Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Y—ENZYMES
  • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
  • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
  • C12Y302/01052—Beta-N-acetylhexosaminidase (3.2.1.52)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/10—Transferases (2.)
  • C12N9/1048—Glycosyltransferases (2.4)
  • C12N9/1081—Glycosyltransferases (2.4) transferring other glycosyl groups (2.4.99)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/10—Transferases (2.)
  • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
  • C12N9/1241—Nucleotidyltransferases (2.7.7)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
  • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/88—Lyases (4.)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/90—Isomerases (5.)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
  • C12P21/00—Preparation of peptides or proteins
  • C12P21/005—Glycopeptides, glycoproteins
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2799/00—Uses of viruses
  • C12N2799/02—Uses of viruses as vector
  • C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
  • C12N2799/026—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

• the invention relates to methods and compositions for expressing sialylated glycoproteins in heterologous expression systems, particularly insect cells.
• heterologous proteins are generally identical at the amino acid level, their post-translationally attached carbohydrate moieties often differ from the carbohydrate moieties found on proteins expressed in their natural host species.
• carbohydrate processing is specific and limiting in a wide variety of organisms including insect, yeast, mammalian, and plant cells.
• the baculovirus expression vector has promoted the use of insect cells as hosts for the production of heterologous proteins (Luckow et al. (1993) Curr. Opin.
• the carbohydrate composition of an attached oligosaccharide, especially sialic acid can affect a glycoprotein' s solubility, structural stability, resistance to protease degradation, biological activity, and in vivo circulation (Goochee et al. (1991) Bio/technology 9:1347-1355, Cumming et al. (1991) Glycobiology 1 :115-130, Opdenakker et al. (1993) FASEB J. 7:1330, Rademacher et ⁇ /. (1988) Ann. Rev. Biochem., Lis et al. (1993) Ewr. J. Biochem. 218:1-27).
• the terminal residues of a carbohydrate are particularly important for therapeutic proteins since the final sugar moiety often controls its in vivo circulatory half-life (Cumming et al. (1991)
• Glycobiology 1 :115-130 Glycobiology 1 :115-130. Glycoproteins with oligosaccharides terminating in sialic acid typically remain in circulation longer due to the presence of receptors in hepatocytes and macrophages that bind and rapidly remove structures terminating in mannose (Man), N-acetylglucosamine (GlcNAc), and galactose (Gal), from the bloodstream (Ashwell et al. (1974) Giochem. Soe. Symp. 40:117-124, Goochee et al. (1991) Bio/technology 9:1347-1355, Opdenakker et al. (1993) FASEB J. 7:1330).
• Man mannose
• GlcNAc N-acetylglucosamine
• Gal galactose
• sialic acid residues are the residues most commonly found on the termini of glycoproteins produced by insect cells.
• the presence of sialic acid can also be important to the structure and function of a glycoprotein since sialic acid is one of the few sugars that is charged at physiological pH.
• the sialic acid residue is often involved in biological recognition events such as protein targeting, viral infection, cell adhesion, tissue targeting, and tissue organization (Brandley et al. (1986) J. of Leukocyte bio. 40:97-111, Varki et al. (1997) FASEB 11 :248-255, Goochee et al. (1991) Bio/technology 9:1347-1355, Lopez et al. (1997) Glycobiology 7:635-651, Opdenakker et al. (1993) FASEB J. 7:1330).
• composition of the attached oligosaccharide for a secreted or membrane- bound glycoprotein is dictated by the structure of the protein and by the post- translational processing events that occur in the endoplasmic reticulum and Golgi apparatus of the host cell. Since the secretory processing machinery in mammalian cells differs from that in insect cells, glycoproteins with very different carbohydrate structures are produced by these two host cells (Jarvis et al. (1995) Virology 212:500- 511, Maru et ⁇ /. (1996) J. Biol. Chem. 271 :16294-16299, Altmann et al. (1996) Trends in Glycoscience and Glycotechnology 8:101-114).
• N-glycosylation is highly significant to glycoprotein structure and function.
• N-glycosylation begins in the endoplasmic reticulum (ER) with the addition of the oligosaccharide, Glc 3 Man 9 GlcNAc onto the asparagine (Asn) residue in the consensus sequence Asn-X-Ser/Thr (Moremen, et al. (1994) Glycobiology 4:113-125, Varki et al. (1993) Glycobiology 3(2):97-130, Altmann et al. (1996) Trends in Glycoscience and Glycotechnology 8:101-114).
• glycoprotein passes through the ER and Golgi apparatus, enzymes trim and add different sugars to this N-linked glycan.
• carbohydrate modification steps can differ in mammalian and insect hosts.
• the initial trimming steps are followed by the enzyme-catalyzed addition of sugars including N-acetylglucosamine (GlcNAc), galactose (Gal), and sialic acid (SA) by the steps shown in Figure 2, and as described in Goochee et al. (1991) Bio/technology 9:1347-1355.
• GlcNAc N-acetylglucosamine
• Gal galactose
• SA sialic acid
• N-linked glycans attached to heterologous and homologous glycoproteins comprise either high-mannose (Man 9 . 5 GlcNAc 2 ) or truncated
• GlcNAcTl co-expression can increase the number of recombinant glycoproteins with oligosaccharides containing GlcNAc on the Man alphail, 3) branch (Jarvis et al. (1996) Nature Biotech. 14:1288-1292, Jarvis et al. (1995) Virology 212:500-511, Hollister et al. (1998) Glycobiology 5:473-480; Wagner et al. (1996) Glycobiology 6:165-175).
• the production of complex carbohydrates comprising sialic acid has not been observed in these studies.
• a similar lack or limitation in donor nucleotide substrates may be observed in other eukaryotes as well.
• the co-expression of sialyltransferase and other transferases must be accompanied by the intracellular generation of the proper donor nucleotide substrates and the proper acceptor substrates in order for the production of sialylated and other complex glycoproteins in eukaryotes.
• sialic acid and CMP-sialic acid are not permeable to cells so these substrates can not be provided directly to the medium of the cultures (Bennett et al. (1981) J. Cell. Biol. 88:1-15).
• Glycoproteins containing sialylated oligosaccharides would have improved in vivo circulatory half-lives that could lead to their increased utilization as vaccines and therapeutics.
• complex sialylated glycoproteins from insect cells would be more appropriate biological mimics of native mammalian glycoproteins in molecular recognition events in which sialic acid plays a role.
• manipulating carbohydrate processing pathways in insect and other eukaryotic cells so that the cells produce complex sialylated glycoproteins is useful for enhancing the value of heterologous expression systems and increasing the application of heterologous cell expression products as vaccines, therapeutics, and diagnostic tools; for increasing the variety of glycosylated products to be generated in heterologous hosts; and for lowering biotechnology production costs, since particular expression systems can be selected based on efficiency of production rather than the capacity to produce particular product glycoforms.
• compositions and methods for producing glycoproteins having sialylated oligosaccharides are provided.
• the compositions of the invention comprise enzymes involved in carbohydrate processing and production of nucleotide sugars, nucleotide sequences encoding such enzymes, and cells transformed with these nucleotide sequences.
• the compositions of the invention are useful in methods for producing complex sialylated glycoproteins in cells of interest including, but not limited to, mammalian cells and non-mammalian cells (e.g., insect cells).
• the sialylation process involves the post-translational addition of a donor substrate, cytidine monophosphate-sialic acid (CMP-SA) onto a specific acceptor carbohydrate (GalGlcNAcMan-R) via an enzymatic reaction catalyzed by a sialyltransferase in the Golgi apparatus. Since one or more of these three reaction components (i.e., acceptor, donor substrate, and the enzyme sialyltransferase) is limiting or absent in certain cells of interest, methods are provided to enhance the production of the limiting components.
• CMP-SA cytidine monophosphate-sialic acid
• GalGlcNAcMan-R specific acceptor carbohydrate
• Polynucleotide sequences encoding the enzymes used according to the methods of the invention are known or novel bacterial invertebrate, fungal, or mammalian sequences and/or fragments or variants thereof , that are optionally identified using bioinformatics searches.
• completion of the sialylation reaction is achieved by expressing a sialyltransferase enzyme, or a fragment or variant thereof, in the presence of acceptor and/or donor substrates.
• the invention also provides an assay for sialylation, wherein the structures and compositions of N-linked oligosaccharides attached to a model secreted glycoprotein, (e.g., transferrin), is elucidated using multidimensional chromatography.
• Cells of interest that have been recombinantly engineered to produce new forms of sialylated glycoproteins, higher concentrations of sialylated glycoproteins, and/or elevated concentrations of donor substrates (.g., nucleotides sugars) required for sialylation, as well as kits for expression of sialylated glycoproteins are also provided.
• donor substrates .g., nucleotides sugars
• Figure 1 depicts the typical differences in insect and mammalian carbohydrate structures.
• Figure 2 depicts the enzymatic generation of a complex sialylated carbohydrate in mammalian cells.
• Figure 3 depicts a Paucimannosidic oligosaccharide.
• Figure 4a depicts a hybrid glycan from Estigmena acrea (Ea-4) insect cells.
• Figure 4b depicts a complex glycan from Estigmena acrea (Ea-4) insect cells.
• Figure 5 depicts the nucleotide sugar production pathways in mammalian and E. coli cells leading to sialylation.
• Figure 6 depicts a chromatogram of labeled oligosaccharides separated by reverse phase High Performance Liquid Chromatography (HPLC) on an ODS-silica column. Using this technique, oligosaccharides are fractionated according to their carbohydrate structures. Panel “L” represents cell lysate fractions and panel “S” represents cell supernatant fractions.
• HPLC High Performance Liquid Chromatography
• Figure 7 depicts the structure of Oligosaccharide G.
• Figure 8 depicts the glycosylation pathway in Trichoplusia ni insect cells (High FiveTM cells; Invitrogen Corp., Carlsbad, CA, USA).
• Figure 9 depicts the chromatogram of a Galactose-transferase assay following High Performance Anion Exchange Chromatography (HP AEC), as described in the Examples and references cited therein.
• HP AEC High Performance Anion Exchange Chromatography
• Figure 10 depicts the chromatogram of a 2,3-Sialyltransferase assay following Reverse Phase-High Performance Liquid Chromatography (RP-HPLC), as described in the Examples.
• RP-HPLC Reverse Phase-High Performance Liquid Chromatography
• Figure 11 depicts the results of a Galactose-transferase (Gal-T) assay of insect cell lysates performed using a Europium (Eu +3 )-labeled Ricinus cummunis lectin (RCA 120) probe; which specifically binds Gal or GalNAc oligosaccharide structures as described in the Examples.
• Each column represents the Gal-T activity in a given sample;
• Column (A) represents boiled T. ni cell lysates,
• Column (B) represents normal T. ni cell lysates,
• Column (C) represents activity in 0.5 mU of enzyme standard,
• Column (D) represents lysate from T.
• FIG. 12 depicts the product of reacting UDP-Gal-6-Naph with dans- AE-GlcNAc in the presence of GalT.
• Figure 12 depicts the reaction products resulting from incubation of UDP-Gal- 6-Naph and Dans-AE-GlcNAc in the presence of Galactose-transferase, as described in the "Experimental” section below.
• Figure 13 depicts the distinguishing emission spectra of GalT assay reactants and products, as described in the "Experimental” section below. Irradiation of the naphthyl group in UDP-Gal-6-Naph at 260-290 nm ("ex") results in an emission peak at 320-370 nm ("em” dotted line) while irradiation of the Galactose-transferase reaction products at these same low wavelengths results in energy transfer to the dansyl group and an emission peak at 500-560 nm ("em" solid line).
• Figure 14 depicts the oxidation reaction of sialic acid.
• Figure 15 schematically depicts a new GlcNAc Tl assay utilizing a synthetic 6-aminohexyl glycoside of the trimannosyl N-glycan core structure labeled with DTPA (Diethylenetriaminepentaacetic acid) and complexed with Eu +3 (see “Experimental” section below).
• This substrate is incubated with insect cell lysates or positive controls containing GlcNAc Tl and UDP-GlcNAc. Chemical inhibitors are added to minimize background N-acetylglucosaminidase activity. After the reaction, an excess of Crocus lectin CVL (Misaki et al. (1997) J. Biol. Chem.
• Figure 16 depicts a chromatogram of sialic acid levels in SF9 insect cells and CHO (Chinese hamster ovary) cells.
• Sf-9 Free Sialic Acid Levels the known sialic acid standard elutes just prior to 10 minutes, while no corresponding sialic acid peak can be detected (above background levels) in Sf-9 cells.
• CHO sialic acid levels the sialic acid standard elutes at approximately 9 minutes, while bound and free (released by acid hydrolysis) sialic acid peaks are observed at similar elution positions.
• Figure 17 depicts how selective inhibition of N-acetylglucosaminidase allows for production of complex oligosaccharide structures.
• Figure 18 depicts ethidium bromide-stained agarose gels following electrophoresis of PCR amplification products from Sf9 genomic DNA or High FiveTM (Invitrogen Corp., Carlsbad, CA, USA) cell cDNA templates using degenerate primers corresponding to three different regions conserved within N- acetylglucosaminidases.
• Figure 19 depicts two potential specific chemical inhibitors of N- acetylglucosaminidase.
• Figure 20 schematically depicts that the overexpression of various glycosyltransferases leads to greater production of oligosaccharide acceptor substrates.
• Figure 21 depicts three possible N-glycan acceptor structures which include the terminal Gal (G) acceptor residue required for subsequent sialylation.
• FIG. 22 depicts a structure of CMP-sialic acid (CMP-SA).
• Figure 23 depicts a metabolic pathway for ManNAc (N-acetylmannosamine) from glucosamine and N-acetylglucosamine (GlcNAc).
• ManNAc N-acetylmannosamine
• GlcNAc N-acetylglucosamine
• Figure 24 depicts a ManNAc (N-acetylmannosamine) to sialic acid metabolic pathway.
• Figure 25 depicts the formation of CMP-sialic acid (CMP-S A) catalyzed by CMP-SA synthetase.
• CMP-S A CMP-sialic acid
• Figure 26 depicts detection of purified (P) transferrin (hTf) or transferrin from unpurified insect cell lysates (M) following separation on an SDS-PAGE gel, as described the Examples.
• Figure 27 depicts the nucleotide sequence of human aldolase.
• Figure 28 depicts the amino acid sequence of human aldolase encoded by the sequence shown in Figure 27.
• Figure 29 depicts the nucleotide sequence of human CMP-SA synthetase (cytidine monophosphate-sialic acid synthetase)
• Figure 30 depicts the amino acid sequence of human CMP-SA synthetase encoded by the sequence shown in Figure 29.
• Figure 31 depicts the nucleotide sequence of human sialic acid synthetase
• Figure 32 depicts the amino acid sequence of human SA-synthetase (SAS) encoded by the sequence shown in Figure 31.
• SAS SA-synthetase
• Figure 33 depicts the types and quantities of oligosaccharide structures found on recombinant human transferrin in the presence and absence of Gal T overexpression.
• Figure 34 depicts bacterial and mammalian sialic acid metabolic pathways.
• Figure 35 depicts human sialic acid synthetase (SAS) genetic information: (A) depicts an alignment of the polypeptide encoded by the human SAS polynucleotide open-reading frame; (B) shows the amino acid sequence homology between human SAS (top) and bacterial sialic acid synthetase (NeuB) (bottom).
• SAS sialic acid synthetase
• Figure 36 (A) depicts an autoradiogram of human sialic acid synthetase gene products following gel electrophoresis.
• the lanes labeled “In Vitro” represent in vitro transcription and translation products of SAS cDNA (amplified via polymerase chain reaction (PCR)).
• Lane 1 (“pA2") depicts a negative control reaction in which pA2 plasmid (without the SAS cDNA) was PCR amplified, transcribed, translated, and radiolabled.
• Lane 2 (“pA2-SAS ") depicts a sample reaction in which pA2-SAS plasmid (containing the human SAS cDNA) was PCR amplified, transcribed, translated, and radiolabeled.
• Lane 3 depicts radiolabeled protein standards migrating at approximately 66, 46, 30, 21.5, and 14.3 kD.
• the lanes labeled "Pulse Label” show radioactive 35 S pulse labeling of polypeptides from insect cells infected by virions not containing or containing the human SAS cDNA.
• Lane 4 (“A35”) depicts a negative control reaction of radiolabled polypeptides from insect cells infected with virions not containing the SAS cDNA.
• Lane 5 (“AcSAS”) depicts a sample reaction of radiolabeled polypeptides from insect cells infected with baculovirus containing the human SAS cDNA.
• Figure 36 (B) depicts an RNA (Northern) blot of human tissues (spleen, thymus, prostate, testis, ovary, small intestine, peripheral blood lymphocytes (PBL), colon, heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas) probed for sialic acid synthetase RNA transcripts. Transcript sizes (in kilobases) are indicated by comparison to the scale on the left side.
• Figure 37 depicts chromatograms indicating the in vivo sialic acid content of various cells as monitored following DMB derivitization and reverse phase HPLC separation.
• Figure 37 (A) depicts the sialic acid content of lysed cell lines after filtration through a 10,000 MWCO membrane. The cell lines analyzed were Sf-9
• FIG. 37 depicts a chromatogram of the sialic acid content of lysates from various Sf-9 cells.
• "AcSAS Infected" cell lysates were from Sf-9 cells infected with baculovirus containing the human SAS cDNA.
• the Neu5Ac and KDN "Standards" are shown at 1,000 fmol concentrations.
• "A35 Infected” cell lysates are from Sf-9 infected by baculovirus not containing the SAS cDNA.
• "Uninfected” cell lysates are from normal Sf-9 cells not infected by any baculovirus.
• Original chromatogram values have been divided by protein concentration to normalize chromatograms.
• Figure 37 (C) depicts a chromatogram of the sialic acid content from lysates of Sf-9 grown in media supplemented by 10 mM ManNAc; cells were infected or not infected with baculovirus as shown in Figure 37 (B).
• Figure 38 depicts chromatograms of in vitro assays for sialic acid phosphorylation activity. Assays were performed with and without alkaline phosphatase (AP) treatment.
• Figure 38 (A) depicts chromatogram results of a Neu5 Ac-9-phosphate assay performed using lysates from Sf-9 cells infected with the AcSAS baculovirus (containing the human SAS cDNA). KDN and Neu5Ac standards are shown at 5000 fmol.
• Figure 38 (B) depicts chromatogram results of a KDN-9-phosphate assay performed using lysates from Sf-9 cells infected with the AcSAS baculovirus (containing the human SAS cDNA). KDN and Neu5Ac standards are shown at 5000 fmol.
• Figure 39 depicts a chromatogram demonstrating production of sialylated nucleotides in SF-9 insect cells following infection with CMP-SA synthetase and SA synthetase containing baculoviruses.
• Sf-9 cells were grown in six well plates and infected with baculovirus containing CMP-SA synthase and supplemented with 10 mM ManNAc ("CMP" line), with baculovirus containing CMP-SA synthase and SA synthase plus 10 mM ManNAc supplementation (“CMP+SA” line), or with no baculovirus and no ManNAc supplementation (“SF9” line).
• CMP mM ManNAc
• CMP+SA baculovirus containing CMP-SA synthase and SA synthase plus 10 mM ManNAc supplementation
• SF9 no baculovirus and no ManNAc supplementation
• compositions and methods for producing glycoproteins with sialylated oligosaccharides are provided.
• carbohydrate processing pathways of cell lines of interest are manipulated to produce complex sialylated glycoproteins.
• Such sialylated glycoproteins find use as pharmaceutical compositions, vaccines, diagnostics, therapeutics, and the like.
• Cells of interest include, but are not limited to, mammalian cells and non- mammalian cells, such as, for example, CHO, plant, yeast, bacterial, insect, and the like.
• the methods of the invention can be practiced with any cells of interest.
• methods for the manipulation of insect cells are described fully herein.
• the methods may be applied to other cells of interest to construct processing pathways in any cell of interest for generating sialylated glycoproteins.
• Oligosaccharides on proteins are commonly attached to asparagine residues found within Asn-X-Ser/Thr consensus sequences; such asparagine-linked oligosaccharides are commonly referred to as "N-linked”.
• the sialylation of N-linked glycans occurs in the Golgi apparatus by the following enzymatic mechanism: CMP- SA + GalGlcNAcMan-R sialyltransferase SAGalGlcNAcMan-R + CMP.
• the successful execution of this sialylation reaction depends on the presence of three elements: 1) the correct carbohydrate acceptor substrate (designated GalGlcNAcMan- R in the above reaction; where the acceptor substrate is a branched glycan, GalGlcNAcMan is comprised by at least one branch of the glycan, the Gal is a terminal Gal, and R is an N-linked glycan); 2) the proper donor nucleotide sugar, cytidine monophosphate-sialic acid (CMP-SA); and 3) a sialyltransferase enzyme.
• Each of these reaction components is limiting or missing in insect cells (Hooker et al.
• any oligosaccharide or monosaccharide any compound containing an oligosaccharide or monosaccharide, any compatible aglycon (for example Gal- sphingosine), any asparagine (N)-linked glycan, any serine- or threonine-linked (O- linked) glycan, and any lipid containing a monosaccharide or oligosaccharide structure can be a proper acceptor substrate and can be sialylated within the cell of interest.
• any compatible aglycon for example Gal- sphingosine
• any asparagine (N)-linked glycan any serine- or threonine-linked (O- linked) glycan
• any lipid containing a monosaccharide or oligosaccharide structure can be a proper acceptor substrate and can be sialylated within the cell of interest.
• the methods of the invention may be applied to generate sialylated glycoproteins for which the acceptor substrate is not necessarily limited to the structure GalGlcNAcMan-R, although this structure is particularly recognized as an appropriate acceptor substrate structure for production of N-linked sialylated glycoproteins.
• the acceptor substrate can be any glycan.
• the acceptor substrate according to the methods of the invention is a branched glycan.
• the acceptor substrate according to the methods of the invention is a branched glycan comprising a terminal Gal in at least one branch of the glycan.
• the acceptor substrate according to the methoids of the invention has the structure GalGlcNAcMan in at least one branch of the glycan and the Gal is a terminal Gal.
• engineering the sialylation process into cells of interest according to the methods of the present invention requires the successful manipulation and integration of multiple interacting metabolic pathways involved in carbohydrate processing. These pathways include participation of glycosyltransferases, glycosidases, the donor nucleotide sugar (CMP- SA) synthetases, and sialic acid transferases.
• Carbohydrate processing enzymes are enzymes involved in any of the glycosyltransfer, glycosidase, CMP- SA synthesis, and sialic acid transfer pathways.
• Known carbohydrate engineering efforts have generally focused on the expression of transferases (Lee et al. (1989) J. Biol Chem. 264:13848-13855, Wagner et al. (1996) J. Virology 70:4103-4109, Jarvis et al. (1996) N ⁇ twre Biotech. 14:1288-1292, Hollister et al. (1998) Glycobiology 5:473-480, Smith et al. (1990) J. Biol. Chem.
• the methods of the present invention permit manipulation of glycoprotein production in cells of interest by enhancing the production of donor nucleotide sugar substrate (CMP-SA) and optionally, by introducing and expressing sialyltransferase and/or acceptor substrates.
• CMP-SA donor nucleotide sugar substrate
• cells of interest any cells in which the endogenous CMP-SA levels are not sufficient for the production of a desired level of sialylated glycoprotein in that cell.
• the cell of interest can be any eukaryotic or prokaryotic cell.
• Cells of interest include, for example, insect cells, fungal cells, yeast cells, bacterial cells, plant cells, mammalian cells, and the like.
• Human cells and cell lines are also included in the cells of interest and may be utilized according to the methods of the present invention to, for example, manipulate sialylated glycoproteins in human cells and/or cell lines, such as, for example, kidney, liver, and the like.
• desired level is intended that the quantity of a biochemical comprised by the cell of interest is altered subsequent to subjecting the cell to the methods of the invention.
• the invention comprises manipulating levels of CMP-SA and/or sialylated glycoprotein in the cell of interest.
• manipulating levels of CMP-SA and sialylated glycoprotein comprise increasing the levels to above endogenous levels. It is recognized that the increase can be from a non-detectable level to any detectable level; or the increase can be from a detected endogenous level to a higher level.
• production of the acceptor substrate is achieved by optionally screening a variety of cell lines for desirable processing enzymes, suppressing unfavorable cleavage reactions that generate truncated carbohydrates, and/or by enhancing expression of desired glycosyltransferase enzymes such as galactose transferase.
• desired glycosyltransferase enzymes such as galactose transferase.
• SA may be achieved by adding key precursors such as N-acetylmannosamine (ManNAc), N-acetylglucosamine (GlcNAc) and glucosamine to cell growth media, by enhancing expression of limiting enzymes in CMP-SA production pathway in the cells, or any combination thereof.
• ManNAc N-acetylmannosamine
• GlcNAc N-acetylglucosamine
• glucosamine glucosamine
• enhancing expression is intended to mean that the translated product of a nucleic acid encoding a desired protein is higher than the endogenous level of that protein in the host cell in which the nucleic acid is expressed.
• the biological activity of a desired carbohydrate processing enzyme is increased by enhancing expression of the enzyme.
• the invention encompasses reducing the endogenous expression of the enzyme protein, for example, by using antisense and/or ribozyme nucleic acid sequences corresponding to the amino acid sequences of the enzyme; gene knock-out mutagenesis; and/or by inhibiting the activity of the enzyme protein, for example, by using chemical inhibitors.
• endogenous is intended to mean the type and/or quantity of a biological function or a biochemical composition that is present in a naturally occurring or recombinant cell prior to manipulation of that cell according to the methods of the invention.
• heterologous is intended to mean the type and/or quantity of a biological function or a biochemical composition that is not present in a naturally occurring or recombinant cell prior to manipulation of that cell by the methods of the invention.
• a heterologous polypeptide or protein is meant as a polypeptide or protein expressed (i.e. synthesized) in a cell species of interest that is different from the cell species in which the polypeptide or protein is normally expressed (i.e. expressed in nature).
• the cells of interest are manipulated (using techniques described herein or otherwise known in the art) to contain this substrate.
• insect cells which principally produce truncated carbohydrates terminating in Man or GlcNAc, such cells may routinely be manipulated to produce a significant fraction of complex oligosaccharides terminating in Gal.
• Three non limiting, non-exclusive approaches that may be routinely applied to produce a significant fraction of complex oligosaccharides terminating in Gal include: (1) developing screening assays to analyze a selection of insect cell lines for the presence of particular carbohydrate processing enzymes; (2) elevating production of Gal- terminated oligosaccharides by expressing specific enzymes relevant to carbohydrate processing pathways; and (3) suppressing carbohydrate processing pathways that produce truncated N-linked glycans which cannot serve as acceptors in downstream glycosyltransferase reactions.
• cell lines of interest are initially, and optionally, screened to identify cell lines with the desired endogenous carbohydrate production for subsequent metabolic manipulations. More particularly, the screening process includes characterizing cell lines for glycosyl transferase activity using techniques described herein or otherwise known in the art. Furthermore, it is recognized that any screened cell line could generate some paucimannosidic carbohydrates. Accordingly, the screening process also includes using techniques described herein or otherwise known in the art to characterize cell lines for particular glycosidase activity leading to production of paucimannosidic structures.
• the invention for the production of the acceptor substrates, encompasses utilizing methods described herein or otherwise known in the art to enhance the expression of one or more transferases.
• Such methods include, but are not limited to, methods that enhance expression of Gal T, GlcNAc -Tl and -TII or any combination thereof; for example, as described in International patent application publication number WO 98/06835 and U.S. Patent No. 5,047,335.
• concentrations of acceptor substrates are increased by using methods described herein or otherwise known in the art to suppress the activity of one or more endogenous glycosidases.
• an endogenous glycosidase the activity of which may be suppressed accoreding to the methods of the invention includes, but is not limited to, the hexosaminidase, N- acetylglucosaminidase (an enzyme that degrades the substrate required for oligosaccharide elongation).
• the invention encompasses enhancing metabolic pathways that produce the desired acceptor carbohydrates and/or suppressing those pathways that produce truncated acceptors.
• the cell lines of interest produce different N-glycan structures. Thus, such cells can routinely be screened using techniques described herein or otherwise known in the art to determine the presence of carbohydrate processing enzymes of interest.
• insect cells for example, different insect cell lines produce very different N-glycan structures (Jarvis et al. (1995) Virology 212:500-511, Hsu et al. (1997) J. Biol. Chem. 272:9062-9070, Nishimura et al. (1996) Bioorg. Med. Chem. 4:91-96).
• only a few cell lines have been characterized, in part due to the lack of efficient screening assays.
• the present invention provides methods implementing fluorescence energy transfer and Europium fluorescence assays to screen a selection of different cells of interest, such as, for example, insect cell lines for the presence of critical carbohydrate processing enzymes.
• Analytical bioassays described herein or otherwise known in the art are also provided according to the methods of the present invention to detect the presence of favorable carbohydrate processing enzymes, including, but not limited to, galactosyl transferase (Gal T), GlcNAc transferase I (GlcNAc T I), and sialyltransferase; and to detect undesirable enzymes including, but not limited to, N-acetylglucosaminidase.
• the cells of interest are insect cells
• many of these lines can routinely be infected by the baculovirus, Autographa californica nuclear polyhedrosis virus (A ⁇ NPV), and used for the production of heterologous proteins.
• a ⁇ NPV Autographa californica nuclear polyhedrosis virus
• Only a few cell lines are routinely used for recombinant protein production using techniques described herein or otherwise known in the art.
• These cell lines will be immediately apparent by one skilled in the art. It is recognized that any cell line can be screened for specific carbohydrate processing enzymes, and manipulated for the purposes of the present invention.
• Such cell lines include, but are not limited to, insect cell lines, including but not limited to, Spodoptera frugiperda (e.g. Sf-9 or Sf-21 cells), Trichoplusia ni (T. ni), and Estigmene acrea (Ea4).
• Spodoptera frugiperda lines Sf-9 or Sf-21 are the most widely used cell lines and a significant amount information is known about the oligosaccharide processing in these cells.
• Trichoplusia ni e.g.
• Drosophila Schneider S2 cell lines represent another insect cell line used for the production of heterologous proteins. Though these cells cannot be infected by the AcNPV expression vector, they are used for production of heterologous proteins via an alternative technology known in the art. These cell lines represent other insect cell line candidates whose glycosylation processing characteristics may be modified to include sialylation. In insect cells, paucimannosidic structures are produced by a membrane-bound N-acetylglucosaminidase, which removes terminal GlcNAc residues from the alpha(l,3) arm of the trimannosyl core (Altmann et al. (1995) J. Biol. Chem. 270:17344-17349).
• trimannosyl core structure lacks the proper termini required for conversion of side chains to sialylated complex structures; therefore, suppression of the N-acetylglucosaminidase activity can reduce or eliminate the formation of these undesired oligosaccharide structures, as illustrated in Figure 17.
• the invention provides vectors encoding N-acetylglucosaminidase or other glucosaminidase cDNAs in the antisense orientation and/or, vectors encoding ribozymes and/or, vectors containing sequences capable of "knocking out" the N- acetylglucosaminidase other glucosaminidase genes via homologous recombination.
• Expression plasmids described herein or otherwise known in the art are constructed using techniques known in the art to produce stably-transformed insect cells that constitutively express the antisense construct and/or ribozyme construct to suppress translation of N-acetylglucosaminidase other glucosaminidases or alternatively, to use homologous recombination techniques known in the art are to "knock-out" the N- acetylglucosaminidase other glucosaminidase genes.
• Particular sequences to be used in the antisense and/or ribozyme construction are described herein, for example, in Example 4. Techniques described herein or otherwise known in the art may be routinely applied to analyze N-linked oligosaccharide structures and to determine if N-glycan processing is altered and of the number of paucimannosidic structures in these cells is reduced.
• Antisense technology can be used to control gene expression through antisense DNA or RNA or through triple-helix formation. Antisense techniques are discussed, for example, in Okano, j. Neurochem. 56: 560 (1991); "Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Antisense technology can be used to control gene expression through antisense DNA or RNA, or through triple-helix formation. Antisense techniques are discussed for example, in Okano, J., Neurochem. 56:560 (1991);
• Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance Lee et al., Nucleic Acids Research 6: 3073 (1979); Cooney et al., Science 241 : 456 (1988); and Dervan et al., Science 251 : 1360 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
• the 5' coding portion of a polynucleotide that encodes the amino terminal portion of N- acetylglucosammidase and/or other glucosaminidases may be used to design antisense RNA oligonucleotides of from about 10 to 40 base pairs in length.
• a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of N- acetylglucosaminidase and/or other glucosaminidases.
• the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into N-acetylglucosaminidase and/or other glucosaminidase polypeptides.
• the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of N- acetylglucosaminidase and/or other glucosaminidases.
• the N-acetylglucosaminidase and/or other glucosaminidase antisense nucleic acids of the invention are produced intracellulariy by transcription from an exogenous sequence.
• a vector or a portion thereof is transcribed, producing an antisense nucleic acid (RNA) of the invention.
• RNA antisense nucleic acid
• Such a vector would contain a sequence encoding a N-acetylglucosaminidase and/or other glucosaminidase antisense nucleic acids.
• Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA.
• Such vectors can be constructed by recombinant DNA technology methods standard in the art.
• Vectors can be plasmid, viral, or others know in the art, used for replication and expression in insect, yeast, mammalian, and plant cells.
• Expression of the sequences encoding N-acetylglucosaminidase and/or other glucosaminidases, or fragments thereof, can be by any promoter known in the art to act in insect, yeast, mammalian, and plant cells. Such promoters can be inducible or constitutive. Such promoters include, but are not limited to, the baculovirus polyhedrin promoter (Luckow et al. (1993) Curr. Opin. Biotech. 4:564-572, Luckow et al.
• the SV40 early promoter region (Bernoist and Chambon, Nature 29:304-310 (1981), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., Cell 22:787-797 (1 80), the herpes thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445 (1981), the regulatory sequences of the metallothionein gene (Brinster, et al., Nature 296:39-42 (1982)), etc.
• the antisense nucleic acids of the invention comprise sequences complementary to at least a portion of an RNA transcript of N-acetylglucosaminidase and/or other glucosaminidase genes.
• absolute complementarity although preferred, is not required.
• a sequence "complementary to at least a portion of an RNA,” referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded N-acetylglucosaminidase and/or other glucosaminidase antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
• the ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid Generally, the larger the hybridizing nucleic acid, the more base mismatches with a N-acetylglucosaminidase and/or other glucosaminidase RNAs it may contain and still form a stable duplex (or triplex as the case may be).
• One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
• Oligonucleotides that are complementary to the 5' end of the message should work most efficiently at inhibiting translation.
• sequences complementary to the 3' untranslated sequences of mRNAs have been shown to be effective at inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335.
• oligonucleotides complementary to either the 5'- or 3'- non- translated, non-coding regions of N-acetylglucosaminidase and/or other glucosaminidases could be used in an antisense approach to inhibit translation of endogenous N-acetylglucosaminidase and/or other glucosaminidase mRNAs.
• Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon.
• Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention.
• antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.
• the polynucleotides of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double- stranded.
• the oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
• the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553- 6556; Lemaitre et al., Proc. Natl. Acad. Sci. 84:648-652 (1987); PCT Publication No.
• oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
• the antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including, but not limited to, 5-fluorouracil, 5- bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-man
• the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group including, but not limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
• the antisense oligonucleotide is an alpha-anomeric oligonucleotide.
• An alpha -anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual beta-units, the strands run parallel to each other (Gautier et al., Nucl. Acids Res. 15:6625-6641 (1987)).
• the oligonucleotide is a 2-0-methylribonucleotide (Inoue et al., Nucl. Acids Res. 15:6131-6148 (1987)), or a chimeric RNA-DNA analogue (Inoue et al., FEBS Lett. 215:327-330 (1997)).
• Polynucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.).
• an automated DNA synthesizer such as are commercially available from Biosearch, Applied Biosystems, etc.
• phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (Nucl. Acids Res. 16:3209 (1988))
• methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451 (1988)), etc.
• antisense nucleotides complementary to the N-acetylglucosaminidase and/or other glucosaminidase coding region sequences could be used, those complementary to the transcribed untranslated region are most preferred.
• N-acetylglucosaminidase or other glucosaminidase activity suppressors also include catalytic RNA, or a ribozyme (See, e.g., PCT International Publication WO 90/11364, published October 4, 1990; Sarver et al, Science 247:1222-1225 (1990). While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy N-acetylglucosaminidase and/or other glucosaminidase mRNAs, the use of hammerhead ribozymes is preferred.
• Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'- UG-3'.
• the construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, Nature 334:585-591 (1988).
• the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the N-acetylglucosaminidase and/or other glucosaminidase mRNAs; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.
• the ribozymes of the invention can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and should be delivered to cells which express N-acetylglucosaminidase and/or other glucosaminidases in vivo.
• DNA constructs encoding the ribozyme may be introduced into the cell in the same manner as described above for the introduction of antisense encoding DNA.
• a preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive promoter, such as, for example, pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous N-acetylglucosaminidase and/or other glucosaminidase messages and inhibit translation. Since ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
• Endogenous gene expression can also be reduced by inactivating or "knocking out" the N-acetylglucosaminidase and/or other glucosaminidase gene and/or its promoter using targeted homologous recombination.
• endogenous gene expression can also be reduced by inactivating or "knocking out" the N-acetylglucosaminidase and/or other glucosaminidase gene and/or its promoter using targeted homologous recombination.
• a mutant, non-functional polynucleotide of the invention or a completely unrelated DNA sequence (such as for example, a sialic acid synthetase) flanked by DNA homologous to the endogenous polynucleotide sequence (either the coding regions or regulatory regions of the gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express polypeptides of the invention in vivo.
• techniques known in the art are used to generate knockouts in cells that contain, but do not express the gene of interest. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the targeted gene.
• chemical inhibitors are also within the scope of the present invention, in addition to, or as an alternative to, the antisense approach, and/or the ribozyme approach, and/or the gene "knock-out” approach, as means for suppressing glucosaminidase activity in insect cell cultures.
• Chemical inhibitors that may be used to suppress glucosaminidase activity include, but are not limited to, 2-acetamido- l,2,5-trideoxy-l,5 amino-D-glucitol can limit the N-acetylglucosaminidase activity in insect cells (Legler et al. (1991) Biochim. Biophys. Acta 1080:80-95, Wagner et al. (1996) J.
• N- acetylglucosaminidase inhibitors may also be used according to the present invention, including, but not limited to, nagastatin (with a Ki value in the 10 "8 range) and GlcNAc-oxime (Ki in 0.45-22 mM) which are commercially, publicly, or otherwise available for the pu ⁇ oses of the present invention (Nishimura et al. (1996) Bioorg. Med. Chem. 4:91-96, Aoyagi et al. (1992) J. Antibiotics 45:1404-1408).
• these inhibitors may be tested and compared in in vitro and/or in vivo trials using techniques described herein or otherwise known in the art. As above, these chemical inhibitors are then used in addition to, or as an alternative to, antisense suppression, ribozyme suppression, and/or gene knock-out mutagenesis, of glucosaminidase activity in insect cells.
• Gal T activity in insect cells can be increased significantly by using techniques described described herein or otherwise known in the art to express a heterologous gene using a baculovirus construct containing nucleic acid sequences encoding Gal T or a fragment or variant thereof, or by stably transforming the cells with a gene coding for Gal T or a fragment or variant thereof.
• N-glycan analysis indicates that lower than a desired level of the acceptor substrates are present even following glucosaminidase suppression, techniques described herein or otherwise known in the art may be applied to express glycosyltransferase enzymes as needed in insect cells to produce a larger fraction of the desired acceptor structures.
• Figure 20 depicts that the overexpression of various glycosyltransferases leads to greater production of acceptor substrates.
• glycosyltransferases will serve to limit generation of paucimannosidic structures by generating unacceptable glucosaminidase substrates terminating in Gal, or by competing against the glucosaminidase reaction (Wagner et al. , Glycobiology 6: 165-175 (1996)).
• the invention comprises expression of glycosyltransferases combined with, or as an alternative to, suppression of N-acetylglucosaminidase activity in selected insect cell lines to produce desired quantities of carbohydrates containing the correct Gal (G) acceptor substrate for sialylation.
• Figure 21 illustrates, without limitation, three examples of acceptor N-glycan structures that comprise the terminal Gal acceptor residue required for subsequent sialylation. Other desired carbohydrates structures with a branch terminating Gal are also possible and are encompassed by the invention.
• Baculovirus expression vectors containing the coding sequence for GlcNAc - Tl and -Til, and Gal T or fragments or variants thereof, and stable transfectants overexpressing GlcNAc-TI and GlcNAc-TII, and Gal T, or fragments or variants thereof can be routinely generated using techniques known in the art, and are commercially, publicly, or otherwise available for the pu ⁇ oses of this invention. (See Jarvis et al. (1996) Nature Biotech. 14:1288-1292; Hollister et al. (1998) Glycobiology 8: 473-480; the contents of which are herein inco ⁇ orated by reference).
• stable transfectants expressing GlcNAc-TI and GlcNAc-TII can be routinely generated using techniques known in the art, if overexpression proves desirable.
• CMP-Sialic Acid For production of the donor substrate, CMP-SA, the invention provides methods and compositions comprising expression of limiting enzymes in the CMP- SA production pathway; in addition, or as an alternative to, the feeding of precursor substrates.
• CMP-SA CMP-sialic acid
• the structure of CMP-SA is shown in Figure 22.
• CMP-SA can be enzymatically synthesized from glucose or other simple sugars, glutamine, and nucleotides in mammalian cells and E coli using the metabolic pathways shown in Figure 5, and as described in Ferwerda et al. (1983) Biochem. J. 216:87-92; Mahmoudian et al. (1997) Enzyme and Microbial Technology 20:393-400; Schachter et al. (1973) Metabolic Conjugation and Metabolic Hydrolysis (New York Academic Press) 2-135.
• CMP-SA In some mammalian tissues and cell lines, the production and delivery of CMP-SA limits the sialylation capacity of these cells (Gu et al. (1997) Improvement of the inter feron-gamma sialylation in Chinese hamster ovary cell culture by feeding N-acetylmannosamine). This problem is likely to be amplified in insect cells since negligible sialic acid levels are detected in Trichoplusia ni insect cells as compared to levels in Chinese Hamster Ovary (CHO) mammalian cells ( Figure 16). Furthermore, negligible CMP-SA was observed in Sf-9 and ⁇ a-4 insect cells when compared to CHO cells (Hooker et al.
• NeAc from the precursor substrate ManNAc can proceed through three alternative pathways shown in Figure 5.
• the principal pathway for the production of SA in E coli and other bacteria utilizes the phosphoenylpyruvate (PEP) and ManNAc to produce sialic acids in the presence of sialic acid synthetase (Vann et al. (1997) Glycobiology 7:697-701).
• a second pathway, observed in bacteria and mammals, involves the reversible conversion by aldolase (also named N-acetylneuraminate lyase) of ManNAc and pyruvate to sialic acid (Schachter et al.
• the third pathway begins with the ATP driven phosphorylation of ManNAc, and is followed by the enzymatic conversion of phosphorylated ManNAc to a phosphorylated form of sialic acid, from which the phosphate is removed in a subsequent step (van Rinsum et al. (1983) Biochem. J. 210:21-28, Schachter et al. (1973) Metabolic Conjugation and metabolic Hydrolysis (New York Academic Press) 2-135).
• feeding of alternative precursor substrates may be applied to eliminate or reduce the need to produce CMP-SA from simple sugars (see Example 6).
• CMP-SA and its direct precursor, SA are not permeable to cell membranes (Bennetts et al. (1981) J Cell. Biol. 88:1-15), these substrates cannot be added to the culture medium for uptake by the cell.
• other precursors including N-acetylmannosamine (ManNAc), glucosamine, and N- acetylglucosamine (GlcNAc) when added to the culture medium are absorbed into mammalian cells (see Example 6).
• the substrates are then enzymatically converted to CMP-SA and inco ⁇ orated into homologous and heterologous glycoproteins (Gu et al. (1997) Improvement of the interferon-gamma sialylation in Chinese hamster ovary cell culture by feeding N-acetylmannosamine, Ferwerda et al. (1983) Biochem. J. 216:87-92, Kohn et al. (1962) J. Biol. Chem. 237:304-308, Bennetts et al. (1981) J. Cell Biol. 88:1-15).
• CMP-SA CMP-sialic acid synthetase
• This enzyme has been cloned and sequenced from E. coli and used for the in vitro production of CMP-SA, as described in Zapata et al. (1989) J. Biol. Chem. 264:14769-14774, Kittleman et al. (1995) Appl. Microbiol. Biotechnol. 44:59-67, Ichikawa et al. (1992) Anal. Biochem. 202:215-238, Shames et al. (1991) Glycobiology 1:187-191; the contents of which are herein inco ⁇ orated by reference).
• CMP-SA the activated sugar nucleotide
• the Golgi lumen for sialylation to proceed
• Transport through the trans-Golgi membrane is facilitated by the CMP-SA transporter protein, which was identified by complementation cloning into sialylation deficient CHO cells ( ⁇ ckhardt et al. (1996) Proc. Natl. Acad. Sci. USA 93:7572- 7576).
• This mammalian gene has also been cloned and expressed in a functional form in the heterologous host, S. cerevisiae (Bernisone et al. (1997) J Biol. Chem. 272:12616-12619).
• CMP-SA transporter genes are introduced and expressed using routine recombinant DNA techniques may also be employed according to the methods of the present invention. These techniques are optionally combined with ManNAc, GlcNAc, or glucosamine feeding strategies described above, to maximize CMP-SA production.
• ManNAc can be produced chemically using sodium hydroxide (Mahmoudian et al. (1997) Enzyme and Microbial Technology 20:393-400).
• the enzymes that convert these substrates to ManNAc or fragments or variants of these enzymes can be expressed in insect cells using techniques described herein or otherwise known in the art.
• the production of ManNAc from GlcNAc and glucosamine proceeds through the metabolic pathway shown in Figure 23.
• approach (a) is achieved using the gene encoding a GlcNAc-2- epimerase isolated from pig kidney, or fragments or variants thereof, to directly convert GlcNAc to ManNAc (See Maru et al. (1996) J Biol. Chem. 271 :16294- 16299; the contents of which are herein inco ⁇ orated by reference).
• sequence for a homologue of this enzyme can be routinely obtained from bioinformatics databases, and cloned into baculovirus vectors, or stably integrated into insect cells using techniques described herein or otherwise known in the art.
• approach (b) requires insertion of the gene to convert UDP- GlcNAc to ManNAc.
• Engineering the production of UDP-GlcNAc from glucosamine or GlcNAc is likely not required since most insect cells comprise metabolic pathways to synthesize UDP-GlcNAc; as indicated by the presence of GlcNAc-containing oligosaccharides.
• the gene encoding a rat bifunctional enzyme coding for conversion of UDP-GlcNAc to ManNAc and ManNAc to ManNAc-6-P, or fragments or variants thereof is used to engineer the production of UDP-GlcNAc using techniques described herein or otherwise known in the art (Stasche et al. (1997) J. Biol. Chem. 272:24319-24324, the contents which are herein inco ⁇ orated by reference).
• the segment of this enzyme responsible for conversion of UDP-GlNAc to ManNAc may be expressed independently in insect cells using techniques known in the art to produce ManNAc rather than ManNAc-6-P.
• ManNAc Once ManNAc is generated, it is converted to SA according to the methods of the invention. There are three possible metabolic pathways for the conversion of ManNAc to SA in bacteria and mammals, as shown in Figure 24. Negligible SA levels have previously been observed in insect cells (in the absence of exogenous supplementation of ManNAc to the culture media).
• the conversion of ManNAc and PEP to S A using sialic acid synthetase is the predominant pathway for SA production in E. coli (Vann et al. (1997) Glycobiology 7:697-701).
• the E. coli sialic acid (SA) synthetase gene NeuB (SEQ ID NO:7 and 8) has been cloned and sequenced and is commercially, publicly, and/or otherwise available for the pu ⁇ oses of the present invention.
• the human sialic acid synthetase gene has also been cloned (cDNA clone HA5AA37), sequenced, and deposited with the American Type Culture Collection ("ATCC”) on
• the nucleic acid compositions encoding a SA synthetase such as, for example, an E.coli and/or human sialic acid synthetase and/or a fragment or variant thereof, may be inserted into a host expression vector or into the host genome using techniques described herein or otherwise known in the art.
• the production of SA can also be achieved from ManNAc and pyruvate using an aldolase, such as, for example, bacterial aldolase (Mahmoudian et al. (1997) Enzyme and Microbial Technology 20:393-400), or a human aldolase (as described herein) or fragment or variant thereof.
• an aldolase such as, for example, bacterial aldolase (Mahmoudian et al. (1997) Enzyme and Microbial Technology 20:393-400), or a human aldolase (as described herein) or fragment or variant thereof.
• the human aldolase gene has been cloned (cDNA clone HDPAK85), sequenced, and deposited with the American Type Culture Collection ("ATCC”) on February 24, 2000 and was given the ATCC Deposit Number .
• ATCC American Type Culture Collection
• the aldolase enzyme is considered as an alternative for converting ManNAc to SA.
• the aldolase sequences can be amplified directly from E coli and human DNA using primers and PCR amplification as described in Mahmoudian et al. (Mahmoudian et al. (1997) Enzyme and Microbial Technology 20:393-400); the contents of which are herein inco ⁇ orated by reference) and herein, and using techniques described herein or otherwise known in the art to enhance expression of aldolase, or a fragment or variant thereof. Since the aldolase reaction is reversible, high levels of added ManNAc and pyruvate, may be used according to the methods of the invention to drive this reversible reaction in the direction of the product SA (Mahmoudian et al.
• an exclusively eukaryotic pathway may also employed according to the methods of the invention to convert ManNAc to SA through the phosphate intermediates ManNAc-6-phosphate and SA-9-phosphate. It is recognized that the mammalian enzymes (synthetase and phosphatase) responsible for converting ManNAc to SA through phosphate intermediates can be utilized for engineering this eukaryotic pathway into insect cells.
• the methods of the invention also encompass the use of CMP-SA synthetase to enzymatically converts SA to CMP-SA (see, e.g., the reaction shown in Figure 25).
• insect cells such as, for example, Sf9 insect cells, have negligible endogenous CMP-SA synthetase activity.
• Evidence of limited CMP-SA synthetase in insect cells is also demonstrated by increased SA levels found following substrate feeding and genetic manipulation without a concomitant increase in CMP-SA.
• specific embodiments of the invention provide methods for enhancing the expression of CMP-SA synthetase, and/or fragments or variants thereof.
• the methods of the present invention provide for enhancing expression of bacterial or human CMP-SA synthetase or fragments, or variants thereof, in cells of interest, such as, for example, in insect cells, using techniques described herein, or otherwise known in the art.
• CMP-SA must be delivered into the Golgi apparatus in order for sialylation to occur, and this transport process depends on the presence of the CMP-SA transporter protein (Deutscher et al. (1984) Cell 39:295-299).
• CMP-SA transporter protein Deutscher et al. (1984) Cell 39:295-299.
• insect cell vesicles are prepared and transport of CMP-SA is measured as described in (Bernisone et al. (1997) J Biol. Chem. 272:12616-12619) and/or using techniques otherwise known in the art.
• a transporter enzyme is cloned and expressed in insect cells using the known mammalian gene sequence (as described in Bernisone et al. (1997) J. Biol. Chem. 272:12616-12619, Eckhardt et al. (1996) Proc. Natl. Acad. Sci. USA 93:7572- 7576; the contents of which are herein inco ⁇ orated by reference) and/or sequences otherwise known in the art. Corresponding sequences are available from bioinformatics databases for the pu ⁇ oses of this invention. Localization of the protein to the Golgi is evaluated using an antibody generated against the heterologous protein using techniques known in the art in concert with commercially available fluorescent probes that identify the Golgi apparatus.
• transcripts for example, transcripts encoding CMP-SA pathway enzymes, glycosyl transferases, and ribozymes or anti-sense RNAs to suppress hexosaminidases
• co-infection of cells with multiple viruses using techniques known in the art can also be used to simultaneously produce multiple recombinant transcripts.
• plasmids that inco ⁇ orate multiple foreign genes including some under the control of the early promoter IE1 are commercially, publicly, or otherwise available for the pu ⁇ oses of the invention, and can be used to create baculovirus constructs.
• the present invention encompasses using any of these techniques.
• the invention also encompasses using the above mentioned types of vectors to enable expression of desired carbohydrate processing enzymes in baculovirus infected insect cells prior to production of a heterologous glycoprotein of interest under control of the very late polyhedrin promoter. In this manner, once the desired polypeptide is synthesized essential N-glycan processing enzymes can facilitate N-glycan processing once the glycoprotein of interest.
• genes for some of the enzymes may be inco ⁇ orated directly into the insect cell genome using vectors known in the art, such as, for example, vectors similar to those described in (Jarvis et al. (1990) Bio/Technology 8:950-955, Jarvis et al. (1995) Baculovirus Expr. Protocols ed. 39:187-202).
• Genomic integration eliminates the need to infect the cells with a large number of viral constructs.
• constructs for genomic integration contain one or more early viral promoters, including Ac NPV IE1 and 39K, which provide constitutive expression in transfected insect cells (Jarvis et al. (1990) Bio/Technology 8:950-955).
• a sequential transformation strategy may routinely be developed for producing stable transformants that constitutively express up to four different heterologous genes simultaneously.
• These vectors and transformation techniques are provided for the pu ⁇ oses of this invention. In this manner, inco ⁇ oration of plasmids containing heterologous genes into the insect cell genome combined with baculovirus infection integrates the metabolic pathways leading to efficient acceptor and donor substrate production in insect cells.
• the final step in the generation of sialylated glycoproteins or glycolipids in mammalian cells is the enzymatic transfer of sialic acid from the donor substrate, CMP-SA, onto an acceptor substrate in the Golgi apparatus; a reaction which is catalyzed by sialyltransferase.
• the sialic acid (SA) residues occurring in N-linked glycoproteins are alpha-linked to the 3 or 6 position of the Gal GlcNAc sugars (Tsuji, S. (1996) J. Biochem. 120:1-13).
• the SA ⁇ b ⁇ 2-3GalGlcNAc linkage is found in heterologous glycoproteins expressed by CHO and human cells and the SA alpha2- 6GalGlcNAc linkage is found in many human glycoproteins (Goochee et al. (1991) Bio/technology 9: 1347-1355).
• the alpha2-3- and/or ⁇ /pb ⁇ 2-6-sialyltransferase genes along with a number of other sialyltransferase genes have been cloned, sequenced and expressed as active heterologous proteins as described in Lee et al. (1989) J Biol. Chem. 264:13848-13855, Ichikawa et ⁇ /. (1992) Anal.
• the methods of the invention further comprise expression of a sialyltransferase or fragment or variant thereof, in the cells.
• the completion of the sialylation reaction can be verified by elucidating the N-glycan structures attached to a desired glycoprotein using techniques described herein or otherwise known in the art. It is recognized that evaluation of N-glycans attachments may also suggest additional metabolic engineering strategies that can further enhance the level of sialylation in insect cells.
• T. ni insect cell lysates failed to generate any sialylated compounds when incubated with the substrate, LacMU, and the nucleotide sugar, CMP-SA. Thus, it is concluded that these cells comprise negligible native sialyltransferase activity.
• infection of insect cells with a baculovirus containing alpha2,3 sialyltransferase provided significant enzymatic conversion of LacMU and CMP-SA to sialylLacMU.
• heterologous sialyltransferase can be expressed using techniques described herein or otherwise known in the art either by co-infection with a virus coding for sialyltransferase, or fragment, or variant thereof, or by using stable transfectants expressing the enzyme.
• baculovirus vectors comprising sequences coding for alpha2,6 sialyltransferase and/or fragments or variants thereof as well as stably transformed insect cells stably expressing both gal T and sialyltransferase are commercially, or publicly available, and/or may routinely be generated using techniques described herein or otherwise known in the art.
• sialyltransferase activity is determined using the FRET or HPLC assays described herein and/or using other assays known in the art. Localization of the sialyltransferase to the Golgi is accomplished using anti- sialyltransferase antibodies commercially, publicly, or otherwise available for the pu ⁇ ose of this invention in concert with Golgi specific marker proteins.
• pu ⁇ oses of enhancing carbohydrate processing enzymes of the invention suppressing activity of endogenous N-acetylglucosaminidase, expressing heterologous proteins in the cells of the invention, and constructing vectors for the pu ⁇ oses of the invention; genetic engineering methods are known to those of ordinary skill in the art. For example, see Schneider, A. et al, (1998) Mol. Gen.
• Zl 1234 and Zl 1235 for two human galactosyltransferases see also United States Patent Number 5,955,282; the contents of which are herein inco ⁇ orated by reference); and/or in Genbank accession No. D83766 for GlcNAc-2-epimerase, Y07744 for the bifunctional rate liver enzyme capable of catalyzing conversion of UDP-GlcNAc to ManNAc, J05023 for E. coli CMP-SA synthetase, AJ006215 for murine CMP-SA synthetase, Z71268 for murine CMP-SA transporter, X03345 for E. coli aldolase, U05248 for E.
• coli SA synthetase X17247 for human 2,6 sialyltransferase, L29553 for human 2,3 sialyltransferase, M13214 for bovine galactosyltransferase, L77081 for human GlcNAc T-I, U15128 or L36537 for human GlcNAc T-II, D87969 for human CMP-SA transporter, and S95936 for human transferrin; and fragments or variants of the enzymes that display one or more of the biological activities of the enzymes (such biological activities may routinely be assayed using techniques described herein or otherwise known in the art).
• the sequences described above are readily accessible using the provided accession number in the NCBI Entrez database, known to the person of ordinary skill in the art.
• one aspect of the invention provides for use of isolated nucleic acid molecules comprising polynucleotides having nucleotide sequences selected from the group consisting of : (a) nucleotide sequences encoding a biologically active fragment or variant of the polypeptide having the amino acid sequence described in GenSeq accession No. Zl 1234 and Zl 1235 for two human galactosyltransferases; and/or in Genbank accession No. D83766 for GlcNAc-2-epimerase, Y07744 for the bifunctional rate liver enzyme capable of catalyzing conversion of UDP-GlcNAc to ManNAc, J05023 for E.
• coli SA synthetase XI 7247 for human 2,6 sialyltransferase, L29553 for human 2,3 sialyltransferase, Ml 3214 for bovine galactosyltransferase, L77081 for human GlcNAc T-I, U15128 or L36537 for human GlcNAc T-II, D87969 for human CMP-SA transporter, and/or S95936 for human transferrin; (b) nucleotide sequences encoding an antigenic fragment of the polypeptide having the amino acid sequence described in GenSeq accession No.
• Zl 1234 and Zl 1235 for two human galactosyltransferases see also United States Patent Number 5,955,282; the contents of which are herein inco ⁇ orated by reference); and/or in Genbank accession No. D83766 for GlcNAc -2-epimerase, Y07744 for the bifunctional rate liver enzyme capable of catalyzing conversion of UDP-GlcNAc to ManNAc, J05023 for E coli CMP-SA synthetase, AJ006215 for murine CMP-SA synthetase, Z71268 for murine CMP-SA transporter, X03345 for E.
• Polypeptides encoded by such nucleic acids may also be used according to the methods of the present invention.
• Further embodiments of the invention include use of isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 80%, 85%, or 90% identical, and more preferably at least 95%, 97%, 98% or 99% identical, to any of the above nucleotide sequences, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide that is complementary to any of the above nucleotide sequences.
• This polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
• Polypeptides encoded by such nucleic acids may also be used according to the methods of the present invention.
• the nucleic acid sequences (including fragments or variants) that may be used according to the methods of the present invention encode a polypeptide having a biological activity. Such biological activity may routinely be assayed using techniques described herein or otherwise known in the art.
• nucleotide sequences and amino acid sequences disclosed in Figures 27-32, and fragments and variants of these sequences may also be used according to the methods of the invention.
• specific enzyme polypeptides comprise the amino acid sequences shown in Figures 28, 30 and 32; or otherwise described herein.
• the invention also encompasses sequence variants of the polypeptide sequences shown in Figures 28, 30 and 32.
• one, two, three, four, five or more human polynucleotide sequences, or fragments, or variants thereof, and/or the polypeptides encoded thereby, are used according to the methods of the present invention to convert ManNAc to SA (see Example 6).
• Such polynucleotide and polypeptide sequences include, but are not limited to, sequences corresponding to human aldolase (SEQ ID NO:l and SEQ ID NO:2), human CMP-SA synthetase (SEQ ID NO:3 and SEQ ID NO:4), and human SA synthetase (SEQ ID NO:5 and SEQ ID NO:6); see also Figures 27 - 32.
• the methods of present invention include the use of one or more novel isolated nucleic acid molecules comprising polynucleotides encoding polypeptides important to intracellular carbohydrate processing in humans.
• Such polynucleotide sequences include those disclosed in the figures and/or Sequence Listing and/or encoded by the human cDNA plasmids (Human CMP-Sialic Acid Synthetase, cDNA clone HWLLM34; Human Sialic Acid Synthetase, cDNA clone HA5AA37; and Human Aldolase cDNA clone HDPAK85) deposited with the American Type Culture Collection (ATCC) on February 24, 2000 and receiving accession numbers .
• ATCC American Type Culture Collection
• the present invention further includes the use of polypeptides encoded by these polynucleotides.
• the present invention also provides for use of isolated nucleic acid molecules encoding fragments and variants of these polypeptides, and for the polypeptides encoded by these nucleic acids.
• one aspect of the invention provides for use of isolated nucleic acid molecules comprising polynucleotides having nucleotide sequences selected from the group consisting of : (a) nucleotide sequences encoding human aldolase having the amino acid sequences as shown in SEQ ID NO:2; (b) nucleotide sequences encoding a biologically active fragment of the human aldolase polypeptide having the amino acid sequence shown in SEQ ID NO:2; (c) nucleotide sequences encoding an antigenic fragment of the human aldolase polypeptide having the amino acid sequence shown in SEQ ID NO:2; (d) nucleotide sequences encoding the human aldolase polypeptide comprising the complete amino acid sequence encoded by the plasmid contained in the ATCC Deposit; (e) nucleotide sequences encoding a biologically active fragment of the human aldolase polypeptide having the amino acid sequence encoded by the plasmid contained in the ATCC Deposit; (
• nucleic acids may also be used according to the methods of the present invention.
• Further embodiments of the invention include use of isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 80%, 85%, or 90% identical, and more preferably at least 95%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), or (g), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b), (c), (d), (e), (f), or (g), above.
• This polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
• Polypeptides encoded by such nucleic acids may also be used according to the methods of the present invention.
• nucleic acid molecules comprising polynucleotides having nucleotide sequences selected from the group consisting of : (a) nucleotide sequences encoding human CMP-SA synthetase having the amino acid sequences as shown in SEQ ID NO:4; (b) nucleotide sequences encoding a biologically active fragment of human CMP-SA synthetase polypeptide having the amino acid sequence shown in SEQ ID NO:4; (c) nucleotide sequences encoding an antigenic fragment of the human CMP-SA synthetase polypeptide having the amino acid sequence shown in SEQ ID NO:4; (d) nucleotide sequences encoding the human CMP-SA synthetase polypeptide comprising the complete amino acid sequence encoded by the plasmid contained in the ATCC Deposit; (e) nucleotide sequences encoding a biologically active fragment of the human CMP-SA synthet
• nucleic acids may also be used according to the methods of the present invention.
• Further embodiments of the invention include use of isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 80%, 85%, or 90% identical, and more preferably at least 95%, 97%, 98% or 99%) identical, to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), or (g) above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b), (c), (d), (e), (f), or (g), above.
• This polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
• Polypeptides encoded by such nucleic acids may also be used according to the methods of the present invention.
• nucleic acid molecules comprising polynucleotides having nucleotide sequences selected from the group consisting of: (a) nucleotide sequences encoding human SA synthetase having the amino acid sequences as shown in SEQ ID NO:6; (b) nucleotide sequences encoding a biologically active fragment of the human SA synthetase polypeptide having the amino acid sequence shown in SEQ ID NO:6; (c) nucleotide sequences encoding an antigenic fragment of the human SA synthetase polypeptide having the amino acid sequence shown in SEQ ID NO:6; (d) nucleotide sequences encoding the human SA synthetase polypeptide comprising the complete amino acid sequence encoded by the plasmid contained in the ATCC Deposit; (e) nucleotide sequences encoding a biologically active fragment of the human SA synthetase polypeptide having the amino acid sequence encoded by the group consisting of: (a) nu
• nucleic acids may also be used according to the methods of the present invention.
• Further embodiments of the invention include use of isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 80%), 85%, or 90% identical, and more preferably at least 95%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), or (g) above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b), (c), (d), (e), (f), or (g), above.
• This polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
• Polypeptides encoded by such nucleic acids may also be used according to the methods of the present invention.
• nucleic acid having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence of the present invention it is intended that the nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the described polypeptide.
• nucleic acid having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
• the query sequence may be an entire sequence, such as, for example, that shown of SEQ ID NO:l, the ORF (open reading frame), or any fragment as described herein.
• nucleic acid molecule or polypeptide is at least, for example, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence of the presence invention can be determined conventionally using known computer programs.
• a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245.) In a sequence alignment the query and subject sequences are both DNA sequences.
• RNA sequence can be compared by converting U's to T's.
• the result of said global sequence alignment is in percent identity.
• the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment.
• This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
• This corrected score is what is used for the pu ⁇ oses of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the pu ⁇ oses of manually adjusting the percent identity score.
• a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity.
• the deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5' end.
• the 10 unpaired bases represent 10% of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%.
• a 90 base subject sequence is compared with a 100 base query sequence.
• deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matched/aligned with the query.
• percent identity calculated by FASTDB is not manually corrected.
• bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to made for the pu ⁇ oses of the present invention.
• polypeptide having an amino acid sequence at least, for example, 95% "identical" to a query amino acid sequence of the present invention it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
• up to 5% of the amino acid residues in the subject sequence may be inserted, deleted (indels) or substituted with another amino acid.
• alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
• whether any particular polypeptide is at least, for example, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for example, the amino acid sequences of SEQ ID NO:2 or to the amino acid sequence encoded by the cDNA contained in a deposited clone can be determined conventionally using known computer programs.
• a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245(1990)).
• the query and subject sequences are either both nucleotide sequences or both amino acid sequences.
• the result of said global sequence alignment is in percent identity.
• the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment.
• This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
• This final percent identity score is what is used for the pu ⁇ oses of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the pu ⁇ oses of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence. For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity.
• the deletion occurs at the N- terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus.
• the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C- termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%).
• a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query.
• the sequences are aligned for optimal comparison pu ⁇ oses (e.g., gaps can be introduced in the sequence of one protein or nucleic acid for optimal alignment with the other protein or nucleic acid).
• the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in one sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the other sequence, then the molecules are homologous at that position.
• amino acid or nucleic acid "homology” is equivalent to amino acid or nucleic acid "identity”.
• the percent homology between the two sequences is a function of the number of identical positions shared by the sequences (i.e., per cent homology equals the number of identical positions/total number of positions times 100).
• Variants of above described sequences include a substantially homologous protein encoded by the same genetic locus in an organism, i.e., an allelic variant.
• Variants also encompass proteins derived from other genetic loci in an organism, but having substantial homology to the proteins of Figures 27-32, or otherwise described WO 00/52135 g PCT/USOO/05313
• Variants also include proteins substantially homologous to the protein but derived from another organism, i.e., an ortholog. Variants also include proteins that are substantially homologous to the proteins that are produced by chemical synthesis. Variants also include proteins that are substantially homologous to the proteins that are produced by recombinant methods. As used herein, two proteins (or a region of the proteins) are substantially homologous when the amino acid sequences are at least about 55-60%), typically at least about 70-75%), more typically at least about 80-85%), and most typically at least about 90-95% or more homologous.
• a substantially homologous amino acid sequence will be encoded by a nucleic acid sequence hybridizing to the nucleic acid sequence, or portion thereof, of the sequence shown in Figures 27, 28, 31 or otherwise described herein under stringent conditions as more fully described below.
• Orthologs, homologs, and allelic variants that are encompassed by the invention and that may be used according to the methods of the invention can be identified using methods well known in the art. These variants comprise a nucleotide sequence encoding a protein that is at least about 55%, typically at least about 70- 75%, more typically at least about 80-85%), and most typically at least about 90-95% or more homologous to the nucleotide sequence shown in Figures 27, 29, 31, or otherwise described herein, or a fragment of this sequence.
• nucleic acid molecules can readily be identified as being able to hybridize under stringent conditions, to the nucleotide sequence shown in Figures 27, 29, 31, or complementary sequence thereto, or otherwise described herein, or a fragment of the sequence. It is understood that stringent hybridization does not indicate substantial homology where it is due to general homology, such as poly A sequences, or sequences common to all or most proteins in an organism or class of proteins.
• the invention also encompasses polypeptides having a lower degree of identity but having sufficient similarity so as to perform one or more of the same functions performed by the enzyme polypeptides described herein. Similarity is determined by conserved amino acid substitution. Such substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics (see Table 1). Conservative substitutions are likely to be phenotypically silent.
• conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu, and He; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe, Tyr.
• Guidance concerning which amino acid changes are likely to be phenotypically silent are found in Bowie et al, Science 247:1306-1310 (1990). TABLE 1. Conservative Amino Acid Substitutions.
• a variant polypeptide can differ in amino acid sequence by one or more substitutions, deletions, insertions, inversions, fusions, and truncations or a combination of any of these.
• Variant polypeptides can be fully functional or can lack function in one or more activities.
• variations can affect the function, for example, of one or more of the modules, domains, or functional subregions of the enzyme polypeptides of the invention.
• polypeptide variants and fragments have the described activities routinely assayed via bioassays described herein or otherwise known in the art.
• Fully functional variants typically contain only conservative variation or variation in non-critical residues or in non-critical regions. Functional variants can also contain substitution of similar amino acids, which result in no change or an insignificant change in function. Alternatively, such substitutions may positively or negatively affect function to some degree.
• Non- functional variants typically contain one or more non-conservative amino acid substitutions, deletions, insertions, inversions, or truncation or a substitution, insertion, inversion, or deletion in a critical residue or critical region.
• variants can be naturally-occurring or can be made by recombinant means or chemical synthesis to provide useful and novel characteristics for the polypeptide.
• Amino acids that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham et al, Science 244:1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity. Sites that are critical can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffmity labeling (Smith et al, J. Mol. Biol. 224:899-904 (1992); de Vos et al. Science 255:306-312 (1992)).
• the invention further encompasses variant polynucleotides, and fragments thereof, that differ from the nucleotide sequence, such as, for example, those shown in Figures 27, 29, 31 or otherwise described herein, due to degeneracy of the genetic code and thus encode the same protein as that encoded by the nucleotide sequence shown in Figures 27, 29, 31 or otherwise described herein.
• the invention also provides nucleic acid molecules encoding the variant polypeptides described herein.
• polynucleotides may be naturally occurring, such as allelic variants (same locus), homologs (different locus), and orthologs (different organism), or may be constructed by recombinant DNA methods or by chemical synthesis.
• non-naturally occurring variants may be made by mutagenesis techniques, including those applied to polynucleotides, cells, or organisms. Accordingly, as discussed above, the variants can contain nucleotide substitutions, deletions, inversions and insertions.
• Variation can occur in either or both the coding and non-coding regions.
• the variations can produce both conservative and non-conservative amino acid substitutions.
• Polynucleotides” or “nucleic acids” that may be used according to the methods of the invention also include those polynucleotides capable of hybridizing, under stringent hybridization conditions, to sequences contained in SEQ ID NO:l, the complement thereof, or a cDNA within the deposited plasmids.
• hybridizes under stringent conditions is intended to describe conditions for hybridization and washing under which nucleotide sequences encoding a receptor at least 55% homologous to each other typically remain hybridized to each other. The conditions can be such that sequences at least about 65%, at least about 70%, or at least about 75% or more homologous to each other typically remain hybridized to each other.
• stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6.
• One example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45degrees C, followed by one or more washes in 0.2 X SSC, 0.1% SDS at 50-65 degrees C.
• SSC sodium chloride/sodium citrate
• SDS sodium chloride/sodium citrate
• nucleic acid molecules that hybridize to a polynucleotide disclosed herein under lower stringency hybridization conditions.
• Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature.
• washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC).
• blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations.
• the inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
• polynucleotide which hybridizes only to polyA+ sequences (such as any 3' terminal polyA+ tract of a cDNA shown in the sequence listing), or to a complementary stretch of T (or U) residues, would not be included in the definition of "polynucleotide,” since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone generated using oligo-dT as a primer).
• an isolated nucleic acid molecule that hybridizes under stringent conditions to a sequence disclosed herein, or the complement thereof, such as, for example, the sequence of Figures 27, 29, 31, corresponds to a naturally- occurring nucleic acid molecule.
• a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein).
• the present invention also encompasses recombinant vectors, which include the isolated nucleic acid molecules and polynucleotides that may be used according to the methods of the present invention, and to host cells containing the recombinant vectors and/or nucleic acid molecules, as well as to methods of making such vectors and host cells and for using them for production of glycosylation enzyme by recombinant techniques. Polypeptides produced by such methods are also provided.
• the invention encompasses utilizing vectors for the maintenance (cloning vectors) or vectors for expression (expression vectors) of the desired polynucleotides encoding the carbohydrate processing of the invention, or those encoding proteins to be sialylated by the methods of the invention and/or by expression of the proteins the cells of the invention.
• the vectors can function in prokaryotic or eukaryotic cells or in both (shuttle vectors).
• one or more of the polynucleotide sequences used according to the methods of the invention are inserted into commercially, publicly, or otherwise available baculovirus expression vectors for enhanced expression of the corresponding enzyme.
• one ore more of the polynucleotides used according to the methods of the invention are inserted into other viral vectors or for generation of stable insect cell lines. Techniques known in the art, such as, for example, HP AEC and HPLC techniques, may be routinely used to evaluate the enzymatic activity of these enzymes from both eukaryotic and bacterial sources to determine which source is best for generating SA in insect cells.
• expression vectors contain cis-acting regulatory regions that are operably linked in the vector to the polynucleotide to be expressed, or other relevant polynucleotides such that transcription of the polynucleotides is allowed in a host cell.
• the polynucleotides can be introduced into the host cell with a separate polynucleotide capable of affecting transcription.
• the second polynucleotide may provide a trans-acting factor interacting with the cis-regulatory control region to allow transcription of the polynucleotides from the vector.
• a transacting factor may be supplied by the host cell.
• a trans-acting factor can be produced from the vector itself.
• transcription of the polynucleotides can occur in a cell-free system.
• the regulatory sequence to which the polynucleotides described herein can be operably linked include, for example, promoters for directing mRNA transcription. These promoters include, but are not limited to, baculovirus promoters including, but not limited to, 1E0, 1E1, 1E2, 39k, 35k, egt, ME53, ORF 142, PE38, p6.9, capsid, gp64 polyhedrin, plO, basic and core; and insect cell promoters including, but not limited to, Drosophila actin, metallothionine, and the like.
• promoters include, but are not limited to, the left promoter from bacteriophage lambda, the lac, TRP, and TAC promoters from E. coli, promoters from Actinomycetes, including Nocardia, and Streptomyces. Promoters may be isolated, if they have not already been isolated, by standard promoter identification and trapping methods known in the art, see, for example, in Sambrook et al. , Molecular Cloning: A Laboratory Manual. 2nd. ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (1989).
• host cells can be used for simply amplifying, but not expressing, the nucleic acid.
• host cells can also be used to produce desirable amounts of the desired polypeptide.
• the host cell is simply used to express the protein , er se.
• amounts of the protein could be produced that enable its purification and subsequent use, for example, in a cell free system.
• the promoter is compatible with the host cell.
• Host cells can be chosen from virtually any of the known host cells that are manipulated by the methods of the invention to produce the desired glycosylation patterns. These could include mammalian, bacterial, yeast, filamentous fungi, or plant cells.
• expression vectors may also include regions that modulate transcription, such as repressor binding sites and enhancers.
• expression vectors can also contain sequences necessary for transcription termination and, in the transcribed region a ribosome binding site for translation.
• Other regulatory control elements for expression include initiation and termination codons as well as polyadenylation signals. The person of ordinary skill in the art would be aware of the numerous regulatory sequences that are useful in expression vectors. Such regulatory sequences are described, for example, in Sambrook et al, cited above.
• vectors can be used to express the polynucleotide.
• Such vectors include chromosomal, episomal, and particularly virus-derived vectors, for example, A ⁇ MNPV, OpMNPV, BmNPV, HzMNPV, and RoMNPV.
• Vectors may also be derived from combinations of these sources such as those derived from plasmid and bacteriophage genetic elements, e.g. cosmids and phagemids. Appropriate cloning and expression vectors for prokaryotic and eukaryotic hosts are described in Sambrook et al. , Molecular Cloning: A
• the regulatory sequence may provide constitutive expression in one or more host cells or may provide for inducible expression in one or more cell types such as by temperature, nutrient additive, or exogenous factor such as a hormone or other ligand.
• a variety of vectors providing for constitutive and inducible expression in prokaryotic and eukaryotic hosts are well known to those of ordinary skill in the art.
• the polynucleotides can be inserted into the vector nucleic acid using techniques known in the art. Generally, the DNA sequence that will ultimately be expressed is joined to an expression vector by cleaving the DNA sequence and the expression vector with one or more restriction enzymes and then ligating the fragments together. Procedures for restriction enzyme digestion and ligation are well known to those of ordinary skill in the art.
• Any cell type or expression system can be used for the pu ⁇ oses of the invention including but not limited to, for example, baculovirus systems (O'Riley et al. (1992) Baculovirus Expression Vectors, W.H. Freeman and Company, New York 1992) and Drosophila-derived systems (Johansen et al. (1989) Genes Dev 3(6):882-889).
• the invention also encompasses vectors in which the nucleic acid sequences described herein are cloned into the vector in reverse orientation, but operably linked to a regulatory sequence that permits transcription of antisense RNA.
• an antisense transcript can be produced to all, or to a portion, of the polynucleotide sequences described herein, including both coding and non-coding regions. Expression of this antisense RNA is subject to each of the parameters described above in relation to expression of the sense RNA (regulatory sequences, constitutive or inducible expression, tissue-specific expression).
• the recombinant host cells are prepared by introducing the vector constructs described herein into the cells by techniques readily available to the person of ordinary skill in the art. These include, but are not limited to, calcium phosphate transfection, DEAE-dextran-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, lipofection, and other techniques such as those found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). Where secretion of the polypeptide is desired, appropriate secretion signals known in the art are inco ⁇ orated into the vector using techniques known in the art. The signal sequence can be endogenous to the polypeptides or heterologous to these polypeptides.
• the desired protein can be isolated from the host cell by techniques known in the art, such as, for example, standard disruption procedures, including freeze thaw, sonication, mechanical disruption, use of lysing agents and the like.
• the polypeptide can then be recovered and purified by well-known purification methods including, but not limited to, ammonium sulfate precipitation, acid extraction, anion or cationic exchange chromatography, phosphocellulose chromatography, hydrophobic-interaction chromatography, affinity chromatography, hydroxylapatite chromatography, lectin chromatography, and high performance liquid chromatography.
• the invention encompasses utilizing the sequences deduced from the fragment identified in Figure 18, and described in Example 4. More particularly, in this aspect, the invention comprises utilization of the glucosaminidase nucleotide sequences which are produced by using primers, such as, for example, those primer combinations described in Example 4. These nucleotide sequences may be used in the construction and expression of anti-sense RNA, ribozymes, or homologous recombination (gene "knock-out") constructs, using methods readily available to those skilled in the art, to reduce or eliminate in vivo glucosaminidase activity.
• Cell lines produced by the methods of the invention can be tested by expressing a model recombinant glycoprotein in such cell lines and assessing the N- glycans attached therein using techniques described herein or otherwise known in the art. The assessment can be done, for example, by 3 -dimensional HPLC techniques.
• human transferrin is used as a model target glycoprotein, since this glycoprotein is sialylated in humans and extensive oligosaccharide structural information for the protein is available (Montreuil et al. (1997) Glycoproteins II Ed. 203-242). In this manner, cell lines with superior processing characteristics are identified.
• Such a cell line can then be evaluated for its growth rate, product yields, and capacity to grow in suspension culture (Lindsay et al. (1992) Biotech, and Bioeng. 39:614-618, Reuveny et al. (1992) Ann. NY Acad. Sci. 665:320, Reuveny et al. (1993) Appl. Microbiol. Biotechnol. 38:619-623, Reuveny et al. (1993) Biotechnol. Bioeng. 42:235-239).
• the invention encompasses expressing heterologous proteins in the cells of the invention and/or according to the methods of the invention for any pu ⁇ ose benefiting from such expression.
• a pu ⁇ ose includes, but is not limited to, increasing the in vivo circulatory half life of a protein; producing a desired quantity of the protein; increasing the biological function of the protein including, but not limited to, enzyme activity, receptor activity, binding capacity, antigenicity, therapeutic property, capacity as a vaccine or a diagnostic tool, and the like.
• Such proteins may be naturally occurring chemically synthesized or recombinant proteins.
• proteins that benefit from the heterologous expression of the invention include, but are not limited to, transferrin, plasminogen, Na + , K + - ATPase , thyrotropin, tissue plasminogen activator, erythropoietin, interleukins, and interferons.
• transferrin transferrin
• plasminogen Na + , K + - ATPase
• thyrotropin tissue plasminogen activator
• erythropoietin interleukins
• interferons include transferrin, transferrin, plasminogen, Na + , K + - ATPase , thyrotropin, tissue plasminogen activator, erythropoietin, interleukins, and interferons.
• proteins that benefit from the heterologous expression of the invention are mammalian proteins.
• mammals include but are not limited to, cats, dogs, rats, mice, cows, pigs,
• heterologous expression of the invention not only encompasses proteins that are sialylated in their native source; but also those that are not sialylated as such, and benefit from the expression in the cells of and/or according to the methods of the invention.
• proteins that are not sialylated in their native source can be altered by known genetic engineering methods so that the heterologous expression of the protein according to the invention will result in sialylation of the protein.
• Such methods include, but are not limited to, the genetic engineering methods described herein.
• altering the proteins could encompass engineering into the protein targeting signals to ensure targeting of the proteins to the ER and Golgi apparatus for sialylation, where such signals are needed.
• the cells of the invention contain proteins, which are not sialylated prior to manipulation of the cells according to the methods of the invention, but are sialylated subsequent to the manipulation.
• the invention also encompasses proteins that have amino acid sequences that are endogenous to the cells of the invention, but are sialylated as a result manipulation of the cells according to the methods of the invention. It is recognized that the analysis of the N-glycans produced according to the methods of the invention may suggest additional strategies to further enhance the sialylation of glycoproteins in insect cells. If the production of Gal containing carbohydrate acceptor structures is low relative to those containing GlcNAc, then the levels of Gal transferase expression are increased by integrating multiple copies of this gene into the insect cell genome or by expressing Gal T under a stronger promoter using techniques described herein or otherwise known in the art.
• substrate feeding strategies are used to enhance the levels of UDP-Gal for this carbohydrate processing reaction.
• sialyltransferase or CMP-SA production is enhanced.
• Examination of sialyltransferase activity using techniques described herein or otherwise known in the art, such as, for example, FRET or HPLC and CMP-SA levels using HP AEC, is used to determine which step is the metabolic limiting step to sialylation.
• Analytical bioassays are implemented to evaluate enzymatic activities in the N-glycosylation pathway of insect cells.
• bioassays in which multiple samples can be analyzed simultaneously are advantageous. Consequently, bioassays based on fluorescence energy transfer (FRET) and time-resolved fluorometry of europium (Eu) are designed to screen native and recombinant insect cell lines for carbohydrate processing enzymes in a format that can handle multiple samples. Fluorescence assays are especially useful in detecting limiting steps in carbohydrate processing due to their sensitivity and specificity.
• FRET fluorescence energy transfer
• Eu time-resolved fluorometry of europium
• FRET and Eu assays detect enzymatic activities at levels as low as 10 "14 M, which is greater than the sensitivity obtained with I25 I.
• substrates modified with fluorophores enables the measurement of one specific enzyme activity in an insect cell lysate, and multiple samples can be analyzed simultaneously in a microtiter plate configuration used in an appropriate fluorometer. With these assays, insect cell lines are rapidly screened for the presence of processing enzymes including Gal, GlcNAc, and sialic acid transferases to identify limiting enzymes in N-glycosylation in native and recombinant cells.
• Glycosyl transferase activity assays are based on the principle of fluorescence energy transfer (FRET), which has been used to study glycopeptide conformation (Rice et al (1991) Biochemistry 30:6646-6655) and to develop endo-type glycosidase assays (Lee et al (1995) Anal. Biochem. 230:31-36).
• FRET fluorescence energy transfer
• the fluorescent compound, UDP-Gal-6-Naph, synthesized by consecutive reactions of galactose oxidase (generating 6-oxo compound) and reductive amination with naphthylamine, is found to be effective as a substrate for Gal transferase.
• UDP-Gal-6-Naph is reacted with an acceptor carrying a dansyl group (Dans-AE- GlcNAc) in the presence of Gal-T, a product is created that can transfer energy (Figure 12).
• a sialyltransferase assay is designed using similar FRET technology described in the above example for Gal T.
• the 3-carbon tail (exocyclic chain) of sialic acid in particular, its glycoside
• This intermediate is reductively aminated to generate a fluorescently tagged sialic acid (after removal of its aglycon), which is then modified to form a fluorescently modified CMP-sialic acid (See also Lee et al. (1994) Anal. Biochem. 216:358-364, Brossamer et al. (1994) Methods Enzymol 247:153-177).
• the acceptor substrate is modified as described above to include the dansyl group. Then the FRET approach is used to measure either alpha(2, 3) or alpha(2, 6) sialyltransferase activity since these enzymes should utilize the modified CMP-SA as donor substrate to generate a product with altered fluorescent emission characteristics.
• the choice of the fluorescent donor and acceptor pair can be flexible. The above examples are given using naphthyl-dansyl pairs, but other fluorescent combinations may be even more sensitive (Wu et al. (1994) Anal. Biochem. 250:260- 262).
• a new GlcNAc-TI assay illustrated in Figure 15, utilizes a synthetic 6- aminohexyl glycoside of the trimannosyl N-glycan core structure labeled with DTPA (Diethylenetriaminepentaacetic acid) and complexed with Eu +3 .
• This substrate is then incubated with insect cell lysates or positive controls containing GlcNAc Tl and UDP-GlcNAc. Addition of chemical inhibitors are used to minimize background N- acetylglucosaminidase activity. After the reaction, an excess of Crocus lectin CVL (Misaki et al. (1997) J Biol. Chem.
• N-acetylglucosaminidase activity is developed using a different lectin, GS-II, which is specific for GlcNAc.
• the substrate is prepared by modification of the same trimannosyl core glycoside described above using in vitro purified GlcNAc Tl, which results in addition of a GlcNAc_bet ⁇ (l-2) residue to the Man_alpha(l-3) residue.
• enzymatic hydrolysis by N-acetylglucosaminidase removes GlcNAc from the substrate resulting in the tri-mannosyl core product. The product is not susceptible to lectin binding and thus escapes into the filtrate.
• Evaluation of Eu +3 fluorescence in the filtrate provides a measure of the N-acetylglucosaminidase activity.
• enhanced binding of the Eu-bound trimannosyl core to the Crocus lectin described above can be used as another assay for N-acetylglucosaminidase activity.
• composition of these structures provided insights into the carbohydrate processing pathways present in insect cells and allowed a comparison of intracellular and secreted N-glycan structures.
• the Trichoplusia ni cells grown in serum free medium in suspension culture were infected with a baculovirus vector encoding a murine IgG (Summers et al. (1987) A manual of methods for baculovirus vectors and insect cells culture procedures).
• IgG includes an N-linked oligosaccharide attachment on each of the two heavy chains.
• Heterologous IgG was purified from the culture supernatant and soluble cell lysates using a Protein A-Sepharose column.
• N-linked oligosaccharides were isolated following protease digestion of IgG and treatment with glycoamidase A to release the N-glycans. Oligosaccharides were then derivatized with 2-aminopyridine (PA) at the reducing ends to provide fluorogenic properties for detection.
• PA 2-aminopyridine
• a DEAE column was used to separate oligosaccharides on the basis of carbohydrate acidity (first dimension). None of the oligosaccharides retained on this column were found to include sialic acid. Treatment of the acidic fractions with neuraminidase from Arthrobacter ureafaciens (known to cleave all known sialic acid linkages) failed to release any sialic acid, and ODS-chromatography of the fractions revealed several minor components different from all known sialylated oligosaccharides.
• the second dimension used reverse phase HPLC with an ODS-silica column to fractionate the labeled oligosaccharides according to carbohydrate structure.
• Supernatant (S) and lysate (L) IgGs oligosaccharides were separated into 6 and 10 fractions, respectively, labeled A-L in Figure 6.
• Separation in the third and final dimension was accomplished using an amide column to isolate oligosaccharides on the basis of molecular size. Peak B from the ODS column was separated into two separate oligosaccharide fractions, and peak H was separated into three separate oligosaccharide fractions on the amide-column.
• oligosaccharide purification After oligosaccharide purification, structures of unknown oligosaccharides were determined by comparing their positions on the 3-dimensional map with the positions of over 450 known oligosaccharides. Co-elution of an unknown sample with a known PA-oligosaccharide on the ODS and amide-silica columns was used to confirm the identity of an oligosaccharide. Digestion by glycosidases with specific cleavage sites (alp b ⁇ -L-fucosidase, bet ⁇ -galactosidase, beta-N- acetylglucosaminidase, and ⁇ - b ⁇ -mannosidase) followed by reseparation provided further confirmation.
• oligosaccharide G All the oligosaccharides in the culture medium and cell lysates matched known carbohydrates except for oligosaccharide G.
• the structure of oligosaccharide G was elucidated by treatment of the N-glycan with ⁇ /pb ⁇ -L-fucosidase, known to digest Fuc_ ⁇ //.b ⁇ l-6GIcNAc, followed by treatment with 13.5 M trifluoroacetic acid to remove the alphal, 3 linked fucose.
• the de-alphal, 6- and de-alphal, 3-fucosylated oligosaccharide G co-eluted with a known oligosaccharide, allowing the identification of G.
• the structure of oligosaccharide G is shown in Figure 7.
• oligosaccharide G was further confirmed by l H-NMR and electrospray ionization (ESI) mass spectrometry (Hsu et al. (1997) J. Biol Chem. 272:9062-9070). Thus, the combination of these techniques can be used to elucidate both known and unknown oligosaccharides.
• the initial processing in the T. ni cells appears to be similar to the mammalian pathway, including trimming of the terminal glucose and mannose residues.
• the trimming process follows a linear pathway with the exception of two different forms of the Man 7 GlcNAc 2 (M7GN, in Figure 8 also observed in native insect glycoproteins (Altmann et al. (1996) Trends in Glycoscience and Glycotechnology 8:101-114) and IgG , from NS/0 cells (Ip et al. (1994) Arch. Biochem. Biophys. 308:387-399).
• M7GN Man 7 GlcNAc 2
• IgG IgG
• GlcNAc GN
• GlcNAc Tl N- acetylglusosaminyltransf erase I
• Altmann et al. (1996) Trends in Glycoscience and Glycotechnology 8:101-114).
• GlcNAc i Man 5 GlcN AC 2 must be a shortlived intermediate quickly processed by alpha-Man II, since this structure was not detected in the T. ni cell lysate.
• Man 3 GlcNAc oligosaccharide At the GlcNAci, Man 3 GlcNAc oligosaccharide, several branching steps in the N-glycan processing pathway are possible in insect cells.
• Complex glycoforms can be generated by the action of GlcNAc Til (N- acetylglucosaminyltransferase II) and Gal T (galactosyltransferase T) to provide oligosaccharides which include terminal GlcNAc (GN) and Gal (G) residues. None of the complex oligosaccharide structures included sialic acid indicating that sialylation is negligible or non-existent in these cells.
• the intracellular N-glycans obtained from insect cells include more than 50% high-mannose type structures.
• the fraction of intracellular complex oligosaccharides is less than 15% and only 8% include a terminal Gal residue.
• the high level of high-mannose structures from intracellular sources indicates significantly less oligosaccharide processing for most of the intracellular immunoglobulins. Many of these intracellular immunoglobulins may not reach the compartments in which carbohydrate trimming takes place (Jarvis et al (1989) Mol. Cell. Biol. 9:214-223). High mannose glycoforms are also observed intracellulariy for mammalian cells (Jenkins et al. (1998) Cell Culture Engineering VI).
• Example 1 Evaluation of N-glycosylation Pathway Enzymes The levels of N-linked oligosaccharide processing enzymes are measured using analytical assays to characterize carbohydrate processing in native and recombinant insect cells. These assays are used to compare the N-glycan processing capacity of different cell lines and to evaluate changes in processing and metabolite levels following metabolic engineering modifications.
• HP AEC High Performance Anion Exchange Chromatography
• HP AEC is used in combination with pulsed amperometric detection (HPAEC- PAD) or conductivity to detect metabolite levels in the CMP-SA pathway and to evaluate N-linked oligosaccharide processing enzymes essentially as described by (Lee et al. (1990) Anal. Biochem. 34:953-95 ', Lee et al. (1996) J. Chromatography A 720:137-149).
• HPAEC- PAD pulsed amperometric detection
• conductivity to detect metabolite levels in the CMP-SA pathway and to evaluate N-linked oligosaccharide processing enzymes essentially as described by (Lee et al. (1990) Anal. Biochem. 34:953-95 ', Lee et al. (1996) J. Chromatography A 720:137-149).
• Shown in Figure 9 is an example of the use of HPAEC-PAD for measuring Gal T activity by following the lactose formation reaction:
• Trichoplusia ni lysates were incubated in the presence of exogenously added CMP-SA and the fluorescent substrate, 4-methylumbelliferyl lactoside (Lac-MU). Negligible conversion of the substrate was observed, indicating the absence of endogenous sialyltransferase activity.
• conversion of Lac-MU to the product sialyl LacMU was observed in cell lysates using Reverse Phase HPLC and a fluorescence detector ( Figure 10).
• Lac-ABA o-aminobenzamide
• HPLC and HP AEC is used in conjunction with other fluorometric methods detailed in the procedures to analyze the metabolites and enzymatic activities in insect cells.
• DELFIA Dissociation Enhanced Lanthananide FluorommunoAssay
• FIG. 11 depicts GlcNAc-BSA in (A) Boiled lysate; (B) T. ni; (C) Standard enzyme, 0.5 mU; (D) T.
• Gal T activity level is increased significantly following infection with a baculovirus vector including a mammalian Gal T gene under the IE1 promoter or by using Sf-9 cells stably- transformed with the Gal T gene (cell lines are described in Jarvis et al (1996) Nature Biotech. 14:1288-1292; and Hollister et al. (1998) Glycobiology 5:473-480).
• the DELFIA method is not limited to Gal T measurement. This technique is used to evaluate the activity of any processing enzyme which generates carbohydrate structures containing binding sites for a specific lectin or carbohydrate-specific antibodies (Taki et al. (1994) Anal. Biochem. 219:104-108, Rabina et /. (1997) Anal. Biochem. 246:459-470).
• Example 2 Enhancing SA levels by Substrate Addition Because the conventional substrates in insect cell media are not efficiently converted to CMP-SA in insect cells as demonstrated by the low levels of CMP-SA, alternative substrates are added to the culture medium. Because sialic acid and CMP- SA are not permeable to cell membranes (Bennetts et al. (1981) J. Cell. Biol. 88:1- 15), they are not considered as appropriate substrates. However, other precursors in the CMP-SA pathway are inco ⁇ orated into cells and considered as substrates for the generation of CMP-SA in insect cells.
• ManNAc has been added to mammalian tissue and cell cultures and enzymatically converted to SA and CMP-SA (Ferwerda et al. (1983) Biochem. J. 216:87-92, Gu et al. (1997) Improvement of the inter feron-gamma sialylation in Chinese hamster ovary cell culture by feeding N-acetylmannosamine, Thomas et al. (1985) Biochim. Biophys. Acta 846:37-43). Consequently, external feeding of ManNAc is examined as one strategy to enhance CMP-SA levels in insect cells.
• ManNAc is available commercially (Sigma Chemical Co.) or can be prepared chemically from the less expensive feedstock GlcNAc in vitro using sodium hydroxide (Mahmoudian et al. (1997) Enzyme and Microbial Technology 20:393- 400). Initially, the levels of native cellular ManNAc, if any, is determined using HPAEC-PAD techniques (Lee et al. (1990) Anal. Biochem. 34:953-957, Lee et al. (1996) J. Chromatography A 720:137-149, Hardy et al. (1988) Anal. Biochem.
• ManNAc The ability to increase intracellular ManNAc levels is evaluated by adding ManNAc to cell culture media. Inco ⁇ oration of exogenous ManNAc is quantified using unlabeled ManNAc if levels of native ManNAc are negligible, or 14 C- or 3 H-labeled ManNAc if significant levels of native ManNAc are present) (Bennetts et al. (1981) J Cell. Biol. 88:1-15, Kriesel et al. (1988) J. Biol. Chem. 263:11736-11742). The levels of radioactive ManNAc and other metabolites axe determined by collecting ManNAc peaks following HP AEC and measuring the radioactivity using scintillation countering.
• the ManNAc To be effective as a substrate for sialylation, the ManNAc must be converted to SA and CMP-SA through intracellular pathways. This conversion is detected directly from externally added ManNAc by following an increase in internal SA and CMP-SA levels using HP AEC or thin layer chromatography (TLC) combined with liquid scintillation counting to detect the radiolabeled metabolites.
• HP AEC techniques have been used to quantify cellular pools of CMP-SA in as few as 6 x 10 6 mammalian cells (Fritsch et ⁇ l. (1996) Journal of ' Chromatography A 727:223-230), and TLC has been used to evaluate conversion of 14 C labeled ManNAc to sialic acid in bacteria (Vann et al.
• ManNAc a limiting step exists in the production of ManNAc from conventional insect cell media substrates. Different ManNAc feeding concentrations are tested and the effect on CMP-SA levels and insect cell viability evaluated to determine if there are any deleterious effects from feeding the ManNAc as substrate. Conversion of ManNAc to SA through the aldolase pathway requires pyruvate, and the addition of cytidine can enhance CMP- SA production from SA (Thomas et al. (1985) Biochim. Biophys. Acta 846:37-43).
• pyruvate and cytidine are optionally added to the medium to enhance conversion of ManNAc to CMP-SA (Tomita et al. (1995) Biochim. Biophys. Acta 1243:329-335, Thomas et al (1985) Biochim. Biophys. Acta 846:37-43).
• a bioinformatics search of the cDNA libraries of HGS revealed a novel human CMP-SA synthetase gene based on its homology with the E. coli DNA sequence.
• the bacterial enzyme includes a nucleotide binding site for CTP. This binding site contains a number of amino acids that are conserved among all known bacterial CMP-SA synthetase enzymes (See Stoughton et al, Biochem J. 15:397-402 (1999).
• the identity of the human cDNA as a CMP-SA synthetase gene was confirmed by the presence of significant homology within this binding motif:
• This human homologue commercially, publicly, or otherwise available for the pu ⁇ oses of this invention is cloned and expressed in insect cells.
• the nucleotide and amino acid sequences of human CMP SA synthetase are shown in Figures 29 and 30 respectively.
• Example 4 Isolation and Inhibition of glucosaminidase It is recognized that insect cells could possess additional N- acetylglucosaminidase enzymes other than the enzyme responsible for generating low-mannose structures, so both recombinant DNA and biochemical approaches are implemented to isolate the target N-acetylglucosaminidase gene. PCR techniques are used to isolate fragments of N-acetylglucosaminidase genes by the same strategies used in isolating ⁇ /pb ⁇ -mannosidase cDNAs from Sf-9 cells (Jarvis et al. (1997)
• oligonucleotide primers are designed corresponding to regions of conserved amino acid sequence identified in all N-acetylglucosaminidases described thus far, from human to bacteria, including two lepidopteran insect enzymes (Zen et al. (1996) Insect Biochem. Mol. Biol. 26:435-444). These primers are used to amplify a fragment of the N-acetylglucosaminidase gene(s) from genomic DNA or cDNA of lepidopteran insect cell lines commercially, publicly, or otherwise available for the pu ⁇ oses of this invention.
• FIG. 18 A putative N-acetylglucosaminidase gene fragment from Sf9 genomic DNA and from High FiveTM cell (Invitrogen Co ⁇ ., Carlsbad, CA, USA) cDNA has been identified ( Figure 18). Similar techniques are used to isolate cDNAs from other insect cell lines of interest. The identification of cDNAs for the Sf9 or High FiveTM N-acetylglucosaminidase facilitates the isolation of the gene in other insect cell lines.
• Figure 18 depicts PCR amplification of Sf9 genomic DNA (A) or High
• Sense primer #1 5'-T/C,T,I,C,A,C/T,T,G,G,C,A,C/T,- ⁇ /T/C,T,I,G,T,I,G,A-3' (SEQ ID NO:9)
• Sense primer #2 5'-G,A,G/A,A/T,T,A/C/T,G,A,C/T,I,I,I,C,C,I,G,G/C,I,C,A-3' (SEQ ID NO: 10)
• Antisense primer #2 5'-T,G,I,C/G,C,I,G,G,I,I,I,G/A,T,C,T/G/A,A,T/A,C/T,T,C-3' (SEQ ID NO: 11)
• Antisense primer #3 5 * -A,C/A/G,C/T,T,C,G/A,T,C,I,C,C,I,C,C,I,I,I,G/A,T,G-3' (SEQ ID NO: 12)
• the PCR amplified fragments are cloned and sequenced using the chain termination method (Sanger et al. (1977) Proc. Natl. Acad. Sci. USA 74:5463-5467). The results are used to design exact-match oligonucleotide primers to isolate an N- acetylglucosaminidase clone(s) from existing Sf9 and/or High FiveTM lambda ZAPII cDNA libraries by sibling selection and PCR (Jarvis et al. (1997) Glycobiology 7:113- 127, Kawar et al. (1997) Glycobiology 7:433-443).
• the library is consecutively split into sub-pools that score positive in PCR screens until a positive sub-pool of approximately 2,000 clones is obtained. These clones are then screened by plaque hybridization (Benton et al. (1977) Science 196:180-182) using the cloned PCR fragment, and positive clones are identified and plaque purified. The cDNA(s) are then excised in vivo as a pBluescript-based subclone in E. coli.
• the target N-acetylglucosaminidase is membrane bound, so it must be solubilized using a detergent such as Triton-X 100 prior to purification.
• a detergent such as Triton-X 100 prior to purification.
• the enzyme is purified by a combination of gel filtration, ion exchange, and affinity chromatography.
• affinity chromatography the affinants 6- aminohexyl thio-N-acetylglucosaminide (Chipowsky et al. (1973) Carbohydr. Res. 31 :339-346) or BSA modified with thio-N-acetylglucosaminide (Lee et al. (1976) Biochemistry 15:3956-3963) is tried first.
• 6-aminohexyl a-D-[2-(thio-2- amino-2-deoxy-b-D-glucosaminyl)-mannopyranodside or other thio-oligosaccharides are synthesized and used as affinants.
• Affinity matrices are prepared using commercially available products.
• the target enzyme is "anchored" to the membrane by a glycophosphoinositide.
• a specific phospholipase C is used to release the active enzyme from the membrane, and the use of detergent for solubilization is avoided.
• the purity of the enzyme is examined with SDS-PAGE and mass spectroscopy, and the activity of the enzyme characterized.
• Once the enzyme is sufficiently purified its amino-terminal region is sequenced by conventional Edman degradation techniques, available commercially. If N-terminal blockage is encountered, the purified protein are digested, peptides purified, and these peptides are used to obtain internal amino acid sequences. The resulting sequence information is used to design degenerate oligonucleotide primers that are used, in turn, to isolate cDNAs as described above.
• Isolated full-length cDNAs are sequenced, compared to other N- acetylglucosaminidase cDNAs, and expressed using known polyhedrin-based baculovirus vectors.
• the overexpressed proteins are purified, their biochemical activities and substrate specificities characterized, and new polyclonal antisera is produced to establish the subcellular locations of the enzymes in insect cells.
• the locations are optionally identified by using the antisera in conjunction with secretory pathway markers, including Golgi and endoplasmic reticulum specific dyes and GFP- tagged N-glycan processing enzymes commercially, publicly, or otherwise available for the pu ⁇ oses of this invention.
• Example 5 Expression of the model glycoprotein transferrin The gene encoding human transferrin as described in Genbank accession No.
• S95936 is cloned into the baculovirus vector, expressed in multiple insect cell lines, and purified to homogeneity.
• the transferrin is purified to homogeneity, the structures of the oligosaccharides which are N-linked at two sites of the transferrin are analyzed using 3-dimensional HPLC mapping techniques. Over 450 N-glycans have been mapped with this technique. For example, characterization of the N-linked oligosaccharides attached to the heavy chain of secreted and intracellular IgG is described.
• Sialylation is confirmed by treating the purified N-glycan with sialidase from A. ureafaciens and measuring the release of sialic acid using HPAEC-PAD.
• Example 6 Cloning, expression, and characterization of the human sialic acid synthetase (SAS) gene and gene product.
• SAS sialic acid synthetase
• This example reports the cloning and characterization of a novel human gene having homology to the Escherichia coli sialic acid synthetase gene (neuB).
• This human gene is ubiquitously expressed and encodes a 40 kD enzyme which results in N-acetylneuraminic acid ( ⁇ eu5Ac) and 2-keto-3-deoxy-D-g/ cero-D-g ⁇ / ⁇ cto-nononic acid (KDN) production in insect cells upon recombinant baculovirus infection.
• the human enzyme uses N-acetylmannosamine-6-phosphate and mannose-6- phosphate as substrates to generate phosphorylated forms of ⁇ eu5Ac and KDN, respectively, but exhibits much higher activity toward the Neu5Ac phosphate product.
• the E. coli sialic acid synthetase gene (Annunziato et al., J. Bacteriol 177, 312-319 (1995)) was used to search the human EST database of Human Genome Sciences, Inc. (Rockville, MD).
• One EST with significant homology to the neuB gene was found in a human liver cDNA library and used to identify a full length cDNA ( Figure 35 A) with an ORF homologous to the bacterial synthetase over most of its length.
• the putative synthetase consisted of 359 amino acids (SEQ ID NO:6) while the neuB gene product contained 346 amino acids (SEQ ID NO:8). Alignment of the human against the bacterial enzyme demonstrated that significant differences were found primarily in the N-terminus (Figure 35B). Overall, the two synthetases were found to be 36.1% identical and 56.1%> similar at the amino acid level.
• SAS was inserted into baculovirus under the polh promoter using lacZ as a positive selection marker. After transfection and viral titering, the resulting virus (AcSAS) was used to infect Spodoptera frugiperda (Sf-9) cells followed by pulse labeling. An -40 kD band was observed in the Sf-9 lysates from cells infected by AcSAS ( Figure 36A, lane 5) and not in the mock infected control ( Figure 36A, lane 4). Furthermore, this band co-migrated with the protein produced in vitro. To verify SAS expression, the band was visualized in the non-nuclear fraction (Miyamoto et al., Mol. Cell. Biol.
• the sialic acid content in cell lysates before and after filtration through a 10,000 MWCO membrane was determined by DMB labeling and HPLC separation.
• the native sialic acid levels in Sf-9 cells grown without fetal bovine serum (FBS) supplementation are substantially lower than the levels found in CHO cells (Table 2; Figure 37A).
• FBS fetal bovine serum
• the sialic acid content of insect cells cultured in 10% FBS was determined.
• the Neu5 Ac content of Sf-9 cells is nearly an order of magnitude lower than the content of CHO cells (Table 2).
• the origin of the sialic acid detected in insect cells, whether natively produced or the result of contamination from the media, is not clear since even serum free insect cell media contains significant levels of sialic acid (data not shown).
• CHO and Sf-9 cells were grown to confluency in T-75 flasks.
• Cell lysates with and without 10,000 MWCO filtration were analyzed for sialic acid content following DMB derivatization and HPLC separation.
• Sialic acid levels have been normalized based on lysate protein content. Dashes indicate sialic acid was not detectable.
• Sialic acid levels were quantified in lysates of uninfected, A35 infected, and AcSAS infected Sf-9 cells grown in media with and without Man, mannosamine (ManN), or ManNAc supplementation (Table 3).
• Man feeding resulted in detection of KDN slightly above background, and ManNAc feeding marginally increased Neu5Ac levels in uninfected and A35 infected cells (Table 3).
• ManN supplementation had no effect on KDN levels but increased Neu5Ac levels (Table 3).
• the most significant changes in sialic acid levels occurred with AcSAS infection.
• AcSAS infection of Sf-9 cells led to large increases in KDN levels with slight enhancements upon Man or ManNAc supplementation. Both AcSAS infection and ManNAc feeding were required to obtain substantial Neu5Ac levels.
• the mammalian pathway for Neu5Ac synthesis uses a phosphate intermediate (Jourdian et al., J Biol. Chem. 239, PC2714-PC2716 (1964); Kundig et al., J Biol. Chem. 241, 5619-5626 (1966); Watson et al., J. Biol. Chem. 241, 5627- 5636 (1966)) while the E. coli pathway directly converts ManNAc and PEP to Neu5Ac (Vann et al, Glycobiology 7, 697-701 (1997)).
• in vitro assays were performed using lysates of infected Sf-9 cells and protein purified from the prokaryotic expression system.
• Lysates or purified protein plus PEP and MnCl 2 were incubated with Man, mannose-6-phosphate (Man-6- P), ManNAc, or ManNAc-6-P followed by DMB labeling and HPLC analysis.
• Assays were performed by incubating lysates with different substrate solution concentrations of Man-6-P and ManNAc-6-P in order to evaluate substrate preference. After incubation for a fixed time period, the samples were treated with AP, and DMB derivatives of Neu5Ac and KDN were quantified and compared (Table 4). When equimolar amounts of substrates are used, Neu5Ac production is significantly favored over KDN especially at higher equimolar concentrations (10 and 20 mM) of the two substrates. Only when the substrate concentration of ManNAc-6- P is substantially lower than the Man-6-P levels are production levels of the two sialic acids comparable.
• the enzyme prefers ManNAc-6-P over Man-6-P in the production of phosphorylated forms of Neu5Ac and KDN, respectively.
• the 40 kD sialic acid phosphate synthetase enzyme, SAS was expressed in cells.
• SAS was identified based on homology with neuB whose enzyme product directly forms Neu5Ac from ManNAc and PEP (Vann et al., Glycobiology 7, 697-701 (1997)). Furthermore, insect cells produce Neu5Ac following recombinant SAS expression and ManNAc supplementation. However, mammalian cells are known only to produce Neu5Ac from ManNAc through a three-step pathway with phosphorylated intermediates. Therefore, in vitro assays were performed to determine the substrate specificity of SAS. Both AcSAS infected insect cell lysates and protein purified from the prokaryotic expression system were assayed using ManNAc and ManNAc-6-P as possible substrates.
• Sf-9 cells natively possess the ability to complete the three-step mammalian pathway when only the sialic acid phosphate synthetase gene is provided. Sf-9 cells have been shown to have substantial ManNAc kinase ability (Effertz et al., J. Biol. Chem. 274, 28771-28778 (1999)), and phosphatase activity has also been detected in insect cells (Sukhanova et al, Genetika 34, 1239-1242 (1998)).
• N-glycans of recombinant glycoproteins produced in insect cells lack significant levels of terminal sialic acid residues (Jarvis and Finn, Virology 212, 500-511 (1995); Ogonah et al, Bio/Technology 14, 197-202 (1996)).
• insect cells may possess limited native sialic acid synthetic ability. Similar substrate supplementation results have been reported in mammalian cells, as cultivation in Man-rich or ManNAc-rich media enhanced the synthesis of native intracellular KDN and Neu5Ac, respectively (Angata et al., Biochem. Biophys. Res. Commun. 261, 326- 331 (1999)).
• KDN encoding any enzyme with KDN synthetic ability.
• KDN enzymatic activity has been characterized in trout testis, a tissue high in KDN content.
• KDN is synthesized from Man in trout through a three- step pathway involving a synthetase with a Man-6-P substrate (Angata et al., J. Biol. Chem. 274, 22949-22956 (1999)).
• the fish synthetase enzyme partially purified from trout testis, was approximately 80 kD as compared to the human enzyme of 40 kD.
• the ratio of Neu5Ac to KDN is on the order of 100:1 in blood cells and ovaries (Inoue et al., 1998), although this ratio may change during development and cancer.
• the levels of free KDN in newborn fetal cord red blood cells are higher than those of maternal red blood cells (Inoue et al., J. Biol. Chem. 273, 27199-27204 (1998)).
• a 4.2 fold increase in the ratio of free KDN to free Neu5 Ac was observed in ovarian tumor cells as compared to normal cells, and the ratio appears to increase with the extent of invasion or malignancy for ovarian adenocarcinomas (Inoue et al., J. Biol. Chem. 273, 27199-27204 (1998)).
• nucleotide sugars from lysed cells were extracted with 75% ethanol, dried, resuspended in water, and filtered through a 10,000 molecular weight cut-off membrane. Samples were then separated on a Dionex Carbopac PA-1 column using a Shimadzu VP series HPLC. Nucleotide sugars were detected based upon their absorbance at 280 nm, and CMP sialic acid standards were shown to elute at approximately 7 minutes. These results demonstrate the ability to produce the desired oligosaccharide products in insect cells via introduction and expression of sialyltransferase enzymes.
• the E. coli neuB coding sequence was used to query the Human Genome Sciences (Rockville, MD) cDNA database with BLAST software.
• One EST clone, HMKAK61, from a human (liver) cDNA library demonstrated significant homology to neuB and was chosen for further characterization.
• the tissue distribution profile was determined by Northern blot hybridization. Briefly, the cDNA was radio-labeled with [ 32 P]-dCTP using a RediPrimeTMII kit (Amersham/Pharmacia Biotech, Piscataway, NJ) following the manufacturer's directions.
• the full length ORF was amplified by PCR using the following primers.
• the forward primer, 5'- TGTAATACGACTCACTATAGGGCGG ⁇ ECCGCCATC ATGCCGCTGGAGCTG GAGC (SEQ ID NO: 13) contained a synthetic T7 promoter sequence (underlined), a BamHI site (italics), a KOZAK sequence (bold), and sequence corresponding to the first six codons of SAS.
• GTACGG ⁇ CCTTATTAAGACTTGATTTTTTTGCC (SEQ ID NO: 14), contained an Asp 718 site (italics), two in-frame stop codons (underlined), and sequences representing the last six codons of SAS.
• the PCR product was digested with BamHI and Asp 718 (Roche, Indianapolis, IN) and the resulting fragment cloned into the corresponding sites of the baculovirus transfer vector, pA2.
• the plasmid (pA2-SAS) was transfected into Sf-9 cells to generate the recombinant baculovirus AcSAS as previously described (Coleman et al., Gene 190, 163-171 (1997)). Amplified virus was used to infect cells, and the gene product was radio- labeled with [ 35 S]-Met and [ 35 S]-Cys. Bands corresponding to the gene product were visualized by SDS-PAGE and autoradiography.
• the PCR product was used as a template for in vitro transcription and translation using rabbit reticulocyte lysate (Promega, Madison, WI) in the presence of [ 35 S]-Met. Translation products were resolved by SDS-PAGE and visualized by autoradiography.
• Sf-9 cells were seeded in serum- free media at a density of lxl 0 6 cells/ml in spinner flasks and infected at a multiplicity of infection of 1-2 with the recombinant virus.
• a detergent fractionation procedure was employed (Miyamoto et al., Mol. Cell. Biol. 5, 2860-2865 (1985)) to separate nuclear from non- nuclear fractions.
• Protein was resolved by SDS-PAGE, transferred to a ProBlottTM membrane (ABI, Foster City, CA), and visualized by Ponceau S staining. A prominent band at the expected MW of ⁇ 40 kD was visible and excised for protein microsequencing using an ABI-494 sequencer (PE Biosystems, Foster City, CA).
• the mobile phase was an acetonitrile, methanol, and water mixture (9:7:84, v/v) with a flow rate of 0.7 ml/min.
• Response factors of Neu5Ac and KDN were established with authentic standards based on peak areas for quantifying sample sialic acid levels.
• Sialic acid content was normalized based on protein content measured with the Pierce (Rockford, IL) BCA assay kit and a Molecular Devices (Sunnyvale, CA) microplate reader.
• Sf-9 (ATCC, Manassas, VA) cells were grown in Ex-CellTM 405 media (JRH BioScience, Lenexa, KS) with and without 10% FBS at 27°C.
• CHO-K1 cells ATCC, Manassas, VA were cultured at 37°C in a humidified atmosphere with 5% CO 2 in Dulbecco's Modified Eagle Medium (Life Technologies, Rockville, MD) supplemented with 10% FBS, 100 U/ml penicillin, 100 ⁇ g/ml streptomycin, 100 ⁇ M MEM essential amino acids, and 4 mM L-glutamine (Life Technologies, Rockville, MD).
• Lysates were prepared from A35 and AcSAS infected and uninfected Sf-9 cells cultured in T-75 flasks with and without 10 mM ManNAc supplementation.
• ManNAc-6-P was prepared by acid hydrolysis of meningococcal Group A polysaccharide. The polysaccharide (15.5 mg) in 5.8 ml water was mixed with 770 mg of Dowex 50 H+ and heated for 1 hr. at 100°C. The filtered hydro lysate was dried in vacuo and the residue dissolved to give a solution of 50 mM ManNAc-6-P and stored frozen.
• Substrate solutions containing 25 mM Man and ManNAc were also used. Boiled samples were used as negative controls. Following incubation, all samples were boiled 3 min., centrifuged for 10 min. at 12,000g, and split into two 10 ⁇ l aliquots. One aliquot was treated with 9 units of calf intestine alkaline phosphatase (Roche, Indianapolis, IN) along with 3 ⁇ l of accompanying buffer while the other aliquot was diluted with water and buffer. AP treated aliquots were incubated 4 hrs. at 37°C, and 10 ⁇ l of both AP treated and untreated samples were reacted with DMB as described above. 2 ⁇ l of the samples incubated with insect lysates and 10 ⁇ l of the samples incubated with bacterial protein were injected onto the HPLC for sialic acid analysis as described above.
• Man-6-P and ManNAc-6-P concentrations in the substrate solution were varied from 1 to 20 mM.
• In vitro assays were run with Sf-9 lysates as described above. Samples were treated with 7 ⁇ l buffer and 18 units of AP, incubated for 4 hrs. at 37°C, and analyzed for sialic acid content. Samples containing more than 1 mM ManNAc-6-P in the substrate solution produced high levels of sialic acid and were diluted 1 :5 before injection to avoid fluorescence detector signal saturation.
• HP AEC Sf-9 cells were grown in T-75 flasks and then infected with A35 or AcSAS or left uninfected in the presence or absence of 10 mM ManNAc. After 80 hrs., cells were washed twice in PBS and sonicated. Aliquots (200 ⁇ l ) were filtered through 10,000 MWCO membranes, and 50 ⁇ l samples were treated with 12.5 ⁇ l aldolase solution [0.0055 U aldolase (ICN, Costa Mesa, CA), 1.4 mM NADH (Sigma, St.
• Samples were normalized based on protein content by dilution with water, and 20 ⁇ l of each sample were analyzed. Ten ⁇ l of each sample were also derivatized with DMB and analyzed by HPLC as described above to confirm the elimination of sialic acids by aldolase treatment.
• the applicant hereby requests that the application has been laid open to public inspection (by the Norwegian Patent Office), or has been finally decided upon by the Norwegian Patent Office without having been laid open inspection, the furnishing of a sample shall only be effected to an expert in the art.
• the request to this effect shall be filed by the applicant with the Norwegian Patent Office not later than at the time when the application is made available to the public under Sections 22 and 33(3) of the Norwegian Patents Act. If such a request has been filed by the applicant, any request made by a third party for the furnishing of a sample shall indicate the expert to be used. That expert may be any person entered on the list of recognized experts drawn up by the Norwegian Patent Office or any person approved by the applicant in the individual case.
• the applicant hereby requests that, until the application has been laid open to public inspection (by the Danish Patent Office), or has been finally decided upon by the Danish Patent office without having been laid open to public inspection, the furnishing of a sample shall only be effected to an expert in the art.
• the request to this effect shall be filed by the applicant with the Danish Patent Office not later that at the time when the application is made available to the public under Sections 22 and 33(3) of the Danish Patents Act. If such a request has been filed by the applicant, any request made by a third party for the furnishing of a sample shall indicate the expert to be used. That expert may be any person entered on a list of recognized experts drawn up by the Danish Patent Office or any person by the applicant in the individual case.
• the applicant hereby requests that, until the application has been laid open to public inspection (by the Swedish Patent Office), or has been finally decided upon by the Swedish Patent Office without having been laid open to public inspection, the furnishing of a sample shall only be effected to an expert in the art.
• the request to this effect shall be filed by the applicant with the International Bureau before the expiration of 16 months from the priority date (preferably on the Form PCT/RO/134 reproduced in annex Z of Volume I of the PCT Applicant's Guide). If such a request has been filed by the applicant any request made by a third party for the furnishing of a sample shall indicate the expert to be used. That expert may be any person entered on a list of recognized experts drawn up by the Swedish Patent Office or any person approved by a applicant in the individual case.
• the applicant hereby requests that until the date of a grant of a Netherlands patent or until the date on which the application is refused or withdrawn or lapsed, the microorganism shall be made available as provided in the 31 F( 1 ) of the Patent Rules only by the issue of a sample to an expert.
• the request to this effect must be furnished by the applicant with the Netherlands Industrial Property Office before the date on which the application is made available to the public under Section 22C or Section 25 of the Patents Act of the Kingdom of the Netherlands, whichever of the two dates occurs earlier.

Landscapes

• Chemical & Material Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Health & Medical Sciences (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Zoology (AREA)
• Wood Science & Technology (AREA)
• Genetics & Genomics (AREA)
• Bioinformatics & Cheminformatics (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• General Engineering & Computer Science (AREA)
• Molecular Biology (AREA)
• Biotechnology (AREA)
• Microbiology (AREA)
• Medicinal Chemistry (AREA)
• Biomedical Technology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Enzymes And Modification Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)

Applications Claiming Priority (5)

Publications (2)

Family

ID=26820692

Family Applications (1)

Country Status (5)

Families Citing this family (22)

• 2000
  • 2000-03-01 EP EP00913684A patent/EP1399538A2/de not_active Withdrawn
  • 2000-03-01 AU AU35083/00A patent/AU3508300A/en not_active Abandoned
  • 2000-03-01 CA CA2363297A patent/CA2363297C/en not_active Expired - Lifetime
  • 2000-03-01 JP JP2000602747A patent/JP2003524395A/ja not_active Withdrawn
  • 2000-03-01 WO PCT/US2000/005313 patent/WO2000052135A2/en active Application Filing

Non-Patent Citations (3)

Also Published As

Similar Documents

Legal Events