA which is expressed or present in single-stranded in one or more types of mammalian cells.
  • a “base-specific intracellular binding event involving a target RNA” refers to the specific binding of an oligomer to a target RNA sequence inside a cell.
  • the base specificity of such binding is sequence specific.
  • a single-stranded polynucleotide can specifically bind to a single-stranded polynucleotide that is complementary in sequence.
  • An “antisense oligomer composition” refers to a composition comprising one or more antisense oligomers for use in the RNA detection methods of the present invention. In some cases, such an “antisense oligomer composition” contains a plurality of antisense oligomers.
  • an “effective amount” of an antisense oligomer, targeted against an infecting ssRNA virus is an amount effective to reduce the rate of replication of the infecting virus, and/or viral load, and/or symptoms associated with the viral infection.
  • body fluid encompasses a variety of sample types obtained from a subject including, urine, saliva, plasma, blood, spinal fluid, or other sample of biological origin, such as skin cells or dermal debris, and may refer to cells or cell fragments suspended therein, or the liquid medium and its solutes.
  • relative amount is used where a comparison is made between a test measurement and a control measurement.
  • the relative amount of a reagent forming a complex in a reaction is the amount reacting with a test specimen, compared with the amount reacting with a control specimen.
  • the control specimen may be run separately in the same assay, or it may be part of the same sample (for example, normal tissue surrounding a malignant area in a tissue section).
  • "Treatment" of an individual or a cell is any type of intervention provided as a means to alter the natural course of the individual or cell. Treatment includes, but is not limited to, administration of e.g., a pharmaceutical composition, and may be performed either prophylactically, or subsequent to the initiation of a pathologic event or contact with an etiologic agent.
  • the related term "improved therapeutic outcome" relative to a patient diagnosed as infected with a particular virus refers to a slowing or diminution in the growth of virus, or viral load, or detectable symptoms associated with infection by that particular virus.
  • An agent is "actively taken up by mammalian cells” when the agent can enter the cell by a mechanism other than passive diffusion across the cell membrane.
  • the agent may be transported, for example, by "active transport”, referring to transport of agents across a mammalian cell membrane by e.g. an ATP-dependent transport mechanism, or by "facilitated transport”, referring to transport of antisense agents across the cell membrane by a transport mechanism that requires binding of the agent to a transport protein, which then facilitates passage of the bound agent across the membrane.
  • the antisense agent preferably has a substantially uncharged backbone, as defined below.
  • the antisense compound may be formulated in a complexed form, such as an agent having an anionic backbone complexed with cationic lipids or liposomes, which can be taken into cells by an endocytotic mechanism.
  • the present invention is based on the discovery that effective inhibition of certain classes of small, single-stranded, positive sense RNA viruses can be achieved by exposing cells infected with the virus to antisense compounds (i) targeted against the initiation region of the viral first open reading frame (ORFl) and (ii) having physical and pharmacokinetic features which allow effective interaction between the antisense compound and the virus within host cells.
  • the oligomers can be used in treating a mammalian subject infected with the virus.
  • RNA viruses having genomes that are: (i) single stranded, (ii) positive polarity, (iii) less than 12 kb, and (iv) encoding a polyprotein at the first open reading frame (ORFl).
  • Targeted viral families include picornavirus, calicivirus, togavirus, coronavirus, and flavivirus.
  • the targeted virus is an RNA virus from the coronavirus family or a West Nile, Yellow Fever or Dengue virus from the flavivirus family.
  • Various physical, morphological, and biological characteristics of each of these four families, and members therein, can be found, for example, in Textbook of Human Virology, R.
  • Picornavirus The picornaviruses, which infect both humans and animals, can cause severe paralysis (paralytic poliomyelitis), aspectic meningitis, hepatitis, pleurodynia, myocarditis, skin rashes, and colds; inapparent infection is common.
  • poliovirus hepatitis A virus
  • rhinovirus Aphthovirus
  • coxsackie virus a virus that is recognized as the cause of the common cold in humans.
  • Serotypes are designated from 1 A to 100.
  • RNA Transmission is primarily by the aerosol route and the virus replicates in the nose.
  • the genomic RNA of Picornaviruses is infectious; that is, the genomic RNA is able to direct the synthesis of viral proteins directly, without host transcription events.
  • calicivirus Other genera of the calicivirus include the Norwalk-like and Sapporo-like viruses, which together comprise the human calicivirus, and the lagoviruses, which cause hemorrhagic diseases in rabbits, a particularly rapid and deadly virus.
  • the human caliciviruses are the most common cause of viral diarrhea outbreaks worldwide in adults, as well as being significant pathogens of infants (O'Ryan et al,
  • the family includes the genera Alphavirus, Rubivirus (rubella), Pestivirus (mucosal disease), Arterivirus (equine arteritis) and the Hepatitis E virus (HEV).
  • HEV was initially described in 1987 and first reported in the U.S. in 1991.
  • the virus was initially described as a Calicivirus based on the small, single-stranded RNA character. Some still classify HEV as a Calicivirus, but it has also been classified as a member of the Togavirus family. Infection appears to be much like hepatitis A viral infection.
  • the disease is an acute viral hepatitis which is apparent about 20 days after initial infection, and the virus may be observed for about 20 days in the serum.
  • Flavivirus Members of this family include, several serious human pathogens, among them mosquito-borne viruses of yellow fever, West Nile fever, hepatitis C, Japanese encephalitis, St. Louis encephalitis, Murray Valley encephalitis, and dengue.
  • the flavivirus virion is approximately 40 to 50 nm in diameter. The symmetry of the flavivirus nucleocapsid has not been fully defined. It is known that the flavivirus envelope contains only one species of glycoprotein. As yet, no subgenomic messenger RNA nor polyprotein precursors have been detected for the flavivirus.
  • Coronavirus Members of this family include human corona viruses that cause the common cold and other respiratory infections, and murine hepatitis virus. More recently, severe acute respiratory syndrom (SARS) has been identified as a coronavirus.
  • SARS severe acute respiratory syndrom
  • the preferred target sequence is a region that spans the AUG start site of the first open reading frame (ORFl) of the viral genome.
  • the first ORF generally encodes a polyprotein containing non-structural proteins such as polymerases, helicases and proteases.
  • spans the AUG start site is meant that the target sequence includes at least three bases on one side of the AUG start site and at least two bases on the other (a total of at least 8 bases). Preferably, it includes at least four bases on each side of the start site (a total of at least 11 bases). More generally, preferred target sites include targets that are conserved between a variety of viral isolates.
  • favored sites include the IRES (internal ribosome entry site), transactivation protein binding sites, and sites of initiation of replication.
  • IRES internal ribosome entry site
  • transactivation protein binding sites sites of initiation of replication.
  • Complex and large viral genomes which may provide multiple redundant genes, may be efficiently targeted by targeting host cellular genes coding for viral entry and host response to viral presence.
  • a variety of viral-genome sequences are available from well known sources, such as the NCBI Genbank databases. Alternatively, a person skilled in the art can find sequences for many of the subject viruses in the open literature, e.g., by searching for references that disclose sequence information on designated viruses. Once a complete or partial viral sequence is obtained, the ORFl of the virus is identified. Typically, the ORFl is identified in the gene database or reference relied on.
  • Fig. 3 A shows the genome structure 10 of a picornavirus, in this case, a rhinovirus of the Picornavirus family.
  • the rhinovirus genome 10 is a single molecule of single-stranded, positive sense, polyadenylated RNA of approximately 7.5kb. As shown, the genome includes a long UTR 12, which is located upstream of the first polyprotein, and a single open reading frame (ORF) having a VPg (viral genome linked) protein covalently attached to its end. The ORF is subdivided into two segments (14, 16), each of which encodes a polyprotein.
  • ORF open reading frame
  • the first segment 14 encodes a polyprotein that is cleaved subsequently to form viral proteins VPl to VP4, and the second segment 16 encodes a polyprotein which is the precursor of viral proteins including a Cis-pro, a protease, and a polymerase.
  • the ORF terminates in a polyA termination sequence 18.
  • the target initial AUG start site is located between base positions 615-640. Targeting this region is effective to inhibit translation of both polyprotein segments 14, 16.
  • Figure 3B shows the genome 20 of a calicivirus; in this case, a vesivirus of the Calicivirus family. The genome is a single molecule of infectious, single stranded, positive sense RNA of approximately 7.5kb.
  • the genome 20 includes a UTR 22 upstream of the first open reading frame (ORFl) 24 which is unmodified.
  • the 3' end 26 of genome 20 is polyadenylated.
  • Genome 20 includes three open reading frames.
  • the first open reading frame 24 encodes a polyprotein, which is subsequently cleaved to form the viral non-structural proteins including a helicase, a protease, an RNA dependent RNA polymerase, and "VPg", a protein that becomes bound to the 5' end of the viral genomic RNA (Clarke and Lambden, 2000).
  • the second open reading frame 28 codes for the single capsid protein
  • the third open reading frame 29 codes for what is reported to be a structural protein that is basic in nature and probably able to associate with RNA (Green et al, 2000).
  • the target initial AUG start site is located between base positions 7-35. Targeting this region is effective in inhibiting the translation of first reading frame 24.
  • Figure 3C shows the structure of the genome 30 of a togavirus; in this case, a rubella virus of the Togavirus family.
  • Genome 30 is a single linear molecule of single-stranded, positive-sense RNA of approximately 11.7 kb, which is infectious.
  • Genome 30 includes two open reading frames 36, 38.
  • First open reading frame 36 encodes a polyprotein which is subsequently cleaved into four functional proteins, nsPl to nsP4.
  • Second open reading frame 38 encodes the viral capsid protein and three other viral proteins, PE2, 6K and El.
  • the AUG start site for first open reading frame 36 is located between base positions 10-40. Targeting this region is effective to inhibit the translation of first open reading frame 36.
  • D Flavivirus.
  • Figure 3D shows the structure of the genome 40 of the hepatitis C virus of the Flavivirus family.
  • the hepatitis C virus genome is a single linear molecule of single-stranded, positive-sense RNA of about 11 kb.
  • the 5' end 42 is capped with a m 7 GppAmp molecule, and the 3' end 44 is not polyadenylated.
  • Genome 40 includes only one open reading frame 46 which encodes a precursor polyprotein separable into six structural and functional proteins.
  • the initial AUG start site is located at base position 310.
  • GenBank references for exemplary viral nucleic acid sequences containing the ORFl start site in the corresponding viral genomes are listed in Table 3, below.
  • sequences are only illustrative of other sequences in the ORFl start-site region of members of the five virus families, as may be available from available gene-sequence databases of literature or patent resources.
  • the sequences below, identified as SEQ ED NOs 1-15 and 42-46, are listed in Table 10 at the end of the specification.
  • the target sequence is selected from SEQ ID NOs: 42-46.
  • the targeting sequence that is, the base sequence of the antisense oligomer
  • the targeting sequence is preferably directed against an AUG-spanning portion of the viral target sequence.
  • the targeting sequence is complementary, or substantially complementary, as defined above, to a portion of the target region spanning the AUG start site of the first open reading frame of the viral genome, and the degree of complementarity between the target and targeting sequence is sufficient to form a stable duplex.
  • the targeting sequence includes a CAT sequence directed against the AUG codon, and at least three bases on one side of this sequence, and two on the other.
  • the region of complementarity of the antisense oligomers with the target RNA sequence may be as short as 8-11 bases, but is preferably 12-15 bases or more, e.g. 12-20 bases, or 12-25 bases.
  • An antisense oligomer of about 15 bases is generally long enough to have a unique complementary sequence in the viral genome.
  • a minimum length of complementary bases may be required to achieve the requisite binding T m , as discussed below.
  • Oligomers as long as 40 bases may be suitable, where at least the minimum number of bases, e.g., 8-11, preferably 12-15 bases, are complementary to the target sequence.
  • facilitated or active uptake in cells is optimized at oligomer lengths less than about 30, preferably less than 25, and more preferably 20 or fewer bases.
  • an optimum balance of binding stability and uptake generally occurs at lengths of 13-18 bases.
  • the oligomer may be 100% complementary to the viral nucleic acid target sequence, or it may include mismatches, e.g., to accommodate variants, as long as a heteroduplex formed between the oligomer and viral nucleic acid target sequence is sufficiently stable to withstand the action of cellular nucleases and other modes of degradation which may occur in vivo. Oligomer backbones which are less susceptible to cleavage by nucleases are discussed below.
  • Mismatches if present, are less destabilizing toward the end regions of the hybrid duplex than in the middle.
  • the number of mismatches allowed will depend on the length of the oligomer, the percentage of G:C base pairs in the duplex, and the position of the mismatch(es) in the duplex, according to well understood principles of duplex stability.
  • an antisense oligomer is not necessarily 100% complementary to the viral nucleic acid target sequence, it is effective to stably and specifically bind to the target sequence, such that a biological activity of the nucleic acid target, e.g., expression of viral protein(s), is modulated.
  • the stability of the duplex formed between the oligomer and the target sequence is a function of the binding T m and the susceptibility of the duplex to cellular enzymatic cleavage.
  • the T m of an antisense compound with respect to complementary-sequence RNA may be measured by conventional methods, such as those described by Hames et al, Nucleic Acid Hybridization, ERL Press, 1985, pp.107-108.
  • Each antisense oligomer should have a binding T m , with respect to a complementary-sequence RNA, of greater than body temperature and preferably greater than 50°C. T m 's in the range 60-80°C or greater are preferred.
  • the T m of an oligomer compound, with respect to a complementary-based RNA hybrid can be increased by increasing the ratio of C:G paired bases in the duplex, and/or by increasing the length (in base pairs) of the heteroduplex.
  • Table 4 lists exemplary targeting sequences directed against a target region that spans the translation initiation site of the first open reading frame (ORFl) of selected viruses of the picornavirus, calicivirus, togavirus, coronavirus, and flavivirus families. These sequences were selected, as indicated above, by constructing a complementary sequence to one or more sequences spanning the AUG site in the target sequences given above. Exceptions to this general rule are the following: SEQ ED NO: 26 is directed to the origin of the viral genome; SEQ ID NOs: 23-25 contain mismatches and/or inserts, as indicated by underlining; and SEQ ID NO: 33 includes only one base of the ATG start codon.
  • the target sequence is selected from SEQ ID NOs: 42-46, and the antisense sequence is selected from SEQ ED NOs: 37-41.
  • the oligomer has a base sequence directed to a targeted portion of the viral genome, preferably spanning the ORFl start site.
  • the oligomer is able to effectively target infecting viruses, when administered to an infected host cell, e.g. in an infected mammalian subject. This requirement is met when the oligomer compound (a) has the ability to be actively taken up by mammalian cells, and (b) once taken up, form a duplex with the target ssR ⁇ A with a T m greater than about 50°C.
  • the ability to be taken up by cells requires that the oligomer backbone be substantially uncharged, and, preferably, that the oligomer structure is recognized as a substrate for active or facilitated transport across the cell membrane.
  • the ability of the oligomer to form a stable duplex with the target R ⁇ A will also depend on the oligomer backbone, as well as factors noted above, the length and degree of complementarity of the antisense with respect to the target, the ratio of G:C to AT base matches, and the positions of any mismatched bases.
  • the ability of the antisense agent to resist cellular nucleases promotes survival and ultimate delivery of the agent to the cell cytoplasm. Below are disclosed methods for testing any given, substantially uncharged backbone for its ability to meet these requirements.
  • the antisense compound may be taken up by host cells by facilitated or active transport across the host cell membrane if administered in free (non-complexed) form, or by an endocytotic mechanism if administered in complexed form.
  • the antisense compound should be substantially uncharged, meaning that a majority of its intersubunit linkages are uncharged at physiological pH.
  • a small number of net charges e.g., 1-2 for a 15- to 20-mer oligomer, can in fact enhance cellular uptake of certain oligomers with substantially uncharged backbones.
  • the charges may be carried on the oligomer itself, e.g., in the backbone linkages, or may be terminal charged-group appendages.
  • the number of charged linkages is no more than one charged linkage per four uncharged linkages. More preferably, the number is no more than one charged linkage per ten, or no more than one per twenty, uncharged linkages.
  • the oligomer is fully uncharged.
  • -An oligomer may also contain both negatively and positively charged backbone linkages, as long as opposing charges are present in approximately equal number.
  • the oligomer does not include runs of more than 3-5 consecutive subunits of either charge.
  • the oligomer may have a given number of anionic linkages, e.g. phosphorothioate or N3'- P5' phosphoramidate linkages, and a comparable number of cationic linkages, such as N,N-diethylenediamine phosphoramidates (Dagle, 2000).
  • the net charge is preferably neutral or at most 1-2 net charges per oligomer.
  • the antisense agent is preferably a substrate for a membrane transporter system (i.e. a membrane protein or proteins) capable of facilitating transport or actively transporting the oligomer across the cell membrane. This feature may be determined by one of a number of tests for oligomer interaction or cell uptake, as follows.
  • a first test assesses binding at cell surface receptors, by examining the ability of an oligomer compound to displace or be displaced by a selected charged oligomer, e.g., a phosphorothioate oligomer, on a cell surface.
  • the cells are incubated with a given quantity of test oligomer, which is typically fluorescently labeled, at a final oligomer concentration of between about 10-300 nM. Shortly thereafter, e.g., 10-30 minutes (before significant internalization of the test oligomer can occur), the displacing compound is added, in incrementally increasing concentrations. If the test compound is able to bind to a cell surface receptor, the displacing compound will be observed to displace the test compound.
  • a selected charged oligomer e.g., a phosphorothioate oligomer
  • the test compound is considered to bind at the same recognition site for the cell transport system as the displacing compound.
  • a second test measures cell transport, by examining the ability of the test compound to transport a labeled reporter, e.g., a fluorescence reporter, into cells. The cells are incubated in the presence of labeled test compound, added at a final concentration between about 10-300 nM. After incubation for 30-120 minutes, the cells are examined, e.g., by microscopy, for intracellular label. The presence of significant intracellular label is evidence that the test compound is transported by facilitated or active transport.
  • a labeled reporter e.g., a fluorescence reporter
  • the antisense compound may also be administered in complexed form, where the complexing agent is typically a polymer, e.g., a cationic lipid, polypeptide, or non- biological cationic polymer, having an opposite charge to any net charge on the antisense compound.
  • the complexing agent is typically a polymer, e.g., a cationic lipid, polypeptide, or non- biological cationic polymer, having an opposite charge to any net charge on the antisense compound.
  • the liposomal composition Lipofectin® (Feigner et al, 1987), containing the cationic lipid DOTMA (N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride) and the neutral phospholipid DOPE (dioleyl phosphatidyl ethanolamine), is widely used. After administration, the complex is taken up by cells through an endocytotic mechanism, typically involving particle encapsulation in endosomal bodies.
  • DOTMA N-[l-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride
  • DOPE dioleyl phosphatidyl ethanolamine
  • the requisite properties of oligomers with any given backbone can be confirmed by a simple in vivo test, in which a labeled compound is administered to an animal, and a body fluid sample, taken from the animal several hours after the oligomer is administered, assayed for the presence of heteroduplex with target RNA.
  • This method is detailed in subsection D below.
  • Substantial resistance to RNaseH Two general mechanisms have been proposed to account for inhibition of expression by antisense oligonucleotides. (See e.g., Agrawal et al, 1990; Bonham et al, 1995; and Boudvillain et al, 1997).
  • a heteroduplex formed between the oligonucleotide and the viral RNA acts as a substrate for RNaseH, leading to cleavage of the viral RNA.
  • Oligonucleotides belonging, or proposed to belong, to this class include phosphorothioates, phosphotriesters, and phosphodiesters (unmodified "natural" oligonucleotides).
  • phosphorothioates phosphorothioates
  • phosphotriesters phosphotriesters
  • phosphodiesters unmodified "natural" oligonucleotides
  • a second class of oligonucleotide analogs termed “steric Mockers” or, alternatively, “RNaseH inactive” or “RNaseH resistant”, have not been observed to act as a substrate for RNaseH, and are believed to act by sterically blocking target RNA nucleocytoplasmic transport, splicing or translation.
  • This class includes methylphosphonates (Toulme et al, 1996), morpholino oligonucleotides, peptide nucleic acids (PNA's), certain 2'-O-allyl or 2'-O-alkyl modified oligonucleotides (Bonham, 1995), and N3'->P5' phosphoramidates (Gee, 1998; Ding, 1996).
  • a test oligomer can be assayed for its RNaseH resistance by forming an RNA: oligomer duplex with the test compound, then incubating the duplex with RNaseH under a standard assay conditions, as described in Stein et al. After exposure to RNaseH, the presence or absence of intact duplex can be monitored by gel electrophoresis or mass spectrometry. A3. In vivo uptake, there is provided a simple, rapid test for confirming that a given antisense oligomer type provides the required characteristics noted above, namely, high T m , ability to be actively taken up by the host cells, and substantial resistance to RNaseH.
  • This method is based on the discovery that a properly designed antisense compound will form a stable heteroduplex with the complementary portion of the viral RNA target when administered to a mammalian subject, and the heteroduplex subsequently appears in the urine (or other body fluid). Details of this method are also given in co-owned U.S. Patent Application Pubn. Nos. US 2001024783 and US 2003171328, entitled "Non-Invasive Method for Detecting Target RNA". Briefly, a test oligomer containing a backbone to be evaluated, having a base sequence targeted against a known RNA, is injected into a mammalian subject.
  • the antisense oligomer may be directed against any intracellular RNA, including a host RNA or the RNA of an infecting virus. Several hours (typicaly 8-72) after administration, the urine is assayed for the presence of the antisense-RNA heteroduplex. If heteroduplex is detected, the backbone is suitable for use in the antisense oligomers of the present invention.
  • the test oligomer may be labeled, e.g. by a fluorescent or a radioactive tag, to facilitate subsequent analyses, if it is appropriate for the mammalian subject.
  • the assay can be in any suitable solid-phase or fluid format.
  • a solid-phase assay involves first binding the heteroduplex analyte to a solid-phase support, e.g., particles or a polymer or test-strip substrate, and detecting the presence/amount of heteroduplex bound.
  • a solid-phase support e.g., particles or a polymer or test-strip substrate
  • the analyte sample is typically pretreated to remove interfering sample components. If the oligomer is labeled, the presence of the heteroduplex is confirmed by detecting the label tags.
  • the heteroduplex may be detected by immunoassay if in solid phase format or by mass spectroscopy or other known methods if in solution or suspension format.
  • the method can be used to detect the presence of a given ssRNA virus, or reduction in the amount of virus during a treatment method.
  • a virus-specific region of the viral genome such as the translation initiation region of ORFl, as described above
  • the method can be used to detect the presence of a given ssRNA virus, or reduction in the amount of virus during a treatment method.
  • B Exemplary oligomer backbones Examples of nonionic linkages that may be used in oligonucleotide analogs are shown in Figs. 4A-4H.
  • B represents a purine or pyrimidine base-pairing moiety effective to bind, by base-specific hydrogen bonding, to a base in a polynucleotide, preferably selected from adenine, cytosine, guanine and uracil.
  • PNAs Peptide nucleic acids
  • PNAs containing natural pyrimidine and purine bases hybridize to complementary oligonucleotides obeying Watson-Crick base-pairing rules, and mimic DNA in terms of base pair recognition (Egholm et al, 1993).
  • the backbone of PNAs are formed by peptide bonds rather than phosphodiester bonds, making them well-suited for antisense applications.
  • the backbone is uncharged, resulting in PNA/DNA or PNA/RNA duplexes which exhibit greater than normal thermal stability.
  • PNAs are not recognized by nucleases or proteases.
  • a preferred oligomer structure employs morpholino-based subunits bearing base- pairing moieties, joined by uncharged linkages, as described above.
  • a substantially uncharged phosphorodiamidate-linked morpholino oligomer such as illustrated in Fig. 4H and in Fig. 2B-B.
  • Morpholino oligonucleotides, including antisense oligomers are detailed, for example, in co-owned U.S. Patent Nos. 5,698,685, 5,217,866, 5,142,047, 5,034,506, 5,166,315, 5,185, 444, 5,521,063, and 5,506,337.
  • RNA 1 A-E include: the ability to be linked in a oligomeric form by stable, uncharged backbone linkages; the ability to support a nucleotide base (e.g. adenine, cytosine, guanine or uracil) such that the polymer formed can hybridize with a complementary-base target nucleic acid, including target RNA, with high T m , even with oligomers as short as 10-14 bases; the ability of the oligomer to be actively transported into mammalian cells; and the ability of the oligome ⁇ RNA heteroduplex to resist RNAse degradation.
  • exemplary backbone structures for antisense oligonucleotides of the invention include the ⁇ -morpholino subunit types shown in Figs.
  • Fig. 1 A-E each linked by an uncharged, phosphorus-containing subunit linkage.
  • Fig. 1 A shows a phosphorus- containing linkage which forms the five atom repeating-unit backbone shown Fig. 2A, where the morpholino rings are linked by a 1-atom phosphoamide linkage.
  • Fig. IB shows a linkage which produces a 6-atom repeating-unit backbone, as shown in Fig. 2B.
  • the atom Y linking the 5' morpholino carbon to the phosphorus group may be sulfur, nitrogen, carbon or, preferably, oxygen.
  • the X moiety pendant from the phosphorus may be fluorine, an alkyl or substituted alkyl, an alkoxy or substituted alkoxy, a thioalkoxy or substituted thioalkoxy, or unsubstituted, monosubstituted, or disubstituted nitrogen, including cyclic structures, such as morpholines or piperidines.
  • Alkyl, alkoxy and thioalkoxy preferably include 1-6 carbon atoms.
  • the Z moieties are sulfur or oxygen, and are preferably oxygen.
  • the linkage shown in Figs. 1C-E are designed for 7-atom unit-length backbones, as shown for structures in Figs. 2C-E.
  • the X moiety is as in Structure 2B, and the moiety Y may be methylene, sulfur, or, preferably, oxygen.
  • the X and Y moieties are as in Structure 2B.
  • X is as in Structure 2B, and Y is O, S, or NR, where R is hydrogen or lower alkyl, preferably hydrogen or methyl.
  • Z is O or S, and each of Pi and Pj is a base pairing moiety, preferably selected from adenine, cytosine, guanine and uracil.
  • the substantially uncharged oligomer may advantageously include a limited number of charged linkages, e.g. up to about 1 per every 5 uncharged linkages, more preferably up to about 1 per every 10 uncharged linkages. Therefore a small number of charged linkages, e.g. charged phosphoramidate or phosphorothioate, may also be incorporated into the oligomers.
  • such a charged linkage may be a linkage as represented by any of Figs. 2 A-E, where X is oxide (-0 or sulfide (-S " ).
  • the antisense compounds can be prepared by stepwise solid-phase synthesis, employing methods detailed in the references cited above. In some cases, it may be desirable to add additional chemical moieties to the antisense compound, e.g. to enhance pharmacokinetics or to facilitate capture or detection of the compound. Such a moiety may be covalently attached, typically to a terminus of the oligomer, according to standard synthetic methods.
  • a polyethyleneglycol moiety or other hydrophilic polymer e.g., one having 10-100 monomeric subunits
  • One or more charged groups e.g., anionic charged groups such as an organic acid
  • a reporter moiety such as fluorescein or a radiolabeled group
  • the reporter label attached to the oligomer may be a ligand, such as an antigen or biotin, capable of binding a labeled antibody or streptavidin.
  • the antisense compounds detailed above are useful in inhibiting replication of ssRNA viruses of the picornavirus, calicivirus, togavirus, coronavirus, and flavivirus families.
  • the virus is an RNA virus from the coronavirus family or a West Nile, Yellow Fever or Dengue virus from the flavivirus family.
  • such inhibition is effective in treating infection of a host animal by these viruses.
  • the method comprises, in one embodiment, contacting a cell infected with the virus with an antisense agent effective to inhibit the translation of a polyprotein encoded in the first open reading frame of the genome of the specific virus.
  • the antisense agent is administered to a mammalian subject, e.g., human or domestic animal, infected with a given virus, in a suitable pharmaceutical carrier. It is contemplated that the antisense oligonucleotide arrests the growth of the RNA virus in the host.
  • the RNA virus may be decreased in number or eliminated with little or no detrimental effect on the normal growth or development of the host.
  • A. Identification of the Infective Agent The specific virus causing the infection can be determined by methods known in the art, e.g. serological or cultural methods, or by methods employing the antisense oligomers of the present invention.
  • Serological identification employs a viral sample or culture isolated from a biological specimen, e.g., stool, urine, cerebrospinal fluid, blood, etc., of the subject. Immunoassay for the detection of virus is generally carried out by methods routinely employed by those of skill in the art, e.g., ELISA or Western blot. In addition, monoclonal antibodies specific to particular viral strains or species are often commercially available. Culture methods may be used to isolate and identify particular types of virus, by employing techniques including, but not limited to, comparing characteristics such as rates of growth and morphology under various culture conditions.
  • Another method for identifying the viral infective agent in an infected subject employs one or more antisense oligomers targeting broad families and/or genera of viruses, e.g., Picornaviridae, Caliciviridae, Togaviridae and Flaviviridae. Sequences targeting any characteristic viral RNA can be used.
  • the desired target sequences are preferably (i) common to broad virus families/genera, and (ii) not found in humans. Characteristic nucleic acid sequences for a large number of infectious viruses are available in public databases, and may serve as the basis for the design of specific oligomers.
  • the following steps are carried out: (a) the oligomer(s) are administered to the subject; (b) at a selected time after said administering, a body fluid sample is obtained from the subject; and (c) the sample is assayed for the presence of a nuclease-resistant heteroduplex comprising the antisense oligomer and a complementary portion of the viral genome. Steps (a) - (c) are carried for at least one such oligomer, or as many as is necessary to identify the virus or family of viruses. Oligomers can be administered and assayed sequentially or, more conveniently, concurrently.
  • the virus is identified based on the presence (or absence) of a heteroduplex comprising the antisense oligomer and a complementary portion of the viral genome of the given known virus or family of viruses.
  • a first group of oligomers, targeting broad families is utilized first, followed by selected oligomers complementary to specific genera and/or species and/or strains within the broad family/genus thereby identified.
  • This second group of oligomers includes targeting sequences directed to specific genera and/or species and/or strains within a broad family/genus.
  • Several different second oligomer collections i.e. one for each broad virus family/genus tested in the first stage, are generally provided.
  • routes of antisense oligomer delivery include, but are not limited to, various systemic routes, including oral and parenteral routes, e.g., intravenous, subcutaneous, intraperitoneal, and intramuscular, as well as inhalation, transdermal and topical delivery.
  • routes of antisense oligomer delivery include, but are not limited to, various systemic routes, including oral and parenteral routes, e.g., intravenous, subcutaneous, intraperitoneal, and intramuscular, as well as inhalation, transdermal and topical delivery.
  • the appropriate route may be determined by one of skill in the art, as appropriate to the condition of the subject under treatment.
  • an appropriate route for delivery of an antisense oligomer in the treatment of a viral infection of the skin is topical delivery, while delivery of an antisense oligomer for the treatment of a viral respiratory infection is by inhalation.
  • the oligomer may also be delivered directly to the site of viral infection, or to the bloodstream.
  • the antisense oligomer may be administered in any convenient vehicle which is physiologically acceptable.
  • Such a composition may include any of a variety of standard pharmaceutically accepted carriers employed by those of ordinary skill in the art.
  • saline examples include, but are not limited to, saline, phosphate buffered saline (PBS), water, aqueous ethanol, emulsions, such as oil/water emulsions or triglyceride emulsions, tablets and capsules.
  • PBS phosphate buffered saline
  • emulsions such as oil/water emulsions or triglyceride emulsions, tablets and capsules.
  • suitable physiologically acceptable carrier will vary dependent upon the chosen mode of administration.
  • liposomes may be employed to facilitate uptake of the antisense oligonucleotide into cells. (See, e.g., Williams, S.A, Leukemia 10(12): 1980-1989, 1996; Lappalainen et al, Antiviral Res.
  • Hydrogels may also be used as vehicles for antisense oligomer administration, for example, as described in WO 93/01286.
  • the oligonucleotides may be administered in microspheres or microparticles.
  • Sustained release compositions may also be used. These may include semipermeable polymeric matrices in the form of shaped articles such as films or microcapsules.
  • the subject is a human subject, e.g., a patient diagnosed as having a localized or systemic viral infection.
  • the condition of a patient may also dictate prophylactic administration of an antisense oligomer of the invention, e.g. in the case of a patient who (1) is immunocompromised; (2) is a burn victim; (3) has an indwelling catheter; or (4) is about to undergo or has recently undergone surgery.
  • the oligomer is a phosphorodiamidate morpholino oligomer, contained in a pharmaceutically acceptable carrier, and is delivered orally. In another preferred embodiment, the oligomer is a phosphorodiamidate morpholino oligomer, contained in a pharmaceutically acceptable carrier, and is delivered intravenously (IV).
  • the subject is a livestock animal, e.g., a chicken, turkey, pig, cow or goat, etc, and the treatment is either prophylactic or therapeutic.
  • the invention also includes a livestock and poultry food composition containing a food grain supplemented with a subtherapeutic amount of an antiviral antisense compound of the type described above.
  • the antisense compound is generally administered in an amount and manner effective to result in a peak blood concentration of at least 200-400 nM antisense oligomer.
  • one or more doses of antisense oligomer are administered, generally at regular intervals, for a period of about one to two weeks.
  • Preferred doses for oral administration are from about 1-25 mg oligomer per 70 kg. In some cases, doses of greater than 25 mg oligomer/patient may be necessary.
  • preferred doses are from about 0.5 mg to 10 mg oligomer per 70 kg.
  • the antisense oligomer may be administered at regular intervals for a short time period, e.g., daily for two weeks or less. However, in some cases the oligomer is administered intermittently over a longer period of time. Administration may be followed by, or concurrent with, administration of an antibiotic or other therapeutic treatment.
  • the treatment regimen may be adjusted (dose, frequency, route, etc.) as indicated, based on the results of immunoassays, other biochemical tests and physiological examination of the subject under treatment. C.
  • An effective in vivo treatment regimen using the antisense oligonucleotides of the invention may vary according to the duration, dose, frequency and route of administration, as well as the condition of the subject under treatment (i.e., prophylactic administration versus administration in response to localized or systemic infection).
  • RNA virus RNA virus
  • CBC complete blood count
  • nucleic acid detection methods e.g., nucleic acid detection methods
  • immunodiagnostic tests e.g., viral culture, or detection of heteroduplex.
  • the efficacy of an in vivo administered antisense oligomer of the invention in inhibiting or eliminating the growth of one or more types of RNA virus may be determined from biological samples (tissue, blood, urine etc.) taken from a subject prior to, during and subsequent to administration of the antisense oligomer.
  • Assays of such samples include (1) monitoring the presence or absence of heteroduplex formation with target and non-target sequences, using procedures known to those skilled in the art, e.g., an electrophoretic gel mobility assay; (2) monitoring the amount of viral protein production, as determined by standard techniques such as ELISA or Western blotting, or (3) measuring the effect on viral titer, e.g. by the method of Spearman-Karber.
  • an electrophoretic gel mobility assay e.g., an electrophoretic gel mobility assay
  • monitoring the amount of viral protein production as determined by standard techniques such as ELISA or Western blotting
  • measuring the effect on viral titer e.g. by the method of Spearman-Karber.
  • a preferred method of monitoring the efficacy of the antisense treatment is by detection of the antisense-RNA heteroduplex.
  • a body fluid is collected for detecting the presence and/or measuring the level of heteroduplex species in the sample.
  • the body fluid sample is collected 3-24 hours after administration, preferably about 6-24 hours after administering.
  • the body fluid sample may be urine, saliva, plasma, blood, spinal fluid, or other liquid sample of biological origin, and may include cells or cell fragments suspended therein, or the liquid medium and its solutes.
  • the amount of sample collected is typically in the 0.1 to 10 ml range, preferably about 1 ml of less.
  • the sample may be treated to remove unwanted components and/or to treat the heteroduplex species in the sample to remove unwanted ssRNA overhang regions, e.g. by treatment with RNase. It is, of course, particularly important to remove overhang where heteroduplex detection relies on size separation, e.g., electrophoresis of mass spectroscopy.
  • a variety of methods are available for removing unwanted components from the sample. For example, since the heteroduplex has a net negative charge, electrophoretic or ion exchange techniques can be used to separate the heteroduplex from neutral or positively charged material.
  • the sample may also be contacted with a solid support having a surface-bound antibody or other agent specifically able to bind the heteroduplex. After washing the support to remove unbound material, the heteroduplex can be released in substantially purified form for further analysis, e.g., by electrophoresis, mass spectroscopy or immunoassay.
  • a solid support having a surface-bound antibody or other agent specifically able to bind the heteroduplex.
  • the heteroduplex can be released in substantially purified form for further analysis, e.g., by electrophoresis, mass spectroscopy or immunoassay.
  • Example 1 Antisense inhibition of Picornaviridae (Human rhinovirus) in vitro The inhibitory effect on rhinovirus 16 of a phosphorodiamidate morpholino oligomer (PMO) having a sequence targeted to the translation initiation zone of rhinovirus 14 was evaluated.
  • the phosphorodiamidate morpholino oligomers (PMO) were synthesized at AVI BioPharma (Corvallis, OR), as described in Summerton and Weller, 1997. Purity of the full-length oligomer was greater than 90% as determined by reverse-phase high- pressure liquid chromatography and MALDI TOF mass spectroscopy.
  • the lyophilized PMOs were dissolved in sterile 0.9% NaCl and filtered through 0.2 ⁇ m Acrodisc filters (Gelman Sciences, Ann Arbor, MI) prior to use in cell cultures.
  • the PMO includes a nucleic acid sequence targeting rhinovirus 14 and containing three mispairs in respect to the rhinovirus 16 target sequence.
  • the target sequence GenBank NC001752 618-637; SEQ ID NO: 5
  • targeting sequence SEQ ED NO: 18 are as follows: HRV-16: TTGTTATCATGGGCGCTCAA SEQ ED NO: 5
  • HRN-14 antisense GACACTAGTACCCGCGAGTC SEQ ID NO: 18 where the bolded codon is the start codon, and the mispairs are underlined.
  • MEM Earles minimal essential medium
  • the PMOs were introduced into the cultured cells by a "scrape-loading" method, which is known to deliver PMOs to 80-90% of the adherent cells in the culture (Partridge et al, 1996).
  • the oligomers were diluted to a final concentration of 20 ⁇ M in MEM without serum.
  • An 0.5 ml volume of oligomer-MEM media was added to the cultures and after 1 minute at room temperature the cells were gently scraped off with a rubber policeman.
  • the cells were returned to the CO 2 incubator for 10 minutes, then diluted into 8 ml of MEM with calf serum and dispersed in 0.1 ml per well of a 96-well plate containing log dilutions of rhinovirus 16 (8 wells per dilution).
  • Niral titers were determined by the method of Spearman-Karber. Niral titer for the different treatment groups is shown in Table 6 below and graphically in Fig. 5. Table 6
  • results show greater than 75% inhibition of the viral titer of HRN-16 when treated with PMO antisense to the HRN-14. While efficacy is lower than the efficacy of rhinovirus 16 targeting sequence directed against rhinovirus 16 infection, demonstrated in a previous study, as expected from the three mismatched basepairs, the study confirms the antiviral effects of PMOs substantially complementary to the translation initiation zone of the HRN-16 genome.
  • Example 2 -Antisense inhibition of Caliciviridae Vesivirus isolates PCV Pan-1 and SMSV- 13 in Porcine kidney (PK-15) and African Green Monkey Kidney (Vero) tissue culture
  • the antiviral efficacy of three phosphorodiamidate morpholino oligomers (PMO) targeted to the ORFl translation initiation zone of the strains Pan-1 and SMSV-13 of the vesivirus genus of Caliciviridae was evaluated.
  • the PMOs were scrape-loaded, as described above, to two host cell lines, Porcine kidney cells (PK-15) (ATCC No. CCL33) and African Green Monkey Kidney cells (ATCC No.
  • Example 2 CCL81 (Vero), which were subsequently exposed to vesiviruses of the strains Pan-1 and SMSV-13.
  • the protocol of Example 1 was followed for incubation and determination of viral load.
  • the three PMOs each included a targeting sequence complementary to the Pan-1 sequence (GenBank accession no. AF091736) spanning the start codon of ORFl. PMOs were used at a concentration of 20 ⁇ m in serum free media. A saline blank and scrambled sequence control PMO were included in the study.
  • the PMO sequences, identified as ORF1.1 (SEQ ID NO. 27), ORF1.2 (SEQ ID NO. 28), and ORF1.3 (SEQ ID NO. 29), and the target site locations are listed in Table 7 below.
  • Table 8 Effects of antisense PMOs on viral titers of vesiviruses, strains PCV Pan-1 and SMSV-13. in PK-15 and Vero host cells.
  • Example 3 Effect of PMO antisense to feline calicivirus.
  • a feline calicivirus that became a hemorrhagic virus to the cat was isolated and propagated in a cell culture. The cell culture was exposed, following the protocol described in Example 1, to an antisense PMO having the following targeting sequence: CAG AGT TTG AGA CAT TGT CTC (SEQ ID No. 32). A one-log reduction of viral titer was observed in the cell culture.
  • Example 4 Effect of an Antisense PMO Targeted to HCV Viremia in HCV-Trimera Mice
  • CB6F1 and SCID/beige mice obtained from Harlan Inc. (reared and maintained in the Weizmann Institute Animal Breeding Center). The mice were housed in a specific pathogen-free environment; allowed sterile food and acidified water ad lib prior to initiation of the study.
  • CB6F1 mice were thymectomized at the age of 7-9 weeks. Experiments were performed using CB6F1 mice at the age of 12-18 weeks (19-25 g/mouse).
  • mice Prior to heterotransplantation, the CB6F1 mice received a split dose of total body irradiation (4 Gy followed 1 day later by 11 Gy) from a gamma beam 150- A 60 Co source (Atomic Energy of Canada) with irradiation rate of 0.7 Gy/min. After the first irradiation, ciprofloxacin (20 ⁇ g/ml; Bayer) was added to drinking water for 7-10 days. Immediately after the second radiation dose, mice were injected i.v. with 4-6x10 6 bone-marrow cells (in 0.2 ml PBS) obtained from 6-10 weeks old SCID/beige mice.
  • 4-6x10 6 bone-marrow cells in 0.2 ml PBS
  • mice were anesthetized with 10 mg/mouse of 2,2,2 tribromoethanol (Aldrich) and a laparotomy performed.
  • Human liver fragments infected ex vivo with hepatitis C virus (HCV) were transplanted behind the ear pinna. The incisions were closed with 9 mm autoclip wound clips.
  • the mice were treated with PMO antisense to the HCV nucleic sequence spanning the AUG site of the first open reading frame, having the targeting sequence GTG CTC ATG GTG CAG GGT C (SEQ ID No. 35).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Animal Behavior & Ethology (AREA)
  • Oncology (AREA)
  • Communicable Diseases (AREA)
  • Public Health (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
EP04775901A 2003-04-24 2004-04-22 Antisense-antivirusmittel und verfahren zur behandlung einer ssrna-virusinfektion Withdrawn EP1623012A4 (de)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US10/422,671 US20030224353A1 (en) 2001-10-16 2003-04-24 Antisense antiviral agent and method for treating ssRNA viral infection
PCT/US2004/012623 WO2005007805A2 (en) 2003-04-24 2004-04-22 ANTISENSE ANTIVIRAL AGENT AND METHOD FOR TREATING ssRNA VIRAL INFECTION

Publications (2)

Publication Number Publication Date
EP1623012A2 true EP1623012A2 (de) 2006-02-08
EP1623012A4 EP1623012A4 (de) 2008-03-19

Family

ID=34078948

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04775901A Withdrawn EP1623012A4 (de) 2003-04-24 2004-04-22 Antisense-antivirusmittel und verfahren zur behandlung einer ssrna-virusinfektion

Country Status (5)

Country Link
US (1) US20030224353A1 (de)
EP (1) EP1623012A4 (de)
AU (1) AU2004257136A1 (de)
CA (1) CA2522508A1 (de)
WO (1) WO2005007805A2 (de)

Families Citing this family (41)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20020097241A (ko) * 2000-05-04 2002-12-31 에이브이아이 바이오파마 인코포레이티드 스플라이스-영역 안티센스 조성물 및 방법
WO2004085633A1 (en) * 2003-03-24 2004-10-07 The University Of Hong Kong A novel human virus causing severe acute respiratory syndrome (sars) and uses thereof
CA2523658A1 (en) * 2003-04-25 2005-03-03 Intradigm Corporation Rnai agents for anti-sars coronavirus therapy
ES2351976T3 (es) 2003-04-29 2011-02-14 Avi Biopharma, Inc. Composiciones para mejorar el transporte y la eficacia antisentido de análogos de ácidos nucleicos en células.
EP1668145A4 (de) * 2003-08-07 2010-03-10 Avi Biopharma Inc Sense-antivirusverbindung und verfahren zur behandlung einer ssrna-virusinfektion
US20050222068A1 (en) * 2003-10-23 2005-10-06 Mourich Dan V Method and antisense composition for selective inhibition of HIV infection in hematopoietic cells
US20050171044A1 (en) * 2003-12-24 2005-08-04 Stein David A. Oligonucleotide compound and method for treating nidovirus infections
EP1713332A4 (de) * 2004-01-23 2010-08-18 Avi Biopharma Inc Antisense-oligomere und verfahren zur induktion von immuntoleranz und immunosuppression
USRE48960E1 (en) 2004-06-28 2022-03-08 The University Of Western Australia Antisense oligonucleotides for inducing exon skipping and methods of use thereof
EP2500430B1 (de) 2004-06-28 2017-03-08 The University Of Western Australia Antisense-Oligonukleotide zur Induktion von Exon-Skipping sowie Verfahren zur Verwendung davon
DK1766012T3 (da) * 2004-07-02 2011-09-19 Avi Biopharma Inc Antisense-antibakteriel fremgangsmåde og forbindelse
US8129352B2 (en) * 2004-09-16 2012-03-06 Avi Biopharma, Inc. Antisense antiviral compound and method for treating ssRNA viral infection
US8357664B2 (en) 2004-10-26 2013-01-22 Avi Biopharma, Inc. Antisense antiviral compound and method for treating influenza viral infection
US7524829B2 (en) * 2004-11-01 2009-04-28 Avi Biopharma, Inc. Antisense antiviral compounds and methods for treating a filovirus infection
US20060240032A1 (en) * 2005-03-31 2006-10-26 Hinrichs David J Immunomodulating compositions and methods for use in the treatment of human autoimmune diseases
US8067571B2 (en) 2005-07-13 2011-11-29 Avi Biopharma, Inc. Antibacterial antisense oligonucleotide and method
WO2007030691A2 (en) * 2005-09-08 2007-03-15 Avi Biopharma, Inc. Antisense antiviral compound and method for treating picornavirus infection
WO2007030576A2 (en) 2005-09-08 2007-03-15 Avi Biopharma, Inc. Antisense antiviral compound and method for treating picornavirus infection
WO2007044468A2 (en) * 2005-10-05 2007-04-19 The Cbr Institute For Biomedical Research, Inc. Method to treat flavivirus infection with sirna
US8501704B2 (en) 2005-11-08 2013-08-06 Sarepta Therapeutics, Inc. Immunosuppression compound and treatment method
PL2735568T3 (pl) * 2006-05-10 2018-02-28 Sarepta Therapeutics, Inc. Analogi oligonukleotydowe mające kationowe połączenia pomiędzy podjednostkami
US8785407B2 (en) * 2006-05-10 2014-07-22 Sarepta Therapeutics, Inc. Antisense antiviral agent and method for treating ssRNA viral infection
CA2691673A1 (en) 2007-06-29 2009-01-08 Avi Biopharma, Inc. Tissue specific peptide conjugates and methods
AU2008345033B2 (en) * 2007-12-28 2014-04-03 Sarepta Therapeutics, Inc. Immunomodulatory agents and methods of use
KR20250016146A (ko) 2008-10-24 2025-02-03 사렙타 쎄러퓨틱스 인코퍼레이티드 Dmd를 위한 다중 엑손 스키핑 조성물
US8592386B2 (en) * 2008-12-17 2013-11-26 Sarepta Therapeutics, Inc. Antisense compositions and methods for modulating contact hypersensitivity or contact dermatitis
KR102239374B1 (ko) 2009-11-12 2021-04-14 더 유니버시티 오브 웨스턴 오스트레일리아 안티센스 분자 및 이를 이용한 질환 치료방법
KR101944119B1 (ko) 2009-11-13 2019-01-30 사렙타 쎄러퓨틱스 인코퍼레이티드 안티센스 항바이러스 화합물 및 인플루엔자 바이러스 감염을 치료하는 방법
KR20200133284A (ko) 2010-05-28 2020-11-26 사렙타 쎄러퓨틱스, 인코퍼레이티드 변형된 서브유니트간 결합 및/또는 말단 그룹을 갖는 올리고뉴클레오타이드 유사체
US8198429B2 (en) 2010-08-09 2012-06-12 Avi Biopharma, Inc. Antisense antiviral compounds and methods for treating a filovirus infection
WO2012031243A2 (en) 2010-09-03 2012-03-08 Avi Biopharma, Inc. dsRNA MOLECULES COMPRISING OLIGONUCLEOTIDE ANALOGS HAVING MODIFIED INTERSUBUNIT LINKAGES AND/OR TERMINAL GROUPS
CN107693797B (zh) 2011-05-05 2021-05-11 萨勒普塔医疗公司 肽寡核苷酸缀合物
KR102142689B1 (ko) 2011-11-18 2020-08-10 사렙타 쎄러퓨틱스, 인코퍼레이티드 기능적으로-변형된 올리고뉴클레오티드 및 이의 서브유니트
WO2013109057A1 (ko) 2012-01-18 2013-07-25 (주)바이오니아 자성나노입자-samirna 복합체 및 그 제조방법
CN105378081B (zh) 2013-03-14 2019-06-14 萨勒普塔医疗公司 用于治疗肌营养不良的外显子跳跃组合物
EP3662912B1 (de) 2013-03-15 2025-12-03 Sarepta Therapeutics, Inc. Verbesserte eteplirsen dosierungen zur behandlung von duchenne muskeldystrophie
US9695421B2 (en) * 2013-07-05 2017-07-04 Bioneer Corporation Dengue virus-specific siRNA, double helix oligo-RNA structure comprising siRNA, and composition for suppressing proliferation of dengue virus comprising RNA structure
RU2670164C2 (ru) 2013-07-05 2018-10-18 Байонир Корпорейшн Улучшенная олигонуклеотидная конструкция типа наночастицы, обладающая высокой эффективностью, и способ ее получения
US11020417B2 (en) 2015-06-04 2021-06-01 Sarepta Therapeutics, Inc Methods and compounds for treatment of lymphocyte-related diseases and conditions
EP3555293A4 (de) 2016-12-15 2020-08-12 Meharry Medical College Viruzide
US20230250169A1 (en) 2020-04-08 2023-08-10 Bergenbio Asa AXL Inhibitors for Antiviral Therapy

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2528107B2 (ja) * 1985-03-15 1996-08-28 サマ−トン,ジエ−ムス ポリヌクレオチド測定試薬と方法
US5506337A (en) * 1985-03-15 1996-04-09 Antivirals Inc. Morpholino-subunit combinatorial library and method
US5576302A (en) * 1991-10-15 1996-11-19 Isis Pharmaceuticals, Inc. Oligonucleotides for modulating hepatitis C virus having phosphorothioate linkages of high chiral purity
CA2125269A1 (en) * 1991-12-23 1993-07-08 Chiron Diagnostics Corporation Hav probes for use in solution phase sandwich hybridization assays
US6174868B1 (en) * 1992-09-10 2001-01-16 Isis Pharmaceuticals, Inc. Compositions and methods for treatment of hepatitis C virus-associated diseases
AU7513794A (en) * 1993-09-10 1995-03-27 E.I. Du Pont De Nemours And Company Improved process for preparing 2-amino-4,6-dichloropyrimidine
US5955318A (en) * 1995-08-14 1999-09-21 Abbott Laboratories Reagents and methods useful for controlling the translation of hepatitis GBV proteins
AU2002342057B2 (en) * 2001-10-16 2009-01-22 Avi Biopharma, Inc. Antisense antiviral agent and method for treating ssRNA viral infection
CA2501946C (en) * 2002-10-16 2014-12-23 Gen-Probe Incorporated Compositions and methods for detecting west nile virus
JP4791043B2 (ja) * 2002-12-31 2011-10-12 プロリゴ・エルエルシー 同一固体支持体上で、2以上のオリゴヌクレオチドをタンデムに合成するための方法および組成物

Also Published As

Publication number Publication date
EP1623012A4 (de) 2008-03-19
AU2004257136A1 (en) 2005-01-27
US20030224353A1 (en) 2003-12-04
WO2005007805A2 (en) 2005-01-27
CA2522508A1 (en) 2005-01-27
WO2005007805A3 (en) 2006-05-04

Similar Documents

Publication Publication Date Title
CA2463641C (en) Antisense antiviral agent and method for treating ssrna viral infection
US20030224353A1 (en) Antisense antiviral agent and method for treating ssRNA viral infection
US8785407B2 (en) Antisense antiviral agent and method for treating ssRNA viral infection
AU2002342057A1 (en) Antisense antiviral agent and method for treating ssRNA viral infection
EP1802777B1 (de) Antivirale antisense-verbindung und verfahren zur behandlung einer ssrna-virusinfektion
EP1654363B1 (de) Oligonukleotidanalog und verfahren zur behandlung von flavivirusinfektionen
EP1937278B1 (de) Antivirale antisense-verbindung und verfahren zur behandlung von picornavirus-infektion
AU2004263124B2 (en) Sense antiviral compound and method for treating ssRNA viral infection
HK1100961B (en) Antisense antiviral compound and method for treating ssrna viral infection
AU2013205445A1 (en) Antisense antiviral compound and method for treating picornavirus infection

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20051123

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL HR LT LV MK

PUAK Availability of information related to the publication of the international search report

Free format text: ORIGINAL CODE: 0009015

RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 39/215 20060101ALI20060516BHEP

Ipc: A61K 39/12 20060101ALI20060516BHEP

Ipc: C07H 21/04 20060101AFI20060516BHEP

RIC1 Information provided on ipc code assigned before grant

Ipc: C12N 15/11 20060101ALI20080205BHEP

Ipc: A61K 39/215 20060101ALI20080205BHEP

Ipc: A61K 39/12 20060101ALI20080205BHEP

Ipc: C07H 21/04 20060101AFI20060516BHEP

A4 Supplementary search report drawn up and despatched

Effective date: 20080214

17Q First examination report despatched

Effective date: 20080909

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090120