EP1395684A2 - New polynucleotides and polypeptides of the ifnalpha-7 gene - Google Patents

New polynucleotides and polypeptides of the ifnalpha-7 gene

Info

Publication number
EP1395684A2
EP1395684A2 EP02747458A EP02747458A EP1395684A2 EP 1395684 A2 EP1395684 A2 EP 1395684A2 EP 02747458 A EP02747458 A EP 02747458A EP 02747458 A EP02747458 A EP 02747458A EP 1395684 A2 EP1395684 A2 EP 1395684A2
Authority
EP
European Patent Office
Prior art keywords
polypeptide
nucleotide sequence
polynucleotide
diseases
ifnα
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02747458A
Other languages
German (de)
English (en)
French (fr)
Inventor
Jean-Louis Escary
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
GenOdyssee SA
Original Assignee
GenOdyssee SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by GenOdyssee SA filed Critical GenOdyssee SA
Publication of EP1395684A2 publication Critical patent/EP1395684A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/555Interferons [IFN]
    • C07K14/56IFN-alpha
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/02Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • A61P19/10Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease for osteoporosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/14Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
    • A61P25/16Anti-Parkinson drugs
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/24Antidepressants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04Antibacterial agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/02Antineoplastic agents specific for leukemia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/02Immunomodulators
    • A61P37/06Immunosuppressants, e.g. drugs for graft rejection
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06Antianaemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6863Cytokines, i.e. immune system proteins modifying a biological response such as cell growth proliferation or differentiation, e.g. TNF, CNF, GM-CSF, lymphotoxin, MIF or their receptors
    • G01N33/6866Interferon
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/10Screening for compounds of potential therapeutic value involving cells

Definitions

  • the present invention relates to new polynucleotides derived from the nucleotide sequence of the IFN ⁇ -7 gene comprising new SNPs, and new polypeptides derived from the natural wild-type IFN ⁇ -7 protein comprising " mutations caused by these SNPs, as well as their therapeutic uses.
  • IFN ⁇ -7 The interferon alpha 7 gene, hereinafter referred to as IFN ⁇ -7, is described in the following publications:
  • nucleotide sequence of this gene is accessible under accession number X02960 in the GenBank database.
  • the IFN ⁇ are known for their cellular antiproliferative effects and their involvements in antiviral and antiparasitic responses.
  • the IFN ⁇ are also known to inhibit the expression of several other cytokines at the level of the hematopoietic stem cells, as well as to inhibit the cellular proliferation of certain tumors.
  • the IFN ⁇ are also known to reduce the expression of the receptors to the EGF in renal carcinomas, to inhibit the expression of certain mitochondrial genes, to inhibit the proliferation of fibroblasts, monocytes and B lymphocytes, especially in vitro, and to block the synthesis of antibodies by B lymphocytes.
  • the IFN ⁇ are also known to induce the expression of tumor specific antigens on the surface of tumor cells and also to induce the genes placed under the control of promoter regions of the ISRE type (Interferon- Stimulated Response Element) by acting on the specific transcription factors of these ISRE.
  • ISRE Interferon- Stimulated Response Element
  • the IFN ⁇ are involved in different disorders and/or human diseases, such as the different cancers like for example, carcinomas, melanomas, lymphomas, leukemias and cancers of the liver, neck, head and kidneys, cardiovascular diseases, metabolic diseases such as those that are not connected with the immune system like, for example, obesity, infectious diseases such as hepatitis B and C and AIDS, pneumonias, ulcerative colitis, diseases of the central nervous system like, for example, Alzheimer's disease, schizophrenia and depression, the rejection of tissue or organ grafts, healing of wounds, anemia in dialyzed patients, allergies, asthma, multiple sclerosis, osteoporosis, psoriasis, rheumatoid arthritis, Crohn's disease, autoimmune diseases and disorders, gastrointestinal disorders or even disorders connected with chemotherapy treatments.
  • the different cancers like for example, carcinomas, melanomas, lymphomas, leukemias and cancers of the liver, neck, head and kidneys, cardiovascular diseases, metabolic diseases such as those that are not
  • the IFN ⁇ are particularly used for the treatment of certain leukemias, metastasizing renal carcinomas as well as tumors that appear following an immunodeficiency, such as Kaposi's sarcoma in the case of AIDS.
  • the IFN ⁇ are also effective against other types of tumors and against certain viral infections.
  • the IFN ⁇ are also recognized by the FDA (Food and Drug Administration) for the treatment of genital warts or venereal diseases.
  • IFN ⁇ and in particular IFN ⁇ -7, have numerous side effects when they are used in pharmaceutical compositions, such as reactions of acute hypersensitivity (urticaria, bronchoconstriction, anaphylactic shock etc.), cardiac arrythmias, low blood pressure, epileptic seizures, problems with thyroid functions, flulike syndromes (fevers, sweats, myalgias), etc.
  • the patients treated with IFN ⁇ can develop antibodies neutralizing these molecules, thus decreasing their effectiveness.
  • the inventors have found new polypeptide and new polynucleotide analogs to the IFN ⁇ -7 gene capable of having a different functionality from the natural wild-type IFN ⁇ -7 protein.
  • the invention has as its first object new polynucleotides that differ from the nucleotide sequence of the reference wild-type IFN ⁇ -7 gene, in that they comprise one or several SNPs (Single Nucleotide Polymorphism).
  • the nucleotide sequence SEQ ID NO. 1 of the human reference wild-type IFN ⁇ - 7 gene is composed of 1983 nucleotides and comprises a coding sequence of 570 nucleotides, from nucleotide 751 (start codon) to nucleotide 1320 (stop codon).
  • the applicant has identified 14 SNPs in the nucleotide sequence of the reference wild-type IFN ⁇ -7 gene. These 14 SNPs are the following: a559c, g580a, c667t, c682t, t779c, gl033a, cl084a, gl 125a, gl 135t, gl 161a, tl 166c, gl 181a, al212g, and al294c.
  • the letters a, t, c and g correspond respectively to the nitrogenous bases adenine, thymine, cytosine and guanine.
  • the first letter corresponds to the wild-type nucleotide, whereas the last letter corresponds to the mutated nucleotide.
  • the SNP gl033a corresponds to a mutation of the nucleotide guanine (g) at position 1033 of the nucleotide sequence SEQ ID NO. 1 of the reference wild-type IFN ⁇ -7 gene, into nucleotide adenine (a).
  • SNPs were identified by the applicant using the determination process described in applicant's patent application FR 00 22894, entitled "Process for the determination of one or several functional polymorphism(s) in the nucleotide sequence of a preselected functional candidate gene and its applications" and filed December 6, 2000, cited here by way of reference.
  • the process described in this patent application permits the identification of one (or several) preexisting SNP(s) in at least one individual from a random population of individuals.
  • a fragment of the nucleotide sequence of the IFN ⁇ -7 gene comprising, for example, the coding sequence, was isolated from different individuals in a population of individuals chosen in a random manner.
  • the fragment sequenced in this way was then compared to the nucleotide sequence of the fragment of the reference wild-type IFN ⁇ -7 gene and the SNPs in conformity with the invention identified.
  • the SNPs are natural and each of them is present in certain individuals of the world population.
  • the reference wild-type IFN ⁇ -7 gene codes for an immature protein of 189 amino acids, corresponding to the amino acid sequence SEQ ID NO. 2, that will be converted to a mature protein of 166 amino acids, by cleavage of the signal peptide that includes the first 23 amino acids.
  • Each of the coding SNPs of the invention namely: t779c, gl033a, cl084a, gl l35t, tl 166c, gl 181a, al294c, causes modifications, at the level of the amino acid sequence, of the protein encoded by the nucleotide sequence of the IFN ⁇ -7 gene.
  • the SNP t779c causes a mutation of the amino acid valine (V) at position 10 in the immature protein of the IFN ⁇ -7 gene, corresponding to the amino acid sequence SEQ ID NO. 2, in alanine (A).
  • V amino acid valine
  • A alanine
  • This SNP affects an amino acid located in the signal sequence that will be cleaved during the process of protein maturation and, thus, this SNP is not found on the mature protein.
  • VI OA the mutation encoded by this SNP by reference to the immature protein.
  • the SNP gl033a causes a mutation of the amino acid aspartic acid (D) at position 95 in the immature protein of the IFN ⁇ -7 gene, corresponding to the amino acid sequence SEQ ID NO. 2, in asparagine (N) and at position 72 of the mature protein.
  • D amino acid aspartic acid
  • N amino acid sequence SEQ ID NO. 2
  • D72N and D95N the mutation encoded by this SNP according to whether one refers respectively to the mature protein or to the immature protein.
  • the SNP c 1084a causes a mutation of the amino acid leucine (L) at position 112 in the immature protein of the IFN ⁇ -7 gene, corresponding to the amino acid sequence SEQ ID NO. 2, in isoleucine (I) and at position 89 of the mature protein.
  • L amino acid leucine
  • I isoleucine
  • L89I and LI 121 the mutation encoded by this SNP according to whether one refers respectively to the mature protein or to the immature protein.
  • the SNP gl l35t causes a mutation of the amino acid valine (V) at position 129 in the immature protein of the IFN ⁇ -7 gene, corresponding to the amino acid sequence SEQ ID NO. 2, in leucine (L) and at position 106 of the mature protein.
  • V amino acid valine
  • L leucine
  • V106L and V129L the mutation encoded by this SNP according to whether one refers respectively to the mature protein or to the immature protein.
  • the SNP tl 166c causes a mutation of the amino acid phenylalanine (F) at position 139 in the immature protein of the IFN ⁇ -7 gene, corresponding to the amino acid sequence SEQ ID NO. 2, in serine (S) and at position 116 of the mature protein.
  • F amino acid phenylalanine
  • S serine
  • FI 16S and F139S the mutation encoded by this SNP according to whether one refers respectively to the mature protein or to the immature protein.
  • the SNP gl 181a causes a mutation of the amino acid arginine (R) at position 144 in the immature protein of the IFN ⁇ -7 gene, corresponding to the amino acid sequence SEQ ID NO. 2, in lysine (K) and at position 121 of the mature protein.
  • R121K and R144K the mutation encoded by this SNP according to whether one refers respectively to the mature protein or to the immature protein.
  • the SNP al294c causes a mutation of the amino acid lysine (K) at position 182 in the immature protein of the IFN ⁇ -7 gene, corresponding to the amino acid sequence SEQ ID NO. 2, in glutamine (Q) and at position 159 of the mature protein.
  • K amino acid lysine
  • Q glutamine
  • the SNPs gl033a (D95N), tl l66c (F139S), gl l ⁇ la (R144K), al294c (K182Q), cause modifications of the spatial conformation of the polypeptides in conformity with the invention compared to the polypeptide encoded by the nucleotide sequence of the wild-type reference IFN ⁇ -7 gene.
  • the mutated protein possesses a three-dimensional conformation different from the natural wild-type IFN ⁇ -7 protein.
  • the mutation D72N also causes the loss of the negative charge carried by the aspartic acid.
  • the mutation of the aspartic acid residue of position 72 into an asparagine residue, in the vicinity of the IFN ⁇ -7 part that binds to its receptor, must alter the protein function.
  • computational molecular modeling predicts that the presence of the asparagine at position 72 involves a significant modification of the structure and of the function of the natural wild-type IFN ⁇ -7 protein. In particular, it is likely that this mutation changes the affinity of the IFN ⁇ -7 protein to its receptor.
  • the most important effect of the F116S mutation is a weakening of the pi- staking effect caused by the network of phenylalanines in the inside of the IFN ⁇ -7 structure, which probably causes a higher flexibility in the protein structure.
  • the mutated protein possesses a three-dimensional conformation different from the natural wild-type IFN ⁇ -7 protein.
  • R121 residue of IFN ⁇ -2 may be important for the antiviral activity of interferons (Weber H, Valenzuela D, Lujber G, Gubler M, Weissmann C; "Single amino acid changes that render human IFN alpha 2 biologically active on mouse cells”. (1987) EMBO . 6 : 591-598.).
  • the mutated protein possesses a three-dimensional conformation different from the natural wild-type IFN ⁇ -7 protein.
  • computational molecular modeling predicts that the presence of the lysine at position 121 involves a significant modification of the structure and of the function of the natural wild-type IFN ⁇ -7 protein.
  • Computational molecular modeling shows that the K159Q mutation on the mature mutated protein causes a disturbance in the loop located after helix E, which effect probably continues till the C-terminal end of the protein.
  • the loop located just before helix B is also modified at the level of the Q149 residue.
  • lysine (K) at position 159 may affect the antiviral activity of the interferons C-terminal part (Chang NT, Kung HF, Pestka S.; "Synthesis of a human leukocyte interferon with a modified carboxy terminus in Escherichia coli.” Arch. Biochem. Biophys. (1983) 221 : 585-589).
  • the mutated protein possesses a three-dimensional conformation different from the natural wild-type IFN ⁇ -7 protein.
  • SNPs in conformity with the invention namely: a559c, g580a, c667t, c682t, gl l25a, gl l61a, and al212g, do not involve modification of the protein encoded by the nucleotide sequence of the IFN ⁇ -7 gene at the level of the amino acid sequence SEQ ID NO. 2.
  • the SNPs gl l25a, gl l ⁇ la, al212g, are silent and the SNPs a559c, g580a, c667t, c682t, are non-coding.
  • the silent SNP gl 125a does not modify the amino acid glutamine (Q) at position 125 on the amino acid sequence SEQ ID NO. 2.
  • the silent SNP gll ⁇ la does not modify the amino acid glutamic acid (E) at position 137 on the amino acid sequence SEQ ID NO. 2.
  • the silent SNP al212g does not modify the amino acid leucine (L) at position 154 on the amino acid sequence SEQ ID NO. 2.
  • Genotyping of the polynucleotides in conformity with the invention can be carried out in such a fashion as to determine the allelic frequency of these polynucleotides in a population. Examples of genotyping are given, hereinafter, in the experimental section. The determination of the functionality of the polypeptides of the invention can equally be carried out by a test of their biological activity.
  • the invention also has for an object the use of polynucleotides and of polypeptides in conformity with the invention as well as of therapeutic molecules obtained and/or identified starting from these polynucleotides and polypeptides, notably for the prevention and the treatment of certain human disorders and/or diseases.
  • Figure 1A represents a model of the encoded protein according to the invention comprising the SNP D72N and the natural wild-type IFN ⁇ -7 protein.
  • Figure IB represents a close up of the model of the inferior part of each one of the proteins represented in Figure 1 A.
  • the black ribbon represents the structure of the natural wild-type IFN ⁇ -7 protein and the white ribbon represents the structure of the D72N mutated IFN ⁇ -7 protein.
  • Figure 2A represents a model of the encoded protein according to the invention comprising the SNP F116S and the natural wild-type IFN ⁇ -7 protein.
  • Figure 2B represents a close up of the model of the superior part of each of the proteins represented in Figure 2A.
  • the black ribbon represents the structure of the natural wild-type IFN ⁇ -7 protein and the white ribbon represents the structure of the F1 16S mutated IFN ⁇ - 7 protein.
  • Figure 3 A represents a model of the encoded protein according to the invention comprising the SNP R121K and the natural wild-type IFN ⁇ -7 protein.
  • Figure 3B represents a close up of the model of the central part of each of the proteins represented in Figure 3A.
  • the black ribbon represents the structure of the natural wild-type IFN ⁇ -7 protein and the white ribbon represents the structure of the R121K mutated IFN ⁇ -7 protein.
  • Figure 4A represents a model of the encoded protein according to the invention comprising the SNP K159Q and the natural wild-type IFN ⁇ -7 protein.
  • Figure 4B represents a close up of the model of the superior part of each of the proteins represented in Figure 4A.
  • the black ribbon represents the structure of the natural wild-type IFN ⁇ -7 protein and the white ribbon represents the structure of the K159Q mutated IFN ⁇ -7 protein.
  • Figure 5 represents the results of the test for measuring the antiproliferative effect of D72N mutated IFN ⁇ -7, on the TF-1 cell line.
  • the abscissas correspond to the concentration of IFN ⁇ (ng/mL) and the ordinates correspond to the inhibition of cell proliferation (%).
  • the antiproliferative effect of the D72N mutated IFN ⁇ -7 black diamonds
  • Figure 6 represents the survival rate of mice previously infected by VSV virus and treated with D72N mutated IFN ⁇ -7 protein, in comparison to those treated with wild-type IFN ⁇ -2, or those which have not been treated.
  • the abscissas correspond to the time of survival (days) and the ordinates correspond to the relative survival rate of VSV infected mice.
  • the black diamonds represent the data for VSV infected mice treated with D72N mutated IFN ⁇ -7.
  • the black squares represent the data for VSV infected mice treated with wild-type IFN ⁇ -2, and the open triangles represent the data for VSV infected mice which have not been treated.
  • Figure 7 represents the survival rate of mice previously inoculated with malignant Friend erythroleukemia cells (FLC) and treated with D72N mutated IFN ⁇ -7 protein, in comparison to those treated with wild-type IFN ⁇ -2, or those which have not been treated.
  • the abscissas correspond to the time of survival (days) and the ordinates correspond to the relative survival rate of FLC inoculated mice.
  • the black diamonds represent the data for FLC inoculated mice treated with D72N mutated IFN ⁇ - 7.
  • the black squares represent the data for FLC inoculated mice treated with wild-type IFN ⁇ -2, and the open triangles represent the data for FLC inoculated mice which have not been treated.
  • Nucleotide sequence of the reference wild-type gene is understood as the nucleotide sequence SEQ ID NO. 1 of the human IFN ⁇ -7 gene.
  • Natural wild-type IFN ⁇ -7 protein or wild-type IFN ⁇ -7 protein are understood as the mature protein encoded by the nucleotide sequence of the reference wild-type IFN ⁇ -7 gene.
  • the natural wild-type immature protein IFN ⁇ -7 corresponds to the peptide sequence shown in SEQ ID NO. 2.
  • Polynucleotide is understood as a polyribonucleotide or a polydeoxyribonucleotide that can be a modified or non-modified DNA or an RNA.
  • polynucleotide includes, for example, a single strand or double strand DNA, a DNA composed of a mixture of one or several single strand region(s) and of one or several double strand region(s), a single strand or double strand RNA and an RNA composed of a mixture of one or several single strand region(s) and of one or several double strand region(s).
  • polynucleotide can also include an RNA and/or a DNA including one or several triple strand regions.
  • Polypeptide is understood as a peptide, an oligopeptide, an oligomer or a protein comprising at least two amino acids joined to each other by a normal or modified peptide bond, such as in the cases of the isosteric peptides, for example.
  • a polypeptide can be composed of amino acids other than the 20 amino acids defined by the genetic code.
  • a polypeptide can equally be composed of amino acids modified by natural processes, such as post translational maturation processes or by chemical processes, which are well known to a person skilled in the art. Such modifications are fully detailed in the literature. These modifications can appear anywhere in the polypeptide: in the peptide skeleton, in the amino acid chain or even at the carboxy- or amino-terminal ends.
  • a polypeptide can be branched following an ubiquitination or be cyclic with or without branching. This type of modification can be the result of natural or synthetic post-translational processes that are well known to a person skilled in the art.
  • polypeptide modifications is understood to include acetylation, acylation, ADP-ribosylation, amidation, covalent fixation of flavine, covalent fixation of heme, covalent fixation of a nucleotide or of a nucleotide derivative, covalent fixation of a lipid or of a lipidic derivative, the covalent fixation of a phosphatidylinositol, covalent or non-covalent cross-linking, cyclization, disulfide bond formation, demethylation, cysteine formation, pyroglutamate formation, formylation, gam a-carboxylation, glycosylation, PEGylation, GPI anchor formation, hydroxylation, iodization, methylation, myristoylation, oxidation, proteolytic processes, phosphorylation, prenylation, racemization, seneloylation, sulfatation, amino acid addition such as arginylation or ubiquitination.
  • isolated polynucleotide or isolated polypeptide are understood as a polynucleotide or a polypeptide respectively such as previously defined which is isolated from the human body or otherwise produced by a technical process.
  • a polynucleotide having, for example, an identity of at least 95 % with the nucleotide sequence SEQ ID NO. 1 is a polynucleotide which contains at most 5 points of mutation over 100 nucleotides, compared to said sequence.
  • These points of mutation can be one (or several) substitution(s), addition(s) and/or deletion(s) of one (or several) nucleotide(s).
  • a polypeptide having, for example, an identity of at least 95 % with the amino acid sequence SEQ ID NO. 2 is a polypeptide that contains at most 5 points of mutation over 100 amino acids, compared to said sequence. These points of mutation can be one (or several) substitution(s), addition(s) and/or deletion(s) of one (or several) amino acid(s).
  • polypeptides and the polypeptides according to the invention which are not totally identical with respectively the nucleotide sequence SEQ ID NO. 1 or the amino acid sequence SEQ ID NO. 2, it being understood that these sequences contains at least one of the SNPs of the invention, are considered as variants of these sequences.
  • a polynucleotide according to the invention possesses the same or practically the same biological activity as the nucleotide sequence SEQ ID NO. 1 comprising at least one of the SNPs of the invention.
  • a polypeptide according to the invention possesses the same or practically the same biological activity as the amino acid sequence SEQ ID NO. 2 comprising at least one of the coding SNPs of the invention.
  • a variant, according to the invention can be obtained, for example, by site- directed mutagenesis or by direct synthesis.
  • SNP is understood any natural variation of a base in a nucleotide sequence.
  • a SNP, on a nucleotide sequence, can be coding, silent or non-coding.
  • a coding SNP is a polymorphism included in the coding sequence of a nucleotide sequence that involves a modification of an amino acid in the sequence of amino acids encoded by this nucleotide sequence.
  • SNP applies equally, by extension, to a mutation in an amino acid sequence.
  • a silent SNP is a polymorphism included in the coding sequence of a nucleotide sequence that does not involve a modification of an amino acid in the amino acid sequence encoded by this nucleotide sequence.
  • a non-coding SNP is a polymorphism included in the non-coding sequence of a nucleotide sequence. This polymorphism can notably be found in an intron, a splicing zone, a transcription promoter or a site enhancer sequence.
  • a SNP such as previously defined, which is included in a nucleotide sequence or an amino acid sequence, having a functionality.
  • functionality is understood the. biological activity of a polypeptide or of a polynucleotide.
  • the functionality of a polypeptide or of a polynucleotide according to the invention can consist in a conservation, an augmentation, a reduction or a suppression of the biological activity of the polypeptide encoded by the nucleotide sequence of the wild-type reference gene or of this latter nucleotide sequence.
  • polypeptide or of a polynucleotide according to the invention can equally consist in a change in the nature of the biological activity of the polypeptide encoded by the nucleotide sequence of the reference wild-type gene or of this latter nucleotide sequence.
  • the biological activity can, notably, be linked to the affinity or to the absence of affinity of a polypeptide according to the invention with a receptor.
  • the present invention has for its first object an isolated polynucleotide comprising: a) a nucleotide sequence having at least 80 % identity, preferably at least 90 % identity, more preferably at least 95 % identity and still more preferably at least 99 % identity with the sequence SEQ ID NO.
  • nucleotide 1 or its coding sequence (from nucleotide 751 to nucleotide 1320), it being understood that this nucleotide sequence comprises at least one of the following coding SNPs t779c, gl033a, cl084a, gl l35t, tl l66c, gl l81a, al294c, or b) a nucleotide sequence complementary to a nucleotide sequence under a).
  • the present invention relates equally to an isolated polynucleotide comprising: a) a nucleotide sequence SEQ ID NO. 1 or its coding sequence, it being understood that each of these sequences comprises at least one of the following coding SNPs: t779c, gl033a, cl084a, gl 135t, tl 166c, gl 181a, al294c; or b) a nucleotide sequence complementary to a nucleotide sequence under a).
  • the polynucleotide of the invention consists of the sequence SEQ ID NO. 1 or its coding sequence, it being understood that each of these sequences comprises at least one of the following coding SNPs: t779c, gl033a, cl084a, gl l35t, tl 166c, gl l ⁇ la, al294c.
  • the polynucleotide previously defined comprises a single coding SNP selected from the group consisting of: t779c, gl033a, cl084a, gl l35t, tl l66c, gl l ⁇ la, and al294c.
  • the polynucleotide previously defined comprises the coding SNP gl033a.
  • a polynucleotide such as previously defined can equally include at least one of the following non-coding and silent SNPs: a559c, g580a, c667t, c682t, gl 125a, gl 161a, and al212g.
  • the present invention equally has for its object an isolated polynucleotide comprising or consisting of: a) a nucleotide sequence SEQ ID NO. 1 or if necessary its coding sequence, it being understood that each of these sequences comprises at least one of the following non coding or silent SNPs: a559c, g580a, c667t, c682t, gl l25a, gl l ⁇ la, and al212g; or b) a nucleotide sequence complementary to a nucleotide sequence under a).
  • the present invention also concerns an isolated polynucleotide consisting of a part of: a) a nucleotide sequence SEQ ID NO. 1 or its coding sequence, it being understood that each of these sequences comprises at least one of the following SNPs: a559c, g580a, c667t, c682t, t779c, gl033a, cl084a, gl l25a, gl l35t, gl l ⁇ la, tl l66c, gl l81a, al212g, and al294c, or b) a nucleotide sequence complementary to a nucleotide sequence under a).
  • said isolated polynucleotide being composed of at least 10 nucleotides.
  • the isolated polynucleotide as defined above is composed of 10 to 40 nucleotides.
  • the present invention also concerns an isolated polynucleotide comprising: a) all or part of the nucleotide sequence SEQ ID NO. 1, provided that such nucleotide sequence, or part of sequence, comprises at least one SNP selected from the group consisting of a559c, g580a, c667t, c682t, t779c, gl033a, cl084a, gl l25a, gl l35t, gl 161a, tl 166c, gl 181a, and al212g; or b) a nucleotide sequence complementary to a nucleotide sequence under a).
  • the isolated polynucleotide as defined above is composed of at least 10 nucleotides, and preferably from 10 to 40 nucleotides.
  • the polynucleotide previously defined comprises a single coding SNP selected from the group consisting of: t779c, gl033a, cl084a, gl 135t, tl 166c, gl 181a, and al294c.
  • the polynucleotide previously defined comprises the coding SNP gl 033 a.
  • the present invention also has for its object an isolated polynucleotide coding for a polypeptide comprising all or part of: a) the amino acid sequence SEQ ID NO. 2; or b) the amino acid sequence comprising the amino acids included between positions 24 and 189 in the sequence of amino acids SEQ ID NO. 2; it being understood that said polypeptide has an amino acid sequence comprising at least one of the following coding SNPs: VIOA, D95N, LI 121, V129L, F139S, R144K, and 182Q.
  • the previously defined polypeptide comprises a single coding SNP such as defined above.
  • an isolated polynucleotide according to the invention codes for a polypeptide comprising all or part of the amino acid sequence SEQ ID NO. 2 and having the coding SNP D95N.
  • a polynucleotide according to the invention is composed of a DNA or RNA molecule.
  • a polynucleotide according to the invention can be obtained by standard DNA or RNA synthetic methods.
  • a polynucleotide according to the invention can equally be obtained by site- directed mutagenesis starting from the nucleotide sequence of the IFN ⁇ -7 gene by modifying the wild-type nucleotide by the mutated nucleotide for each SNP on the nucleotide sequence SEQ ID NO. 1.
  • a polynucleotide according to the invention comprising SNP g 1033a can be obtained by site-directed mutagenesis starting from the nucleotide sequence of the IFN ⁇ -7 gene by modifying the nucleotide guanine by the nucleotide adenine at position 1033 on the nucleotide sequence SEQ ID NO. 1.
  • An isolated polynucleotide can equally include, for example, nucleotide sequences coding for pre-, pro- or pre-pro -protein amino acid sequences or marker amino acid sequences, such as hexa-histidine peptide.
  • a polynucleotide of the invention can equally be associated with nucleotide sequences coding for other proteins or protein fragments in order to obtain fusion proteins or other purification products.
  • a polynucleotide according to the invention can equally include nucleotide sequences such as the 5' and/or 3' non-coding sequences, such as, for example, transcribed or non-transcribed sequences, translated or non-translated sequences, splicing signal sequences, polyadenylated sequences, ribosome binding sequences or even sequences which stabilize mRNA.
  • nucleotide sequences such as the 5' and/or 3' non-coding sequences, such as, for example, transcribed or non-transcribed sequences, translated or non-translated sequences, splicing signal sequences, polyadenylated sequences, ribosome binding sequences or even sequences which stabilize mRNA.
  • a nucleotide sequence complementary to the nucleotide or polynucleotide sequence is defined as one that can hybridize with this nucleotide sequence, under stringent conditions.
  • “Stringent hybridization conditions” is generally but not necessarily understood as the chemical conditions that permit a hybridization when the nucleotide sequences have an identity of at least 80 %, preferably greater than or equal to 90 %, still more preferably greater than or equal to 95 % and most preferably greater than or equal to 97 %.
  • nucleotide sequence when the stringent hybridization conditions permit hybridization of the nucleotide sequences having an identity equal to 100 %, the nucleotide sequence is considered to be strictly complementary to the nucleotide sequence such as described under a).
  • nucleotide sequence complementary to a nucleotide sequence comprises at least one anti-sense SNP according to the invention.
  • nucleotide sequence comprises the SNP g 1033 a
  • its complementary nucleotide sequence comprises the nucleotide thymine (t) at the equivalent of position 1033.
  • the present invention also has for its object the use of all or part of: a) a polynucleotide having 80 to 100 % identity (preferably at least 90 % identity, more preferably 95 % identity and particularly 100 % identity) with the nucleotide sequence SEQ ID NO.
  • a polynucleotide according to the invention comprising at least one SNP in order to identify, hybridize and/or amplify all or part of a polynucleotide having 80 to 100 % identity (preferably at least 90 % identity, more preferably 95 % identity and particularly 100 % identity) with the nucleotide sequence SEQ ID NO.
  • each one of these sequences comprises at least one of the following SNPs: a559c, g580a, c667t, c682t, t779c, gl033a, cl084a, gl l25a, gl l35t, gl l61a, tl l66c, gl l81a, al212g, and al294c.
  • the present invention also concerns a method for identifying or amplifying all or part of a polynucleotide having 80 to 100% identity with nucleotide sequence SEQ ID NO. 1 comprising hybridizing, under appropriate hybridization conditions, said polynucleotide with the polynucleotide according to the invention.
  • the present invention equally has for its object the use of all or part of: a) a polynucleotide having 80 to 100 % identity (preferably at least 90 % identity, more preferably 95 % identity and particularly 100 % identity) with the nucleotide sequence SEQ ID NO. 1, and/or b) a polynucleotide according to the invention comprising at least one SNP for the genotyping of all or part of a polynucleotide having 80 to 100 % identity (preferably at least 90 % identity, more preferably 95 % identity and particularly 100 % identity) with the nucleotide sequence SEQ ID NO.
  • each one of these sequences comprises at least one of the following SNPs: a559c, g580a, c667t, c682t, t779c, gl033a, cl084a, gl l25a, gl l35t, gl 161a, tl 166c, gl l ⁇ la, al212g, and al294c.
  • the present invention also concerns a method for genotyping all or part of a polynucleotide having 80 to 100% identity with nucleotide sequence SEQ ID NO. 1 comprising the steps of amplifying a region of interest in the genomic DNA of a subject or a population of subjects, and determining the allele of at least one position in the nucleotide sequence SEQ ID NO. 1 chosen from the group consisting of 559, 580, 667, 682, 779, 1033, 1084, 1125, 1135, 1161, 1166, 1181, and 1212.
  • the genotyping may be carried out on an individual or a population of individuals.
  • genotyping is defined as a process for the determination of the genotype of an individual or of a population of individuals.
  • Genotype consists of the alleles present at one or more specific loci.
  • Population of individuals is understood as a group of individuals selected in random or non-random fashion. These individuals can be humans, animals, microorganisms or plants.
  • the group of individuals comprises at least 10 individuals, preferably from 100 to 300 individuals.
  • the individuals can be selected according to their ethnicity or according to their phenotype, notably those who are affected by the following disorders and/or diseases: carcinomas, melanomas, lymphomas, leukemias and cancers of the liver, neck, head and kidneys, cardiovascular diseases, metabolic diseases such as those that are not connected with the immune system like, for example, obesity, infectious diseases in particular viral infections like hepatitis B and C and AIDS, pneumonias, ulcerative colitis, diseases of the central nervous system like, for example, Alzheimer's disease, schizophrenia and depression, the rejection of tissue or organ grafts, healing of wounds, anemia in dialyzed patients, allergies, asthma, multiple sclerosis, osteoporosis, psoriasis, rheumatoid arthritis, Crohn's disease, autoimmune diseases and disorders, gastrointestinal disorders or even disorders connected with chemotherapy treatments.
  • disorders and/or diseases notably those who are affected by the following disorders and/or diseases: carcinomas, melanomas, lymphomas, leukemias and
  • a functional SNP according to the invention is preferably genotyped in a population of individuals.
  • Genotyping can notably be carried out by minisequencing with hot ddNTPs (2 different ddNTPs labeled by different fluorophores) and cold ddNTPs (2 different non labeled ddNTPs), in connection with a polarized fluorescence scanner.
  • the minisequencing protocol with reading of polarized fluorescence FP-TDI Technology or Fluorescence Polarization Template-direct Dye-Terminator Incorporation
  • FP-TDI Technology or Fluorescence Polarization Template-direct Dye-Terminator Incorporation is well known to a person skilled in the art.
  • PCR polymerase chain reaction
  • the sense and antisense primers can easily be selected by a person skilled in the art according to the position of the SNPs of the invention.
  • the sense and antisense nucleotide sequences corresponding to the primers used for the PCR amplification of a nucleotide sequence comprising the IFN ⁇ -7 coding sequence can be, respectively:
  • SEQ ID NO. 3 Sense primer: TACCCACCTCAGGTAGCC
  • SEQ ID NO. 4 Antisense primer: CATGAAAGTGTGAGATGATGC
  • nucleotide sequences permit amplification of a fragment having a length of 669 nucleotides, from nucleotide 711 to nucleotide 1379 in the nucleotide sequence SEQ ID NO. 1.
  • a statistical analysis of the frequency of each allele (allelic frequency) encoded by the gene comprising the SNP in the population of individuals is then achieved, which permits determination of the importance of their impact and their distribution in the different sub-groups and notably, if necessary, the diverse ethnic groups that constitute this population of individuals.
  • the genotyping data are analyzed in order to estimate the distribution frequency of the different alleles observed in the studied populations.
  • the calculations of the allelic frequencies can be carried out with the help of software such as SAS-suite® (SAS) or SPLUS® (MathSoft).
  • SAS-suite® SAS
  • SPLUS® SPLUS®
  • the comparison of the allelic distributions of a SNP of the invention across different ethnic groups of the population of individuals can be carried out by means of the software ARLEQUIN® and SAS-suite®.
  • SNPs of the invention as genetic markers.
  • SNPs modifying functional sequences of genes are likely to be directly related to disease susceptibility or resistance
  • all SNPs may provide valuable markers for the identification of one or several genes involved in these disease states and, consequently, may be indirectly related to these disease states (See Cargill et al. (1999). Nature Genetics 22:231-238; Riley et al. (2000). Pharmacogenomics 1 :39-47; Roberts L. (2000). Science 287: 1898-1899).
  • the present invention also concerns a databank comprising at least one of the following SNPs: a559c, g580a, c667t, c682t, t779c, gl033a, cl084a, gl l25a, gl l35t, gl l ⁇ la, tl l ⁇ c, gl l ⁇ la, al212g, and al294c, in a polynucleotide of the IFN ⁇ - 7 gene.
  • SNPs are numbered in accordance with the nucleotide sequence SEQ ID NO. 1.
  • This databank may be analyzed for determining statistically relevant associations between:
  • the present invention also concerns the use of at least one of the following SNPs: a559c, g580a, c667t, c682t, t779c, gl033a, cl084a, gl l25a, gl l35t, gl l61a, tl l66c, gl l ⁇ la, al212g, and al294c, in a polynucleotide of the IFN ⁇ -7 gene, for developing diagnostic/prognostic kits for a disease or a resistance to a disease.
  • a SNP of the invention such as defined above may be directly or indirectly associated to a disease or a resistance to a disease.
  • these diseases may be those which are defined as mentioned hereinafter.
  • the present invention concerns also a method for determining statistically relevant associations between at least one SNP selected from the group consisting of a559c, g5 ⁇ 0a, c667t, c682t, t779c, gl033a, cl084a, gl l25a, gl l35t, gl l ⁇ la, tl l ⁇ c, gl l ⁇ la, al212g, and al294c, in the IFND-7 gene, and a disease or resistance to disease comprising: a) Genotyping a group of individuals; b) Determining the distribution of said disease or resistance to disease within said group of individuals; c) Comparing the genotype data with the distribution of said disease or resistance to disease; and d) Analyzing said comparison for statistically relevant associations.
  • the present invention equally concerns a method for diagnosing or determining a prognosis of a disease or a resistance to a disease comprising detecting at least one SNP selected from the group consisting of a559c, g580a, c667t, c6 ⁇ 2t, t779c, gl033a, cl084a, gl l25a, gl l35t, gl l ⁇ la, tl l ⁇ c, gl l ⁇ la, al212g, and al294c, in the IFND-7 gene.
  • Detection of the SNPs of the invention may be carried out by methods well known to a person skilled in the art such as those described below.
  • the detection of at least one SNP of the invention may be carried out starting from biological samples from the subject to be studied, such as cells, blood, urine, saliva, or starting from a biopsy or an autopsy of the subject to be studied.
  • the genomic DNA may be used for the detection directly or after a PCR amplification, for example.
  • RNA or cDNA can equally be used in a similar fashion.
  • nucleotide sequence of the polynucleotide isolated from the subject with the nucleotide sequence of a polynucleotide comprising at least one SNP of the invention.
  • the comparison of the nucleotide sequences can be carried out by sequencing, by DNA hybridization methods, by mobility difference of the DNA fragments on an electrophoresis gel with or without denaturing agents or by melting temperature difference. See Myers et al., Science (1985) 230: 1242. Such modifications in the structure of the nucleotide sequence at a precise point can equally be revealed by nuclease protection tests, such as RNase and the SI nuclease or also by chemical cleaving agents. See Cotton et al, Proc. Nat. Acad. Sci. USA (1985) 85: 4397-4401. A combination of DNA hybridization methods and enzymatic digestion may also be used as in the Invader assay. Oligonucleotide probes comprising a polynucleotide fragment of the invention can equally be used to conduct the screening. Expression vector and host cells.
  • the present invention also has for its object a recombinant vector comprising at least one polynucleotide according to the invention.
  • chromosomes chromosomes
  • episomes derived viruses
  • the recombinant vectors used can be derived from bacterial plasmids, transposons, yeast episomes, insertion elements, yeast chromosome elements, viruses such as baculovirus, papilloma viruses such as SV40, vaccinia viruses, adenoviruses, fox pox viruses, pseudorabies viruses, retroviruses.
  • recombinant vectors can equally be cosmid or phagemid derivatives.
  • the nucleotide sequence can be inserted in the recombinant expression vector by methods well known to a person skilled in the art such as, for example, those that are described in MOLECULAR CLONING: A LABORATORY MANUAL, Sambrook et al, 4th Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001.
  • the recombinant vector can include nucleotide sequences that control the regulation of the polynucleotide expression as well as nucleotide sequences permitting the expression and the transcription of a polynucleotide of the invention and the translation of a polypeptide of the invention, these sequences being selected according to the host cells that are used.
  • an appropriate secretion signal can be integrated in the recombinant vector so that the polypeptide, encoded by the polynucleotide of the invention, will be directed towards the lumen of the endoplasmic reticulum, towards the periplasmic space, on the membrane or towards the extracellular environment.
  • the present invention also has for its object a host cell comprising a recombinant vector according to the invention.
  • the introduction of the recombinant vector in a host cell can be carried out according to methods that are well known to a person skilled in the art such as those described in BASIC METHODS IN MOLECULAR BIOLOGY, Davis et al, 2nd ed., McGraw-Hill Professional Publishing, 1995, and MOLECULAR CLONING: A LABORATORY MANUAL, supra, such as transfection by calcium phosphate, transfection by DEAE dextran, transfection, microinjection, transfection by cationic lipids, electroporation, transduction or infection.
  • the host cell can be, for example, bacterial cells such as cells of streptococci, staphylococci, E. coli or Bacillus subtilis, cells of fungi such as yeast cells and cells of Aspergillus, Streptomyces, insect cells such as cells of Drosophila S2 and of Spodoptera Sf9, animal cells, such as CHO, COS, HeLa, C127, BHK, HEK 293 cells and human cells of the subject to treat or even plant cells.
  • bacterial cells such as cells of streptococci, staphylococci, E. coli or Bacillus subtilis
  • cells of fungi such as yeast cells and cells of Aspergillus, Streptomyces
  • insect cells such as cells of Drosophila S2 and of Spodoptera Sf9
  • animal cells such as CHO, COS, HeLa, C127, BHK, HEK 293 cells and human cells of the subject to treat or even plant cells.
  • the host cells can be used, for example, to express a polypeptide of the invention or as active product in pharmaceutical compositions, as will be seen hereinafter.
  • the present invention also has for its object an isolated polypeptide comprising an amino acid sequence having at least 80 % identity, preferably at least 90 % identity, more preferably at least 95 % identity and still more preferably at least 99 % identity with all or part of: a) the amino acid sequence SEQ ID NO. 2, or b) the amino acid sequence comprising the amino acids included between positions 24 and 189 of the amino acid sequence SEQ ID NO. 2, it being understood that said polypeptide contains at least one of the following coding SNPs: V10A, D95N, LI 121, V129L, F139S, R144K, K182Q.
  • the polypeptide of the invention can equally comprise all or part of: a) the amino acid sequence SEQ ID NO.
  • polypeptide contains at least one of the following coding SNPs: V10A, D95N, LI 121, V129L, F139S, R144K, K182Q.
  • the polypeptide of the invention can more particularly consist of all or part of: a) the amino acid sequence SEQ ID NO. 2, or b) the amino acid sequence containing the amino acids included between positions 24 and 189 of the amino acid sequence SEQ ID NO. 2, it being understood that said polypeptide contains at least one of the following coding SNPs: VIOA, D95N, LI 121, V129L, F139S, R144K, K182Q.
  • a polypeptide according to the invention contains a single coding SNP selected from the group consisting of: VIOA, D95N, LI 121, V129L, F139S, R144K, K182Q.
  • the polypeptide according to the invention comprises amino acids 24 through 189 of the amino acid sequence SEQ ID NO. 2, and has the coding SNP D95N.
  • the present invention equally has for its object a process for the preparation of the above-described polypeptide, in which a previously defined host cell is cultivated in a culture medium and said polypeptide is isolated from the culture medium.
  • the polypeptide can be purified starting from the host cells' culture medium, according to methods well known to a person skilled in the art such as precipitation with the help of chaotropic agents such as salts, in particular ammonium sulfate, ethanol, acetone or trichloroacetic acid, acid extraction; ion exchange chromatography; phosphocellulose chromatography; hydrophobic interaction chromatography; affinity chromatography; hydroxyapatite chromatography or exclusion chromatographies.
  • chaotropic agents such as salts, in particular ammonium sulfate, ethanol, acetone or trichloroacetic acid, acid extraction; ion exchange chromatography; phosphocellulose chromatography; hydrophobic interaction chromatography; affinity chromatography; hydroxyapatite chromatography or exclusion chromatographies.
  • Culture medium is understood as the medium in which the polypeptide of the invention is isolated or purified. This medium can be composed of the extracellular medium and/or the cellular lysate. Techniques well known to a person skilled in the art equally permit the latter to give back an active conformation to the polypeptide, if the conformation of said polypeptide was altered during the isolation or the purification.
  • the present invention also has for its object a process for obtaining an immunospecific antibody.
  • Antibody is understood as the monoclonal, polyclonal, chimeric, simple chain, humanized antibodies as well as the Fab fragments, including Fab or immunoglobulin expression library products.
  • An immunospecific antibody can be obtained by immunization of an animal with a polypeptide according to the invention.
  • the invention also relates to an immunospecific antibody for a polypeptide according to the invention, such as defined previously.
  • a polypeptide according to the invention one of its fragments, an analog, one of its variants or a cell expressing this polypeptide can also be used to produce immunospecific antibodies.
  • immunospecific means that the antibody possesses a better affinity for the polypeptide of the invention than for other polypeptides known in the prior art.
  • the immunospecific antibodies can be obtained by administration of a polypeptide of the invention, of one of its fragments, of an analog or of an epitopic fragment or of a cell expressing this polynucleotide in a mammal, preferably non human, according to methods well known to a person skilled in the art.
  • Transgenic animals such as mice, for example, can equally be used to produce humanized antibodies.
  • the present invention equally has for its object a method for identifying an agent among one or more compounds to be tested which activates or inhibits the activity of a polypeptide according to the invention, comprising: a) providing host cells comprising a recombinant vector comprising a polynucleotide according to the invention containing at least one coding SNP; b) contacting said host cells with said compounds to be tested, c) determining the activating or inhibiting effect upon the activity of said polypeptide whereby said activating or inhibiting agent is identified.
  • a polypeptide according to the invention can also be employed for a method for screening compounds that interact with it.
  • These compounds can be activating (agonists) or inhibiting (antagonists) agents of intrinsic activity of a polypeptide according to the invention.
  • These compounds can equally be ligands or substrates of a polypeptide of the invention. See Coligan et al., Current Protocols in Immunology 1 (2), Chapter 5 (1991).
  • Such cells can be, for example, cells of mammals, yeasts, insects such as Drosophila or bacteria such as E. coli.
  • the binding capacity of the compounds to be tested with the polypeptide of the invention can then be observed, as well as the inhibition or the activation of the functional response.
  • Step c) of the above method can be implemented by using an agent to be tested that is directly or indirectly labeled. It can also include a competition test, by using a labeled or non-labeled agent and a labeled competitor agent.
  • an agent to be tested generates an activation or inhibition signal on cells expressing the polypeptide of the invention by using detection means appropriately chosen according to the signal to be detected.
  • Such activating or inhibiting agents can be polynucleotides, and in certain cases oligonucleotides or polypeptides, such as proteins or antibodies, for example.
  • the present invention also has for its object a method for identifying an agent among one or more compounds to be tested whose activity is potentiated or inhibited by a polypeptide according to the invention, comprising: a) providing host cells comprising a recombinant vector comprising a polynucleotide according to the invention containing at least one coding SNP; b) contacting said host cells with said compounds to be tested, c) determining the potentiating or inhibiting effect upon the activity of said agent whereby said potentiated or inhibited agent is identified.
  • An agent potentiated or inhibited by the polypeptide of the invention is an agent that responds, respectively, by an activation or an inhibition in the presence of this polypeptide.
  • the agents, potentiated or inhibited directly or indirectly by the polypeptide of the invention can consist of polypeptides such as, for example, membranal or nuclear receptors, kinases and more preferably tyrosine kinases, transcription factor or polynucleotides.
  • the present invention also has for object a method for analyzing the biological characteristics of a polynucleotide according to the invention and/or of a polypeptide according to the invention in a subject, comprising at least one of the following: a) Determining the presence or the absence of a polynucleotide according to the invention in the genome of a subject; b) Determining the level of expression of a polynucleotide according to the invention in a subject; c) Determining the presence or the absence of a polypeptide according to the invention in a subject; d) Determining the concentration of a polypeptide according to the invention in a subject; and/or e) Determining the functionality of a polypeptide according to the invention in a subject.
  • These biological characteristics may be analyzed in a subject or in a sample from a subject.
  • These biological characteristics may permit to carry out a genetic diagnosis and to determine whether a subject is affected or at risk of being affected or, to the contrary, presents a partial resistance to the development of a disease, an indisposition or a disorder linked to the presence of a polynucleotide according to the invention and/or a polypeptide according to the invention.
  • diseases can be disorders and/or human diseases, such as cancers and tumors, infectious diseases, venereal diseases, immunologically related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, and disorders connected with chemotherapy treatments.
  • Said cancers and tumors include carcinomas comprising metastasizing renal carcinomas, melanomas, lymphomas comprising follicular lymphomas and cutaneous T cell lymphoma, leukemias comprising hairy-cell leukemia, chronic lymphocytic leukemia and chronic myeloid leukemia, cancers of the liver, neck, head and kidneys, multiple myelomas, carcinoid tumors and tumors that appear following an immune deficiency comprising Kaposi's sarcoma in the case of AIDS.
  • Said infectious diseases include viral infections comprising chronic hepatitis B and C and HIV/AIDS, infectious pneumonias, and venereal diseases, such as genital warts.
  • Said immunologically and auto-immunologically related diseases may include the rejection of tissue or organ grafts, allergies, asthma, psoriasis, rheumatoid arthritis, multiple sclerosis, Crohn's disease and ulcerative colitis.
  • Said metabolic diseases may include such non-immune associated diseases as obesity.
  • Said diseases of the central nervous system may include Alzheimer's disease, Parkinson's disease, schizophrenia and depression.
  • Said diseases and disorders may also include healing of wounds, anemia in dialyzed patient, and osteoporosis.
  • This method also permits genetic diagnosis of a disease or of a resistance to a disease linked to the presence, in a subject, of the mutant allele encoded by a SNP according to the invention.
  • step a) the presence or absence of a polynucleotide, containing at least one coding SNP such as previously defined, is going to be detected.
  • the detection of the polynucleotide may be carried out starting from biological samples from the subject to be studied, such as cells, blood, urine, saliva, or starting from a biopsy or an autopsy of the subject to be studied.
  • the genomic DNA may be used for the detection directly or after a PCR amplification, for example.
  • RNA or cDNA can equally be used in a similar fashion.
  • nucleotide sequence of a polynucleotide according to the invention is then possible to compare the nucleotide sequence of a polynucleotide according to the invention with the nucleotide sequence detected in the genome of the subject.
  • the comparison of the nucleotide sequences can be carried out by sequencing, by DNA hybridization methods, by mobility difference of the DNA fragments on an electrophoresis gel with or without denaturing agents or by melting temperature difference. See Myers et al., Science (1985) 230: 1242. Such modifications in the structure of the nucleotide sequence at a precise point can equally be revealed by nuclease protection tests, such as RNase and the SI nuclease or also by chemical cleaving agents. See Cotton et al., Proc. Nat. Acad. Sci. USA (1985) 85: 4397-4401. Oligonucleotide probes comprising a polynucleotide fragment of the invention can equally be used to conduct the screening.
  • the level of expression of the polynucleotide may be measured by quantifying the level of RNA encoded by this polynucleotide (and coding for a polypeptide) according to methods well known to a person skilled in the art as, for example, by PCR, RT-PCR, RNase protection, Northern blot, and other hybridization methods.
  • step c) and d) the presence or the absence as well as the concentration of a polypeptide according to the invention in a subject or a sample from a subject may be carried out by well known methods such as, for example, by radioimmunoassay, competitive binding tests, Western blot and ELISA tests.
  • the determined concentration of the polypeptide according to the invention can be compared with the natural wild-type protein concentration usually found in a subject.
  • step e) the determination of the functionality of a polypeptide according to the invention may be carried out by methods well l ⁇ iown to a person skilled in the art as, for example, by in vitro tests such as above mentioned or by an use of host cells expressing said polypeptide.
  • the present invention also has as an object a diagnostic kit comprising one or more of: an isolated polynucleotide according to the invention ; a previously defined recombinant vector ; a previously defined host cell ; a polypeptide according to the invention ; a previously defined antibody.
  • the present invention also has for its object a therapeutic compound containing, by way of active agent, a polypeptide according to the invention.
  • the invention also relates to the use of a polypeptide according to the invention, for the manufacture of a therapeutic compound intended for the prevention or the treatment of different human disorders and/or diseases.
  • diseases can be disorders and/or human diseases, such as cancers and tumors, infectious diseases, venereal diseases, immunologically related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, and disorders connected with chemotherapy treatments.
  • Said cancers and tumors include carcinomas comprising metastasizing renal carcinomas, melanomas, lymphomas comprising follicular lymphomas and cutaneous T cell lymphoma, leukemias comprising hairy-cell leukemia, chronic lymphocytic leukemia and chronic myeloid leukemia, cancers of the liver, neck, head and kidneys, multiple myelomas, carcinoid tumors and tumors that appear following an immune deficiency comprising Kaposi's sarcoma in the case of AIDS.
  • Said infectious diseases include viral infections comprising chronic hepatitis B and C and HIV/AIDS, infectious pneumonias, and venereal diseases, such as genital warts.
  • Said immunologically and auto-immunologically related diseases may include the rejection of tissue or organ grafts, allergies, asthma, psoriasis, rheumatoid arthritis, multiple sclerosis, Crohn's disease and ulcerative colitis.
  • Said metabolic diseases may include such non-immune associated diseases as obesity.
  • Said diseases of the central nervous system may include Alzheimer's disease, Parkinson's disease, schizophrenia and depression.
  • Said diseases and disorders may also include healing of wounds, anemia in dialyzed patient, and osteoporosis.
  • a polypeptide according to the invention can also be used for the manufacture of a therapeutic compound intended for the prevention or the treatment of different human disorders and/or diseases, such as certain viral infections such as chronic hepatitis B and C, leulcemias such as hairy-cell leukemia and chronic myeloid leulcemia, multiple myelomas, follicular lymphomas, carcinoid tumors, malignant melanomas, metastasizing renal carcinomas, Alzheimer's disease, Parkinson's disease, as well as tumors that appear following an immune deficiency, such as Kaposi's sarcoma in the case of AIDS, and genital warts or venereal diseases.
  • certain viral infections such as chronic hepatitis B and C
  • leulcemias such as hairy-cell leukemia and chronic myeloid leulcemia, multiple myelomas, follicular lymphomas, carcinoid tumors, malignant melanomas, metastasizing renal carcinomas, Alzheimer's disease,
  • Certain of the compounds permitting to obtain the polypeptide according to the invention as well as the compounds obtained or identified by or from this polypeptide can likewise be used for the therapeutic treatment of the human body, i.e. as a therapeutic compound.
  • the present invention also has for an object a medicament containing, by way of active agent, a polynucleotide according to the invention containing at least one previously defined coding SNP, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody.
  • the invention also relates to the use of a polynucleotide according to the invention containing at least one previously defined coding SNP, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody for the manufacture of a medicament intended for the prevention or the treatment of different human disorders and/or diseases.
  • diseases can be disorders and/or human diseases, such as cancers and tumors, infectious diseases, venereal diseases, immunologically related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, and disorders connected with chemotherapy treatments.
  • Said cancers and tumors include carcinomas comprising metastasizing renal carcinomas, melanomas, lymphomas comprising follicular lymphomas and cutaneous T cell lymphoma, leukemias comprising hairy-cell leukemia, chronic lymphocytic leukemia and chronic myeloid leulcemia, cancers of the liver, neck, head and kidneys, multiple myelomas, carcinoid tumors and tumors that appear following an immune deficiency comprising Kaposi's sarcoma in the case of AIDS.
  • Said infectious diseases include viral infections comprising chronic hepatitis B and C and HIV/AIDS, infectious pneumonias, and venereal diseases, such as genital warts.
  • Said immunologically and auto-immunologically related diseases may include the rejection of tissue or organ grafts, allergies, asthma, psoriasis, rheumatoid arthritis, multiple sclerosis, Crohn's disease and ulcerative colitis.
  • Said metabolic diseases may include such non-immune associated diseases as obesity.
  • Said diseases of the central nervous system may include Alzheimer's disease, Parkinson's disease, schizophrenia and depression.
  • Said diseases and disorders may also include healing of wounds, anemia in dialyzed patient, and osteoporosis.
  • the invention concerns the use of a polynucleotide according to the invention containing at least one previously defined SNP, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody, for the manufacture of a medicament intended for the prevention or the treatment of different human disorders and/or diseases, such as certain viral infections such as chronic hepatitis B and C, leulcemias such as hairy-cell leulcemia and chronic myeloid leulcemia, multiple myelomas, follicular lymphomas, carcinoid tumors, malignant melanomas, metastasizing renal carcinomas, Alzheimer's disease, Parkinson's disease, as well as tumors that appear following an immune deficiency, such as Kaposi's sarcoma in the case of AIDS, and genital warts or venereal diseases.
  • the dosage of a polypeptide and of the other compounds of the invention, useful as active agent depends on the choice of the compound, the therapeutic indication, the mode of administration
  • a polypeptide according to the invention is generally administered at doses ranging between 1 and 100 ⁇ g/kg of the subject.
  • the invention also has as an object a pharmaceutical composition that contains, as active agent, at least one above-mentioned compound such as a polypeptide according to the invention, a polynucleotide according to the invention containing at least one previously defined SNP, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody, as well as a pharmaceutically acceptable excipient.
  • a pharmaceutical composition that contains, as active agent, at least one above-mentioned compound such as a polypeptide according to the invention, a polynucleotide according to the invention containing at least one previously defined SNP, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody, as well as a pharmaceutically acceptable excipient.
  • the active agent is advantageously present at physiologically effective doses.
  • compositions can be, for example, solids or liquids and be present in pharmaceutical forms currently used in human medicine such as, for example, simple or coated tablets, gelcaps, granules, caramels, suppositories and preferably injectable preparations and powders for injectabies.
  • pharmaceutical forms can be prepared according to usual methods.
  • the active agent(s) can be incorporated into excipients usually employed in pharmaceutical compositions such as talc, Arabic gum, lactose, starch, dextrose, glycerol, ethanol, magnesium stearate, cocoa butter, aqueous or non-aqueous vehicles, fatty substances of animal or vegetable origin, paraffmic derivatives, glycols, various wetting agents, dispersants or emulsifiers, preservatives.
  • excipients usually employed in pharmaceutical compositions such as talc, Arabic gum, lactose, starch, dextrose, glycerol, ethanol, magnesium stearate, cocoa butter, aqueous or non-aqueous vehicles, fatty substances of animal or vegetable origin, paraffmic derivatives, glycols, various wetting agents, dispersants or emulsifiers, preservatives.
  • the active agent(s) according to the invention can be employed alone or in combination with other compounds such as therapeutic compounds such as other cytokines such as interleukins or interferons, for example.
  • the different formulations of the pharmaceutical compositions are adapted according to the mode of administration.
  • the pharmaceutical compositions can be administered by different routes of administration known to a person skilled in the art.
  • the present invention also concerns a method for preventing or treating in an individual a disease selected from the group consisting of cancers and tumors, infectious diseases, immunologically and auto-immunologically related diseases, cardiovascular diseases, metabolic diseases, central nervous system diseases, and disorders connected with chemotherapy treatments, comprising administering to said individual a therapeutically effective amount of the previously defined agent, plus a pharmaceutically acceptable excipient.
  • the invention equally has for an object a diagnostic composition that contains, as active agent, at least one above-mentioned compound such as a polypeptide according to the invention, a polynucleotide according to the invention, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody, as well as a suitable pharmaceutically acceptable excipient.
  • a diagnostic composition that contains, as active agent, at least one above-mentioned compound such as a polypeptide according to the invention, a polynucleotide according to the invention, a previously defined recombinant vector, a previously defined host cell, and/or a previously defined antibody, as well as a suitable pharmaceutically acceptable excipient.
  • This diagnostic composition may contain, for example, an appropriate excipient like those generally used in the diagnostic composition such as buffers and preservatives.
  • the present invention equally has as an object the use: a) of a therapeutically effective quantity of a polypeptide according to the invention, and/or b) of a polynucleotide according to the invention, and/or c) of a host cell from the subject to be treated, previously defined, to prepare a therapeutic compound intended to increase the expression or the activity, in a subject, of a polypeptide according to the invention.
  • this polynucleotide can be inserted in a retroviral expression vector.
  • a retroviral expression vector can be isolated starting from cells having been infected by a retroviral plasmid vector containing RNA encoding for the polypeptide of the invention, in such a fashion that the transduced cells produce infectious viral particles containing the gene of interest. See Gene Therapy and other Molecular Genetic-based Therapeutic Approaches, Chapter 20, in Human Molecular Genetics, Strachan and Read, BIOS Scientifics Publishers Ltd (1996).
  • a polynucleotide containing at least one coding SNP such as previously defined will be preferably used.
  • the present invention equally relates to the use: a) of a therapeutically effective quantity of a previously defined immunospecific antibody, and/or b) of a polynucleotide permitting inhibition of the expression of a polynucleotide according to the invention, in order to prepare a therapeutic compound intended to reduce the expression or the activity, in a subject, of a polypeptide according to the invention.
  • a complementary polynucleotide containing at least one coding SNP such as previously defined can be used.
  • the present invention also concerns a method for increasing or decreasing the activity in a subject of the polypeptide according to the invention comprising administering a therapeutically effective quantity of one or more of: an isolated polynucleotide comprising all or part of the nucleotide sequence SEQ ID NO.
  • nucleotide sequence comprises at least one SNP selected from the group consisting of a559c, g580a, c667t, c682t, t779c, gl033a, cl084a, gl l25a, gl l35t, gll ⁇ la, tl l ⁇ c, gl l ⁇ la, al212g and al294c, or a nucleotide sequence complementary to said nucleotide sequence; a recombinant vector comprising said polynucleotide; a host cell comprising said recombinant vector, wherein said host cell may be obtained from said subject to be treated; an isolated polypeptide comprising all or part of amino acid sequence SEQ ID NO.
  • coding SNP selected from the group consisting of VIOA, D95N, LI 121, V129L, F139S, R144K and Kl ⁇ 2Q; an antibody specific for said polypeptide; and a pharmaceutically acceptable excipient.
  • the present invention concerns also the use of a IFN ⁇ -7 protein for the preparation of a medicament for the prevention or the treatment of an individual having a disorder or a disease caused by a IFN ⁇ -7 variant linked to the presence in the genome of said individual of a nucleotide sequence having at least 95% identity (preferably, 97% identity, more preferably 99% identity and particularly 100% identity) with the nucleotide sequence SEQ ID NO.
  • nucleotide sequence comprises one of the following SNPs: a559c, g580a, c667t, c682t, t779c, gl033a, cl084a, gl 125a, gl l35t, gl 161a, tl 166c, gl l ⁇ la, al212g, and al294c.
  • said medicament is used for the prevention or the treatment of one of the diseases selected from the group consisting of cancers and tumors, infectious diseases, venereal diseases, immunologically related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, and disorders connected with chemotherapy treatments.
  • diseases selected from the group consisting of cancers and tumors, infectious diseases, venereal diseases, immunologically related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, and disorders connected with chemotherapy treatments.
  • Said cancers and tumors include carcinomas comprising metastasizing renal carcinomas, melanomas, lymphomas comprising follicular lymphomas and cutaneous T cell lymphoma, leulcemias comprising hairy-cell leulcemia, chronic lymphocytic leulcemia and chronic myeloid leulcemia, cancers of the liver, neck, head and kidneys, multiple myelomas, carcinoid tumors and tumors that appear following an immune deficiency comprising Kaposi's sarcoma in the case of AIDS.
  • Said infectious diseases include viral infections comprising chronic hepatitis B and C and HIV/AIDS, infectious pneumonias, and venereal diseases, such as genital warts.
  • Said immunologically and auto-immunologically related diseases may include the rejection of tissue or organ grafts, allergies, asthma, psoriasis, rheumatoid arthritis, multiple sclerosis, Crohn's disease and ulcerative colitis.
  • Said metabolic diseases may include such non-immune associated diseases as obesity.
  • Said diseases of the central nervous system may include Alzheimer's disease, Parkinson's disease, schizophrenia and depression.
  • Said diseases and disorders may also include healing of wounds, anemia in dialyzed patient, and osteoporosis.
  • the present invention concerns also a method for preventing or treating in an individual a disorder or a disease linked to the presence in the genome of said individual of a polynucleotide according to the invention, comprising administering a therapeutically effective amount of one or more of: an isolated polynucleotide comprising all or part of the nucleotide sequence SEQ ID NO.
  • coding SNP selected from the group consisting of VIOA, D95N, LI 121, V129L, F139S, R144K and Kl ⁇ 2Q; an antibody specific for said polypeptide; and a pharmaceutically acceptable excipient.
  • Mimetic compounds of an IFN ⁇ -7 polypeptide comprising the SNP D95N of the invention are Mimetic compounds of an IFN ⁇ -7 polypeptide comprising the SNP D95N of the invention.
  • the present invention also concerns a new compound having a biological activity substantially similar to that of the polypeptide of: a) amino acid sequence SEQ ID NO. 2, or b) amino acid sequence comprising the amino acids included between positions 24 and 189 of the amino acid sequence SEQ ID NO. 2, provided that said amino acid sequences under a) and b) comprise the SNP D95N.
  • Said biological activity may be evaluated, for example, by measuring signal transduction, dendritic cell maturation, cytokine release by CD4+ or CD8+ T- lymphocytes, cytokine release by monocytes, in vitro or in vivo antiviral activity, anti- tumoral activity in mice previously inoculated with malignant Friend erythroleukemia cells, cellular antiproliferative activity on Daudi Burkitt's cell line, cellular antiproliferative activity on TF-1 cell line, as described in the experimental section.
  • the D95N mutated IFN ⁇ -7 shows: a weak capacity to stimulate dendritic cell maturation a high capacity to stimulate cytokine release (IFN gamma and IL- 10) by CD4+ T-lymphocytes and CD8+ T-lymphocytes preactivated by SEB antigen a capacity to stimulate cytokine (IL-10, IL-12, and TNF- ⁇ ) release by monocytes a capacity to inhibit Daudi cell proliferation a weak antiproliferative activity on TF-1 cells an antiviral activity in vitro in cell culture infected with VSV a high antiviral activity in vivo in mice infected with EMCV an anti-tumoral activity in FLC-inoculated mice
  • the D95N mutated IFN ⁇ -7 protein in comparison to wild-type IFN ⁇ -2, possesses: a similar capacity to activate signal transduction a lower capacity to stimulate dendritic cell maturation a higher capacity to stimulate IFN gamma release by CD4+ T-lymphocytes and CD8+ T-lymphocytes preactivated by SEB antigen a higher capacity to stimulate IL-10 and TNF- ⁇ release by monocytes a similar antiproliferative activity on TF-1 cells a lower antiviral activity in vitro in cell culture infected with VSV a higher antiviral activity in vivo in mice infected with EMCV a slightly lower anti-tumoral activity in FLC-inoculated mice
  • the D95N mutated IFN ⁇ -7 protein in comparison to wild-type IFN ⁇ -7, the D95N mutated IFN ⁇ -7 protein possesses:
  • a new compound of the invention may possess a biological activity substantially similar to that of the D95N mutated IFN ⁇ -7.
  • Said compound may also have a biological activity, such as IFN-gamma release by T-lymphocytes, IL-10 and TNF- ⁇ release by monocytes, in vivo antiviral activity in mice infected with EMCV, and/or an anti-tumoral activity in FLC-inoculated mice, which is even higher than that of the D95N mutated IFN ⁇ -7.
  • a biological activity such as IFN-gamma release by T-lymphocytes, IL-10 and TNF- ⁇ release by monocytes, in vivo antiviral activity in mice infected with EMCV, and/or an anti-tumoral activity in FLC-inoculated mice, which is even higher than that of the D95N mutated IFN ⁇ -7.
  • Said compound may also have a biological activity, such as dendritic cell maturation, which is even lower than that of the D95N mutated IFN ⁇ -7.
  • Said compound may be a biochemical compound, such as a polypeptide or a peptide for example, or an organic chemical compound, such as a synthetic peptide- mimetic for example.
  • the present invention also concerns the use of a polypeptide of the invention containing the D95N SNP, for the identification of a compound such as defined above.
  • the present invention also concerns a method for the identification of a compound of the invention, comprising the following steps: a) Determining the biological activity of the compound to be tested, such as signal transduction, dendritic cell maturation, cytokine release by CD4+ or CD8+ T- lymphocytes, cytokine release by monocytes, in vitro or in vivo antiviral activity, anti-tumoral activity in mice previously inoculated with malignant Friend erythroleukemia cells, cellular antiproliferative activity on Daudi Burkitt's cell line, cellular antiproliferative activity on TF-1 cell line, for example; b) Comparing: i) the activity determined in step a) of the compound to be tested, with ii) the activity of the polypeptide of amino acid sequence SEQ ID NO.
  • step b) Determining on the basis of the comparison carried out in step b) whether the compound to be tested has a substantially similar, or lower or higher, activity compared to that of the polypeptide of amino acid sequence SEQ ID NO. 2, or of amino acid sequence comprising the amino acids included between positions 24 and 189 of the amino acid sequence SEQ ID NO. 2; provided that said amino acid sequences comprise the D95N SNP.
  • the compound to be tested may be previously identified from synthetic peptide combinatorial libraries, high-throughput screening, or designed by computer-aided drug design so as to have the same three-dimensional structure as that of the polypeptide of amino acid sequence SEQ ID NO. 2, or of amino acid sequence comprising the amino acids included between positions 24 and 189 of the amino acid sequence SEQ ID NO. 2; provided that said amino acid sequences comprise the D95N SNP.
  • the compounds of the invention may be used for the preparation of a medicament intended for the prevention or the treatment of one of the diseases selected from the group consisting of cancers and tumors, infectious diseases, venereal diseases, immunologically related diseases and/or autoimmune diseases and disorders, cardiovascular diseases, metabolic diseases, central nervous system diseases, and disorders connected with chemotherapy treatments.
  • Said cancers and tumors include carcinomas comprising metastasizing renal carcinomas, melanomas, lymphomas comprising follicular lymphomas and cutaneous T cell lymphoma, leulcemias comprising hairy-cell leulcemia, chronic lymphocytic leukemia and chronic myeloid leukemia, cancers of the liver, neck, head and kidneys, multiple myelomas, carcinoid tumors and tumors that appear following an immune deficiency comprising Kaposi's sarcoma in the case of AIDS.
  • Said infectious diseases include viral infections comprising chronic hepatitis B and C and HIV/AIDS, infectious pneumonias, and venereal diseases, such as genital warts.
  • Said immunologically and auto-immunologically related diseases may include the rejection of tissue or organ grafts, allergies, asthma, psoriasis, rheumatoid arthritis, multiple sclerosis, Crohn's disease and ulcerative colitis.
  • Said metabolic diseases may include such non-immune associated diseases as obesity.
  • Said diseases of the central nervous system may include Alzheimer's disease, Parkinson's disease, schizophrenia and depression.
  • Said diseases and disorders may also include healing of wounds, anemia in dialyzed patient, and osteoporosis.
  • the compounds of the invention may be used for the preparation of a medicament intended for the prevention or the treatment of one of the diseases selected from the group consisting of certain viral infections such as chronic hepatitis B and C, leukemias such as hairy-cell leulcemia and chronic myeloid leukemia, multiple myelomas, follicular lymphomas, carcinoid tumors, malignant melanomas, metastasizing renal carcinomas, Alzheimer's disease, Parkinson's disease, as well as tumors that appear following an immune deficiency, such as Kaposi's sarcoma in the case of AIDS, and genital warts or venereal diseases.
  • certain viral infections such as chronic hepatitis B and C
  • leukemias such as hairy-cell leulcemia and chronic myeloid leukemia
  • multiple myelomas multiple myelomas
  • follicular lymphomas carcinoid tumors
  • malignant melanomas malignant melanomas
  • Example 1 Modeling of a protein encoded by a polynucleotide of nucleotide sequence containing SNP g!033a, tl l66c gl l ⁇ la, or a!294c, and of the protein encoded by the nucleotide sequence of the wild-type reference gene
  • IFN ⁇ -7 In a first step the three-dimensional structure of IFN ⁇ -7 was constructed starting from that of IFN ⁇ -2 whose structure is available in the PDB database (code IITF) and by using the software Modeler (MSI, San Diego, CA).
  • the mature polypeptide fragment was then modified in such a fashion as to reproduce the mutation D72N, FI 16S, R121K,or K159Q.
  • Example 2 Genotyping of the SNPs t779c. g!033a. c!084a. gl l35t. tl l ⁇ c. gl l ⁇ la or a!294c in a population of individuals
  • the genotyping of SNPs is based on the principle of the minisequencing wherein the product is detected by a reading of polarized fluorescence.
  • the technique consists of a fluorescent minisequencing (FP-TDI Technology or Fluorescence Polarization Template-direct Dye-terminator Incorporation).
  • the minisequencing is performed on a product amplified by PCR from genomic DNA of each individual of the population.
  • This PCR product is chosen in such a manner that it covers the genie region containing the SNP to be genotyped. After elimination of the PCR primers that have not been used and the dNTPs that have not been incorporated, the minisequencing is carried out.
  • the minisequencing consists of lengthening an oligonucleotide primer, placed just upstream of the site of the SNP, by using a polymerase enzyme and fluorolabeled dideoxynucleotides.
  • the product resulting from this lengthening process is directly analyzed by a reading of polarized fluorescence.
  • the genotyping steps 1 and 2 are carried out in the same conditions for each of the SNPs t779c, gl033a, cl084a, gl l35t, tl l66c, gl l81a and al294c.
  • the steps 3, 4 and 5 are specific to each one of these polymorphisms.
  • the PCR amplification of the nucleotide sequence of the IFN ⁇ -7 gene is carried out starting from genomic DNA coming from 268 individuals of ethnically diverse origins.
  • the 268 individuals are distributed as follows:
  • the genomic DNA coming from each one of these individuals constitutes a sample.
  • the PCR amplification is carried out starting from the following primers:
  • SEQ ID NO. 3 Sense primer: TACCCACCTCAGGTAGCC
  • SEQ ID NO. 4 Antisense primer: CATGAAAGTGTGAGATGATGC
  • nucleotide sequences permit amplification of a fragment having a length of 669 nucleotides, from nucleotide 711 to nucleotide 1379 in the nucleotide sequence
  • the PCR product will serve as a template for the minisequencing
  • the total reaction volume of the PCR reaction is 5 ⁇ l per sample.
  • This reaction volume is composed of the reagents indicated in the following table:
  • PCR Cycles 1 min at 94° C, followed by 36 cycles composed of 3 steps (15 sec. at 94° C, 30 sec. at 56° C, 1 min at 68° C).
  • the PCR amplified product is then purified using two enzymes: Shrimp Alkaline Phosphatase (SAP) and exonuclease I (Exo I).
  • SAP Shrimp Alkaline Phosphatase
  • Exo I exonuclease I
  • the first of these enzymes permits the dephosphorylation of the dNTPs which have not been incorporated during the PCR amplification, whereas the second eliminates the single stranded DNA residues, in particular the primers which have not been used during the PCR.
  • This digestion is done by addition, in each well of the PCR plate, of a reaction mixture of 5 ⁇ l per sample.
  • This reaction mixture is composed of the following reagents:
  • the plate is sealed, centrifuged, then placed in a thermocycler for 384 well plates (Tetrad of MJ Research) and undergoes the following incubation: Digestion SAP-EXO: 45 min at 37° C, 15 min at 80° C.
  • the elongation or minisequencing step is then carried out on the product of PCR digested by addition of a reaction mixture of 5 ⁇ l per prepared sample.
  • the minisequencing 3) and the reading steps 4) and interpretation of reading 5) are specific to each of the SNPs t779c, gl033a, cl084a, gl l35t, tl l ⁇ c, gl l ⁇ la and al294c.
  • the sequences of the minisequencing primers necessary for the genotyping were determined in a way to correspond to the sequence of the nucleotides located upstream of the site of a SNP according to the invention.
  • the PCR product that contains the SNP being a double stranded DNA product, the genotyping can therefore be done either on the sense strand or on the antisense strand.
  • the selected primers are manufactured by Life Technologies Inc.
  • the minisequencing of the SNPs was first validated over 16 samples, then genotyped over the set of the population of individuals composed of 268 individuals and 10 controls.
  • the elongation or minisequencing step is then carried out as indicated in the following table:
  • ddNTPs a mixture of the 4 bases is carried out according to the polymorphism studied. Only the 2 bases of interest (wild-type nucleotide/mutated nucleotide) composing the functional SNP are labeled, either in Tamra, or in R110.
  • the mixture of ddNTPs is composed of:
  • the plate is sealed, centrifuged, then placed in a thermocycler for 384-well plates (Tetrad of MJ Research) and undergoes the following incubation: Elongation cycles: 1 min. at 93° C, followed by 35 cycles composed of 2 steps (10 sec. at 93° C, 30 sec. at 55° C).
  • the plate is directly placed on a polarized fluorescence reader of type Analyst® HT of LJL Biosystems Inc.
  • the plate is read //using Criterion Host® software by using two methods. The first permits reading the Tamra labeled base by using emission and excitation filters specific for this fluorophore (excitation 550-10 nm, emission 580-10 nm) and the second permits reading the R110 labeled base by using the excitation and emission filters specific for this fluorophore (excitation 490-10 nm, emission 520-10 nm).
  • a dichroic double mirror Rl 10/Tamra
  • the other reading parameters are: Z-height: 1.5 mm Attenuator: out
  • MP 1000(// - g ⁇ )/(// + g ⁇ ).
  • the value _L is weighted by a factor g. It is a machine parameter that must be determined experimentally beforehand.
  • mP values are reported on a graph using Microsoft Inc. Excel software, and/or Allele Caller® software developed by LJL Biosystems Inc.
  • the mP value of the Tamra labeled base On the abscissa is indicated the mP value of the Tamra labeled base, on the ordinate is indicated the mP value of the R110 labeled base.
  • a strong mP value indicates that the base labeled with this fluorophore is incorporated and, conversely, a weak mP value reveals the absence of incorporation of this base.
  • Allele Caller® software permits, once the identification of the different groups is carried out, to directly extract the genotype defined for each individual in table form.
  • the allele c read in antisense corresponds to the allele g read in sense, and is related to the presence of an aspartic acid (D) at position 95 of the immature IFN ⁇ -7 protein sequence and therefore that the allele t read in antisense corresponds to the allele a read in sense corresponding to an asparagine (N) for this position in the sequence of the corresponding protein.
  • D aspartic acid
  • N asparagine
  • the genotype is in theory either homozygote TT, or heterozygote TC, or homozygote CC in the tested individuals. In reality, and as shown below, the homozygote genotype CC is not detected in the population of individuals.
  • the genotype is in theory either homozygote GG, or heterozygote GA, or homozygote AA in the tested individuals. In reality, and as shown below, the homozygote genotype AA is not detected in the population of individuals.
  • the genotype is in theory either homozygote GG, or heterozygote GT, or homozygote TT in the tested individuals. In reality, and as shown below, the homozygote genotype TT is not detected in the population of individuals.
  • the genotype is in theory either homozygote CC, or heterozygote CA, or homozygote AA in the tested individuals. In reality, and as shown below, the homozygote genotype A A is not detected in the population of individuals.
  • the genotype is in theory either homozygote TT, or heterozygote TC, or homozygote CC in the tested individuals. In reality, and as shown below, the homozygote genotype CC is not detected in the population of individuals.
  • the genotype is in theory either homozygote GG, or heterozygote GA, or homozygote A A in the tested individuals. In reality, and as shown below, the homozygote genotype AA is not detected in the population of individuals.
  • the genotype is in theory either homozygote AA, or heterozygote AC, or homozygote CC in the tested individuals. In reality, and as shown below, the homozygote genotype CC is not detected in the population of individuals.
  • - % represents the percentage of individuals in the specific sub-population
  • allelic frequency represents the percentage of the mutated allele in the specific sub-population
  • IC represents the minimal and maximal interval of confidence at 95 %.
  • nucleotide sequences coding for the mature part of the natural wild-type IFN ⁇ -7, D72N mutated IFN ⁇ -7, V106L mutated IFN ⁇ -7, or K159Q mutated IFN ⁇ -7 are amplified by PCR using as template genomic DNA from an individual who is heterozygote for one of said SNPs.
  • the PCR primers permitting such an amplification are: SEQ ID NO. 19: Sense primer: TGTGATCTGCCTCAGACCCAC SEQ ID NO. 20: Antisense primer: TCAATCCTTCCTCCTTAATCCTTTTT
  • the PCR products are inserted in the eukaryote expression vector pPicZ ⁇ - TOPO under the control of the hybrid promoter AOX1 inducible by methanol TO?0 1M -cloning; Invitrogen Corp.).
  • This vector permits the heterologous expression of eukaryote proteins in the yeast Pichia pastoris.
  • the vector After checking of the nucleotide sequence of the region of the vector coding for the recombinant proteins, the vector is linearized by the Pmel restriction enzyme, and the P. pastoris yeast strain (Invitrogen) is transformed with these recombinant expression vectors.
  • Two saturated pre-cultures of 50 L of BMGY medium (2% Peptone, 1% yeast extract, 1.34% YNB, 1% Glycerol, 100 mM potassium phosphate, 0.4 mg/Liter biotin pH 6.0) containing a clone coding for natural wild-type IFN ⁇ -7, or that coding for D72N mutated IFN ⁇ -7, V106L mutated IFN ⁇ -7, or K159Q mutated IFN ⁇ -7, were carried out for 24-48 hours at 30°C at an agitation of 200 rotations per minute (rpm).
  • BMGY medium 2% Peptone, 1% yeast extract, 1.34% YNB, 1% Glycerol, 100 mM potassium phosphate, 0.4 mg/Liter biotin pH 6.0
  • the culture When the culture reaches a saturating cellular density (corresponding to an optical density of 12 measured at a wavelength of 600 nm), it is used to inoculate, at 5 OD/mL, 250 mL of BMMY medium (2% Peptone, 1% yeast extract, 1.34% YNB, 0.5% Methanol, 100 mM potassium phosphate, 0.4 mg/Liter biotin pH 6.0).
  • BMMY medium 2% Peptone, 1% yeast extract, 1.34% YNB, 0.5% Methanol, 100 mM potassium phosphate, 0.4 mg/Liter biotin pH 6.0.
  • the expression of the protein is then induced by methanol at a final concentration of 1%, for 24 hours at 30 °C, with an agitation of the culture flask at 180 rpm.
  • the proteins Due to the presence of the signal peptide sequence of the "alpha factor", upstream of the coding sequence, the proteins are secreted by the yeasts in the culture medium.
  • the alpha factor is naturally cleaved during the processing.
  • the suspension is centrifuged and the protein is purified by HPLC starting from the obtained supernatant.
  • an ultrafiltration (Labscale, cut-off 5000Da, Millipore) followed by a dialysis permits a ten times concentration of the yeast supernatant in a buffer of 50 mM Tris-Cl pH 9.0, 25 mM NaCl.
  • the first chromato graphic step permits protein recovery by affinity on a blue sepharose column (Amersham Pharmacia).
  • the presence of the protein in the collected fractions is verified, on the one hand by electrophoresis of SDS PAGE type and on the other hand by immuno-detection by a specific antibody directed against the IFN ⁇ -7 protein.
  • the purity of the protein of interest is higher than 75%.
  • a gel filtration permits buffer exchange of the collected fractions corresponding to IFN ⁇ -7 proteins against 50 mM Tris pH 9.0, 25 mM NaCl.
  • the last step of the purification consists of a separation of the proteins on an ion exchange chromatography column.
  • the fractions containing the recombinant protein are injected on an anion exchange column (ResourceQ 6.0 mL, Pharmacia) equilibrated beforehand in Tris 50 mM pH 9, NaCl 25 mM buffer.
  • the elution of the proteins is carried out by the migration of a gradient between 0,025 and 1 M NaCl in the Tris 50 mM pH 9 buffer.
  • the purification may be performed using blue cibacron.
  • the purity of the protein of interest is estimated on SDS/PAGE gel and the protein concentrations are measured by densitometry (Quantity one, Biorad) and BCA assay (bicinchoninic acid and copper sulfate, Sigma).
  • Purified natural wild-type IFN ⁇ -7, D72N mutated IFN ⁇ -7, V106L mutated IFN ⁇ -7, or K159Q mutated IFN -7 proteins obtained according to this protocol, eventually scaled-up to produce higher amount of proteins, are used for the functional tests described below.
  • the interferons are known to act through signaling pathways involving the JAK (Janus Kinase) and the STAT (Signal Transducers and Activators of Transcription) proteins.
  • JAK Janus Kinase
  • STAT Signal Transducers and Activators of Transcription
  • the binding of interferon to its receptor induces phosphorylation of the JAK proteins which in turn activate by phosphorylation the STAT proteins.
  • Activated STAT proteins translocate to the nucleus where they bind to interferon response elements on gene promoters, which stimulates transcription of the respective genes.
  • the reporter gene technique was used. The procedure is described below.
  • the use of a human cell line stably transfected with the luciferase reporter gene under the control of an interferon responsive chimeric promoter provides the basis for this in vitro assay.
  • the luciferase activity detected reflects the ability of the IFNs to induce a signal at the nuclear level.
  • the dose-response curves exhibited by D72N mutated IFN ⁇ -7, wild-type IFN ⁇ -7, and wild-type IFN ⁇ -2 are analyzed and the results are expressed in terms of international units referring to Intron A (commercial product corresponding to interferon alpha 2b) activity per mg of IFN ⁇ protein.
  • IFNs type I IFN alpha and IFN beta
  • DC dendritic cells
  • HLA- ABC MHC class I
  • HLA-DR HLA-DR
  • Immunomodulatory activity of D72N mutated IFN ⁇ -7 was first investigated on dendritic cells maturation and compared to that of wild-type IFN ⁇ -2 chosen as a representative of commercial Intron A product.
  • dendritic cells were first generated from adult peripheral blood monocytes cultivated in the presence of GM-CSF and IL-4 cytokines. After purification using a CD 14+ cells purification kit, these dendritic cells were placed in presence of 100 ng/mL of D72N mutated IFN ⁇ -7, or wild-type IFN ⁇ -2, and their phenotype was determined by FACS analysis aiming at looking for the expression of the MHC class I and II molecules and the CD40, CD ⁇ O, CD ⁇ , CD83 and CD la markers.
  • the maturation state of these dendritic cells has also been compared to that obtained without IFN ⁇ treatment to provide a control with non-stimulated dendritic cells and to that obtained with 1 ⁇ g/ml LPS or 2.5 ng/ml TNF ⁇ , which are l ⁇ iown to induce dendritic cell maturation.
  • D72N mutated IFN ⁇ -7 protein possesses a weak capacity to stimulate dendritic cell maturation.
  • the D72N mutated IFN ⁇ -7 protein shows an immunosuppressive activity.
  • Immunomodulatory activity of D72N mutated IFN ⁇ -7 was also investigated by measuring cytokine release by T lymphocytes placed in presence of the mutated IFN ⁇ -7 protein and with or without a strong antigen (SEB) in order to mimic an immune response against an aggression. This test was also performed in presence of wild-type IFN ⁇ -2 used as control and chosen as representative of the Intron A commercial product.
  • SEB strong antigen
  • peripheral blood mononuclear cells were isolated from healthy donors and stimulated for 16 hours in an appropriate medium containing anti-CD3 and anti-CD28 antibodies or SEB. In each culture was added 4 ⁇ g/mL of D72N mutated IFN ⁇ -7 or wild-type IFN ⁇ -2. After stimulation, T lymphocytes were extracellularly labelled with anti-CD3, anti-CD4 and anti-CD69 antibodies or anti-CD3, anti-CD ⁇ and anti-CD69 antibodies, and intracellularly labelled with specific antibodies directed against Thl-type cytokines (IFN-gamma) or Th2-type cytokines (IL-10). Fluorescent cells were analysed using FACScalibur and CellQuest software.
  • IFN-gamma Thl-type cytokines
  • IL-10 Th2-type cytokines
  • D72N mutated IFN ⁇ -7 and wild-type IFN ⁇ -2 do not stimulate IL-10 and IFN-gamma release and, thus, do not activate T lymphocytes in absence of SEB.
  • D72N mutated IFN ⁇ -7 and wild-type IFN ⁇ -2 proteins stimulate cytokines (IL-10 and IFN-gamma) release by SEB-activated T-lymphocytes as shown in the table below.
  • This table represents the cytokine release by T- lymphocytes in presence of SEB, expressed as percentage of the CD4+ CD69+ cells or CD8+ CD69+ cells for the CD4+ T-lymphocytes and CD8+ T-lymphocytes, respectively, and the percentage of CD69+ cells on total cells.
  • D72N mutated IFN ⁇ -7 has a high capacity to stimulate cytokine release (IFN gamma and IL-10) by CD4+ T-lymphocytes and CD ⁇ + T-lymphocytes previously activated by SEB antigen.
  • IFN gamma and IL-10 the interferon gamma production by CD4+ or CD8+ T-lymphocytes is higher in presence of D72N mutated IFN ⁇ -7 than in presence of wild-type IFN ⁇ -2.
  • PBMC peripheral blood mononuclear cells
  • Fluorescent cells were analyzed using FACScalibur and CellQuest software.
  • monocytes In contrast, in presence of LPS, monocytes release cytokines (IL-10, IL-12 and TNF- ⁇ ), this release being additionally increased in presence of D72N mutated IFN ⁇ -7 protein or wild-type IFN ⁇ -2 as shown in the table below.
  • This table represents cytokine release by monocytes in presence of LPS, expressed as percentage of the CD64+ CD4dim cells, and the percentage of CD4dim CD64+ cells on total cells.
  • D72N mutated IFN ⁇ -7 protein is able to stimulate cytokine release by monocytes.
  • stimulation of IL- 10 and TNF- ⁇ release by monocytes is higher in presence of D72N mutated IFN ⁇ -7 than in presence of wild-type IFN ⁇ -2.
  • Example 6 Evaluation of in vitro antiproliferative activity of D72N mutated IFN ⁇ -7 a) on the human lymphoblasts of Daudi Burkitt's cell line
  • IFN ⁇ -7 human Daudi Burkitt's lymphoma cell line, hereinafter called "Daudi cells”
  • Daudi cells human Daudi Burkitt's lymphoma cell line, hereinafter called "Daudi cells”
  • RPMI 1640 medium supplied with 10% fetal calf serum and 2 mM of L-Glutamine
  • 96-well plates at the cellular density of 4.10 4 cells/ well.
  • Daudi cells are placed in contact of increasing concentrations of either natural wild-type IFN ⁇ -7, D72N mutated IFN ⁇ -7, V106L mutated IFN ⁇ -7, or K159Q mutated IFN ⁇ -7 mutated IFN ⁇ -7, ranging from 0.003 pM to 600 nM.
  • the Daudi cells are then incubated for 66 h at 37 °C under 5%> CO 2 after which the Uptiblue reagent (Uptima) is added to the cultures.
  • the rate of cell proliferation is quantified by measuring the fluorescence emitted at 590nm (excitation 560nm) after an additional period of incubation of 4 hours.
  • the antiproliferative activity of the mutated IFN ⁇ -7 proteins or wild-type IFN ⁇ -7 is based on the measurements of the IC50 corresponding to the concentration of IFN ⁇ -7 inhibiting 50% of the cell growth.
  • the average IC50 values measured for each of the tested IFN ⁇ -7 proteins appear in the tables below, as well as the average ratio corresponding to the IC50 value measured with the mutant protein over the IC50 value measured with the wild-type protein.
  • the effect of D72N mutated IFN ⁇ -7 was also evaluated on TF-1 erythroleukemia cell line. This test was also performed in presence of wild-type IFN ⁇ -2 used as control and chosen as representative of the Intron A commercial product.
  • TF-1 cells were placed in contact of increasing concentrations of D72N mutated IFN ⁇ -7 or wild-type IFN ⁇ -2 (0.001 to 1000 ng/mL) and the cell proliferation measured.
  • D72N mutated IFN ⁇ -7 has a weak antiproliferative effect on TF-1 cells.
  • the antiproliferative effect of D72N mutated IFN ⁇ -7 on TF-1 erythroleukemia cells is similar to that of wild-type IFN ⁇ -2.
  • the IFNs play an important role in the antiviral defence.
  • the IFN antiviral activity is partly due to IFNs induced enzymatic systems, such as:
  • the 2' 5' oligoadenylate synthetase an enzyme which catalyzes the adenosine oligomere synthesis. These oligomeres activate the RNase L, an endoribonuclease which destroy the viral RNA once activated.
  • the Mx proteins (GTPases) which inhibit the synthesis and/or the maturation of viral transcripts. This activity is mainly exerted on the influenza virus.
  • the PKR protein (or p68 kinase) which is activated by the double-stranded RNA.
  • the activated PKR inhibits protein synthesis.
  • the IFNs antiviral activity is also induced by other mechanisms such as, in the case of retroviruses, the inhibition of viral particles entry into the cells, the replication, the binding, the exit of the particles and the infective power of viral particles.
  • the IFNs exert an indirect antiviral activity by modulating certain functions of the immune system, in particular by favoring the response to cellular mediation (including an increase of the MHC class I and II molecules, increase of IL-12 and IFN-gamma production, increase of the CTL activities, among others).
  • the antiviral activity of D72N mutated IFN ⁇ -7 has been evaluated both in vitro in cell culture and in vivo in mouse model. Both tests have been carried out in parallel with wild-type IFN ⁇ -2 used as control and chosen as representative of the Intron A commercial product.
  • This assay permits evaluation of the antiviral activity of D72N mutated IFN ⁇ -7 in cell culture using the vesicular stomatitis virus (VSV), and comparison with that of wild-type IFN ⁇ -2.
  • VSV vesicular stomatitis virus
  • WISH human epithelial cells were cultivated for 24 hours in the presence of decreasing concentrations of D72N mutated IFN ⁇ -7, or wild-type IFN ⁇ -2. Then, the cells were infected by the virus of vesicular stomatitis (VSV) during 24 to 4 ⁇ additional hours and cell lysis was measured.
  • VSV vesicular stomatitis
  • the antiviral activity of the different IFN ⁇ tested is determined by comparing the specific activity (IU/ ⁇ g) corresponding to the amount of IFN ⁇ -7 that inhibits 50% of cell lysis induced by the VSV.
  • the unit IU/ ⁇ g stands for international units referring to Intron A activity per ⁇ g of IFN ⁇ protein.
  • D72N mutated IFN ⁇ -7 protein possesses a weak antiviral activity in vitro in cell culture.
  • the D72N mutated IFN ⁇ -7 has a lower antiviral activity than the wild-type IFN ⁇ -2.
  • This test in vivo is performed in EMCV (Encephalomyocarditis virus) mouse model.
  • Human IFNs exhibit dose-dependent antiviral activity in the mouse which is in general 100 to 1,000 fold less than that exhibited by the same amount of mouse IFN (Meister et al. (1986). J. Gen. Virol. 67, 1633-1644).
  • mice Groups of 20 six- week old Swiss mice were infected intraperitoneally with 100 x LD50 EMCV and treated one hour later, and then once daily for 3 days thereafter with
  • Results are presented in Figure 6 and indicate that the relative survival rate of the mice which have been treated with D72N mutated IFN ⁇ -7 is much higher than the survival rate of the non-treated mice, demonstrating the antiviral activity of D72N mutated IFN ⁇ -7 in vivo in mouse model. Moreover, after 14 days, 45% of the mice treated with D72N mutated IFN ⁇ -7 are alive, while 30% of the mice treated with wild- type IFN ⁇ -2 are alive. Thus, the antiviral activity of D72N mutated IFN ⁇ -7 in vivo in mouse model is higher than that observed for the mice which have been treated with wild-type IFN ⁇ -2.
  • Example 8 Evaluation of the anti-tumoral activity of D72N mutated IFN ⁇ -7 in mice previously inoculated with malignant Friend erythroleukemia cells
  • IFN ⁇ have been shown to be as effective in protecting mice against the growth of a clone of Friend leulcemia cells resistant to the direct anti-proliferative activity of IFN ⁇ , as against IFN sensitive parental Friend leulcemia cells (Belardelli et al, Int. J. Cancer, 30, 813-820, 1982; Belardelli et al, Int. J. Cancer, 30, 821-825, 1982), reflecting the importance of indirect immune mediated mechanisms in the anti-tumoral activity of IFN ⁇ .
  • mice 12 six- week old DBA/2 mice were inoculated intraperitoneally with 100,000 IFN resistant Friend leulcemia cells (3Cl ⁇ ) (20,000 LD 50 ) and treated one hour later and then once daily for 21 days thereafter with 2.0 ⁇ g of the wild-type IFN ⁇ -2 or with 2.0 ⁇ g of D72N mutated IFN ⁇ -7 or an equivalent volume of excipient alone. The animals were then followed daily for survival and the primary efficacy analysis was the relative survival of each treatment group in comparison to its excipient only group.
  • IFN resistant Friend leulcemia cells 3Cl ⁇
  • 20,000 LD 50 20,000 LD 50
  • mice with D72N mutated IFN ⁇ -7 results in an increase in the number of mice surviving after inoculation with highly malignant Friend erythroleukemia cells (FLC).
  • FLC highly malignant Friend erythroleukemia cells
  • 34% of the mice treated with D72N mutated IFN ⁇ -7 are alive, while 50% of the mice treated with wild- type IFN ⁇ -2 are alive.
  • the survival rate of FLC inoculated mice is slightly lower after treatment with D72N mutated IFN ⁇ -7 than after treatment with wild-type IFN ⁇ -2.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Analytical Chemistry (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Biotechnology (AREA)
  • Urology & Nephrology (AREA)
  • Wood Science & Technology (AREA)
  • Rheumatology (AREA)
  • Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Diabetes (AREA)
EP02747458A 2001-06-11 2002-06-11 New polynucleotides and polypeptides of the ifnalpha-7 gene Withdrawn EP1395684A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
FR0107588 2001-06-11
FR0107588A FR2825716B1 (fr) 2001-06-11 2001-06-11 Nouveaux polynucleotides et polypeptides de l'ifn alpha 7
PCT/EP2002/007456 WO2002101048A2 (en) 2001-06-11 2002-06-11 NEW POLYNUCLEOTIDES AND POLYPEPTIDES OF THE IFNα-7 GENE

Publications (1)

Publication Number Publication Date
EP1395684A2 true EP1395684A2 (en) 2004-03-10

Family

ID=8864156

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02747458A Withdrawn EP1395684A2 (en) 2001-06-11 2002-06-11 New polynucleotides and polypeptides of the ifnalpha-7 gene

Country Status (6)

Country Link
US (1) US7399464B2 (cg-RX-API-DMAC7.html)
EP (1) EP1395684A2 (cg-RX-API-DMAC7.html)
JP (1) JP2005500029A (cg-RX-API-DMAC7.html)
AU (1) AU2002317867A1 (cg-RX-API-DMAC7.html)
FR (1) FR2825716B1 (cg-RX-API-DMAC7.html)
WO (1) WO2002101048A2 (cg-RX-API-DMAC7.html)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7087726B2 (en) 2001-02-22 2006-08-08 Genentech, Inc. Anti-interferon-α antibodies
FR2822845B1 (fr) * 2001-03-30 2003-12-12 Genodyssee Nouveaux polynucleotides comportant des polymorphismes de type snp fonctionnels dans la sequence nucleotidique du gene ifn-alpha-21 ainsi que de nouveaux polypeptides codes par ces polynucleotides et leurs utilisations therapeutiques
US7597884B2 (en) * 2004-08-09 2009-10-06 Alios Biopharma, Inc. Hyperglycosylated polypeptide variants and methods of use
CN113166261A (zh) 2018-10-11 2021-07-23 印希比股份有限公司 B7h3单域抗体及其治疗性组合物
JP7611820B2 (ja) 2018-10-11 2025-01-10 インヒブルクス バイオサイエンシズ インコーポレイテッド Dll3シングルドメイン抗体およびその治療用組成物
JP2022504802A (ja) 2018-10-11 2022-01-13 インヒブルクス インコーポレイテッド 5t4シングルドメイン抗体およびその治療組成物
CN120623346A (zh) 2018-10-11 2025-09-12 因荷布瑞克斯生物科学公司 Pd-1单结构域抗体及其治疗组合物

Family Cites Families (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CH651308A5 (de) 1980-07-01 1985-09-13 Hoffmann La Roche Interferone und deren herstellung.
ZA814375B (en) 1980-07-01 1982-07-28 Hoffmann La Roche Interferons and process for their preparation
JPH064673B2 (ja) 1980-11-10 1994-01-19 ゲネンテツク・インコ−ポレ−テツド ハイブリド型ヒト白血球インタフエロン
EP0072541A3 (en) 1981-08-14 1984-04-18 F. HOFFMANN-LA ROCHE & CO. Aktiengesellschaft Human leukocyte interferons, process for their microbial production, intermediates therefor and compositions containing them
US4801685A (en) * 1981-08-14 1989-01-31 Hoffmann-La Roche Inc. Microbial production of mature human leukocyte interferon K and L
US4810645A (en) 1981-08-14 1989-03-07 Hoffmann-La Roche Inc. Microbial production of mature human leukocyte interferon K and L
US4678751A (en) 1981-09-25 1987-07-07 Genentech, Inc. Hybrid human leukocyte interferons
GB2108510B (en) 1981-10-03 1984-12-12 Ciba Geigy Ag Dnas, recombinant dnas, hosts containing them, polypeptides and processes for the production thereof
US5098703A (en) 1982-01-15 1992-03-24 Cetus Corporation Interferon-alpha 76
WO1983002460A1 (en) 1982-01-15 1983-07-21 Cetus Corp Interferon-alpha 74
IE54592B1 (en) 1982-03-08 1989-12-06 Genentech Inc Anumal interferons, processes involved in their production, compositions containing them, dna sequences coding therefor and espression vehicles containing such sequences and cells transformed thereby
CA1217440A (en) 1982-08-18 1987-02-03 Michael A. Innis INTERFERON .alpha. 6L
IL71555A (en) 1984-04-15 1992-06-21 State Of Israel Israel Inst Fo Bovine interferon
SE8502430L (sv) 1985-05-15 1986-11-16 Kabivitrum Ab En cdna-molekyl som kodar for expressionen av en polypeptid av typen interferon alfa, en bakteriell eller celluler verd transformerad med en sadan molekyl och en polypeptid som uppvisar interferonaktivetet framstelld me
SU1703690A1 (ru) 1986-04-30 1992-01-07 Всесоюзный научно-исследовательский институт генетики и селекции промышленных микроорганизмов Рекомбинантна плазмидна ДНК @ 22, кодирующа синтез интерферона @ -11 человека, и штамм бактерии РSеUDомоNаS Sp. -продуцент- интерферона @ -11 человека
US5780021A (en) 1993-03-05 1998-07-14 Georgetown University Method for treating type 1 diabetes using α-interferon and/or β-i
CA2164811A1 (en) 1993-06-11 1994-12-22 Sidney Pestka Super proteins including interferons and interleukins
US6001589A (en) 1993-06-11 1999-12-14 Pbl Biomedical Laboratories, Inc. Method of identifying proteins modified by disease states related thereto
WO2000039280A2 (en) * 1998-12-31 2000-07-06 Viragen, Inc. Leukocyte-derived interferon preparations
US20040002474A1 (en) * 1999-10-07 2004-01-01 Maxygen Inc. IFN-alpha homologues
WO2001025438A2 (en) * 1999-10-07 2001-04-12 Maxygen, Inc. Ifn-alpha homologues
US7666995B2 (en) * 2000-11-03 2010-02-23 Pestka Biomedical Laboratories Interferons, uses and compositions related thereto
JPWO2002069913A1 (ja) 2001-03-01 2004-09-09 株式会社クリニカルコスメティック 皮膚改善用組成物セット

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO02101048A2 *

Also Published As

Publication number Publication date
FR2825716B1 (fr) 2004-09-24
JP2005500029A (ja) 2005-01-06
WO2002101048A3 (en) 2003-08-14
US7399464B2 (en) 2008-07-15
US20040126799A1 (en) 2004-07-01
AU2002317867A1 (en) 2002-12-23
WO2002101048A2 (en) 2002-12-19
FR2825716A1 (fr) 2002-12-13

Similar Documents

Publication Publication Date Title
US20080299081A1 (en) Polynucleotides and Polypeptides of the IFNalpha-21 Gene
US20090004156A1 (en) POLYNUCLEOTIDES AND POLYPEPTIDES OF THE IFNalpha17 GENE
EP1383927B1 (en) New polynucleotides and polypeptides of the erythropoietin gene
AU2002257777A1 (en) New polynucleotides and polypeptides of the IFN$G(A)-21 gene
AU2002338442A1 (en) New polynucleotides and polypeptides of the IFN alpha-17 gene
US20040203118A1 (en) Polynucleotides and polypeptides of the IFNalpha-14 gene
US7358333B2 (en) Polypeptides of the IFNα-5 gene
US7399464B2 (en) Polypeptides of the IFNα-7 gene
EP1236800A2 (en) Nucleic acids encoding interferon alpha 2, containing single nucleotide polymorphisms and methods of use thereof
WO2002083733A2 (en) Polynucleotides and polypeptides of the ifnalpha-6 gene

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20031229

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

17Q First examination report despatched

Effective date: 20050321

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20081125