EP1407045A2 - Tests des retinoidstoffwechselpfades, sowie hierfür geeignete zusammensetzungen - Google Patents

Tests des retinoidstoffwechselpfades, sowie hierfür geeignete zusammensetzungen

Info

Publication number
EP1407045A2
EP1407045A2 EP01996629A EP01996629A EP1407045A2 EP 1407045 A2 EP1407045 A2 EP 1407045A2 EP 01996629 A EP01996629 A EP 01996629A EP 01996629 A EP01996629 A EP 01996629A EP 1407045 A2 EP1407045 A2 EP 1407045A2
Authority
EP
European Patent Office
Prior art keywords
polypeptide
isolated
perturbagen
sequence
isolated polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01996629A
Other languages
English (en)
French (fr)
Inventor
Carl Alexander Kamb
Burt Timothy Richards
Jon Karpilow
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Deltagen Proteomics Inc
Original Assignee
Deltagen Proteomics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Deltagen Proteomics Inc filed Critical Deltagen Proteomics Inc
Publication of EP1407045A2 publication Critical patent/EP1407045A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6897—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids involving reporter genes operably linked to promoters
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to certain nucleic acid sequences, amino acid sequences, other compositions and methods relating to the characterization and physiologic implications of the retinoic acid pathway.
  • retinoids in the treatment of disease has expanded in the past decade.
  • Retinoid therapy has been found to be helpful in the treatment of multiple forms of cancer including (i) small and non-small cell lung carcinoma (Ruotsalainen, T. et al. (2000), "Interferon-alpha and 13-cis-retinoic acid as maintenance therapy after high-dose combination chemotherapy with growth factor support for small cell lung cancer ⁇ a feasibility study," Anticancer Drugs ll(2):101-8; Recchia, F. et al. (1999), "Carboplatin, vindesine, 5-fluorouracil-leucovorin and 13-cis retinoic acid in the treatment of advanced non-small cell lung cancer.
  • retinoid therapy has also proven useful in treating several forms of dermatitis including but not limited to (i) hyperkeratosis (Okan, G. et al. (1999) "Nevoid hyperkeratosis of the nipple and areola: treatment with topical retinoic acid.” J Eur Acad Dermatol Venereol 13(3):218-20); (ii) eczema (Bollag ,W.
  • APL acute promyelocytic leukemia
  • APL is brought about by a reciprocal chromosomal translocation (t (15: 17) (q21- ql 1-22). Rabbitts, T.H. (1994) "Chromosomal translocations in human cancer.” Nature, 3J2: 143-149. These breaks lead to two unrelated genes, a portion of the retinoic acid receptor alpha (RAR ⁇ ) and a second gene designated PML (promyelocytic leukemia), to be ligated together to form a novel fusion protein, PML-RAR ⁇ ( Figure 1).
  • RAR ⁇ retinoic acid receptor alpha
  • PML promyelocytic leukemia
  • RAR ⁇ encodes a member of the Type II steroid receptor/transcription factor family and mediates the RA signal at specific RA-responsive promoters/enhancers called RAREs (retinoic acid response element).
  • RAREs retinoic acid response element
  • retinoic acid binds to either the homodimeric retinoic acid receptor (RAR RAR) or the heterodimeric RAR/RXR (retinoid X receptor) complex localized in the cytoplasm or nuclear compartment ( Figure 2).
  • RARE RAR homodimeric retinoic acid receptor
  • Figure 2 The association with the appropriate receptor complex, and subsequent binding of this complex to a RARE element, up-regulates transcription of the downstream gene(s).
  • ATRA all- trans retinoic acid
  • Acquired ATRA resistance is associated with an increase in gene transcription of CRABP H (cytosolic retinoic acid binding protein H) and P450 (Adamson, P.C. et al. (1993) "Time course of induction of metabolism of all-trans retinoic acid and the up-regulation of cellular retinoic acid binding protein.” Cancer Res 53, 472-476).
  • CRABP H cytosolic retinoic acid binding protein H
  • P450 Adamson, P.C. et al. (1993) "Time course of induction of metabolism of all-trans retinoic acid and the up-regulation of cellular retinoic acid binding protein.” Cancer Res 53, 472-476).
  • the increased expression of these two proteins leads to higher levels of proteins involved in ATRA catabolism and thus, is proposed to be the reason for low plasma ATRA levels observed in resistant patients undergoing differential therapy.
  • cisplatinin fail to exhibit specificity and thus are toxic to a wide range of cell types that divide rapidly, hi contrast, ATRA and related compounds appear to be effective agents in the treatment of several cancers; acting to heighten sensitivity of these cells to secondary pharmacological agents and, in the case of APL, directing an irreversible and terminal differentiation of promyelocytic leukemia cells.
  • the RA pathway appears to be one of a select group of recently identified pathways to which new drugs that exhibit a high degree of specificity can be designed.
  • the present invention relates to activity of RA-related pathways, as well as to compositions therefrom. More specifically, the present invention generally relates to methods for assessing RA pathway-related activity, and from such methods, obtaining perturbagens with RA-related activity. Such perturbagens then are used to obtain RA- related targets, which in turn can be used to identify potential therapeutics.
  • the invention also provides genetic material for the development of gene therapy agents, vectors and host cells.
  • the present invention provides polypeptides of Perturbagens R3, 802 and 820, biologically active fragments, analogs and modifications thereof, and polypeptides consisting essentially of such perturbagen sequences.
  • the invention provides polypeptides having at least 99%, at least 95%, at least 90%, at least 85% or at least 80% sequence identitity or homology with such perturbagens, and in other aspects provides N- and C-terminal fragments of such perturbagens.
  • Trie invention further provides a composition of such polypeptides in a pharmaceutically acceptable carrier, and for treating a RA-related condition with a therapeutically effective amount of a polypeptide of the invention.
  • the present invention also provides polypeptides having RA pathway activity that are fused to heterologous sequences, in some aspects a scaffold or more particularly, a fluorescent protein scaffold, and provides polypeptides having RA pathway activity that are chemically modified, or more particularly, radiolabelled, acetylated, glycosylated, or fluorescently tagged. Antibodies to the polypeptides of the invention also are provided.
  • the present invention further provides polynucleotides encoding Perturbagens
  • the invention provides polynucleotides encoding polypeptides having at least 99%, at least 95%, at least 90%, at least 85% or at least 80% sequence identity or homology with such perturbagens, and in other aspects provides polynucleotides encoding N- and C-terminal fragments of such perturbagens.
  • the polynucleotides are chemically synthesized.
  • the present invention further provides host cells, vectors, and gene therapy vectors comprising the polynucleotides of the invention.
  • the host cells of the invention further provide for methods for producing RA-related polypeptides by culturing such host cells and recovering such polypeptides.
  • the present invention also provides methods for identifying a cellular target that interacts with the polypeptides of the invention.
  • the method is performed in vitro and comprises detecting reporter expression, and in particular aspects, utilizes a yeast two-hybrid assay format.
  • the present invention further provides for the use of such target in screening for putative RA-related therapeutics, and in some aspects screens for disruption of polypeptide-target pairs.
  • a. combinatorial chemical library is so screened.
  • the present invention provides the PAT1 polypeptide, analogs and modifications thereof, and polypeptides consisting essentially of such perturbagen sequences.
  • the invention provides polypeptides having at least 99%, at least 95%, at least 90%, at least 85% or at least 80% sequence identitity or homology with the PAT1 polypeptide.
  • the present invention further provides polynucleotides encoding the PAT1 polynucleotide, analogs and modifications thereof, and polypeptides consisting essentially of such polypeptide sequences.
  • the present invention further provides host cells, vectors, and gene therapy vectors comprising the polynucleotides of the invention.
  • FIG. 1 Diagram of PML-RAR ⁇ chimeric protein. Both the DNA and ligand binding domains of the RAR ⁇ gene (dark boxes) are retained in the chimeric protein. In addition, the fusion also includes the presumptive DNA-binding zinc-finger domains and leucine zipper of PML.
  • FIG. 1 Activation of RA-responsive genes.
  • ATRA small black circles enters the cell by simple diffusion and binds to RAR homodimers or RAR-RXR heterodimers. Such complexes can translocate across the nuclear membrane and bind to promoter elements referred to as retinoic acid response elements (RARE). Binding of the receptor complex to a RARE promoter activates transcription of the downstream ATRA- responsive gene.
  • Figure 3. Diagram of Trans-FACS phenotypic assay. When each cell carries a reporter construct that is sensitive to compound "X" and a member of a perturbagen library, it is possible to isolate perturbagens that activate or suppress expression of the reporter.
  • Figure 4 A. Mapping the Biologically important region of a perturbagen. Four perturbagens are derived from different breakpoints within the same gene. By mapping the smallest sequence that is common to all four perturbagens (dotted line) it is possible to identify the biologically critical region (black box). B. Critical regions of a gene can be determined by deletion analysis. For instance, a series of N-terminal deletions (dotted line) can be tested for biological activity. In this way, regions of biological importance can be identified.
  • FIG. 5 Secondary assays.
  • ATRA stimulates the promylocytic cell line, HL60, to differentiate into a granulocyte-like cell.
  • HL60 promylocytic cell line
  • a perturbagen is introduced into HL60 cells and tested for its ability to mimic ATRA action.
  • Figure 6. Basic two-hybrid methodology. When bait and prey molecules interact, the Gal4-AD and Gal4-BD binding domains of the Gal4 transcriptional activator are reconstituted. As a result, this functional unit can sit down upon the Gall UAS and induce transcription of the reporter gene (lacZ).
  • FIG. 7 Four-Hybrid System. Host cell RNA targets are identified through a four-hybrid modification of the original two-hybrid scheme. Expanded region (lower left) pictures interaction between "bait" and "target” RNA molecules.
  • FIG. 9 DELFIATM .
  • the target is immobilized to a solid support using an Eu labeled monoclonal antibody.
  • the well is washed to remove unbound Cy5. Due to the close proximity of the Eu and Cy5 moieties in the bound complex, excitation of the lanthanide chelate leads to excitation (and emission) of Cy5.
  • a small molecule inhibitor black circles
  • the Eu-target and Gy5- ⁇ erturbagen moieties never come in close proximity.
  • the free, unbound, Cy5-peptide conjugate is removed and the Eu induced Cy5 signal is insignificant.
  • Figure 10 Analysis of pRAR ⁇ -EGFP library evolution and individual clones: A. A comparison of autofluorescence of WM35 with the original pRAR ⁇ -EGFP library (-ATRA), pRAR ⁇ -EGFP library (+ATRA), and the F3 sublibrary (+ATRA). B/C. A comparison of six clones (Cl, C5, C7, C8, C9 and CIO) in the presence and absence of ATRA.
  • FIG. 11 Analysis of RAR ⁇ 403. Histogram shows a comparison between the Clone 8 (-ATRA), Clone 8 (+ATRA), and Clone 8, RAR ⁇ 403 (+ATRA).
  • Figure 12 Bar Graph showing the four perturbagens that disrupt the RA pathway. Results from both the original (-1) and a second (-2) reading frame are plotted.
  • Figure 13a, b DNA and peptide sequence of four perturbagen clones that inactivate the RARE-GFP reporter.
  • Figure 14. Isolation of Activating Perturbagens.
  • C) Bar graph showing four activating perturbagens isolated. Note, "OF” out of frame
  • Figure 15a,b DNA and peptide sequence of perturbagens that up-regulate the expression of the RARE-GFP reporter construct.
  • Figure 16a-d DNA and peptide sequence of target molecules identified by two- hybrid procedures.
  • FIG. 18 Western Blot Results.
  • A. Yeast two-hybrid results showing scaffold independence of R3-PAT1 interaction
  • C. Western Blot of D? gel stained with anti-PATl antibodies
  • D. Western blot of total protein stained with anti-PATl to show all cells expressing PAT1 protein.
  • Figures 20-22. Vector diagrams.
  • perturbagen or "phenotypic probe” refers to an agent that is proteinaceous or ribonucleic in nature and acts in a transdo inant mode to interfere with specific biochemical processes in cells,i.e., through its interaction with specific cellular target(s) or other such component(s), capable of disrupting or activating a particular signaling pathway and/or cellular event.
  • Perturbagens may be encoded by a naturally derived library of compounds such as a cDNA or genomic DNA (gDNA) expression library, or an artificial library comprising synthetic oligonucleotide sequences of a desired length or range of lengths, e.g. a random peptide library.
  • proteinaceous perturbagen encompasses peptides, oligo- or polypeptides, proteins, protein fragments, or protein variants. Some proteinaceous perturbagens can be as short as three amino acids in length. Alternatively, these agents can be greater than 3 amino acids but less than ten amino acids. Other agents can be greater than ten amino acids but shorter than 30 axi ⁇ no acids in length. Still other agents can be greater than 30 amino acids but less than 100 amino acids in length. Still other agents can be greater than 100 amino acids in length. Naturally occurring proteinaceous perturbagens (i.e. those derived from cDNA or genomic DNA) exhibit a range in size from as little as three to several hundred amino acids.
  • synthetic perturbagens may range in size from three amino acids to fifty amino acids in length and more preferably, from three to 20 amino acids in length, and yet more preferably, about 15 amino acids in length.
  • the length of RNA perturbagens can vary. Some RNA perturbagens are as short as 6-10 nucleotides in length. Other RNA perturbagens are between 10 and 50 nucleotides in length. Still other RNA perturbagens are between 50 and 200 nucleotides in length. Other RNA perturbagens are greater than 200 nucleotides in length.
  • mimetic refers to a small molecule that (i) exerts the same or similar physiological or phenotypic effect in abioassay system or in an animal model as does a given perturbagen, or (ii) is capable of displacing a perturbagen from a target in a displacement assay.
  • small molecule refers to a chemical compound, for instance a peptide or oligonucleotide that may optionally be derivatized, natural product or any other low molecular weight (less than about 1 kDalton) organic, bioinorganic or inorganic compound, of either natural or synthetic origin. Such small molecules may be a therapeutically deliverable substance or may be further derivatized to facilitate delivery.
  • target refers to any cellular component that is directly acted upon by the perturbagen that leads to and or induces the phenotypic change, detectible for example in a bioassay system.
  • library or “genetic library” refer to a collection of nucleic acid fragments that may individually range in size from about a few to about a million basepairs, with typical expression librariesof about nine to about ten thousand basepairs. These fragments are generated using a variety of techniques familiar to the art.
  • sublibrary refers to a portion of a genetic library that has been isolated by application of a specific screening or selection procedure.
  • insert in the context of a library refers to an individual DNA fragment that constitutes a single member of the library.
  • reporter gene refers to nucleic acid sequences (or encoded polypeptides) for which screens or selections can be devised. Reporters may be proteins capable of emitting light, or genes that encode intracellular or cell surface proteins detectible by antibodies. Preferably, the reporter activity may be evaluated in a quantitative manner. Alternatively, reporter genes can confer antibiotic resistance.
  • gene refers to a DNA substantially encoding an endogenous cellular component, and includes both the coding and antisense strands, the 5' and 3' regions that are not transcribed but serve as transcriptional control domains, and transcribed but not expressed domains such as introns (including splice junctions), polyadenylation signals, ribosomal recognition domains, and the like.
  • polynucleotide or “nucleic acid molecule” are used interchangeably to refer to polymeric forms of nucleotides of any length.
  • the polynucleotides may contain deoxyribonucleotides, ribonucleotides and/or their analogs. Nucleotides may have any three-dimensional structure, and may perform any function, known or unknown.
  • polynucleotide includes single-, double-stranded and triple helical molecules.
  • Olionucleotide refers to polynucleotides of between 5 and about 100 nucleotides of single- or double-stranded DNA.
  • Oligonucleotides are also known as oligomers or oligos and may be isolated from genes, or chemically synthesized by methods known in the art.
  • a nucleic acid molecule may also comprise modified nucleic acid molecules, such as methylated nucleic acid molecules and nucleic acid molecule analogs.
  • Analogs of purines and pyrimidines are known in the art, and include, but are not limited to, aziridinycytosine, 4- acetylcytosine, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethyl-aminomethyluracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseudouracil, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, pseudouracil, 5- pentylnyluracil and 2,6-diaminopurine.
  • uracil as a substitute for thymine in a deoxyribonucleic acid is also considered an analogous form of pyrimidine.
  • fragment refers to any portion of a proteinaceous perturbagen that is at least 3 amino acids in length, or any RNA molecule that is at least 5 nucleotides in length.
  • biologically relevant or “biologically active” refer to that portion of a protein or protein fragment, RNA or RNA fragment, or DNA fragment that encodes either of the two previous entities, that is responsible for an observable phenotype (or for activation of a correlative reporter construct).
  • variant refers to biologically active forms of the perturbagen sequence
  • homologous refers to the percentage of residues in a candidate sequence that are identical with the residues in the reference sequence after aligning the two sequences and introducing gaps, if necessary, to achieve the maximum percent of overlap (see, for example, Altschul, S.F. et al. (1990) "Basic local alignment search tool.” J Mol Biol 215(3):403-10; Altschul, S.F. et al. (1997) "Gapped BLAST and PSI-BLAST: anew generation of protein database search programs.” Nucleic Acids Res 25(17):3389-402). It is understood that homologous sequences can accommodate insertions, deletions and substitutions in the nucleotide sequence.
  • linear sequences of nucleotides can be essentially identical even if some of the nucleotide residues do not precisely correspond or align.
  • the reference sequence may be a subset of a larger sequence, such as a portion of a gene or flanking sequence, or a repetitive portion of a chromosome.
  • scaffold refers to a proteinaceous or RNA sequence to which the perturbagen is covalently linked to provide e.g., conformational stability and/or protection from degradation.
  • Agents isolated from the methods described herein have broad potential and application.
  • the invention permits the definition of disease pathways, the identification of diagnostically or therapeutically useful targets, and the identification of therapeutic agents.
  • retinoic acid pathway-related genes that are mutated or down-regulated under disease conditions may be involved in causing or exacerbating the disease condition. Treatments directed at up-regulating the activity of such genes or treatments that involve alternate pathways may ameliorate the disease condition.
  • the agents and assays described herein thus have utility as models for diseases related to the retinoic acid pathway.
  • the assays may be utilized as part of a screening strategy designed to identify agents such as compounds that are capable of ameliorating disease symptoms.
  • RNA-based or proteinaceous agents each RNA-based or proteinaceous agent (or a mimetic, agonist or antagonist thereof identified through, e.g., routine small molecule screens) maybe useful as a direct therapeutic agent in the treatment of cancer and or various skin diseases.
  • a corresponding target molecule can be readily identified using standard interaction methodologies such as the two-hybrid technique.
  • targets are useful in the development of novel drugs for new chemotherapeutic strategies and may provide useful diagnostic tools for profiling the genetic background (genotype) of the particular disease under study.
  • the invention describes the isolation of new and previously unidentified perturbagens that alter the ability of a cell to detect and respond to all-trans retinoic acid (“ATRA”), and related targets.
  • ATRA all-trans retinoic acid
  • the perturbagens described herein were isolated using a phenotypic assay. See priority document U.S. Patent No. 5,955,275, "Methods for identifying nucleic acid sequences encoding agents that affect cellular phenotypes," the disclosure of which is incorporated by reference herein in its entirety. Briefly, the assay identifies agents that alter the responsiveness of a cell to ATRA and/or related compounds, including but not Hmited to 9-cis retinoic acid. To accomplish this, a library polynucleotide sequences is generated using a variety of techniques familiar to the art. After ligating this material into a standard expression vector, the library is transferred into a population of cells of a given type (e.g.
  • the assay advantageously identifies one or more relevant sequences from the library in the selected host cell population.
  • Cells expressing a biologically relevant perturbagen induce a particular phenotype (or correlative activation of a reporter gene), and are then separated from the rest of the population using, e.g., high-throughput Fluorescent Activated Cell Sorting (FACS) screening procedures.
  • FACS Fluorescent Activated Cell Sorting
  • a random primed library of 12 x 10 6 clones was constructed from cDNA isolated from placental tissue. This genetic library was transfected into an ATRA- sensitive melanoma cell line that contained a transcriptionalry regulated RA-responsive reporter, grown under conditions where RA was limiting and the reporter was initially substantially inactivated. Subsequently, roughly 50 million cells, representing a 4x fold coverage of the library, were subjected to FACS analysis to identify perturbagens that directly or indirectly activated the RA signal ( Figure 3).
  • ATRA-sensitive cells containing the above described reporter and library constructs are grown under conditions where sufficient but non- saturating amounts of ATRA are provided in the medium. Under these conditions, the reporter is activated in the vast majority of cells unless the cell contains a library sequence that directly or indirectly inactivates the RA pathway.
  • Perturbagen identification may elucidate the function of known genes, or alternatively may work in a black-box approach to identify new genes, gene products, or cellular targets.
  • perturbagens may be encoded by a previously identified gene (or gene fragment thereof). Such a gene may be one whose contribution to the disease pathway has previously been identified. Alternatively, the contribution of a gene to the pathway may have been previously unrecognized. In yet other cases, the perturbagen may be found to have no homology with any previously identified polynucleotide or proteinaceous agent.
  • Such perturbagens may be derived from previously unidentified genes, or alternatively may be random sequences that have the proper conformation and/or chemical characteristics needed to alter or modulate one or more components of a pathway(s) that influences the phenotype under investigation.
  • no prior knowledge of the perturbagen or of its corresponding gene, gene product or cellular target is necessary.
  • two or more variants of the same perturbagen may be identified and isolated from a single library without any additional screening steps.
  • the invention encompasses both the phenotypic probes (perturbagens) described herewith and the polynucleotide sequences encoding them.
  • phenotypic probes perturbagens
  • polynucleotide sequences encoding them may be describedby their RNA sequence, amino acid sequence, or correlative DNA sequence. Alternatively, the agents can be sufficiently described in terms of their identity as isolates of a library that exhibit a particular biological activity.
  • Perturbagens may be encoded by a variety of genetic libraries, including those developed from cDNA, gDNA, and random, synthetic oligonucleotides synthesized using current available methods in chemistry (see, for example, Caponigro et al. (1998) "Transdominant genetic analysis of a growth control pathway.” PNAS 95:7508-7513; Caruthers, M.H. et al. (1980) Nucleic Acids Symposium, Ser. 7:215-223; Horn, T. et al. (198.0) Nucleic Acids Symposium, Ser.7:225-232; Cwirla, S.E. et al. (1990) "Peptides on phage: a vast library of peptides for identifying ligands.” Proc Natl Acad Sci
  • the perturbagen itself can be synthesized using chemical methods.
  • peptide and RNA synthesis can be performed using various techniques (Roberge, J.Y. et al. (1995) "A strategy for a convergent synthesis of N-linked glycopeptides on a solid support.” Science 269:202-204; Zhang, X. et al. (1997) "RNA synthesis using a universal base-stable allyl linker.” NAR 25(20): 3980-3983) and diverse combinatorial peptide libraries can be constructed using, a variety of strategies such as the multipin strategy, the tea bag method, or the split-couple-mix method (see, for instance, Geysen, H.M.
  • the polynucleotide sequence encoding a perturbagen represents a fragment of an existing gene.
  • the perturbagen can be readily used to reverse engineer and identify the gene from which the phenotypic probe is derived.
  • the nucleic acid sequence of such a perturbagen may be extended utilizing a partial nucleotide sequence and employing various PCR-based methods known in the art to detect upstream sequences.
  • restriction site PCR uses universal and nested primers to amplify unknown sequence from genomic DNA within a cloning vector (Sarkar, G.
  • PCR Methods Applic. 2:318-322 Another method, inverse PCR, uses primers that extend in divergent directions to amplify unknown sequence from a circularized template.
  • the template is derived fror ⁇ restriction fragments comprising a known genomic locus and surrounding sequences (see Triglia, T. et al. (1988) "A procedure for in vitro amplification of DNA segments that lie outside the boundaries of known sequences.” NAR. 16:8186).
  • a third method, capture PCR involves PCR amplification of D ⁇ A fragments adjacent to known sequences in human and yeast artificial chromosome D ⁇ A (Lagerstrom, M. et al. (1991) "Capture PCR: efficient amplification of D ⁇ A fragments adjacent to a known sequence in human and YAC D ⁇ A.” PCR Methods Applic. 1:111-119).
  • multiple restriction enzyme digestions and ligations may be used to insert an engineered double stranded sequence into a region of known sequence before performing PCR.
  • Other methods which may be used to retrieve unknown sequences are known in the art (Parker, J.D. et al (1991) "Targeted gene walking polymerase chain reaction.” NAR. 19:3055-3060).
  • primers may be designed, using commercially available software such as OLIGO 4.06 Primer Analysis software (National Biosciences, Plymouth MN) or another appropriate program, to be about 22 to 30 nucleotides in length, to have a GC content of about 50% or more, and to anneal to the template at temperatures of about 68°C to 72°C.
  • the invention encompasses proteinaceous perturbagens, biologically active fragments, (N-terminal, C-terminal, or central) or variants thereof.
  • Proteinaceous perturbagens can exert their effects by multiple means.
  • a peptide may act by binding and disrupting the interactions between two or more proteinaceous entities within the cell.
  • a peptide perturbagen can bind to, and disrupt translation of a particular mRNA molecule.
  • peptide perturbagens may bind to genomic DNA and disrupt gene expression by altering the ability of one or more transcription factor(s) (e.g. activators or repressors) from binding to a critical enhancer/promoter region of the regulatory region of the gene.
  • transcription factor(s) e.g. activators or repressors
  • Penetrance is another property of perturbagens. Penetrance is defined as the number of cells exhibiting a particular phenotype divided by the total number of cells in the experiment (when a perturbagen is present in the cells), minus the total number of cells exhibiting a particular phenotype divided by the total number of cells in the experiment when the perturbagen is not present in the cells.
  • the penetrance of any given pertubagen can vary depending upon a variety of parameters including 1) the cell type it is being expressed in, 2) the vector being used to express the perturbagen, 3) the biological stability (half-life) of the perturbagen or mRNA encoding the perturbagen 4) the concentration of the perturbagen in the cell, as well as other parameters.
  • a desirable, biologically active perturbagen may present a relatively low rate of penetrance.
  • perturbagens of low penetrance may be obtained and manipulated via standard cycling and/or amplification procedures.
  • some preferred perturbagens may exhibit as low as 1-2% penetrance.
  • Other preferred perturbagens may exhibit between 2% and 5% penetrance, between 5 and 10% penetrance, 10% and 20% penetrance, between 20% and 50% penetrance, or even in some instances, between 50% and 100% penetrance.
  • the action, penetrance, or biological activity of a perturbagen may be affected in some part by the scaffold to which it is associated.
  • the scaffold may drive the perturbagen to adopt a conformation that enhances its biological action.
  • one or more neighboring residues from, e.g., the C-terminus of a scaffold may act in concert with the perturbagen to enhance the functionality of the molecule.
  • the complete biologically active sequence may include one or more C-terminal residues derived from the scaffold molecule. Multiple techniques may be used to determine the contribution of the scaffold to the phenotypic effect of any given perturbagen.
  • perturbagen sequences can be shifted to alternative scaffolds and retested for biological activity. If these procedures result in a significant loss of the perturbagen' s activity, a fusion between the perturbagen and, for instance, the 30-most residues from the C-terminus of the scaffold may be linked to a second scaffold molecule and retested for biological activity. Should operations such as these lead to the recovery of lost activity, experiments in which smaller and small portions of the scaffold are associated with the perturbagen can be tested.
  • the phenotypic probe is an RNA molecule which is itself active (i.e. is not acting through the correlative encoded protein or peptide that results from translation of the RNA).
  • RNA molecules may act to inhibit or activate a biological pathway.
  • the RNA perturbagen acts in an antisense mode to disrupt ribonucleic acid transcription or translation of a cellular mRNA target via hybridization to a target ribonucleic acid (Weiss, B. et al.(1999) "Antisense RNA gene therapy for studying and modulating biological processes.” Cell Mol Life Sci. 55(3):334-58).
  • RNA perturbagens may act as a RNA-PRO agents, disrupting or activating the ATRA pathway by interacting with proteinaceous components of the cell (see Sengupta, D . (1999) "Identification of RNAs that bind to a specific protein using the yeast three-hybrid system.” RNA 5:596-601).
  • RNA agents act as a triplex-forming oligonucleotide (TFO) agents to interact with promoter sequences, exons, introns, or other portions of genomic DNA to disrupt or activate transcription of components of the ATRA pathway (see Postel, E.H. et al. (1989) "Evidence that a triplex-forming oligonucleotide binds to the c-myc promoter in HeLa cells, thereby reducing c-myc RNA levels.” PNAS 88: 8227-8231; Svinarchuk, F. et al. (1997) "Recruitment of transcription factors to the target site by triplex-forming oligonucleotides.” NAR 25:3459-3464.
  • TFO triplex-forming oligonucleotide
  • RNA perturbagens are dependent upon the perturbagen stability or half-life, the perturbagen' s ability to achieve access to the target molecule, and other factors.
  • Perturbagens may also exhibit cross-reactivity.
  • a variety of host target proteins can contain similarities in both the primary and secondary structure.
  • one or more of the agents described herein may exhibit affinity for one or more target variants/isoforms present in nature.
  • agents identified in the following screens may exhibit affinity for two or more functionally unrelated proteins that contain regions or domains that share homology or related functional groups.
  • a perturbagen that recognizes a zinc-binding domain of one protein may also show affinity for the homologous (and functionally equivalent) region of a second protein (see, e.g., Mavromatis K. O. et al. (1997) "The carboxyl-terminal zinc-binding domain of the human papillomavirus E7 protein can be functionally replaced by the homologous sequences of the E6 protein.” Viral Research 52(1):109-18). In cases where such interactions lead to relevant biological phenotypes, the underlying mechanism(s) may differ considerably from those brought about by the original perturbagen-target interactions.
  • Host range is another characteristic of perturbagens.
  • the term "host range” refers to the breadth of potential host cells that exhibit perturbagen-induced phenotypes. In some instances, such as the case where the perturbagen is represented by an apoptosis- inducing fragment of BID, the host range is broad, due to the near ubiquitous participation of BK) or BID-like agents in the apoptotic pathway of many cells. In contrast, some perturbagens have a very limited host range due to, for instance, the restricted expression of the perturbagen target.
  • the invention includes sequence variants of both the phenotypic probes and the polynucleotide sequences that encode them.
  • variants contain at least one amino acid substitution, deletion, or insertion from the original isolated form of the perturbagen that provides biological properties that are substantially similar to those of the initial perturbagen.
  • variants of RNA-based phenotypic probes contain at least one nucleotide substitution, deletion, or insertion when compared to the original isolated sequence.
  • variants may also be identified by the relative amounts of homology they have in common with the original perturbagen sequence.
  • a variant of a proteinaceous perturbagen may be described in terms of defining the nature of an amino acid substitution.
  • Constant substitutions are those in which the substituting residue is structurally or functionally similar to the substituted residue.
  • the substituting and substituted residue will be from structurally or functionally different classes. For the purposes herein, these classes are as follows: 1. Electropositive: R, K,H; 2.
  • variants have between 95% and greater than 99% polypeptide sequence identity with the original perturbagen agent.
  • the homology between two perturbagens (variants) is confined to a small region of the molecule (e.g. a motif).
  • conserved sequences are often indicative of regions that contain biologically important functions and suggest the perturbagens share a common cellular target. In these situations, while only limited and conservative amino acid changes are desirable within the region of the motif, greater levels of variation can exist in adjacent and more distal portions of the polypeptide.
  • variants of RNA perturbagens may also be described in terms of percent homology.
  • the variant ribonucleotide sequences can have 65-75% homology with the original agent.
  • the variants have between 75% and 85% homology with the original agent or between 85% and 95% homology with the original perturbagen sequence, or even between 95% and greater than 99% sequence identity with the original perturbagen agent.
  • greater variation can, in some embodiments, exist outside an identified region/motif without altering biological activity.
  • the degree of variance will depend upon and/or reflect the degeneracy of the genetic code.
  • a given phenotypic probe is encoded by a selection Of polynucleotide sequences. Therefore, the invention encompasses each variation of polynucleotide sequence that encodes the given perturbagen, such variations being made in accordance with the standard triplet genetic code as applied to the polynucleotide sequence of each perturbagen.
  • all such corresponding DNA variations are to be considered as being specifically disclosed.
  • Variants of phenotypic probes may arise by a variety of means. Some Variants may be artif actual and result from, for instance, errors that occur in the process of PCR amplification or cloning of the perturbagen encoding sequence. Alternatively, variants may be constructed intentionally. For instance, it may be advantageous to produce nucleotide sequences encoding perturbagens possessing a substantially different codon usage. Codons may be selected to increase the rate at which expression of the peptide or RNA occurs in a particular prokaryotic or eukaryotic cell in accordance with the frequency with which particular codons are utilized by the host (Berg, O.G.
  • RNA transcripts that have increased half-life. This may be accomplished by altering a sequence's structural stability (see, for example, Gross, G. et al. (1990) "RNA primary sequence or secondary structure in the translational initiation region controls expression of two variant interferon-beta genes in Escherichia coli.” J Biol Chem. 265(29): 17627-36; Ralston, C.Y. et al.
  • the category of intentional variants are those whose sequence has been altered in order to add or deleted sites involved in post-translational modification. Included in this list are variants in which phosphorylation sites, acetylation sites, methylatiori sites, and/or glycosylation sites have been added or deleted (see, for example, Wicker-Planquart, C. (1999) "Site- directed removal of N-glycosylation sites in human gastric lipase.” Eu JBiochem. 262(3):644-51; Dou, Y. (1999) "Phos-phorylation of linker histone HI regulates gene expression in vivo by mimicking HI removal.” Mol Cell.4(4):641-7).
  • Variants may also arise as a result of simple and relatively routine techniques involving random mutagenesis or DNA shuffling; procedures that are often used to rapidly evolve perturbagen encoding sequences and allow identification of variants that have increased biological stability or activity (see, for instance, Ner, S.S. et al. (1988) "A simple and efficient procedure for generating random point mutations and for codon replacements using mixed oligonucleotides.” DNA 7:127-134; Stemmer ,W. (1994) "Rapid evolution of a protein in vitro by DNA shuffling.” Nature 370:389-391).
  • the fragment encoding the perturbagen is PCR amplified under conditions that increase the error rate of Taq polymerase.
  • the error rate of Taq polymerase may be increased from 1.0 x 10 "4 errors per nucleotide per pass of the polymerase, to approximately 7 x 10 "3 errors per nucleotide per pass. Amplifying a perturbagen-encoding sequence under these conditions allows the development of a library of dissimilar sequences which can subsequently be screened for variants that exhibit improved biological activity.
  • variants may also exist.
  • a perturbagen derived from a sequence that exists in multiple copies within the genome (e.g. duplications, repetitive sequences)
  • Such sequences often contain polymorphisms that result in alterations in the encoded RNA and polypeptide sequence (see, for example, Satoh, H. et al. (1999) "Molecular cloning and characterization of two sets of alpha-theta genes in the rat alpha-like globin gene cluster.” Gene 230(l):91-9) and thus, may represent natural variants of the perturbagen agent.
  • variants may be isolated as a result of allelic variation (see, for example, Posnett, D.N. (1990) "Allelic variations of human TCR V gene products.” Immunol Today. ll(10):368-73). Variants of phenotypic probes may arise by these and other means.
  • Variants of any given perturbagen may in some instances exhibit additional biological properties.
  • perturbagens that previously recognized only a single target may demonstrate broadened specificity, e.g., may bind multiple isoforms or serotypes of a target in response to the alteration of a single amino acid in the perturbagen variant.
  • a perturbagen having a specific phenotype in one cell may exhibit additional phenotypes or may exhibit a broader effective host range after making small alterations in perturbagen variant sequence.
  • D. Biologically Active Fragments Some embodiments of the invention encompass biologically active fragments of a given proteinaceous or RNA-based perturbagen.
  • Biologically active fragments may be compromised of N-terminal, C-terminal, or internal fragments of peptide perturbagens, or 5', 3' or internal fragments of RNA perturbagens.
  • the fragment encodes or represents portions of a natural gene.
  • the fragment is derived from a larger polynucleotide or polypeptide that has no known natural counterpart.
  • biologically active regions of a perturbagen can be artificially synthesized (by chemical or recombinant methods) so that multiple, tandem copies of the phenotypic probe are covalently linked together and expressed. All such biologically active perturbagen fragments are, in turn, encoded by a variety of correlative DNA sequences.
  • the biologically active portion of a molecule can be identified by several means.
  • biological relevant regions can be deduced by simple physical mapping of families of overlapping sequences isolated from a phenotypic assay (Hingorani, . et al. (2000) "Mapping the functional domains of nucleolar protein B23.” / Biol Chem May 26).
  • multiple perturbagens derived from alternative breakpoints of the same gene, may be isolated from one or more genetic libraries. ( Figure 4).
  • the smallest region that is common to all of the perturbagens can demarcate the area of biological importance.
  • critical regions of a perturbagen can frequently be distinguished by comparing the polynucleotide and/or amino acid sequence of two or more perturbagens that share a common target (see, for example, Gr ndy, W.N. (1998) “Homology detection via family pair-wise search.” / Comput Biol. 5(3):4J9-9; Gorodkin, J. et al. (1997) "Finding common sequence and structure motifs in a set of RNA sequences.” Ismb 5:120-3).
  • conserved sequences (or motifs) that are identified by this form of analysis often provide important clues necessary to determine biologically important regions of a given molecule.
  • the gene encoding a particular perturbagen can be subjected to deletion analysis whereby portions of the gene are removed in a systematic fashion, thus allowing the remaining entity to be retested for its ability to evoke a biological response (see, for example, Huhn, J. et al. (2000) "Molecular analysis of CD26-mediated signal transduction in cells.” Immunol Lett 72(2):127-132; Davezac, N. et al. (2000) "Regulation of CDC25B phosphatases subcellular localization.” Oncogene 19(18):2179- 85).
  • biologically critical regions of a molecule can be identified by inducing mutations in the sequence encoding the polypeptide (see, for example, Ito, Y. et al. (1999) "Analysis of functional regions of YPM, a superantigen derived from gram- negative bacteria.” EurJBiochem; 263(2):326-37; Kim, S.W. et al. (2000) 'Identification of functionally important amino acid residues within the C2-domain of human factor V using alanine-scanning mutagenesis.” Biochemistry 39(8): 1951-8.). Subsequent testing of the variants of said molecule for biological activity enables the investigator to identify regions of the perturbagen that are both critical and sensitive to manipulation.
  • molecular probes such as monoclonal antibodies and epitope-specific peptides can be useful in the identification of biologically important regions of a perturbagen (see, for example, Midgley, C. A. et al. (2000) "An N-terminal pl4ARF peptide blocks Mdm2-dependent ubiquitination in vitro and can activate p53 in vivo.” Oncogene 19(19):2312-23; Lu, D. et al. (2000) "Identification of the residues in the extracellular region of KDR importantf ⁇ r interaction with vascular endothelial growth factor and neutralizing anti- DR antibodies.” J Biol Chem 275(19): 14321-30).
  • heterologous sequence(s) include versions of the perturbagens that are i) scaffolded by other entities, ii) tagged with marker sequences that can be recognized by antibodies or specific peptides, iii) altered to transform post-translational patterns of modification, or iv) altered chemically so as to cyclicize the molecule for alternative pharmacodynamic/pharmacokinetic properties.
  • Peptide perturbagens can be fused to protein scaffolds at N-terminal, C-terminal, or internal sites.
  • RNA de ⁇ ved perturbagens can be fused to RNA sequences at 5', 3' or internal sites.
  • the fusion of a perturbagen to a second entity can increase the relative effectiveness of the perturbagen by increasing the stability of either the messenger RNA (mRNA) or protein of said agent.
  • scaffolds may be a relatively inert protein, (i.e. having no enzymatic activity or fluorescent properties) such as hemagglutinin.
  • Such proteins can be stably expressed in a wide variety of cell types without disrupting the normal physiological functions of the cell.
  • scaffolds may serve a dual function, e.g., increasing perturbagen stability while at the same time, serving as an indicator or gauge of the level of perturbagen expression.
  • the scaffold may be an autofluorescent molecule such as a green fluorescent protein (Clontech) or embody an enzymatic activity capable of altering a substrate in such a way that it can be detected by eye or instrumentation (e.g. ⁇ galactosidase).
  • various molecular techniques that are common to the field are used to link the perturbagen library to, e.g., the C-terminus of a nonfluorescent variant of GFP.
  • dEGFP (also referred to as “dead-GFP”) is one such nonfluorescent variant brought about by conversion of Tyr -> Phe ' at codon 66 of EGFP (Clontech).
  • each library member is fused to a separate dEGFP molecule.
  • Such chimeric fusions can easily be detected by Western Blot analysis using antibodies directed against GFP and are useful in determination of intracellular expression levels of perturbagens.
  • the perturbagen may be directed to a particular compartment within the host cell.
  • proteinaceous perturbagens can be directed to the nucleus of certain cell types by attachment of a nuclear localization sequence (NLS); a heterogeneous sequence made up of short stretches of basic amino acid residues recognized by importins alpha and/or beta.
  • NLS nuclear localization sequence
  • heterogeneous sequence made up of short stretches of basic amino acid residues recognized by importins alpha and/or beta.
  • Perturbagens can be constructed to contain a heterologous moiety (a "tag") that is recognized by a commercially available antibody.
  • heterologous forms may facilitate studies of subjects including, but not limited to, i) perturbagen subcellular localization, ii) intracellular concentration assessment and iii) target binding interactions.
  • the tagging of a perturbagen may also facilitate purification of fusion proteins using commercially available matrices (see, for example, James, E.A. et al. "Production and characterization of biologically active human GM-CSF secreted by genetically modified plant cells.” Protein Expr Purif. 19(1): 131-8; Kilic, F. and Rudnick, G.
  • tag moieties include, but are not limited to glutathione-S-transferase (GST), maltose binding protein (MBP), thioredoxin (Trx), calmodulin binding peptide (CBP), 6-His, FLAG, c ⁇ myc, and hemagglutinin (HA).
  • GST, MBP, Trx, CBP, and 6-His enable purification of their cognate fusion proteins on immobilized glutathione, maltose, phenylarsine oxide, calmodulin, and metal-chelate resins, respectively.
  • FLAG, c-myc and HA enable immunoaffinity purification of fusion proteins using commercially available monoclonal and polyclonal antibodies that specifically recognize these epitope tags.
  • Such fusion proteins may also be engineered to contain a proteolytic cleavage site located between the perturbagen sequence and the heterologous protein sequence, so that the perturbagen may be cleaved away from the heterologous moiety following purification. ' A variety of commercially available kits may be used to facilitate expression and purification of fusion proteins. 3. Chemically Modified Perturbagens
  • chemical modification encompass a variety of modifications including, but not limited to, perturbagens that have been radiolabeled with 32 P or 35 S, acetylated, glycosylated, or labeled with fluorescent molecules such as FITC or rhodamine. These modifications may be directly imposed on the perturbagen itself (see, for example, Shuvaev, V. V. et al. (1999) "Glycation of apolipoprotein E impairs its binding to heparin: identification of the major glycation site.” Biochim Biophys Act ⁇ 1454(3) :296-308; Dobransky, T. et al.
  • the invention also encompasses polynucleotide sequences that are capable of hybridizing to the claimed polynucleotide sequences encoding phenotypic probes and said variants of such entities described previously, under various conditions of stringency.
  • Such reagents may be useful in i) therapeutics, ii) diagnostic assays, iii) immunocytology, iv) target identification, and v) purification.
  • the sequence encoding a particular perturbagen is introduced into a subject for gene therapeutic purposes, it may be necessary to monitor the success of integration and the levels of expression of said agent by Southern and Northern Blot analysis respectively (Pu, P. et al.
  • hybridization may be used as a tool to define or describe a perturbagen variant or fragment, and a hybridizing sequence thus may have direct relevance as an ATRA mimetic or other such therapeutic agent.
  • hybridization refers to any process by which a strand of nucleic acid binds with a complementary or near-complementary strand through base pairing.
  • stringent salt concentrations will ordinarily be less than about 750mM NaCl and 75mM trisodium citrate, preferably less than about 500mM NaCl and 50mM trisodiium citrate, and most preferably less than about 250mM NaCl and 25mM trisodium citrate.
  • Low stringency hybridization can be obtained in the absence of organic solvent (e.g.
  • stringency hybridization while high stringency hybridization can be obtained in the presence of at least about 35% formamide, and most preferably at least about 50% formamide.
  • Stringent temperature conditions will ordinarily include temperatures of at least about 30°C, more preferably of at least about 37°C, and most preferably of at least about 42°C. Varying additional parameters, such as hybridization time, the concentration of detergent and the inclusion or exclusion of carrier DNA are well known to those skilled in the art Various levels of stringency are accomplished by combining these various conditions as needed. In a preferred embodiment, hybridization will occur at 30°C in 750 mM NaCl, 75mM trisodium citrate, and 1% SDS.
  • hybridization will occur at 37°C in 500 mM NaCl, 50mM trisodium citrate, 1% SDS, 35% formamide and lOOug/ml denatured salmon sperm DNA (ssDNA). In a most preferred embodiment, hybridization will occur at 42°C in 250 mM NaCl, 25mM trisodium citrate, 1% SDS, 50% formamide and 200ug/ml denatured ssDNA. Useful variations on these conditions will be readily apparent to those skilled in the art.
  • wash stringency conditions can be defined by salt concentration and by temperature. As above, wash stringency can be increased by decreasing salt concentration or by increasing temperature.
  • stringent salt concentrations for the wash steps will preferably be less than about 30mM NaCl and 3mM trisodium citrate, and most . preferably less than about 15mM NaCl and 1.5mM trisodium citrate.
  • Stringent temperature conditions for the wash steps will ordinarily include temperatures of at least about 25°C, more preferably of at least about 42°C, and most preferably of at least about 68°C. In a preferred embodiment, wash steps will occur at 25°C in 30mM NaCl, 3mM trisodium citrate and 0.1% SDS.
  • wash steps will occur at 42°C in 15mM NaCl, 1.5mM trisodium citrate and 0.1% SDS. In a most preferred embodiment, wash steps will occur at 68°C in 15mMNaCl, 1.5mM tiisodium citrate and 0.1% SDS. Additional variations on these conditions will be readily apparent ' to those skilled in the art.
  • G Expression Vectors The DNA sequence encoding each perturbagen or target (or variant or fragment thereof) may be inserted into an expression vector which contains the necessary elements for transcriptional/translational control in a selected host cell.
  • DNA sequence may be expressed for, e.g., testing in a bioassay such as those described herein, or in a binding assay such as those described herein, or for production and recovery of the proteinaceous agent.
  • Methods which are well known to those skilled in the art are used to construct expression vectors containing sequences encoding the perturbagens and the appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination (see Sambrook, J. et al. (1989) "Molecular Cloning, A Laboratory Manual", Cold Spring Harbor Press, Plainview NY).
  • Exemplary expression vectors may include one or more of the following: (i) regulatory sequences, such as enhancers, constitutive and inducible promoters, and or (ii) 5' and 3' untranslated regions, and/or (iii) mRNA stabilizing sequences or scaffolds, for optimal expression of the perturbagen in a given host.
  • regulatory sequences such as enhancers, constitutive and inducible promoters, and or (ii) 5' and 3' untranslated regions, and/or (iii) mRNA stabilizing sequences or scaffolds, for optimal expression of the perturbagen in a given host.
  • intracellular perturbagen levels can be modulated using alternative promoter sequences such as CMV, RSV, and SV40 promoters, to drive transcription (see, for example, Zarrin, A.A. et al.
  • inducible promoter systems e.g. ponesterone-induced promoter (PIND, Invitrogen, see Dunlop, J. et al. (1999) "Steroid hormone-inducible expression of the GLT-1 subtype of high-affinity 1-glutamate transporter in human embryonic kidney cells.” Biochem Biophys Res Commun. 265(1): 101-5), tissue specific enhancers (see Scharf, D. et al. (1994) Results Probl.
  • paired expression vector/host systems may be utilized to contain and express sequences encoding the perturbagens.
  • selection of a given system is dictated by the purpose of expression: e.g., bioassay, binding assay, or production of proteinaceous product for subsequent isolation and purification.
  • Such systems include, but are not limited to, microorganisms such as bacteria transformed with recombinant bacteriophage, plasmid or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with viral expression vectors (e.g. baculovirus), plant cell systems transformed with viral expression vectors (e.g. tobacco mosaic virus, TMV) or with bacterial expression vectors (e.g.
  • Ti or pBR322 plasmids or mammalian cell systems (e.g. COS, CHO, BHK, 293, 3T3) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metall ⁇ thionine promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5 K promoter).
  • the host cell employed does not limit the invention.
  • a number of cloning and expression vectors may be- selected depending upon the use intended for polynucleotide sequences encoding the perturbagens.
  • routine cloning, subcloning, and propagation of polynucleotide sequences encoding perturbagens can be achieved using a multifunctional E. coli Vector such as PBLUESCRIPT (Stratagene, La Jolla Ca). Ligation of sequences encoding perturbagens into the vector's cloning site disrupts the lacZ gene, allowing a colorimetric screening procedure for identification of transformed bacteria containing recombinant molecules.
  • these vectors may be useful for in vitro transcription, dideoxy sequencing, single strand rescue with helper phage, and creation of nested deletions in the cloned sequence, (see e.g., Van Heeke, G. and Schuster, S.M.
  • vectors which direct high level expression of perturbagens may be used.
  • Exemplary vectors feature the strong, inducible T5 or T7 bacteriophage promoter; the E.
  • coli expression vector pUR278 (Ruther et al, EMBO J., 2:1791-94 (1983)), in which the gene protein coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (fnouye & Inouye, Nucleic Acids Res., 13:3101-09 (1985); * Van Heeke et al, J. Biol. Chem., 264:5503-9 (1989)); and the like.
  • pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST).
  • fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
  • the pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned anaphylatoxin C3a receptor gene protein can be released from the GST moiety.
  • Yeast expression systems may also be used for production of perturbagens.
  • a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH promoters, may be used in the yeast Saccharomyces cerivisiae or related strains.
  • such vectors can be designed to direct either the secretion or intracellular retention of expressed proteins and enable integration of foreign sequences in the host genome for stable propagation, (see, e.g. Bitter, G.A. et al. (1987) "Expression and secretion vectors for yeast.” Methods Enzymology. 153:516-544; and Scorer, CA. et al. (1994) "Rapid selection using G418 of high copy number transformants of Pichia pastoris for high-level foreign gene expression.” Biotechnology 12:181-184).
  • a number of viral-based expression systems may be utilized.
  • the gene coding sequence of interest may be ligated to an adenovirus transcription translation control complex, e.g. , the late promoter and tripartite leader sequence.
  • This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing gene protein in infected hosts, (e.g., see Logan et ⁇ l, Proc. N ⁇ tl Ac ⁇ d.
  • Specific initiation signals may be used to achieve more efficient translation of sequences encoding the perturbagen. Such signals include the ATG initiation codon and adjacent sequences, e.g. the Kozak sequence. In cases where sequences encoding the perturbagen and its initiation codon and upstream regulatory sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence is inserted, exogenous translational control signals including an in-frame ATG initiation codon are provided by the vector. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert.
  • exogenous translational elements and initiation codons may be of various origins, both natural and synthetic.
  • the efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bitter, et al, Methods in Enzymol, 153:516-44 (1987)).
  • many of these elements are not required in vectors that are specific for RNA-based perturbagens. Instead, sequences that stabilize the RNA transcript or direct the RNA sequence to a particular compartment will be included (see, for instance, Wood Chuck post transcriptional regulatory element, WPRE, Zufferey, R. et al. (1999) "Woodchuck hepatitis virus posttranscriptional regulatory element enhances expression of transgenes delivered by retroviral vectors.” J Virol 73(4):2886-92).
  • Plant systems may also be used for expression of perturbagens. Transcription of sequences encoding perturbagens may be driven by viral promoters, e.g. the 35S and 19S promoters of CaMV used alone or in combination with the omega leader sequence from TMV (Takamatsu, N. (1991) "Deletion analysis of the 5' untranslated leader sequence of tobacco mosaic virus RNA.” / Virology 65:1619-22). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters may be used, (see, for example, Coruzzi, G. et al.
  • the gene coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Successful insertion of gene coding sequence will result in inactivation of the polyhedrin gene and production of non- occluded recombinant virus (i.e. , virus lacking the proteinaceous coat coded for by the polyhedrin gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed (see, e.g., Smith, et at-., J. Virol. 46: 584-93 (1983); U.S. Patent No.4,745,051).
  • a host cell strain may be chosen that modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein.
  • Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells that possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used.
  • Such mammalian host cells include but are not limited to CHO, VERO, BH , HeLa, COS, MDC , 293, 3T3, WI38, etc.
  • the selected construct can be introduced into the selected host cell by direct DNA transformation or pathogen-mediated transfection.
  • transformation and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electiroporation.
  • Preferred technologies for introducing perturbagens into mammalian cells include, but are not limited to, retroviral infection as well as transformation by EB V or similar episomally-maintained viral vectors (Makrides, S.C. (1999) "Components of vectors for gene transfer and expression in mammalian cells.” Protein Expr Purif 17(2): 183-202).
  • Other suitable methods for transforming or transfecting host cells can be found in Maniatis, T. et al ("Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor Laboratory Press) and other standard laboratory manuals. For long term production of recombinant proteins in mammalian systems, stable expression of perturbagens in cell lines is preferred.
  • sequences encoding perturbagens can be transformed or introduced into cell lines using expression vectors which may contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector.
  • cells can be transfected using, for instance, retroviral, adenoviral, or adeno-associated viral agents as delivery systems for the perturbagen.
  • retroviral vectors e.g. LRCX, Clontech
  • retroviral vectors may be used to introduce and express perturbagens in a variety of mammalian cell cultures.
  • Such vectors may rely on the virus' own 5' LTR as a means of driving perturbagen expression or may utilize alternative promoters/enhancers (e.g. those of CMV, RSN and SV40, PT ⁇ D) to regulate perturbagen expression levels.
  • timing and/or quantity of expression of the recombinant protein can be controlled using an inducible expression construct.
  • Inducible constructs and systems for inducible expression of recombinant proteins will be well known to those skilled in the art.
  • Examples of such inducible promoters or other gene regulatory elements include, but are not limited to, tetracycline, metallothionine, ecdysone, and other steroid-responsive promoters, rapamycin responsive promoters, and the like (No, et ⁇ l, Proc. N ⁇ tl. Ac ⁇ d. Sci. USA, 93:3346-51 (1996); Furth, et at " ., Proc. N ⁇ tl. Ac ⁇ d. Sci.
  • Tet inducible gene expression system is utilized. (Gossen et ⁇ l, Proc. N ⁇ tl. Ac ⁇ d. Sci. USA, 89:5547-51 (1992); Gossen, et ⁇ l, Science, 268:1766-69 (1995)). Tet Expression Systems are based on two regulatory elements derived from the tetracycline-resistance peron of the E.
  • TetR tetracycline repressor protein
  • tetO tetracycline operator sequence
  • expression of the recombinant protein is placed under the control of the tetO operator sequence and transfected or transformed into a host cell.
  • TetR which is co-transfected into the host cell
  • expression of the recombinant protein is repressed due to binding of the TetR protein to the tetO regulatory element.
  • Tc tetracycline
  • Do ⁇ doxycycline
  • the gene protein When used as a component in an assay system, the gene protein may be labeled, either directly or indirectly, to facilitate detection of a complex formed between the gene protein and a test substance.
  • labeling systems Any of a variety of suitable labeling systems may be used including but not limited to radioisotopes such as 12S I; enzyme labeling systems that generate a detectable calorimetric signal or light when exposed to substrate; and fluorescent labels.
  • radioisotopes such as 12S I
  • enzyme labeling systems that generate a detectable calorimetric signal or light when exposed to substrate
  • fluorescent labels Where recombinant DNA technology is used to produce the gene protein for such assay systems, it may be advantageous to engineer fusion proteins that can facilitate labeling, immobilization and/or detection.
  • Indirect labeling involves the use of a protein, such as a labeled antibody, which specifically binds to the gene product.
  • a protein such as a labeled antibody
  • Such antibodies include but are not limited to polyclonal, monoclonal, chimeric, single chain, Fab fragments and fragments produced by a Fab expression library.
  • a preliminary selection is performed to verify that the host cells have been successfully transformed/transfected. Following the introduction of the vector, cells are allowed to grow in enriched media, and are then switched to selective media. The selectable marker confers resistance to the selective agent, and thus, only those cells that successfully express the introduced sequences survive in the selective media. Any number of selection systems may be used to recover transformed cell lines.
  • herpes simplex virus thymidine kinase and adenine phosphoribosyltransferase genes for use in tk ⁇ or apr- cells, respectively (see e.g. Wigler, M. et al. (1977) "Transfer of purified herpes virus thymidine kinase gene to cultured mouse cells.” Cell 11:223-32; Lowy, I. et al. (1980) "Isolation of transforming DNA: cloning the hamster aprt gene.” Cell 22:817-23). Also antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection.
  • dhfr confers resistance to methotrexate
  • neo confers resistance to the aminoglycosides, neomycin and G-418
  • Host cells transformed/transfected with nucleotide sequences encoding for the - perturbagen of interest may be cultured under conditions suitable for the expression and recovery of the protein from cell culture.
  • the protein produced by a transformed transfected cell may be secreted when the selected expression vector incorporates signal sequences that direct secretion of the perturbagen through a prokaryotic or eukaryotic cell membrane.
  • Perturbagen sequences may be isolated or purified from recombinant cell culture by methods heretofore employed for other proteins, e.g. native or reducing SDS gel electrophoresis, salt precipitation, isoelectric focusing, immobilized pH gradient electrophoresis, solvent fractionation, and chromatography such as ion exchange, gel filtration, immunoaffinity, and ligand affinity.
  • Host cell lines for use in the methodology described herein typically embody desirable traits such as 1) short cell cycle (i.e. 20-36 hr. doubling time), 2) amenability to high throughput procedures (e.g. FACS) without undue loss of membrane integrity or viability, 3) susceptibility to standard techniques designed to introduce reporter constructs and other forms of foreign DNA, and 4) exhibition of a readily selected phenotype (or its correlative marker gene expression).
  • the cell line is an ATRA-responsive subline of the melanoma cell line WM35.
  • This WM35 subline is highly susceptible to retroviral infection and other methods of introducing foreign genetic materials and can express/maintain said materials for long periods of time using a variety of selectable markers common to the field (e.g. neomycin, puromycin).
  • selectable markers common to the field
  • such sublines can be grown for limited periods of time (5-8 days) in media containing supplements (FBS) that have been depleted of small hydrophobic compounds (including ATRA and related small molecules) by chemical methods (e.g. charcoal stripping).
  • Reporter cell lines consist of a host cell that contains a reporter gene operably- linked to a cis-acting promoter that is related to the RA pathway.
  • the terms "operably- associated” and “operably-linked” refer to functionally related nucleic acids.
  • a promoter is “operably-associated” or “operably-linked” with a coding sequence if the promoter controls or regulates the transcription of the gene to which it is linked.
  • Reporter cell lines can be obtained by several methodologies. For instance, episomal vectors carrying reporter constructs can be transformed into the cell type of choice and selected to identify rare events in which the reporter becomes stably incorporated into the genome.
  • a population of host cells containing the reporter construct of interest can be constructed using standard retroviral technology (Palu, G. et al. (2000) "Progress with retroviral gene vectors.” Rev Med Virol 10(3): 185-202).
  • Preferred reporter lines exhibit several properties including 1) a large (>50-fold) "induced signal” to "uninduced signal” ratio, 2) a minimal number ( ⁇ 5%) of uninduced (“dim”) cells when the population has been fully induced and, 3) a minimal number ( ⁇ 5%) of induced ("bright”) cells when the populations is grown under non-inducing conditions.
  • Clone 8 One representative subline containing an ATRA-sensitive reporter is referred to herein as Clone 8.
  • the reporter construct of Clone 8 consists of a retinoic acid response element (RARE) operably-linked in cis to a reporter gene (EGFP, Clontech). Variants of the RARE promoter sequence exist (Panariello, L. et al. (1996) "Identification of a novel retinoic acid response element in the promoter region of the retinol-binding protein gene.” JBiol Chem. 271(41):25524-32; de The. H et al.
  • RARE retinoic acid response element
  • RARE promoter sequences need not be derived from natural sources but instead can be artificially constructed. Such artificial RARE sequences can exist as monomers of the RARE consensus sequence (A/G)G(G/T)TCANNNNN(A/G)G(G/T)TCA or can be repeated multiply in tandem. For this reason, the size of the ATRA responsive promoter fragment can vary considerably.
  • Synthetic promoters which often consist of tandem repeats of the RARE consensus sequence, can be relatively small (e.g. 17-51 nucleotides) while natural RARE promoters sequences can be considerably larger (e.g. >500 bp) depending upon the breakpoints used to isolate the element.
  • ATRA-sensitive clones such as Clone 8. For example, to identify such sublines from the WM 35 melanoma line, one transfects a population of WM35 cells with the RARE-GFP retroviral construct and screens for individual members that are responsive to the presence of ATRA.
  • M35 R A RE -G F P cells respond to ATRA is influenced by several actors including, but not limited to, 1) the presence of needed host-encoded elements (e.g. RAR ⁇ , RXR, necessary to detect the RA signal and 2) the site in which the RARE-GFP retroviral reporter construct is inserted into the WM35 genome.
  • host-encoded elements e.g. RAR ⁇ , RXR, necessary to detect the RA signal
  • RARE-GFP retroviral reporter construct is inserted into the WM35 genome.
  • ATRA lOOnM-luM ATRA or related compounds, e.g. 9- cis-retinoic acid
  • FBS serum that contains endogenous ATRA and ATRA derivatives.
  • GFP reporter
  • cells that express high levels of the reporter (GFP) are separated from non- or less-responsive members of the population by FACS. These cells are then expanded to sufficient numbers (>10 6 ) prior to repeating the procedure for further enrichment.
  • the population is transferred to media that has been stripped of ATRA (e.g. CBI media without ATRA) and uninduced . cells ("dims") are collected.
  • ATRA e.g. CBI media without ATRA
  • ims uninduced . cells
  • individual clones can then be examined for properties such as 1) level of ATRA-induced induction, 2) percent signal overlap between induced and uninduced populations and 3) overall sensitivity to ATRA.
  • FACS could be replaced with antibody affinity chromatography methods (using cell surface localized reporter) to isolate ATRA-responsive clones (see, for example, Larsson, P.H. et al. (1989) "Improved cell depletion in a panning technique using covalent binding of immunoglobulins to surface modified polystyrene dishes.” J Immunol Methods. 116(2):293-8; Contractor, S.F. et al. (1988) "Human placental cells in culture: a panning technique using a trophoblast-specific monoclonal antibody for cell separation.” Dev PKysiol.lO(l):41-5l).
  • the gates used to sort bright (or dim) cells in the FACS procedures could be adjusted to increase or decrease the enrichment procedures and thus alter the population of cells being collected arid studied (see, for example Shapiro, H.M. (1995) "Practical Flow Cytometry” Wilely-Liss publishers).
  • the protocol used in these proceedings i.e. enriching for "bright” cells on three consecutive sorts, followed by identifying dim cells manually using a fluorescent microscope
  • cells that constitutively express the reporter could be removed (by FACS) at that beginning of the procedure, followed by subsequent enrichment of cells that respond to the ATRA.
  • the invention envisions each and every possible variation of these procedures that achieve the same end result.
  • suitable host cell lines including, but not limited to, transformed and/or immortalized cell lines derived from (i) lung (Manna, S.K. et al. (2000), "All-trans-retinoic acid upregulates TNF receptors and potentiates TNF-induced activation of nuclear factors-kappaB, activated protein-1 and apoptosis in human lung cancer cells.” Oncogene 19(17):2110-9); (ii) breast or prostate (Koshiuka, . et al.
  • Any cell line such as these can be used as a host cell in the invention and can readily be screened to identify ATRA-responsive sublines.
  • the phenotypic assay described herein selects for perturbagens that modulate the RA pathway.
  • the procedures used to screen libraries for perturbagens include: 1) introducing perturbagen encoding sequences (libraries) into the reporter cell line and selecting stable integrants; 2) growing cells (containing both the reporter and one or more members of the library) under the appropriate conditions necessary to identify perturbagens that either stimulate or repress expression of the reporter; 3) screening cells by FACS or alternative high-throughput methods in order to segregate cells with the appropriate phenotype (e.g.
  • the methodology can identify perturbagens that either activate or inhibit the RA pathway. This is accomplished by placing the perturbagen library in an ATRA-responsive reporter cell population (e.g., a Clone 8 population) and raising the cells under one of two different conditions.
  • ATRA-responsive reporter cell population e.g., a Clone 8 population
  • Class I perturbagens represent perturbagens that disrupt the ATRA pathway and thus prevent the cell from transcribing the RARE-GFP reporter under conditions that normally induce reporter expression.
  • Class II perturbagens • are those that activate the ATRA pathway under conditions that normally silence the reporter gene.
  • Various methods and instrumentation familiar to those who are skilled in the art are used to screen and test perturbagens.
  • the media, supplements, and reagents used in culturing, packaging, and maintenance of WM35 cells, HS293gp packaging cell lines, and additional lines e.g. HL60 (promyelocytic leukemia, ATCC: B1H1) can be purchased from a variety of commercial sources (Life Technologies, Clonetics, Cocalico Biologicals Inc.). It should be noted that although a particular set of procedures and media formulations are used in the work described herein, alternatives can be substituted with little or no effect.
  • retroviral packaging was accomplished using lipofectamine. Though this is the preferred method of introducing retroviral vectors into 293gp packaging cells, alternative procedures such as the CaCl 2 method of packaging may be used. Molecular techniques used in procedures such as genomic DNA isolation, PCR amplification, DNA endonculease digestion, ligation, cloning, and sequencing utilize common reagents that are supplied commercially (see, for example, Qiagen, New England BioLabs, Stratagene),
  • Fluorescent activated cell sorting and analysis is performed on a Coulter EPICS Elite Cell Sorter using EXPO "Build” and EXPO "Analysis” software. Again, alternative reagents and equipment, such as the MoFio* High-Speed Cell Sorter (Cytomation), are compatible with these procedures and may be substituted with little or no effect.
  • a library is introduced into, e.g., Clone 8 cells and grown in media that has been stripped of ATRA and related compounds. Under these conditions the vast majority of cells (99%+) fail to express the correlati e reporter gene (e.g., a green, blue or red fluorescent protein). Subsequently, "bright" cells that potentially contain perturbagen(s) capable of activating the reporter in the absence of ATRA are collected by FACS. The perturbagen encoding sequences are then retrieved and recycled through the screen to enrich for sequences that activate the RARE-GFP reporter.
  • the invention includes methods for screening for perturbagen clones that block or inactivate the retinoic acid pathway.
  • RA-responsive host cells e.g., Clone 8 cells
  • Clone 8 cells containing one or more members of a perturbagen library are grown under conditions that induce the expression of the reporter. Multiple conditions may be used to ensure reporter activation.
  • Clone 8 cells can be grown in media supplemented with 1-2% fetal bovine serum (FBS) which contains endogenous ATRA (and ATRA-derivatives) capable of activating the RARE-fluorescent protein (FP) construct.
  • FBS fetal bovine serum
  • ATRA and ATRA-derivatives
  • FP RARE-fluorescent protein
  • Clone 8 cells can be grown in media containing roughly 1- 2% charcoal-stripped FBS (CBI, Cocalico Biologies) and supplemented with lOOnM-luM ATRA (Sigma).
  • Biologically active perturbagen sequences are subsequently retrieved and then re- introduced into the screen to further enrich for perturbagens.
  • the sequences can be re-introduced into a fresh Clone 8 population and subsequently plated at low density. After 8-10 days of growth in media containing ATRA, individual clones that fail to express the reporter, or express the reporter in only a fraction of the cells making up the clone, can be isolated. The perturbagen encoding sequence can then be re-isolated and tested for its ability to block RA activation of the RARE-FP reporter. As was the case in the previous embodiment, variations in these procedures and alternative sources of media/instrumentation can be substituted with minimal effects.
  • perturbagen-encoding sequences may be recovered by PCR (see, for example, Schott, B. (1997) "Efficient recovery and regeneration of integrated retro viruses.” Nucleic Acids Res.25(14):2940-2).
  • genomic DNA derived from cells taken from the FACS sorting procedures is used as the template for PCR amplification.
  • oligonucleotide primers that flank the perturbagen encoding sequence complex mixtures with diversities of greater than 50,000 can be amplified efficiently.
  • sequences can subsequently be re-cloned into a retroviral vector, and introduced into a fresh population of, e.g., Clone 8 cells for additional rounds of screening.
  • retrieval of the perturbagen may be accomplished by reactivating the inserted retroviral vector that contains the perturbagen- encoding sequence.
  • host cells containing the perturbagen-encoding (non- infective) retrovirus are transformed with sequences that encode the necessary retroviral gag, pol and envelope proteins.
  • infective retroviral virions that contain the perturbagen-encoding sequences are released and can be isolated in the form of a viral supernatant.
  • Secondary cell lines may optionally be employed to test individual perturbagens for the ability to induce an RA related phenotype. For example, previous studies have shown that when HL60 cells are exposed to ATRA, the cells undergo terminal differentiation. Thus, in order to test how closely each perturbagen mimics the action of ATRA, a secondary assay is developed to study whether perturbagens that induce transcription of the RARE-FP reporter in, e.g., Clone 8 cells can also induce differentiation of HL60 cells.
  • the invention encompasses the polypeptide, ribonucleotide, or polynucleotide sequence of the target (or fragment or variant of each target) that is identified with each perturbagen agent, as well as the gene encoding each target and " relevant fragments of said gene.
  • Targets of specific perturbagens may be identified by several means.
  • perturbagens can be modified with homo- or hetero- bifunctional coupling reagents and targets can be identified by chemical cross-linking techniques (see, for example, Tzeng, M.C. et al. (1995) "Binding proteins on synaptic membranes for crotoxin and taipoxin, two phospholipases A2 with neurotoxicity.” Toxicon. 33(4):451-7; Cochet, C. et al. (1988) "Demonstration of epidermal growth factor-induced receptor dimerization in living cells using a chemical covalent cross-linking agent.” JBiol Chem. 263(7):3290-5).
  • a particular phenotype may be the result of a perturbagen differentially regulating a distinct combination of genes.
  • a perturbagen might, through its interaction with a particular transcription factor which, in turn, recognizes a particular DNA promoter sequence, elevate the expression of two or more target genes that act in concert to elicit a unique phenotype (e.g. viral resistance).
  • a unique phenotype e.g. viral resistance
  • each of the genes whose levels of expression are altered by the perturbagen can be considered to be perturbagen targets.
  • Such targets can be identified by a variety of techniques including (but not limited to) SAGE and expression profiling via microarray analysis (see, for instance, Cummings CA. and Rel an D.A. (2000) "Using DNA Microarrays to Study Host-Microbe Interactions.” Emerg Infect Dis. 6(5):513-525; Yamamoto M. et al. (2001) "Use of serial analysis of gene expression (SAGE) technology. J Immunol Methods. 2001 A ⁇ r;250(l-2):45 ⁇ 66).
  • a preferred method of target identification involves application of variants of the standard two-hybrid technology. See, e.g., U.S.S.N. 09/193,759 and WO 00/29565 "Methods for validating polypeptide targets that correlate to cellular phenotypes", the entire disclosures of which are incorporated by reference herein.
  • the two-hybrid procedure is a quasi-genetic approach to detecting binding events.
  • This assay often is performed in yeast cells (although it can be adapted for use in mammalian and bacterial cells), and relies upon constructing two vectors; the first having an interaction probe or bait (that in this case, will be the perturbagen) that typically is fused to a DNA binding domain (“BD”) moiety, and a second vector having an interaction target or prey (a cDNA library) that typically is fused to a DNA transcriptional moiety (the activation domain or "AD"). Neither of the two fusion proteins can, individually, induce transcription of the reporter gene.
  • BD DNA binding domain
  • AD activation domain
  • the AD and BD moieties are brought into sufficient physical proximity to result in transcription of a reporter gene (e.g., the His3 gene or lacZ gene) located downstream of the bound complex ( Figure 6).
  • a reporter gene e.g., the His3 gene or lacZ gene located downstream of the bound complex ( Figure 6).
  • Prey/bait interactions are then detected by identifying yeast cells that are expressing the reporter gene - e.g. which express lacZ or are able to grow in the absence of histidine.
  • yeast host strains known in the art are suitable for use for identifying targets of individual perturbagens.
  • suitable host strains including but not limited to (1) whether the host cells can be mated to cells of opposite mating type (i.e., they are haploid), and (2) whether the host cells contain chromosomally integrated reporter constructs that can be used for selections or screens (e.g., His3 and L ⁇ cZ).
  • mating can be desirable in some embodiments, it is not strictly necessary for purposes of practicing the present invention.
  • the mating procedures can be eUminated by introducing the bait and prey constructs into a single yeast cell, whereupon the screens can be performed on the haploid cell.
  • Gal4 strains or LexA host strains may be used with the appropriate reporter constructs.
  • Representative examples include strains yVT 69, yVT 87, yVT96, yVT97, yVT98 and yVT99, yVTIOO, yVT360.
  • the host strains used in the present invention may be modified in other ways known to the art in order to optimize assay performance. For example, it may be desirable to modify the strains so that they contain alternative or additional reporter genes that respond to two-hybrid interactions. The following host yeast strains are thus constructed to have the indicated characteristics:
  • YVT69 (mat ⁇ , ura3-52, his3-200, ade2-101, trpl-901, leu2-3, 112, gal4 ⁇ , met " , gal80 ⁇ , URA3::GALlu A s-GALl ⁇ ATA -lacZ) was obtained from Clontech
  • YVT87 (Mat- ⁇ ura3-52,his3-200,trpl-901 ,LexA op (x6r LEU2-3,112) was obtained from Clontech (EGY48).
  • YVT96 The starting strain was YM4271 (Liu, J. et al., 1993) MATa, ura3-52 his3-200 ade2-101 ade5 lys2-801 leu2-3, 112 trpl-901 tyrl-501 gal4 ⁇ gal ⁇ O ⁇ ade5::hisG.
  • YM4271 was converted to yVT96, MATa ura3-52 his3-200 ade 2-101 ade5 lys2::GAL2-URA3 leu2-3, 112 trpl-901 tyrl-501 gal4D gal80 ⁇ ade5::hisG by homologous recombination of Reporter 1 to the LYS2 locus. The integration is confirmed by PCR.
  • YVT97 The starting strain is YM4271 (Liu, J. et al ' ., 1993) MATa, ura3-52 his3-
  • YVT98 The starting strain was EGY48 (Estojak, J. Et al., 1995) MAT ⁇ , ura3 his3 trpl leu2::LexAop(x6)-LEU2. EGY48 was converted to strain yVT98 MAT ⁇ ura3 his3 trpl leu2::lexAo ⁇ (x6)-LEU2 lys2::lexAop(8x or 2x)-LacZ by homologous recombination of Reporter 6 into theLYS2 locus. YVT99: The starting strain was EGY48 (Estojak, J.
  • EGY48 was converted to strain yVT99 MATa ura3 his3 trpl leu2::lexAop(x6)-LEU2 lys2::lexAop(8x or 2x)-URA3 by homologous recombination of Reporter 2 into the LYS2 locus and by switching the mating type from MAT ⁇ to MATa via transient expression of the HO endonuclease.
  • YVTlOO The starting strain was YM4271 (Liu, J.
  • YM4271 was converted to yVTlOO, MATa ura3-52 his3-200 ade2-101 ade5 lys2::lexAo ⁇ (8x or 2x)-URA3 leu2-3, 112 trpl-901 tyr-501 ga!4 ⁇ gal80 ⁇ ade5::hisGby homologous recombination of Reporter 2 to the LYS2 locus.
  • the integration was confirmed by PCR.
  • YVT360 yNT360 (mat a, trpl-901, leu2-3,112, ura3-52, his3-200, ga!4 •, gal 80-, LYS2::GAL1 UAS -GAL1 TATA -HIS3, GAL2 UAS -GAL2 TATA -ADE2, URA3:MEL1 UAS - MELl TATA -lacZ) was obtained from Clontech (AH109).
  • Exemplary yeast-reporter strains are constructed using a variety of standard techniques. Many of the starting yeast strains already carry multiple mutations that lead to an auxotrophic phenotype (e.g. ura3-52, ade2-101). When necessary, reporter constructs can be integrated into the genome of the appropriate strain by homologous recombination. Successful integration can be confirmed by PCR. Alternatively, reporters may be maintained in the cells episomally.
  • the yeast two-hybrid reporter gene typically is fused to an upstream promoter region that is recognized by the BD, and is selected to provide a marker that facilitates screening. Examples include the lacZ gene fused to the Gall promoter region and the His3 yeast gene fused to Gall promoter region.
  • yeast two-hybrid reporter constructs are suitable for use in the present invention.
  • suitable reporters include whether (1) the reporter construct provides a rigorous selection (i.e., yeast cells die in the absence of a protein-protein or peptide-protein interaction between the bait and prey sequences), and/or (2) the reporter construct provides a convenient screen (e.g., the cells turn color when they harbor bait and prey sequences that interact).
  • reporter genes include (1) the Ura3 gene, which confers growth in the absence of uracil and death in the presence of 5-fluoroorotic acid (5-FOA); (2) the His3 gene, which permits growth in the absence of histidine; (3) the L cZ gene, which is monitored by a colorimetric assay in the presence/absence of beta-galactosidase substrates (e.g. X-gal); (4) the Leu2 gene, which confers growth in the absence of leucine; and (5) the Lys2 gene, which confers growth in the absence of lysine or, in the alternative, death in the presence of ⁇ -aminoadipic acid.
  • These reporter genes may be placed under the transcriptional control of any one of a number of suitable cis-regulatory elements, including for example the G ⁇ l2 promoter, the Gall promoter, the Gal7 promoter, or the LexA operator sequences.
  • Reporter 1 - This reporter comprises the URA3 gene under the transcriptional control of the yeast Gal2 upstream activating sequence (UAS).
  • UAS yeast Gal2 upstream activating sequence
  • the G ⁇ l2-Ur ⁇ 3 construct is flanked on the 5' side by the 500 base pairs that lie immediately upstream of the coding region of the LYS2 gene and on the 3' side by the 500 base pairs that lie immediately 3' of the coding region of the LYS2 gene.
  • the entire vector is also cloned into the yeast centromere containing vector pRS413 (Sikorski, RS and Hieter, P., Genetics 122(1): 19-27 (1989) and can therefore be used episomally.
  • This reporter is intended for use with a G ⁇ l4-based two-hybrid system, e.g. , Fields, S. and Song, O., Nature 340:245-246 (1989).
  • This reporter is comprised of the yeast His3 gene under the transcriptional control of the yeast Gall upstream activating sequence (UAS). In order to f acilitate integration of this reporter into the yeast chromosome in place of the His3 coding region the Gall-His3 construct is flanked on the 5' side by the 500 base pairs (bp) immediately upstream of the His3 coding region and on the 3' side by the 500 bp immediately 3' of the His3 coding region.
  • UAS yeast Gall upstream activating sequence
  • the entire reporter is also cloned into the yeast centromere containing vector pRS415 and can therefore be used episomally.
  • This reporter is intended for use with a G ⁇ /4-based two-hybrid system.
  • ' Reporter 4 - (pVT88): This reporter is identical to Reporter 3 except that the His3 gene is under the transcriptional control of Gall UAS sequences rather than the Gall UAS. The reporter is used with a G ⁇ t ⁇ -based two-hybrid system.
  • Reporter 5 - (pVT89) This reporter contains the bacterial LacZ gene under the transcriptional control of the Gall UAS.
  • the entire reporter will be cloned into a yeast centromere-using vector, e.g., pRS413, and is used episomally.
  • Reporter 6 - (p VT90): This reporter consists of the LacZ gene under the transcriptional control of eight LexA operator sequences. As for Reporter 2, the number of LexA operator sequences in this reporter may either be increased or decreased in order to obtain optimal levels of transcriptional regulation. Two features of this reporter facilitate integration of the reporter into the yeast chromosome in place of the Lys2 coding region. First, it is flanked on the 5' side by the 500 base pairs that lie immediately upstream of the coding region of the Lys2 gene and on the 3' side by the 500 base pairs that lie immediately 3' of the coding region of the Lys2 gene. Second, the neomycin (NEO) resistance gene has been inserted between the 5' Lys2 sequences and the LexA promoter sequences.
  • NEO neomycin
  • This reporter is used in conjunction with a LexA-based interaction trap, e.g., Golemis, E.A., et al., (1996), "Interaction trap/two hybrid system to identify interacting proteins.” Current Protocols in Molecular Biology, Ausebel et al., eds., New York, John Wiley & Sons, Chap. 20.1.1-20.1.28.
  • LexA-based interaction trap e.g., Golemis, E.A., et al., (1996), "Interaction trap/two hybrid system to identify interacting proteins.” Current Protocols in Molecular Biology, Ausebel et al., eds., New York, John Wiley & Sons, Chap. 20.1.1-20.1.28.
  • perturbagen-induced phenotypes may be the result of RNA-RNA, RNA-polypeptide, polypeptide-DNA, or RNA-DNA interactions.
  • variations of the original two-hybrid theme may be applied to identify the target of the phenotypic probe.
  • the first vector consists of the D ⁇ ABP (e.g. GAL4 BD) described previously, linked to a specific R ⁇ A binding protein, arbitrarily called "R ⁇ ABP-A" (e.g. the Rev responsive element R ⁇ A binding protein, RevMlO, see Putz, U. et al. (1996) "A tri- hybrid system for the analysis and detection of R ⁇ A-protein interactions.” NAR 24:4838- 4840).
  • D ⁇ ABP e.g. GAL4 BD
  • R ⁇ ABP-A e.g. the Rev responsive element R ⁇ A binding protein, RevMlO, see Putz, U. et al. (1996) "A tri- hybrid system for the analysis and detection of R ⁇ A-protein interactions.”
  • Vector #2 contains the transcriptional activation domain (e.g. GAL4 AD) linked to a second R ⁇ A binding protein ("R ⁇ ABP-B", e.g. the MS2 coat protein of the MS2 bacteriophage, see for example, SenGupta, D.J. et al. (1996) "A three hybrid system to detect R ⁇ A-protein interactions in vivo.” PNAS 93:8496-8501).
  • R ⁇ ABP-B R ⁇ A binding protein
  • the third vector encodes an R ⁇ A molecule that is recognized by R ⁇ ABP-A (e.g. the RRE sequence, Zapp, MX.
  • Target sequences or fragments thereof can vary greatly in size. Some target fragments can be as small as ten amino acids in length. Alternatively, target sequences can be greater than 10 amino acids but less than thirty amino acids in length. Still other targets can be greater than thirty amino acids in length but shorter than 60 amino acids in length. Still other targets are cellular proteins or subunits or domains therein of more than 60 amino acids in length. Still other targets are cellular proteins or subunits or domains there of more than 60 amino acids in length. Still other targets are cellular proteins or subunits or domains there of more than 60 amino acids in length. Still other targets are cellular proteins or subunits or domains there of more than 60 amino acids in length. In addition, for reasons described previously, the sequences encoding targets can vary greatly due to allelic variation, duplications and closely related gene family members.
  • a preferred target variant is one which has at least about 80%, alternatively at least about 90%, and in another alternative at least about 95% amino acid sequence identity to the original target amino acid sequence and which contains at least one functional or structural characteristic of the original target.
  • compositions, relations and phenotypic effects yielded by the methodology described herein may advantageously be placed into or stored in a variety of databases.
  • a database may include information about one or more targets identified by the methods herein, including for example sequence information, motif information, structural information and/or homology information.
  • the database may optionally contain such information regarding perturbagen agents, and may correlate the perturbagen information to corresponding target information. Further helpful database aspects may include information regarding, e.g., variants or fragments of the above.
  • the database may also correlate the indexed compounds to, e.g., immunoprecipitation data, further yeast n-hybrid interaction data, genotypic data (e.g., identification of disrupted genes or gene variants), and with a variety phenotypic data.
  • Such databases are preferably electronic, and may additionally be combined with a search tool so that the database is searchable.
  • An additional embodiment of the invention includes antibodies that recognize the perturbagen itself, cellular targets of the perturbagen, or one or more epitopes of the foregoing.
  • Such reagents may include, but are not limited to, polyclonal, monoclonal, humanized, chimeric, and single chain antibodies, Fab fragments, F(ab') 2 fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragements of any of the above.
  • Antibodies directed against perturbagens or cellular targets may be useful for a variety of purposes including i) therapeutics, ii) diagnostic assays, iii) cytoimmunology, iv) target identification, and v) purification.
  • various hosts including goats, rabbits, rats, mice, humans and others may be immunized by injection with a perturbagen, target or any fragment thereof which has immunogenic properties.
  • various adjuvants may be used to increase immunological response.
  • adjuvants include, but are not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, and surface-active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, KLH, and dinitrophenol.
  • BCG Bacilli Calmette-Guerin
  • Corynebacterium parvum are especially preferable.
  • Polyclonal antibodies are heterogeneous populations of antibody molecules derived from the sera of animals immunized with an antigen, such as a given perturbagen, target, or an antigenic functional derivative thereof.
  • an antigen such as a given perturbagen, target, or an antigenic functional derivative thereof.
  • host animals such as those described above, may be immunized by injection with gene product supplemented with adjuvants as also described above.
  • Monoclonal antibodies that recognize perturbagens may be prepared using any technique that provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B- cell hybridoma technique, and the EBN hybridoma technique, (see, for example, Kohler, G. et al. (1975) "Continuous cultures of fused cells secreting antibody of predefined specificity.” Nature 256:495-497; Kozbor, D. et al (1985) "Specific immunoglobulin production and enhanced tumorigenicity following ascites growth of human hybridomas.” J. Immunol. Methods 81:31-42; Cote, R.J. et al. (1983) PNAS 80:2026- 2030; and Cole, S.P. et al. (1984) "Generation of human monoclonal antibodies reactive with cellular antigens" Mol. Cell Biol. 62:109-120).
  • chimeric antibodies such as the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity. See, e.g., Morrison, S.L. et al. (1984) "Chimeric human antibody molecules: mouse antigen- binding domains with human constant region domains.” PNAS 81:6851-6855); Neuberger, M.S. et al. (1984) "Recombinant antibodies possessing novel effector functions.” Nature 312:604-608; andTakeda, S. et al. (1985) "Construction of chimeric processed immunoglobulin genes containing mouse variable and human constant region sequences.” Nature 314:452-454).
  • single chain antibodies may be adapted, using methods known in the art, to produce perturbagen-specific antibodies (see, e.g. Burton, D.R. (1991) "A large array of human monoclonal antibodies to type 1 human immunodeficiency virus from combinatorial libraries of asymptomatic seropositive individuals.” PNAS 88:10134-10137).
  • Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobuHn libraries or panels of highly specific binding reagents as disclosed in the literature, (see, for example, Orlandi, R. et al.
  • Antibody fragments that contain specific binding sites for perturbagens may also be generated.
  • fragments include, but are not limited to F(ab 2 fragments produced by pepsin digesting of the antibody molecule and Fab fragments generated by reducing the disulfide bridges of the F(ab 2 fragments.
  • Fab expression libraries may be constructed to allow rapid and easy identification of monclonal Fab fragments with the desired specificity. (See, for example, Huse, W.D. et al. (1989) "Generation of a large combinatorial library of the immunoglobulin repertoire in phage lambda.” Science 246:1275-1281). M. Screening Assays
  • the agents of the invention can be used to screen for drugs or compounds (small molecules) that mimic or modulate the activity or expression of said phenotypic probes.
  • the present invention may be employed in a process for screening for agents such as agonists, i.e. agents that bind to and activate an RA pathway target, or antagonists, i.e. inhibit the activity or interaction of an RA pathway target with an endogenous or exogenous ligand.
  • agents of the invention may also be used to assess the binding of small molecule substrates and ligands in, for example, cells, cell-free preparations, chemical libraries, and natural product mixtures as known in the art. Any methods routinely used to identify and screen for agents that can modulate receptors may be used in accordance with the present invention.
  • the invention provides a method for identifying modulators, i.e. candidate or test compounds or agents (e.g. peptidomimetics, small molecules or other drugs) that bind to the agent or its target, and have a stimulatory or inhibitory effect on the pathway(s) affected by said agent.
  • modulators i.e. candidate or test compounds or agents (e.g. peptidomimetics, small molecules or other drugs) that bind to the agent or its target, and have a stimulatory or inhibitory effect on the pathway(s) affected by said agent.
  • In vitro systems may be designed to identify compounds capable of binding, e.g., an RA pathway target gene product.
  • Such compounds may include, but are not limited to, peptides made of D-and/or L-configuration amino acids (in, for example, the form of random peptide libraries; (see e.g., Lam, et al, Nature, 354:82-4 (1991)), phosphopeptides (in, for example, the form of random or partially degenerate, directed phosphopeptide libraries; see, e.g., Songyang, et al., Cell, 72:76 '-78 (1993)), antibodies, and small organic or inorganic molecules.
  • test compounds identified may be useful, for example, in modulating the activity of RA pathway target gene proteins, preferably mutant proteins; elaborating the biological function of the RA pathway target gene protein; or screening for compounds that disrupt normal RA pathway target gene interactions or themselves disrupt such interactions.
  • the invention provides libraries of test compounds.
  • the test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries, spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the one-bead one-compound library method; and synthetic library methods using affinity chromatography selection.
  • an assay may be devised to directly identify agents that bind to, e.g., an RA pathway target protein.
  • Such direct binding assays generally involve preparing a reaction mixture of the RA pathway target protein and the test compound under conditions and for a time sufficient to allow the two components to interact and bind, thus forming a complex that can be removed and/or detected in the reaction mixture.
  • These assays can be conducted in a variety of ways. For example, one method to conduct such an assay would involve anchoring the RA pathway target protein or the test substance onto a solid phase and detecting target protein/test substance complexes anchored on the solid phase at the end of the reaction.
  • the RA pathway target protein may be anchored onto a solid surface, and the test compound, which is not anchored, may be labeled, either directly or indirectly.
  • the anchored component may be immobilized by non-covalent or covalent attachments.
  • Non-covalent attachment may be accomplished simply by coating the solid surface with a solution of the protein and drying.
  • an immobilized antibody preferably a monoclonal antibody, specific for the protein may be used to anchor the protein to the solid surface.
  • the surfaces may be prepared in advance and stored.
  • the nonimmobilized component is added to the coated surface containing the anchored component. After the reaction is complete, unreacted components are removed (e.g. , by washing) under conditions such that any complexes formed will remain immobilized on the solid surface.
  • the detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previously nonimmobilized component is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed.
  • an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for the previously nonimmobilized component (the antibody, in turn, may be directly labeled or indirectly labeled with a labeled anti-Ig antibody).
  • a reaction can be conducted in a liquid phase, the reaction products separated from unreacted components, and complexes detected; e.g., using an immobilized antibody specific for an RA pathway gene product or the test compound to anchor any complexes formed in solution, and a labeled antibody specific for the other component of the possible complex to detect anchored complexes.
  • Compounds that are shown to bind to a particular RA pathway gene product through one of the methods described above can be further tested for their ability to elicit a biochemical response from the RA pathway gene protein.
  • Agonists, antagonists and/or inhibitors of the expression product can be identified utilizing assays well known in the art.
  • perturbagen/target pairs are used to identify small molecule mimetics in a displacement assay format.
  • assays can be based upon a variety of technologies including, but not limited to i) ELIS As (see, for example, Rice, J.W. et al. (1996) "Development of a high volume screen to identify inhibitors of endothelial cell activation.” Anal Biochem 241(2):254-9), ii) scintillation proximity assays (see, for example, Lerner, C.G. and Saiki, A.
  • LANCETM is a homogeneous assay that is performed in solution and requires no wash steps to separate bound and unbound label.
  • the target is produced in large quantities and labeled with a lanthanide chelate (i.e. a fluorescent donor such as a Europium, (Eu) or Terbium (Tb) chelate).
  • a lanthanide chelate i.e. a fluorescent donor such as a Europium, (Eu) or Terbium (Tb) chelate.
  • the perturbagen is labeled with one of several fluorescent "acceptor" moieties that can be excited by the emissions of the donor molecule (e.g.
  • allophycocyanin APC
  • rhodamine Rh rhodamine Rh
  • the target is immobilized to a solid support using a monoclonal antibody that has been labeled with Eu ( Figure 9).
  • a monoclonal antibody that has been labeled with Eu Figure 9
  • Subsequent addition and binding of a rhodamine labeled perturbagen in the presence or absence of a candidate small organic displacement molecule is followed by several wash steps to remove unbound material.
  • TR-FRET is then performed by exciting Eu and measuring the levels of Rh emissions.
  • the target is immobilized to the solid support using an unlabeled monoclonal antibody.
  • an Eu-labeled perturbagen (+/- a candidate small organic displacement molecule) is added to each well and allowed to equilibrate, followed by a washing procedure to eliminate unbound Eu-labeled material.
  • the bound Eu-perturbagen molecules are released and excited in the presence of commercially available enhancement solutions (DELFIATM Enhancement Solutions, Wallac).
  • DELFIATM Enhancement Solutions By comparing the levels of emissions in wells that contain members of the molecule library with standardized controls, small molecules that disrupt the interaction between the perturbagen and its target are identified.
  • Another preferred method for identifying small molecule mimetics makes use of a variation of the two-hybrid technology.
  • the yeast host cells containing i) AD-perturbagen, ii) the BD-target, and iii) a reporter construct made up of a promoter recognized by the BD, functionally linked to, for instance, the gene encoding lacZ or ZsGreen (Clontech), are grown in liquid culture media and subjected to the test chemical. Assay plates are then incubated at 30°C for 48 hours and samples are scored by looking the expression of the marker by FACS or other conventional techniques.
  • compounds that are attached to a solid support e.g. beads
  • yeast cells modified for reverse genetic studies can be arrayed in nanodroplets (100-200 nanoliter volumes) that contain i) the selective elements of the medium (e.g. 5-FOA, cyclohexamide) and ii) one or more beads linked to a chemical library member. Subsequent photolysis of the chemical agent from the bead allows diffusion of the test molecules into the yeast cell and disruption of the two-hybrid interaction (see, Borchardt A et al. (1997) "Small molecule-dependent genetic selection in stochastic nanodroplets as a means of detecting protein-ligand interactions on a large scale.” Chemical Biology 4(12):961-8; You, A.J. et al.
  • perturbagens, fragments or derivatives of a perturbagen, small molecule mimetics of a perturbagen, sequences encoding perturbagens, sequences that can hybridize to perturbagen encoding sequences, RA pathway targets of the perturbagen, or agents that bind said target (e.g. antibodies) or portions thereof, may be utilized to treat or prevent a disorder that has previously shown sensitivity to treatment with retinoids.
  • polypeptides or RNA molecules described herein can be used i) modulate cellular proliferation, ii) modulate cellular differentiation, iii) induce or modulate necrotic o apototic processes, or iv) sensitize cells to secondary compounds that induce either i), ii), or iii) by direct application of said agent.
  • disorders that may be aided by such agents include, but are not limited to cancers of the i) head and neck, ii) small cell lung carcinoma, iii) hepatocellular carcinomas (HCC), iv) cancers of the breast, v) leukemias, vi) cutaneous T-cell lymphoma (CTCL), vii) non-small cell lung carcinoma, viii) neuroblastomas, ix) pancreatic carcinomas, x) Karposi's sarcoma, xi)renal cell carcinoma (RCC), xi ⁇ ) squamous cell carcinomas, and cancers of the xiii) prostrate, xiv) ovaries, and xv) cervix.
  • any of the agents of the invention may be administered to a subject to treat or prevent i) psoriasis, ii) hyperkeratosis, iii) eczema, iv) Multicentric Castlemans disease, v) pyoderma faciate, vi) acne vulgaris, vii) Darier's disease, viii) Reiter's disease, ix) follicular mucinosis, and other forms of dermatitis.
  • Ailments that respond to retinoid therapy can be treated with the perturbagen or RA pathway target directly, for example by administering a therapeutically effective dose of a proteinaceous agent intravenously or by other peptide delivery techniques known to the art.
  • a therapeutically effective dose of a pharmaceutical composition comprising a substantially purified perturbagen, or a fragment thereof, or a small molecule mimetic, optionally in conjunction with a suitable pharmaceutical carrier, may be administered to a subject to treat or prevent a disorder previously shown to be sensitive to retinoid therapy.
  • a "therapeutically effective" dose refers to that amount of the compound sufficient to result in amelioration of symptoms of the disease.
  • a “pharmaceutical carrier” includes any and all solvents, dispersion media, coatings, antibacterial and ahtifungal agents, and the like, compatible with pharmaceutical administration.
  • the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated.
  • Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 50 (the dose lethal to 50% of the population) and the ED S0 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 50 /ED '5 5 0 I * Compounds that exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
  • the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED 50 with little or no toxicity.
  • the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC 30 (i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture.
  • IC 30 i.e., the concentration of the test compound that achieves a half-maximal inhibition of symptoms
  • levels in plasma may be measured, for example, by high performance liquid chromatography.
  • compositions of the invention are formulated to be compatible with intended routes of delivery.
  • routes of administration include parenteral e.g. intravenous, intradermal, subcutaneous, oral, inhalation, transdermal, topical, transmucosal, and rectal administration.
  • Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent, such as water for injection, saline solution, fixed oils, polyethylene, glycols, glycerine, propylene glycol, or other synthetic solvents, antibacterial agents such as benzyl alcohol or methyl parabens, antioxidants such as ascorbic acid or sodium bisulfite, chelating agents such as ethylenediaminetetraacetic acid, buffers such as acetates, citrates, or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene, glycols, glycerine, propylene glycol, or other synthetic solvents
  • antibacterial agents such as benzyl alcohol or methyl parabens
  • antioxidants such as ascorbic acid or sodium bisulfite
  • compositions suitable for injectable use include aqueous solutions (where water-soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • suitable carriers include physiological saline, bacteriostatic water Cremophor ELTM (BASF; Parsippany, NJ) or phosphate buffered saline (PBS). In all cases the composition must be sterile and should be fluid to the extent that easy syringability exists.
  • Oral compositions can also be prepared using any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth, or gelatin; an excipient such as starch or lactose, disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate, a glidant such as colloidal silicon dioxide, a sweetening agent such as sucrose or saccharin, or a flavoring agent such as peppermint or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth, or gelatin
  • an excipient such as starch or lactose, disintegrating agent such as alginic acid, Primogel, or corn starch
  • a lubricant such as magnesium stearate, a glidant such as colloidal silicon dioxide, a sweetening agent such as sucrose or saccharin, or a flavoring agent such as peppermint or orange flavoring
  • penetrants appropriate to the barrier to be permeated are used in the formulation.
  • penetrants are generally known in the art and include, for example, bile salts and fusidic acid derivatives.
  • Transmucosal administration can also be accomplished through the use of nasal sprays and suppositories.
  • the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
  • the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled microencapsulated delivery system.
  • a controlled microencapsulated delivery system such as a controlled microencapsulated delivery system.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to specific cell surface epitopes) can also be used as pha ⁇ naceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No.4,522,811.
  • such therapeutics can be administered indirectly, for example by gene therapy utilizing a gene or RNA sequence encoding a perturbagen, RA pathway target, or variant or fragment of the foregoing.
  • a vector capable of expressing a perturbagen or target, or a fragment or derivative thereof may be administered to a subject to treat or prevent a disease.
  • Expression vectors including, but not limited to, those derived from retroviruses, adenoviruses, adeno-associated viruses, or herpes or vaccinia viruses or from various bacterial plasmids, may be used for delivery of nucleotide sequences to the targeted organ, tissue, or cell population (see, for example, Carter, P.J. and Samulski, R.J.
  • Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (U.S. Patent 5,328,470) or by stereotactic injection (see, for example, Chen, S.H. et al.
  • the pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded.
  • the pharmaceutical preparation can include one or more cells which produce the gene delivery system.
  • agents that may be used as therapeutics include any RA pathway target genes, associated expression product and functional fragments thereof. Additionally, agents that reduce or inhibit mutant RA pathway target gene activity may be used to ameliorate disease symptoms. Such agents include antisense, ribozyme, and triple helix molecules. Techniques for the production and use of such molecules are well known to those of skill in the art. Anti-sense RNA and DNA molecules act to directly block the translation of mRNA by hybridizing to targeted mRNA and preventing protein translation. With respect to antisense DNA, oligodeoxyribonucleotides derived from the translation initiation site, e.g., between the -10 and +10 regions of the RA pathway target gene nucleotide sequence of interest, are preferred.
  • Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA.
  • the mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage.
  • the composition of ribozyme molecules must include one or more sequences complementary to a RA pathway target gene mRNA, and must include the well known catalytic sequence responsible for mRNA cleavage. For this sequence, see U.S. Patent No. 5,093,246, which is incorporated by reference herein in its entirety.
  • engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of RNA sequences encoding anaphylatoxin C3a receptor gene proteins:
  • ribozyme cleavage sites within any potential RNA target are initially identified by scanning the molecule of interest for ribozyme cleavage sites that include the following sequences, GUA, GUU and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the RA pathway target gene containing the cleavage site may be evaluated for predicted structural features, such as secondary structure, that may render the oligonucleotide sequence unsuitable. The suitability of candidate sequences may also be evaluated by testing their accessibility to hybridization with complementary oligonucleotides, using ribonuclease protection assays.
  • Nucleic acid molecules to be used in triple helix formation for the inhibition of transcription should be single stranded and composed of deoxyribonucleotides.
  • the base composition of these oligonucleotides must be designed to promote triple helix formation via Hoogsteen base pairing rules, which generally require sizeable stretches of either purines or pyrimidines to be present on one strand of a duplex.
  • Nucleotide sequences may be pyrimidine-based, which will result in TAT and CGC triplets across the three associated strands of the resulting triple helix.
  • the pyrimidine-rich molecules provide base complementarity to a purine-rich region of a single strand of the duplex in a parallel orientation to that strand.
  • nucleic acid molecules may be chosen that are purine-rich, for example, containing a stretch of G residues. These molecules will form a triple helix with a DNA duplex that is rich in GC pairs, in which the majority of the purine residues are located on a single strand of the targeted duplex, resulting in GGC triplets across the three strands in the triplex.
  • the potential sequences that can be targeted for triple helix formation may be increased by creating a so called "switchback" nucleic acid molecule.
  • Switchback molecules are synthesized in an alternating 5'-3', 3'-5' manner, such that they base pair with first one strand of a duplex and then the other, eliminating the necessity for a sizeable stretch of either purines or pyrimidines to be present on one strand of a duplex. It is possible that the antisense, ribozyme, and/or triple helix molecules described herein may reduce or inhibit the transcription (triple helix) and/or translation (antisense, ribozyme) of mRNA produced by both normal and mutant RA pathway target gene alleles.
  • nucleic acid molecules that encode and express RA pathway target gene polypeptides exhibiting normal activity may be introduced into cells that do not contain sequences susceptible to whatever antisense, ribozyme, or triple helix treatments are being utilized.
  • Anti-sense RNA and DNA, ribozyme, and triple helix molecules of the invention may be prepared by any method known in the art for the synthesis of DNA and RNA molecules. These include techniques for chemically synthesizing oligodeoxyribonucleotides and oligoribonucleotides well known in the art such as for example solid phase phosphoramidite chemical synthesis.
  • RNA molecules may be generated by in vitro and in vivo transcription of DNA sequences encoding the antisense RNA molecule. Such DNA sequences may be incorporated into a wide variety of vectors that incorporate suitable RNA polymerase promoters such as the TJ or SP6 polymerase promoters.
  • antisense cDNA constructs that synthesize antisense RNA constitutively or inducibly, depending on the promoter used, can be introduced stably into cell lines.
  • DNA molecules may be introduced as a means of increasing intracellular stability and half-life. Possible modifications include but are not limited to the addition of flanking sequences of ribonucleotides or deoxyribonucleotides to the 5' and/or 3' ends of the molecule or the use of phosphorothioate or 2' O-methyl rather than phosphodiesterase linkages within the oligodeoxyribonucleotide backbone. Antibodies that are both specific for RA pathway target gene protein, and in particular, mutant gene protein, and interfere with its activity may be used to inhibit mutant RA pathway target gene function.
  • Such antibodies may be generated against the proteins themselves or against peptides corresponding to portions of the proteins using standard techniques known in the art and as also described herein. Such antibodies include but are not limited to polyclonal, monoclonal, Fab fragments, single chain antibodies, chimeric antibodies, etc. In instances where a RA pathway target gene protein is intracellular and whole antibodies are used, internalizing antibodies may be preferred. However, lipofectin liposomes may be used to deliver the antibody or a fragment of the Fab region that binds to the RA pathway target gene epitope into cells. Where fragments of the antibody are used, the smallest inhibitory fragment that binds to the target or expanded target protein's binding domain is preferred.
  • peptides having an amino acid sequence corresponding to the domain of the variable region of the antibody that binds to the RA pathway target gene protein may be used.
  • Such peptides may be synthesized chemically or produced via recombinant DNA technology using methods well known in the art (see, e.g., Creighton, Proteins: Structures and Molecular Principles (1984) W.H. Freeman, New York 1983, supra; and Sambrook, et al, 1989, supra).
  • single chain neutralizing antibodies that bind to intracellular RA pathway target gene epitopes may also be administered.
  • Such single chain antibodies may be administered, for example, by expressing nucleotide sequences encoding single-chain antibodies within the target cell population by utilizing, for example, techniques such as those described in Marasco, et al, Proc. Natl Acad. Sci. USA, 90:7889-93 (1993). N. Diagnostic Uses
  • polynucleotides, polypeptides, variants, targets and antibodies to any one of these molecules can, in addition to previously mentioned therapeutic applications, be used in one or more of the following methods: 1) detection assays (e.g. chromosomal mapping, tissue typing, forensic biology), and 2) predictive medicine (e.g. diagnostic or prognostic assays, pharmacogenomics and monitoring clinical trials).
  • detection assays e.g. chromosomal mapping, tissue typing, forensic biology
  • predictive medicine e.g. diagnostic or prognostic assays, pharmacogenomics and monitoring clinical trials.
  • agents may be used to detect a specific mRNA or gene (e.g. in a biological sample) for a genetic lesion.
  • agents described herein may be applied to the field of predictive medicine in which diagnostic assays or prognostic assays, pharmacogenomics, and monitoring clinical trials are used for predictive purposes to thereby treat an individual prophylactically.
  • one aspect of the present invention relates to diagnostic assays for determining expression of a polypeptide or nucleic acid of the invention and or activity of said agent of the invention, in the context of a biological sample to thereby determine whether an individual is afflicted with a disease or disorder, or is at risk of developing a disorder, associated with aberrant expression or activity of a polypeptide or polynucleotide of the invention.
  • the invention provides methods for detecting expression of a nucleic acid or polypeptide of the invention or activity of a polypeptide or polynucleotide of the invention in an individual to thereby select appropriate therapeutic or prophylactic agents for that individual (referred to herein as "pharmacogenomics").
  • Pharmoacogenomics allows for the selection of agents (e.g. drugs) for therapeutic or prophylactic treatment of an individual based on the genotype of the individual (e.g. the genotype of the individual examined to determine the ability of the individual to respond to a particular agent). Still another aspect of the invention pertains to monitoring the influence of agents (e.g. drugs or other compounds) on the expression or activity of a polypeptide or polynucleotide of the invention in clinical trials. 1. Detection Assays
  • polynucleotide sequences of the invention can be used in numerous ways as polynucleotide reagents. For example, these sequences can be used to i) map their respective genes on a chromosome and, thus, locate gene regions associated with genetic diseases; ii) identify an individual from a minute biological sample (tissue typing); and iii) aid in forensic identification of biological samples. a. Gene and Chromosome Mapping.
  • sequence (or portion of a sequence) of a gene has been isolated, this sequence can be used to identify the entire gene, analyze the gene for homology to other sequences (i.e., identify it as a member of a gene family such as EGF receptor family) and then map the location of the gene on a chromosome. Accordingly, nucleic acid molecules described herein or fragments thereof, can be used to map the location of the gene on a chromosome. The mapping of the sequences to chromosomes is an important first step in correlating these sequences with genes associated with disease. Briefly, genes can be mapped to chromosomes by preparing PCR primers from the sequence of a gene of the invention.
  • these agents can be used to assess the intactness or functionality of a particular gene. Comparison of affected and unaffected individuals can begin with looking for structural alterations in the chromosomes such as deletions, inversions, or translocations that are based on that DNA sequence. Once this is accomplished, the physical position of the sequence on the chromosome can be correlated with genetic data map. (such data are found, for example in McKusick, V. "Mendialian Inheritance in Man" available on-line through John Hopkins University Welch Medical Library).
  • genes and disease, mapped to the same chromosomal region can then be identified through linkage analysis (co-inheritance of physically adjacent genes), described in e.g. Egeland, J.A. et al. (1987) "Bipolar affective disorders linked to DNA markers on chromosome 11.” Nature, 325:783-787).
  • polynucleotide sequences can be used as probes in Southern Blot analysis to identify alterations in the organization of the gene of interest and surrounding regions.
  • complete sequencing of genes from several individuals can be performed to confirm the presence of a mutation and to distinguish mutations from polymorphisms. If a specific mutation is observed in some or all individuals affected by a particular disease, but not in any unaffected individuals, then the mutation is likely to be the causative agent of the particular disease b.
  • the nucleic acid sequences of the present invention can also be used to identify individuals from minute biological samples.
  • the United States military, for example, is considering the use of restriction fragment length polymorphism (RFLP) for identification of its personnel.
  • RFLP restriction fragment length polymorphism
  • an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identification.
  • the sequences of the present invention are useful as additional DNA markers for RFLP mapping (described in US Patent 5,272,057).
  • sequences of the present invention can be used to determine the actual base-by-base DNA sequence of selected portions of an individual's genome.
  • the nucleic acid sequences described herein can be used to prepare two PCR primers from the 5' and 3' ends of the individual's DNA and subsequently sequence it. Panels of corresponding DNA sequences from individuals, prepared in this manner, can provide unique individual identifications, as each individual will have a unique set of such DNA sequences due to allelic variation.
  • the sequences of the present invention can be used to obtain such identification sequences from individuals and from tissue.
  • the nucleic acid sequences of the invention uniquely represent portions of the human genome. Allelic variation occurs to some degree in the coding regions of these sequences, and to a greater degree in the non-coding regions.
  • allelic variation between individual humans occurs with a frequency of about once per 500 bases.
  • each of the sequences described herein may be, to some degree, used as a standard against which DNA from an individual can be compared for identification purposes.
  • sequences described herein can be used in forensic biology. Forensic biology is a scientific field employing genetic typing of biological evidence found at a crime scene as a means for positively identifying, for example a perpetrator of a crime. To make such an identification, PCR-based technology can be used to amplify DNA sequences taken from very small biological samples such as tissues, (e.g. hair, skin, or body fluids). The amplified sequence can then be compared to a standard thereby allowing identification of the origin of the biological sample.
  • tissues e.g. hair, skin, or body fluids
  • sequences of the present invention can be used to provide polynucleotide reagents (e.g. PCR primers) targeted to specific loci in the human genome, which can enhance the reliability of DNA-based forensic identifications by, for example, providing another "identification marker” (i.e. another DNA sequence that is unique to a particular individual.
  • the nucleic acid sequences described herein can further be used to provide polynucleotide reagents e.g. labeled or labelable probes, which can be used in, for example, an in situ hybridization technique, to identify a specific tissue. This technique can be exceedingly useful in cases where a forensic pathologist is presented with a tissue of unknown origin. Panels of such probes can be used to identify tissue by species and/or organ type.
  • Predictive Medicine Portions or fragments of the polynucleotide sequences of the invention can be used for predictive purposes to thereby treat an individual prophylacticaHy.
  • a preferred agent for detecting mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to the sequence one is attempting to detect (for instance, the sequence of the invention).
  • the nucleic acid probe can be, for example, a full length cDNA, or a portion thereof such as an oligonucleotide of at least 15, 30, 50, 100, 250, or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to a mRNA or genomic DNA encoding the invention.
  • labeled in this context refers to modifications in said sequences including, but not limited to, biotin labeling that can then be detected with a fluorescently labeled streptavidin, or 32 P labeling.
  • a preferred agent for detecting a polypeptide of the invention is an antibody or peptide capable of binding to the invention, preferably an antibody with a detectable label.
  • Antibodies can be polyclonal or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g. a Fab or F(ab) 2 ) can be used.
  • the term "labeled” in this context refers to direct labeling of the probe or antibody by coupling (i.e. physical linking) a detectable substance to the probe or antibody, such as a fluorescent labeled moiety or biotin.
  • the detection methods of the invention can be used to detect mRNA, protein, or genomic DNA in a biological sample in vitro as well as in vivo.
  • in vitro techniques for detection of mRNA include (but are not limited to) Northern Blot hybridization and in situ hybridizations.
  • in vitro techniques for detection of a polypeptide of the invention include enzyme linked immunosorbent assays (ELISA' s), Western blots, immunoprecipitations, and immunofluorescence.
  • kits for detecting the presence of a polypeptide or nucleic acid of the invention in a biological sample can be used to determine if a subject is suffering from or is at increased risk of developing a disorder associate with aberrant expression of a polypeptide or polynucleotide of the invention.
  • the kit can comprise a labeled compound or agent (as well as all the necessary supplementary agents needed for signal detection e.g. buffers, substrates, etc...) capable of detecting the polypeptide, or mRNA in the sample (e.g. an antibody which binds the polypeptide or a oligonucleotide probe that binds to DNA or mRNA encoding the polypeptide).
  • the methods of the invention can also be used to detect genetic lesions or mutations in a gene of the invention, thereby determining if a subject with the lesioned gene is at risk for a disorder characterized by aberrant expression or activity of an agent of the invention.
  • the methods include detecting the presence or absence of a genetic lesion or mutation characterized by at least one alteration affecting the integrity of the agent of the invention.
  • such genetic lesions or mutations can be detected by ascertaining the existence of at least one of: 1) a deletion of one or more nucleotides from a gene; 2) an addition of one or more nucleotides to a gene; 3) a substitution of one or more nucleotides of the gene; 4) a chromosomal rearrangement of the gene; 5) an alteration in the level of a messenger RNA transcript of the gene; 6) an aberrant modification of the gene, such as of the methylation pattern of the genomic DNA; 7) the presence of a non-wild type splicing pattern of a messenger RNA; 8) a non- wild type level of the protein encoded by the gene; 9) an allelic loss of the gene; and 10) an inappropriate post translational modification of the protein encoded by the gene.
  • mutations in a selected gene from a sample can be identified by alterations in restriction enzyme cleavage patterns.
  • sample and control DNA is isolated, digested with one or more restriction endonucleases, and fragment length sizes (determined by gel electrophoresis) are compared. Observable differences in fragment length sizes between sample and control DNA indicates mutations in the sample DNA.
  • Additional techniques that can be applied to detecting mutations include, but are not limited to, detection based on direct sequencing, PCR-based detection of deletions, inversions, or translocations, detection based on mismatch cleavage reactions (Myers, R.M. et al.
  • Pharmacogenetics deals with clinically significant hereditary variation in the response to drugs due to altered drug disposition and altered action in affected persons (see Linder, M.W. et al. (1997) "Pharmacogenetics: a laboratory tool for optimizing therapeutic efficiency.” Clin Chem. 43(2):254-266).
  • two types of pharmacogenetic conditions can be differentiated. There are genetic conditions transmitted as a single factor altering the way drugs act on the body, referred to as “altered drug action”. Alternatively, there are genetic conditions transmitted as single factors altering the way the body acts on drugs (referred to as “altered drag metabolism"). These two conditions can occur either as rare defects, or as polymorphisms.
  • glucose-6- ⁇ hosphate dehydrogenase deficiency is a common inherited enyzmopathy in which the main clinical complication is haemolysis after ingestion of oxidant drugs (e.g. anti-malarials, sulfonamides etc.).
  • oxidant drugs e.g. anti-malarials, sulfonamides etc.
  • the activity of drug metabolizing enzymes is a major determinant of both the intensity and duration of drag action.
  • the discovery of genetic polymorphisms of drag metabolizing enzymes e.g. N-acetyltransferase 2 (NAT2) and cytochrome P450 enzymes (CYP2D6 and CYP2C19) has provided a explanation as to why some patients do not obtain the expected drug effects or show exaggerated drug response and serious toxicity after taking the standard and safe dose of a drug.
  • NAT2D6 and cytochrome P450 enzymes CYP2D6 and CYP2C19
  • the gene coding for CYP2D6 is highly polymorphic and several mutations have been identified in PM which all lead to the absence of functional CYP2D6. Poor metabolizers of this sort quite frequently experience exaggerated drug response and side effects when they receive standard doses. If a metabolite is the active therapeutic moiety, a PM will show no therapeutic response, as demonstrated for the analgesic effect of codeine mediated by its CYP2D6-formed metabolite morphine. At the other extreme are the so- called ultra rapid metabolizer who do not respond to standard doses. Recently, the molecular basis of ultra rapid metabolism has been identified to be due to CYP2D6 gene amplification. .
  • an agent of the invention can be used to determine or select appropriate agents for therapeutic prophylactic treatment of the individual.
  • pharmacogenetic studies can be used to apply genotyping of polymorphic alleles encoding drug-metabolizing enzymes to the identification of an individuals drug responsiveness phenotype. 3. Monitoring of Effects During Clinical Trials
  • Monitoring the influence of agents that effect the expression or activity of a polypeptide or polynucleotide of the invention can be applied in clinical trials.
  • the effectiveness of a drug directed toward a target identified by the invention and intended to treat a particular ailment can be monitored in clinical trials of subjects exhibiting said ailment by monitoring the level of gene expression of the target, activity of the target, or levels of the target of the invention.
  • the present invention provides a method for monitoring the effectiveness of treatment of a subject with an agent by comprising the steps of (i) obtaining a pre--administration sample from a subject prior to administration of the agent; (ii) detecting the level of the polypeptide or polynucleotide of the invention in the pre-ad inistration sample; (iii) obtaining one or more post-administration samples from the subject; (iv) detecting the level or activity of said target of the invention in the post-administration samples, (v) comparing the level of said target of the invention in the post adrninistration sample with levels in the pre-administration samples, and (vi) altering the administration of the agent to the subject accordingly.
  • the pRETRO-ON retroviral vector (Clontech, #6158) was digested with EcoRI and Xhol to remove the reverse tetracycUn-controlled transactivator " (rtTA) and SV40 promoter sequences from the vector backbone. Subsequently, the mini-CMV and adjoining EGFP coding sequence were PCR amplified from an in-house plasmid vector (pVT304-2, original source, Clontech, Genbank Ace. N.
  • oligonucleotides oVT 818 and oVT819 that had Xhol and EcoRI restriction sites engineered into the primers (oVT 818: 5' CGTACGGGAATTCGTCGACCGGTCAT GGCTG; oVT 819: 5' CGTTACGGCTCGAGGTAGGCGTGTACGGTGGG).
  • the mini-CMV-EGFP fragment was then digested with EcoRI and Xhol and inserted into the modified pRETRO-ON backbone. This mosaic construct was then digested with EcoRI, blunted with Klenow, and religated to eliminate the EcoRI site. A similar procedure was performed to knock out the remaining Notl site.
  • MCS multiple cloning site
  • CGCGAATTCTGTC CGCGAATTCTGTC that contained the appropriate restriction sites flanked by one intact and one crippled Xhol site.
  • the final double stranded annealing product was ligated into the Xhol site of our vector and sequenced to identify a clone with the correct orientation.
  • An 800-base pair RARE promoter sequence from the RAR U gene (de The, H. et al. (1990) "Identification of a retinoic acid responsive element in the retinoic acid receptor beta gene.” Nature 343:177-180) ' was selected as the cis-regulatory element for this experiment.
  • the RARE was PCR amplified from genomic DNA taken from HL60 cells grown in tissue culture (oVT825 - 5' AGAACACACAGC TGGTAAGTGGCAGACCTGG 3' and oVT827 - 5' ACGCTCACTTGA AAGCCACTTGGGATGGGCCC 3').
  • the RARE was then cloned in the correct orientation upstream of the EGFP-encoding sequence using the XhoI/EcoRI sites that was engineered into the PCR primers. This placed the RARE directly upstream of a minimal CMV promoter, thereby bringing the EGFP reporter under the control of the endogenous RA-inducible cellular pathway.
  • the hybrid pRETRO-On, RARE controlled EGFP construct (designated pVT355) was then co- transfected with VSV-G envelope expression plasmid into 293gp packaging cells (gift of I. Verma, Salk Institute) using LipofectAmine (Life Technologies).
  • 1, 3 x 10 6 cells of the packaging cell line (293gp) are seeded into a T175 flask.
  • LipofectAMINE Gibco BRL + 1.5 ml DMEM (serum free) are mixed and left at room temperature for 30 minutes. Subsequently, the two tubes are mixed together along with 17 ml of serum free DMEM. This cocktail is referred to as the "transfection mix.”
  • Previously plated 293gp cells are then gently washed with serum free media and exposed to 20 ml of the transfection mix for 4 hours at 37°C Following this period, the transfection mix can be removed and the cells are incubated with complete DMEM (10% serum) for a period of 72 hours at 37°C On Day 4 or 5, the media (now referred to as "viral supernatant") overlying the 293gp cells is collected, filtered through a 0.45 ⁇ filter and frozen down in at -80°C Alternatively, retroviral DNA can be packaged using a technique that is referred to herein as the "CaCl 2 Method".
  • Retroviral supernatant can subsequently be thawed and used directly to infect WM35 melanoma cells (a gift of M. Herlyn, Wistar Institute).
  • RA-responsive melanoma cells were screened for responsiveness to RA.
  • a host population of RA-responsive melanoma cells was identified as follows. When the WM35 cell line was exposed to 5 ⁇ M RA (Sigma), they exhibited an increase in granularity. The visual observation of RA-induced morphological changes were consistent with FACS analysis that showed RA-induced changes in the Forward vs. Side Scatter Plot of WM35 cells. Following standard procedures common to the art, a population of 1 X 10 7 WM35 cells were infected with the pVT355 retroviral supernatant for 24 hours, using a 20% vol/vol of retroviral supernatant to complete media (KBM catalogue no.CC3101, Clonetics) plus 2% FBS.
  • Cells containing stable inserts of the pVT355 vector were selected by culturing cells in 1 ⁇ g/ml puromycin (Sigma). The puromycin resistant cell population was transferred to media supplemented with 2% charcoal-stripped FBS serum (CBI, Cpcalico Biologicals Inc.) to "reduce or eliminate retinoids present in FBS.
  • CBI charcoal-stripped FBS serum
  • ATRA all-trans retinoic acid dissolved in 100% ethanol
  • the EGFP-expressing cells (referred to as "FI") were recovered using a fluorescent activated cell sorter (FACS, Coulter EPICS Elite).
  • FACS fluorescent activated cell sorter
  • RA-responsive clone To obtain a robust RA-responsive clone, the following procedure was performed: some 2000 RA-responsive cells obtained from the above FACS cycling procedure were plated on 150 mm plates to allow clonal isolation. After 7 days there were approximately 100 cells/colony at which time the complete media (+FBS) was replaced with CBI supplemented media. After 3 days in CBI media, 5 ⁇ M RA was added to the plate. Two days after induction of the RARE-EGFP reporter with RA, 24 independent colonies that contained a very high percentage of EGFP expressing cells were picked for further analysis. One clone ⁇ designated Clone 8 ⁇ showed minimal expression of EGFP in CBI and a 290-fold induction when treated with RA.
  • RA reporter cell line In order to test the responsiveness of the RA reporter cell line, a population of Clone 8 cells was subjected to a synthetic perturbagen to verify that (1) the fluorescence induction was in fact related to RA, and (2) the reporter construct was sensitive to the presence of the synthetic perturbagen. This was accomplished by introducing into the Clone 8 cells a known RA pathway inhibitor ⁇ a synthetic, dominant-negative perturbagen designated RAR ⁇ 403 — as follows.
  • the dominant negative inhibitor of the RA pathway was introduced into the Clone 8 cells in three separate modes: (i) as a naked cDNA, (ii) inserted into a non-fluorescent EGFP scaffold, "dGFP," which bears a Tyr ->Phe mutation at amino acid residue 66, and (Iii) inserted onto the 3' end of the glutathione S-transferase "GST" scaffold, commonly used for purification of fusion proteins.
  • the various ⁇ 403 constructs were packaged in 293 gp's as described previously, and infected into a population of Clone 8 cells as described elsewhere herein.
  • the RA responsiveness of the various ⁇ 403-bearing cell populations was compared to the basal (untreated) Clone 8 population as follows. Each cell population was cultured in the presence of 100 nM RA, and subjected to FACS analysis. Approximately 98% of the control Clone 8 population shifted to the "bright" gate in response to the RA, while approximately 2% remained non-responsive to RA. In contrast, a significant percentage of the cells in which the naked ⁇ 403 construct had been introduced into the Clone 8 background remained in the "dim" gate in the presence of RA. Individual clones derived from this population displayed a penetrance ranging from approximatelylO-93%, with the ⁇ 403 population as a whole showing roughly 34% penetrance.
  • a synthetic perturbagen, RAR-VP16 is constructed and introduced into the C8 cell line.
  • RAR-VP16 a synthetic perturbagen
  • Example 2 Preparation and Transfer of a cDNA Library Using techniques that are familiar to individuals in the art, randomly primed cDNA libraries were used as a source of sequences encoding putative RA-pathway activating and blocking agents.
  • poIyA mRNA derived from placental tissue was PCR amplified using a random 9-mer linked to a unique Sfil sequence ("SfiA"), followed by an additional set of nucleotides that is used later for library amplification (OVT 906: 5* ACTCTGGACTAG GCAGGTTCAGTGGCCATTATGGCC(N) 9 ).
  • the product of this reaction was size selected (>400 base pairs) and subjected to RNAse A/H treatment to remove the original RNA template.
  • the remaining single stranded DNA was then subjected to a second round of PCR using a random hexamer nucleotide sequence linked to a second unique Sfil sequence ("SfiB") which was again followed by an additional set of nucleotides for future library amplification: (OVT 908: 5' AAGCAGTGGTGTCAACG CAGTGAGGCCGAGGCGGCC (N) 6 ).
  • the library containing C8 cells (F0) were grown for 48-72 hours in the presence of ATRA (2% FBS). Subsequently, non-fluorescent, or "dim" cells were collected by FACS. The size and position of the "dim” sort gate was determined from previous work with Clone 8 cells carrying the dominant-negative control perturbagen, RAR ⁇ 403. The collected dim cells (referred to as 'TI") were then allowed to expand 10-fold before being re-sorted using the same "dim” gates described previously. Approximately 10% (122,000 cells) of the FI population fell into the "dim” gate. When the cycling process was repeated on these cells (F2), 25% of the population fell into the "dim” gate.
  • the perturbagen inserts contained in the dim population can be PCR amplified from genomic DNA derived from FI, F2, or F3 populations. This material can subsequently be used to construct new sublibraries that, in turn, can be re-screened for further enrichment.
  • the DNA encoding ten of these perturbagens was then PCR amplified using oligonucleotide sequences that flanked the cDNA insert (oVT 181: 5' GGATCACTCTCGGCATGGACGAG and oVT 178: 5' ATTTTATCGATGTTAGCTTGGCCATT), recloned into the original vector (in both the original reading frame and a second reading frame), and tested for their ability to suppress the ATRA induced signal.
  • three demonstrated perturbagen activity when retested ( Figure 12).
  • a fourth perturbagen (P241) was isolated after a sublibrary was generated from the F3 population of dim cells.
  • PCR product was then digested with Sfil, directionally cloned back into the original vector (pVT352.1), and reinfected into fresh Clone 8 cells for a second round of selection. This process was repeated through six consecutive rounds of selection and each new sublibrary was compared with parallel control infections using pVT352.1 that lacked an insert. Following these procedures, individual clones were sequenced and retested. Under the conditions described above, the number of cells falling into the
  • the polynucleotide sequence encoding perturbagen R3 was cloned into pNT 2527 using Gap-repair. As a result of these procedures, the 9 amino acids of R3 were fused in- frame with the C-terminus of dGFP, which was, in turn, fused to the LexA binding domain. Using conventional means the vector was then introduced into the yeast strain yNT 87 and mated to a population of yVT 99 cells that contain an episomal, human cD ⁇ A library (Proquest Fetal Brain library, Gibco) fused to the C-terminus of the LexA activation domain and regulated by the Gal4 promoter.
  • human cD ⁇ A library Proquest Fetal Brain library, Gibco
  • the yVT99 strain contains two chromosomal-linked reporter constructs (URA3 AND LEU1 reporter genes) that are operably associated with eight tandem copies of the LexA operator sequence. Diploids containing a copy of both the R3 encoding vector and a member of the cDNA library were then selected by plating the cells on SD -Trp, -His media. To identify cellular targets of the R3 perturbagen, diploid cells were collected and plated on SD -His, -Trp, -Ura, and -Leu, -Dex, +Gal plates. Cells that were capable of growing and forming colonies under these conditions were then picked and the associated cDNA target was sequenced using standard techniques.
  • Target sequences were then used to search the NCBI BLAST database to determine target identity.
  • R3 targets including PAT1 (a kinesin light chain-related protein accession), TCTELl, alpha crystalUn ⁇ chain, and Hira Interacting Protein, were identified by two-hybrid analysis (see Figure 16 a-d).
  • PAT1 a kinesin light chain-related protein accession
  • TCTELl alpha crystalUn ⁇ chain
  • Hira Interacting Protein were identified by two-hybrid analysis (see Figure 16 a-d).
  • Messenger RNAs from two different C8 populations were either labeled with CY3 or CY5, and then competitively hybridized to a UniGEM V5 human microarray by Incyte Genomics, Inc. (California). Detection and analysis of the ratio of transcript signals observed for the CY3 versus CY5 probes were performed by Incyte Genomics, Inc.
  • transcript levels for roughly 9,000 genes were compared in C8 cells expressing either R3 or an out-of-frame (OF) R3, maintained in CBI. Analysis of the data showed that the expression profile of only 30 genes were altered by 1.8-fold or more with the largest difference being 2.8-fold (Fig. 19). These data suggested that the R3 perturbagen causes specific, limited phenotypic change in the global expression profile of these cells. In contrast, RA treatment of C8 cells expressing R3-OF caused a more dramatic shift in molecular phenotype, with 285 genes altered in expression level by 1.8-fold or greater (data not shown).

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Analytical Chemistry (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
EP01996629A 2000-11-17 2001-11-17 Tests des retinoidstoffwechselpfades, sowie hierfür geeignete zusammensetzungen Withdrawn EP1407045A2 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US24946800P 2000-11-17 2000-11-17
US249468P 2000-11-17
PCT/US2001/044039 WO2002040719A2 (en) 2000-11-17 2001-11-17 Retinoid pathway assays, and compositions therefrom

Publications (1)

Publication Number Publication Date
EP1407045A2 true EP1407045A2 (de) 2004-04-14

Family

ID=22943585

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01996629A Withdrawn EP1407045A2 (de) 2000-11-17 2001-11-17 Tests des retinoidstoffwechselpfades, sowie hierfür geeignete zusammensetzungen

Country Status (4)

Country Link
EP (1) EP1407045A2 (de)
AU (1) AU2002219851A1 (de)
CA (1) CA2429515A1 (de)
WO (1) WO2002040719A2 (de)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101469316B (zh) * 2007-12-29 2011-06-29 中国科学院生态环境研究中心 检测类/抗维甲酸化合物的双杂交酵母以及生物测试方法
US20120034613A1 (en) * 2010-08-03 2012-02-09 Nse Products, Inc. Apparatus and Method for Testing Relationships Between Gene Expression and Physical Appearance of Skin

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5955275A (en) * 1997-02-14 1999-09-21 Arcaris, Inc. Methods for identifying nucleic acid sequences encoding agents that affect cellular phenotypes
EP1131419A1 (de) * 1998-11-17 2001-09-12 Arcaris Verfahren zur überprüfung von polypeptidzielen, welche mit zellulären phenotypen korrelieren

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0240719A2 *

Also Published As

Publication number Publication date
AU2002219851A1 (en) 2002-05-27
CA2429515A1 (en) 2002-05-23
WO2002040719A3 (en) 2003-11-06
WO2002040719A2 (en) 2002-05-23

Similar Documents

Publication Publication Date Title
US5998136A (en) Selection systems and methods for identifying genes and gene products involved in cell proliferation
CA2148252C (en) Interaction trap system for isolating novel proteins
US20020019005A1 (en) Process for identification of genes encoding proteins having cell proliferation-promoting activity
JP2003525019A (ja) ゲノム解析の並列処理方法群
CA2360396A1 (en) Characterization of a calcium channel family
JPH11506907A (ja) アポトーシスを変調する新規ペプチドおよび組成物
JP2012065671A (ja) Ｍａｃａｃａｆａｓｃｉｃｕｌａｒｉｓ由来のＰ−糖タンパク質およびその使用
US20020177125A1 (en) Human rhinovirus assays, and compositions therefrom
KR100646074B1 (ko) 카스파제-8 상호작용 단백질
US20020081688A1 (en) Retinoid pathway assays, and compositions therefrom
JP2002529051A (ja) ヘルペスウイルス侵入メディエーター関連タンパク質ファミリーの新規分子およびその使用
WO2002040719A2 (en) Retinoid pathway assays, and compositions therefrom
JP2003513670A (ja) ジフテリア毒素構築体を用いるスクリーニングのための方法および組成物
US6872811B1 (en) HRPCa9 and HRPCa10 nucleic acids and polypeptides
US20020086386A1 (en) B-catenin assays, and compositions therefrom
US20030054389A1 (en) Methods for identifying agents that induce a cellular phenotype, and compositions thereof
US20020028508A1 (en) Novel genes encoding proteins having prognostic, diagnostic, preventive , therapeutic and other uses
US20040047845A1 (en) Methods and compositions for diagnosis and treatment of cancer based on the transcription factor ets2
WO2004012574A2 (en) Negative selections assays, and compositions thereof
US7063959B1 (en) Compositions of the SOC/CRAC calcium channel protein family
US20060281078A1 (en) Human fast-1 gene
WO2002055697A2 (en) Human rhinovirus assays, and compositions comprising anti-rhinoviral perturbagens
US6485921B1 (en) UBCLP and uses thereof
EP1484396B1 (de) Moleküle in verbindung mit der c-terminalen domäne in einer rezeptorzelle
US20060019248A1 (en) Mutant sh-3 binding protein compositions and methods

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030701

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050601

RIN1 Information on inventor provided before grant (corrected)

Inventor name: KARPILOW, JON

Inventor name: RICHARDS, BURT, TIMOTHY

Inventor name: KAMB, CARL, ALEXANDER