Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/1034—Isolating an individual clone by screening libraries
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
  • C12Q1/6813—Hybridisation assays
  • C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
  • C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips

Definitions

• the present invention relates generally to screening of mixed populations of organisms or nucleic acids and more specifically to the identification of bioactive molecules and bioactivities using screening techniques, including high throughput screening and capillary array platform for screening samples.
• Enzymes have evolved by selective pressure to perform very specific biological functions within the milieu of a living organism, under conditions of mild temperature, pH and salt concentration. For the most part, the non- DNA modifying enzyme activities thus far described (Enzyme Nomenclature, 1992) have been isolated -from mesophilic organisms, which represent a very small fraction of the available phylogenetic diversity (Amann et al., 1995). The dynamic field of biocatalysis takes on a new dimension with the help of enzymes isolated from microorganisms that thrive in extreme environments.
• Such enzymes must function at temperatures above 100 °C in terrestrial hot springs and deep sea thermal vents, at temperatures below 0 °C in arctic waters, in the saturated salt environment of the Dead Sea, at pH values around 0 in coal deposits and geothermal sulfur-rich springs, or at pH values greater than 11 in sewage sludge (Adams and Kelly, 1995).
• the enzymes may also be obtained from: geothermal and hydrothermal fields, acidic soils, sulfotara and boiling mud pots, pools, hot-springs and geysers where the enzymes are neutral to alkaline, marine actinomycetes, metazoan, endo and ectosymbionts, tropical soil, temperate soil, arid soil, compost piles, manure piles, marine sediments, freshwater sediments, water concentrates, hypersaline and supercooled sea ice, arctic tundra, Sargosso sea, open ocean pelagic, marine snow, microbial mats (such as whale falls, springs and hydrothermal vents), insect and nematode gut microbial communities, plant endophytes, epiphytic water samples, industrial sites and ex situ enrichments.
• the enzymes may be isolated from eukaryotes, prokaryotes, myxobacteria (epothilone), air, water, sediment, soil or rock. Enzymes obtained from these extremophilic organisms open a new field in biocatalysis. For example, several esterases and lipases cloned and expressed from extremophilic organisms are remarkably robust, showing high activity throughout a wide range of temperatures and pHs. The fingerprints of several of these esterases show a diverse substrate spectrum, in addition to differences in the optimum reaction temperature. Certain esterases recognize only short chain substrates while others only acts on long chain substrates in addition to a huge difference in the optimal reaction temperature. These results suggest that more diverse enzymes fulfilling the need for new biocatalysts can be found by screening biodiversity. Substrates upon which enzymes act are herein defined as bioactive substrates.
• bioactive molecules other than enzymes are also afforded by the present invention.
• antibiotics, antivirals, antitumor agents and regulatory proteins can be discovered utilizing the present invention.
• genes Bacteria and many eukaryotes have a coordinated mechanism for regulating genes whose products are involved in related processes.
• the genes are clustered, in structures referred to as "gene clusters," on a single chromosome and are transcribed together under the control of a single regulatory sequence, including a single promoter which initiates transcription of the entire cluster.
• the gene cluster, the promoter, and additional sequences that function in regulation altogether are referred to as an "operon" and can include up to 30 or more genes, usually from 2 to 6 genes.
• a gene cluster is a group of adjacent genes that are either identical or related, usually as to their function.
• Some gene families consist of one or more identical members. Clustering is a prerequisite for maintaining identity between genes, although clustered genes are not necessarily identical. Gene clusters range from extremes where a duplication is generated of adjacent related genes to cases where hundreds of identical genes lie in a tandem array. Sometimes no significance is discernable in a repetition of a particular gene. A principal example of this is the expressed duplicate insulin genes in some species, whereas a single insulin gene is adequate in other mammalian species.
• Gene clusters undergo continual reorganization and, thus, the ability to create heterogeneous libraries of gene clusters from, for example, bacterial or other prokaryote sources is valuable in determining sources of novel proteins, particularly including enzymes such as, for example, the polyketide synthases that are responsible for the synthesis of polyketides having a vast array of useful activities.
• enzymes such as, for example, the polyketide synthases that are responsible for the synthesis of polyketides having a vast array of useful activities.
• other types of proteins and molecules that are the product(s) of gene clusters are also contemplated, including, for example, antibiotics, antivirals, antitumor agents and regulatory proteins, such as insulin.
• Polyketides are molecules which are an extremely rich source of bioactivities, including antibiotics (such as tetracyclines and erythromycin), anti-cancer agents (daunomycin), immunosuppressants (FK506 and rapamycin), and veterinary products (monensin). Many polyketides (produced by polyketide synthases) are valuable as therapeutic agents. Polyketide synthases are multifunctional enzymes that catalyze the biosynthesis of a huge variety of carbon chains differing in length and patterns of functionality and cyclization. Polyketide synthase genes fall into gene clusters and at least one type (designated type I) of polyketide synthases have large size genes and encoded enzymes, complicating genetic manipulation and in vitro studies of these genes/proteins. The method(s) of the present invention facilitate the rapid discovery of these gene clusters in gene expression libraries.
• antibiotics such as tetracyclines and erythromycin
• anti-cancer agents diaunomycin
• immunosuppressants FK506 and
• PKSs bacterial polyketide synthases
• a host- vector system in Streptomyces has been developed that allows directed mutation and expression of cloned PKS genes (McDaniel et al. 1993, Science 262:1546-1550; Kao et al. 1994, Science 265:509-512).
• This specific host-vector system has been used to develop more efficient ways of producing polyketides, and to rationally develop novel polyketides (Khosla et al., WO 95/08548).
• Another example is the production of the textile dye, indigo, by fermentation in an E. coli host. Two operons containing the genes that encode the multienzyme biosynthetic pathway have been genetically manipulated to improve production of indigo by the foreign E. coli host.
• the methods of the present invention facilitate the rapid discovery of genes, gene pathways and gene clusters, particularly polyketide synthase genes, polyketide synthase gene pathways and polyketides, from gene expression libraries.
• cellular "switches” known as receptors which interact with a variety of biomolecules, such as hormones, growth factors, and neurotransmitters, to mediate the transduction of an "external" cellular signaling event into an "internal” cellular signal.
• External signaling events include the binding of a ligand to the receptor, and internal events include the modulation of a pathway in the cytoplasm or nucleus involved in the growth, metabolism or apoptosis of the cell.
• Internal events also include the inhibition or activation of transcription of certain nucleic acid sequences, resulting in the increase or decrease in the production or presence of certain molecules (such as nucleic acid, proteins, and/or other molecules affected by this increase or decrease in transcription).
• Drugs to cure disease or alleviate its symptoms can activate or block any of these events to achieve a desired pharmaceutical effect.
• Transduction can be accomplished by a transducing protein in the cell membrane which is activated upon an allosteric change the receptor may undergo upon binding to a specific biomolecule.
• the "active" transducing protein activates production of so-called “second messenger” molecules within the cell, which then activate certain regulatory proteins within the cell that regulate gene expression or alter some metabolic process. Variations on the theme of this "cascade" of events occur.
• a receptor may act as its own transducing protein, or a transducing protein may act directly on an intracellular target without mediation by a second messenger.
• G-proteins Guanine nucleotide-binding proteins
• a large number of G protein-linked receptors funnel extracellular signals as diverse as hormones, growth factors, neurotransmitters, primary sensory stimuli, and other signals through a set of G proteins to a small number of second-messenger systems.
• the G proteins act as molecular switches with an "on” and "off state governed by a GTPase cycle. Mutations in G proteins may result in either constitutive activation or loss of expression mutations.
• Many receptors convey messages through heterotrimeric G proteins, of which at least 17 distinct forms have been isolated. Additionally, there are several different G protein-dependent effectors. The signals transduced through the heterotrimeric G proteins in mammalian cells influence intracellular events through the action of effector molecules.
• G protein-coupled signal transduction Given the variety of functions subserved by G protein-coupled signal transduction, it is not surprising that abnormalities in G protein-coupled pathways can lead to diseases with manifestations as dissimilar as blindness, hormone resistance, precocious puberty and neoplasia.
• G-protein-coupled receptors are extremely important to drug research efforts. It is estimated that up to 60% of today's prescription drugs work by somehow interacting with G protein-coupled receptors. However, these drugs were developed using classical medicinal chemistry and without a knowledge of the molecular mechanism of action. A more efficient drug discovery program could be deployed by targeting individual receptors and making use of information on gene sequence and biological function to develop effective therapeutics.
• the present invention allows one to, for example, study molecules which affect the interaction of G proteins with receptors, or of ligands with receptors.
• WO92/05244 (April 2, 1992) describes a transformed yeast cell which is incapable of producing a yeast G protein D subunit, but which has been engineered to produce both a mammalian G protein D subunit and a mammalian receptor which interacts with the subunit.
• the authors found that a modified version of a specific mammalian receptor integrated into the membrane of the cell, as shown by studies of the ability of isolated membranes to interact properly with various known agonists and antagonists of the receptor. Ligand binding resulted in G protein- mediated signal transduction.
• Adenylyl cyclase is among the best studied of the effector molecules which function in mammalian cells in response to activated G proteins.
• Activators of adenylyl cyclase cause the enzyme to become more active, elevating the cAMP signal of the yeast cell to a detectable degree.
• Inhibitors cause the cyclase to become less active, reducing the cAMP signal to a detectable degree.
• the method describes the use of the engineered yeast cells to screen for drugs which activate or inhibit adenylyl cyclase by their action on G protein-coupled receptors.
• Fluorescence-activated cell sorting has been primarily used in studies of human and animal cell lines and the control of cell culture processes. Fluorophore labeling of cells and measurement of the fluorescence can give quantitative data about specific target molecules or subcellular components and their distribution in the cell population. Flow cytometry can quantitate virtually any cell-associated property or cell organelle for which there is a fluorescent probe (or natural fluorescence). The parameters which can be measured have previously been of particular interest in animal cell culture.
• Flow cytometry has also been used in cloning and selection of variants from existing cell clones. This selection, however, has required stains that diffuse through cells passively, rapidly and irreversibly, with no toxic effects or other influences on metabolic or physiological processes. Since, typically, flow sorting has been used to study animal cell culture performance, physiological state of cells, and the cell cycle, one goal of cell sorting has been to keep the cells viable during and after sorting.
• Diaper and Edwards used flow cytometry to detect viable bacteria after staining with a range of fluorogenic esters including fluorescein diacetate (FDA) derivatives and CemChrome B, a proprietary stain sold commercially for the detection of viable bacteria in suspension (Diaper and Edwards, 1994). Labeled antibodies and oligonucleotide probes have also been used for these purposes.
• FDA fluorescein diacetate
• CemChrome B a proprietary stain sold commercially for the detection of viable bacteria in suspension
• lipase production was automatically assayed (turbidimetrically) in the microtiter plates, and a representative set of the most active were reisolated, cultured, and assayed conventionally (Betz et al., 1984).
• Scrienc et al. have reported a flow cytometric method for detecting cloned - galactosidase activity in the eukaryotic organism, S. cerevisiae.
• the ability of flow cytometry to make measurements on single cells means that individual cells with high levels of expression (e.g., due to gene amplification or higher plasmid copy number) could be detected.
• a non-fluorescent compound ⁇ -naphthol- ⁇ -galactopyranoside is cleaved by ⁇ -galactosidase and the liberated naphthol is trapped to form an insoluble fluorescent product.
• the insolubility of the fluorescent product is of great importance here to prevent its diffusion from the cell.
• the technique used to momtor b-galactosidase expression from spo-lacZ fusions in single cells involved taking samples from a sporulating culture, staining them with a commercially available fluorogenic substrate for b-galactosidase called C8-FDG, and quantitatively analyzing fluorescence in single cells by flow cytometry.
• the flow cytometer was used as a detector to screen for the presence of the spo gene during the development of the cells.
• the device was not used to screen and recover positive cells from a gene expression library or nucleic acid for the purpose of discovery.
• Another group has utilized flow cytometry to distinguish between the developmental stages of the delta-proteobacteria Myxococcus xanthus (F.
• the lacZ gene from E. coli is often used as a reporter gene in studies of gene expression regulation, such as those to determine promoter efficiency, the effects of trans-acting factors, and the effects of other regulatory elements in bacterial, yeast, and animal cells.
• a chromogenic substrate such as ONPG (o-nitrophenyl-(-D- galactopyranoside)
• ONPG o-nitrophenyl-(-D- galactopyranoside
• gel microdroplets containing (physically) single cells which can take up nutrients, secret products, and grow to form colonies.
• the diffusional properties of gel microdroplets may be made such that sufficient extracellular product remains associated with each individual gel microdroplet, so as to permit flow cytometric analysis and cell sorting on the basis of concentration of secreted molecule within each microdroplet.
• Beads have also been used to isolate mutants growing at different rates, and to analyze antibody secretion by hybridoma cells and the nutrient sensitivity of hybridoma cells.
• the gel microdroplet method has also been applied to the rapid analysis of mycobacterial growth and its inhibition by antibiotics.
• the gel microdroplet technology has had significance in amplifying the signals available in flow cytometric analysis, and in permitting the screening of microbial strains in strain improvement programs for biotechnology.
• Wittrup et al. (Biotechnolo.Bioeng. (1993) 42:351-356) developed a microencapsulation selection method which allows the rapid and quantitative screening of >10 6 yeast cells for enhanced secretion of Aspergillus awamori glucoamylase. The method provides a 400-fold single-pass enrichment for high-secretion mutants.
• Gel microdroplet or other related technologies can be used in the present invention to localize as well as amplify signals in the high throughput screening of recombinant libraries. Cell viability during the screening is not an issue or concern since nucleic acid can be recovered from the microdroplet.
• thermostable bioactivities Different types of encapsulation strategies and compounds or polymers can be used with the present invention. For instance, high temperature agaroses can be employed for making microdroplets stable at high temperatures, allowing stable encapsulation of cells subsequent to heat kill steps utilized to remove all background activities when screening for thermostable bioactivities.
• FACS systems have typically been based on eukaryotic separations and have not been refined to accurately sort single E. coli cells; the low forward and sideward scatter of small particles like E. coli, reduces the ability of accurate sorting; enzyme substrates typically used in automated screening approaches, such as umbelifferyl based substrates, diffuse out of E. coli at rates which interfere with quantitation. Further, recovery of very small amounts of DNA from sorted organisms can be problematic.
• the methods of the present invention address and overcome these hurdles with the novel screening approaches described herein.
• bioactive compounds are derived from soil microorganisms. Many microbes inhabiting soils and other complex ecological communities produce a variety of compounds that increase their ability to survive and proliferate. These compounds are generally thought to be nonessential for growth of the organism and are synthesized with the aid of genes involved in intermediary metabolism. Such secondary metabolites that influence the growth or survival of other organisms are known as "bioactive" compounds and serve as key components of the chemical defense arsenal of both micro- and macroorganisms. Humans have exploited these compounds for use as antibiotics, antiinfectives and other bioactive compounds with activity against a broad range of prokaryotic and eukaryotic pathogens (Barnes et al., Proc.Nat. Acad. Sci. U.S.A., 91, 1994).
• a central core of modern biology is that genetic information resides in a nucleic acid genome, and that the information embodied in such a genome (i.e., the genotype) directs cell function. This occurs through the expression of various genes in the genome of an organism and regulation of the expression of such genes.
• the expression of genes in a cell or organism defines the cell or organism's physical characteristics (i.e., its phenotype). This is accomplished through the translation of genes into proteins. Determining the biological activity of a protein obtained from an environmental sample can provide valuable information about the role of proteins in the environments. In addition, such information can help in the development of biologies, diagnostics, therapeutics, and compositions for industrial applications.
• the present invention provides methods and compositions to access this untapped biodiversity and to rapidly screen for polynucleotides, proteins and small molecules of interest utilizing high throughput screening of multiple samples.
• biomolecules can be derived from cultured or uncultured samples of organisms.
• the methods of the present invention provides a method for high throughput cultivation of unculturable microorganisms.
• cancer is the second leading cause of disease-related deaths, second only to cardiovascular disease and it is projected to become the leading cause of death within a few years.
• the most common curative therapies for cancers found at an early stage include surgery and radiation (1). These methods are not nearly as successful in the more advanced stages of cancer.
• Current chemotherapeutic agents have been useful but are limited in their effectiveness. Significant results are obtained with chemotherapy in a small range of cancers including childhood cancers and certain adult malignancies such as lymphoma and leukemia (2). Despite these positive results, most chemotherapeutic treatments are not curative and serve primarily as palliatives (1). Thus, it is clear that current medical science still has a long way to go before providing long-term survival to patients and curability of most cancers.
• Small molecule inhibitors of Bcr- abl, protein kinase C, VEGF receptors, and EGF receptors are all in clinical trials (4).
• Some specific examples include the EGF receptor inhibitors, ZD1839 and CP358774, which are in Phase II trials and appear to be well tolerated by patients with positive signs of clinical activity (6).
• the complexities of tumorigenesis necessitate not only the ongoing discovery and development of novel therapeutic agents but also the basic research to elucidate the underlying mechanisms of the disease.
• cancer related targets there are at least 50 known cancer related targets and it has been speculated that there may be up to several hundred new targets discovered (2).
• novel methods for the ultra high throughput screening of potential anti-cancer drugs must be developed.
• the therapeutic agents from natural sources have been primarily of plant and microbial origins. Of these, the greatest biodiversity exists in the microorganisms that populate virtually every corner of the earth. The approach currently used to screen microbes for new bioactive compounds has changed little over the last 50 years. Microbiologists collect samples from the environment, isolate a pure culture, grow up sufficient material, extract the culture, and test their metabolites for pharmacological activity. Variations of these natural products can then be generated through mutagenesis of the producing organism or through chemical or biochemical modification of the original backbone molecules. Natural products are typically made by multi-enzyme systems in which each enzyme carries out one of the many transformations required to make the final small molecule products, an example being antibiotics.
• bioactive molecules are derived from the organism's ability to produce secondary metabolites in response to the specific needs and challenges of their local environments.
• the genes encoding these enzymes are often clustered into so-called "biosynthetic operons" which contain the blueprint for building a natural product (10).
• This blueprint for production of a small bioactive molecule is typically more than 25,000 nucleotides and can be greater than 100,000 nucleotides.
• Some of these pathways e.g. actinorhodin, tetracenomycin, puromycin, nikkomycin
• Culture-independent approaches to directly clone genes encoding both target enzymes and other bioactive molecules from environmental samples are based on the construction of libraries which represent the collective genomes of naturally occurring organisms, archived in cloning vectors that can be propagated in E. coli, Streptomyces, or other suitable hosts . Because the cloned DNA is initially extracted directly from environmental samples containing a mixed population of organisms, the representation of the libraries is not limited to the small fraction of prokaryotes that can be grown in pure culture, nor is it biased towards a few rapidly growing species. Samples can be obtained from virtually all ecosystems represented on earth, including such extreme environments as geothermal and hydrothermal vents, acidic soils and boiling mud pots, contaminated industrial sites, marine symbionts, etc.
• Through-holes are typically machined into a plate by one of a number of well-known methods. Through-holes rely on capillary forces for introducing the sample to the plate, and utilize surface tension for suspending the sample in the through-holes.
• typical through-hole-based devices are limited to relatively small aspect ratios, or the ratio of length to internal diameter of the hole. A small aspect ratio yields greater evaporative loss of a liquid contained in the hole, and such evaporation is difficult to control.
• Through-holes are also limited in their functionality. For example, the process of forming through-holes in a plate usually does not allow for the use of various materials to line the inside of the holes, or to clad the outside of the holes.
• the present invention comprises methods for high throughput screening for biomolecules of interest.
• nucleic acids or nucleic acid libraries derived from mixed populations of nucleic acids and/or organisms are screened very rapidly for bioactivities of interest utilizing liquid phase screening methods.
• These libraries can represent the genomes of multiple organisms, species or subspecies.
• the libraries are screened via hybridization methods, such as "biopanning", or by activity based screening methods.
• High throughput screening can be performed by utilizing single cell screening systems, such as fluorescence activated cell sorting (FACS) or by capillary array-based systems.
• FACS fluorescence activated cell sorting
• the present invention provides a process for identifying clones having a specified activity of interest, which process comprises (i) generating one or more gene libraries derived from nucleic acid isolated from a mixed population of organisms; and (ii) screening said libraries utilizing a high throughput cell analyzer, e.g., a fluorescence activated cell sorter or a non-optical cell sorter, to identify said clones.
• a high throughput cell analyzer e.g., a fluorescence activated cell sorter or a non-optical cell sorter
• the invention provides a process for identifying clones having a specified activity of interest by (i) generating one or more libraries, e.g., expression libraries, made to contain nucleic acid directly or indirectly isolated from a mixed population of organisms ; (ii) exposing said libraries to a particular substrate or substrates of interest; and (iii) screening said exposed libraries utilizing a high throughput cell analyzer, e.g., a fluorescence activated cell sorter or a non-optical cell sorter, to identify clones which react with the substrate or substrates.
• a high throughput cell analyzer e.g., a fluorescence activated cell sorter or a non-optical cell sorter
• the invention also provides a process for identifying clones having a specified activity of interest by (i) generating one or more gene libraries derived from nucleic acid directly or indirectly isolated from a mixed population of organsims; and (ii) screening said exposed libraries utilizing an assay requiring a binding event or the covalent modification of a target, and a high throughput cell analyzer, e.g., a fluorescence activated cell sorter or non-optical cell sorter, to identify positive clones.
• a high throughput cell analyzer e.g., a fluorescence activated cell sorter or non-optical cell sorter
• the invention further provides a method of screening for an agent that modulates the activity of a target protein or other cell component (e.g., nucleic acid), wherein the target and a selectable marker are expressed by a recombinant cell, by co-encapsulating the agent in a microenvironment with the recombinant cell expressing the target and detectable marker and detecting the effect of the agent on the activity of the target cell component.
• a target protein or other cell component e.g., nucleic acid
• the invention provides a method for enriching for target DNA sequences containing at least a partial coding region for at least one specified activity in a DNA sample by co-encapsulating a mixture of target DNA obtained from a mixture of organisms with a mixture of DNA probes including a detectable marker and at least a portion of a DNA sequence encoding at least one enzyme having a specified enzyme activity and a detectable marker; incubating the co-encapsulated mixture under such conditions and for such time as to allow hybridization of complementary sequences and screening for the target DNA.
• the method further comprises transforming host cells with recovered target DNA to produce an expression library of a plurality of clones.
• the invention further provides a method of screening for an agent that modulates the interaction of a first test protein linked to a DNA binding moiety and a second test protein linked to a transcriptional activation moiety by co-encapsulating the agent with the first test protein and second test protein in a suitable microenvironment and determining the ability of the agent to modulate the interaction of the first test protein linked to a DNA binding moiety with the second test protein covalently linked to a transcriptional activation moiety, wherein the agent enhances or inhibits the expression of a detectable protein.
• the present invention provides a method for identifying a polynucleotide in a liquid phase, including contacting a plurality of polynucleotides derived from at least one organism, e.g., a mixed population of organisms, including microorganisms or plant tissue, with at least one nucleic acid probe under conditions that allow hybridization of the probe to the polynucleotides having complementary sequences, wherein the probe is labeled with a detectable molecule (e.g., a fluorescent, magnetic or other molecule).
• a detectable molecule e.g., a fluorescent, magnetic or other molecule.
• the detectable molecule changes, e.g., fluoresces, upon interaction of the probe to a target polynucleotide in the library.
• Clones from the library are then separated with an analyzer that detects the change in the detectable molecule, e.g., fluorescence, magnetic field or dielectric signature.
• the detectable molecule may also be a bioluminescent molecule, a chemiluminescent molecule, a colorimetric molecule, an electromagnetic molecule, an isotopic molecule, a thermal molecule or an enzymatic substrate.
• the separated clones can be contacted with a reporter system that identifies a polynucleotide encoding a polypeptide or a small molecule of interest, for example, and the clones capable of modulating expression or activity of the reporter system identified thereby identifying a polynucleotide of interest.
• the liquid phase of the embodiment includes in a solution (cell-free), in a cell, or in a non-solid phase.
• the invention provides a method for identifying a polynucleotide encoding a polypeptide of interest.
• the method includes co- encapsulating in a microenvironment a plurality of library clones containing DNA obtained from a mixed population of organisms with a mixture of oligonucleotide probes comprising a detectable marker and at least a portion of a polynucleotide sequence encoding a polypeptide of interest having a specified bioactivity.
• the encapsulated clones are incubated under such conditions and for such time as to allow interaction of complementary sequences and clones containing a complement to the oligonucleotide probe encoding the polypeptide of interest identified by separating clones with a fluorescent analyzer or non-optical analyzer that detects the detectable marker.
• the invention provides a method for high throughput screening of a polynucleotide library for a polynucleotide of interest that encodes a molecule of interest.
• the method includes contacting a library containing a plurality of clones comprising polynucleotides derived from a mixed population of organisms with a plurality of oligonucleotide probes labeled with a detectable molecule wherein said detectable molecule becomes detectable upon interaction of the probe to a target polynucleotide in the library; separating clones with an analyzer that detects the detectable marker; contacting the separated clones with a reporter system that identifies a polynucleotide encoding the molecule of interest; and identifying clones capable of modulating expression or activity of the reporter system thereby identifying a polynucleotide of interest.
• the invention provides a method of screening for a polynucleotide encoding an activity of interest.
• the method includes (a) obtaining polynucleotides from a sample containing a mixed population of organisms; (b) normalizing the polynucleotides obtained from the sample; (c) generating a library from the normalized polynucleotides; (d) contacting the library with a plurality of oligonucleotide probes comprising a detectable marker and at least a portion of a polynucleotide sequence encoding a polypeptide of interest having a specified activity to select library clones positive for a sequence of interest; (e) selecting clones with an analyzer (e.g.
• a fluorescent or non-optical analyzer that detects the marker; (f) contacting the selected clones with a reporter system that identifies a polynucleotide encoding the activity of interest; and (g) identifying clones capable of modulating expression or activity of the reporter system thereby identifying a polynucleotide of interest; wherein the positive clones contain a polynucleotide sequence encoding an activity of interest which is capable of catalyzing the bioactive substrate.
• the present invention provides a method for screening polynucleotides, comprising contacting a library of polynucleotides derived from a mixed population of organism with a probe oligonucleotide labeled with a detectable molecule, which is detectable upon binding of the probe to a target polynucleotide of the library, to select library polynucleotides positive for a sequence of interest; separating library members that are positive for the sequence of interest with an analyzer that detects the molecule; expressing the selected polynucleotides to obtain polypeptides; contacting the polypeptides with a reporter system; and identifying polynucleotides encoding polypeptides capable of modulating expression or activity of the reporter system.
• the invention provides a method for obtaining an organism from a mixed population of organisms in a sample.
• the method includes encapsulating in a microenvironment at least one organism from the sample; incubating the encapsulated orgamsm under such conditions and for such a time to allow the at least one microorganism to grow or proliferate; and sorting the encapsulated organism by flow cytometry to obtain an organism from the sample.
• the invention provides a method for identifying a polynucleotide in a liquid phase comprising: a) contacting a plurality of polynucleotides derived from at least one organism with at least one nucleic acid probe under conditions that allow hybridization of the probe to the polynucleotides having complementary sequences, wherein the probe is labeled with a detectable molecule; and
• a sample screening apparatus includes a plurality of capillaries formed into an array of adjacent capillaries, wherein each capillary comprises at least one wall defining a lumen for retaining a sample.
• the apparatus further includes interstitial material disposed between adjacent capillaries in the array, and one or more reference indicia formed within of the interstitial material.
• a capillary for screening a sample wherein the capillary is adapted for being bound in an array of capillaries, includes a first wall defining a lumen for retaining the sample, and a second wall formed of a filtering material, for filtering excitation energy provided to the lumen to excite the sample.
• a method for incubating a bioactivity or biomolecule of interest includes the steps of introducing a first component into at least a portion of a capillary of a capillary array, wherein each capillary of the capillary array comprises at least one wall defining a lumen for retaining the first component, and introducing an air bubble into the capillary behind the first component.
• the method further includes the step of introducing a second component into the capillary, wherein the second component is separated from the first component by the air bubble.
• a method of incubating a sample of interest includes introducing a first liquid labeled with a detectable particle into a capillary of a capillary array, wherein each capillary of the capillary array comprises at least one wall defining a lumen for retaining the first liquid and the detectable particle, and wherein the at least one wall is coated with a binding material for binding the detectable particle to the at least one wall.
• the method further includes removing the first liquid from the capillary tube, wherein the bound detectable particle is maintained within the capillary, and introducing a second liquid into the capillary tube.
• Another embodiment of the invention includes a recovery apparatus for a sample screening system, wherein the system includes a plurality of capillaries formed into an array.
• the recovery apparatus includes a recovery tool adapted to contact at least one capillary of the capillary array and recover a sample from the at least one capillary.
• the recovery apparatus further includes an ejector, connected with the recovery tool, for ejecting the recovered sample from the recovery tool.
• Figure 1 illustrates the protocol used in the cell sorting method of the invention to screen for a polynucleotide of interest, in this case using a (library excised into E. coli).
• the clones of interest are isolated by sorting.
• Figure 2 shows a microtiter plate where clones or cells are sorted in accordance with the invention. Typically one cell or cells grown within a microdroplet are dispersed per well and grown up as clones.
• Figure 3 depicts a co-encapsulation assay.
• Cells containing library clones are coencapsulated with a substrate or labeled oligonucleotide. Encapsulation can occur in a variety of means, including GMDs, liposomes, and ghost cells. Cells are screened via high throughput screening on a fluorescence analyzer.
• Figure 4 depicts a side scatter versus forward scatter graph of FACS sorted gel- microdroplets (GMDs) containing a species of Streptomyces which forms unicells. Empty gel-microdroplets are distinguished from free cells and debris, also.
• GMDs FACS sorted gel- microdroplets
• Figure 5 is a depiction of a FACS/Biopanning method described herein and described in Example 3, below.
• Figure 6A shows an example of dimensions of a capillary array of the invention.
• Figure 6B illustrates an array of capillary arrays.
• Figure 7 shows a top cross-sectional view of a capillary array.
• Figure 8 is a schematic depicting the excitation of and emission from a sample within the capillary lumen according to one embodiment of the invention.
• Figure 9 is a schematic depicting the filtering of excitation and emission light to and from a sample within the capillary lumen according to an alternative embodiment of the invention.
• Figure 10 illustrates an embodiment of the invention in which a capillary array is wicked by contacting a sample containing cells, and humidified in a humidified incubator followed by imaging and recovery of cells in the capillary array.
• Figure 11 illustrates a method for incubating a sample in a capillary tube by an evaporative and capillary wicking cycle.
• Figure 12A shows a portion of a surface of a capillary array on which condensation has formed.
• Figure 12B shows the portion of the surface of the capillary array, depicted in Figure 12 A, in which the surface is coated with a hydrophobic layer to inhibit condensation near an end of individual capillaries.
• Figures 13A-C depict a method of retaining at least two components within a capillary.
• Figure 14A depicts capillary tubes containing paramagnetic beads and cells.
• Figure 14B depicts the use of the paramagnetic beads to stir a sample in a capillary tube.
• Figure 15 depicts an excitation apparatus for a detection system according to an embodiment of the invention.
• Figure 16 illustrates a system for screening samples using a capillary array according to an embodiment of the invention.
• FIG 17A illustrates one example of a recovery technique useful for recovering a sample from a capillary array.
• a needle is contacted with a capillary containing a sample to be obtained.
• a vacuum is created to evacuate the sample from the capillary tube and onto a filter.
• Figure 17B illustrates one sample recovery method in which the recovery device has an outer diameter greater than the inner diameter of the capillary from which a sample is being recovered.
• Figure 17C illustrates another sample recovery method in which the recovery device has an outer diameter approximately equal to or less than the inner diameter of the capillary.
• Figure 17D shows the further processing of the sample once evacuated from the capillary.
• Figure 18 is a schematic showing high throughput enrichment of low copy gene targets.
• Figure 19 is a schematic of FACS-Biopanning using high throughput culturing. Polyketide synthase sequences from environmental samples are shown in the alignment.
• Figure 20 shows whole cell hybridization for biopanning.
• Figure 21 is a schematic showing co-encapsulation of a eukaryotic cell and a bacterial cell.
• Figure 22 shows a whole cell hybridization schematic for biopanning and FACS sorting.
• FIG. 23 shows a schematic of T7 RNA Polymerase Expression system. DETAILED DESCRIPTION OF THE INVENTION
• the present invention provides a method for rapid sorting and screening of libraries derived from a mixed population of organisms from, for example, an environmental sample or an uncultivated population of organisms.
• gene libraries are generated, clones are either exposed to a substrate or substrate(s) of interest, or hybridized to a fluorescence labeled probe having a sequence corresponding to a sequence of interest and positive clones are identified and isolated via fluorescence activated cell sorting.
• Cells can be viable or non-viable during the process or at the end of the process, as nucleic acids encoding a positive activity can be isolated and cloned utilizing techniques well known in the art.
• This invention differs from fluorescence activated cell sorting, as normally performed, in several aspects.
• FACS machines have been employed in studies focused on the analyses of eukaryotic and prokaryotic cell lines and cell culture processes.
• FACS has also been utilized to monitor production of foreign proteins in both eukaryotes and prokaryotes to study, for example, differential gene expression.
• the detection and counting capabilities of the FACS system have been applied in these examples.
• FACS has never previously been employed in a discovery process to screen for and recover bioactivities in prokaryotes.
• non-optical methods have not been used to identify or discover novel bioactivities or biomolecules.
• the present invention does not require cells to survive, as do previously described technologies, since the desired nucleic acid (recombinant clones) can be obtained from alive or dead cells.
• the cells only need to be viable long enough to contain, carry or synthesize a complementary nucleic acid sequence to be detected, and can thereafter be either viable or non-viable cells so long as the complementary sequence remains intact.
• the present invention also solves problems that would have been associated with detection and sorting of E. coli expressing recombinant enzymes, and recovering encoding nucleic acids.
• the invention includes within its embodiments apparatus capable of detecting a molecule or marker that is indicative of a bioactivity or biomolecule of interest, including optical and non-optical apparatus.
• the present invention includes within its embodiments any apparatus capable of detecting fluorescent wavelengths associated with biological material, such apparatuses are defined herein as fluorescent analyzers (one example of which is a FACS apparatus).
• the invention is based on the construction of "mixed population libraries" which represent the collective genomes of naturally occurring organisms archived in cloning vectors that can be propagated in suitable prokaryotic hosts. Because the cloned DNA is initially extracted directly from environmental samples, the libraries are not limited to the small fraction of prokaryotes that can be grown in pure culture. Additionally, a normalization of the DNA present in these samples could allow more equal representation of the DNA from all of the species present in the original sample. This can increase the efficiency of finding interesting genes from minor constituents of the sample which may be under-represented by several orders of magnitude compared to the dominant species.
• the present invention allows the rapid screening of complex mixed population libraries, containing, for example, genes from thousands of different organisms.
• the benefits of the present invention can be seen, for example, in screening a complex mixed population sample. Screening of a complex sample previously required one to use labor intensive methods to screen several million clones to cover the genomic biodiversity.
• the invention represents an extremely high- throughput screening method which allows one to assess this enormous number of clones.
• the method disclosed herein allows the screening anywhere from about 30 million to about 200 million clones per hour for a desired nucleic acid sequence or biological activity. This allows the thorough screening of mixed population libraries for clones expressing novel biomolecules.
• the invention provides methods and composition whereby one can screen, sort or identify a polynucleotide sequence, polypeptide, or molecule of interest from a mixed population of organisms (e.g., organisms present in a mixed population sample) based on polynucleotide sequences present in the sample.
• the invention provides methods and compositions useful in screening organisms for a desired biological activity or biological sequence and to assist in obtaining sequences of interest that can further be used in directed evolution, molecular biology, biotechnology and industrial applications.
• the invention increases the repertoire of available sequences that can be used for the development of diagnostics, therapeutics or molecules for industrial applications. Accordingly, the methods of the invention can identify novel nucleic acid sequences encoding proteins or polypeptides having a desired biological activity.
• the invention provides a method for high throughput culturing of organisms.
• the organisms are a mixed population of organisms.
• the organisms include host cells of a library containing nucleic acids.
• libraries include nucleic acid obtained from various isolates of organisms, which are then pooled; nucleic acid obtained from isolate libraries, which are then pooled; or nucleic acids derived directly from a mixed population of organisms.
• a sample containing the organisms is mixed with a composition that can form a microenvironment, as described herein, e.g., a gel microdroplet or a liposome.
• a mixed population of microorganisms is mixed with the encapsulation material in such a way that preferably fewer than 5 microorganisms are encapsulated.
• the cells are cultured in a manner which allows growth of the organisms, e.g., host cells of a library.
• Example 8 provides growth of the encapsulated organisms in a chromotography column which allows a flow of growth medium providing nutrients for growth and for removal of waste products from cells.
• a clonal population of the preferably one organism grows within the microenvironment.
• microenvironments e.g., gel microdroplets, can be sorted to eliminate "empty" microenvironments and to sort for the occupied microenvironments.
• the nucleic acid from organisms in the sorted microenvironments can be studied directly, for example, by treating with a PCR mixture and amplified immediately after sorting.
• 16S rRNA genes from individual cells were studied and organisms assessed for phylogenetic diversity from the samples.
• the high throughput culturing methods of the invention allow culturing of organisms and enrichment of low copy gene targets.
• a library of nucleic acid obtained from various isolates of organisms, which are then pooled; nucleic acid obtained from isolate libraries, which are then pooled; or nucleic acids derived directly from a mixed population of organisms, for example, are encapsulated, e.g., in a gel microdroplet or other microenvironment, and grown under conditions which allow clonal expansion of each organism in the microenvironment.
• the cells of the clonal population are lysed and treated with proteinases to yield nucleic acid (see Figure X) (e.g., the microcolonies are deproteinized by incubating gel microdroplets in lysis solution containing proteinase K at 37 degrees C for 30 minutes).
• nucleic acid see Figure X
• the microcolonies are deproteinized by incubating gel microdroplets in lysis solution containing proteinase K at 37 degrees C for 30 minutes.
• alkaline denaturing solution 0.5M NaOH
• neutralized e.g., with Tris pH8.
• nucleic acid entrapped in the microenvironment is hybridized with Digoxiginin (DIG)-labeled oligonucleotides (30-50 nt) in Dig Easy Hyb (available from Roche) overnight at 37 degrees C, followed by washing with 0.3xSSC and O.lxSSC at 38-50 degrees C to achieve desired stringency.
• DIG Digoxiginin
• oligonucleotides (30-50 nt) in Dig Easy Hyb (available from Roche) overnight at 37 degrees C, followed by washing with 0.3xSSC and O.lxSSC at 38-50 degrees C to achieve desired stringency.
• the nucleic acid is hybridized with a probe which is preferably labeled.
• a signal can be amplified with a secondary label (e.g., fluorescent) and the nucleic acid sorted for fluorescent microenvironments, e.g., gel microdroplets.
• Nucleic acid that is fluorescent can be isolated and further studied or cloned into a host cell for further manipulation.
• signals are amplified with Tyramide Signal Amplification (TSA) kit from Molecular Probe.
• TSA is an enzyme-mediated signal amplification method that utilizes horseradish peroxidase (HRP) to depose fluorogenic tyramide molecules and generate high-density labeling of a target nucleic acid sequence in situ.
• the signal amplification is conferred by the turnover of multiple tyramide substrates per HRP molecule, and increases in signal strength of over 1, 000- fold have been reported.
• the procedure involves incubating GMDs with anti-DIG conjugated horseradish peroxidase (anti-DIG-HRP) (Roche, IN) for 3 hours at room temperature. Then the tyramide substrate solution will be added and incubated for 30 minutes at room temperature.
• this high throughput culturing method followed by sorting e.g., FACS
• sorting e.g., FACS
• biopanning allows for identification of gene targets. It may be desirable to screen for nucleic acids encoding virtually any protein or any bioactivity and to compare such nucleic acids among various species of organisms in a sample (e.g., study polyketide sequences from a mixed population).
• nucleic acid derived from high throughput culturing of organisms can be obtained for further study or for generation of a library. Such nucleic acid can be pooled and a library created, or alternatively, individual libraries from clonal populations of organisms can be generated and then nucleic acid pooled from those libraries to generate a more complex library.
• the libraries generated as described herein can be utilized for the discovery of biomolecules (e.g., nucleic acid or bioactivities) or for evolving nucleic acid molecules identified by the high throughput culturing methods described in the present invention invention.
• evolution methods are known in the art or described herein, such as, shuffling, cassette mutagenesis, recursive ensemble mutagenesis, sexual PCR, directed evolution, exonuclease-mediated reassembly, codon site-saturation mutagenesis, amino acid site- saturation mutagenesis, gene site saturation mutagenesis, introduction of mutations by non-stochastic polynucleotide reassembly methods, synthetic ligation polynucleotide reassembly, gene reassembly, oligonucleotide-directed saturation mutagenesis, in vivo reassortment of polynucleotide sequences having partial homology, naturally occurring recombination processes which reduce sequence complexity, and
• Flow cytometry has been used in cloning and selection of variants from existing cell clones. This selection, however, has required stains that diffuse through cells passively, rapidly and irreversibly, with no toxic effects or other influences on metabolic or physiological processes. Since, typically, flow sorting has been used to study animal cell culture performance, physiological state of cells, and the cell cycle, one goal of cell sorting has been to keep the cells viable during and after sorting.
• Fluorescence and other forms of staining have been employed for microbial discri ⁇ -ination and identification, and in the analysis of the interaction of drugs and antibiotics with microbial cells.
• Flow cytometry has been used in aquatic biology, where autofluorescence of photosynthetic pigments are used in the identification of algae or DNA stains are used to quantify and count marine populations (Davey and Kell, 1996).
• Diaper and Edwards used flow cytometry to detect viable bacteria after staining with a range of fluorogenic esters including fluorescein diacetate (FDA) derivatives and CemChrome B, a stain sold commercially for the detection of viable bacteria in suspension (Diaper and Edwards, 1994). Labeled antibodies and oligonucleotide probes can also been used for these purposes.
• lipase production was automatically assayed (turbidimetrically) in the microtiter plates, and a representative set of the most active were reisolated, cultured, and assayed conventionally (Betz et al., 1984).
• the ability of flow cytometry to make measurements on single cells means that individual cells with high levels of expression (e.g., due to gene amplification or higher plasmid copy number) could be detected.
• GMDs gel microdroplets
• the diffusional properties of GMDs maybe made such that sufficient extracellular product remains associated with each individual GMD, so as to permit flow cytometric analysis and cell sorting on the basis of concentration of secreted molecule within each microdroplet. Beads have also been used to isolate mutants growing at different rates, and to analyze antibody secretion by hybridoma cells and the nutrient sensitivity of hybridoma cells.
• the GMD technology has had significance in amplifying the signals available in flow cytometric analysis, and in permitting the screening and sorting of microbial strains in strain improvement and isolation programs.
• GMD or other related technologies can be used in the present invention to localize, sort as well as amplify signals in the high throughput screening of recombinant libraries. Cell viability during the screening is not an issue or concern since nucleic acid can be recovered from the microdroplet.
• Different types of encapsulation strategies and compounds or polymers can be used with the present invention. For instance, high temperature agaroses can be employed for making microdroplets stable at high temperatures, allowing stable encapsulation of cells subsequent to heat-kill steps utilized to remove all background activities when screening for thermostable bioactivities. Encapsulation can be in beads, high temperature agaroses, gel microdroplets, cells, such as ghost red blood cells or macrophages, liposomes, or any other means of encapsulating and localizing molecules.
• Erythrocytes employed as carriers in vitro or in vivo for substances entrapped during hypo-osmotic lysis or dielectric breakdown of the membrane have also been described (reviewed in Diler, G. M. (1983) J. Pharm. Ther). These techniques are useful in the present invention to encapsulate samples for screening.
• Microenvironment is any molecular structure which provides an appropriate environment for facilitating the interactions necessary for the method of the invention.
• An environment suitable for facilitating molecular interactions include, for example, gel microdroplets, ghost cells, macrophages or liposomes.
• Liposomes can be prepared from a variety of lipids including phospholipids, glycolipids, steroids, long-chain alkyl esters; e.g., alkyl phosphates, fatty acid esters; e.g., lecithin, fatty amines and the like.
• a mixture of fatty material may be employed such a combination of neutral steroid, a charge amphiphile and a phospholipid.
• Illustrative examples of phospholipids include lecithin, sphingomyelin and dipalmitoylphos-phatidylcholine.
• Representative steroids include cholesterol, cholestanol and lanosterol.
• Representative charged amphiphilic compounds generally contain from 12-30 carbon atoms.
• a sample screening apparatus includes a plurality of capillaries formed into an array of adjacent capillaries, wherein each capillary comprises at least one wall defining a lumen for retaining a sample.
• the apparatus further includes interstitial material disposed between adjacent capillaries in the array, and one or more reference indicia formed within of the interstitial material, (see co-pending applications 09/687,219 and 09/894,956, herein incorporated by reference in their entirety).
• a capillary for screening a sample wherein the capillary is adapted for being bound in an array of capillaries, includes a first wall defining a lumen for retaining the sample, and a second wall formed of a filtering material, for filtering excitation energy provided to the lumen to excite the sample.
• a method for incubating a bioactivity or biomolecule of interest includes the steps of introducing a first component into at least a portion of a capillary of a capillary array, wherein each capillary of the capillary array comprises at least one wall defining a lumen for retaining the first component, and introducing an air bubble into the capillary behind the first component.
• the method further includes the step of introducing a second component into the capillary, wherein the second component is separated from the first component by the air bubble.
• a method of incubating a sample of interest includes introducing a first liquid labeled with a detectable particle into a capillary of a capillary array, wherein each capillary of the capillary array comprises at least one wall defining a lumen for retaining the first liquid and the detectable particle, and wherein the at least one wall is coated with a binding material for binding the detectable particle to the at least one wall.
• the method further includes removing the first liquid from the capillary tube, wherein the bound detectable particle is maintained within the capillary, and introducing a second liquid into the capillary tube.
• Another embodiment of the invention includes a recovery apparatus for a sample screening system, wherein the system includes a plurality of capillaries formed into an array.
• the recovery apparatus includes a recovery tool adapted to contact at least one capillary of the capillary array and recover a sample from the at least one capillary.
• the recovery apparatus further includes an ejector, connected with the recovery tool, for ejecting the recovered sample from the recovery tool.
• amino acid is a molecule having the structure wherein a central carbon atom (the ⁇ -carbon atom) is linked to a hydrogen atom, a carboxylic acid group (the carbon atom of which is referred to herein as a “carboxyl carbon atom”), an amino group (the nitrogen atom of which is referred to herein as an "amino nitrogen atom"), and a side chain group, R.
• an amino acid loses one or more atoms of its amino acid carboxyUc groups in the dehydration reaction that links one amino acid to another.
• an amino acid is referred to as an "amino acid residue."
• Protein or “polypeptide” refers to any polymer of two or more individual amino acids (whether or not naturally occurring) linked via a peptide bond, and occurs when the carboxyl carbon atom of the carboxylic acid group bonded to the ⁇ -carbon of one amino acid (or amino acid residue) becomes covalently bound to the amino nitrogen atom of amino group bonded to the ⁇ -carbon of an adjacent amino acid.
• protein is understood to include the terms “polypeptide” and “peptide” (which, at times may be used interchangeably herein) within its meaning.
• proteins comprising multiple polypeptide subunits (e.g., DNA polymerase m, RNA polymerase II) or other components (for example, an RNA molecule, as occurs in telomerase) will also be understood to be included within the meaning of "protein” as used herein.
• proteins comprising multiple polypeptide subunits (e.g., DNA polymerase m, RNA polymerase II) or other components (for example, an RNA molecule, as occurs in telomerase) will also be understood to be included within the meaning of "protein” as used herein.
• fragments of proteins and polypeptides are also within the scope of the invention and may be referred to herein as "proteins.”
• a particular amino acid sequence of a given protein is determined by the nucleotide sequence of the coding portion of a mRNA, which is in turn specified by genetic information, typically genomic DNA (including organelle DNA, e.g., mitochondrial or chloroplast DNA).
• genomic DNA including organelle DNA, e.g., mitochondrial or chloroplast DNA.
• isolated means altered “by the hand of man” from its natural state; i.e., if it occurs in nature, it has been changed or removed from its original environment, or both.
• a naturally occurring polynucleotide or a polypeptide naturally present in a living animal a biological sample or an environmental sample in its natural state is not “isolated”, but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated”, as the term is employed herein.
• Such polynucleotides when introduced into host cells in culture or in whole organisms, still would be isolated, as the term is used herein, because they would not be in their naturally occurring form or environment.
• polynucleotides and polypeptides may occur in a composition, such as a media formulation (solutions for introduction of polynucleotides or polypeptides, for example, into cells or compositions or solutions for chemical or enzymatic reactions).
• a media formulation solutions for introduction of polynucleotides or polypeptides, for example, into cells or compositions or solutions for chemical or enzymatic reactions.
• Polynucleotide or “nucleic acid sequence” refers to a polymeric form of nucleotides. In some instances a polynucleotide refers to a sequence that is not immediately contiguous with either of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived.
• the term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA) independent of other sequences.
• the nucleotides of the invention can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide.
• a polynucleotides as used herein refers to, among others, single-and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
• polynucleotide as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
• the strands in such regions may be from the same molecule or from different molecules.
• the regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules.
• One of the molecules of a triple-helical region often is an oligonucleotide.
• polynucleotide encompasses genomic DNA or RNA (depending upon the organism, i.e., RNA genome of viruses), as well as mRNA encoded by the genomic DNA, and cDNA.
• Enzymes have evolved by selective pressure to perform very specific biological functions within the milieu of a living organism, under conditions of temperature, pH and salt concentration. For the most part, the non-DNA modifying enzyme activities thus far described have been isolated from mesophilic organisms, which represent a very small fraction of the available phylogenetic diversity. The dynamic field of biocatalysis takes on a new dimension with the help of enzymes isolated from microorganisms that thrive in extreme environments.
• such enzymes must function at temperatures above 100°C in terrestrial hot springs and deep sea thermal vents, at temperatures below 0°C in arctic waters, in the saturated salt environment of the Dead Sea, at pH values around 0 in coal deposits and geothermal sulfur-rich springs, or at pH values greater than 11 in sewage sludge.
• the invention provides not only a source of materials for the development of biologies, therapeutics, and enzymes for industrial appUcations, but also provides a new materials for further processing by, for example, directed evolution and mutagenesis to develop molecules or polypeptides modified for particular activity or conditions.
• the invention can be used to obtain and identify polynucleotides and related sequence specific information from, for example, infectious microorganisms present in the environment such as, for example, in the gut of various macroorganisms.
• the methods and compositions of the invention provide for the identification of lead drug compounds present in an environmental sample.
• the methods of the invention provide the ability to mine the environment for novel drugs or identify related drugs contained in different microorganisms.
• lead compounds drug candidates
• natural product collections synthetic chemical collections
• synthetic combinatorial chemical libraries such as nucleotides, peptides, or other polymeric molecules that have been identified or developed as a result of environmental mining.
• Each of these sources has advantages and disadvantages.
• the success of programs to screen these candidates depends largely on the number of compounds entering the programs, and pharmaceutical companies have to date screened hundred of thousands of synthetic and natural compounds in search of lead compounds. Unfortunately, the ratio of novel to previously-discovered compounds has diminished with time.
• the invention provides a rapid and efficient method to identify and characterize environmental samples that may contain novel drug compounds.
• bioactive compounds currently in use are derived from soil microorganisms. Many microbes inhabiting soils and other complex ecological communities produce a variety of compounds that increase their abiUty to survive and proliferate. These compounds are generally thought to be nonessential for growth of the organism and are synthesized with the aid of genes involved in intermediary metabolism hence their name - "secondary metabolites”. Secondary metabolites are generally the products of complex biosynthetic pathways and are usually derived from common cellular precursors.
• bioactive compounds Secondary metabolites that influence the growth or survival of other organisms are known as "bioactive" compounds and serve as key components of the chemical defense arsenal of both micro- and macro-organisms. Humans have exploited these compounds for use as antibiotics, antiinfectives and other bioactive compounds with activity against a broad range of prokaryotic and eukaryotic pathogens. Approximately 6,000 bioactive compounds of microbial origin have been characterized, with more than 60% produced by the gram positive soil bacteria of the genus Streptomyces. (Barnes et al., Proc.Nat. Acad. Sci. U.S.A., 91, 1994). Of these, at least 70 are currently used for biomedical and agricultural appUcations. The largest class of bioactive compounds, the polyketides, include a broad range of antibiotics, immunosuppressants and anticancer agents which together account for sales of over $5 billion per year.
• the invention provides methods of identifying a nucleic acid sequence encoding a polypeptide having either known or unknown function. For example, much of the diversity in microbial genomes results from the rearrangement of gene clusters in the genome of microorganisms. These gene clusters can be present across species or phylogenetically related with other organisms.
• genes are clustered, in structures referred to as "gene clusters," on a single chromosome and are transcribed together under the control of a single regulatory sequence, including a single promoter which initiates transcription of the entire cluster.
• the gene cluster, the promoter, and additional sequences that function in regulation altogether are referred to as an "operon" and can include up to 20 or more genes, usually from 2 to 6 genes.
• a gene cluster is a group of adjacent genes that are either identical or related, usually as to their function. Gene clusters are generally 15 kb to greater than 120 kb in length.
• Some gene famiUes consist of identical members. Clustering is a prerequisite for maintaining identity between genes, although clustered genes are not necessarily identical. Gene clusters range from extremes where a dupUcation is generated to adjacent related genes to cases where hundreds of identical genes lie in a tandem array. Sometimes no significance is discemable in a repetition of a particular gene. A principal example of this is the expressed duplicate insulin genes in some species, whereas a single insulin gene is adequate in other mammaUan species.
• gene clusters undergo continual reorganization and, thus, the ability to create heterogeneous Ubraries of gene clusters from, for example, bacterial or other prokaryote sources is valuable in detem- ning sources of novel proteins, particularly including enzymes such as, for example, the polyketide synthases that are responsible for the synthesis of polyketides having a vast array of useful activities.
• enzymes such as, for example, the polyketide synthases that are responsible for the synthesis of polyketides having a vast array of useful activities.
• Other types of proteins that are the produces) of gene clusters are also contemplated, including, for example, antibiotics, antivirals, antitumor agents and regulatory proteins, such as insulin.
• polyketide synthases enzymes fall in a gene cluster.
• Polyketides are molecules which are an extremely rich source of bioactivities, including antibiotics (such as tetracyclines and erythromycin), anti-cancer agents (daunomycin), immunosuppressants (FK506 and rapamycin), and veterinary products (monensin). Many polyketides (produced by polyketide synthases) are valuable as therapeutic agents.
• Polyketide synthases are multifunctional enzymes that catalyze the biosynthesis of a huge variety of carbon chains differing in length and patterns of functionality and cyclization.
• Polyketide synthase genes fall into gene clusters and at least one type (designated type I) of polyketide synthases have large size genes and enzymes, complicating genetic manipulation and in vitro studies of these genes/proteins.
• the ability to select and combine desired components from a library of polyketides and postpolyketide biosynthesis genes for generation of novel polyketides for study is appealing.
• the method(s) of the present invention make it possible to, and facilitate the cloning of, novel polyketide synthases, since one can generate gene banks with clones containing large inserts (especially when using the f-factor based vectors), which facilitates cloning of gene clusters.
• biosynthetic genes include NRPS, glycosyl transferases and p450s.
• a gene cluster can be Ugated into a vector containing an expression regulatory sequences which can control and regulate the production of a detectable protein or protein-related array activity from the Ugated gene clusters.
• Use of vectors which have an exceptionally large capacity for exogenous nucleic acid introduction are particularly appropriate for use with such gene clusters and are described by way of example herein to include artificial chromosome vectors, cosmids, and the f-factor (or fertility factor) of E. coli.
• the f-factor of E. coli is a plasmid which affects high-frequency transfer of itself during conjugation and is ideal to achieve and stably propagate large nucleic acid fragments, such as gene clusters from samples of mixed populations of organisms.
• the nucleic acid isolated or derived from these samples can preferably be inserted into a vector or a plasmid prior to screening of the polynucleotides.
• vectors or plasmids are typically those containing expression regulatory sequences, including promoters, enhancers and the like.
• the invention provides novel systems to clone and screen mixed populations of organisms present, for example, in an environmental samples, for polynucleotides of interest, enzymatic activities and bioactivities of interest in vitro.
• the method(s) of the invention allow the cloning and discovery of novel bioactive molecules in vitro, and in particular novel bioactive molecules derived from uncultivated or cultivated samples. Large size gene clusters, genes and gene fragments can be cloned, sequenced and screened using the method(s) of the invention.
• the method(s) of the invention allow one to clone, screen and identify polynucleotides and the polypeptides encoded by these polynucleotides in vitro from a wide range of mixed population samples.
• the invention allows one to screen for and identify polynucleotide sequences from complex mixed population samples.
• DNA libraries obtained from these samples can be created from cell free samples, so long as the sample contains nucleic acid sequences, or from samples containing cellular organisms or viral particles.
• the organisms from which the libraries may be prepared include prokaryotic microorganisms, such as Eubacteria and Archaebacteria, lower eukaryotic microorganisms such as fungi, algae and protozoa, as well as plants, plant spores and pollen.
• the organisms may be cultured organisms or uncultured organisms obtained from mixed population environmental samples and includes extremophiles, such as thermophiles, hyperthermophiles, psychrophiles and psychrotrophs.
• Sources of nucleic acids used to construct a DNA Ubrary can be obtained from mixed population samples, such as, but not limited to, microbial samples obtained from Arctic and Antarctic ice, water or permafrost sources, materials of volcanic origin, materials from soil or plant sources in tropical areas, droppings from various organisms including mammals, invertebrates, as well as dead and decaying matter etc.
• nucleic acids may be recovered from either a cultured or non-cultured organism and used to produce an appropriate DNA library (e.g., a recombinant expression Ubrary) for subsequent determination of the identity of the particular polynucleotide sequence or screening for bioactivity.
• a mixed population sample is any sample containing organisms or polynucleotides or a combination thereof, which can be obtained from any number of sources (as described above), including, for example, insect feces, soil, water, etc. Any source of nucleic acids in purified or non-purified form can be utilized as starting material. Thus, the nucleic acids maybe obtained from any source which is contaminated by an organism or from any sample containing cells.
• the mixed population sample can be an extract from any bodily sample such as blood, urine, spinal fluid, tissue, vaginal swab, stool, amniotic fluid or buccal mouthwash from any mammalian organism.
• the sample can be a tissue sample, salivary sample, fecal material or material in the digestive tract of the organism.
• An environmental sample also includes samples obtained from extreme environments including, for example, hot sulfur pools, volcanic vents, and frozen tundra.
• the sample can come from a variety of sources.
• the sample in horticulture and agricultural testing can be a plant, fertilizer, soil, Uquid or other horticultural or agricultural product; in food testing the sample can be fresh food or processed food (for example infant formula, seafood, fresh produce and packaged food); and in environmental testing the sample can be Uquid, soil, sewage treatment, sludge and any other sample in the environment which is considered or suspected of containing an organism or polynucleotides.
• the sample is a mixture of material (e.g., a mixed population of organisms), for example, blood, soil and sludge, it can be treated with an appropriate reagent which is effective to open the cells and expose or separate the strands of nucleic acids.
• Mixed populations can comprise pools of cultured organisms or samples.
• samples of organisms can be cultured prior to analysis in order to purify a particular population and thus obtaining a purer sample.
• Organisms such as actinomycetes or myxobacteria, known to produce bioacitivities of interest can be enriched for, via culturing.
• Culturing of organisms in the sample can include culturing the organisms in microdroplets and separating the cultured microdroplets with a cell sorter into individual wells of a multi-well tissue culture plate from which further processing may be performed.
• the sample comprises nucleic acids from, for example, a diverse and mixed population of organisms (e.g., microorganisms present in the gut of an insect). Nucleic acids are isolated from the sample using any number of methods for DNA and RNA isolation. Such nucleic acid isolation methods are commonly performed in the art. Where the nucleic acid is RNA, the RNA can be reversed transcribed to DNA using primers known in the art. Where the DNA is genomic DNA, the DNA can be sheared using, for example, a 25 gauge needle.
• Vectors used in the present invention include: plasmids, phages, cosmids, phagemids, viruses (e.g., retroviruses, parainfluenzavirus, herpesviruses, reoviruses, paramyxoviruses, and the like), artificial chromosomes, or selected portions thereof (e.g., coat protein, spike glycoprotein, capsid protein).
• viruses e.g., retroviruses, parainfluenzavirus, herpesviruses, reoviruses, paramyxoviruses, and the like
• artificial chromosomes e.g., coat protein, spike glycoprotein, capsid protein.
• cosmids and phagemids are typically used where the specific nucleic acid sequence to be analyzed or modified is large because these vectors are able to stably propagate large polynucleotides.
• the vector containing the cloned DNA sequence can then be amplified by plating (i.e., clonal amplification) or transfecting a suitable host cell with the vector (e.g., a phage on an E. coli host). Alternatively (or subsequently to amplification), the cloned DNA sequence is used to prepare a library for screening by transforming a suitable organism. Hosts, known in the art are transformed by artificial introduction of the vectors containing the target nucleic acid by inoculation under conditions conducive for such transformation. One could transform with double stranded circular or Unear nucleic acid or there may also be instances where one would transform with single stranded circular or linear nucleic acid sequences.
• transform or transformation is meant a permanent or transient genetic change induced in a cell following incorporation of new DNA (i.e., DNA exogenous to the cell).
• a permanent genetic change is generally achieved by introduction of the DNA into the genome of the cell.
• a transformed cell or host cell generally refers to a cell (e.g., prokaryotic or eukaryotic) into which (or into an ancestor of which) has been introduced, by means of recombinant DNA techniques, a DNA molecule not normally present in the host organism.
• a particularly type of vector for use in the invention contains an f-factor origin replication.
• the f-factor (or fertility factor) in E. coU is a plasmid which effects high frequency transfer of itself during conjugation and less frequent transfer of the bacterial chromosome itself.
• cloning vectors referred to as "fosmids" or bacterial artificial chromosome (BAG) vectors are used. These are derived from E. coli f-factor which is able to stably integrate large segments of DNA. When integrated with DNA from a mixed uncultured mixed population sample, this makes it possible to achieve large genomic fragments in the form of a stable "mixed population nucleic acid library.”
• the nucleic acids derived from a mixed population or sample may be inserted into the vector by a variety of procedures.
• the nucleic acid sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
• a typical cloning scenario may have the DNA "blunted" with an appropriate nuclease (e.g., Mung Bean Nuclease), methylated with, for example, EcoR I Methylase and Ugated to EcoR I linkers.
• the Unkers are then digested with an EcoR I Restriction Endonuclease and the DNA size fractionated (e.g., using a sucrose gradient).
• the resulting size fractionated DNA is then Ugated into a suitable vector for sequencing, screening or expression (e.g., a lambda vector and packaged using an in vitro lambda packaging extract).
• Transformation of a host cell with recombinant DNA may be carried out by conventional techniques as are well known to those skilled in the art.
• the host is prokaryotic, such as E. coli
• competent cells which are capable of DNA uptake can be prepared from cells harvested after exponential growth phase and subsequently treated by the CaCl 2 method by procedures well known in the art.
• MgCl 2 or RbCl can be used. Transformation can also be performed after forming a protoplast of the host cell or by electroporation. Transformation of Pseudomonas fluorescens and yeast host cells can be achieved by electroporation, using techniques described herein.
• Eukaryotic cells can also be cotransfected with a second foreign DNA molecule encoding a selectable marker, such as the herpes simplex thymidine kinase gene.
• a eukaryotic viral vector such as simian virus 40 (SV40) or bovine papiUoma virus
• SV40 simian virus 40
• bovine papiUoma virus bovine papiUoma virus
• the eukaryotic cell maybe a yeast cell (e.g., Saccharomyces cerevisiae), an insect cell (e.g., Drosophila sp.) or may be a mammalian cell, including a human cell.
• Eukaryotic systems and mammalian expression systems, allow for post- translational modifications of expressed mammalian proteins to occur.
• Eukaryotic cells which possess the cellular machinery for processing of the primary transcript, glycosylation, phosphorylation, and, advantageously secretion of the gene product should be used.
• host cell lines may include, but are not limited to, CHO, VERO, BHK, HeLa; COS, MDCK, Jurkat, HEK-293, and WI38.
• the 'biopanning procedure refers to a process for identifying clones having a specified biological activity by screening for sequence homology in the Ubrary of clones, using at least one probe DNA comprising at least a portion of a DNA sequence encoding a polypeptide having the specified biological activity; and detecting interactions with the probe DNA to a substantially complementary sequence in a clone.
• Clones either viable or non- viable are then separated by an analyzer (e.g., a FACS apparatus or an apparatus that detects non-optical markers).
• the probe DNA used to probe for the target DNA of interest contained in clones prepared from polynucleotides in a mixed population of organisms can be a full-length coding region sequence or a partial coding region sequence of DNA for a known bioactivity.
• the sequence of the probe can be generated by synthetic or recombinant means and can be based upon computer based sequencing programs or biological sequences present in a clone.
• the DNA library can be probed using mixtures of probes comprising at least a portion of the DNA sequence encoding a known bioactivity having a desired activity. These probes or probe libraries are preferably single-stranded.
• the probes that are particularly suitable are those derived from DNA encoding bioactivities having an activity similar or identical to the specified bioactivity which is to be screened.
• a nucleic acid library from a mixed population of organisms is screened for a sequence of interest by transfecting a host cell containing the library with at least one labeled nucleic acid sequence which is all or a portion of a DNA sequence encoding a bioactivity having a desirable activity and separating the library clones containing the desirable sequence by optical- or non-optical-based analysis.
• in vivo biopanning may be performed utilizing a FACS-based machine.
• Complex gene libraries are constructed with vectors which contain elements which stabilize transcribed RNA.
• sequences which result in secondary structures such as hairpins which are designed to flank the transcribed regions of the RNA would serve to enhance their stability, thus increasing their half life within the cell.
• the probe molecules used in the biopanning process consist of oligonucleotides labeled with reporter molecules that only fluoresce upon binding of the probe to a target molecule.
• Various dyes or stains well known in the art, for example those described in "Practical Flow Cytometry", 1995 Wiley-Liss, Inc., Howard M.
• Shapiro, M.D. can be used to intercalate or associate with nucleic acid in order to "label" the oligonucleotides.
• These probes are introduced into the recombinant cells of the library using one of several transformation methods.
• the probe molecules interact or hybridize to the transcribed target mRNA or DNA resulting in DNA/RNA heteroduplex molecules or DNA/DNA duplex molecules. Binding of the probe to a target will yield a fluorescent signal which is detected and sorted by the FACS machine during the screening process.
• the probe DNA should be at least about 10 bases and preferably at least 15 bases. Desirable size ranges for probe DNA are at least about 15 bases to about 100 bases, at least about 100 bases to about 500 bases, at least about 500 bases to about 1,000 bases, at least about 1,000 bases to about 5,000 bases and at least about 5,000 bases to about 10,000 bases. In one embodiment, an entire coding region of one part of a pathway may be employed as a probe. Where the probe is hybridized to the target DNA in an in vitro system, conditions for the hybridization in which target DNA is selectively isolated by the use of at least one DNA probe will be designed to provide a hybridization stringency of at least about 50% sequence identity, more particularly a stringency providing for a sequence identity of at least about 70%.
• Hybridization techniques for probing a microbial DNA library to isolate target DNA of potential interest are well known in the art and any of those which are described in the literature are suitable for use herein.
• the clones Prior to fluorescence sorting the clones may be viable or non- viable.
• the cells are fixed with paraformaldehyde prior to sorting.
• polynucleotides present in the separated clones may be further manipulated. In some instances, it may be desirable to perform an ampUfication of the target DNA that has been isolated.
• the target DNA is separated from the probe DNA after isolation.
• the clone can be grown to expand the clonal population.
• the host cell is lysed and the target DNA amplified. It is then amplified before being used to transform a new host (e.g., subcloning).
• Long PCR Barnes, W M, Proc. Natl. Acad. Sci, USA, Mar. 15, 1994
• Numerous amplification methodologies are now well known in the art.
• the selected DNA is then used for preparing a library for further processing and screening by transforming a suitable organism.
• Hosts particularly those specifically identified herein as preferred, are transformed by artificial introduction of a vector containing a target DNA by inoculation under conditions conducive for such transformation.
• the resultant Ubraries (enriched for a polynucleotide of interest) can then be screened for clones which display an activity of interest.
• Clones can be shuttled in alternative hosts for expression of active compounds, or screened using methods described herein.
• the screening for activity may be effected on individual expression clones or may be initially effected on a mixture of expression clones to ascertain whether or not the mixture has one or more specified activities. If the mixture has a specified activity, then the individual clones may be rescreened for such activity or for a more specific activity.
• an encapsulation techniques such as GMDs, which may be employed to locaUze at least one clone in one location for growth or screening by a fluorescent analyzer (e.g. FACS).
• the separated at least one clone contained in the GMD may then be cultured to expand the number of clones or screened on a FACS machine to identify clones containing a sequence of interest as described above, which can then be broken out into individual clones to be screened again on a FACS machine to identify positive individual clones. Screening in this manner using a FACS machine is described in patent application Ser. No.08/876,276, filed June 16, 1997, herein incorporated by reference.
• the individual clones may be recovered and rescreened utilizing a FACS machine to determine which of such clones has the specified desirable activity.
• a normalization step is performed prior to generation of the expression library, the expression library is then generated, the expression library so generated is then biopanned, and the biopanned expression library is then screened using a high throughput cell sorting and screening instrument.
• a normalization step is performed prior to generation of the expression library, the expression library is then generated, the expression library so generated is then biopanned, and the biopanned expression library is then screened using a high throughput cell sorting and screening instrument.
• the library may, for example, be screened for a specified enzyme activity.
• the enzyme activity screened for may be one or more of the six IUB classes; oxidoreductases, transferases, hydrolases, lyases, isomerases and ligases.
• the recombinant enzymes which are determined to be positive for one or more of the IUB classes may then be rescreened for a more specific enzyme activity.
• the library may be screened for a more specialized enzyme activity.
• the library may be screened for a more specialized activity, i.e. the type of bond on which the hydrolase acts.
• the library may be screened to ascertain those hydrolases which act on one or more specified chemical functionalities, such as: (a) amide (peptide bonds), i.e. proteases; (b) ester bonds, i.e. esterases and Upases; (c) acetals, i.e., glycosidases etc.
• the invention provides a process for activity screening of clones containing selected DNA derived from a mixed population of organisms or more than one organism. Biopanning polynucleotides from a mixed population of organisms by separating the clones or polynucleotides positive for sequence of interest with a fluorescent analyzer that detects fluorescence, to select polynucleotides or clones containing polynucleotides positive for a sequence of interest, and screening the selected clones or polynucleotides for specified bioactivity.
• the polynucleotides are contained in clones having been prepared by recovering DNA of a microorganism, which DNA is selected by hybridization to at least one DNA sequence which is all or a portion of a DNA sequence encoding a bioactivity having a desirable activity.
• a DNA library derived from a microorganism is subjected to a selection procedure to select therefrom DNA which hybridizes to one or more probe DNA sequences which is all or a portion of a DNA sequence encoding an activity having a desirable activity by:
• the present invention offers the abiUty to screen for many types of bioactivities. For instance, the ability to select and combine desired components from a Ubrary of polyketides and postpolyketide biosynthesis genes for generation of novel polyketides for study is appealing.
• the method(s) of the present invention make it possible to and facilitate the cloning of novel polyketide synthase genes and/or gene pathways, and other relevant pathways or genes encoding commercially relevant secondary metabolites, since one can generate gene banks with clones containing large inserts (especially when using vectors which can accept large inserts, such as the f-factor based vectors), which facilitates cloning of gene clusters.
• the biopanning approach described above can be used to create libraries enriched with clones carrying sequences substantially homologous to a given probe sequence.
• Ubraries containing clones with inserts of up to 40 kbp or larger can be enriched approximately 1,000 fold after each round of panning. This enables one to reduce the number of clones to be screened after 1 round of biopanning enrichment.
• This approach can be applied to create libraries enriched for clones carrying sequence of interest related to a bioactivity of interest, for example, polyketide sequences.
• Hybridization screening using high density filters or biopanning has proven an efficient approach to detect homologues of pathways containing genes of interest to discover novel bioactive molecules that may have no known counterparts.
• a polynucleotide of interest is enriched in a library of clones it may be desirable to screen for an activity. For example, it may be desirable to screen for the expression of small molecule ring structures or "backbones". Because the genes encoding these polycyclic structures can often be expressed in E. coli, the small molecule backbone can be manufactured, even if in an inactive form. Bioactivity is conferred upon transferring the molecule or pathway to an appropriate host that expresses the requisite glycosylation and methylation genes that can modify or "decorate" the structure to its active form.
• E. coli can produce active small molecules and in certain instances it may be desirable to shuttle clones to a metaboUcally rich host for "decoration" of the structure, but not required.
• the use of high throughput robotic systems allows the screening of hundreds of thousands of clones in multiplexed arrays in microtiter dishes.
• FACS screening a procedure described and exempUfied in U.S. Ser. No. 08/876,276, filed June 16, 1997.
• Polycyclic ring compounds typically have characteristic fluorescent spectra when excited by ultraviolet Ught.
• clones expressing these structures can be distinguished from background using a sufficiently sensitive detection method.
• High throughput FACS screening can be utilized to screen for small molecule backbones in, for example, E. coU libraries.
• Commercially available FACS machines are capable of screening up to 100,000 clones per second for UV active molecules. These clones can be sorted for further FACS screening or the resident plasmids can be extracted and shuttled to Streptomyces for activity screening.
• a bioactivity or biomolecule or compound is detected by using various electromagnetic detection devices, including, for example, optical, magnetic and thermal detection associated with a flow cytometer.
• Flow cytometer typically use an optical method of detection (fluorescence, scatter, and the like) to discriminate individual cells or particles from within a large population.
• optical method of detection fluorescence, scatter, and the like
• Magnetic field sensing is one such techniques that can be used as an alternative or in conjunction with, for example, fluorescence based methods.
• Hall-Effect Sensors are one example of sensors that can be employed.
• Superconducting Quantum Interference Devices (“SQUIDS”) are the most sensitive sensors for magnetic flux and magnetic fields, so far developed.
• a standardized criteria for the sensitivity of a SQUID is its energy resolution. This is defined as the smallest change in energy that the SQUID can detect in one second (or in a bandwidth of 1 Hz). Typical values are 10 " J/Hz.
• the utitity of SQUIDS can be found in the presence of magnetosomes in certain types of bacterial that contain chains of permanent single magnetic domain particles of magnetite (FE 3 O ) of gregite (Fe 3 S ).
• the magnetic field (or residual magnetic field) of a cell that contains a magnetosome is detected by positioning a SQUTD in close proximity to the flow stream of a flow cytometer.
• cells or cells containing, for example, magnetic probes can be isolated based on their magnetic properties.
• changes in the synthetic pathway of magnetosome containing bacteria can be measured using a similar technique. Such techniques can be used to identify agents which modulate the synthetic pathway of magnetosomes.
• MCS Multipole Coupling Spectroscopy
• MCS utilizes a small microwave (500 MHz to 50 GHz) transceiver that could be positioned in close proximity to the flow stream of a flow cytometer. Because of the short measurement times (e.g., microseconds) required, a complete MCS signature for each cell within the stream of a flow cytometer can be generated and analyzed. Certain cells can then be sorted and/or isolated based on either spectral features that are known a priori or based on some statistical variation from a general population. Examples of uses for this technique include selection of expression mutants, small molecule pre-screening, and the like.
• biomolecules from candidate clones can be tested for bioactivity by susceptibility screening against test organisms such as Staphylococcus aureus, Micrococcus luteus, E. coU, or Saccharomyces cervisiae.
• FACS screening can be used in this approach by co-encapsulating clones with the test organism.
• the “mixed extract” screening approach takes advantage of the fact that the accessory genes needed to confer activity upon the polycyclic backbones are expressed in metaboUcally rich hosts, such as Streptomyces, and that the enzymes can be extracted and combined with the backbones extracted from E. coli clones to produce the bioactive compound in vitro.
• Enzyme extract preparations from metaboUcally rich hosts, such as Streptomyces strains, at various growth stages are combined with pools of organic extracts from E. coli libraries and then evaluated for bioactivity.
• Another approach to detect activity in the E. coli clones is to screen for genes that can convert bioactive compounds to different forms.
• a recombinant enzyme was recently discovered that can convert the low value daunomycin to the higher value doxorubicin. Similar enzyme pathways are being sought to convert penicillins to cephalosporins. Screening may be carried out to detect a specified enzyme activity by procedures known in the art. For example, enzyme activity may be screened for one or more of the six IUB classes; oxidoreductases, transferases, hydrolases, lyases, isomerases and ligases. The recombinant enzymes which are determined to be positive for one or more of the IUB classes may then be rescreened for a more specific enzyme activity. Alternatively, the library may be screened for a more speciaUzed enzyme activity.
• the Ubrary may be screened for a more specialized activity, i.e. the type of bond on which the hydrolase acts.
• the library may be screened to ascertain those hydrolases which act on one or more specified chemical functionalities, such as: (a) amide (peptide bonds), i.e. proteases; (b) ester bonds, i.e. esterases and Upases; (c) acetals, i.e., glycosidases.
• FACS screening can also be used to detect expression of UV fluorescent molecules in any host, including metaboUcally rich hosts, such as Streptomyces.
• recombinant oxytetracylin retains its diagnostic red fluorescence when produced heterologously in S. Uvidans TK24.
• Pathway clones which can be sorted by FACS, can thus be screened for polycyclic molecules in a high throughput fashion.
• Recombinant bioactive compounds can also be screened in vivo using "two- hybrid" systems, which can detect enhancers and inhibitors of protein-protein or other interactions such as those between transcription factors and their activators, or receptors and their cognate targets.
• both the small molecule pathway and the reporter construct are co-expressed. Clones altered in reporter expression can then be sorted by FACS and the pathway clone isolated for characterization.
• DNA can be isolated from positive clones utiUzing techniques well known in the art.
• the DNA can then be amplified either in vivo or in vitro by utiUzing any of the various amplification techniques known in the art. In vivo ampUfication would include transformation of the clone(s) or subclone(s) into a viable host, followed by growth of the host. In vitro amplification can be performed using techniques such as the polymerase chain reaction. Once amplified the identified sequences can be "evolved" or sequenced.
• One advantage afforded by present invention is the abiUty to manipulate the identified polynucleotides to generate and select for encoded variants with altered activity or specificity.
• Clones found to have the bioactivity for which the screen was performed can be subjected to directed mutagenesis to develop new bioactivities with desired properties or to develop modified bioactivities with particularly desired properties that are absent or less pronounced in the wild-type activity, such as stabiUty to heat or organic solvents.
• Any of the known techniques for directed mutagenesis are applicable to the invention.
• particularly preferred mutagenesis techniques for use in accordance with the invention include those described below.
• Such variegation can modify the polynucleotide sequence in order to modify (e.g., increase or decrease) the encoded polypeptide's activity, specificity, affinity, function, etc.
• Such evolution methods are known in the art or described herein, such as, shuffling, cassette mutagenesis, recursive ensemble mutagenesis, sexual PCR, directed evolution, exonuclease- mediated reassembly, codon site-saturation mutagenesis, amino acid site-saturation mutagenesis, gene site saturation mutagenesis, introduction of mutations by non- stochastic polynucleotide reassembly methods, synthetic ligation polynucleotide reassembly, gene reassembly, oligonucleotide-directed saturation mutagenesis, in vivo reassortment of polynucleotide sequences having partial homology, naturally occurring recombination processes which reduce sequence complexity, and any combination thereof.
• the clones enriched for a desired polynucleotide sequence may be sequenced to identify the DNA sequence(s) present in the clone, which sequence information can be used to screen a database for similar sequences or functional characteristics.
• DNA having a sequence of interest e.g., a sequence encoding an enzyme having a specified enzyme activity
• associate the sequence with known or unknown sequence in a database e.g., database sequence associated with an enzyme having an activity (including the amino acid sequence thereof)
• a database sequence associated with an enzyme having an activity including the amino acid sequence thereof
• Sequencing may be performed by high through-put sequencing techniques.
• the exact method of sequencing is not a limiting factor of the invention. Any method useful in identifying the sequence of a particular cloned DNA sequence can be used.
• sequencing is an adaptation of the natural process of DNA replication. Therefore, a template (e.g., the vector) and primer sequences are used.
• a template preparation and sequencing protocol begins with automated picking of bacterial colonies, each of which contains a separate DNA clone which will function as a template for the sequencing reaction. The selected clones are placed into media, and grown overnight. The DNA templates are then purified from the cells and suspended in water.
• sequencers such as Applied Biosystems, Inc., Prism 377 DNA Sequencers.
• the resulting sequence data can then be used in additional methods, including to search a database or databases. Database Searches and Alignment Algorithms
• a number of source databases are available that contain either a nucleic acid sequence and/or a deduced amino acid sequence for use with the invention in identifying or determining the activity encoded by a particular polynucleotide sequence. All or a representative portion of the sequences (e.g., about 100 individual clones) to be tested are used to search a sequence database (e.g., GenBank, PFAM or ProDom), either simultaneously or individually. A number of different methods of performing such sequence searches are known in the art.
• the databases can be specific for a particular organism or a collection of organisms. For example, there are databases for the C. elegans, Arabadopsis. sp., M. genitalium, M. jannaschii, E. coli, H. influenzae, S. cerevisiae and others.
• the sequence data of the clone is then aligned to the sequences in the database or databases using algorithms designed to measure homology between two or more sequences.
• sequence alignment methods include, for example, BLAST (Altschul et al, 1990), BLITZ (MPsrch) (Sturrock & Collins, 1993), and FASTA (Person & Lipman, 1988).
• the probe sequence e.g., the sequence data from the clone
• the threshold value may be predetermined, although this is not required.
• the threshold value can be based upon the particular polynucleotide length.
• To align sequences a number of different procedures can be used. Typically, Smith-Waterman or Needleman- Wunsch algorithms are used. However, as discussed faster procedures such as BLAST, FASTA, PSI-BLAST can be used.
• optimal aUgnment of sequences for aligning a comparison window may be conducted by the local homology algorithm of Smith (Smith and Waterman, Adv Appl Math, 1981; Smith and Waterman, J Teor Biol, 1981; Smith and Waterman, J Mol Biol, 1981; Smith et al, J Mol Evol, 1981), by the homology alignment algorithm of Needleman (Needleman and Wuncsch, 1970), by the search of similarity method of Pearson (Pearson and Lipman, 1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, WI, or the Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin, Madison, WT), or by inspection, and the best alignment (i.e., resulting in the highest percentage of homology over the comparison window) generated by the various methods is selected.
• the similarity of the two sequence i.e., the probe sequence and the database sequence
• Such software matches similar sequences by assigning degrees of homology to various deletions, substitutions and other modifications.
• the terms "homology” and "identity" in the context of two or more nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same when compared and aUgned for maximum correspondence over a comparison window or designated region as measured using any number of sequence comparison algorithms or by manual alignment and visual inspection.
• sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
• test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
• sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
• a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
• BLAST and BLAST 2.0 algorithms are described in Altschul et al, Nuc. Acids Res.25:3389-3402 (1977) and Altschul et al, J. Mol. Biol. 215:403-410 (1990), respectively.
• Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/).
• This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence.
• HSPs high scoring sequence pairs
• W wordlength
• E expectation
• the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul, Proc. Natl. Acad. Sci. USA 90:5873 (1993)).
• One measure of similarity provided by BLAST algorithm is the smallest sum probabiUty (P(N)), which provides an indication of the probability by which a match between two nucleotide sequences would occur by chance.
• P(N) probabiUty
• a nucleic acid is considered similar to a references sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
• Sequence homology means that two polynucleotide sequences are homolgous (i.e., on a nucleotide-by-nucleotide basis) over the window of comparison.
• a percentage of sequence identity or homology is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence homology.
• This substantial homology denotes a characteristic of a polynucleotide sequence, wherein the polynucleotide comprises a sequence having at least 60 percent sequence homology, typically at least 70 percent homology, often 80 to 90 percent sequence homology, and most commonly at least 99 percent sequence homology as compared to a reference sequence of a comparison window of at least 25-50 nucleotides, wherein the percentage of sequence homology is calculated by comparing the reference sequence to the polynucleotide sequence which may include deletions or additions which total 20 percent or less of the reference sequence over the window of comparison.
• Sequences having sufficient homology can the be further identified by any annotations contained in the database, including, for example, species and activity information. Accordingly, in a typical mixed population sample, a plurality of nucleic acid sequences will be obtained, cloned, sequenced and corresponding homologous sequences from a database identified. This information provides a profile of the polynucleotides present in the sample, including one or more features associated with the polynucleotide including the organism and activity associated with that sequence or any polypeptide encoded by that sequence based on the database information. As used herein "fingerprint” or “profile” refers to the fact that each sample will have associated with it a set of polynucleotides characteristic of the sample and the environment from which it was derived.
• Such a profile can include the amount and type of sequences present in the sample, as well as information regarding the potential activities encoded by the polynucleotides and the organisms from which polynucleotides were derived. This unique pattern is each sample's profile or finge rint.
• a particular cloned polynucleotide sequence once its identity or activity is determined or an suggested identity or activity is associated with the polynucleotide.
• the desired clone if not already cloned into an expression vector, is Ugated downstream of a regulatory control element (e.g., a promoter or enhancer) and cloned into a suitable host cell.
• a regulatory control element e.g., a promoter or enhancer
• expression vectors which may be used there may be mentioned viral particles, baculovirus, phage, plasmids, phagemids, cosmids, fosmids, bacterial artificial chromosomes, viral nucleic acid (e.g., vaccinia, adenovirus, foul pox virus, pseudorabies and derivatives of SV40), PI -based artificial chromosomes, yeast plasmids, yeast artificial chromosomes, and any other vectors specific for specific hosts of interest (such as bacillus, aspergillus, yeast, etc.)
• the DNA may be included in any one of a variety of expression vectors for expressing a polypeptide.
• Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences. Large numbers of suitable vectors are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example; ZAP Express, Lambda ZAP ® - CMV, Lambda ZAP ® II , Lambda gtlO, Lambda gtl 1, pMyr, pSos, pCMV-Script, pCMV-Script XR, pBK Phagemid, pBK-CMV, pBK- RSV, pBluescript II Phagemid, pBluescript II KS +, pBluescript II SK +, pBluescript II SK-, Lambda FIX II, Lambda DASH II, Lambda EMBL3 and EMBL4, EMBL3, EMBL4, SuperCos I and ⁇ WE15, ⁇ WE15, SuperCos I, pPCR-Script Amp, pPCR- Script Cam
• the nucleic acid sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
• promoters include lad, lacZ, T3, T7, gpt, lambda PR, PL, SP6, tip, / ⁇ cUV5, PBAD, araBAD, araB, trc, proV, p-D-HSP, HSP, GAL4 UAS/Elb, TK, GAL1, CMV/TetO 2 Hybrid, EF-la CMV, EF-la CMV, EF-la CMV, EF, EF-la, ubiquitin C, rsv-ltr, rsv , b -lactamase, nmtl, and gallO.
• Eukaryotic promoters include CMN immediate early, HSN thymidine kinase, early and late SN40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
• the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator.
• the vector may also include appropriate sequences for amplifying expression. Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers.
• the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.
• the nucleic acid sequence(s) selected, cloned and sequenced as hereinabove described can additionally be introduced into a suitable host to prepare a Ubrary which is screened for the desired enzyme activity.
• the selected nucleic acid is preferably already in a vector which includes appropriate control sequences whereby a selected nucleic acid encoding an enzyme maybe expressed, for detection of the desired activity.
• the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
• the selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.
• nucleic acid sequence is amplified by PCR reaction or similar reaction known to those of skill in the art.
• PCR reaction or similar reaction known to those of skill in the art.
• amplification kits are available to carry out such amptification reactions.
• the alignment algorithms and searchable database can be implemented in computer hardware, software or a combination thereof. Accordingly, the isolation, processing and identification of nucleic acid sequences and the corresponding polypeptides encoded by those sequence can be implemented in and automated system.
• FIG. 6A shows a capillary array (10) which includes a plurality of individual capillaries (20) having at least one outer wall (30) defining a lumen (40).
• the outer wall (30) of the capillary (20) can be one or more walls fused together.
• the wall can define a lumen (40) that is cylindrical, square, hexagonal or any other geometric shape so long as the walls form a lumen for retention of a liquid or sample.
• the capillaries (20) of the capillary array (10) are held together in close proximity to form a planar structure.
• the capillaries (20) can be bound together, by being fused (e.g., where the capillaries are made of glass), glued, bonded, or clamped side-by-side.
• the capillary array (10) can be formed of any number of individual capillaries (20). In an embodiment, the capillary array includes 100 to 4,000,000 capillaries (20). In one embodiment, the capillary array includes 100 to 500,000,000 capillaries (20). In one embodiment, the capillary array includes 100,000 capillaries (20). In one specific embodiment, the capillary array (10) can be formed to conform to a microtiter plate footprint, i.e. 127.76mm by 85.47mm, with tolerances. The capillary array (10) can have a density of 500 to more than 1,000 capillaries (20) per cm2, or about 5 capillaries per mm2. For example, a microtiter plate size array of 3um capillaries would have about 500 million capillaries.
• the capillaries (20) are preferably formed with an aspect ratio of 50: 1. hi one embodiment, each capillary (20) has a length of approximately 10mm, and an internal diameter of the lumen (40) of approximately 200 ⁇ m. However, other aspect ratios are possible, and range from 10:1 to well over 1000:1. Accordingly, the thickness of the capillary array can vary from 0.5mm to over 10cm. Individual capillaries (20) have an inner diameter that ranges from 3- 500 ⁇ m and 0-500 ⁇ m. A capillary (20) having an internal diameter of 200 ⁇ m and a length of 1 cm has a volume of approximately 0.3 ⁇ l.
• each capillary (20) is based on a desired volume and other characteristics discussed in more detail below, such as evaporation rate of liquid from within the capillary, and the like.
• Capillaries of the invention may include a volume as low as 250 nanoUters/well.
• one or more particles are introduced into each capillary (20) for screening.
• Suitable particles include cells, cell clones, and other biological matter, chemical beads, or any other particulate matter.
• the capillaries (20) containing particles of interest can be introduced with various types of substances for causing an activity of interest.
• the introduced substance can include a liquid having a developer or nutrients, for example, which assists in cell growth and which results in the production of enzymes.
• a chemical solution containing new particles can cause a combining event with other chemical beads already introduced into one or more capillaries (20).
• the particles and resulting activity of interest are screened and analyzed using the capillary array (10) according to the present invention, hi one embodiment, the activity produces a change in properties of matter within the capillary (20), such as optical properties of the particles.
• Each capillary can act as a waveguide for guiding detectable light energy or property changes to an analyzer.
• the capillaries (20) can be made according to various manufacturing techniques.
• the capillaries (20) are manufactured using a hollow-drawn technique.
• a cylindrical, or other hollow shape, piece of glass is drawn out to continually longer lengths according to known techniques.
• the piece of glass is preferably formed of multiple layers.
• the drawn glass is then cut into portions of a specific length to form a relatively large capillary.
• the capillary portions are next bundled into an array of relatively large capillaries, and then drawn again to increasingly narrower diameters.
• application of heat can fuse interstitial areas of adjacent capillaries together.
• a glass etching process is used.
• a soUd tube of glass is drawn out to a particular width, cut into portions of a specific length, and drawn again. Then, each soUd tube portion is center-etched with an acid or other etchant to form a hollow capillary.
• the tubes can be bound or fused together before or after the etch process.
• a number of capillary arrays (10) can be connected together to form an array of arrays (12), as shown in Figure 6B.
• the capillary arrays (10) can be glued together. Alternatively, the capillary arrays (10) can be fused together.
• the anay of arrays (12) can have any desired size or footprint, formed of any number of high-precision capillary arrays (10).
• a large number of materials can be suitably used to form a capillary array according to the invention and depending on the manufacturing technique used, including without limitation, glass, metal, semiconductors such as siUcon, quartz, ceramics, or various polymers and plastics including, among others, polyethylene, polystyrene, and polypropylene.
• the internal walls of the capillary array, or portions thereof, may be coated or silanized to modify their surface properties. For example, the hydrophilicity or hydrophobicity may be altered to promote or reduce wicking or capillary action, respectively.
• the coating material includes, for example, ligands such as avidin, streptavidin, antibodies, antigens, and other molecules having specific binding affinity or which can withstand thermal or chemical steriUzation.
• the size, spacing and alignment of the capillaries within an array may be non-uniform.
• One capillary array according to the invention may be cut horizontally along its thickness, and separated to form two capillary arrays.
• the two resulting capillary arrays will each include at least one surface having capillary openings of substantially identical size, spacing and alignment, and suitable for contacting together for transferring liquid from one resulting capillary array to the other.
• FIG. 7 shows a horizontal cross section of a portion of an array of capillaries (20).
• Capillary (20) is shown having a first cylindrical wall (30), a lumen (40), a second exterior wall (50), and interstitial material (60) separating the capillary tubes in the array (10).
• the cylindrical wall (30) is comprised of a sleeve glass
• exterior wall (50) is comprised of an extra mural absorption (EMA) glass to minimize optical crosstalk among neighboring capillaries (20).
• EMA extra mural absorption
• a capillary array may optionally include reference indicia (22) for providing a positional or alignment reference.
• the reference indicia (22) may be formed of a pad of glass extending from the surface of the capillary array, or embedded in the interstitial material (60).
• the reference indicia (22) are provided at one or more corners of a microtiter plate formed by the capillary array. According to the embodiment, a corner of the plate or set of capillaries may be removed, and replaced with the reference indicia (22).
• the reference indicia (22) may also be formed at spaced intervals along a capillary array, to provide an indication of a subset of capillaries (20).
• Figure 8 depicts a vertical cross-section of a capillary of the invention.
• the capillary (20) includes a first wall (30) defining a lumen (40), and a second wall (50) surrounding the first wall (30).
• the second wall (50) has a lower index of refraction than the first wall (30).
• the first wall (30) is sleeve glass having a high index of refraction, forming a waveguide in which light from excited fluorophores travels.
• the second wall (50) is black EMA glass, having a low index of refraction, forming a cladding around the first wall (30) against which tight is refracted and directed along the first wall (30) for total internal reflection within the capillary (20).
• the second wall (50) can thus be made with any material that reduces the "cross-talk” or diffusion of tight between adjacent capillaries.
• the inside surface of the first wall (30) can be coated with a reflective substance to form a mirror, or mirror-like structure, for specular reflection within the lumen (40).
• a filtering material can be formed around the lumen (40) to filter energy to and from the lumen (40) as depicted in Figure 9.
• the inner wall of the first wall (30) of each capillary of the array, or portion of the array is coated with the filtering material.
• the second wall (50) includes the filtering material.
• the second wall (50) can be formed of the filtering material, such as filter glass for example, or in one exemplary embodiment, the second wall (50) is EMA glass that is doped with an appropriate amount of filtering material.
• the filtering material can be formed of a color other than black and tuned for a desired excitation/emission filtering characteristic.
• the filtering material allows transmission of excitation energy into the lumen (40), and blocks emission energy from the lumen (40) except through one or more openings at either end of the capillary (20).
• excitation energy is illustrated as a soUd line, while emission energy is indicated by a broken line.
• the second wall (50) is formed with a filtering material as shown in Figure 9, certain wavelengths of light representing excitation energy are allowed through to the lumen (40), and other wavelengths of light representing emission energy are blocked from exiting, except as directed within and along the first wall (30).
• the entire capillary array, or a portion thereof, can be tuned to a specific individual wavelength or group of wavelengths, for filtering different bands of light in an excitation and detection process.
• a particle (70) is depicted within the lumen (40).
• an excitation light is directed into the lumen (40) contacting the particle (70) and exciting a reporter fluorescent material causing emission of Ught.
• the emitted light travels the length of the capillary until it reaches a detector.
• the second wall (50) is black EMA glass
• the black EMA glass refracts and directs the emitted light towards either end of the capillary tube thus increasing the signal detected by an optical detector (e.g., a CCD camera and the Uke).
• an optical detection system is atigned with the array, which is then scanned for one or more bright spots, representing either a fluorescence or luminescence associated with a "positive."
• the term "positive” refers to the presence of an activity of interest. Again, the activity can be a chemical event, or a biological event.
• FIG. 10 depicts a general method of sample screening using a capillary array (10) according to the invention, hi this depiction, capillary array (10) is immersed or contacted with a container (100) containing particles of interest.
• the particles can be cells, clones, molecules or compounds suspended in a liquid.
• the liquid is wicked into the capillary tubes by capillary action.
• a substrate for measuring biological activity e.g., enzyme activity
• the substrate can include clones of a cell of interest, for example.
• the substrate can be introduced simultaneously into the capillaries by placing an open end of the capillaries in the container (100) containing a mixture of the particle-bearing liquid and the substrate.
• a particular concentration of particles may also be achieved by dilution.
• FigureS 13A-C show one such process, which is described below.
• the particle-bearing liquid may be wicked a portion of the way into the capillaries, and then the substrate is wicked into a remaining portion of the capillaries.
• the mixture in the capillaries can then be incubated for producing a desired activity.
• the incubation can be for a specific period of time and at an appropriate temperature necessary for cell growth, for example, or to allow the substrate to permeabilize the cell membrane to produce an optically detectable signal, or for a period of time and at a temperature for optimum enzymatic activity.
• the incubation can be performed, for example, by placing the capillary anay in a humidified incubator or in an apparatus containing a water source to ensure reduced evaporation within the capillary tubes. Evaporative loss may be reduced by increasing the relative humidity (e.g., by placing the capillary array in a humidified chamber).
• the evaporation rate can also be reduced by capping the capillaries with an oil, wax, membrane or the like.
• a high molecular weight fluid such as various alcohols, or molecules capable of forming a molecular monolayer, bilayers or other thin films (e.g., fatty acids), or various oils (e.g., mineral oil) can be used to reduce evaporation.
• Figure 11 illustrate a method for incubating a substrate solution containing cells of interest. While only a single capillary (20) is shown in Figure 11 for simplicity, it should be understood that the incubation method applies to a capillary array having a pluraUty of capillaries (20).
• a first fluid is wicked into the capillary (20) according to methods described above.
• the capillary (20) containing the substrate solution and cells (32) is then introduced to a fluid bath (70) containing a second liquid (72).
• the second liquid may or may not be the same as the first.
• the first liquid may contain particles (32) from which an activity is screened.
• the particles (32) are suspended in Uquid within the lumen (40), and gradually migrate toward the top of the lumen (40) in the direction of the flow of liquid through the capillary (20) due to evaporation.
• the width of the lumen (40) at the open end of the capillary (20) is sized to provide a particular surface area of liquid at the top of the lumen (40), for controlUng the amount and rate of evaporation of the Uquid mixture.
• the amount of evaporation is balanced against possible diffusion of the contents of the capillary (20) into the liquid (72), and against possible mechanical mixing of the capillary contents with the liquid (72) due to vibration and pressure changes.
• the non- submersed open end of the capillary (20) may also be capped to create a vacuum force for holding the capillary contents within the capillary, and minimizing mechanical mixing and diffusion of the contents within the liquid (72). However when capped, the capillary (20) will not experience evaporation.
• the liquid (72) can be supplemented with nutrients (74) to support a greater likelihood or rate of activity of the particles (32).
• oxygen can be added to the liquid to nourish cells or to optimize the incubation environment of the cells.
• the liquid (72) can contain a substrate or a recombinant clone, or a developer for the particles (32).
• the cells can be optimally cultured by controlling the amount and rate of evaporation. For instance, by decreasing relative humidity of the environment (68), evaporation from the lumen (40) is increased, thereby increasing a rate of flow of liquid (72) through the capillary (20). Another advantage of this method is the ability to control conditions within the capillary (20) and the environment (68) that are not otherwise possible.
• FIG. 12A shows a portion of a capillary array (10) of the invention, to depict a situation in which a condensation bead (80) forms on the outer edge surface of several capillary walls (30), creating a potential conduit or bridge for "crosstalk" of matter between adjacent capillary tubes (20).
• the outer edge surface of the capillary walls (30) is preferably a planar surface. In an embodiment in which the wall (30) of the capillary (20) is glass, the outer edge surface of the capillary wall (30) can be polished glass.
• a hydrophobic coating (35) is provided over the outer edge surface of the capillary walls (30), as depicted in Figure 12B.
• the coating (35) reduces the tendency for water or other Uquid to accumulate near the outer edge surface of the capillary wall (30). Condensation will form either as smaller beads (82), be repelled from the surface of the capillary array, or form entirely over an opening to the lumen (40). In the latter case, the condensation bead (80) can form a cap to the capillary (20).
• the hydrophobic coating (35) is TEFLON. In one configuration, the coating (35) covers only the outer edge surfaces of the capillary walls (30).
• the coating (35) can be formed over both the interstitial material (60) and the outer edge surfaces of the capillary walls (30).
• Another advantage of a hydrophobic coating (35) over the outer edge surface of the capillary tubes is during the initial wicking process, some fluidic material in the form of droplets will tend to stick to the surface in which the fluid is introduced. Therefore, the coating (35) minimizes extraneous fluid from fo ⁇ ning on the surface of a capillary array (10), dispensing with a need to shake or knock the extraneous fluid from the surface.
• FigureS 13A-C show a dilution process that may be used to achieve a particular concentration of particles.
• a bolus of a first component (82) is wicked into a capillary (20) by capillary action until only a portion of the capillary (20) is filled.
• pressure is applied at one end of the capillary
• (21) of the capillary may be completely or partially capped to provide the pressure.
• An amount of air (84) is then introduced into the capillary adjacent the first component.
• the air (84) can be introduced by any number of processes. One such process includes moving the first component (82) in one direction within the capillary until a suitable amount of the air (84) is introduced behind the first component (82). Further movement of the first component (82) by a pulling and/or pushing pressure causes a piston-like action by the first component (82) on the air.
• the capillary (20) or capillary anay is then contacted to a second component (86).
• the second component (86) is preferably pulled into the capillary (20) by the piston-like action created by movement of the first component (82), until a suitable amount of the second component (86) is provided in the capillary, separated from the first component by the air (84).
• One of the first or second components may contain one or more particles of interest, and the other of the components may be a developer of the particles for causing an activity of interest.
• the capillary or capillary anay can then be incubated for a period of time to allow the first and second components to reach an optimal temperature, or for a sufficient time to allow cell growth for example.
• the air-bubble separating the two components can be disrupted in order to allow mix the two components together and initiaUze the desired activity. Pressure can be applied to collapse the bubble.
• the mixture of the first and second components starts an enzymatic activity to achieve a multi-component assay.
• Paramagnetic beads contained within a capillary (20) can be used to disrupt the air bubble and/or mix the contents of the capillary (20) or capillary array (10).
• Figure 14A and 9B depict an embodiment of the invention in which paramagnetic beads are magnetically moved from one location to another location. The paramagnetic beads are attracted by magnetic fields applied in proximity to the capillary or capillary anay. By alternating or adjusting the location of the magnetic field with respect to each capillary, the paramagnetic beads will move within each capillary to mix the Uquid therein. Mixing the liquid can improve cell growth by increasing aeration of the cells. The method also improves consistency and detectabiUty of the Uquid sample among the capillaries.
• a method of forming a multi-component assay includes providing one or more capsules of a second component within a first component.
• the second component capsules can have an outer layer of a substance that melts or dissolves at a predetermined temperature, thereby releasing the second component into the first component and combining particles among the components.
• a thermally activated enzyme may be used to dissolve the outer layer substance.
• a "release on command" mechanism that is configured to release the second component upon a predetermined event or condition may also be used.
• recombinant clones containing a reporter construct or a substrate are wicked into the capillary tubes of the capillary anay.
• a substrate as the reporter construct or substrate contained in the clone can be readily detected using techniques known in the art.
• a clone containing a reporter construct such as green fluorescent protein can be detected by exposing the clone or substrate within the clone to a wavelength of light that induces fluorescence.
• Such reporter constructs can be implemented to respond to various culture conditions or upon exposure to various physical stimuti (including light and heat).
• various compounds can be screened in a sample using similar techniques. For example, a compound detectably labeled with a florescent molecule can be readily detected within a capillary tube of a capillary anay.
• a fluorescence-activated cell sorter (FACS) is used to separate and isolate clones for delivery into the capillary anay.
• FACS fluorescence-activated cell sorter
• one or more clones per capillary tube can be precisely achieved.
• cells within a capillary are subjected to a lysis process. A chemical is introduced within one of the components to cause a lysis process where the cells burst.
• Some assays may require an exchange of media within the capillary.
• a media exchange process a first Uquid containing the particles is wicked into a capillary. The first liquid is removed, and replaced with a second Uquid while the particles remain suspended within the capillary. Addition of the second Uquid to the capillary and contact with the particles can initialize an activity, such as an assay, for example.
• the media exchange process may include a mechanism by which the particles in the capillary are physically maintained in the capillary while the first liquid is removed.
• the inner walls of the capillary anay are coated with antibodies to which cells bind. Then, the first liquid is removed, while the cells remain bound to the antibodies, and the second liquid is wicked into the capillary.
• the second Uquid could be adapted to cause the cells to unbind if desirable.
• one or more walls of the capillary can be magnetized.
• the particles are also magnetized and attracted to the walls.
• magnetized particles are attracted and held against one side of the capillary upon application of a magnetic field near that side.
• the capillary array is analyzed for identification of capillaries having a detectable signal, such as an optical signal (e.g., fluorescence), by a detector capable of detecting a change in light production or light transmission, for example. Detection may be performed using an illumination source that provides fluorescence excitation to each of the capillaries in the anay, and a photodetector that detects resulting emission from the fluorescence excitation.
• Suitable illumination sources include, without -imitation, a laser, incandescent bulb, Ught emitting diode (LED), arc discharge, or photomultipUer tube.
• Suitable photodetectors include, without limitation, a photodiode anay, a charge- coupled device (CCD), or charge injection device (CID).
• a detection system includes a laser source (82) that produces a laser beam (84).
• the laser beam (84) is directed into a beam expander (85) configured to produce a wider or less divergent beam (86) for exciting the array of capillaries (20).
• Suitable laser sources include argon or ion lasers.
• a cooled CCD can be used.
• the light generated by, for example, enzymatic activation of a fluorescent substrate is detected by an appropriate light detector or detectors positioned adjacent to the apparatus of the invention.
• the light detector may be, for example, film, a photomultipUer tube, photodiode, avalanche photo diode, CCD or other light detector or camera.
• the Ught detector may be a single detector to detect sequential emissions, such as a scanning laser.
• the light detector may include a plurality of separate detectors to detect and spatially resolve simultaneous emissions at single or multiple wavelengths of emitted Ught.
• the light emitted and detected may be visible light or may be emitted as non-visible radiation such as infrared or ultraviolet radiation.
• a thermal detector may be used to detect an infrared emission.
• the detector or detectors may be stationary or movable.
• Illumination can be channeled to particles of interest within the anay by means of lenses, minors and fiber optic light guides or light conduits (single, multiple, fixed, or moveable) positioned on or adjacent to at least one surface of the capillary anay.
• a detectable signal such as emitted light or other radiation, may also be channeled to the detector or detectors by the use of such mechanisms.
• the photodetector preferably comprises a CCD, CID or an anay of photodiode elements. Detection of a position of one or more capillaries having an optical signal can then be determined from the optical input from each element.
• the array may be scanned by a scanning confocal or phase-contrast fluorescence microscope or the like, where the anay is, for example, carried on a movable stage for movement in a X-Y plane as the capillaries in the anay are successively aligned with the beam to determine the capillary anay positions at which an optical signal is detected.
• a CCD camera or the like can be used in conjunction with the microscope.
• the detection system is preferably computer-automated for rapid screening and recovery.
• the system uses a telecentric lens for detection.
• the magnification of the lens can be adjusted to focus on a subset of capillaries in the capillary anay.
• the detection system can have a 1:1 conelation of pixels to capillaries.
• the focus can be adjusted to determine other properties of the signal. Having more pixels per capillary allows for subsequent image processing of the signal.
• the change in the absorbance spectrum can be measured, such as by using a spectrophotometer or the like. Such measurements are usually difficult when dealing with a low-volume Uquid because the optical path length is short.
• the capillary approach of the present invention permits small volumes of liquid to have long optical path lengths (e.g., longitudinally along the capillary tube), thereby providing the abiUty to measure absorbance changes using conventional techniques.
• a fluid within a capillary will usually form a memscus at each end. Any light entering the capillary will be deflected toward the wall, except for paraxial rays, which enter the memscus curvature at its center. The paraxial rays create a small bright spot in middle of capillary, representing the small amount of light that makes it through. Measurement of the bright spot provides an opportunity to measure how much Ught is being absorbed on its way through.
• a detection system includes the use of two different wavelengths. A ratio between a first and a second wavelength indicates how much light is absorbed in the capillary. Alternatively, two images of the capillary can be taken, and a difference between them can be used to ascertain a differential absorbance of a chemical within the capillary.
• the fluid bath can be contained in a clear, light-passing container, and the light source can be directed through the fluid bath into the capillary.
• bioactivity or a biomolecule or compound is detected by using various electromagnetic detection devices, including, for example, optical, magnetic and thermal detection.
• radioactivity can be detected within a capillary tube using detection methods known in the art. The radiation can be detected at either end of the capillary tube.
• Other detection modes include, without limitation, luminescence, fluorescence polarization, time-resolved fluorescence.
• Luminescence detection includes detecting emitted light that is produced by a chemical or physiological process associated with a sample molecule or cell.
• Fluorescence polarization detection includes excitation of the contents of the lumen with polarized Ught. Under such environment, a fluorophore emits polarized light for a particular molecule. However, the emitting molecule can be moving and changing its angle of orientation, and the polarized light emission could become random.
• Time-resolved fluorescence includes reading the fluorescence at a predete ⁇ riined time after excitation.
• the molecule is flashed with excitation energy, which produces emissions from the fluorophore as well as from other particles within the substrate. Emissions from the other particles causes background fluorescence.
• the background fluorescence normaUy has a short lifetime relative to the long-life emission from the fluorophore. The emission is read after excitation is complete, at a time when all background fluorescence usually has short lifetime, and during a time in which the long-life fluorophores continues to fluoresce. Time-resolved fluorescence are therefore a technique for suppressing background fluorescent activity.
• FIG 16 shows an example of a recovery system (100) of the invention.
• a needle 105 is selected and connected to recovery mechanism (106).
• a support table (102) supports a capillary anay (10) and a light source (104). The light source is used with a camera assembly (110) to find an X, Y and Z coordinate location of a needle (105) connected to the recovery mechanism (106).
• each section of a recovery system can be moved or kept stationary.
• the recovery mechanism (106) then provides a needle (105) to a capillary containing a "hit” by overlapping the tip of the needle (105) with the capillary contaimng the "hit,” in the Z direction, until the tip of the needle engages the capillary opening.
• the needle may be attached to a spring or be of a material that flexes.
• the capillary anay may be moved relative to a stationary needle (105), or both moved.
• a single camera is used for deteirmining a location of a recovery tool, such as the tip of a needle, in the Z-plane.
• the Z-plane determination can be accomplished using an auto-focus algorithm, or proximity sensor used in conjunction with the camera.
• an image processing function can be executed to determine a precise location of the recovery tool in X and Y.
• the recovery tool is back- lit to aid the image processing.
• the capillary anay can be moved in X and Y relative to the precise location of the recovery tool, which can be moved along the Z axis for coupling with a target capillary.
• two or more cameras are used for determining a location of the recovery tool. For instance, a first camera can detennine X and Z coordinate locations of the recovery tool, such as the X, Z location of a needle tip. A second camera can determine Y and Z coordinate locations of the recovery tool. The two sets of coordinates can then be multiplexed for a complete X,Y-Z coordinate location. Next, the movement of the capillary anay relative to the recovery tool can be executed substantially as above.
• the sample can be expelled by, for example, injecting a blast of inert gas or fluid into the capillary and collecting the ejected sample in a collection device at the opposite end of the capillary.
• the diameter of the collection device can be larger than or equal to the diameter of the capillary.
• the collected sample can then be further processed by, for example, extracting polynucleotides, proteins or by growing the clone in culture.
• the sample is aspirated by use of a vacuum.
• the needle contacts, or nearly contacts, the capillary opening and the sample is "vacuumed” or aspirated from the capillary tube onto or into a collection device.
• the collection device may be a microfuge tube or a filter located proximal to the opening of the needle, as depicted in Figure 17A-D.
• Figure 17D shows further processing of a sample collected onto a filter following aspiration of the sample from the capillary.
• the sample includes particles, such as cells, proteins, or nucleic acids, which when present on the filter, can be dehvered into a collection device.
• Suitable collection devices include a microfuge tube, a capillary tube, microtiter plate, cell culture plate, and the Uke. The delivery of the sample can be accomplished by forcing another media, air or other fluid through the filter in the reverse direction.
• the sample can also be expelled from a capillary by a sample ejector.
• the ejector is a jet system where sample fluid at one end of the capillary tube is subjected to a high temperature, causing fluid at the other end of the capillary tube to eject out.
• the heating of fluid can be accomplished mechanically, by applying a heated probe directly into one end of a capillary tube.
• the heated probe preferably seals the one end, heats fluid in contact with the probe, and expels fluid out the other end of the capillary tube .
• the heating and expulsion may also be accompUshed electronically.
• at least one wall of a capillary tube is metaUzed.
• a heating element is placed in direct contact with one end of the wall.
• the heating element may completely close off the one end, or partially close the one end.
• the heating element charges up the metaUzed wall, which generates heat within the fluid.
• the heating element can be an electricity source, such as a voltage source, or a cunent source.
• a laser applies heat pulses to the fluid at one end of the capillary tube.
• An electric field may be created in or near the fluid to create an electrophoretic reaction, which causes the fluid to move according to electromotive force created by the electric field.
• a electromagnetic field may also be used.
• one or more capillaries contain, in addition to the fluid, magnetically charged particles to help move the fluid or magnetized partcles out of the capillary anay.
• Each capillary of an array of capillaries is individually addressable, i.e. the contents of each well can be ascertained during screening.
• a quantum-dot- tagged microbead method and anangement is used. In such a method and anangement, tens of thousands of unique fluorescent codes can be generated.
• the assay of interest is attached to a coded bead, and multi-spectral imaging is used to measure both the assay and the beads/codes simultaneously. There will always be some capillaries that get multiple beads and some that get none.
• an anay which contains approximately 100,000 capillaries one approach is to fill the 100,000 capillaries of the array with a solution that contains 10 copies of 10,000 different coded beads (or 5 copies of 20,000 codes).
• simple statistical analysis can be used to determine which of the wells have single beads and maybe even the contents of every well. The chance of having any two beads together in a well more than 5 times on any one capillary anay platform is negligibly small.
• Quantum-dots method An advantage of the quantum-dots method is that only a single excitation band is needed. This allows a lot of flexibility for the assay (i.e. it can use a different excitation band). Magnetic-coded beads may also be used to add another dimension to the assay detection. A multi-spectral imaging system can then be used. Alternatively, a neural network application can be utilized for spectral decomposition.
• the invention provides screening platforms and methods for use with a Fluorescence Activated Cell Sorter (FACS).
• FACS methodologies cells are mixed with substrates and then streamed past a detector to screen for a positive molecular event. This signal could be a fluorescent signal resulting from the cleavage of an enzyme substrate or a specific binding event.
• the greatest advantage of the use of a FACS machine is throughput; up to 109 clones can be screened/day.
• FACS based screening also has limitations including cell wall permeability of enzymes and substrates/products and incubation times and temperatures.
• viability of host cells post-sort and dependence on a single data point for each individual cell further limit such technologies.
• capillary anay overcomes many of these shortcomings. Like microtiter and soUd phase screens, it combines the preservation of native protein conformation with increased signal strength of clonal amplification. The throughput, however, approaches that of selective assays and FACS-based assays. Moreover, as array plates are reusable, the amount of plastic waste generated is greatly reduced. Approximately 24 tons of plastic waste* is generated annually in screening 100,000 wells per day in a 96 well format (* Assuming 84g/plate x 1000 plates/day x 260 days/year).
• a typical screen of 100,000 wells on a robotic high throughput screening system requires 261 384-well microtiter plates and over 24 hours of equipment time versus less than 10 minutes to process a single plate.
• the enhancement of this technology to densities of one miltion wells per plate is aimed at approaching the throughput of selective assays and FACS-based assays while retaining the advantages of a microtiter-based screen.
• the first generation capillary anay plates can be fabricated using manufacturing techniques originally developed for the fiber optics industry, ciurently consist of 100,000 cylindrical compartments or wells contained within a 3.3" x 5" reusable plate, the size of a SBS (Society for Biomolecular Screening) standard 96 well microtiter plate. These wells are 200 ⁇ m in diameter (about the diameter of a human hair) and act as discrete 250 nanoUter volume microenvironments in which isolated clones can be grown and screened.
• SBS Society for Biomolecular Screening
• the processes involved in anay screening closely parallel those in microtiter plate screening, but with significant simplification in required instrumentation and decrease in plate storage capacity requirements and reagent costs.
• the plates are filled with clones and reagents (e.g. fluorescent substrate, growth media, etc.) by surface tension, filling all 100,000 wells simultaneously within a few seconds without the need for complicated dispensing equipment.
• the number of clones per well typically 1 to 10, is adjusted by dilution of the cell culture.
• the plates are then incubated in a humidity-controlled environment for 24 to 48 hours to allow for both clonal amplification and enzymatic turnover.
• the plates are fransfened to the detection and recovery station where fluorescence imaging is used to detect the expression of bioactive molecules.
• the automated detection and recovery system combines fluorescence imaging and precision motion control technologies through the use of machine vision and image processing techniques. Images are generated by focusing light from a broadband light source (e.g. metal halide arc lamp) onto the plate through a set of fluorescence excitation filters. The resulting fluorescence emission is filtered then imaged by a telecentric lens onto a high-resolution cooled CCD camera in an epi- fluorescent configuration. The plates are scanned to generate a total of 56 sUghtly overlapping images in approximately one minute.
• a broadband light source e.g. metal halide arc lamp
• Putative hits clones that have converted the substrate to a fluorescent product
• putative hits are recovered from the anay plate and fransfened to a standard microtiter plate for confirmation and secondary screening.
• the process of recovery consists of: 1) mounting and locating a sterile recovery needle (typically a standard blunt end stainless steel needle commonly used for dispensing adhesives for mounting miniature surface mount electronic components), 2) atigning the recovery needle to the well containing the putative hit, 3) aspirating the contents of the well into the needle (which has attached .22 micron filter to avoid upstream contamination and loosing the sample), 4) flushing the well contents into a standard microtiter plate with an appropriate media, and finally 5) stripping off the recovery needle in preparation for the next recovery.
• a sterile recovery needle typically a standard blunt end stainless steel needle commonly used for dispensing adhesives for mounting miniature surface mount electronic components
• This invention is configured for use with a Fluorescence Activated Cell Sorter (FACS).
• FACS Fluorescence Activated Cell Sorter
• cells are mixed with substrates and then streamed past a detector to screen for a positive molecular event.
• This signal could be a fluorescent signal resulting from the cleavage of an enzyme substrate or a specific binding event.
• the greatest advantage of the use of a FACS machine is throughput; up to 109 clones can be screened/day.
• FACS based screening also has limitations including cell wall permeability of enzymes and substrates/products and incubation times and temperatures.
• viability of host cells post-sort and dependence on a single data point for each individual cell further limit such technologies.
• the well diameter, plate thickness (well depth), and material optical properties will be specified prior to fabricating the new 1 ,000,000-well density matrices. Once these parameters are specified, high density matrices will be fabricated in rectangular pieces approximately 1cm square. The process entails a low-risk modification to the same basic fabrication technique that is used to make the 100,000 well plates.
• the anay density can be calculated by using the following formula:
• V3 ellDiameter + WellSeparationWall V3 ellDiameter + WellSeparationWall
• Samples will be constructed from both transparent and opaque materials to evaluate illumination efficiencies, well-to-well optical crosstalk, surface-finish effects, and background fluorescence.
• the cunent 100,000-well plates use an opaque material.
• the use of transparent materials improves the efficiency of fluorescence excitation at the expense of increased well-to-well optical crosstalk.
• the tradeoff may favor the use of transparent materials to improve detection sensitivity.
• We estimate that the specification and manufacturing process will take two months.
• a special holder will also be fabricated to adapt the matrices to the capillary anay hardware. Once the specified matrices are manufactured, they will be tested for each of the optical and mechanical properties detailed below:
• Optical Efficiency- The 100,000-well plates are cunently illuminated by a roughly collimated beam directly on the face of the plate. Light enters each well through the aperture formed by the wall around the well. Transparent materials are expected offer illumination advantages over opaque materials with the cunent illumination system by fransimtting additional excitation energy through the walls separating the wells.
• the optical efficiency of the 1,000,000-well density matrices will be evaluated by determining the detectable concentration of a fluorescein solution. Typically, liquid phase enzyme discovery assays use 10-100 ⁇ M concentrations of fluorescent substrate.
• the cunent detection system can detect approximately lOnM of fluorescein in the 200 ⁇ m wells.
• the equivalent fluorescence of LB our typical cell growth media
• Hardware modifications described in Goal 3 may be required in the unlikely event that the detectable levels are less than lO ⁇ M for the new matrices.
• Optical Crosstalk While the use of fransparent materials may improve the efficiency of fluorescence excitation as described above, it does so at the expense of increased well- to-well optical crosstalk.
• This optical crosstalk is due to fluorescence emission that leaks from one well into its neighbors. This is easily quantified by, spotting a fluorophore onto the matrix, and then measuring the signal intensity vs. distance from a fluorophore filled well. The crosstalk could potentially mask the signal of a weak positive well resulting in a false negative or be detected as a false positive. In applications where the expected hit rate is low (which is commonly the case with enzyme discovery from environmental libraries) the probability of this occurring is generally insignificant. However, crosstalk can complicate the image processing required to automatically locate putative hits and therefore must be evaluated.
• the plates are filled by placing the surface of the plate in contact with the assay solution.
• Surface tension at the tiquid/plate interface causes the assay components to be drawn or wick into all of the wells simultaneously.
• the surface preparation of the plate can have significant affects on the wicking properties of the matrix.
• Some surface polishing techniques have been found to make the glass face of the plate hydrophobic, thus preventing or significantly slowing the filling of the plate. Initially, the same surface finish cunently used on the 100,000-well plate will be tested. If necessary, matrices with different surface preparations will be placed into contact with a cell media mixture and their wicking properties quantified by timing the filling process and weighing the matrices before and after filling. In the event that plate filling remains inadequate after testing available surface preparations and treatments, surfactants can be added to improve filling.
• the matrices will be processed through multiple, rigorous cleaning and sterilization protocols. Cunently, there is a great deal of latitude in both the cleaning and sterilization protocols. Cleaning can consist of a combination of flushing, soaking, and/or sonication in water, solvents and/or soaps. Likewise, due to the inherent raggedness of the materials used, sterilization can be accomplished by autoclaving, bleach, ethanol, and/or acid washing. Cleanliness is verified by fluorescence imaging of the material at multiple excitation wavelengths. Sterilization is verified by overnight incubation of matrices filled with sterile growth media, followed by plating the contents onto agar and looking for colony formation.
• the detection sensitivity of the new matrices is expected to be lower (especially for opaque matrices) than for the cunent plates using the cunent detection system hardware.
• a number of hardware enhancements that could significantly improve sensitivity including: Higher sensitivity cooled CCD camera; Laser based illumination or other higher power density light source; and Faster (possibly non-telecentric) imaging optics.
• Method 1 Screening Lambda Phage Libraries for Enzymatic Activity - Gene libraries cloned into lambda-based vectors are first titered by plating dilutions on soft agar in the presence of an appropriate E. coU host strain according to standard techniques. Using this titer information, an adequate amount of the lambda library is allowed to adsorb to the host.
• a mixture of growth medium and fluorescent substrate is then added to produce a final suspension having the following characteristics: [1] a density of host cells that will allow both sufficient growth and an effective multiphcity of infection, [2] an optimal concentration of fluorescent substrate for detection of the enzymatic activity, and [3] a density of phage particles such that, when loaded into a 1,000,000-well density matrix, each well will contain an average of 1 - 4 library clones. (Densities of 5-10 clones per well will be attempted once the initial details are worked out.) A sample of this suspension is plated on soft agar to determine the average seed density of library clones (concomitant titer). The remainder of the suspension is used to load the wells of the matrices. The plates are incubated at 37°C for 16-24 hours (protected from light and evaporative loss; see note on Incubation below) to allow lytic multiplication of bacteriophage in the wells prior to detection and recovery.
• Method 2 Screening Phagemid and Other Colony-Based Libraries for Enzymatic Activity - Phagemid Ubraries are produced from parental bacteriophage libraries using an in vivo excision process (Short et al., 1988). Following initial titering, these libraries are used to infect an appropriate E. coli host strain. After the 15-minute adsorption period, cells are suppUed with a small amount of medium and aUowed to grow at 30 degrees Celsius without antibiotic selection for 45 minutes to allow expression of the antibiotic resistance gene present on the phagemid. The suspension is then plated onto soUd plates containing antibiotic and allowed to grow at 30 degrees Celsius overnight. Amptified clones from the resulting antibiotic-resistant colonies are collected into a pooled suspension.
• a mixture of antibiotic, fluorescent substrate and growth medium is then added to produce the final suspension used to load the high-density matrices (with characteristics analogous to [2] and [3] above).
• a sample of this suspension is also plated onto solid agar plates containing antibiotic to determine the average seed density of library clones (concomitant titer).
• the matrices are then incubated at 30-37 degrees C for 1-2 days (protected from Ught and evaporative loss; see note on Incubation below) to allow phagen ⁇ d-containing host cells to multiply within the wells prior to detection and recovery.
• Libraries created in other vectors are also screened using this platform. Factors such as growth requirements, transformation modality, and transformation efficiency have to be taken into consideration when adapting a particular library vector to this technology.
• Factors such as growth requirements, transformation modality, and transformation efficiency have to be taken into consideration when adapting a particular library vector to this technology.
• the use of a variety of library and vector types permits screening for small molecules and protein therapeutics in addition to novel enzymes.
• the anay plates are typically incubated in a humidified incubator at 90% relative humidity for 24 to 48 hours.
• the plates are stackable and designed such that each plate is contained witiiin a humidity and temperature stable environment by the plates above and below it. Lids or extra plates filled with water are used at the top and bottom of each stack to seal the end plates.
• the incubation process requires validation of cell growth, evaporation, and condensation.
• E. coli which will be used as the enzyme screening host, has been clearly demonstrated in the 100,000 well anay plate.
• Other types of cells including streptomyces, mammaUan (Jurkat human leukemic T cells), and lambda phage have also been shown to grow in this format.
• these mixing methods could be employed to improve oxygen diffusion and cell growth.
• Other methods include oxygen saturation of the assay solution prior to plate Siting, incubation in a high oxygen environment, and the addition of time-released oxygen generating compounds such as sodium percarbonate.
• controlUng evaporation from the 1,000,000-well plates will be critical.
• the surface to volume ratio is favorable for ininimizing evaporation. Evaporation studies conducted in 100,000-well plates indicate a 10% loss of media volume over 24 hours. This loss is reduced to 5% with the addition of 10% glycerol. Because the surface area to volume ratio of the 1,000,000-well plates will be similar (if not more favorable) to the 100,000- well plates. Evaporation in the higher density matrices will be measured by filling the plates with typical assay media and weighing them at several time points over a 96-hour period. If stricter evaporation control is required, glycerol can be added.
• condensation moisture on the surface of the matrices are also considered. Because they are incubated in high-humidity environments, droplets on the outer surfaces of the matrices that remain after filling or condense during incubation may not evaporate and can cause well to well cross-contamination. These droplets can lead to the detection of false positives in wells neighboring a true positive as well as cause a blotchy appearance on the plate surface that obscures weak positives. Such problems with surface droplets remaining after filling the 100,000-well plates are avoided by letting them sit at room temperature until all of the surface moisture has evaporated. Avoiding condensation during incubation is accomplished by using strict temperature and humidity control.
• Negative libraries spiked with the positive ⁇ -gal clone at a defined frequency will be the first subjects of a feasibility screen.
• the same screen will be performed in parallel in a conventional microtiter format for comparison. Once this is proven, screening will proceed (again in parallel with microtiter format) to libraries known to contain positive clones.
• a mixed population library was validated for this purpose during the development of the 100,000-well platform and will be used for the 1,000,000-well feasibility screening.
• Validation of the feasibiUty screens can be performed by simply comparing the number of positive wells in the fluorescence images of the 1,000,000-well matrices to those in a 100,000-well anay plate filled with the identical assay solution. Further verification will be done in standard microtiter format.
• the number of positive wells is a function of the concentration of positive clones in the initial assay solution and the volume of the wells. Since the well volume of the 1,000,000-well matrices is approximately 1/lOth that of the 100,000 well plates, the expected number of positive wells should also be about 1/10th when loading the same initial assay solution.
• the anay of capillaries can be ananged to fit within a footprint of a microtiter plate, one standard of which is a footprint of 3.3" x 5". Within that footprint, up to 1,000,000 or more capillaries, or wells, can be provided in the anay.
• a 1,000,000 well platform for screening gene libraries from mixed populations of organisms for novel enzymatic activities provides an ultra high-throughput screening platform in the 3.3" x 5" footprint of a standard microtiter plate.
• each well includes a capillary having a diameter of 200 ⁇ m, and which holds 250nl.
• the anay platform permits rapid screening of genes and gene pathways, and increases the productivity of discovery and gene optimization programs for products such as novel enzymes, protein therapeutics, compounds and small molecule drugs.
• novel enzymes of various catalytic classes e.g., amylases, proteases, secondary amidases
• the same proprietary cost effective process by which the 100,000- well plates are made can be utilized to make the 1,000,000-well plates for smaller, non- biological applications.
• the anay screening platform greatly expands the amount of molecular diversity that can be screened to discover new products.
• the 1,000,000-well plates, with wells each about half the diameter of a human hair are be reusable and require only miniscule volumes of reagents, making them highly cost effective and environmentally responsible.
• This invention includes the design and fabrication of 1cm square matrices with 1,000,000 well/plate density (i.e. 12,000 wells/cm2) using a process that is scalable to full microtiter plate sized anays.
• the platform can be utilized to develop a novel liquid phase nitrilase assay in the 1,000,000-well format, as well as screening gene libraries from mixed populations of organisms for chiral nitrilases for use in the manufacture of chemical intermediates for chiral therapeutic compounds.
• Naked Biopanning involves the direct screening or enrichment for a gene or gene cluster from environmental genomic DNA.
• the enrichment for or isolation of the desired genomic DNA is performed prior to any cloning, gene-specific PCR or any other procedure that may introduce unwanted bias affecting downstream processing and applications due to toxicity or other issues.
• Several methodologies can be described for this type of sequence based discovery. These generally include the use of nucleic acid probe(s) that is(are) partially or completely homologous to the target sequence in conjunction with the binding of the probe-target complex to a solid phase support.
• the probe(s) may be polynucleotide or modified nucleic acid, such as peptide nucleic acid (PNA) and may be used with other facilitating elements such as proteins or additional nucleic acids in the capture of target DNA.
• PNA peptide nucleic acid
• An amplification step which does not introduce sequence bias may be used to ensure adequate yield for downstream applications.
• ClonCaptureTM cDNA selection procedure (CLONTECH Laboratories, Inc.), with some modification, to take advantage of csD- loop formation, a stable structure which may be used to capture genomic DNA containing an internal target sequence:
• Environmental genomic DNA is cleaved into fragments (fragment size depends upon type of target and desired downstream insert size if making a pre- enriched library) using mechanical shearing or restriction digest. Fragments are size selected according to desired length and purified.
• a biotinylated dsDNA probe is produced, based upon existing knowledge of conserved regions within the target, by PCR from a positive clone or by synthetic means. The probe can be internally (ex.
• biotin 21-dCTP incorporation of biotin 21-dCTP or end labeled with biotin. It must be purified to remove any unincorporated biotin.
• the probe is heat denatured (5 min. at 95°C) and placed immediately on ice. The denatured probe is then reacted with RecA and an ATP mix contaimng ATP and a nonhydrolyzable analog (15 min. at 37°C).
• the target DNA is added and incubated with the RecA/biotinylated probe nucleofilaments to form the csD-loop structure (20 min. at 37°C).
• the RecA is then removed by treatment with proteinase K and SDS.
• streptavidin paramagnetic beads are fransfened to the reaction and incubated to bind the csD-loop complex to the support (rotate 30 min. at room temp.). The unbound DNA is removed and may be saved for use as target for a different probe. The beads are thoroughly washed and the enriched population is eluted using an alkaline buffer and fransfened off.. The enriched DNA is then ethanol precipitated and is ready for ligation and pre-enriched library preparation.
• PNAs may be used, either as "openers” to allow insertion of a probe into dsDNA (Bukanov et al., 1998), or as tandem probes themselves (Lohse et al., 1999).
• PNAs bind to two short tracts of homopurines that are in close proximity to each other. They form P- loop structures, which displace the unbound strand and make it available for binding by a probe, which can then be used to capture the target using an affinity capture method involving a solid phase.
• PNAs may be used in a "double-duplex invasion" to form a stable complex and allow target recovery.
• Simpler methods may be used in the retrieval of targets from environmental genomic DNA that involve complete denaturation of the DNA fragments. After cutting genomic DNA into fragments of the desired length via mechanical shearing or through the use of restriction enzymes, the target DNA may be bound to a solid phase using a direct hybridization affinity capture scheme.
• a nucleic acid probe is covalently bound to a solid phase such as a glass slide, paramagnetic bead, or any type of matrix in a column, and the denatured target DNA is allowed to hybridize to it.
• the unbound fraction may be collected and rehybridized to the same probe to ensure a more complete recovery, or to a host of different probes, as a part of a cascade scenario, where a population of environmental genomic DNA is subsequently panned for a number of different genes or gene clusters.
• Linkers containing restriction sites and sites for common primers may be added to the ends of the genomic fragments using sticky-ended or blunt-ended ligations (depending upon the method used for cutting the genomic DNA). These enable one to amplify the size-selected inserted fragment population by PCR without significant sequence bias. Thus, after using any of the abovementioned techniques for isolation or enrichment, one may help to ensure adequate recovery for downstream processing. Furthermore, the recovered population is ready for cutting and ligation into a suitable vector as well as containing the priming sites for sequencing at any time.
• a variation of the above scheme involves including a tag from a combinatorial synthesis of polynucleotide tags (Brenner et al., 1999) within the linker that is attached onto the ends of the genomic fragments. This allows each fragment within the starting population to have its own unique tag. Therefore, when amplified with common primers, each of these uniquely tagged fragments give rise to a multitude of in vitro clones which are then bound to the paramagnetic bead containing millions of copies of the complementary, covalently bound anti-tag. A fluorescently labeled, target specific probe may be subsequently hybridized to the target-containing beads.
• the beads may be sorted using FACS, where the positives may be sequenced directly from the beads and the insert may be cut out and Ugated into the desired vector for further processing.
• the negative population may be hybridized with other probes and resorted as part of the cascade scenario previously described.
• Transposon technology may allow the insertion of environmental genomic DNA into a host genome through the use of transposomes (Goryshin & Reznikoff, 1998) to avoid bias resulting from expression of toxic genes. The host cells are then cultured to provide more copies of target DNA for discovery, isolation, and downstream processes.
• DNA isolation DNA is isolated using the IsoQuick Procedure as per manufacturer's instructions (Orca, Research Inc., Bothell, WA). DNA can be normalized according to Example 2 below. Upon isolation the DNA is sheared by pushing and pulling the DNA through a 25G double-hub needle and a 1-cc syringes about 500 times. A small amount is run on a 0.8% agarose gel to make sure the majority of the DNA is in the desired size range (about 3-6 kb).
• the DNA is blunt-ended by mixing 45 ul of 10X Mung Bean Buffer, 2.0 ul Mung Bean Nuclease (150 u/ul) and water to a final volume of 405 ul. The mixture is incubate at 37°C for 15 minutes. The mixture is phenol/chloroform extracted followed by an additional chloroform extraction. One ml of ice cold ethanol is added to the final extract to precipitate the DNA. The DNA is precipitated for 10 minutes on ice. The DNA is removed by centrifugation in a microcentrifuge for 30 minutes. The pellet is washed with 1 ml of 70% ethanol and repelleted in the microcentrifuge. Following centrifugation the DNA is dried and gently resuspended in 26 ul of TE buffer.
• the DNA is methylated by mixing 4 ul of 10X EcoR I Methylase Buffer, 0.5 ul SAM (32 mM), 5.0 ul EcoR I Methylase (40 u/ul) and incubating at 37°C, 1 hour.
• the DNA is Ugated by gently resuspending the DNA in 8 ul EcoR I adaptors (from Stratagene's cDNA Synthesis Kit), 1.0 ul of 10X Ligation Buffer, 1.0 ul of 10 mM rATP, 1.0 ul of T4 DNA Ligase (4Wu ul) and incubating at 4°C for 2 days. The ligation reaction is terminated by heating for 30 minutes at 70°C.
• the adaptor ends are phosphorylated by mixing the ligation reaction with 1.0 ul of 10X Ligation Buffer, 2.0 ul of lOmM rATP, 6.0 ul of H 2 0, 1.0 ul of polynucleotide kinase (PNK) and incubating at 37°C for 30 minutes. After 30 minutes 31 ul H 2 O and 5 ml 10X STE are added to the reaction and the sample is size fractionate on a Sephacryl S-500 spin column. The pooled fractions (1-3) are phenol/chloroform extracted once followed by an additional chloroform extraction. The DNA is precipitated by the addition of ice cold ethanol on ice for 10 minutes.
• the precipitate is pelleted by centrifugation in a microfuge at high speed for 30 minutes.
• the resulting pellet is washed with 1 ml 70% ethanol, repelleted by centrifugation and allowed to dry for 10 minutes.
• the sample is resuspended in 10.5 ul TE buffer. Do not plate. Instead, ligate directly to lambda arms as above except use 2.5 ul of DNA and no water.
• Sucrose Gradient (2.2 ml) Size Fractionation. Stop ligation by heating the sample to 65°C for 10 minutes. Gently load sample on 2.2 ml sucrose gradient and centrifuge in mini-ultracentrifuge at 45K, 20°C for 4 hours (no brake). Collect fractions by puncturing the bottom of the gradient tube with a 20G needle and allowing the sucrose to flow through the needle. Collect the first 20 drops in a Falcon 2059 tube then collect 10 1-drop fractions (labeled 1-10). Each drop is about 60 ul in volume. Run 5 ul of each fraction on a 0.8% agarose gel to check the size.
• pool fractions 1-4 (about 10-1.5 kb) and, in a separate tube, pool fractions 5-7 (about 5-0.5 kb).
• Pellet the precipitate by centrifugation in a microfuge at high speed for 30 minutes. Wash the pellets by resuspending them in 1 ml 70% ethanol and repelleting them by centrifugation in a microfuge at high speed for 10 minutes and dry. Resuspend each pellet in 10 ul of TE buffer.
• Harvest Phage Recover phage suspension by pouring the SM buffer off each plate into a 50-ml conical tube. Add 3 ml of chloroform, shake vigorously and incubate at room temperature for 15 minutes. Centrifuge the tubes at 2K rpm for 10 minutes to remove cell debris. Pour supernatant into a sterile flask, add 500 ul chloroform and store at 4°C.
• the cell suspension was mixed with one volume of 1 % molten Seaplaque LMP agarose (FMC) cooled to 40 C, and then immediately drawn into a 1 ml syringe.
• FMC Seaplaque LMP agarose
• the syringe was sealed with parafilm and placed on ice for 10 min.
• the cell-containing agarose plug was extruded into 10 ml of Lyses Buffer (10 mM Tris pH 8.0, 50 mM NaCl, 0.1 M EDTA, 1% Sarkosyl, 0.2% sodium deoxycholate, 1 mg/ml lysozyme) and incubated at 37 C for one hour.
• the agarose plug was then fransfened to 40 mis of ESP Buffer (1% Sarkosyl, 1 mg/ml proteinase K, in 0.5M EDTA), and incubated at 55 C for 16 hours. The solution was decanted and replaced with fresh ESP Buffer, and incubated at 55 C for an additional hour. The agarose plugs were then placed in 50 mM EDTA and stored at 4 C shipboard for the duration of the oceanographic cruise.
• ESP Buffer 1% Sarkosyl, 1 mg/ml proteinase K, in 0.5M EDTA
• agarose plug 72 1
• buffer A 100 mM NaCl, 10 mM Bus Tris Propane-HCl, 100 g/ml acetylated BSA: pH 7.0 @ 25 C
• the solution was replaced with 250 1 of fresh buffer A containing 10 mM MgCl, and 1 mh4 DTT and incubated on a rocking platform for 1 hr at room temperature.
• the solution was then changed to 250 1 of the same buffer containing 4U of Sau3Al (NEB), equilibrated to 37 C in a water bath, and then incubated on a rocking platform in a 37 C incubator for 45 min.
• the plug was fransfened to a 1.5 ml microcentrifuge tube and incubated at 68 C for 30 min to inactivate the enzyme and to melt the agarose.
• the agarose was digested and the DNA dephosphorylased using Gelase and HK-phosphatase (Epicentre), respectively, according to the manufacturer's recommendations. Protein was removed by gentle phenol/chloroform extraction and the DNA was ethanol precipitated, pelleted, and then washed with 70% ethanol. This partially digested DNA was resuspended in sterile H,O to a concentration of 2.5ng/l for ligation to the pFOSl vector.
• Agarose plugs prepared from this picoplankton sample were chosen for subsequent fosmid library preparation.
• Each 1 ml agarose plug from this site contained approximately 7.5 x 10 5 cells, therefore approximately 5.4 x 10 5 cells were present in the 72 1 slice used in the preparation of the partially digested DNA.
• Vector arms were prepared from pFOSl as described by Kim et al. (Kim, 1992). Briefly, the plasmid was completely digested with Astfl, dephosphorylated with HK phosphatase, and then digested with BamHI to generate two arms, each of which contained a cos site in the proper orientation for cloning and packaging Ugated DNA between 35-45 kbp. The partially digested picoplankton DNA was Ugated overnight to the PFOS 1 arms in a 15 1 ligation reaction containing 25 ng each of vector and insert and 1U of T4 DNA ligase (Boehringer-Mannheim).
• the Ugated DNA in four microliters of this reaction was in vitro packaged using the Gigapack XL packaging system (Stratagene), the fosmid particles transfected to E. coli strain DH10B (BRL), and the cells spread onto LB cm ⁇ 5 plates.
• the resultant fosmid clones were picked into 96-well microtiter dishes containing LB cm i 5 supplemented with 7% glycerol.
• Recombinant fosmids, each containing ca. 40 kb of picoplankton DNA insert yielded a library of 3.552 fosmid clones, containing approximately 1.4 x 10 8 base pairs of cloned DNA. All of the clones examined contained inserts ranging from 38 to 42 kbp. This library was stored frozen at -80 C for later analysis.
• MicroDialyzer with multipipette. (Fill dialyzer completely with TE, get rid of any air bubble, transfer samples very fast to avoid new air-bubbles).
• a sample composed of genomic DNA from Clostridium perfringens (21% G+C), Escherichia coli (49% WC) and Micrococcus lysodictium (72% G+C) was purified on a cesium-chloride gradient.
• the tube was then filled with the filtered cesium chloride solution and spun in a NTi5O rotor in a Beckman L8-70 Ulfracentrifuge at 33,000 rpm for 72 hours. Following centrifugation, a syringe pump and fractionator (Brandel Model 186) were used to drive the gradient through an ISCO UA-5 UV absorbance detector set to 280 nm. Three peaks representing the D ⁇ A from the three organisms were obtained. PCR amplification of D ⁇ A encoding rR ⁇ A from a 10-fold dilution of the E. coli peak was performed with the following primers to amplify eubacterial sequences:
• Hybridization of fixed cells Centrifuge fixed cells at 4000 rpm for 10 min. Resuspend in 1 ml 40 mM Tris pH7.6/ 0.2% NP40. Transfer 100 ul fixed cells to an eppendorf tube. Centrifuge for 1 min and remove supernatant. Resuspend each reaction in 50 ul Hybridization buffer (0.9 M NaCl; 20 mM Tris ⁇ H7.4; 0.01% SDS; 25% formamide- can be made in advance and stored at -20°C). Add 0.5 nmol fluorescein-labeled primer to the appropriate reactions. Incubate with rocking at 46°C for 2 hr.
• Hybridization temperature may depend on sequence of primer and template.
• Wash buffer 0.9 M NaCl; 20 mM Tris pH 7.4; 0.01% SDS.
• FACS sorting Dilute cells in 1 ml PBS. If cells are clumping, sonicate for 20 seconds at 1.5 power. FAC sort the most highly fluorescent single-cells and collect in 0.5 ml PCR strip tubes (approximately one 96-well plate/ library). PCR single-cells with vector specific primers to amplify the insert in each cell. Elecfrophores all samples on an agarose gel and select samples with single inserts. These can be re-amplified with Biotin-labeled primers, hybridized to insert-specific primers, and examined in an ELISA assay. Positive clones can then be sequenced. Alternatively, the selected samples can be re-amplified with various combinations of insert-specific primers, or sequenced directly.
• Encapsulate 1 vial of 3% home-made SeaPlaque gel. Each vial of gel can make 10 6 GMD. Take lOOul melt frozen fosmid ⁇ MF21/DH10B library, OD600 0.4 to encapsulate, centrifuge down to lOul. Melt agarose gel, add lOOul FBS (fetal bovine serum) and vortex. Place in 50 C water in a beaker. Add lOul culture, vortex and add to 17ml mineral oil. Shake for about 30 times, place on the One Cell machine. Blend at 2600rpm lmin at room temperature and 2600rpm 9 minutes on ice. Wash with PBS twice.
• FBS fetal bovine serum
• Proteinase K 375ul proteinase K stock (lOmg/ml)
• CA98 ACTTCCGGCTCGTATATTGTGTGG
• CA103 ACGACTCACTATAGGGCGAATTGGG
• reaction product should be a strong smear of products usually ranging from 0.5-5 kb in size and centered around 1.5-2 kb.
• Reagents PCR reagents
• Topo-TA cloning kit with Topi OF 5 comp cells (Invitrogen #K4550-40) High Salt Buffer: 5M NaCl, lOmM EDTA, lOmM Tris pH 7.3
• reaction product should be a strong smear of products usually ranging from 0.5-5 kb in size and centered around 1.5-2 kb.
• Cells were obtained after filtering 110 L of surface water through a 0.22 ⁇ m membrane. The cell pellet was then resuspended with seawater and a volume of 100 ⁇ L was used for cell encapsulation. This provided cell numbers of approximately 10 7 cells per mL.
• CelMix Emulsion Matrix and CelGel Encapsulation Matrix (One Cell Systems, Inc., Cambridge, MA)
• Pluronic F-68 solution and Dulbecco's Phosphate Buffered Saline (PBS, without Ca 2+ and Mg 2+ ).
• Scintillation vials each containing 15 ml of CelMixTM emulsion matrix were placed in a 40°C water bath and were eliquilibrated to 40°C for a minimum of 30 minutes.
• 30 ul of Pluronic Solution F-68 (10%) was added to each of 6 vials of melted CelGelTM agarose. The agarose mixture was incubated to 40°C for a minimum of 3 minutes.
• the encapsulation mixture was then divided into two 15 ml conical tubes and in each vial, the emulsion was overlayed with 5 ml of PBS.
• the vials tubes were then centrifuged at 1800 rpm in a bench top centrifuge for 10 minutes at RT, resulting in a visible Gel MicroDrop (GMD) pellet.
• the oil phase was then removed with a pipette and disposed of in an oil waste container. The remaining aqueous supernatant was aspirated and each pellet was resuspended in 2 ml of PBS. Each resuspended pellet was then overlayed with 10 ml of PBS.
• the GMD suspension was then centrifuged at 1500 rpm for 5 minutes at RT.
• the primers used include the pair 27F and 1392R and 27F and 1522R according to the positions in E.coli gene sequence.
• the primers were obtained from IDT-DNA Technologies and were purified by HPLC. The primer concentration used in the reactions was 0.2 ⁇ M.
• the encapsulated GMDs were placed into chromatography columns that allowed the flow of culture media providing nutrients for growth and also washed out waste products from cells.
• the experiment consisted of 4 treatments including the use of seawater, and amendments (inorganic nutrients including trace metals and vitamins, amino acids including trace metals and vitamins, and diluted rich organic marine media). This different set of nutrients provided a gradient to bias different microbial populations.
• the seawater used as base for the media was filter sterilized through a 1000 kDa and a 0.22 ⁇ m filter membranes prior to amendment and introduction to the columns.
• the cells were then incubated for a period of 17 weeks and cell growth was monitored by phase contrast microscopy. Cell identification was done by 16S rRNA gene sequence of grown colonies.
• the gene sequences were aligned and compared to our 16S rRNA database with the ARB phylogenetic program. Maximum Parsimony and neighbor joining trees were constructed using the amplified gene sequences (approximately 1400 bp).
• a single copy of Streptomyces containing clones from a mixed population are FACS- sorted onto agar, allowed to develop into individual colonies, and bioassayed as individual clones.
• a genomic library of Streptomyces murayamaensis is constructed in pJO436 (Bierman et al., Gene 1991 116:43-49) vector and hybridized with probes for polyketide synthase.
• a clone (IB) which hybridized was chosen and shuttled into Streptomyces venezuelae ATCC 10712 strain.
• the vector pMF17 was also introduced into S. diversa as a negative control. When bioassayed on solid media, clone IB expressed strong bioactivity towards Micrococcus luteus suggesting that the insert present in clone IB encoded a bioactive polyketide molecule.
• the S. venezuelae exconiugant spores contaning clone IB, as well as pJO436 vector, are FACS-sorted in 48-well, 96-well, and 384-well format into conesponding plates containing MYM agar + Apramycin 50ug/ml.
• the single spore clones were allowed to germinate, grow and sporulate for 4-5 days.
• Natural product extraction procedure After the clones were fully grown and sporulated for 4-5 days, following volumes of solvent methanol were added to the each well containing the clones.
• the plates were incubated at room temperature overnight.
• the extracts were assayed from a single well, and after combining extracts from 2, 4 and 10 wells.
• the methanol extract was dried and resuspended in 40 ul of methano water and 20 ul of which was assayed against M. luteus as the indicator strain.
• a single colony ofS. venezuelae containing clone IB produced enough bioactive molecule, in 48-well, 96-well as well as 384-well format, to be extracted by the microextraction procedure and to be detected by bioassay.
• the act clone was grown in R2-S liquid cultures with and without apramycin and total cell count was done by plating on R2-S agar with and without apramycin. The act clone gave 100% and 96% apramycin resistant colonies when grown with and without apramycin, respectively. This suggests that S. venezuelae pJO436 clones are quite stable segregationally.
• Orfl of the jadomycin biosynthetic gene cluster was chosen as a target. Primers were designed so as to amplify jad-L and jad-R fragments with proper restriction sites for future subcloning. S. venezuelae is reasonably sensitive to hygromycin and therefore, hygromycin resistance gene will be used to disrupt the orf- 1 gene. The strategy used for disrupting the jadomycin orf-1 is described in the attached figure. The hyg-disrupted copy of the orf-1 gene will then be placed on pKC1218 and used for gene replacement in the S. venezuelae 10712, as well as VS153 chromosome.
• the single arm rescue technique to recover the yellow clone insert from S. lividans clone 525Sm575 was described.
• the recovered clone #3 was mated into S. venezuelae 10712 as well as VS153. Yellow color was evident after several days on both 10712 as well as VS153 plates but absent in the pJO436 vector alone controls.
• Three 10712 yellow clones were grown in liquid R2-S medium and all three produced yellow color profusely.
• This experiment has validated S. venezuelae as a host and pJO436 as the vector for heterologous expression for the second time, the first time being with the actinorhodin gene cluster.
• This yellow clone insert could now be used in validation of different strains in our strain improvement program.
• MYM media In order to produce single cells or fragmented mycelia, 25ml MYM media was inoculated (see recipe below) in 250 ml baffled flask with 100 ul of Streptomyces 10712 spore suspension and incubated overnight at 30°C 250rpm. After a 24 hour incubation, 10 ml was fransfened to 50ml conical polypropylene centrifuge tube and centrifuged at 4,000rpm for 10 minutes @ 25°C. Supernatant was decanted and the pellet was resuspended in 10ml 0.05M TES buffer. The cells were sorted into MYM agar plates (sort 1 cell per drop, 5 cells per drop, 10 cells per drop) and we incubated the plates at 30°C.
• MYM media (Stuttard, 1982, J. Gen .Microbiol. 128:115-121) contains: 4 g maltose, 10 g malt ext, 4 g yeast extract, 20 g agar, pH 7.3, water to 1 L.
• the following describes a method for the discovery of novel enzymes requiring large substrates (e.g., cellulases, amylases, xylanases) using the ultra high throughput capacity of the flow cytometer.
• substrates e.g., cellulases, amylases, xylanases
• a strategy other than single intracellular detection must be employed in order to use the flow cytometer.
• GMD gel microdrop
• the enzyme substrate is captured within the GMD and the enzyme allowed to hydrolyze the substrate within this microenvironment.
• this method is not limited to any particular gel microdrop technology. Any microdrop-forming material that can be derivatized with a capture molecule can be used.
• the basic experimental design is as follows: Encapsulate individual bacteria containing DNA libraries within the GMDs and allow the bacteria to grow to a colony size containing hundreds to thousands of cells each.
• the GMDs are made with agarose derivatized with biotin, which is commercially available (One Cell Systems). After appropriate colony growth, streptavidin is added to serve as a bridge between a biotinylated substrate and the biotin-labeled agarose. Finally, the biotinylated substrate will be added to the GMD and captured within the GMD through the biotin-streptavidin-biotin bridge. The bacterial cells will be lysed and the enzyme released from the cells.
• the enzyme will catalyze the hydrolysis of the substrate, thereby increasing the fluorescence of the substrate within the GMD.
• the fluorescent substrate will be retained within GMD through the biotin- streptavidin-biotin bridge and thus, will allow isolation of the GMD based on fluorescence using the flow cytometer.
• the entire microdrop will be sorted and the DNA from the bacterial colony recovered using PCR techniques. This technique can be applied to the discovery of any enzyme that hydrolyzes a substrate with the result of an increased fluorescence. Examples include but are not limited to glycosidases, proteases, Upases, ferullic acid esterases, secondary amidases, and the like.
• One system uses a biotin capture system to retain secreted antibodies within the GMD.
• the system is designed to isolate hybridomas that secrete high levels of a desired antibody.
• This basic design is to form a biotin-streptavidin-biotin sandwich using the biotinylated agarose, streptavidin, and a biotinylated capture antibody that recognizes the secreted antibody.
• the "captured" antibody is detected by a fluoresceinated reporter antibody.
• the flow cytometer is then used to isolate the microdrop based on increased fluorescence intensity.
• the potentially unique aspect to the method described here is the use of large fluorogenic substrates for the determination of enzyme activity within the GMD. Additionally, this example uses bacterial cells contaimng DNA libraries instead of eukaryotic cells and is not confined to secreted proteins as the bacterial cells will be lysed to allow access to the enzymes.
• the fluorogenic substrates can be easily tailored to the particular enzyme of interest. Described below is a specific example of the chemical synthesis of an esterase substrate. Additionally, two examples are given which describe the different possible chemical combinations that can be used to make a wide variety of substrates. Example of Reaction Sequence Leading to GMD- Attachable Substrate
• l-amino-ll-azido-3,6,9-trioxaundecane [Reference 3], an asymmetric spacer, is attached to N-hydroxysuccinamide ester of 5-carboxyfluorescein (Molecular Probes).
• activated biotin (Molecular Probes) is attached to the amine terminus (step 3), and the sequence is completed by esterification of phenolic groups of the fluorescein moety (step 4).
• the resulting compound can be used as a substrate in screens for esterase activity. Design of GMD- Attachable Fluorogenic Substrates
• Fluor- core fluorophore structure capable of forming fluorogenic derivatives, e.g. coumarins, resorufins, xanthenes, and others.
• Spacer - a chemically inert moiety providing connection between biotin moiety and the fluorophore. Examples include alkanes and oligoethyleneglycols. The choice of the type and length of the spacer will affect synthetic routes to the desired products, physical properties of the products (such as solubility in various solvents), and the ability of biotin to bind to deep pockets in avidin.
• Cl, C2, C3, C4 - connector units providing covalent links between the core fluorophore structure and other moieties.
• Cl and C2 affect the specificity of the substrates towards different enzymes.
• C3 and C4 determine stability of the desired product and synthetic routes to it. Examples include ether, amine, amide, ester, urea, thiourea, and other moieties.
• Rl and R2 - functional groups attachment of which provides for quenching of fluorescence of the fluorophore. These groups determine the specificity of substrates towards different enzymes. Examples include straight and branched alkanes, mono- and oligosaccharides, unsaturated hydrocarbons and aromatic groups. a. Design of GMD-Attaphable Fluorescence Resonance Energy Transfer Substrates
• Fluor - A fluorophore examples include acridines, coumarins, fluorescein, rhodamine, BODIPY, resorufin, po hyrins, etc.
• Quencher - A moiety which is capable of quenching fluorescence of the fluorophore when located at a close enough distance. Quencher can be the same moiety as the fluorophore or a different one.
• Polymer is a moiety, consisting of several blocks, a bond between which can be cleaved by an enzyme. Examples include amines, ethers, esters, amides, peptides, and oligosaccharides,
• Cl and C2 are equivalent to C3 and C4 in the previous design.
• Spacer is equivalent to Spacer in the previous design.
• the goal of this experiment is to develop an ultra high throughput screen designed for discovery of novel anticancer agents.
• the method of Example 14 uses a recombinant approach to the discovery of bioactive molecules.
• the examples use complex DNA libraries from a mixed population of uncultured microorganisms that provide a vast source of natural products through recombinant expression from whole gene pathways.
• the two objectives of this Example include:
• the present invention provides a new paradigm for screening technologies that brings the small molecule libraries and target together in a three dimensional ultra high throughput screen using the flow cytometer. In this format, it is possible to achieve screening rates of up to 10 8 per day.
• the feasibility of this system is tested using assays focused on the discovery of novel anti-cancer agents in the areas of signal transduction and apoptosis. Development of a validated assay should have a profound impact on the rate of discovery of novel lead compounds.
• the goal of this example is to develop an ultra high throughput screening format that can be used to discover novel chemotherapeutic agents active against a range of molecular targets known to be important in cancers.
• the feasibility of this approach will be tested using mammalian cell lines that respond to activation of the epidermal growth factor receptor (EGFR) with induction of expression of a reporter protein.
• EGFR-responsive cells will be brought together with our microbial expression host within a microdrop (see Example 13 and co-pending U.S. patent 6,280,926, and U.S. application Serial No. 09/894,956, both herein incorporated by reference).
• These expression hosts will be Streptomyces or E coli and will contain libraries derived from a mixed population of organisms, i.e.
• the mixed population libraries may contain from 10 4 -10 10 clones, including 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , or any multiple thereof.
• EGF receptor An assay based on the EGF receptor was chosen because of its possible role in the pathogenesis of several human cancers.
• the EGF-mediated signal transduction pathway is very well characterized and several inhibitors of the EGF receptor have been found from natural sources (21,22).
• the EGFR is one of the early oncogenes discovered (erbB) from the avian erythroblastosis retro virus and due to a deletion of nearly all of the extracellular domain, is constitutively active (23). Similar types of mutations have been found in 20- 30% of cases of glioblastoma multiforme, a major human brain tumor (24).
• the gene encoding EGFR was obtained from Dr. Gordon Gill (University of California, San Diego) and cloned it into the pcDNA3/hygro vector. The resulting vector was transfected into CHO cells and stable transformants selected with hygromycin. Enrichment of high EGFR- expressing CHO cells was performed through two rounds of FACS sorting using the anti-EGFR antibody.
• the EGFR is a tyrosine kinase receptor that functions through the MAP-kinase pathway to activate the transcription factor Elk-1 (33).
• the PathDetect product includes a fusion trans-activator plasmid (pFA-Elkl) that encodes for expression of a fusion protein containing the activation domain of the Elk-1 transcription activator and the DNA binding domain of the yeast GAL4.
• a second plasmid contains a synthetic promoter with five tandem repeats of the yeast GAL4 binding sites that control expression of the Photinus pyralis luciferase gene.
• the luciferase gene was removed and replaced with the gene encoding for the destabilized version of the enhanced green fluorescent protein (EGFP) (plasmid designated pFR-d2EGFP).
• EGFP enhanced green fluorescent protein
• the two plasmids were transfected together into the EGFR/CHO and HeLa cells at a ratio of 10:1 (pFR-EGFP: pFA-Elkl) and stable transformants selected using the neomycin resistance gene located on the pFA-Elkl plasmid.
• pFR-EGFP pFA-Elkl
• stable transformants selected using the neomycin resistance gene located on the pFA-Elkl plasmid.
• the second group of cell lines uses the Mercury Profiling system to assay the same EGFR pathway.
• This system responds to activation of the pathway with an increase in the expression of human placental secreted alkaline phosphatase (SEAP).
• SEAP human placental secreted alkaline phosphatase
• a fluorescent signal will be obtained by the addition of the phosphatase substrate ELF-97-phosphate (Molecular Probes), which yields a bright fluorescent precipitate upon cleavage.
• ELF-97-phosphate Molecular Probes
• the advantage of this approach over the PathDetect system is the ability to amplify the signal through enzyme catalysis for low-level activation of the pathway. This parallel approach will increase the probability of success in finding bioactive compounds.
• a vector containing the cis-acting enhancer element SRE and the TATA box from the thymidine kinase promoter is used to drive expression of alkaline phosphatase (pTA-SEAP).
• This system relies on the endogenous transactivators present in the cell, such as Elk-1, to bind the SRE element on the vector and drive expression of SEAP upon stimulation of EGFR.
• the pTA-SEAP vector was transfected into the EGFR/CHO and HeLa cells and stable transformants selected using neomycin. Again, stimulation of the pathway occuned in the presence of serum factors in the media. Upon serum starvation, this response was greatly reduced (Figure 2B). Single high expressing clones will be isolated following stimulation with EGF and sorting using a flow cytometer. Development of ultra high throughput FACS assay
• an expression host Streptomyces, E. coli
• a mammalian reporter cell will be co-encapsulated together within a microdrop.
• the microdrop holds the cells in close proximity to each other and provide a microenvironment that facilitates the exchange of biomolecules between the two cell types.
• the reporter cell will have a fluorescent readout and the entire microdrop will be run through the flow cytometer for clonal isolation.
• the DNA from the genes or pathway of interest will subsequently be recovered using in vitro molecular techniques.
• This assay format will be validated for the discovery of both EGFR inhibitors as well as for small molecules that induce apoptosis. With validation of this format, we will progress to the ultra high throughput screening phase designed to discover novel chemotherapeutic agents active against these important molecular mechanisms underlying tumorigenesis.
• a colony of bacteria will form prior to any or minimal cell division of the eukaryotic cell. This colony will then provide a significantly increased concentration of the bioactive molecule.
• the bacterial colony will be selectively lysed using the antibiotic polymyxin at a concentration that allows cell survival (35). This antibiotic acts to perforate bacterial cell walls and should result in the release of EGF from these cells without affecting the eukaryotic cell. In the final discovery assays, this lysis treatment should not be necessary as the small molecule products will likely be able to freely diffuse out of the cell.
• the EGF will activate the signal transduction pathway in the eukaryotic cell and turn on expression of the reporter protein.
• microdrops will be run through the flow cytometer and those microdrops exhibiting an increased fluorescence will be sorted.
• the DNA from the sorted microdrops will be recovered using PCR amplification of the insert encoding for EGF.
• a couple of additional steps are required to achieve a fluorescent readout.
• the enzyme is secreted from the cell, it is possible to prevent the diffusion of the protein from the microdrop by selectively capturing it within the matrix of the microdrop. This can be accomplished by using microdrops made with agarose derivatized with biotin.
• Subsequent steps include determining the response of encapsulated clonal EGF-responsive mammalian cells to varying concentrations of EGF in the presence and absence of EGFR inhibitors such as Tyrphostin A46 or Tyrphostin A48 (Calbiochem).
• E. coli clones producing high levels of secreted EGF will be isolated using the Quantikine human EGF immunoassay (R&D Systems).
• R&D Systems Quantikine human EGF immunoassay
• the next step will be to mix the EGF-expressing E. coli with non-expressing cells at varying ratios from 1 : 1,000 to 1 : 1,000,000 to mimic the conditions of an mixed population library discovery screen.
• the bacterial mixtures and the mammalian cells will be co-encapsulated as described above.
• the highly fluorescent microdrops will be individually sorted by the flow cytometer.
• the DNA will be recovered by PCR amplification using primers directed against the EGF gene. To improve the signal to noise ratio, it is likely that it will be necessary to undergo several rounds of enrichment before isolation of positive EGF-expressing clones, especially for the higher mixture ratios.
• the microdrops will first be sorted in bulk, the microdrop material removed with GELase (Epicentre Technologies) and the bacteria allowed to grow. The encapsulation protocol will be repeated with fresh eukaryotic cells until a highly enriched population is observed. At this point, single microdrops will be isolated and recovery of the EGF-expressing clone confirmed by PCR. With validation of this assay, the goal will be to screen for inhibitors of the EGFR using our mixed population libraries expressed in optimized E. coli and Streptomyces hosts. This assay will be done in the presence of EGF and the assay endpoint will be a decrease in fluorescence.
• GELase Epicentre Technologies
• This format is not limited to only EGFR inhibitors as any protein within this pathway could be inhibited and would appear positive in this screen.
• this screen can also be adapted to the multitude of anti-cancer targets that are known to regulate gene expression.
• inhibitors of other growth factors such as PDGF and VEGF. If an increase in fluorescence is not observed with co-encapsulation of the EGF- expressing cells and the mammalian reporter cell, there could be several reasons. First, it is possible that the EGF diffuses out of the cell too quickly to elicit a response.
• the cells will not continue to produce EGF after polymyxin treatment and thus, the incubation time of the reporter cells with EGF will be minimal. This is unlikely as the polymyxin treatment used will be at concentrations well below that which produces decreased cell viability.
• EGF bacteriocin release protein
• the BRP opens the inner and outer membranes of E. coli in a controlled manner enabling protein release into the culture medium. This system can be used for large-scale protein production in a continuous culture and thus should be compatible with cell survival.
• Apoptosis or programmed cell death, is the process by which the cell undergoes genetically determined death in a predictable and reproducible sequence. This process is associated with distinct morphological and biochemical changes that distinguish apoptosis from necrosis. The malfunctioning of this essential process can often lead to cancer by allowing cells to proliferate when they should either self- destruct or stop dividing. Thus, the mechanisms underlying apoptosis are cunently under intense scrutiny from the research community and the search for agents that induce apoptosis is a very active area of discovery.
• the present invention provides to develop an assay for the discovery of apoptotic molecules using our ultra high throughput encapsulation technology.
• the source of these small molecules will come from our extremely complex mixed population libraries expressed in Streptomyces and E. coli host strains. These host strains will be co-encapsulated together with a eukaryotic reporter cell, the small molecule will be produced in the bacterial strain, and will act on the mammalian reporter cell which will respond by induction of apoptosis. Apoptosis will be detected using a fluorescent marker, the entire microdrop sorted using the flow cytometer, and the DNA of interest recovered. The feasibility of this assay will be determined using our optimized Streptomyces host strain, S.
• apoptotic reporter cell derived from human T cell leukemia (e.g., Jurkat cells).
• the pathway controlling production of the anti-tumor antibiotic, bleomycin, will be cloned into S. diversa as the source of an apoptosis-inducing agent.
• the readout for induction of apoptosis in Jurkat cells will be obtained using the fluorescent marker, Alexis 488-annexin V.
• the bleomycin group of compounds are anti-tumor antibiotics that are cunently being used clinically in the treatment of several types of tumors, notably squamous cell carcinomas and malignant lymphomas.
• bleomycin congeners are peptide/polyketide metabolites that function by binding to sequence selective regions of DNA and creating single and double stranded DNA breaks.
• bleomycin induces apoptosis in eukaryotic cells (43-45).
• the biosynthetic gene cluster encoding for the production of bleomycin has recently been cloned from Streptomyces verticillus and is encoded on a contiguous 85 kb fragment (46).
• a library will be made from the S. verticillus ATCC15003 strain and cloned into the BAG vector, pBlumate2.
• probes will be designed against sequences from the 5' and 3' ends of the pathway.
• the library will be introduced into E. coli and screened using colony hybridization with the probe generated against one end of the pathway. Positive clones will subsequently be screened with the second probe to identify which clone contains the entire pathway.
• Clones containing the complete pathway will be fransfened into our optimized expression host S. diversa by mating. Expression of bleomycin will be detected using whole cell bioassays with Bacillus subtillis.
• Jurkat cells are the classic human cell line used for studies of apoptosis.
• the fluorescent Alexis 488 conjugate of annexin V (Molecular Probes) will be used as the marker of apoptosis in these cells.
• Annexin V binds to phosphotidylserine molecules normally located on the internal portion of the membrane in healthy cells. During early apoptosis, this molecule flips to the outer leaf of the membrane and can be detected on the cell surface using fluorescent markers such as the annexin V- conjugates.
• the bleomycin-induced apoptotic response in Jurkat cells will initially be characterized by varying both the concentrations of the exogenously administered drug and the incubation time with the drug.
• Alexis 488-annexin V will then be add to the cells and the level of fluorescence analyzed on the flow cytometer. Necrotic cell death will be determined using propidium iodide and the apoptotic population will be normalized to this value.
• confirmation of bleomycin production will be performed by sorting of the encapsulated S. diversa clone into 1536 well plates. After a predetermined incubation period, the supernatent will be removed and spotted on filter disks for whole cell bioassays using the susceptible strain B. subtilis. Use of the 1536 well plates will hopefully avoid significant dilution of the antibiotic in the media. As cloning of the bleomycin pathway is quite recent, it has not yet been heterologously expressed from the complete pathway.
• Du et al demonstrated the heterologous bioconversion of the inactive aglycones into active bleomycin congeners by cloning a portion of the pathway into a S. lividans host (46). If bleomycin expression is not detectable in our assay, we will employ a similar strategy using our host strain S. diversa. If little bleomcyin production is detected under these conditions, it will be necessary to optimize the culture conditions for S. diversa to induce pathway expression within the microdrop.
• pathway expression is an issue that is not limited to the bleomycin example.
• Bioactive small molecules within microorganisms are often produced to increase the host's ability to survive and proliferate. These compounds are generally thought to be nonessential for growth of the organism and are synthesized with the aid of genes involved in intermediary metabolism, hence the name “secondary metabolites.”
• the pathways controlling expression of these secondary metabolites are often regulated under non-optimal conditions such as stress or nutrient limitation.
• our system relies on use of the endogenous promoters and regulators, it might be necessary to optimize conditions for maximal pathway expression.
• transposon containing a promoter-less GFP.
• the enhanced GFP optimized for eukaryotes will be used as it has a codon bias for high GC organisms.
• Transposition into a known pathway e.g., actinorhodin
• the transposants will be introduced into an E. coli host, screened for clones that express GFP, and positive clones isolated on the flow cytometer.
• the S. diversa clone containing GFP and the actinorhodin pathway will be encapsulated in the microdrops and several different growth conditions will be tested, e.g., conditioned media, nutrient limiting media, known inducing factors, varying incubation times, etc.
• the microdrops will be analyzed under the microscope and on the flow cytometer to determine which conditions produce optimal expression of the pathway. These conditions will be verified for viability in eukaryotic cells as well. These optimized growth conditions will be confirmed using the bleomycin pathway to assess production of the secondary metabolite.
• whole cell optimization of S. diversa is ongoing with production of strains that are missing different pleiotropic regulators that often negatively impact secondary metabolite production. As these strains are developed, they will be analyzed in the microdrops for enhanced pathway expression.
• the proximity of the two cell types within the microdrop should result in a high concentration of the bioactive molecule at the site of the reporting cell.
• concentration of the molecule at the site of the reporter cell could be achieved by a reduction in the microdrop pore size.
• Pore size reduction can be accomplished by one or a combination of the following approaches: (i) "plugging" the holes with particles of an appropriate size, which are held in the pores by non-covalent or covalent interactions; (ii) cross-linking of the microdrop-forming polymer with low molecular weight agents; (iii) creation of an external shell around the microdrop with pores of smaller size than those in the cunent microdrop.
• Plugging the pores can be accomplished using polydisperse latexes with particles sized to fit within the pores of the microdrop.
• Latex particles may be modified on their surface such that they are attracted to the microdrop-forming polymer.
• agarose-based microdrops cany a negative electrostatic charge on the surface.
• amidine-modified polystyrene latex particles (friterfacial Dynamics Corporation) will be attracted to the microdrop surface and the latex particles will effectively plug the microdrop pores provided that the charge density on the latex particles and the microdrop surface is high enough to sustain strong electrostatic bonds.
• cross-linking of agarose beads can be achieved by treating them with various reagents according to known procedures (47). For our purposes, the cross-linking needs to occur only on the surface of microdrop. Thus, it may be advantageous to use polymers carrying reactive groups for cross-linking of agarose, such that permeation of the cross-linking agent inside the microdrop is prevented.
• microdrops Encapsulation of cells in polyacrylamide, alginate, fibrin, and other gel-forming polymers has been described (51). Another plausible candidate for encapsulation material is silica gel, which can be formed under physiological conditions with the assistance of enzymes (silicateins) (52) or enzyme mimetics (53). Additionally, various polymers may be used as the material for microdrop construction. Microdrops may be formed either upon polymerization of monomers (i.e. water-soluble acrylates or metacrylates) or upon gelation and/or cross-linking of preformed polymers (polyacrylates, polymetacrylates, polyvinyl alcohol).
• monomers i.e. water-soluble acrylates or metacrylates
• preformed polymers polyacrylates, polymetacrylates, polyvinyl alcohol
• microdrops Since the formation of microdrops occurs simultaneously with encapsulation of living cells, such formation has to proceed under conditions compatible with cell survival.
• the precursors for microdrops should be soluble in aqueous media at physiological conditions and capable of the transformation into the microdrop material without any significant participation and/or emission of toxic compounds.
• a library from a mixed population of organisms was prepared. An extract of the library was collected. Extracts from the libraries were either pooled or kept separate.. Control extracts, without a bioactivity or biomolecule of interest were also prepared.
• Mass spectra were generated for the natural product expression host (e.g. S. venezuelae) and vector alone (e.g.pJO436) system. Mass spectra were also generated for the host cells containing the library extracts, alone or pooled. The spectra generated from multiple runs of either the background samples or the library samples were combined within each set to create a composite spectra. Composite spectra may be generated by using a percentage occunence of an average intensity of each binned mass per time period or by using multiple aligned single mass spectra over a time period. By using a redundant sampling method where each sample was measured several times in the presence of other extracts, the novel signals that consistently occuned within a sample extract but not within the background spectra were determined.
• the host-vector background spectrum was compared to the mass spectra obtained from large insert library clone extracts. Extra peaks observed in the large insert library clone extracts were considered as novel compounds and the cultures responsible for the extracts were selected for scale culture so the compound can be isolated and identified. Novel metabolite identification by mass spectroscopic screening.
• Liquid chromatography-mass spectrometry is used to determine the background mass spectra of the natural product expression host (e.g. S. diversa DS10 or DS4) and vector alone (e.g.pmfl7) system. This host- vector background spectrum is compared to the mass spectra obtained from large insert library clone exfracts. Extra peaks observed in the large insert library clone extracts are considered as novel compounds and the cultures responsible for the extracts are selected for scale culture so the compound can be isolated and identified.
• the natural product expression host e.g. S. diversa DS10 or DS4
• vector alone e.g.pmfl7
• the spectra generated from multiple runs of either the background samples or the library samples are combined within each set to create a composite spectra.
• Composite spectra may be generated by using a percentage occunence of an average intensity of each binned mass per time period or by using multiple aligned single mass spectra over a time period.
• the purpose of this invention is to identify novel compounds produced by recombinant genes encoding biosynthetic pathways without relying on the compounds having bioactivity. This detection method is expected to be more universal than bioactivity for identifying novel compounds.
• the method is best practiced with a set of control extracts and sample extracts. Mixing of the compounds in pools prior to analysis and deconvolution of the mixed extract pools will provide high throughput while maintaining the ability to measure each extract several times.
• a secondary screen may be required to eliminate false positives.
• This method is more specific for identifying potential novel compounds by molecular ion than cunent methods.
• This method uses a different data analysis strategy than the dereplication methods for the identification of specific peaks for new compounds in extracts. Using the molecular ion as a signal to collect on this method may be coupled to mass based collection methods for the rapid isolation of compounds.
• Solvent A 98.0 % (Water) Solvent B 0.0 % (MeOH) Solvent C 2.0 % (AcCN) Solvent D 0.0 % (iPrOH)
• TestFileData [12 34 45 56 67]
• MasterDir ' C: ⁇ HPCHEM ⁇ 1 ⁇ DATA ⁇ MS20FEBA ⁇ IND4TST'; % User inputed directory containing other directories with files cd (MasterDir) ;
• MasterDirFiles dir % Load all files in master directory to one variable.
• TotalFiles size (MasterDirFiles)
• Is_Original_Files strcmp (MasterDirFiles (ExtractDir) .name, Original_Files) ; if not (Is_Original_Files)
• CompressedDirList CompressCount
• .name MasterDirFiles (ExtractDir) .name; % assign new directories.
• CompressCount CompressCount+l; % 'Increment count compressed directories end end end end end
• TotalDirectories size (CompressedDirList) ;
• CompressCount 3.TotalDirectories (1, 2) % Main loop for moving in and out of directories .
• CurrentDirectory CompressedDirList (CompressCount) .name; cd(CurrentDirectory) ;
• PrintHistograms 0; % 1 means print histogram, 0 means no print.
• SortedDataFileName sortrows (DataFileName)
• FileNames strcat (FileNameStub, FileNameRoot) ; % Create full filename as a variable.
• NameFile fopen(FileNames, 'a+' ) % Open file to record filenames used to create master matrix
• OddCol ( (testlength*2)+l) ;
• Spacer char (Name (OddCol) ) fprintf (NameFile, NameOut) ; fprintf (NameFile, ' ⁇ n' ) ; % Writes even rows filenames, with linebreak between. fprintf (NameFile, Spacer) ; fprintf (NameFile, ' ⁇ n' ) ; % Writes odd row with the spacer, with a linebreak between.
• MaxColmlntensity (l,mcol+l) 0; %Sets column intensity to zero so a comparison can be made.
• Masstab files smass spectra(j, 1) ; % m/z value for each mass is in column 1 of Masstab files.
• % InBin Logical variable to determine if the current mass is in a bin
• % InSameBin Logical variable to determine if there is a second signal at the same mass as the previous one
• MaxColmlntensity (l,mcol) intensity; % and store it in
• MaxColumlntensity (1, mcol+1) intensity; % and store it in MaxColmlntensity for later use .
• OutputRoot char ( ' -output . csv' ) ;
• Output_File strcat (FileNameStub, OutputRoot) ; dlmwrite (Output_File,master) ; % Write master matrix to file.
• sizemaster size (master) ;
• Halfd d/2; master (i,d) ;
• SignalOne (i, l) master (i,l) ;
• SignalTwo (i, l) master (i, 1) ;
• SignalOnePercent (i, l) master (i, 1) ;
• Comprsd_odd_d round(Halfd) ;
• SignalTwoPercent (i,Comprsd_odd_d) master(i,d) /MaxColmlntensity (l,d) *100;
• SignallRoot char ( ' -SignalOne-output . cs ' ) ;
• Signal_l File strcat (FileNameStub, SignallRoot) ;
• dlmwrite Simufactuation_l_File, SignalOne
• Signal2Root char ( ' -SignalTwo-output . csv' ) ;
• Signal_2_File strcat (FileNameStub, Signal2Root) ; dlmwrite (Signal_2_File, SignalTwo) ; % Write second signal data file.
• Normal2Root char ( ' -Normal-SignalTwo-output . csv ' )
• Normal_2_File strcat (FileNameStub, Normal2Root) ; dlmwrite (Normal_2_File, SignalTwoPercent) ; % % Write second signal relative (normalized) data file.
• SummaryF ⁇ le strcat (FileNameStub, SummaryRoot) ; dlmwrite (SummaryFile, Summaryl) ;
• TwoColSummaryRoot char ( '-SignalOne-TwoColSummary.csv' ) ;
• TwoColSummaryF ⁇ le strcat (FileNameStub, TwoColSummaryRoot) ;
• TwoColSummaryFileOpen fopen(TwoColSummaryF ⁇ le, 'a+')
• %Create histograms showing binning of percentage occurence, in 5 percent divisions .
• T ⁇ tleWord(l, : ) cellstr (OverZero) ;
• F ⁇ leName strcat (FileNameStub, FigureTitle) ; print ( ' -djpeg ' , ' -r200 ' , FileName)
• figure (2) hist (Summaryl (: ,3) ,20) ;
• FileName strcat (FileNameStub, FigureTitle) ; print ( ' -djpeg ' , ' -r200 ' , FileName)
• FileName strcat (FileNameStub, FigureTitle) ; print ( '-djpeg' , '-r200' , FileName)
• OverZero2 ' Greater than 50% occurrence of signal over 0% — ';
• FileName strcat (FileNameStub, FigureTitle) ; print ( ' -djpeg' , ' -r200 ' , FileName)
• OverTwoFive2 ' Greater than 50% occurrence of signal over 2.5% —
• FileName strcat (FileNameStub, FigureTitle) ; print ( '-djpeg' , '-r200' , FileName)
• OverFive2 ' Greater than 50% occurrence of signal over 5% — ';
• FileName strcat (FileNameStub, FigureTitle) ; print ( ' -djpe ' , ' -r200 ' , FileName)
• OverZero3 ' Percentage occurrence of signal over 0% — ';
• FileName strcat (FileNameStub, FigureTitle) j print ( ' -djpeg' , ' -r200 ' , FileName)
• FileName strcat (FileNameStub, FigureTitle) ; print ( '-djpeg' , '-r200' , FileName)
• FileName strca (FileNameStub, FigureTitle) ; print ( '-djpeg' , '-r200' , ileName)
• X % prints after while end % Main loop for moving in and out of directories .
• the program determines the average background value looking at the entire peak shape of the spectra.

Applications Claiming Priority (11)

Publications (1)

Family

ID=27540945

Family Applications (1)

Country Status (7)

Cited By (1)

Families Citing this family (100)

Family Cites Families (7)

• 2001
  • 2001-10-10 JP JP2002534567A patent/JP2005501217A/ja active Pending
  • 2001-10-10 CA CA002393374A patent/CA2393374A1/en not_active Abandoned
  • 2001-10-10 MX MXPA02005717A patent/MXPA02005717A/es unknown
  • 2001-10-10 EP EP01979708A patent/EP1364052A2/de not_active Withdrawn
  • 2001-10-10 IL IL15002001A patent/IL150020A0/xx unknown
  • 2001-10-10 WO PCT/US2001/031806 patent/WO2002031203A2/en not_active Application Discontinuation
  • 2001-10-10 AU AU11642/02A patent/AU1164202A/en not_active Abandoned

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events