EP1360335A2 - Methods for identifying the target of a compound which inhibits cellular proliferation - Google Patents

Methods for identifying the target of a compound which inhibits cellular proliferation

Info

Publication number
EP1360335A2
EP1360335A2 EP02728338A EP02728338A EP1360335A2 EP 1360335 A2 EP1360335 A2 EP 1360335A2 EP 02728338 A EP02728338 A EP 02728338A EP 02728338 A EP02728338 A EP 02728338A EP 1360335 A2 EP1360335 A2 EP 1360335A2
Authority
EP
European Patent Office
Prior art keywords
gene product
strains
culture
nucleic acid
strain
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP02728338A
Other languages
German (de)
French (fr)
Inventor
Grant J. Carr
Howard H. Xu
Gordon J. Foulkes
Carlos Zamudio
Robert Haselbeck
Kari L. Ohlsen
Judith W. Zyskind
Daniel Wall
John D. Trawick
Robert T. Yamamoto
Terry Roemer
Bo Jiang
Charles Boone
Howard Bussey
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Elitra Pharmaceuticals Inc
Original Assignee
Elitra Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Elitra Pharmaceuticals Inc filed Critical Elitra Pharmaceuticals Inc
Publication of EP1360335A2 publication Critical patent/EP1360335A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034—Isolating an individual clone by screening libraries

Definitions

  • the compounds to be evaluated for therapeutic activity may be members of a library of compounds generated by combinatorial chemistry or members of a library of natural products.
  • the present invention provides reagents and methods for identifying the target of a compound which reduces the activity or level of gene products required for cellular proliferation.
  • the present invention provides reagents and methods for identifying novel therapeutic compounds or compounds which act on novel targets.
  • proliferation-required or “required for proliferation” encompasses instances where the absence or substantial reduction of a gene transcript and/or gene product completely eliminates cell growth as well as instances where the absence of a gene transcript and/or gene product merely reduces cell growth.
  • E. coli or Escherichia coli is meant Escherichia coli or any organism previously categorized as a species of Shigella including Shigella boydii, Shigella flexneri, Shigella dysenteriae, Shigella sonnei, Shigella 2A.
  • homologous coding nucleic acid is meant a nucleic acid homologous to a nucleic acid encoding a gene product whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs.: 8-3795 or a portion thereof.
  • the homologous coding nucleic acid may have at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of SEQ ID NO: 1
  • the homologous coding nucleic acids may have at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, at least 70% , at least 60%, at least 50%, or at least 40% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of the nucleotide sequences complementary to one of SEQ ID NOs.: 8-3795 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof. Identity may be measured using BLASTN version 2.0 with the default parameters or tBLASTX with the default parameters. (Altschul, S.F. et al.
  • Gapped BLAST and PSI-BLAST A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997), the disclosure of which is inco ⁇ orated herein by reference in its entirety
  • a "homologous coding nucleic acid” could be identified by membership of the gene of interest to a functional orthologue cluster. All other members of that orthologue cluster would be considered homologues.
  • Such a library of functional orthologue clusters can be found at http ://www.ncbi.nlm.nih. gov/COG.
  • a gene can be classified into a cluster of orthologous groups or COG by using the COGNITOR program available at the above web site, or by direct BLASTP comparison of the gene of interest to the members of the COGs and analysis of these results as described by Tatusov, R.L., Galperin, M.Y.,
  • homologous coding nucleic acid also includes nucleic acids comprising nucleotide sequences which encode polypeptides having at least 99%,
  • protein identity or similarity may be identified using BLASTP with the default parameters, BLASTX with the default parameters, TBLASTN with the default parameters, or tBLASTX with the default parameters.
  • homologous coding nucleic acid also includes coding nucleic acids which hybridize under stringent conditions to a nucleic acid selected from the group consisting of the nucleotide sequences complementary to one of SEQ ID NOS.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944 and coding nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequences complementary to one of SEQ ID NOS.:
  • stringent conditions means hybridization to filter-bound nucleic acid in 6xSSC at about 45°C followed by one or more washes in O.lxSSC/0.2% SDS at about 68°C.
  • Other exemplary stringent conditions may refer, e.g., to washing in 6xSSC70.05% sodium pyrophosphate at 37°C, 48°C, 55°C, and 60°C as appropriate for the particular probe being used.
  • homologous coding nucleic acid also includes coding nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleotide sequence selected from the group consistmg of the sequences complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and
  • 14111-14944 and coding nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequences complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916- 10012, and 14111-14944.
  • moderate conditions means hybridization to filter-bound DNA in 6x sodium chloride/sodium citrate (SSC) at about 45°C followed by one, preferably 3-5 washes in 0.2xSSC/0.1% SDS at about 42-65°C.
  • homologous coding nucleic acids also includes nucleic acids comprising nucleotide sequences which encode a gene product whose activity may be complemented by a gene encoding a gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795.
  • the homologous coding nucleic acids may encode a gene product whose activity is complemented by the gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944.
  • the homologous coding nucleic acids may comprise nucleotide sequences which encode a gene product whose activity is complemented by one of the polypeptides of SEQ ID NOs. 3801-3805, 4861-5915, 10013-14110 and 14945- 15778.
  • homologous antisense nucleic acid includes nucleic acids comprising a nucleotide sequence having at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, or at least 40% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of one of the sequences of SEQ ID NOS. 8-3795 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof.
  • Homologous antisense nucleic acids may also comprising nucleotide sequences which have at least 97%, at least 95%, at least 90%>, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, or at least 40% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of the sequences complementary to one of sequences of SEQ ID NOS.: 3796-3800, 3806- 4860, 5916-10012, and 14111-14944 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof. Nucleic acid identity may be determined as described above.
  • homologous antisense nucleic acid also includes antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleotide sequence complementary to one of SEQ ID NOs.: 8-3795 and antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 8-3795.
  • Homologous antisense nucleic acids also include antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944.
  • homologous antisense nucleic acid also includes antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleotide sequence complementary to one of SEQ ID NOs.: 8-3795 and antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 8-3795.
  • Homologous antisense nucleic acids also include antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and antisense nucleic acids which comprising nucleotide sequences hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300,
  • homologous polypeptide is meant a polypeptide homologous to a polypeptide whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 or by a homologous antisense nucleic acid.
  • homologous polypeptide includes polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 8-3795 or by a homologous antisense nucleic acid, or polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide to a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a polypeptide whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs.: 8-3795 or by a homologous antis
  • Identity or similarity may be determined using the FASTA version 3.0t78 algorithm with the default parameters. Alternatively, protein identity or similarity may be identified using BLASTP with the default parameters, BLASTX with the default parameters, or TBLASTN with the default parameters. (Altschul, S.F. et al. Gapped
  • homologous polypeptide also includes polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least
  • polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778 and polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a fragment comprising at least 5, 10, 15,
  • Salmonella is the generic name for a large group of gram-negative enteric bacteria that are closely related to Escherichia coli. The diseases caused by
  • Salmonella are often due to contamination of foodstuffs or the water supply and affect millions of people each year.
  • Traditional methods of Salmonella taxonomy were based on assigning a separate species name to each serologically distinguishable strain (Kauffrnarm, F 1966 The bacteriology of the Enter ohacteriaceae. Munksgaard, Copenhagen).
  • Serology o ⁇ Salmonella is based on surface antigens (O [somatic] and H [flagellar]).
  • Over 2,400 serotypes or serovars of Salmonella are known (Popoff, et al. 2000 Res. Microbiol. 151:63-65). Therefore, each serotype was considered to be a separate species and often given names, accordingly (e.g. S. paratyphi, S.
  • Salmonella species were lumped into a single species (all serotypes and subgenera I, II, and IN and all serotypes of Arizona) with a second subspecies, S. bongorii also recognized (Crosa, et al., 1973, J. Bacteriol. 115:307-315). Though species designations are based on the highly variable surface antigens, the Salmonella are very similar otherwise with a major exception being pathogenicity determinants.
  • S. enterica is divided into six subspecies (I, S. enterica subsp. enterica; II, S. enterica, subsp. salamae; Ilia, S. enterica subsp. arizon ⁇ e; IITb, S. enterica subsp. diarizonae; IN, S. enterica subsp. houtenae; and VI, S. enterica subsp. indica).
  • serotypes are used to distinguish each of the serotypes or serovars (e.g. S.
  • enterica serotype Enteriditis S. enterica serotype Typhimurium, S. enterica serotype Typhi, and S. enterica serotype Choleraesuis, etc.
  • Current convention is to spell this out on first usage (Salmonella enterica ser. Typhimurium) and then use an abbreviated form (Salmonella Typhimurium or S. Typhimurium).
  • the genus and species names (Salmonella enterica) are italicized but not the serotype/serovar name (Typhimurium). Because the taxonomic committees have yet to officially approve of the actual species name, this latter system is what is employed by the CDC (Brenner, et al. 2000 J. Clin. Microbiol. 38:2465-2467). Due to the concerns of both taxonomic priority and medical importance, some of these serotypes might ultimately receive full species designations (S.typhi would be the most notable).
  • S. enterica or S. enterica includes serovars Typhi, Typhimurium, Paratyphi, Choleraesuis, etc.”
  • appeals of the "official" name are in process and the taxonomic designations may change (S. choleraesuis is the species name that could replace S. enterica based solely on priority).
  • inducer an agent or solution which, when placed in contact with a cell or microorganism, increases transcription, or inhibitor and/or promoter clearance/fidelity, from a desired promoter.
  • nucleic acid means DNA, RNA, or modified nucleic acids.
  • the terminology “the nucleic acid of SEQ ID NO: X” or “the nucleic acid comprising the nucleotide sequence” includes both the DNA sequence of SEQ ID NO: X and an RNA sequence in which the thymidines in the DNA sequence have been substituted with uridines in the RNA sequence and in which the deoxyribose backbone of the DNA sequence has been substituted with a ribose backbone in the RNA sequence.
  • Modified nucleic acids are nucleic acids having nucleotides or structures which do not occur in nature, such as nucleic acids in which the internucleotide phosphate residues with methylphosphonates, phosphorothioates, phosphoramidates, and phosphate esters.
  • Nonphosphate internucleotide analogs such as siloxane bridges, carbonate bridges, thioester bridges, as well as many others known in the art may also be used in modified nucleic acids.
  • Modified nucleic acids may also comprise, ⁇ -anomeric nucleotide units and modified nucleotides such as 1,2-dideoxy-d-ribofuranose, 1,2-dideoxy-l- phenylribofuranose, and N, JV'-ethano-S-methyl-cytosine are contemplated for use in the present invention.
  • Modified nucleic acids may also be peptide nucleic acids in which the entire deoxyribose-phosphate backbone has been exchanged with a chemically completely different, but structurally homologous, polyamide (peptide) backbone containing 2-aminoethyl glycine units.
  • overexpress refers to strains which possess either a level of the gene product which is higher than the level possessed by wild type cells or an affinity for a test compound which is lower than the affinity of a wild type gene product
  • underexpress refers to strains which possess a level of the gene product which is lower than the level possessed by wild type cells or an affinity for a test compound which is higher than the affinity of a wild type gene product.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
  • said culture includes at least one strain which does not overexpresses a gene product which is essential for proliferation of said organism.
  • identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture.
  • said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enter ococcus faecalis, Enteroc
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-
  • 15778 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherem each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consistmg of SEQ ID NOs: 8-
  • a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consistmg of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of
  • SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an array of strains on a solid growth medium wherein each strain in overexpresses a different gene product which is essential for proliferation of said organism contacting said array of strains with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly on said solid medium.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of strains wherem each strain overexpresses a different gene product which is essential for proliferation of said orgamsm; contacting each of said cultures with a different concentration of said compound ; and identifying the gene product which is overexpressed in a strain whose proliferation is inhibited by said compound.
  • 25 The method of Paragraph 23, wherein at least one strain in said plurality of cultures does not overexpress a gene product which is essential for proliferation of said organism.
  • a method of profiling a compound's activity comprising performing the method of Paragraph 1 on a first culture using a first compound; performing the method of Paragraph 1 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture.
  • a method of profiling a first compound's activity comprising growing an array of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each strain in said array overexpresses a different gene product which is essential for proliferation of an organism and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organismwherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-100 ⁇ 2, and
  • 14111-14944 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795,
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111- 14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800,
  • a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism; and contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.
  • a method of profiling a compound's activity comprising performing the method of Paragraph 29 on a first culture using a first compound; performing the method of Paragraph 29 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture. 51.
  • a method of profiling a first compound's activity comprising growing an array of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said array comprises a plurality of strains wherem each strain underexpresses a different gene product which is essential for proliferation of an organism and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of culturescomprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism; contacting each of said plurality of cultures with a varying concentration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism ; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.
  • a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism.
  • said strains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.
  • the culture of Paragraph 54 wherein said culture is a culture of an organism selected from the group consistmg of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kejyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis,
  • Salmonella enterica Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
  • a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed.
  • a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed.
  • a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801- 3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed.
  • a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters
  • a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860/5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide
  • a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-
  • a culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism.
  • the culture of Paragraph 64 wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens,
  • Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides,
  • Pasteurella haemolytica Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis,
  • Streptococcus pneumoniae Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
  • a culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed.
  • a culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is underexpressed.
  • a culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801- 3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed.
  • a culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the
  • a culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherem said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ
  • nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed.
  • a culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861- 5915, 10013-14110 and 14945-15778 is underexpressed.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
  • the method of Paragraph 74 wherein the step of identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene comprises performing an amplification reaction and detecting a unique amplification product corresponding to said gene. 79.
  • the method of Paragraph 75 wherein the native promoter of each of the genes encoding a gene product essential for proliferation is replaced with the same promoter.
  • Torulopsis glabrata Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans,
  • Enterobacter cloacae Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boyd
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts;
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product correspondmg to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916- 10012, and 14111-14944 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least
  • nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which
  • SEQ ID NOs: 8-3795 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consistmg of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and
  • nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ
  • a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherem the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
  • said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a transcriptional activator, a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA and an upstream activating sequence.
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes and wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underex
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleo
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version
  • nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and
  • nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consistmg of SEQ ID NOS.:
  • nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ
  • a method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherem the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes , wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using
  • FASTA version 3.0178 to a polypeptide selected from the group consisting of
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherem said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111- 14944 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group
  • ⁇ consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using
  • BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-
  • nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least
  • a method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a
  • a method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a
  • a method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed
  • a method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherem said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a
  • a method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherem said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a
  • a method for identifying the target of a compound which inhibits the proliferation of an orgamsm comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having
  • nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ED NOS.: 3796-3800, 3806-4860, 5916- 10012, and 14111-14944 under stringent conditions
  • nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed.
  • a method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a
  • a method for determimng the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherem said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which
  • a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene
  • nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherem said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction.
  • each primer pair comprises a primer which is labeled with a distinguishable dye, and the distinguishable dye used to label each set of primer pairs is distinguishable from the dye used to label the other sets of primer pairs.
  • said nucleic acid sample is divided into N aliquots; said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.
  • the method of Paragraph 144 further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consistmg of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product whose activity or
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherem said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucle
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product selected from the group consist
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a
  • a method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising a poly
  • Figures 1 A and IB illustrate one method for identifying amplification products which are unde ⁇ epresented or ove ⁇ epresented in a culture.
  • Figures 2A and 2B illustrate another method for identifying amplification products which are unde ⁇ epresented or ove ⁇ epresented in a culture.
  • Figure 3 illustrates the results of a hybridization analysis where the antisense nucleic acid expressed by a strain in the culture is not complementary to all or a portion of the gene encoding the target of the compound (i.e. a nonspecific strain).
  • Figure 4 illustrates the results of a hybridization analysis where the antisense nucleic acid expressed by a strain in the culture is complementary to all or a portion of the gene encoding the target of the compound, the hybridization intensity for that strain will be intimately co ⁇ elated with the concentration of the compound (i.e. a specific strain).
  • Figure 5 A illustrates a method for replacing a promoter using a promoter replacement cassette comprising a 5' region homologous to the sequence which is 5' of the natural promoter in the chromosome, the promoter which is to replace the chromosomal promoter and a 3' region which is homologous to sequences 3' of the natural promoter in the chromosome.
  • Figure 5B illustrates a method for replacing a promoter using a promoter replacement cassette comprising a nucleic acid encoding an identifiable or selectable marker disposed between the 5' region which is homologous to the sequence 5' of the natural promoter and the promoter which is to replace the chromosomal promoter and a transcriptional terminator 3' of the gene encoding an identifiable or selectable marker.
  • Figures 6A and 6B depict the GRACE method for constructing a gene disruption of one allele of a gene (CaKRE9), and promoter replacement of the second allele of the target gene, placing the second allele under conditional, regulated control by a heterologous promoter.
  • Figure 7 A depicts growth of a wild-type strain and a CaHIS3 heterozygote strain as compared with a CaHISS GRACE strain constitutively expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of inhibitory levels of 3-aminotriazole.
  • Figure 7B depicts growth of a wild-type strain, a haploinsufficient CaHIS3 heterozygote strain, and a CaHIS3 GRACE strain constitutively expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of an intermediate level of 3-aminotriazole.
  • Figure 7C depicts growth of a wild-type strain, a haploinsufficient CaHIS3 heterozygote strain, and a CaHIS3 GRACE strain minimally expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of an intermediate level of 3-aminotriazole.
  • Figure 7D demonstrates the hypersensitivity of the CaHIS3 GRACE strain minimally expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of an intermediate level of 3-aminotriazole.
  • Figure 8 presents a Northern Blot Analysis of CaHIS3, CaALRl, CaCDC24 and CaKRE9 mRNA isolated from GRACE strains to illustrate elevated expression under non-repressing conditions.
  • Figure 9 presents conditional gene expression , using GRACE technology, with KRE1, KRE5, KRE6 and KRE9.
  • Figure 10 presents conditional gene expression using GRACE technology with CaKREl, CaTUBl, CaALGl, CaAURl, CaFKSl and CaSAT2.
  • Figure 11 illustrates an oligonucleotide comprising a lac operator flanked on each side by 40 nucleotides homologous to the promoter is the promoter which drives expression of the yabB yabCftsLftsI murE genes in an operon for use in inserting the lac operator into the promoter.
  • Figure 12 illustrates a microtitration plate which contains antibiotic and inducer at gradient concentrations in a matrix format in 10 times excess quantity.
  • Figure 13 illustrates the results of an experiment demonstrating that at appropriate concentrations of mducer, cells which overexpress the defB gene product were able to grow at elevated concentrations of the antibiotic actinonin
  • Figure 14 illustrates the results of an experiment demonstrating that at appropriate concentrations of inducer cells which overexpress the folA gene product were able to grow at elevated concentrations of the antibiotic trimethoprim.
  • Figure 15 illustrates the results of an experiment demonstrating that overexpression of the fabl gene confers resistance to triclosan, which acts on the gene product of the fabl gene, but does not confer resistance to cerulenin, trimethoprim, or actinonin, each of which act on other gene products.
  • Figure 16 illustrates the results of an experiment demonstrating that overexpression of the folA gene confers resistance to trimethoprim, which acts on the gene product of the folA gene but does not confer resistance to triclosan, cerulenin, or actinonin, each of which act on other gene products.
  • Figure 17 illustrates the results of an experiment demonstrating that overexpression of the defB gene confe ⁇ ed resistance to actinonin, which acts on the gene product of the defB gene but does not confer resistance to cerulenin, trimethoprim, or triclosan, each of which act on other gene products.
  • Figure 18 illustrates the results of an experiment demonstrating that overexpression of the fabB gene confe ⁇ ed resistance to cerulenin, which acts on the gene product of the fabB gene, ⁇ keto-acyl carrier protein synthase but does not confer resistance to triclosan, trimethoprim, or actinonin, each of which act on other gene products.
  • Figure 19 illustrates the results of experiments in which a mixture of nine strains was grown wells in a 96 well plate in medium containing various concentrations of inducer and a sufficient concentration of actinonin, cerulenin, triclosan or trimethoprim to inhibit the growth of strains which do not overexpress the targets of these antibiotics.
  • the present invention utilizes collections or cultures of strains comprising strains which either overexpress a different gene product which is required for cellular proliferation or underexpress a different gene product which is required for cellular proliferation (i.e. at least some of the strains in the culture overexpress or underexpress a gene product required for cellular proliferation).
  • the present invention uses collections or cultures of strains comprising both strains which overexpress gene products required for cellular proliferation and strains which underexpress the same gene products required for cellular proliferation.
  • each of the strains present in the culture or collection either overexpresses or underexpresses a different gene product which is required for cellular proliferation (i.e.
  • the gene product which is overexpressed or underexpressed in each strain may be any gene product which is required for cellular proliferation.
  • the gene product may be a nucleic acid or a polypeptide.
  • culture refers to a plurality of strains growing in a single aliquot of a liquid growth medium and the term “collection” refers to a plurality of strains each of which is growing in a separate aliquot of liquid growth medium or a different location on a solid growth medium.
  • one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product which is required for cellular proliferation.
  • the gene products which are overexpressed or underexpressed in one or more of the strains may be functionally related or functionally unrelated. This may facilitate the identification of compounds when two or more gene products share similar functions in the cell or where the cell has multiple biochemical pathways which lead to a particular end product.
  • the desired gene may be overexpressed or underexpressed while the remaining genes in the operon are expressed at levels where they do not impact the ability of the cell to grow in the presence of a particular compound.
  • the desired gene may be placed under the control of a regulatable promoter, a transcriptional terminator may be placed 3' of the desired gene and a promoter, preferably a constitutive promoter, may be placed 3' of the transcriptional terminator and 5' of the remaining genes in the operon.
  • the culture or collection of strains may comprise a strain which overexpresses or underexpresses a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795.
  • the culture or collection of strains may comprise strains which in aggregate overexpress or underexpress at least two gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least 10 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least 20 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least
  • nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795 at least 50 gene products whose activity or level is inhibited by a nucleic acid selected from the group consistmg of SEQ ED NOS.: 8-3795, at least 100 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least
  • one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ED NOs. 8-3795.
  • the culture or collection of strains may comprise a strain which overexpresses or underexpresses a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944.
  • the culture or collection of strains may comprise strains which in aggregate overexpress or underexpress at least two gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, at least 10 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, at least 20 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916- 10012, and 14111-14944, at least 30 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 379
  • one or more strains in the culture or collection of strains may overexpress or underexpress more than one gene product encoded by a nucleic acid selected from the group consisting of SEQ ID NOs. 3796-3800, 3806-
  • the culture or collection of strains comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ED NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
  • the culture or collection of strains may comprise strains which in aggregate overexpress or underexpress at least two gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 10 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 20 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 30 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 50 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and
  • strains in the culture or collection of strains may overexpress or underexpress more than one gene product selected from the group consistmg ofSEQ ID NOs. 3801-3805, 4861-5915, 10013-14110 and 14945-15778.
  • the culture or collection of strains comprises a strain in which at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least
  • the culture or collection of strains may comprise one or more strains which overexpress or underexpress more than one gene product encoded by a homologous coding nucleic acid.
  • the culture or collection of strains comprises a strain in which at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300 or more than 300 homologous polypeptidesas defined above is overexpressed or underexpressed.
  • the culture or collection of strains may comprise one or more strains which overexpress or underexpress more than one homologous polypeptide.
  • the culture or collection of strains comprises a strain or a group of strains in which in aggregate at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300, or more than 300 gene products selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using F
  • a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions
  • a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed, wherein each strain overexpresses or underexpresses one gene product.
  • one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:
  • the culture or collection of strains comprises a strain or a group of strains in which in aggregate at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300, or more than 300 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which
  • one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.:
  • nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions.
  • the culture or collection of strains comprises a strain or a group of strains in which in aggregate at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300, or more than 300 gene products comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-
  • one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as dete ⁇ nined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945- 15778.
  • the methods of the present invention may be used to identify the targets of compounds which inhibit the proliferation of any desired cell or organism.
  • the methods of the present mvention are employed to identify the targets of compounds which inhibit the proliferation of bacteria, fungi, or protozoans.
  • the methods of the present invention are employed to identify the targets of compounds which inhibit the growth of an organism selected from the group consisting o ⁇ Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis,
  • Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus in ⁇ uenzae, HeUcobacter pylori, Histoplasma capsulatum, Kle
  • Neisseria meningitidis Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
  • Overexpression may be obtained using a variety of techniques familiar to those skilled in the art. For example, overexpression may be obtained by operably linking a gene encoding the gene product to a promoter which transcribes a higher level of mRNA encoding or comprising the gene product than does a wild type cell.
  • a variety of promoters may be used to overexpress the gene product.
  • the promoters used to overexpress the gene product may be relatively strong promoters, promoters which possess a moderate level of activity, or relatively weak promoters and may be either constitutive or regulatable promoters.
  • several strains, each of which overexpresses the gene product to a different extent may be used in order to optimize the degree of overexpression of the gene product.
  • each of the gene products required for proliferation may be placed under the control of several different promoters of varying strengths to create several different strains which express the gene product at varying levels.
  • the level of expression of the gene product in each of the strains is compared to that in wild type cells in order to identify a promoter which provides a desired level of expression relative to wild type cells (i.e. a desired level of overexpression or underexpression).
  • the strain having the desired level of expression is then included in a culture or collection of strains to be contacted with a test compound as discussed below.
  • the promoter is selected to be active in the type of cell in which the gene product is to be expressed.
  • the gene encoding the gene product may be operably linked to promoters such as the SV40 promoter, the metallothionine promoter, the MMTV promoter, the RSV promoter, the tetP promoter, the adenovirus major late promoter or other promoters known to those skilled in the art.
  • the gene encoding the gene product may be operably linked to promoters such as the CYC1, ADHI, ADHII, GAL1, GALIO, PH05, PGK or other promoters used in the art.
  • the gene encoding the gene product may be operably linked to the , SP6, T3, tic promoter, lac promoter, temperature regulated lambda promoters, the Bacillus aprE and nprE promoters (U.S. Patent No. 5,387,521), the bacteriophage lambda P L and P R promoters (Renaut, et al., (1981) Gene 15: 81) the trp promoter (Russell, et al., (1982) Gene 20: 23), the tac promoter (de Boer et al., (1983) Proc. Natl. Acad. Sci. USA 80:
  • B. subtilis alkaline protease promoter (Stahl et al, (1984) J. Bacteriol. 158, 411- 418) alpha amylase promoter of 5. subtilis (Yang et al., (1983) Nucleic Acids Res. 11, 237-249) or B. amyloliquefaciens (Tarkinen, et al, (1983) J. Biol. Chem. 258, 1007- 1013), the neutral protease promoter from B. subtilis (Yang et al, (1984) J. Bacteriol 160, 15-21), T7 RNA polymerase promoter (Studier and Moffatt (1986) J Mol Biol
  • the promoter is a novel inducible promoter system, XylT5, comprising a modified T5 promoter fused to the xylO operator from the xylA promoter of Staphylococcus aureus.
  • This promoter is described in U.S. Patent Application Serial Number 10/032,393, the disclosure of which is incorporated herein by reference in its entirety.
  • the promoter may be a two-component inducible promoter system in which the T7 RNA polymerase gene is integrated on the chromosome and is regulated by / ⁇ cUV5/ lacO (Brunschwig, E. and Darzins, A. 1992.
  • T7 gene 10 promoter which is transcribed by T7 RNA polymerase, is fused with a lacO operator.
  • the promoter may be the promoters from the plasmids pEPEF3 or pEPEF14, which harbor xylose inducible promoters functional in E.faecalis, described in U.S. Patent Application Serial No. 10/032,393, the disclosure of which is inco ⁇ orated herein by reference in its entirety.
  • Other promoters which may be used are familiar to those skilled in the art.
  • the gene encoding the gene product may be operably linked to the CaACTl promoter (Morschhauser, Mol.
  • overexpression may be achieved by using homologous recombination to replace the natural promoter which drives expression of the gene required for proliferation with a regulatable promoter.
  • homologous recombination to replace the natural promoter which drives expression of the gene required for proliferation with a regulatable promoter.
  • 09/948,993 (the disclosure of which is inco ⁇ orated herein by reference in its entirety) and U.S. Patent Application 09/948,993 (the disclosure of which is inco ⁇ orated herein by reference in its entirety) may be used to place the gene required for proliferation under the control of a regulatable promoter.
  • U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is inco ⁇ orated herein by reference in its entirety)
  • U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 (the disclosure of which is inco ⁇ orated herein by reference in its entirety)
  • U.S. Patent Application Serial Number 09/815,242 (the disclosure of which is inco ⁇ orated herein by reference in its entirety), U.S.
  • Patent Application Serial Number 09/492,709 discloses genes and gene products required for proliferation which may be used in any of the methods of the present invention.
  • U.S. Patent Application Serial Number 09/711,164 discloses genes and gene products required for proliferation which may be used in any of the methods of the present invention.
  • U.S. Patent Application Serial Number 09/741,669 disclose genes and gene products required for proliferation which may be used in any of the methods of the present invention.
  • the cells may be haploid, such as bacterial cells.
  • a linear promoter replacement cassette comprising a regulatable promoter flanked by nucleotide sequences having homology to the natural promoter is introduced into the cell.
  • the cassette also comprises a nucleotide sequence encoding a selectable marker or a marker whose expression is readily identified.
  • the cassette may be a double stranded nucleic acid or a single stranded nucleic acid as described in U.S. Patent Application Serial Number 09/948,993, the disclosure of which is inco ⁇ orated herein by reference in its entirety.
  • the natural promoter is replaced with the regulatable promoter, leaving the gene required for proliferation under the control of the regulatable promoter.
  • Strains in which the gene required for proliferation is under control of the regulatable promoter are grown under conditions in which the regulatable promoter provides a level of the proliferation-required gene product which is above the level in a wild type cell.
  • the strains may be grown in the presence of an inducer which induces expression from the regulatable promoter, or under conditions in which the action of a repressor on the regulatable promoter is reduced or eliminated.
  • each of the genes encoding gene product required for proliferation with a single desired replacement promoter a plurality of replacement promoters which provide desired expression levels for the gene products to be overexpressed or underexpressed are used.
  • the method is performed as described above except that rather than using a single labeled primer complementary to a nucleotide sequence within the single replacement promoter, a plurality of labeled primers complementary to suitable nucleotide sequences in the plurality of replacement promoters are used.
  • the strains may be designed such that the length of the nucleotide sequence encoding the antisense nucleic acid is different for each gene.
  • Amplification reactions are performed as described above using primers at each end of the gene encodmg the antisense nucleic acid such that the amplification product corresponding to each gene has a unique length or a dye which allows it to be distinguished from other amplification products of the same length.
  • the lengths of the nucleotide sequences encoding the antisense nucleic acids may not be unique for each gene, but the primers used in the amplification reaction may be selected such that the length of the amplification product co ⁇ esponding to each gene is unique.
  • the native promoters may be replaced with promoters which include therein or adjacent thereto a unique nucleotide sequence which is distinct from that present in the other replacement promoters in the strains in the culture or collection of strains.
  • each promoter includes or has adjacent thereto a unique "tag" which may be used to identify strains which proliferate more rapidly or more slowly in the culture or collection of strains.
  • the tag may be detected using hybridization based methods or amplification based methods, including the amplification method which generates amplification products having a unique size for each proliferation required gene described above.
  • the native promoter which directs the transcription of the gene required for proliferation may rendered regulatable by inserting a regulatory element into the chromosome of the cell via homologous recombination such that the regulatory element regulates the level of transcription from the promoter.
  • the regulatory element may be may be an operator which is recognized by a repressor (e.g. lac, tet, araBAD repressors) or a nucleotide sequence which is recognized by a transcriptional activator.
  • the regulatory element may be a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA or an upstream activating sequence.
  • a linear regulatory element insertion cassette comprising a regulatory element flanked by nucleotide sequences having homology to the natural promoter is introduced into the cell.
  • the cassette also comprises a nucleotide sequence encoding a selectable marker or a marker whose expression is readily identified.
  • the cassette may be a double stranded nucleic acid or a single stranded nucleic acid as described in U.S. Patent Application Serial Number
  • the regulatory element Upon homologous recombination, the regulatory element is inserted into the chromosome, leaving the gene required for proliferation under the control of the regulatory element.
  • Strains in which the gene required for proliferation is under control of the regulatory element are grown under conditions in which the regulatable promoter provides a level of the proliferation-required gene product which is above the level in a wild type cell.
  • the stiains may be grown in the presence of an inducer which induces expression from the promoter, or under conditions in which the action of a repressor on the promoter is reduced or eliminated.
  • the amplification method which generates amplification products having a unique size for each proliferation required gene may be used to detect strains which are ove ⁇ epresented or unde ⁇ epresented in the culture or collection of stiains.
  • primers complementary to a nucleotide sequence within the regulatory element may be used in the amplification reaction.
  • the promoter replacement cassette or regulatory element insertion cassette may be a double stranded nucleic acid, such as an amplicon generated through PCR or other amplification methods, or a single stranded nucleic acid, such as an oligonucleotide.
  • single stranded nucleic acids may be introduced into the chromosome using the methods described in Ellis et al., PNAS 98: 6742-6746, 2001, the disclosure of which is inco ⁇ orated herein by reference in its entirety.
  • the cell into which the promoter replacement cassette or regulatory element insertion cassette is introduced has an enhanced frequency of recombination.
  • the cells may lack or have a reduced level or activity of one or more exonucleases which would ordinarily degrade the DNA to be inserted into the chromosome.
  • the cells may both lack or have reduced levels of exonucleases and express or overexpress proteins involved in mediating homologous recombination.
  • cells in which the activity of exonuclease V of the RecBCD recombination pathway, which degrades linear nucleic acids, has been reduced or eliminated such as recB, recC, or recD mutants may be used.
  • the cells have mutations in more than one of the recB, recC, and recD genes which enhance the frequency of homologous recombination.
  • the cells may have mutations in both the recB and recC genes.
  • the promoter replacement or regulatory element insertion methods may also be performed in Escherichia coli cells in which the activity of the RecET recombinase system of the Rac prophage has been activated, such as cells which carry an sbcA mutation.
  • the RecE gene of the rac prophage encodes ExoVIII a 5 '-3' exonuclease
  • the RecT gene of the Rac prophage encodes a single stranded DNA binding protein which facilitates renaturation and D-loop formation.
  • the gene products of the RecE and RecT genes or proteins with analogous functions facilitate homologous recombination.
  • the RecE and RecT genes lie in the same operon but are normally not expressed.
  • sbcA mutants activate the expression the RecE and RecT genes.
  • the methods may be performed in cells which carry mutations in the recB and recC genes as well as the sbcA mutation.
  • the RecE and RecT gene may be constitutively or conditionally expressed.
  • the methods may be performed in E. coli strain JC8679, which carries the sbcA23, recB21 and recC22 mutations.
  • the methods may be performed in Escherichia coli cells in which recombination via the RecF pathway has been enhanced, such as cells which carry an sbcB mutation. It will be appreciated that the recE and recT gene products, or proteins with analogous functions may be conditionally or constitutively expressed in prokaryotic organisms other than E. coli.
  • these proteins may be conditionally or constitutively expressed in Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens,
  • Coccidiodes immitis Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus in ⁇ uenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides,
  • Pasteurella haemolytica Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella ⁇ exneri, Shigella sonnei, Staphylococcus epidermidis,
  • Streptococcus pneumoniae Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, or Yersinia pestis.
  • plasmids encoding these gene products may be introduced into the organism.
  • the coding sequences encoding these gene products may be optimized to reflect the codon preferences of the orgamsm in which they are to be expressed.
  • the organism may contain mutations analogous to the recB, recC, recD, sbcA or sbcB mutations which enhance the frequency of homologous recombination.
  • the promoter replacement or regulatory element insertion methods may be conducted in cells which utilize the Red system of bacteriophage lambda ( ⁇ ) or analogous systems from other phages to enhance the frequency of homologous recombination.
  • the Red system contains three genes, ⁇ , ⁇ and exo whose products are the Gam, Bet and Exo proteins (see Ellis et al. PNAS 98:6742-6746, 2001, the disclosure of which is inco ⁇ orated herein by reference in its entirety).
  • the Gam protein inhibits the RecBCD exonuclease V, thus permitting Beta and Exo to gain access to the ends of the DNA to be integrated and facilitating homologous recombination.
  • the Beta protein is a single stranded DNA binding protein that promotes the annealing of a single stranded nucleic acid to a complementary single stranded nucleic acid and mediates strand exchange.
  • the Exo protein is a double-stranded DNA dependent 5 '-3' exonuclease that leaves 3' overhangs that can act as substrates for recombination.
  • constitutive or conditional expression of the ⁇ red proteins or proteins having analogous functions facilitates homologous recombination.
  • ⁇ Beta, Gam and Exo proteins, or proteins with analagous functions may be expressed constitutively or conditionally in prokaryotic organisms other than E. coli.
  • these proteins may be conditionally or constitutively expressed in Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium dipth
  • the cells may have an increased frequency of homologous recombination as a result of more than one of the aforementioned characteristics.
  • the enhanced frequency of recombination may be a conditional characteristic of the cells which depends on the culture conditions in which the cells are grown. For example, in some embodiments, expression of the ⁇ Red Gam, Exo, and Beta proteins or recE and recT proteins may be regulated.
  • the cells may have an increased frequency of homologous recombination as a result of any combination of the aforementioned characteristics.
  • the cell may carry the sbcA and recBC mutations.
  • a linear double stranded DNA to be inserted into the chromosome of the organism is introduced into an organism constitutively or conditionally expressing the recE and recT or the ⁇ Beta, Gam and Exo proteins or proteins with analogous functions as described above.
  • the organism may be Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis,
  • the double stranded DNA may be introduced into an organism having the recBC and sbcA mutations or analogous mutations.
  • a single stranded DNA to be inserted into the chromosome of the organism is introduced into an organism expressing the ⁇ Beta protein or a protein with an analogous function.
  • the single stranded DNA is introduced into an organism expressing both the ⁇ Beta and Gam proteins or proteins with analogous functions.
  • the single stranded DNA is introduced into an organism expressing the ⁇ Beta, Gam and Exo proteins or proteins with analogous functions.
  • the ⁇ proteins or analogous protems may be expressed constitutively or conditionally.
  • the organism may be Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli,
  • the linear nucleic acid may be introduced into the chromosome of a first organism which has an enhanced frequency of homologous recombination and then transfe ⁇ ed to a second organism which is less amenable to direct application of the present methods.
  • the linear nucleic acid may be introduced into the chromosome of E. coli and transfe ⁇ ed into a second organism via conjugation or transduction. After introduction into the second organism, the nucleic acid is inserted into the chromosome of the second organism via homologous recombination, thereby effectively transferring the regulatory element from the chromosome of the first organism into the co ⁇ esponding location in the chromosome of the second organism.
  • the cells may be diploid cells, such as fungal cells.
  • one copy of the gene encoding the proliferation-required gene product may be disrupted, rendering it inactive.
  • one copy of the gene encoding the proliferation-required gene product may be disrupted and the other copy of the gene encoding the proliferation-required gene product may be placed under the control of a regulatable promoter.
  • Such strains may be generated by disrupting the first copy of the gene encoding the proliferation-required gene product by homologous recombination using a disruption cassette comprising a nucleotide sequence encoding an expressible dominant selectable marker flanked on each side by nucleic acids homologous to the target sequence to be disrupted.
  • the second copy of the gene encoding the proliferation-required gene product may be placed under the control of a regulatable promoter by homologous recombination using a promoter replacement cassette comprising a regulatable promoter flanked on each side by nucleic acids homologous to the natural promoter for the proliferation-required gene.
  • the promoter replacement cassette may also include a nucleotide sequence encoding a selectable marker located 5' of the regulatable promoter but between the nucleic acids homologous to the natural promoter.
  • overexpression may be achieved by operably linking the gene required for proliferation to a desired promoter in a vector.
  • the vector may be a vector which replicates extrachromosomally or a vector which integrates into the chromosome.
  • the vector may be a pBR322 based vector or a bacteriophage based vector such as PI or lambda.
  • the vector may be a vector based on the 2 micron circle or a vector inco ⁇ orating a yeast chromosomal origin of replication.
  • the vector may be a retroviral vector, SV40 based vector, a vector based on bovine papilloma virus, a vector based on adenovirus, or a vector based on adeno-associated virus. If the vector is to be used in Candida albicans it may be a vector comprising a promoter selected from the group consisting of the CaPCKl, MET25, MAL2, PH05, GAL1.10, STE2 or STE3 promoters.
  • the vectors described in the following publications may be used: CIplO, an efficient and convenient integrating vector for Candida albicans. Murad et al., Yeast 16(4):325-7 (2000); Transforming vector pCPW7, Kvaal et al., : Infect Immun 67(12):6652-62 (1999); Transforming vector pCWOPl ⁇ , Kvaal et al., :
  • Efglp an essential regulator of mo ⁇ hogenesis of the human pathogen Candida albicans
  • Candida albicans is a member of a conserved class of bHLH proteins regulating mo ⁇ hogenetic processes in fungi. EMBO 16:1982- 1991.
  • a variety of other vectors suitable for use in foregoing organisms or in any other organism in which the present mvention is to be practiced are familiar to those skilled in the art.
  • Underexpression of the gene product may be obtained in a variety of ways.
  • underexpression of the gene product may be achieved by providing an agent which reduces the level or activity of the gene product within the cell.
  • the agent may comprise an antisense nucleic acid which is complementary to a nucleic acid encoding the gene product or complementary to a portion of a nucleic acid encodmg the gene product.
  • a nucleic acid which encodes the antisense nucleic acid may be operably linked to a regulatable promoter.
  • the antisense nucleic acid When grown under appropriate conditions, such as media containing an inducer of transcription or an agent which alleviates repression of transcription, the antisense nucleic acid is expressed in the cell, thereby reducing the level or activity of the gene product within the cell.
  • concentration of the mducer of transcription or the agent which alleviates repression of transcription may be varied to provide optimal results.
  • Patent Application Serial Number 09/711,164 (the disclosure of which is inco ⁇ orated herein by reference in its entirety), U.S. Patent Application Serial Number 09/741,669 (the disclosure of which is inco ⁇ orated herein by reference in its entirety), U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is inco ⁇ orated herein by reference in its entirety), or U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 the disclosure of which is inco ⁇ orated herein by reference in its entirety).
  • underexpression of a gene product required for proliferation may be achieved by constructing stiains in which the expression of the gene product is under the control of a constitutive or regulatable promoter using methods such as those described above with respect to methods in which the gene product is overexpressed.
  • the cells are grown under conditions in which expression the gene product is expressed at a level lower than that of a wild type cell.
  • the cells may be grown under conditions in which a repressor reduces the level of transcription from the regulatable promoter.
  • underexpression may be achieved by operably linking the gene required for proliferation to a desired promoter in a vector as described above with respect to embodiments in which gene products required for proliferation are overexpressed.
  • the vector may be present in cells in which the chromosomal copy or copies of the gene has been disrupted.
  • Gene products required for proliferation may be identified using a variety of methods, including the methods described in U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is inco ⁇ orated herein by reference in its entirety), U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 (the disclosure of which is inco ⁇ orated herein by reference in its entirety), U.S. Patent Application Serial Number 09/815,242 (the disclosure of which is inco ⁇ orated herein by reference in its entirety), U.S. Patent Application Serial Number 09/492,709 (the disclosure of which is inco ⁇ orated herein by reference in its entirety), U.S.
  • gene products required for proliferation are identified by operably linking random genomic fragments to a regulatable promoter in a vector.
  • the random genomic fragments may be generated by a partial digestion with a restriction enzyme, mechanical shearing, using techniques such as sonication and nebulization, or DNAsel digestion.
  • the expression vectors Upon induction of transcription from the promoter with a suitable agent, the expression vectors produce an RNA molecule corresponding to the inserted genomic fragments. En those instances where the inserted genomic fragments are in an antisense orientation with respect to the promoter, the transcript produced is complementary to at least a portion of an mRNA encoding a gene product such that they interact with sense mRNA produced from various genes and thereby decrease the translation efficiency or the level of the sense messenger RNA (mRNA) thus decreasing production of the protein encoded by these sense mRNA molecules. In cases where the sense mRNA encodes a protein required for proliferation, cells grown under inducing conditions fail to grow or grow at a substantially reduced rate.
  • mRNA sense messenger RNA
  • the transcript produced is complementary to at least a portion of a non-translated RNA and where that non- translated RNA is required for proliferation
  • cells grown under inducing conditions also fail to grow or grow at a substantially reduced rate.
  • cells grown under non- inducing conditions grow at a normal rate.
  • the genes to which the antisense nucleic acids are complementary are then identified and utilized in the methods of the present invention.
  • genes required for proliferation may be identified by replacing the natural promoter for the proliferation required gene with a regulatable promoter as described above.
  • the growth of such strains under conditions in which the promoter is active or non-repressed is compared to the growth under conditions in which the promoter is inactive or repressed. If the strains fail to grow or grow at a substantially reduced rate under conditions in which the promoter is inactive or repressed but grow normally under conditions in which the promoter is active or non-repressed, then the gene which is operably linked to the regulatable promoter encodes a gene product required for proliferation.
  • proliferation-required genes and gene products identified using promoter replacement are described in U.S.
  • Patent Application Serial Number 09/948,993 (the disclosure of which is inco ⁇ orated herein by reference in its entirety)
  • U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is inco ⁇ orated herein by reference in its entirety)
  • U.S. Patent Application Serial Number 10/032,585 filed December 20
  • the present invention includes a method for identifying the gene product on which a compound which inhibits the proliferation of an organism acts.
  • the method employs a culture which comprises a mixture of strains of the organism. At least some of the strains in the culture overexpress a different gene product which is required for the proliferation of the organism. Preferably, each of the strains in the culture overexpresses a different gene product which is required for proliferation of the organism (i.e. all of the strains in the culture overexpress a gene product which is required for proliferation of the organism). Such strains may be obtained using the methods described above.
  • the culture may comprise any number of strains.
  • the culture may comprise at least two strains, at least 10 strains, at least 20 strains, at least 30, strains, at least 50 strains, at least 100 strains, at least 300 strains or more than 300 strains.
  • the culture may comprise strains which in aggregate overexpress all or most of the gene products required for proliferation of the organism.
  • the culture is contacted with a compound which inhibits proliferation of the organism.
  • the compound may be a candidate drug compound obtained from any source.
  • the compound may be a compound generated using combinatorial chemistry, a compound from a natural product library, or an impure or partially purified compound, such as a compound in a partially purified natural extract.
  • the culture is contacted with a sufficient concentration of the compound to inhibit the proliferation of strains of the organism in the culture which do not overexpress the gene product on which the compound acts, such that strains which overexpress said gene product on which the compound acts proliferate more rapidly in the culture than strains which do not overexpress said gene product on which said compound acts.
  • the strain which overexpresses the gene product on which the compound acts will be more prevalent in the culture than strains which do not overexpress the gene product on which the compound acts.
  • the growth conditions and incubation period are selected so that only one strain, the strain overexpressing the target of the compound, is recovered from the culture.
  • a plurality of cultures containing a plurality of strains each of which overexpresses a different proliferation- required gene product may be grown in the presence of varying concentrations of the compound.
  • the plurality of cultures may be grown at varying concentrations of an agent which regulates the level of expression from the promoter, such as an inducer or an agent which reduces the effect of a repressor on transcription from the promoter.
  • the cultures may be grown in liquid medium in the presence of the compound whose target is to be identified (and where appropriate in the presence of an agent which regulates the level of expression from the promoter) or alternatively, a liquid culture comprising the stiains which overexpress the proliferation-required gene products may be grown in the absence of the compound whose target is to be identified and then introduced onto a solid medium containing the compound (and, where appropriate, also containing an agent which regulates the level of expression from the promoter).
  • the identity of the overexpressed gene product which is the target of the compound may be determined using a variety of methods.
  • the nucleic acids present in the culture or collection of strains which was contacted with the compound may be compared to the nucleic acids present in a control culture or collection of strains which was not contacted with the compound to identify nucleic acids which are ove ⁇ epresented in the culture or collection of strains contacted with the test compound relative to the control culture or collection of stiains.
  • the nucleic acids present in a culture or collection of strains contacted with the test compound may be analyzed to identify those nucleic acids which are present without comparison to a control culture or collection of strains.
  • the strains which proliferated more rapidly in the culture or collection of strains are identified as follows.
  • Amplification products which are correlated with each of the overexpressed genes and which are distinguishable from one another are obtained from a culture or collection grown in the presence of a test compound.
  • the amplification products are distinguished from one another to determine whether a particular amplification product is ove ⁇ epresented in the culture or collection of strains.
  • the amplification products co ⁇ esponding to each of the gene products have lengths which permit them to be distinguished from one another.
  • one or more of the amplification products have similar or identical lengths but are distinguishable from one another based on a detectable agent, such as a dye, attached thereto.
  • amplification products which are ove ⁇ epresented are identified by comparing the amplification products from the culture or collection of stiains which was contacted with the test compound to the amplification products from a culture or collection of strains which was not contacted with the test compound.
  • amplification products which are ove ⁇ epresented may be identified by simply identifying the amplification products obtained from the culture or collection of strains contacted with the test compound (for example, only one or a few strains may have proliferated in the presence of the test compound).
  • each of the native promoters of each of the genes encoding gene product required for proliferation are replaced by a single desired replacement promoter.
  • the nucleic acids from the culture or collection of strains may be divided into at least two aliquots if desired. In a prefe ⁇ ed embodiment the nucleic acids from the culture or collection of strains are divided into four aliquots.
  • a single primer complementary to a nucleotide sequence within the replacement promoter , within the proliferation required genes, or within nucleic acid sequences adjacent to the promoter or proliferation required genes is divided into at least two portions, one portion for each aliquot of nucleic acids. Each portion of the primer is labeled with a distinct detectable dye, such as the 6FAMTM, TETTM, VICTM, HEXTM, NEDTM, and PETTM dyes obtainable from Applied Biosystems (Foster City, CA).
  • the DS-31 or DS-33 dye sets available from Applied Biosystems may be used to label the primers.
  • the HEXTM, NED, JOE, TMR and TETTM dyes available from Amersham Biosciences may be used.
  • a single primer labeled with a single dye may be used.
  • at least 2, at least 3, at least 4 or more than 4 primers labeled with distinguishable dyes may be used.
  • each of the portions of labeled primers are added to each of the aliquots of the nucleic acids from the culture or collection of stiains such that each aliquot of nucleic acid receives a single labeled primer with a single detectable dye thereon.
  • the primers are divided into 3 portions, 4 portions or more than 4 portions, with each portion having a dye which is distinguishable from the dyes on the other portions thereon.
  • Each of the aliquots of nucleic acids also receives a set of unlabeled primers, with each of the unlabeled primers being complementary to a nucleotide sequence within the promoter, within a nucleotide sequence which is unique to one of the genes encoding gene products required for proliferation which were placed under the control of the replacement promoter, or within nucleotide sequences adjacent to the promoter or proliferation required genes.
  • Each of the aliquots receives primers unique to 1/N proliferation required genes which were placed under the control of the replacement promoter, where N is the number of aliquots (i.e.
  • each of the four aliquots of nucleic acids from the culture or collection of strains would receive primers complementary to 25 of the genes).
  • the unlabeled primers are selected so that each will yield an amplification product having a length distinguishable from the length of the amplification product produced with the other unlabeled primers.
  • the amplification products are between about 100- about 400 nucleotides in length, but any lengths which may be distinguished from each other may be used.
  • some of the amplification products may have identical or very similar lengths but be distinguishable from one another due to labeling with distinguishable dyes.
  • a nucleic acid amplification reaction is conducted on each of the nucleic acid aliquots.
  • the amplification products are then separated by length to identify amplification products having increased representation in the culture or collection of strains (i.e. amplification products derived from cells which proliferated more rapidly in the culture or collection of stiams).
  • the amplification products are then co ⁇ elated with the corresponding genes to determine which strains proliferated more rapidly in the culture or collection of strains.
  • amplification products having increased representation in the culture may be identified by comparing the amplification products obtained from a culture or collection of strains which was contacted with the compound to amplification products obtained from a control culture or collection of strains which was not contacted with the compound.
  • the amplification products which are obtained from a culture which was contacted with the compound may be directly identified without comparison to a control culture which was not contacted with the compound.
  • the amplification products from each of the nucleic acid aliquots are pooled and subjected to capillary electrophoresis.
  • the amplification products are detected by detecting the fluorescent dyes attached thereto and their lengths are determined to identify those amplification products having increased or decreased representation in the culture or collection of strains.
  • IA and IB illustrate one embodiment of this method in which the absence of an amplification product from an amplification reaction performed on a culture comprising a plurality of strains underexpressmg genes required for proliferation indicates that a test compound acts on the gene co ⁇ esponding to the missing amplification product. It will be appreciated that the method may also be used to identify an amplification product which is ove ⁇ epresented in an amplification reaction conducted on a culture or collection of strains overexpressing genes required for proliferation because the test compound acted on the co ⁇ esponding gene.
  • a first amplification reaction is performed on nucleic acids obtained from a culture or collection of strains which was contacted with the compound using a first primer complementary to a nucleotide sequence present upstream or downstream of all of the overexpressed genes (such as a primer complementary to a nucleotide sequence in a replacement promoter upstieam of all of the overexpressed genes) and a set of primers complementary to a nucleotide sequence unique to each of the stiains (such as a primer complementary to a nucleotide sequence within each of the proliferation-required genes).
  • a first primer complementary to a nucleotide sequence present upstream or downstream of all of the overexpressed genes such as a primer complementary to a nucleotide sequence in a replacement promoter upstieam of all of the overexpressed genes
  • a set of primers complementary to a nucleotide sequence unique to each of the stiains such as a primer complementary to a nucleotide sequence within each of the proliferation
  • the common primer complementary to a nucleotide sequence upstream or downstream of all of the overexpressed genes is labeled with the dye.
  • the primers used in the amplification reaction are designed so that the amplification product co ⁇ esponding to each proliferation-required gene has a unique length or a dye which allows it to be distinguished from other amplification products of the same length.
  • a second amplification reaction is conducted on a control culture or collection of strains which was not contacted with the compound using the same primers as in the first amplification reaction.
  • the amplification products from the first amplification reaction are compared to those from the second amplification reaction to identify one or more amplification products which are overrepresented in the culture or collection of strains.
  • the amplification products from the first amplification reaction may be run in a separate lane of a polyacrylamide gel or a separate capillary than the amplification products from the second amplification reaction and the two lanes or capillaries are compared to one another.
  • the same dye may be used to label the primers in the first and second amplification reactions.
  • different dyes may be used to label the primers in the first and second amplification reactions.
  • the same dye may be used to label the primers in the first and second amplification reactions.
  • different dyes may be used to label the primers in the first and second amplification reactions.
  • the primers in the second amplification reaction are labeled with a different dye which is distinguishable from the dye used in the first amplification reaction.
  • the amplification reactions may be pooled and run in the same lane on a polyacrylamide gel or in the same capillary and the products from each amplification reaction are compared by comparing the amount of each dye present for each amplification product.
  • Figures 2A and 2B illustrate one embodiment of this method in which the absence of an amplification product from the amplification reaction performed on a culture comprising a plurality of strains underexpressmg genes required for proliferation which was contacted with the compound indicates that a test compound acts on the gene co ⁇ esponding to the missing amplification product. It will be appreciated that the method may also be used to identify an amplification product which is overrepresented in an amplification reaction conducted on a culture or collection of strains overexpressing genes required for proliferation because the test compound acted on the co ⁇ esponding gene.
  • individual amplification reactions may be conducted on nucleic acids obtained from the culture or collection of strains.
  • Each amplification reaction contains primers which will yield an amplification product specific for only one of the proliferation required genes.
  • the resulting amplification products from each of the individual amplification reactions are pooled and amplification products having increased representation in the culture are identified as described above.
  • a culture or collection of strains in which gene products required for proliferation are overexpressed from regulatable promoters which replaced the native promoters of the genes encoding these gene products is allowed to grow in the presence of a test compound for a desired number of generations.
  • the culture or collection of strains is allowed to grow in the presence of the test compound for at least 20 generations.
  • Nucleic acids are isolated from the culture or collection of stiams and an amplification reaction is performed using a primer which is complementary to a nucleotide sequence within the replacement promoter(s) or a nucleotide sequence adjacent to the a 5' end thereof and primers which are complementary to a nucleotide sequence within the proliferation required genes or nucleotide sequences adjacent thereto.
  • the resulting amplification product(s) is directly sequenced using a primer complementary to a nucleotide sequence within the replacement promoter.
  • the vector containing the nucleotide sequence encoding the proliferation-required gene product is obtained from a strain which proliferated more rapidly in the culture using methods such as plasmid preparation techniques. Nucleic acid sequencing techniques are then employed to determine the nucleotide sequence of the gene which was overexpressed. Alternatively, the identity of the overexpressed gene product which is the target of the compound may be determined by performing a nucleic acid amplification reaction, such as a polymerase chain reaction (PCR), to identify the nucleotide sequence of the gene which was overexpressed.
  • PCR polymerase chain reaction
  • aliquots of a nucleic acid preparation such as a purified plasmid, from the strain which is recovered from the culture may each be contacted with pairs of PCR primers which would amplify a different proliferation-required gene to determine which pair of primers yields an amplification product.
  • Yet another method for determining the identity of the gene product which is the target of the compound involves obtaining a nucleic acid array, such as a DNA chip, which contains each of the proliferation-required genes which were overexpressed in the strains in the culture. Each proliferation-required genes occupies a known location in the array.
  • a nucleic acid preparation, such as a plasmid preparation, from the recovered strain is labeled with a detectable agent, such as radioactive or fluorescent moiety, and placed in contact with the nucleic acid array under conditions which permit the labeled nucleic acid to hybridize to complementary nucleic acids on the a ⁇ ay.
  • the location on the a ⁇ ay to which the labeled nucleic acids hybridize is determined to identify the gene which was overexpressed in the recovered strain. If desired the hybridized nucleic acids from a culture which was contacted with the compound may be compared to the hybridized nucleic acids from a J control culture which was not contacted with the compound. Alternatively, the hybridized nucleic acids from a culture which was contacted with the compound may be directly identified without comparison to nucleic acids from a control culture.
  • more than one strain may proliferate more rapidly in the presence of the compound. This may result from a variety of causes. For example, the concentration of the compound may not have been high enough to restrict proliferation only to cells which overexpress one gene product (i.e. the target gene product). While strains which overexpress the target gene product will be the most prevalent strain in the culture, other strains may also have proliferated. In such instances, the identity of the gene product in the strain which is most prevalent in the culture may be identified by quantitating the levels of each of the genes encoding proliferation-required proteins in the culture. This may be accomplished by quantitative PCR, DNA sequencing, hybridization, or a ⁇ ay technology as described above.
  • multiple stiains will exhibit more rapid proliferation in the culture as a result of a common functional attribute.
  • the stiams which proliferate more rapidly may each overexpress a gene product with a common enzymatic activity, such as serine protease activity for example.
  • the strains which proliferate more rapidly may each overexpress a gene product with a common functional domain, such as a cAMP binding domain.
  • the common attribute of the strains which proliferate more rapidly may provide information as to the mode of action of the compound or the biochemical activity of the target of the compound.
  • the compound acts by inhibiting serine protease activity and the target protein is a serine protease.
  • the compound may be derivatized and the efficacy of the derivatized compound against each of the strains which proliferated more rapidly may be assessed as described herein in order to identify derivatives which are capable of interacting with a wide range of targets sharing a common activity or binding site (i.e. derivatives which have a greater ability to inhibit the proliferation of all the strains than the original compound) or to identify derivatives having greater specificity for a desired target (i.e. derivatives which have a greater specificity for one of the strains than the original compound).
  • a nonessential gene product expressed in the cell might also bind to the initial test compound in addition to the gene product required for proliferation.
  • two gene products required for proliferation might bind to the initial test compound but specificity for one of the gene products is desired.
  • the methods of the present invention may be performed using an array of individual strains (i.e. a collection of strains) each of which overexpresses a different proliferation-required gene product.
  • individual strains each overexpressing a different proliferation-required gene product may be grown in different wells of a multiwell plate. Each well is contacted with the compound (and, where appropriate an agent which regulates the level of expression from the promoter). The level of proliferation of the strains in each of the wells is determined to identify a strain which proliferated more rapidly. The identity of the overexpressed gene product in the strain that proliferated more rapidly is determined as described above.
  • individual strains each overexpressing a different proliferation-required gene product are grown at different locations on a solid medium, such as an agar plate.
  • the medium contains the compound and where appropriate an agent which regulates the level of expression from the promoter).
  • the level of proliferation of each of the strains is determined to identify a strain which proliferated more rapidly.
  • the identity of the overexpressed gene product in the strain that proliferated more rapidly is determined as described above.
  • the above methods may be used to prioritize compound development or to determine whether the compound has been previously identified or whether the target of the compound is the target of a previously identified drug.
  • the product is a natural product, it is advantageous to determine whether it has been previously identified prior to investing significant effort in developing it.
  • the target of a partially purified or purified natural product or a compound produced by combinatorial chemistry is identified using the methods described above and compared to the targets of known drugs. If the target is identical to that of a known drug, further development of the compound is halted.
  • an a ⁇ ay of stiains each of which overexpresses a different gene product i.e.
  • a collection of strains is grown on solid medium containing a compound to be evaluated.
  • the location of each strain in the a ⁇ ay and the gene product overexpressed by that strain is known.
  • the pattern of colonies which grow in the presence of the compound is evaluated and compared to the pattern of colonies which grow in the presence of previously identified drugs. If the pattern of colonies which grow in the presence of the compound being evaluated is the same as the pattern of colonies which grow in the presence of a previously identified drug, further development of the compound is halted.
  • the sequence of the gene product in a strain which proliferated more rapidly in the assays described above is compared to the sequence of gene products from heterologous organisms to determine the likely spectrum of species whose growth would be inhibited by the compound.
  • homology may be determined using any of a variety of methods familiar to those skilled in the art. For example, homology may be determined using a computer program such as BLASTP or FASTA. The ability of the compound to inhibit the growth of the heterologous species may then be confirmed by comparing the growth of cells of the heterologous species in the presence and absence of the compound.
  • the present invention uses collections or cultures of strains comprising both strains which overexpress gene products required for cellular proliferation and strains which underexpress the same gene products required for cellular proliferation.
  • the culture or collection of strains is contacted with a compound and the nucleic acids present in the culture or collection of stiains are analyzed.
  • nucleic acids derived from overexpressing strains can be distinguished from those derived from underexpressmg strains.
  • the overexpressing stiains may be obtained using promoter replacement as described above while the underexpressmg stiains may be obtained by expressing antisense nucleic acids.
  • amplification primers may be designed which will uniquely amplify nucleic acids from the overexpressing strains or the underexpressmg strains. If a compound acts on a gene product which was overexpressed and underexpressed in the culture, then the amplification product obtained from the strain in the culture or collection which overexpressed gene product will be ove ⁇ epresented in the culture or collection while the amplification product obtained from the strain which underexpressed the gene product will be unde ⁇ epresented in the culture or collection. If desired, nucleic acids from a culture or collection which was contacted with the compound may be compared to nucleic acids from a control culture or collection which was not contacted with the compound. Alternatively, nucleic acids from a culture or collection which was contacted with the compound may be directly analyzed without comparison to a control culture or collection.
  • Cu ⁇ ent methods for identifying the target of compounds which inhibit cellular proliferation are laborious and time consuming.
  • the above methods may be employed to allow the targets of a large number of compounds to be rapidly identified.
  • the methods described above are simultaneously performed for each of a large number of compounds.
  • the compounds may be members of a library of compounds generated using combinatorial chemistry or members of a natural product library.
  • a plurality of cultures each comprising a plurality of strains each of which overexpresses a different gene product required for proliferation or a plurality of collections of individual strains each of which overexpresses a different gene product required for proliferation is obtained.
  • each culture or collection of strains is contacted with a different compound in the library and the target of the compound is identified as described above.
  • the gene product on which a compound which inhibits the proliferation of an organism acts is identified using a culture which comprises a mixture of strains of the organism including strains which underexpress a different gene product which is required for proliferation of the organism (i.e. at least some of the strains in the culture underexpress a gene product which is required for proliferation of the organism).
  • each of the strains in the culture underexpress a different a gene product which is required for the proliferation of the organism (i.e. all of the strains in the culture underexpress a gene product which is required for the proliferation of the organism).
  • the culture may comprise any number of strains.
  • the culture may comprise at least two strains, at least 10 strains, at least 20 strains, at least 30, strains, at least 50 stiains, at least 100 stiains, at least 300 strains or more than 300 strains.
  • the strains in the culture in aggregate may underexpress all or most of the gene products required for proliferation of the organism.
  • the culture is contacted with a compound which inhibits proliferation of the organism.
  • the compound may be a candidate drug compound obtained from any source.
  • the compound may be a compound generated using combinatorial chemistry, a compound from a natural product library, or an impure or partially purified compound, such as a compound in a partially purified natural extract.
  • the culture is contacted with a sufficient concentration of the compound to inhibit the proliferation of strains of the organism in the culture which underexpress the gene product on which the compound acts, such that strains which do not underexpress the gene product on which the compound acts proliferate more rapidly in the culture than strains which do underexpress said gene product on which said compound acts.
  • the strain which underexpresses the gene product on which the compound acts will be less prevalent in the culture than strains which do not underexpress the gene product on which the compound acts.
  • the growth conditions and incubation period are selected so that only one strain, the strain underexpressmg the target of the compound, proliferates at a reduced rate in the culture.
  • the growth conditions may be selected so that the strain underexpressmg the target of the compound is not recovered from the culture.
  • a plurality of cultures containing a plurality of strains each of which underexpresses a different proliferation-required gene product may be grown in the presence of varying concentrations of the compound.
  • the plurality of cultures may be grown at varying concentrations of an agent which regulates the level of expression from the promoter, such as an inducer or an agent which reduces the effect of a repressor on transcription from the promoter.
  • the cultures may be grown in liquid medium in the presence of the compound whose target is to be identified (and where appropriate in the presence of an agent which regulates the level of expression from the promoter) or alternatively, a liquid culture comprising the strains which underexpress the proliferation-required gene products may be grown in the absence of the compound whose target is to be identified and then introduced onto a solid medium containing the compound (and, where appropriate, also containing an agent which regulates the level of expression from the promoter).
  • the identity of the underexpressed gene product which is the target of the compound may be determined using a variety of methods.
  • the nucleic acids present in the culture or collection of strains which was contacted with the compound may be compared to the nucleic acids present in a control culture or collection of strains which was not contacted with the compound to identify nucleic acids which are unde ⁇ epresented in the culture or collection of strains contacted with the test compound relative to the control culture or strains.
  • the nucleic acids present in a culture or collection of strains contacted with the test compound may be analyzed to identify those nucleic acids which are missing or present at reduced levels without comparison to a control culture or collection of strains.
  • the strains which proliferated more slowly in the culture or collection of strains are identified as follows.
  • Amplification products which are co ⁇ elated with each of the underexpressed genes and which are distinguishable from one another are obtained from a culture or collection grown in the presence of a test compound.
  • the amplification products are distinguished from one another to determine whether a particular amplification product is unde ⁇ epresented in the culture or collection of strains.
  • the amplification products co ⁇ esponding to each of the gene products have lengths which permit them to be distinguished from one another.
  • one or more of the amplification products have similar or identical lengths but are distinguishable from one another based on a detectable agent, such as a dye, attached thereto.
  • amplification products which are unde ⁇ epresented are identified by comparing the amplification products from the culture or collection of strains which was contacted with the test compound to the amplification products from a culture or collection of strains which was not contacted with the test compound.
  • amplification products which are unde ⁇ epresented in the culture or collection of stiains may be identified simply by determining which amplification products are missing or present at reduced levels in the culture or collection of strains.
  • the above methods for generating distinguishable amplification products may be used in conjunction with any of the methods for generating strains which underexpress gene products required for proliferation described herein in order to facilitate the identification of strains which proliferate more slowly in the presence of a test compound.
  • each of the native promoters of each of the genes encodmg gene product required for proliferation are replaced by a single desired replacement promoter.
  • an amplification reaction is performed on nucleic acids obtained from the culture as follows. The nucleic acids from the culture or collection of strains are divided into at least two aliquots. In a prefe ⁇ ed embodiment the nucleic acids from the culture or collection of strains are divided into four aliquots.
  • a single primer complementary to a nucleotide sequence within the replacement promoter , within the proliferation required genes, or within nucleic acid sequences adjacent to the promoter or proliferation required genes is divided into four groups Each group is labeled with a distinct detectable dye, such as the 6FAMTM, TETTM, VICTM, HEXTM, NEDTM, and PETTM dyes obtainable from Applied Biosystems (Foster City, CA).
  • a distinct detectable dye such as the 6FAMTM, TETTM, VICTM, HEXTM, NEDTM, and PETTM dyes obtainable from Applied Biosystems (Foster City, CA).
  • the DS-31 or DS-33 dye sets available from Applied Biosystems (Foster City, CA) may be used to label the primers.
  • Each of the groups of labeled primers are added to each of the aliquots of the nucleic acids from the culture or collection of strains such that each aliquot of nucleic acid receives a single labeled primer with a single detectable dye thereon.
  • Each of the aliquots of nucleic acids also receives a set of unlabeled primers, with each of the unlabeled primers being complementary to a nucleotide sequence within the promoter, within a nucleotide sequence which is unique to one of the genes encoding gene products required for proliferation which were placed under the control of the replacement promoter, or within nucleotide sequences adjacent to the promoter or proliferation required genes.
  • Each of the aliquots receives primers unique to 1/N proliferation required genes which were placed under the control of the replacement promoter, where N is the number of aliquots (i.e.
  • the unlabeled primers are selected so that each will yield an amplification product having a length distinguishable from the length of the amplification product produced with the other unlabeled primers.
  • the amplification products are between about 100- about 400 nucleotides in length, but any lengths which may be distinguished from each other may be used.
  • some of the amplification products may have identical or very similar lengths but be distinguishable from one another due to labeling with distinguishable dyes.
  • a nucleic acid amplification reaction is conducted on each of the nucleic acid aliquots.
  • the amplification products are then separated by length to identify amplification products decreased representation or which are absent in the culture or collection of strains.
  • the amplification products are then correlated with the co ⁇ esponding genes to determine which strains proliferated more slowly in the culture or collection of strains. If desired, amplification products having decreased representation in the culture may be identified by comparing the amplification products obtained from a culture or collection of stiains which was contacted with the compound to amplification products obtained from a control culture or collection of stiains which was not contacted with the compound.
  • the amplification products which are missing or present at reduced levels in a culture which was contacted with the compound may be directly identified without comparison to a control culture which was not contacted with the compound.
  • the amplification products from each of the nucleic acid aliquots are pooled and subjected to capillary electrophoresis.
  • the amplification products are detected by detecting the fluorescent dyes attached thereto and their lengths are determined to identify those amplification products having decreased representation in the culture or collection of strains.
  • Figures IA and IB illustrate one embodiment of this method in which the absence of an amplification product from an amplification reaction performed on a culture comprising a plurality of stiains underexpressmg genes required for proliferation indicates that a test compound acts on the gene co ⁇ esponding to the missing amplification product.
  • a first amplification reaction is performed on nucleic acids obtained from a culture or collection of strains which was contacted with the compound using a first primer complementary to a nucleotide sequence present upstieam or downstream of all of the overexpressed genes (such as a primer complementary to a nucleotide sequence in a replacement promoter upstream of all of the overexpressed genes) and a set of primers complementary to a nucleotide sequence unique to each of the strains (such as a primer complementary to a nucleotide sequence within each of the proliferation-required genes).
  • a first primer complementary to a nucleotide sequence present upstieam or downstream of all of the overexpressed genes such as a primer complementary to a nucleotide sequence in a replacement promoter upstream of all of the overexpressed genes
  • a set of primers complementary to a nucleotide sequence unique to each of the strains such as a primer complementary to a nucleotide sequence within each of the proliferation-re
  • the common primer complementary to a nucleotide sequence upstream or downstream of all of the overexpressed genes is labeled with the dye.
  • the primers used in the amplification reaction are designed so that the amplification product co ⁇ esponding to each proliferation-required gene has a unique length.
  • a second amplification reaction is conducted on a control culture or collection of stiains which was not contacted with the compound using the same primers as in the first amplification reaction.
  • the amplification products from the first amplification reaction are compared to those from the second amplification reaction to identify one or more amplification products which are unde ⁇ epresented in the culture or collection of strains.
  • the amplification products from the first amplification reaction may be run in a separate lane of a polyacrylamide gel or a separate capillary than the amplification products from the second amplification reaction and the two lanes or capillaries are compared to one another.
  • the primers in the second amplification reaction are labeled with a different dye which is distinguishable from the dye used in the first amplification reaction.
  • the amplification reactions may be pooled and run in the same lane on a polyacrylamide gel or in the same capillary and the products from each amplification reaction are compared by comparing the amount of each dye present for each amplification product.
  • Figures 2A and 2B illustrate one embodiment of this method in which the absence of an amplification product from the amplification reaction performed on a culture comprising a plurality of strains underexpressmg genes required for proliferation which was contacted with the compound indicates that a test compound acts on the gene corresponding to the missing amplification product.
  • individual amplification reactions may be conducted on nucleic acids obtained from the culture or collection of stiains.
  • Each amplification reaction contains primers which will yield an amplification product specific for only one of the proliferation required genes.
  • the resulting amplification products from each of the individual amplification reactions are pooled and amplification products having decreased representation in the culture are identified as described above.
  • each strain in the culture may be assessed by hybridizing detectably labeled nucleic acids encoding the proliferation- required gene products, or portions thereof, obtained from the culture to an a ⁇ ay comprising nucleic acids encoding the gene products required for proliferation or portions thereof.
  • Each nucleic acid encoding a gene product required for proliferation or portion thereof occupies a known location on the array.
  • the signal from each location on the a ⁇ ay is quantitated to identify those nucleic acids encoding a proliferation-required gene product which are unde ⁇ epresented in the culture.
  • the hybridized nucleic acids from a culture which was contacted with the compound may be compared to the hybridized nucleic acids from a control culture which was not contacted with the compound.
  • the hybridized nucleic acids from a culture which was contacted with the compound may be directly analyzed without comparison to nucleic acids from a control culture.
  • each strain underexpressmg a gene product required for proliferation may be constructed to contain a unique nucleic acid sequence (refe ⁇ ed to herein as a "tag").
  • the tag may be included in the chromosome of each strain or in an extiachromosomal vector.
  • the tag could be included in a vector encoding an antisense nucleic acid complementary to a gene encoding a gene product required for proliferation or a portion of such a gene or the tag may be included in the antisense nucleic acid itself .
  • each strain in the culture may be assessed by performing an amplification reaction using primers complementary to each of the tags and quantitating the levels of the resulting amplification products to identify a tag which is unde ⁇ epresented or absent from the culture. Since each tag co ⁇ esponds to one strain, the strain which is unde ⁇ epresented or absent from the culture may be identified. If desired the tags present in a culture which was contacted with the compound may be compared to the tags present in a control culture which was not contacted with the compound. Alternatively, the tags present in a culture which was contacted with the compound may be analyzed without comparison to a control culture.
  • unique tags may also be used in embodiments in which gene products required for proliferation are overexpressed.
  • the tags may be within or adjacent to the promoter which drives expression of the gene encoding the gene product.
  • the gene product which is overexpressed in strains which proliferate more rapidly in the culture may be identified by detecting the presence or amount of the unique tag co ⁇ esponding to that gene product in the culture.
  • more than one strain may proliferate less rapidly in the presence of the compound. This may result from a variety of causes. For example, the concentration of the compound may not have been high enough to reduce the proliferation only in cells which underexpress one gene product (i.e. the target gene product).
  • strains which underexpress the target gene product will be the least prevalent strain in the culture, other strains may also be unde ⁇ epresented.
  • identity of the gene product in the strain which is least prevalent in the culture may be identified by quantitating the levels of each of the genes encoding proliferation- required proteins in the culture. This may be accomplished by quantitative PCR, DNA sequencing, hybridization, or array technology as described above.
  • multiple stiains will exhibit less rapid proliferation in the culture as a result of a common functional attribute.
  • the strains which proliferate less rapidly may each underexpress a gene product with a common enzymatic activity, such as serine protease activity for example.
  • the strains which proliferate less rapidly may each underexpress a gene product with a common enzymatic activity, such as serine protease activity for example.
  • the strains which proliferate less rapidly may each underexpress a gene product with a common enzymatic activity, such as serine protease activity for example.
  • the strains which proliferate less rapidly may each underexpress a gene product with a common enzymatic activity, such as serine protease activity for example.
  • the strains which proliferate less rapidly may each underexpress a gene product with a common enzymatic activity, such as serine protease activity for example.
  • the strains which proliferate less rapidly may each underexpress a gene product with
  • the common attribute of the strains which proliferate less rapidly may provide information as to the mode of action of the compound or the biochemical activity of the target of the compound. For example, if all of the underexpressed genes in the strains which proliferated less rapidly are serine proteases, the compound acts by inhibiting serine protease activity and the target protem is a serine protease.
  • the compound may be derivatized and the efficacy of the derivatized compound against each of the strains which proliferated more rapidly may be assessed as described herein in order to identify derivatives which are capable of interacting with a wide range of targets sharing a common activity or binding site (i.e. derivatives which have a greater ability to inhibit the proliferation of all the strains than the original compound) or to identify derivatives having greater specificity for a desired target (i.e. derivatives which have a greater specificity for one of the strains than the original compound).
  • the methods of the present invention may be performed using an a ⁇ ay of individual strains (i.e. a collection of strains) each of which underexpresses a different proliferation-required gene product.
  • individual strains each underexpressmg a different proliferation-required gene product may be grown in different wells of a multiwell plate. Each well is contacted with the compound (and, where appropriate an agent which regulates the level of expression from the promoter). The level of proliferation of the strains in each of the wells is determined to identify a strain which proliferated less rapidly or which did not proliferate at all.
  • individual stiains each underexpressmg a different proliferation-required gene product are grown at different locations on a solid medium, such as an agar plate.
  • the medium contains the compound and, where appropriate, an agent which regulates the level of expression from the promoter.
  • the level of proliferation of each of the strains is determined to identify a strain which proliferated less rapidly (or a strain which is not recovered from the culture).
  • the identity of the underexpressed gene product in the strain that proliferated less rapidly (or the strain which is not recovered from the culture) is determined as described above.
  • the above methods may be used to prioritize compound development or to determine whether the compound has been previously identified or whether the target of the compound is the target of a previously identified drug.
  • the product is a natural product is advantageous to determine whether it has been previously identified prior to investing significant effort in developing it.
  • the target of a partially purified or purified natural product or a compound produced by combinatorial chemistry is identified using the methods described above and compared to the targets of known drugs. If the target is identical to that of a known drug, further development of the compound is halted.
  • an array of strains each of which underexpresses a different gene product is grown on solid medium containing a compound to be evaluated.
  • the location of each strain in the a ⁇ ay and the gene product underexpressed by that strain is known.
  • the pattern of colonies which grow less rapidly or fail to grow in the presence of the compound is evaluated and compared to the pattern of colonies which grow less rapidly or fail to grow in the presence of previously identified drugs. If the pattern of colonies which grow less rapidly or fail to grow in the presence of the compound being evaluated is the same as the pattern of colonies which grow less rapidly or fail to grow in the presence of a previously identified drug, further development of the compound is halted.
  • the nucleotide sequence of the gene product in a strain which proliferated less rapidly (or a strain which was not recovered from the culture) in the assays described above is compared to the nucleotide sequence of gene products from heterologous organisms to determine the likely spectrum of species whose growth would be inhibited by the compound. If the gene product has a high degree of homology to gene products from heterologous species, it is likely that the compound would also inhibit the growth of these heterologous species. Homology may be determined using any of a variety of methods familiar to those skilled in the art. For example, homology may be determined using a computer program such as BLASTP or FASTA.
  • the ability of the compound to inhibit the growth of the heterologous species may then be confirmed by comparing the growth of cells of the heterologous species in the presence and absence of the compound.
  • Cu ⁇ ent methods for identifying the target of compounds which inhibit cellular proliferation are laborious and time consuming.
  • the above methods may be employed to allow the targets of a large number of compounds to be rapidly identified. In such methods, the methods described above are simultaneously performed for each of a large number of compounds.
  • the compounds may be members of a library of compounds generated using combinatorial chemistry or members of a natural product library.
  • a plurality of cultures each comprising a plurality of strains each of which underexpresses a different gene product required for proliferation or a plurality of collections of individual strains each of which underexpresses a different gene product required for proliferation is obtained.
  • Each culture or collection of stiains is contacted with a different compound in the library and the target of the compound is identified as described above.
  • strains are constructed in which a nucleic acid complementary to a gene encoding a gene product required for proliferation, or a portion thereof (i.e. a nucleic acid encoding an antisense nucleic acid to the gene encoding the proliferation required gene product or a portion thereof) is operably linked to a regulatable promoter.
  • a culture comprising a plurality of such stiains wherein each strain expresses an antisense nucleic acid against a different gene product required for proliferation is grown in the presence of varying levels of a compound which inhibits proliferation and in the presence of varying levels of an agent which regulates the level of transcription from the regulatable promoter.
  • Nucleic acids samples are obtained from the culture, detectably labeled and hybridized to a solid support comprising nucleic acids containing the genes encoding the proliferation-required gene products or a portion thereof.
  • the level of hybridization is quantitated for each nucleic acid encodmg each of the proliferation-required gene products to determine the rate at which each of the strains proliferated in the culture. If the antisense nucleic acid expressed by a strain in the culture is not complementary to all or a portion of the gene encoding the target of the compound (i.e.
  • each strain may be grown in a different location on a solid medium or in a different well of a multiwell plate.
  • the methods described herein may be performed simultaneously for each of a plurality of compounds which inhibit proliferation to allow the targets of those compounds to be rapidly identified.
  • the culture comprises a strain in which a gene product selected from the group consisting of a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, and a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
  • nucleic acids comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795
  • nucleic acids comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944
  • gene products comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 are described below.
  • Random genomic fragments are obtained from the organism in which it is desired to identify genes required for cellular proliferation.
  • the random genomic fragments may be generated by a partial digestion with a restriction enzyme, mechanical shearing, using techniques such as somcation and nebulization, or DNAsel digestion.
  • the random genomic fragments are operably linked to a regulatable promoter in a vector.
  • the transcript produced is complementary to at least a portion of an mRNA encoding a gene product such that they interact with sense mRNA produced from various genes and thereby decrease the translation efficiency or the level of the sense messenger RNA (mRNA) thus decreasing production of the protein encoded by these sense mRNA molecules.
  • mRNA sense messenger RNA
  • the sense mRNA encodes a protein required for proliferation
  • cells grown under inducing conditions fail to grow or grow at a substantially reduced rate.
  • the transcript produced is complementary to at least a portion of a non-translated RNA and where that non-tianslated RNA is required for proliferation
  • cells grown under inducing conditions also fail to grow or grew at a substantially reduced rate.
  • cells grown under non-inducing conditions grow at a normal rate.
  • the genes to which the antisense nucleic acids are complementary are then identified and utilized in the methods of the present invention.
  • the extent of proliferation of cells containing the vectors in the presence of an agent which induces transcription from the regulatable promoter is compared to the extent of proliferation of cells in the absence of the agent.
  • Those cells which grow well in the absence of the agent but exhibit significantly reduced proliferation in the presence of the agent contain a vector encoding an antisense nucleic acid complementary to at least a portion of a gene required for cellular proliferation.
  • Patent Application Serial Number 09/815,242, filed March 21, 2001 U.S. Patent Application Serial Number 09/492709, filed January 27, 2000; U.S. Patent Application Serial Number 09/711164, filed November 9, 2000; U.S. Patent Application Serial Number 09/741669, filed December 19, 2000 and U.S. Patent Application Serial Number 09/815,242 filed March 21, 2001.
  • the methods used to identify these genes required for cellular proliferation are summarized below.
  • pLEX5BA-3' the following oligonucleotides were annealed and inserted into the Pstl and Hindlll sites of pLEX5BA: 5 ' -GTCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCCTTGAGGGGTTTTTTGA-
  • Nucleic acids required for proliferation of Staphylococcus aureus, Salmonella typhimurium, and Klebsiella pneumoniae were identified as follows. Randomly generated fragments of Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis genomic DNA were transcribed from inducible promoters.
  • a novel inducible promoter system comprising a modified T5 promoter fused to the xylO operator from the xylA promoter of Staphylococcus aureus was used.
  • the promoter is described in U.S.
  • Patent Application Serial Number 10/032,393 the disclosure of which is inco ⁇ orated herein by reference in its entirety. Transcription from this hybrid promoter is inducible by xylose.
  • Randomly generated fragments of Salmonella typhimurium genomic DNA were transcribed from an IPTG inducible promoter in pLEX5BA (Krause et al, J. Mol. Biol. 274: 365 (1997) or a derivative thereof. Randomly generated fragments of Klebsiella pneumoniae genomic DNA were expressed from an IPTG inducible promoter in pLEX5BA-Kan. To construct pLEX5BA-kan, pLEX5BA was digested to completion with Clai order to remove the bla gene. Then the plasmid was treated with a partial Notl digestion and blunted with T4 D ⁇ A polymerase.
  • a 3.2 kbp fragment was then gel purified and ligated to a blunted 1.3 kbp kan gene from pKan ⁇ . Kan resistant transformants were selected on Kan plates. Orientation of the kan gene was checked by Smal digestion. A clone, which had the kan gene in the same orientation as the bla gene, was used to identify genes required for proliferation of Klebsiella pneumoniae.
  • Randomly generated fragments of Pseudomonas aeruginosa genomic D ⁇ A were transcribed from a two-component inducible promoter system. Integrated on the chromosome was the T7 R ⁇ A polymerase gene regulated by lac JV5l lacO (Brunschwig, E. and Darzins, A. 1992. Gene 111:35-41, the disclosure of which is inco ⁇ orated herein by reference in its entirety). On a separate plasmid, a T7 gene 10 promoter, which is transcribed by T7 R ⁇ A polymerase, was fused with a lacO operator followed by a multiple cloning site.
  • Staphylococcus aureus In the case of Staphylococcus aureus, a shotgun library of Staphylococcus aureus genomic fragments was cloned into the vector pXyIT5-P15a, which harbors the XylT5 inducible promoter. The vector was linearized at a unique BamHI site immediately downstream of the XyIT5 promoter/operator. The linearized vector was treated with shrimp alkaline phosphatase to prevent reclosure of the linearized ends.
  • Genomic D ⁇ A isolated from Staphylococcus aureus strain R ⁇ 450 was fully digested with the restriction enzyme Sau3A , or , alternatively, partially digested with DNase I and "blunt-ended" by incubating with T4 DNA polymerase. Random genomic fragments between 200 and 800 base pairs in length were selected by gel purification. The size-selected genomic fragments were added to the linearized and dephosphorylated vector at a molar ratio of 0.1 to 1, and ligated to form a shotgun library. The ligated products were transformed into electrocompetent E. coli strain XLl-Blue MRF ' (Stratagene) and plated on LB medium with supplemented with carbenicillin at 100 ⁇ g/ml. Resulting colonies numbering 5 x 10 s or greater were scraped and combined, and were then subjected to plasmid purification. The purified library was then transformed into electrocompetent
  • Staphylococcus aureus RN4220 Staphylococcus aureus RN4220. Resulting tiansformants were plated on agar containing LB + 0.2% glucose (LBG medium) + chloramphenicol at 15 ⁇ g/ml (LBG+CM15 medium) in order to generate 100 to 150 platings at 500 colonies per plating. The colonies were subjected to robotic picking and arrayed into wells of 384 well culture dishes. Each well contained lOO ⁇ l of LBG + CM 15 liquid medium.
  • Inoculated 384 well dishes were incubated 16 hours at 37°C, and each well was robotically gridded onto solid LBG + CM 15 medium with or without 2% xylose.
  • Gridded plates were incubated 16 hours at 37°C, and then manually scored for a ⁇ ayed colonies that were growth-compromised in the presence of xylose.
  • Nucleic acids involved in proliferation of Pseudomonas aeruginosa were identified as follows. Randomly generated fragments of Pseudomonas aeruginosa genomic DNA were transcribed from a two-component inducible promoter system. Integrated on the chromosome was the T7 RNA polymerase gene regulated by lac ⁇ JV5l lacO (Brunschwig, E. and Darzins, A. 1992. Gene 111:35-41). On an expression plasmid there was a T7 gene 10 promoter, which is transcribed by T7 RNA polymerase, fused with a lacO operator followed by a multiple cloning site.
  • Transcription from this hybrid promoter is inducible by IPTG. Should the genomic DNA downstream of the promoter contain, in an antisense orientation, at least a portion of an mRNA encoding a gene product involved in proliferation, then induction of expression from the promoter will result in detectable inhibition of proliferation.
  • a shotgun library o ⁇ Pseudomonas aeruginosa genomic fragments was cloned into the vectors pEP5, pEP5S, or other similarly constructed vectors which harbor the TllacO inducible promoter. The vector was linearized at a unique Sm ⁇ l site immediately downstream of the ⁇ lla' cO promoter/operator.
  • the linearized vector was treated with shrimp alkaline phosphatase to prevent reclosure of the linearized ends.
  • Genomic DNA isolated from Pseudomonas aeruginosa strain PAOl was partially digested with DNase I and "blunt-ended" by incubating with T4 DNA polymerase. Random genomic fragments between 200 and 800 base pairs in length were selected by gel purification. The size-selected genomic fragments were added to the linearized and dephosphorylated vector at a molar ratio of 2 to 1, and ligated to form a shotgun library. The ligated products were transformed into electrocompetent E.
  • coli strain XLl-Blue MRF ' (Stratagene) and plated on LB medium with carbenicillin at 100 ⁇ g/ml or Streptomycin 100 ⁇ g/ml. Resulting colonies numbering 5 x 10 s or greater were scraped and combined, and were then subjected to plasmid purification. The purified library was then transformed into electrocompetent Pseudomonas aeruginosa strain PAOl. Resulting transformants were plated on LB agar with carbenicillin at 100 ⁇ g/ml or Streptomycin 40 ⁇ g/ml in order to generate 100 to 150 platings at 500 colonies per plating.
  • the colonies were subjected to robotic picking and a ⁇ ayed into wells of 384 well culture dishes. Each well contained 100 ⁇ l of LB + CB 100 or Streptomycin 40 liquid medium. Inoculated 384 well dishes were incubated 16 hours at room temperature, and each well was robotically gridded onto solid LB + CB100 or Streptomycin 40 medium with or without 1 mM IPTG. Gridded plates were incubated 16 hours at 37°C, and then manually scored for a ⁇ ayed colonies that were growth-compromised in the presence of IPTG. Arrayed colonies that were growth-sensitive on medium containing 1 mM
  • IPTG IPTG
  • Colonies from the plate lacking IPTG were manually picked and inoculated into individual wells of a 96 well culture dish containing LB + CB100 or Streptomycin 40, and were incubated for 16 hours at 30°C. These cultures were robotically diluted 1/100 into fresh medium and allowed to incubate for 4 hours at 37°C, after which they were subjected to serial dilutions in a 384 well a ⁇ ay and then gridded onto media with and without 1 mM EPTG. After growth for 16 hours at 37°C, the a ⁇ ays of serially diluted spots that resulted were compared between the two media. Clones that grew similarly at all dilutions on both media were scored as a negative and were no longer considered. Clones that grew on
  • IPTG medium but failed to grow at the same serial dilution on the non-IPTG plate were given a score based on the differential, i.e. should the clone grow at a serial dilution of 10 4 or less on the IPTG plate and grow at a serial dilution of 10 8 or less on the EPTG plate, then the co ⁇ esponding clone received a score of "4" representing the log difference in growth observed.
  • the inserts or nucleic acid fragments contained in those vectors were isolated for subsequent characterization. Vectors of interest were subjected to nucleic acid sequence determination.
  • Nucleic acids involved in proliferation of E. faecalis were identified as follows. Randomly generated fragments of genomic DNA were expressed from the vectors pEPEF3 or pEPEF14, which contain the CP25 or P59 promoter, respectively, regulated by the xyl operator/repressor. Should the genomic DNA downstream of the promoter contain, in an antisense orientation, at least a portion of a mRNA encoding a gene product involved in proliferation, then induction of expression from the promoter will result in detectable inhibition of proliferation.
  • a shotgun library of E. faecalis genomic fragments was cloned into the vector pEPEF3 or pEPEF14, which harbor xylose inducible promoters.
  • the vector was linearized at a unique Smal site immediately downstream of the promoter/operator.
  • the linearized vector was treated with alkaline phosphatase to prevent reclosure of the linearized ends.
  • Genomic DNA isolated from E. faecalis strain OG1RF was partially digested with DNase I and "blunt-ended" by incubating with T4 DNA polymerase. Random genomic fragments between 200 and 800 base pairs in length were selected by gel purification. The size-selected genomic fragments were added to the linearized and dephosphorylated vector at a molar ratio of 2 to 1, and ligated to form a shotgun library.
  • the ligated products were transformed into electrocompetent E. coli strain TOP10 cells (Invitrogen) and plated on LB medium with erythromycin (Erm) at 150 ⁇ g/ml. Resulting colonies numbering 5 x 10 5 or greater were scraped and combined, and were then subjected to plasmid purification.
  • the purified library was then transformed into electrocompetent E. faecalis strain OG1RF. Resulting transformants were plated on Todd-Hewitt (TH) agar with erythromycin at 10 ⁇ g/ml in order to generate 100 to 150 platings at 500 colonies per plating. The colonies were subjected to robotic picking and a ⁇ ayed into wells of 384 well culture dishes. Each well contained 100 ⁇ l of THB + Erm 10 ⁇ g/ml. Inoculated 384 well dishes were incubated 16 hours at room temperature, and each well was robotically gridded onto solid TH agar + Erm with or without 5% xylose.
  • Gridded plates were incubated 16 hours at 37°C, and then manually scored for a ⁇ ayed colonies that were growth-compromised in the presence of xylose. A ⁇ ayed colonies that were growth-sensitive on medium containing 5% xylose, yet were able to grow on similar medium lacking xylose, were subjected to further growth sensitivity analysis. Colonies from the plate lacking xylose were manually picked and inoculated into individual wells of a 96 well culture dish containing THB + Erm 10, and were incubated for 16 hours at 30°C.
  • the inserts or nucleic acid fragments contained in those expression vectors were isolated for subsequent characterization.
  • the inserts in the vectors of interest were subjected to nucleotide sequence determination.
  • random genomic fragments may be generated by mechanical shearing. Sonication and nebulization are two such techniques commonly used for mechanical shearing of DNA.
  • the nucleotide sequences of the nucleic acid sequences which inhibited the growth of Escherichia coli were determined using plasmid DNA isolated using QIAPREP (Qiagen, Valencia, CA) and methods supplied by the manufacturer.
  • the primers used for sequencing the inserts were 5' - TGTTTATCAGACCGCTT - 3' (SEQ ED NO: 15781) and 5' - ACAATTTCACACAGCCTC - 3' (SEQ ED NO: 15782).
  • nucleotide sequences of the nucleic acid sequences which inhibited the growth of Staphylococcus aureus were dete ⁇ nined as follows. Staphylococcus aureus were grown in standard laboratory media (LB or TB with 15 ug/ml Chloramphenicol to select for the plasmid). Growth was carried out at 37°C overnight in culture tubes or 2 ml deep well microtiter plates.
  • Lysis of Staphylococcus aureus was performed as follows. Cultures (2-5 ml) were centrifuged and the cell pellets resuspended in 1.5 mg/ml solution of lysostaphin (20 ⁇ l/ml of original culture) followed by addition of 250 ⁇ l of resuspension buffer (Qiagen). Alternatively, cell pellets were resuspended directly in 250 ⁇ l of resuspension buffer (Qiagen) to which 5-20 ⁇ l of a 1 mg/ml lysostaphin solution were added.
  • DNA was isolated using Qiagen miniprep kits or Wizard (Qiagen) miniprep kits according to the instructions provided by the manufacturer.
  • the genomic DNA inserts were amplified from the purified plasmids by PCR as follows.
  • Step 5 Return to step 2, 29 times
  • Step 7. 4° C hold The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
  • DNA insert responsible for growth inhibition as follows. Pseudomonas aeruginosa were grown in standard laboratory media (LB with carbenicillin at 100 ⁇ g/ml or
  • T7L1+ GTCGGCGATATAGGCGCCAGCAACCG (SEQ ID NO: 15785)
  • pStrA3 ATAATCGAGCATGAGTATCATACG (SEQ ID NO: 15786)
  • Step 1 95° C 15 min Step 2. 94° C 45 sec Step 3. 54° C 45 sec
  • Step 5 Return to step 2, 29 times
  • PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
  • Step 5 Return to step 2, 24 times
  • PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
  • plasmids from transformant colonies that received a dilution plating score of "2" or greater were isolated to obtain the genomic DNA insert responsible for growth inhibition as follows. E.faecalis were grown in THB 10 ⁇ g/ml
  • DNA 2 ul of culture were placed into 25 ⁇ l Qiagen Hot Start PCR mix. PCR reactions were in 96 well microtiter plates. The following primers were used in the
  • PCR reaction pXylT5: CAGCAGTCTGAGTTATAAAATAG (SEQ ID NO: 15783) and the pEP/pAKl primer.
  • PCR was carried out in a PE GenAmp with the following cycle times: Step l. 95° C 15 min Step 2. 94° C 45 sec Step 3. 54° C 45 sec Step 4. 72° C 1 minute Step 5. Return to step 2, 29 times Step 6. 72° C IO minutes
  • PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
  • PCR The purified PCR products were then directly cycle sequenced with Qiagen Hot Start PCR mix.
  • the following primers were used in the PCR reaction: pXylT5: CAGCAGTCTGAGTTATAAAATAG (SEQ ID NO: 15783) PCR was carried out in a PE GenAmp with the following cycle times: Step l. 94° C 15 min Step 2. 96° C 10 sec Step 3. 50° C 5 sec
  • PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
  • the amplified genomic DNA inserts from each of the above procedures were subjected to automated sequencing.
  • the nucleotide sequences of the antisense nucleic acids which inhibited the proliferation of Escherichia coli, Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis are listed in the accompanying Sequence Listing as SEQ ID
  • EXAMPLE 3 Comparison Of Isolated Nucleic Acids to Known Sequences
  • BLAST is described in Altschul, J Mol Biol. 215 :403-
  • Clones were designated as "antisense” if the cloned fragment was oriented to the promoter such that the RNA transcript produced was complementary to the expressed mRNA (or non-translated RNA) from a chromosomal locus. Clones were designated as "sense” if they coded for an RNA fragment that was identical to a portion of a wild type mRNA from a chromosomal locus.
  • nucleotide sequences of the subcloned fragments from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis obtained from the expression vectors discussed above were compared to known sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis and other microorganisms as follows.
  • the nucleotide sequences of the selected clones were compared against the Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis genomic sequences to align the clone to the co ⁇ ect position on the chromosome.
  • the NCBI BLASTN v 2.0.9 program was used for this comparison, and the incomplete Staphylococcus aureus genomic sequences licensed from TIGR, as well as the NCBI nonredundant GenBank database were used as the source of genomic data.
  • Salmonella typhimurium sequences were compared to sequences available from the Genome Sequencing Center (http://genome.wustl.edu/gsc/salmonella.shtml), and the Sanger Centre
  • Pseudomonas aeruginosa sequences were compared to a proprietary database and the NCBI GenBank database.
  • the E. faecalis sequences were compared to a proprietary database.
  • the BLASTN analysis was performed using the default parameters except that the filtering was turned off. No further analysis was performed on inserts which resulted from the ligation of multiple fragments.
  • ORFs open reading frames
  • databases include the GenBank nonredundant (nr) database, the unfinished genome database available from TIGR and the PathoSeq database developed by Incyte Genomics.
  • the latter database comprises over 40 annotated bacterial genomes including complete ORF analysis. If databases are incomplete with regard to the bacterial genome of interest, it is not necessary to extract all ORFs in the genome but only to extract the ORFs within the portions of the available genomic sequences which are complementary to the clones of interest.
  • Computer algorithms for identifying ORFs such as GeneMark, are available and well known to those in the art.
  • Comparison of the clone DNA to the complementary ORF(s) allows determination of whether the clone is a sense or antisense clone. Furthermore, each ORF extracted from the database can be compared to sequences in well annotated databases including the GenBank (nr) protein database, SWISSPROT and the like. A description of the gene or of a closely related gene in a closely related microorganism is often available in these databases. Similar methods are used to identify antisense clones co ⁇ esponding to genes encoding non-translated RNAs.
  • ORFs were identified and refined by conducting a survey of the public and private data sources. Full-length gene protein and nucleotide sequences for these organisms were assembled from various sources. For Pseudomonas aeruginosa, gene sequences were adopted from the Pseudomonas genome sequencing project (downloaded from http://www.pseudomonas.com). For Klebsiella pneumoniae,
  • Antisense clones were identified as those clones for which transcription from the inducible promoter would result in the expression of an RNA antisense to a complementary ORF, intergenic or intiagenic sequence.
  • ORFs may also be identified using databases other than PathoSeq.
  • the ORFs may be identified using the methods described in U.S. Provisional Patent Application Serial Number 60/191,078, filed March 21, 2000, the disclosure of which is inco ⁇ orated herein by reference in its entirety.
  • the ORFs which co ⁇ espond to the antisense nucleic acids which inhibited proliferation o ⁇ Escherichia coli, Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis are listed in the accompanying Sequence Listing as SEQ ID NOs.: 3796-3800, 3806-4860, and 5916-10012.
  • the polypeptides encoded by the identified ORFs are provided in the accompanying Sequence Listing as SEQ ID NOs.: 3801-3805, 4861-5915, and 10013-
  • the culture comprises a strain in which a gene product encoded by a homologous coding nucleic acid as defined above is overexpressed or underexpressed. In further embodiments, the culture comprises a strain in which a homologous polypeptide as defined above is overexpressed or underexpressed.
  • Homologous coding nucleic acids may be obtained as described in Example 4 below.
  • homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides from other pathogenic microorganisms including nucleic acids homologous to the nucleic acids of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-
  • nucleic acids homologous to the antisense nucleic acids of SEQ ID NOs.: 8-3795, and polypeptides homologous to the polypeptides of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778) may be identified using methods such as those described below.
  • nucleic acids or polypeptides required for the proliferation of protists such as Plasmodium spp.; plants; animals, such as Entamoeba spp. and Contracaecum spp; and fungi including Candida spp, (e.g, Candida albicans), Cryptococcus neoformans, and Aspergillus fumigatus may be identified.
  • protists such as Plasmodium spp.
  • plants such as Entamoeba spp. and Contracaecum spp
  • fungi including Candida spp e.g, Candida albicans
  • Cryptococcus neoformans e.g, Cryptococcus neoformans
  • Aspergillus fumigatus may be identified.
  • monera specifically bacteria, including both Gram positive and Gram negative bacteria, are probed to identify genes required for cellular proliferation.
  • homologous antisense nucleic acids may also be identified.
  • Staphylococcus aureus, Salmonella typhi, or Candida albicans including the nucleic acids of SEQ TD NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, the sequences complementary to the nucleic acids of SEQ ID NOs.: 3796-3800, 3806- 4860, 5916-10012, and 14111-14944, and the polypeptides of SEQ ED NOs.: 3801- 3805, 4861-5915, 10013-14110 and 14945-15778) can be used to identify homologous coding nucleic acids or homologous polypeptides required for proliferation from these and other organisms using methods such as nucleic acid hybridization and computer database analysis.
  • antisense nucleic acids which inhibit proliferation of Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis,
  • Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, or Salmonella typhi may also be used to identify homologous antisense nucleic acids using nucleic acid hybridization or computer database analysis.
  • 8-3795 are used to screen genomic libraries generated from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi, or Candida albicans and other bacterial or fungal species of interest.
  • the genomic library may be from Gram positive bacteria, Gram negative bacteria or other organisms including Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus fa
  • the genomic library may be from an organism other than E. coli. Standard molecular biology techniques are used to generate genomic libraries from various cells or microorganisms. In one aspect, the libraries are generated and bound to nitrocellulose paper. The nucleic acids of SEQ ED NOs.
  • 3796-3800, 3806- 4860, 5916-10012, and 14111-14944 or SEQ ED NOs.: 8-3795, or portions thereof, can then be used as probes to screen the libraries for homologous sequences.
  • the libraries may be screened to identify homologous coding nucleic acids or homologous antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid selected from the group consisting of SEQ ID NOs.: 8-3795, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOs.
  • nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid complementary to one of SEQ ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs.
  • nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75,
  • nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944
  • nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944
  • nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid selected from the group consisting of SEQ ID NOS
  • nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111- 14944.
  • the libraries may also be screened to identify homologous nucleic coding nucleic acids or homologous antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid selected from the group consisting of SEQ ID NOs.: 8-3795, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15,
  • nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid complementary to one of SEQ ID NOs. 8-3795
  • nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs.
  • nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleic acid sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, . and
  • nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ED NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944.
  • homologous nucleic coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides identified as above can then be used in the methods described herein.
  • the homologous coding nucleic acids, homologous antisense nucleic acids, or homologous polypeptides may be used to identify genes which are required for the proliferation of more than one microorganism.
  • the preceding methods may be used to isolate homologous coding nucleic acids or homologous antisense nucleic acids comprising a nucleotide sequence with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of one of the sequences of SEQ ID NOS. 8-3795, fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof, and the sequences complementary thereto.
  • the preceding methods may also be used to isolate homologous coding nucleic acids or homologous antisense nucleic acids comprising a nucleotide sequence with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of one of the nucleotide sequences of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100,
  • the preceding methods may be used to isolate homologous coding nucleic acids or homologous antisense nucleic acids comprising a nucleotide sequence with at least 97%>, at least 95%>, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleic acid sequence selected from the group consisting of one of the sequences of SEQ ID NOS.
  • the homologous polynucleotides may comprise a coding sequence which is a naturally occurring allelic variant of one of the coding sequences described herein.
  • allelic variants may have a substitution, deletion or addition of one or more nucleotides when compared to the nucleic acids of SEQ ID NOs: 8-3795, SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 or the nucleotide sequences complementary thereto.
  • the above procedures may be used to isolate homologous coding nucleic acids which encode polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% ⁇ amino acid identity or similarity to a polypeptide comprising the sequence of one of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 or to a polypeptide whose expression is inhibited by a nucleic acid of one of SEQ ID NOs: 8-3795 or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof as determined using the FASTA version 3.0t78 algorithm with the default parameters.
  • protein identity or similarity may be identified using BLASTP with the default parameters, BLASTX with the default parameters, or TBLASTN with the default parameters.
  • BLASTP Altschul, S.F. et al. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search
  • homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides may be identified by searching a database to identify sequences having a desired level of nucleotide or amino acid sequence homology to a nucleic acid or polypeptide involved in proliferation or an antisense nucleic acid to a nucleic acid involved in microbial proliferation.
  • GenBank and GenSeq are available to those skilled in the art, including GenBank and GenSeq.
  • the databases are screened to identify nucleic acids with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleic acid required for proliferation, an antisense nucleic acid which inhibits proliferation, or a portion of a nucleic acid required for proliferation or a portion of an antisense nucleic acid which inhibits proliferation.
  • nucleic acids with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleic acid required for proliferation, an antisense nucleic acid which inhibits proliferation, or a portion of a nucleic acid required for proliferation or a portion of an antisense nucleic acid which inhibits proliferation.
  • homologous coding sequences may be identified by using a database to identify nucleic acids homologous to one of SEQ ID Nos.
  • homologous to fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof, nucleic acids homologous to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, homologous to fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids homologous to one of SEQ ID Nos.
  • the databases are screened to identify polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25 %> amino acid sequence identity or similarity to a polypeptide involved in proliferation or a portion thereof.
  • the database may be screened to identify polypeptides homologous to a polypeptide comprising one of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, a polypeptide whose expression is inhibited by a nucleic acid of one of SEQ ID NOs: 8- 3795 or homologous to fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of any of the preceding polypeptides.
  • the database may be screened to identify homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides from cells or microorganisms other than the Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, or Salmonella typhi species from which they were obtained.
  • the database may be screened to identify homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides from microorganisms such as Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter bacter
  • Enterococcus faecalis Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shig
  • the homologous coding nucleic acids, homologous antisense nucleic acids, or homologous polypeptides are from an organism other than E. coli.
  • nucleic acid arrays and microa ⁇ ays can be employed to identify homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encodmg homologous polypeptides.
  • Nucleic acid a ⁇ ays are high density a ⁇ ays of DNA samples deposited at specific locations on a glass chip, nylon membrane, or the like.
  • an array comprising nucleic acids from an organism in which it is desired to identify a homologous coding nucleic acid, homologous antisense nucleic acid or nucleic acid encoding a homologous polypeptide is contacted with a detectable probe comprising the nucleic acid, or a portion thereof, for which it is desired to identify a homologue under conditions which permit the probe to specifically hybridize to the homologue.
  • the a ⁇ ays may consist of 12 x 24 cm nylon filters containing PCR products co ⁇ esponding to ORFs from the organism in which it is desired to identify the homologous nucleic acid.
  • homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified in Anaplasma marginale, Aspergillus fumigatus,
  • Bacillus anthracis Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kejyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Qyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma
  • Neisseria gonorrhoeae Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae,
  • Shigella flexneri Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species, including coagulase negative Staphylococcus.
  • homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides can be identified by transcribing an antisense nucleic acid comprising a nucleotide sequence complementary to the proliferation-required sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae,
  • HeUcobacter pylori Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, or Salmonella typhi or a portion thereof in a heterologous cell or microorganism and determining whether the antisense nucleic acid inhibits the proliferation of the cell or microorganism.
  • homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides can be identified by transcribing a homologous antisense nucleic acid such as an antisense nucleic acid homologous to the nucleotide sequence complementary to one of SEQ ED NOs.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944, an antisense nucleic acid comprising a nucleotide sequence homologous to one of SEQ ED Nos.: 8-3795, or an antisense nucleic acid comprising a nucleotide sequence complementary to a portion of any of the preceding nucleic acids in a microorganism, such as the microorganism in which the homologous antisense nucleic acid was identified, and determining whether the proliferation of the microorganism is inhibited as described above.
  • a homologous antisense nucleic acid such as an anti
  • homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides can be identified by using the conserved portions of nucleotide sequences required for proliferation to generate degenerate primers for use in the polymerase chain reaction (PCR).
  • PCR polymerase chain reaction
  • the PCR technique is well known in the art.
  • the successful production of a PCR product using degenerate probes generated from the nucleotide sequences identified herein indicates the presence of a homologous gene sequence in the species being screened. This homologous gene is then utilized in the present invention.
  • Staphylococcus aureus Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi or Candida albicans as described below.
  • Salmonella enterica Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any of the above species.
  • the nucleic acids homologous to proliferation-required sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa,
  • Staphylococcus aureus or Salmonella typhi (including nucleic acids homologous to one of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944) or the sequences complementary thereto (including nucleic acids homologous to one of SEQ ID NOs.: 8-3795) are used to identify proliferation-required sequences in an organism other than E. coli.
  • homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides are identified by transferring antisense nucleic acids complementary to the sequences identified as required for proliferation or portions thereof (including antisense nucleic acids comprising a nucleotide sequence complementary to one of SEQ ID NO: 1
  • the vector may be functional in Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens,
  • Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides,
  • Pasteurella haemolytica Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis,
  • the vector may be functional in an organism other than E. coli.
  • vectors may contain certain elements that are species specific. These elements can include promoter sequences, operator sequences, repressor genes, origins of replication, ribosomal binding sequences, termination sequences, and others.
  • antisense nucleic acids To use the antisense nucleic acids, one of ordinary skill in the art would know to use standard molecular biology techniques to isolate vectors containing the sequences of interest from cultured bacterial cells, isolate and purify those sequences, and subclone those sequences into a vector adapted for use in the species of bacteria to be screened.
  • Vectors for a variety of other species are known in the art. For example, numerous vectors which function in E. coli are known in the art. Also, Pla et al. have reported an expression vector that is functional in a number of relevant hosts including: Salmonella typhimurium, Pseudomonas putida, and Pseudomonas aeruginosa. J. Bacteriol. 172(8):4448-55 (1990). Brunschwig and Darzins (Gene (1992) 111:35-4, the disclosure of which is inco ⁇ orated herein by reference in its entirety) described a shuttle expression vector for Pseudomonas aeruginosa.
  • Expression vectors for Enterococcus faecalis may be engineered by inco ⁇ orating suitable promoters into a pAK80 backbone (Israelsen, H, S. M. Madsen, A. Vrang, E. B. Hansen and E. Johansen.
  • antisense nucleic acids complementary to proliferation-required sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas . aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa,
  • the antisense nucleic acids are conditionally transcribed to test for bacterial growth inhibition.
  • homologous sequence from the second cell or microorganism may be identified and isolated by hybridization to the proliferation-required Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalisEscherichia coli, Enterococcus faecalis, Haemophilus influenzae,
  • the second microorganism may be Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia
  • the homologous nucleic acid sequences from the second cell or microorganism which are identified as described above may then be operably linked to a promoter, such as an inducible promoter, in an antisense orientation and introduced into the second cell or microorganism.
  • a promoter such as an inducible promoter
  • Pseudomonas aeruginosa and Enterococcus faecalis Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi or Candida albicans genes required for proliferation may thus be employed to determine whether the identified nucleotide sequences from a second cell or microorganism inhibit the proliferation of the second cell or microorganism.
  • the second microorganism may be Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii,
  • Candida krusei, Candida kefyr also called Candida pseudotropicalis
  • Candida dubliniensis Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multo
  • the proliferation-required nucleic acid may be from Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Es
  • Salmonella enterica Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species.
  • the proliferation-required nucleotide sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans or homologous nucleic acids are used to identify proliferation-required sequences in an organism other than E. coli.
  • the proliferation-required sequences may be from an organism other than E. coli.
  • the proliferation-required nucleic acids from a cell or microorganism other than Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans may be hybridized to the a ⁇ ay under a variety of conditions which permit hybridization to occur when the probe has different levels of homology to the nucleotide sequence on the microa ⁇ ay. This would provide an indication of homology across the cells or microorganisms as well as clues to other possible essential genes in these cells or microorganisms.
  • Homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified as follows. The ability of an antisense molecule identified in a first organism to inhibit the proliferation of a second organism (thereby confirming that a gene in the second organism which is homologous to the gene from the first organism is required for proliferation of the second organism) was demonstrated using some of the antisense nucleic acids which inhibit the growth of E. coli. Expression vectors which inhibited growth of E. coli upon induction of antisense RNA expression with IPTG were transformed directly into Enterobacter cloacae, Klebsiella pneumonia or Salmonella typhimurium.
  • the transformed cells were then assayed for growth inhibition according to the methods described above. After growth in liquid culture, cells were plated at various serial dilutions and a score determined by calculating the log difference in growth for INDUCED vs. UNTNDUCED antisense RNA expression as determined by the maximum 10 fold dilution at which a colony was observed. The results of these experiments are listed below in Table I. If there was no effect of antisense RNA expression in a microorganism, the clone is minus in Table I. In contrast, a positive in Table I means that at least 10 fold more cells were required to observe a colony on the induced plate than on the non-induced plate under the conditions used and in that microorganism.
  • homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides can be identified by measuring the ability of an antisense nucleic acid which inhibits the proliferation of Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans to inhibit the growth of other organisms.
  • Enterococcus faecalis Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris,
  • Pseudomonas aeruginosa Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica,
  • Yersinia pestis or any species falling within the genera of any of the above species may be evaluated.
  • the ability of the antisense nucleic acid to inhibit the growth of an organism other than E. coli may be evaluated.
  • the antisense nucleic acids are inserted into expression vectors functional in the organisms in which the antisense nucleic acids are evaluated.
  • an antisense nucleic acid to inhibit the proliferation of a heterologous organism may be performed using antisense nucleic acids complementary to any of the proliferation- required nucleic acids from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans (including antisense nucleic acids complementary to SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, such as the antisense nucleic acids of SEQ ID NOs.: 8-3795) or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof, or homologous
  • a negative result in a heterologous cell or microorganism does not mean that that cell or microorganism is missing that gene nor does it mean that the gene is unessential.
  • a positive result means that the heterologous cell or microorganism contains a homologous gene which is required for proliferation of that cell or microorganism.
  • the homologous gene may be obtained using the methods described herein. For example, the homologous gene may be isolated by performing a PCR procedure using primers based on the antisense sequence which reduced the level or activity of the gene product encoded by the homologous gene or by performing a Southern blot.
  • Nucleic acids homologous to proliferation-required nucleic acids from Staphylococcus aureus were identified as follows. Thirty-nine antisense nucleic acids which inhibited the growth o ⁇ Staphylococcus aureus were inserted into an expression vector such that their expression was under the control of a xylose-inducible Xyl-T5 promoter.
  • a vector with Green Fluorescent Protein (GFP) under control of the Xyl- T5 promoter was used to show that expression from the Xyl-T5 promoter in Staphylococcus epidermidis was comparable to that in Staphylococcus aureus.
  • Colonies resulting from overnight growth of these platings were selected, cultured in liquid medium with drug selection, and then subjected to dilution plating analysis as described for Staphylococcus aureus above to test growth sensitivity in the presence of the inducer xylose.
  • the results are shown in Table II below.
  • the first column indicates the Molecule Number of the Staphylococcus aureus antisense nucleic acid which was introduced into Staphylococcus epidermidis.
  • the second column indicates whether the antisense nucleic acid inhibited the growth of Staphylococcus epidermidis, with a "+" indicating that growth was inhibited.
  • Staphylococcus aureus antisense nucleic acids evaluated 20 inhibited the growth o ⁇ Staphylococcus epidermidis.
  • Homologous nucleic acids may also be identified using complementation analyses.
  • Homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified as follows. Gene products whose activities may be complemented by a proliferation-required gene product from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli,
  • Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans or homologous polypeptides are identified using merodiploids, created by introducing a plasmid or Bacterial Artificial Chromosome into an organism having a mutation in the essential gene which reduces or eliminates the activity of the gene product.
  • the mutation may be a conditional mutation, such as a temperature sensitive mutation, such that the organism proliferates under permissive conditions but is unable to proliferate under non-permissive conditions in the absence of complementation by the gene on the plasmid or Bacterial Artificial Chromosome.
  • duplications may be constructed as described in Roth et al. (1987) Biosynthesis of Aromatic Amino Acids in Escherichia coli and Salmonella typhimurium, F. C. Neidhardt, ed, American Society for Microbiology, publisher, pp. 2269-2270, the disclosure of which is inco ⁇ orated herein by reference in its entirety.
  • homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified by placing a gene required for proliferation or a nucleic acid complementary to at least a portion of a gene required for proliferation under the control of a regulatable promoter as described above, introducing a plasmid or Bacterial Artificial Chromosome into the cell, and identifying cells which are able to proliferate under conditions which would prevent or reduce proliferation in the absence of the plasmid or Bacterial Artificial Chromosome.
  • homologous coding nucleic acids may be identified using databases as follows.
  • EXAMPLE 8 Identification of Homologous Nucleic Acids by Database Analysis As a demonstration of the database methodology used to find homologues to an essential gene, nine prokaryotic organisms were analyzed and compared in detail.
  • PathoSeq cluster ID for genes identified as being required for proliferation in Enterococcus faecalis, Escherichia coli, Pseudomonas aeruginosa, and Staphylococcus aureus using the methods described herein. As indicated in the column labelled PathoSeq cluster ID, these sequences share homology to one another and were consequently grouped within the same PathoSeq cluster. Thus, the methods described herein identified genes required for proliferation in several species which share homology. TABLE EH
  • Table VI A at the end of the present specification provides the SEQ ID NOs., clone names, and organisms for the sequences used in the above analysis.
  • Table VI B at the end of the present specification provides the clone name, clone SEQ ID NO., PathoSeq locus, Gene SEQ ID NO. (protein) Genemarked gene and full length ORF protein SEQ ID NOs. for the sequences used in the above analysis.
  • Table VI C at the end of the present specification provides the PathoSeq Gene Locus, nucleotide SEQ ID NOs. and Protem SEQ ID NOs. of the sequences used in the above analysis.
  • strains in which genes encoding gene products required for cellular proliferation under the control of a desired promoter are constructed by replacing the natural promoter with the desired promoter through homologous recombination as described in Examples 9-13 below. It will be appreciated that although Examples 9-13 use Candida albicans as an exemplary organism, similar methods may be utilized in other organisms.
  • Strains which overexpress or underexpress gene products required for proliferation may also be constructed by replacing the promoters which naturally direct transcription of these gene products with promoters which provide the desired level of expression. As described above, such strains are useful in methods for identifying the targets of compounds which inhibit proliferation, as well as in methods for identifying genes encoding gene products required for proliferation.
  • the natural promoter may be replaced using techniques which employ homologous recombination to exchange a promoter present on the chromosome of the cell with the desired promoter.
  • a nucleic acid comprising a promoter replacement cassette is introduced into the cell.
  • the promoter replacement cassette comprises a 5' region homologous to the sequence which is 5' of the natural promoter in the chromosome, the promoter which is to replace the chromosomal promoter and a 3' region which is homologous to sequences 3' of the natural promoter in the chromosome.
  • the promoter replacement cassette may also include a nucleic acid encoding an identifiable or selectable marker disposed between the 5' region which is homologous to the sequence 5' of the natural promoter and the promoter which is to replace the chromosomal promoter.
  • the promoter replacement cassette may also contain a transcriptional terminator 3' of the gene encoding an identifiable or selectable marker, as illustrated in Figure 5B. As illustrated in Figure 5 A and 5B, homologous recombination is allowed to occur between the chromosomal region containing the natural promoter and the promoter replacement cassette. Cells in which the promoter replacement cassette has integrated into the chromosome are identified or selected.
  • the chromosomal structure of the cells may be verified by Southern analysis or PCR.
  • the promoter replacement cassette may be introduced into the cell as a linear nucleic acid, such a PCR product or a restriction fragment.
  • the promoter replacement may be introduced into the cell on a plasmid.
  • Figures 5 A and 5B illustrates the replacement of a chromosomal promoter with a desired promoter through homologous recombination.
  • the cell into which the promoter replacement cassette is introduced may carry mutations which enhance its ability to be transformed with linear DNA or which enhance the frequency of homologous recombination.
  • the cell may have a mutation in the gene encoding Exonuclease V of the RecBCD recombination complex. If the cell is an Escherichia coli cell it may have a mutation that activates the RecET recombinase of the Rac prophage and/or a mutation that enhances recombination through the RecF pathway.
  • the Escherichia coli cells may be RecB or RecC mutants carrying an sbcA or sbcB mutation. Alternatively, the Escherichia coli cells may be recD mutants. In other embodiments the Escherichia coli cells may express the ⁇ Red recombination genes.
  • Escherichia coli cells suitable for use in techniques employing homologous recombination have been described in Datsenko, K.A. and Wanner, B.L., PNAS 97:6640-6645 (2000); Murphy, K.C., J. Bact 180: 2053-2071 (1998); Zhang, Y., et al., Nature Genetics 20: 123-128 (1998); and Muyrers, J.P.P. et al., Genes & Development 14: 1971-1982 (2000), the disclosures of which are incorporated herein by reference in their entireties. It will be appreciated that cells carrying mutations in similar genes may be constructed in organisms other than Escherichia coli.
  • strains in which genes encoding gene products required for proliferation are under the control of a desired promoter may be constructed using the methods described in U.S.
  • Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is incorporated herein by reference in its entirety), and U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 (the disclosure of which is incorporated herein by reference in its entirety)
  • genes and gene products required for proliferation which may be used in any of the methods of the present invention.
  • one chromosomal copy of a gene encoding a gene product required for proliferation is inactivated.
  • the gene may be inactivated by insertion of or replacement by a nucleotide sequence encoding a selectable or detectable gene product, such as a polypeptide which provides resistance to a drug or which allows growth under certain culture conditions.
  • the other chromosomal copy of the gene encoding a gene product required for proliferation is placed under the control of a regulatable promoter by homologous recombination.
  • the resultant strains may be used to identify genes which encode gene products required for proliferation and in the methods of the present invention. For example, one method of constructing diploid cells in which a gene encoding a gene product required for proliferation is under the control of a regulated promoter is depicted in Figures 6A and 6B.
  • one chromosomal copy of the essential Candida albicans gene CaKRE9 is disrupted using a cassette in which nucleic acid sequences homologous to the CaKRE9 gene flank a nucleic acid comprising the SATl gene, which is under the control of the ACT-1 promoter and the PCK1 terminator sequence, which is at the 3' end of the SATl gene.
  • the presence of the Escherichia coli SATl gene within C. albicans allows acetylation of the drug rendering it nontoxic and permitting the strain to grow in the presence of streptothricin at a concentration of 200 micrograms per milliliter. Expression of the SATl gene in C.
  • albicans is made possible by engineering the gene so that its DNA sequence is altered to conform to the genetic code of this organism and by providing a CaACTl promoter (Morschhauser et al. (1998) Mol. Gen. Genet. 257:412-420) and a CaPCKl terminator sequence (Leuker et a (1997) Gene 192: 235-40).
  • CaSATl This genetically modified marker is referred to as CaSATl which is the subject of a copending United States Patent Application, Serial No 09/785,669, filed February 16, 2001, Publication Number, US2001-0031724-A1, the disclosure of which is incorporated herein by reference in its entirety.
  • C. albicans is also sensitive to a second fungicidal compound, blasticidin, whose cognate resistance gene from Bacillus cereus, BSR, has similarly been genetically engineered for expression in C. albicans (CaBSRl), and has been shown to confer a dominant drug resistance phenotype.
  • BSRl Bacillus cereus
  • PCR amplification of either dominant selectable marker so as to include about 65 bp of flanking sequence identical to the sequence 5' and 3' of the C. albicans gene to be disrupted, allows construction of a gene disruption cassette for any given C. albicans gene.
  • a gene disruption event can be obtained following transformation of a C. albicans strain with the PCR-amplified gene disruption cassette and selection for drug resistant transformants that have precisely replaced the wild type gene with the dominant selectable marker.
  • Such mutant strains can be selected for growth in the presence of a drug, such as but not limited to streptothricin.
  • the resulting gene disruptions are generally heterozygous in the diploid C. albicans, with one copy of the allelic pair on one homologous chromosome disrupted, and the other allele on the other homologous chromosome remaining as a wild type allele as found in the initial parental strain.
  • the disrupted allele is non-functional, and expression from this allele of the gene is nil.
  • a set of gene disruptions can be obtained for every gene in the organism.
  • the method can also be applied to a desired subset of genes.
  • the second chromosomal copy of the Candida albicans CaKRE9 gene is placed under the control of a regulatable promoter using a promoter replacement cassette in which nucleic acid sequences homologous to the promoter region to be replaced flank a nucleic acid comprising the CaHIS3 gene (which encodes a selectable marker), the ADH terminator, which is at the 3' end of the CaHIS3 gene, and a tetracycline regulatable promoter (described below).
  • conditional expression is achieved by first constructing a transactivation fusion protein comprising the E. coli TefR tetracycline repressor domain or DNA binding domain (amino acids 1- 207) fused to the transcription activation domain of S.
  • albicans can be achieved by providing a CaACTl promoter and CaACTl terminator sequence.
  • any regulatory regions, promoters and terminators, that are functional in C. albicans can be used to express the fusion protein.
  • a nucleic acid molecule comprising a promoter functional in C. albicans, the coding region of a transactivation fusion protein, and a terminator functional in C. albicans can be used to obtain cells in which a gene encoding a gene product required for proliferation is under the control of a regulatable promoter.
  • Such a nucleic acid molecule can be a plasmid, a cosmid, a transposon, or a mobile genetic element.
  • the TetR-Gal4 or TetR-Hap4 transactivators can be stably integrated into a C. albicans strain, by using either ura3 and his3 auxotrophic markers.
  • the heterologous tetracycline promoter initially developed for S. cerevisiae gene expression contains an ADH1 3' terminator sequence, variable number of copies of the tetracycline operator sequence (2, 4, or 7 copies), and the CYC1 basal promoter.
  • the tetracycline promoter has been subcloned adjacent to both CaHIS3 and CaSATl selectable markers in the orientation favoring tetracycline promoter-dependent regulation when placed immediately upstream the open reading frame of the gene of interest.
  • PCR amplification of the C H/S3-Tet promoter cassette incorporates 65bp of flanking sequence homologous to the promoter sequence around nucleotide positions -200 and -1 (relative to the start codon) of the target gene, thereby producing a conditional promoter replacement fragment for transformation.
  • flanking sequence homologous to the promoter sequence around nucleotide positions -200 and -1 (relative to the start codon) of the target gene, thereby producing a conditional promoter replacement fragment for transformation.
  • homologous recombination between the promoter replacement fragment and the promoter of the wild type allele generates a strain in which the remaining wild type gene is conditionally regulated gene by the tetracycline promoter.
  • Transformants are selected as His prototrophs and verified by Southern blot and PCR analysis.
  • the promoter is induced in the absence of tetracycline, and repressed by the presence of tetracycline.
  • Analogs of tetracycline including but not limited to chlortetracycline, demeclocycline, doxycycline, meclocycline, methocycline, minocycline hydrochloride, anhydrotetracycline, and oxytetracycline, can also be used to repress the expression of the modified gene allele.
  • tetracycline promoter system based upon a mutated tetracycline repressor (tetR) molecule, designated tetR', which is activated (i.e. binds to its cognate operator sequence) by binding of the antibiotic effector molecule to promote expression, and is repressed (i.e. does not bind to the operator sequence) in the absence of the antibiotic effectors, when the tetR' is used instead of, or in addition to, the wild-type tetR may also be used.
  • tetR mutated tetracycline repressor
  • the method could be performed using tetR' instead of tetR in cases where repression is desired under conditions which lack the presence of tetracycline, such as shut off of a gene participating in drug transport (e.g. CaCDRl, CaPDR5, or CaMDRl).
  • a gene participating in drug transport e.g. CaCDRl, CaPDR5, or CaMDRl.
  • the method could be adapted to incorporate both the tetR and tetR' molecules in a dual activator/repressor system where tetR is fused to an activator domain and tetR' is fused to a general repressor (e.g.
  • the method may also be applied to haploid organisms by modifying the single allele of the gene via recombination of the allele with a promoter replacement fragment comprising a nucleotide sequence encoding a heterologous promoter, such that the expression of the gene is conditionally regulated by the heterologous promoter.
  • a preferred subset of genes comprises genes that share substantial nucleotide sequence homology with target genes of other organisms, e.g., C. albicans and S. cerevisiae.
  • the method may be applied to haploid fungal pathogens including, but not limited to, animal fugal pathogens such as Aspergillus fumigatus,
  • Septoria triticii, Tilletia controversa, Ustilago maydis, or any species falling within the genera of any of the above species.
  • the method may be applied to bacteria, including the bacterial species and genera discussed above.
  • conditional expression are not restricted to the tetracycline promoter system and can be performed using other conditional promoters.
  • conditional promoter may, for example, be regulated by a repressor which repress transcription from the promoter under particular condition or by a transactivator which increases transcription from the promoter, such as, when in the presence of an inducer.
  • the C. albicans CaPCKl promoter is not transcribed in the presence of glucose but has a high level of expression in cells grown on other carbon sources, such as succinate, and therefore could also be adopted for conditional expression of the modified allele.
  • both CaHISl and CaSATl are essential for growth on glucose-containing medium using the CaPCKl promoter as an alternative to the tetracycline promoter in the above description.
  • the CaPCKl promoter is heterologous to the gene expressed and not to the organism, and such heterologous promoters are also encompassed in the invention.
  • Alternative promoters that could functionally replace the tetracycline promoter include but are not limited to other antibiotic-based regulatable promoter systems (e.g.,. pristinamycin-induced promoter or PIP) as well as Candida albicans conditionally-regulated promoters such as MET25, MAL2, PH05, GAL 1,10, STE2, or STE3.
  • heterozygous strains are constructed and separately collected as a heterozygote strain collection during the process of drug target validation.
  • Heterozygous strains for a given gene express approximately half the normal diploid level of a particular gene product. Consequently, these strains provide constructions having a diminished level of the encoded gene product, and they may be used in the methods described herein.
  • the order of allele modification followed in this embodiment of the invention is not critical, and that it is feasible to perform these steps in a different order such that the conditional-expressing allele is constructed first and the disruption of the remaining wild type gene allele be performed subsequently.
  • the promoter replacement step is carried out first, it is preferable to delete sequences homologous to those employed in the gene disruption step.
  • conditional expression could be achieved by means other than the reliance of conditional promoters.
  • conditional expression could be achieved by the replacement of the wild type allele in haploid or heterozygous strains with temperature sensitive alleles derived in vitro, and their phenotype would then be analyzed at the nonpermissive temperature.
  • insertion of a ubiquitination signal into the remaining wild type allele to destabilize the gene product during activation conditions can be adopted to examine phenotypic effects resulting from gene inactivation.
  • a constitutive promoter regulated by an excisable transactivator can be used.
  • the promoter is placed upstream to a target gene to repress expression to the basal level characteristic of the promoter.
  • a heterologous promoter containing lexA operator elements may be used in combination with a fusion protein composed of the lexA DNA binding domain and any transcriptional activator domain (e.g. GAL4, HAP4, VP16) to provide constitutive expression of a target gene.
  • Counterselection mediated by 5-FOA can be used to select those cells which have excised the gene encoding the fusion protein.
  • This procedure enables an examination of the phenotype associated with repression of the target gene to the basal level of expression provided by the lexA heterologous promoter in the absence of a functional transcription activator.
  • the strains generated by this approach may be used in the present invention.
  • conditional expression of a target gene can be achieved without the use of a transactivator containing a DNA binding, transcriptional activator domain.
  • a cassette could be assembled to contain a heterologous constitutive promoter downstream of, for example, the URA3 selectable marker, which is flanked with a direct repeat containing homologous sequences to the 5' portion of the target gene. Additional homologous sequences upstream of the target, when added to this cassette would facilitate homologous recombination and replacement of the native promoter with e above-described heterologous promoter cassette immediately upstream of the start codon of the target gene or open reading frame.
  • Conditional expression is achieved by selecting strains, by using 5-FOA containing media, which have excised the heterologous constitutive promoter and URA3 marker (and consequently lack those regulatory sequences upstream of the target gene required for expression of the gene) and examining the growth of the resulting strain versus a wild type strain grown under identical conditions.
  • Oligonucleotide primers for PCR amplification of the SAT selectable marker used in Step 1 contain 25 nucleotides complementary to the SAT disruption cassette in pRC18-ASP, and 65 nucleotides homologous to regions flanking the CaKRE9 open reading frame.
  • Figures 6A and 6B illustrate the procedure for constructing Candida albicans strains in which a gene encoding a gene product is under the control of a regulatable promoter.
  • FIGS. 6A and 6B illustrate, the 2.2 kb cakre9 ⁇ ::SAT disruption fragment produced after PCR amplification and resulting gene replacement of the first wild type CaKRE9 allele via homologous recombination following transformation.
  • PCR conditions were as follows: 5-50 ng pRC18-ASP, 100 pmol of each primer, 200 ⁇ M dNTPs, 10 mM Tris- pH 8.3, 1.5 mM MgC12, 50 mM
  • KC1 1 unit Taq DNA polymerase (Gibco).
  • PCR amplification times were: 5 min 94°C, 1 min 54°C, 2 min 72°C, for 1 cycle; 45 sec 94°C, 45 sec 54°C, 2 min 72°C, for 30 cycles. Transformation was performed using the lithium acetate method adapted for C. albicans, by Braun and Johnson, (Braun, B. R., and A. D. Johnson (1997), Control of filament formation in Candida albicans by the transcriptional repressor TUP 1 , Science
  • Oligonucleotide primers for PCR amplification of the conditional promoter used in Step 2 contain 25 nucleotides complementary to the
  • the essential nature of a gene may be determined by streaking the cells onto a casamino acid plate containing 625 ⁇ g/ml 5-fluororotic acid (5FOA) and 100 ⁇ g/ml uridine to select for ura " cells which have excised (via recombination between CaLEU2 sequence duplications created during targeted integration) the transactivator gene that is normally required for expression of the tetracycline promoter-regulated target gene.
  • 5FOA 5-fluororotic acid
  • uridine 100 ⁇ g/ml uridine
  • the CaKRE9 strains prepared as described above fail to grow. Quantitative evaluation of the terminal phenotype associated with the CaKRE9 strain is performed using 2 x 10 3 cells/ml of overnight culture inoculated into 5.0 ml YNB either lacking or supplemented with 100 ⁇ g/ml tetracycline and measuring optical density (O.D. 600 ) after 24 and 48 hr incubation at 30 °C.
  • Overexpression achieved by the constitutive expression level of CaHIS3 maintained by the tetracycline promoter, confers 3-AT resistance at concentrations sufficient to completely inhibit growth of both wild type and CaHIS3 heterozygote strains (Fig 7A).
  • the phenotype observed is consistent with that expected in light of the predicted 7.5 fold overexpression o ⁇ CaHIS3 determined by Northern bolt analysis (see Fig 8).
  • a heterozygous CaHIS3 strain demonstrates enhanced sensitivity (i.e. haploinsufficient phenotype) to an intermediate 3-AT concentration unable to effect either wild type or tetracycline promoter-based overproducing CaHIS3 strains noticeably (Fig 7B).
  • a third CaHIS3 expression level evaluated for differential sensitivity to 3-AT was produced by partial repression of the tetracycline regulated strain using a threshold concentration of tetracycline 0.1% that normally is used to achieve complete shut-off.
  • This level of CaHIS3 expression represents the minimum expression level required for viability and as predicted, demonstrates an enhanced drug sensitivity relative the heterozygous CaHIS3 strain at an intermediate 3-AT concentration (Fig 7C).
  • strain-specific drug resistance and sensitivity phenotypes to fluconazole and tunicamycin have been demonstrated by increasing and decreasing the level of expression of their respective known drug targets, CaERGll and CaALGl. Together these results demonstrate that three different levels of expression are achieved using the
  • Candida albicans genes which encode gene products required for proliferation were identified by constructing strains in which one chromosomal copy of a gene was disrupted and the other chromosomal copy of the gene was under the control of a regulatable promoter as described above.
  • a strain containing the modified alleles of the gene was cultured under conditions wherein the second modified allele of the gene which is under conditional expression, was substantially underexpressed or not expressed.
  • the viability and or growth of the strain was compared with that of a wild type strain cultured under the same conditions. A loss or reduction of viability or growth indicated that the gene product encoded by the gene is required for proliferation.
  • the level of expression of the gene in strains prepared as described above can be less than 50% of the non-modified allele, less than 30%, less than 20%, and preferably less than 10%.
  • the level of expression can be controlled by, for example, antibiotics, metal ions, specific chemicals, nutrients, pH, temperature, etc.
  • C. albicans conditional gene expression using the method described above was performed using CaKREl, CaKRES, CaKRE ⁇ , and CaKRE9 (Fig.
  • CaKRE5, CaKRE ⁇ , and CaKRE9 are predicted to be essential or conditionally essential (CaKRE9 null strains are nonviable on glucose but viable on galactose), in C. albicans as demonstrated by gene disruption using the Ura blaster method.
  • CaKREl has been demonstrated as a nonessential gene using the Ura blaster method in C. albicans.
  • Strains heterozygous for the above genes were constructed by PCR-based gene disruption method using the CaSATl disruption cassette followed by tetracycline regulated promoter replacement of the native promoter of the wild type allele. Robust growth of each of these strains suggests expression proceeds normally in the absence of tetracycline.
  • CaALG7, CaAURl, and CaFKSl, as well as the predicted essential gene CaSAT2, and CaKREl were under the control of a regulatable promoter were compared under inducing versus repressing conditions (Fig. 10 ).
  • strains in which CaTUBl, CaALG7, CaAURl and CaFKSl were under the control of a regulatable promoter failed to grow under repressing conditions, unlike the strains in which the non- essential CaKREl was under the control of a regulatable promoter.
  • the strain in which the CaSAT2 gene was under the control of a regulatable promoter demonstrates essentiality of this gene in C. albicans.
  • the CaSAT2 gene which has been engineered as a dominant selectable marker for use in C. albicans, is a C. albicans gene that is homologous to a S. cerevisiae gene but is unrelated to the Satl gene of E. coli.
  • strains in which any one of these 17 genes are under the control of a regulatable promoter may be used in the methods of the present invention, for example, the CaTUBl, CaALGl, and CaAURl strains in Fig. 10 and the CaKRE ⁇ strain in Fig. 9. Any of these 17 genes may be included as a control for comparisons in the methods described above, or as a positive control for essentiality in the collections of essential genes.
  • the nucleic acid molecules comprising a nucleotide sequence corresponding to any of these 17 genes may be used in the methods of the present invention, as drug targets, or they may be included individually or in subgroups as controls in a kit or in a nucleic acid microarray.
  • SEQ ID Os: 14111-14944 which encode the polypeptides of SEQ ID ⁇ Os.: 14945-15778 were identified as being required for proliferation.
  • Table VII provided at the end of the present specification, lists the SEQ ID ⁇ Os. of the identified genes along with their Candida designation.
  • the Candida designations provided in Table VII were formulated by identifying the Saccharomyces cerevisae gene which is homologous to the identified Candida albicans gene.
  • the Candida designation also references the location of the homologous Saccharomyces cerevisae gene in the Saccharomyces cerevisae genom.
  • the Candida designation CaYAL038W means that the homologous Saccharomyces cerevisae gene was on yeast chromosome 1 (YB would mean yeast chromosome 2 etc), left arm of centromere (R means right arm of centromere), position 038, w for watson strand (c for crick strand).
  • the homologous Saccharomyces cerevisae gene was identified from genome-www.stanford.edu/saccharomyces.
  • Homologous coding nucleic acids, homologous antisense nucleic acids and homologous polypeptides having homology to the genes of SEQ ID NOs: 14111-14944, nucleic acids complementary to SEQ ID NOs: 14111-14944, or the polypeptides of SEQ ID NOs.: 14945-15778 may be identified using any of the methods described above.
  • An alternative method is available for assessing the essentiality of the modified gene in strains constructed as described above. Repression of expression of the modified gene allele within a strain constructed as described above may be achieved by homologous recombination-mediated excision of the gene encoding the transactivator protein.
  • constitutive expression may be repressed by homologous recombination-mediated excision of the transactivator gene (TetR-GAL4AD).
  • TetR-GAL4AD homologous recombination-mediated excision of the transactivator gene
  • genes defined as essential on 5-FOA containing medium but lacking any detectable growth impairment on tetracycline supplemented medium are the genes, CaYCL052c, CaYNL194c and CaYJR046c. Presumably, this is due to the target gene exhibiting a lower basal level of expression under conditions where the transactivator gene has been completely eliminated than its gene product incompletely inactivated by addition of tetracycline.
  • the method described above offers two independent approaches for the determination of whether or not a given gene is essential for viability of the host strain.
  • a target for promoter replacement is selected.
  • a promoter replacement cassette is obtained by inserting a nucleic acid comprising the rrnBTlT2 transcriptional terminator followed by the lac promoter into pACYC184 such that the rrnB terminator and lac promoter are positioned 3' of the CAT gene.
  • CAT-rrnBTlT2-plac is amplified by PCR.
  • the PCR product is used as the template for another round of PCR using primers with 60-80 bp of homology to a target promoter (i.e. a promoter which directs expression of a gene encoding a gene product required for proliferation) and 20 bp of homology to the CAT/rrnBTlT2/plac template as described above.
  • the region of homology is chosen such that upon homologous recombination, the CAT/rrnBTlT2/plac cassette replaces the promoter of the target gene but leaves its Shine-Delgarno motif untouched.
  • the promoter replacement cassette is transformed into competent JC8679.
  • JC8679 is available from the E. coli genetics stock center.
  • JC8679 allows recombination of short linear DNAs and also contains a lacY mutation which allows titratable regulation of the lac promoter.
  • the transformed cells are plated onto LB/chloramphenicol plates containing various levels of IPTG to assure that the correct level of expression is achieved to allow survival.
  • the correct integration of the promoter replacement cassette is confirmed by colony PCR. If desired, proper regulation of the target gene by the inserted promoter may be confirmed by testing the integrants for growth defects when inducer is absent or present at levels lower than that at which the original colonies were obtained.
  • the inability to grow in the absence of inducer (IPTG) or in the presence of lower levels of the inducer than were used to obtain the clones confirms that the target gene is properly regulated by the inserted promoter.
  • IPTG inducer
  • the method may be performed using any suitable regulatable promoter and organism or strain to generate cells which are capable of overexpressing or underexpressing a gene encoding a gene product required for proliferation.
  • An oligonucleotide comprising a lac operator flanked on each side by 40 nucleotides homologous to the target promoter is designed.
  • the target promoter is the promoter which drives expression of a gene encoding a gene product required for proliferation, such as the yabB yabCftsLftsI murE genes in an operon.
  • the sequence of the oligonucleotide (SEQ ID NO. 15810) and locations of the regions homologous to the promoter are illustrated in Figure 11.
  • the sequence of the promoter is also shown with the locations of the -10 and -35 regions indicated (SEQ ID NO. 15811).
  • the single stranded oligonucleotide is transformed into a bacterium expressing the ⁇ Beta and Gam proteins.
  • the cells in the transformation mixture are diluted and plated on medium containing IPTG.
  • Colonies in which the lac operator has integrated into the target promoter are identified by colony PCR. If desired, proper regulation of the target promoter by the inserted operator is confirmed by growing the identified colonies in medium containing or lacking IPTG. The colonies proliferate on medium containing IPTG but fail to grow on medium lacking IPTG, thereby confirming that the target promoter is properly regulated by the inserted operator. It will be appreciated that the preceding method may be performed with any target promoter and any operator to generate cells which overexpress or underexpress a gene encoding a gene product required for proliferation.
  • strains which overexpress or under express gene products required for proliferation are used to identify the gene product on which a compound which inhibits proliferation of an organism acts or to profile a compound's activity.
  • Examples 16-18 describe methods for identifying the gene product on which a compound which inhibits the proliferation of an organism acts using cells which overexpress or underexpress a gene product required for proliferation.
  • Staphylococcus aureus which are the targets of known antibiotics were operably linked to the xylose inducible promoter XylT5 described above as follows.
  • the genes and the antibiotics which target the products of these genes are listed in Table V below.
  • PCR primer pairs were designed for each of the 11 genes encoding a gene product required for proliferation o ⁇ Staphylococcus aureus as shown in Table V.
  • the upstream primers for each gene included the native ribosomal binding sites (S-D sequences).
  • restriction sites for appropriate restriction enzymes were designed into the primers to facilitate directional cloning of the genes.
  • PCR reactions were carried out using Pfu DNA polymerase (Stratagene, San Diego) under the following conditions per 50 ⁇ l reaction: Pfu polymerase 2U, dNTP 200 ⁇ M, primers
  • S. aureus RN450 genomic DNA (template) 5-10 ng.
  • the reaction involved an initial heating at 94°C for 5 min, followed by 25 cycles of 30 sec at 94°C/30 sec at 55°C/5 min at 72°C, and ending with 7 min of extension at 72°C.
  • the amplified genes were operably linked to the XylT5 promoter as follows. PCR products were cleaned using QIAGEN PCR Cleaning Kits and then were digested with the proper restriction enzymes. The resulting fragments were ligated overnight at 16°C with precut vector DNA containing the XylT5 promoter. Ligation mixtures were ethanol precipitated at -80°C for 20 min in the presence of 0.3 M sodium acetate. The precipitated DNA was spun down at 14,000 rpm for 30 min at 4°C and washed with 1 ml of 70% EtoH. The DNA pellets were air-dried and dissolved in EB or sterile water.
  • the precipitated DNA was mixed with 45 ⁇ l of electroporation competent cells and incubated at room temperature for 30 min.
  • the DNA/cell mixtures were electroporated (settings: 2 volts, 25 ⁇ F, 200 ⁇ ) in 2 mm cuvettes and mixed with 450 ⁇ l B2 medium containing 0.2 ⁇ g/ml chloramphenicol.
  • the cells were incubated at 37°C with shaking for 90 min.
  • Transformed cells were plated onto LB agar plates containing chloramphenicol (34 ⁇ g/ml) for the selection of plasmids. Several colonies for each cloning reaction were picked and streaked to obtain a pure culture. Colony PCR reactions using vector-specific primers were performed to verify the size and identity of the inserts.
  • Gene-walking sequencing was employed to completely sequence the entire insert for several clones of each cloned gene. This was carried out to avoid using a cloned gene whose DNA sequence was mutated during the PCR process.
  • overexpression of the fabl gene conferred resistance to triclosan, which acts on the gene product of the fabl gene, enoyl-acyl carrier protein reductase.
  • overexpression of the fabl gene did not confer resistance to cerulenin, trimethoprim, or actinonin, each of which act on other gene products.
  • overexpression of the folA gene conferred resistance to trimethoprim, which acts on the gene product of the folA gene, dihydrofolate reductase.
  • trimethoprim acts on the gene product of the folA gene
  • dihydrofolate reductase did not confer resistance to triclosan, cerulenin, or actinonin, each of which act on other gene products.
  • overexpression of the defB gene conferred resistance to actinonin, which acts on the gene product of the defB gene, peptide deformylase.
  • overexpression of the defB gene did not confer resistance to cerulenin, trimethoprim, or triclosan, each of which act on other gene products.
  • overexpression of a gene encoding a gene product required for proliferation confers specific resistance to antibiotics which target the overexpressed gene product.
  • EXAMPLE 18 Selection of a Strain Overexpressing a Gene Encoding a Target Gene Product from a Mixture of Strains Overexpressing Genes Required for Proliferation
  • S. aureus strains overexpressing one of nine genes encodmg a gene product required for proliferation were constructed as described above. The nine overexpressed genes were fabF, defB, folA, fabl, ileS, fusA, gyrB, murA, rpoB.
  • a mixture of the nine strains was grown wells in a 96 well plate in medium containing various concentrations of inducer and a sufficient concentration of actinonin, cerulenin, triclosan or trimethoprim to inhibit the growth of strains which do not overexpress the targets of these antibiotics.
  • EXAMPLE 19 Identification of Amplification Products Having Distinguishable Lengths
  • the sequences of the antisense nucleic acids are provided herein as follows:
  • the 5' primer of each pair was complementary to a nucleotide sequence within the xylT5 promoter while 3' primer was complementary to a nucleotide sequence within the antisense clone.
  • the 5' primer of each pair was identical for each amplification reaction.
  • the nucleotide sequence GTTTCTT was appended on the 5' end of the 3' primers.
  • One primer in each pair was labeled with either NIC or 6FAM.
  • Two sets of ten plasmids containing the antisense nucleic acids complementary to the genes listed in each of the columns above were mixed in equal amounts in 11 tubes except that either the plasmid encoding antisense nucleic acids complementary to a nucleotide sequence in the grlA gene or the plasmid encoding antisense nucleic acids complementary to nucleotide sequences in the fmhB gene were serially diluted two fold in each of the 11 tubes (i.e. the first tube had lOOpg of the grlA plasmid or the fmhB plasmid while the last tube had 0.1 Opg of the grlA plasmid or the fmhB plasmid).
  • Amplification reactions were conducted on the mixtures and the amplification products were separated on a 5%> NuSieve 3:1 agarose gel (BioWhittaker Molecular Applications Rockland, ME).
  • the levels of the 151bp or 181 amplification products for the grlA or fmhB primer respectively were specifically reduced in a stepwise fashion with increasing dilutions while the levels of the undiluted products remained constant.
  • the assay readily detected a 10-fold decrease in template concentration reflected in the amplification products corresponding to the grlA or fmhB plasmids.
  • Spectinomycin acts on the product of the rpsR gene
  • mupriocin acts on the product of the ileS gene
  • cerulenin acts on the product of the FabF gene.
  • the middle concentration for each antibiotic is its IC50.
  • the culture containing the ten strains were grown in rich medium (L-Broth; for antisense LB + chloroamphenicol to maintain antisense plasmid) until the cells reached early log phase then contacted with of one of the above-stated compounds at one of the concentrations listed above (preferably near IC50).
  • the cultures were grown for a sufficient length of time to permit the compounds to specifically inhibit the growth of strains underexpressing their targets.
  • the cultures were grown at least 16 hr, more preferably between 24 and 48 hrs. It is desirable to avoid allowing the culture to grow for time periods which might places selective pressure on the strains which could lead to false positives.
  • the cells were harvested by centrifugation and plasmid DNA was isolated from the cultures. PCR amplifications were performed as described in Example 19. Amplification products were run on NuSieve agarose gels as described above. The amounts of the amplification products corresponding to each antisense nucleic acid were determined and compared to those in a control culture which was not contacted with the drug or to the amounts of the amplification products corresponding to the other antisense nucleic acids which were not complementary to nucleotide sequences in the genes encoding the gene products on which the compounds act. In each case, only the amplification product corresponding to the target on which the antibiotic acts was not detectable on the gel.
  • the level or activity of gene products is regulated by transcribing antisense nucleic acids complementary to gene products required for proliferation or by replacing the native promoters of such genes with regulatable promoters, to perform dose-response curve for the inducer used to induce transcription of the antisense nucleic acids or induce transcription from the regulatable promoter.
  • the level of the compound is preferably about IC 90 or above .
  • the level of the compound is preferably about IC 50 or below . It will be appreciated that, if desired, the amplification products may be detected using the dyes described above. It will also be appreciated that amplification products may be detected using any desired amplification method including RT-PCR and PCR. It will be appreciated that no matter how detailed the foregoing appears in text, the invention can be practiced in many ways.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Plant Pathology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The present invention relates to cultures or collections of strains which overexpress or underexpress gene products required for the proliferation of an organism. The present invention also includes methods for identifying the target on which a compound which inhibits the proliferation of an organims acts and methods for identifying the extent to which a strain is present in a culture or collection of strains.

Description

METHODS FOR IDENTIFYING THE TARGET OF A COMPOUND WHICH INHIBITS CELLULAR PROLIFERATION
Background of the Invention Many important therapeutic compounds act by reducing or eliminating the activity or level of a gene product required for cellular proliferation. For example, most antibiotic compounds act by reducing or eliminating the activity or level of gene products which are required for the proliferation of a pathogenic organism. Similarly, compounds used to treat or ameliorate cancer also reduce or inhibit the activity or level of a gene product required for cellular proliferation.
Current drug discovery methods involve screening large number of prospective therapeutic compounds to identify those that are effective therapeutic agents or that can be optimized to provide an effective therapeutic agents. For example, the compounds to be evaluated for therapeutic activity may be members of a library of compounds generated by combinatorial chemistry or members of a library of natural products.
Unfortunately, current methods are laborious and time consuming and may yield compounds which have already been identified or which act on gene products which are already targeted by an existing therapeutic agent. Accordingly, there is a need for rapid screening techniques which yield novel compounds or compounds which act on novel targets.
In addition, a large number of compounds have been identified which have antimicrobial activity but which cannot be administered to individuals suffering from infection due to the fact that their targets are unknown. Accordingly, there is a need for methods which permit the identification of the target on which a compound with antimicrobial activity acts.
Field of the Invention The present invention provides reagents and methods for identifying the target of a compound which reduces the activity or level of gene products required for cellular proliferation. In addition, the present invention provides reagents and methods for identifying novel therapeutic compounds or compounds which act on novel targets.
Sequence Listing The present application is being filed along with 4 copies of a CD-ROM marked "Copy l,""Copy 2," "Copy3" and "CRF" containing a Sequence Listing in electronic format. The copies of the CD-ROM each contain a file entitled 028vpc- final.txt created on February 8, 2002 which is 36,220,587 bytes in size. The information on these duplicate CD-ROMs is incorporated herein by reference in its entirety.
Definitions As used herein, the terminology "proliferation-required" or "required for proliferation" encompasses instances where the absence or substantial reduction of a gene transcript and/or gene product completely eliminates cell growth as well as instances where the absence of a gene transcript and/or gene product merely reduces cell growth.
By "E. coli or Escherichia coli" is meant Escherichia coli or any organism previously categorized as a species of Shigella including Shigella boydii, Shigella flexneri, Shigella dysenteriae, Shigella sonnei, Shigella 2A. By "homologous coding nucleic acid" is meant a nucleic acid homologous to a nucleic acid encoding a gene product whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs.: 8-3795 or a portion thereof. In some embodiments, the homologous coding nucleic acid may have at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof. In other embodiments the homologous coding nucleic acids may have at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, at least 70% , at least 60%, at least 50%, or at least 40% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of the nucleotide sequences complementary to one of SEQ ID NOs.: 8-3795 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof. Identity may be measured using BLASTN version 2.0 with the default parameters or tBLASTX with the default parameters. (Altschul, S.F. et al.
Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997), the disclosure of which is incoφorated herein by reference in its entirety) Alternatively a "homologous coding nucleic acid" could be identified by membership of the gene of interest to a functional orthologue cluster. All other members of that orthologue cluster would be considered homologues. Such a library of functional orthologue clusters can be found at http ://www.ncbi.nlm.nih. gov/COG. A gene can be classified into a cluster of orthologous groups or COG by using the COGNITOR program available at the above web site, or by direct BLASTP comparison of the gene of interest to the members of the COGs and analysis of these results as described by Tatusov, R.L., Galperin, M.Y.,
Natale, D. A. and Koonin, EN. (2000) The COG database: a tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Research v. 28 n. 1, pp. 33-36.
The term "homologous coding nucleic acid" also includes nucleic acids comprising nucleotide sequences which encode polypeptides having at least 99%,
95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide comprising the amino acid sequence of one of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 or to a polypeptide whose expression is inhibited by a nucleic acid comprising a nucleotide sequence of one of SEQ ID NOs: 8-3795 or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof as determined using the FASTA version 3.0t78 algorithm with the default parameters. Alternatively, protein identity or similarity may be identified using BLASTP with the default parameters, BLASTX with the default parameters, TBLASTN with the default parameters, or tBLASTX with the default parameters. (Altschul, S.F. et al. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997), the disclosure of which is incorporated herein by reference in its entirety).
The term "homologous coding nucleic acid" also includes coding nucleic acids which hybridize under stringent conditions to a nucleic acid selected from the group consisting of the nucleotide sequences complementary to one of SEQ ID NOS.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944 and coding nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequences complementary to one of SEQ ID NOS.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944. As used herein, "stringent conditions" means hybridization to filter-bound nucleic acid in 6xSSC at about 45°C followed by one or more washes in O.lxSSC/0.2% SDS at about 68°C. Other exemplary stringent conditions may refer, e.g., to washing in 6xSSC70.05% sodium pyrophosphate at 37°C, 48°C, 55°C, and 60°C as appropriate for the particular probe being used.
The term "homologous coding nucleic acid" also includes coding nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleotide sequence selected from the group consistmg of the sequences complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and
14111-14944 and coding nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequences complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916- 10012, and 14111-14944. As used herein, "moderate conditions" means hybridization to filter-bound DNA in 6x sodium chloride/sodium citrate (SSC) at about 45°C followed by one, preferably 3-5 washes in 0.2xSSC/0.1% SDS at about 42-65°C.
The term "homologous coding nucleic acids" also includes nucleic acids comprising nucleotide sequences which encode a gene product whose activity may be complemented by a gene encoding a gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795. In some embodiments, the homologous coding nucleic acids may encode a gene product whose activity is complemented by the gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944. In other embodiments, the homologous coding nucleic acids may comprise nucleotide sequences which encode a gene product whose activity is complemented by one of the polypeptides of SEQ ID NOs. 3801-3805, 4861-5915, 10013-14110 and 14945- 15778.
The term "homologous antisense nucleic acid" includes nucleic acids comprising a nucleotide sequence having at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, or at least 40% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of one of the sequences of SEQ ID NOS. 8-3795 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof. Homologous antisense nucleic acids may also comprising nucleotide sequences which have at least 97%, at least 95%, at least 90%>, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, or at least 40% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of the sequences complementary to one of sequences of SEQ ID NOS.: 3796-3800, 3806- 4860, 5916-10012, and 14111-14944 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof. Nucleic acid identity may be determined as described above. The term "homologous antisense nucleic acid" also includes antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleotide sequence complementary to one of SEQ ID NOs.: 8-3795 and antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 8-3795. Homologous antisense nucleic acids also include antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944.
The term "homologous antisense nucleic acid" also includes antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleotide sequence complementary to one of SEQ ID NOs.: 8-3795 and antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 8-3795. Homologous antisense nucleic acids also include antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and antisense nucleic acids which comprising nucleotide sequences hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300,
400, or 500 consecutive nucleotides of one of SEQ ED NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944.
By "homologous polypeptide" is meant a polypeptide homologous to a polypeptide whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 or by a homologous antisense nucleic acid. The term "homologous polypeptide" includes polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 8-3795 or by a homologous antisense nucleic acid, or polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide to a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a polypeptide whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs.: 8-3795 or by a homologous antisense nucleic acid. Identity or similarity may be determined using the FASTA version 3.0t78 algorithm with the default parameters. Alternatively, protein identity or similarity may be identified using BLASTP with the default parameters, BLASTX with the default parameters, or TBLASTN with the default parameters. (Altschul, S.F. et al. Gapped
BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997), the disclosure of which is incorporated herein by reference in its entirety).
The term homologous polypeptide also includes polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least
50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778 and polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a fragment comprising at least 5, 10, 15,
20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a polypeptide selected from the group consistmg of SEQ ID NOs: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778.
The term, Salmonella, is the generic name for a large group of gram-negative enteric bacteria that are closely related to Escherichia coli. The diseases caused by
Salmonella are often due to contamination of foodstuffs or the water supply and affect millions of people each year. Traditional methods of Salmonella taxonomy were based on assigning a separate species name to each serologically distinguishable strain (Kauffrnarm, F 1966 The bacteriology of the Enter ohacteriaceae. Munksgaard, Copenhagen). Serology oϊ Salmonella is based on surface antigens (O [somatic] and H [flagellar]). Over 2,400 serotypes or serovars of Salmonella are known (Popoff, et al. 2000 Res. Microbiol. 151:63-65). Therefore, each serotype was considered to be a separate species and often given names, accordingly (e.g. S. paratyphi, S. typhimurium, S. typhi, S. enteriditis, etc.). However, by the 1970s and 1980s it was recognized that this system was not only cumbersome, but also inaccurate. Then, many Salmonella species were lumped into a single species (all serotypes and subgenera I, II, and IN and all serotypes of Arizona) with a second subspecies, S. bongorii also recognized (Crosa, et al., 1973, J. Bacteriol. 115:307-315). Though species designations are based on the highly variable surface antigens, the Salmonella are very similar otherwise with a major exception being pathogenicity determinants.
There has been some debate on the correct name for the Salmonella species. Currently (Brenner, et al. 2000 J. Clin. Microbiol. 38:2465-2467), the accepted name is Salmonella enterica. S. enterica is divided into six subspecies (I, S. enterica subsp. enterica; II, S. enterica, subsp. salamae; Ilia, S. enterica subsp. arizonάe; IITb, S. enterica subsp. diarizonae; IN, S. enterica subsp. houtenae; and VI, S. enterica subsp. indica). Within subspecies I, serotypes are used to distinguish each of the serotypes or serovars (e.g. S. enterica serotype Enteriditis, S. enterica serotype Typhimurium, S. enterica serotype Typhi, and S. enterica serotype Choleraesuis, etc.). Current convention is to spell this out on first usage (Salmonella enterica ser. Typhimurium) and then use an abbreviated form (Salmonella Typhimurium or S. Typhimurium). Note, the genus and species names (Salmonella enterica) are italicized but not the serotype/serovar name (Typhimurium). Because the taxonomic committees have yet to officially approve of the actual species name, this latter system is what is employed by the CDC (Brenner, et al. 2000 J. Clin. Microbiol. 38:2465-2467). Due to the concerns of both taxonomic priority and medical importance, some of these serotypes might ultimately receive full species designations (S.typhi would be the most notable).
Therefore, as used herein "Salmonella enterica or S. enterica" includes serovars Typhi, Typhimurium, Paratyphi, Choleraesuis, etc." However, appeals of the "official" name are in process and the taxonomic designations may change (S. choleraesuis is the species name that could replace S. enterica based solely on priority).
By "inducer" is meant an agent or solution which, when placed in contact with a cell or microorganism, increases transcription, or inhibitor and/or promoter clearance/fidelity, from a desired promoter.
As used herein, "nucleic acid" means DNA, RNA, or modified nucleic acids. Thus, the terminology "the nucleic acid of SEQ ID NO: X" or "the nucleic acid comprising the nucleotide sequence" includes both the DNA sequence of SEQ ID NO: X and an RNA sequence in which the thymidines in the DNA sequence have been substituted with uridines in the RNA sequence and in which the deoxyribose backbone of the DNA sequence has been substituted with a ribose backbone in the RNA sequence. Modified nucleic acids are nucleic acids having nucleotides or structures which do not occur in nature, such as nucleic acids in which the internucleotide phosphate residues with methylphosphonates, phosphorothioates, phosphoramidates, and phosphate esters. Nonphosphate internucleotide analogs such as siloxane bridges, carbonate bridges, thioester bridges, as well as many others known in the art may also be used in modified nucleic acids.
Modified nucleic acids may also comprise, α-anomeric nucleotide units and modified nucleotides such as 1,2-dideoxy-d-ribofuranose, 1,2-dideoxy-l- phenylribofuranose, and N, JV'-ethano-S-methyl-cytosine are contemplated for use in the present invention. Modified nucleic acids may also be peptide nucleic acids in which the entire deoxyribose-phosphate backbone has been exchanged with a chemically completely different, but structurally homologous, polyamide (peptide) backbone containing 2-aminoethyl glycine units. As used herein, the terminology "overexpress" refers to strains which possess either a level of the gene product which is higher than the level possessed by wild type cells or an affinity for a test compound which is lower than the affinity of a wild type gene product, while the terminology "underexpress" refers to strains which possess a level of the gene product which is lower than the level possessed by wild type cells or an affinity for a test compound which is higher than the affinity of a wild type gene product.
Summary of the Invention Some aspects of the present invention are described in the following numbered paragraphs:
1. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture. 2. The method of Paragraph 1, wherem said culture includes at least one strain which does not overexpresses a gene product which is essential for proliferation of said organism.
3. The method of Paragraph 1, wherein said strains which overexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.
4. The method of Paragraph 1, wherein said strains which overexpress said gene products a nucleic acid encodmg said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter. 5. The method of Paragraph 1, wherein said identification step comprises determining the nucleotide sequence of a nucleic acid encoding said gene product in said cell which proliferated more rapidly in said culture.
6. The method of Paragraph 1, wherein said identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture.
7. The method of Paragraph 6, wherein the products of said amplification reaction are labeled with a detectable dye.
8. The method of Paragraph 1, wherein said identification step comprises performing a hybridization procedure.
9. The method of Paragraph 1, wherein said identification step comprises contacting a nucleic acid array with a nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture.
10. The method of Paragraph 1, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa.
11. The method of Paragraph 1, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enter ococcus faecalis, Enterococcus faecium, Escherichia coli,
Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
12. The method of Paragraph 1, wherein said compound is obtained from a library of natural compounds.
13. The method of Paragraph 1, wherein said compound is obtained from a library of synthetic compounds. 14. The method of Paragraph 1, wherein said compound is present in a crude or partially purified state.
15. The method of Paragraph 1, further comprising determining whether said gene product in said strain which proliferated more rapidly in said culture has a counterpart in at least one other organism. 16. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture. 17. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
18. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-
15778 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
19. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherem each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consistmg of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ
ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-
3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture. 20. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consistmg of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of
SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture. 21. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-
14110 and 14945-15778 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture. 22. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an array of strains on a solid growth medium wherein each strain in overexpresses a different gene product which is essential for proliferation of said organism contacting said array of strains with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly on said solid medium.
23. The method of Paragraph 21, wherein at least one strain in said array does not overexpresses a gene product which is essential for proliferation of said organism.
24. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of strains wherem each strain overexpresses a different gene product which is essential for proliferation of said orgamsm; contacting each of said cultures with a different concentration of said compound ; and identifying the gene product which is overexpressed in a strain whose proliferation is inhibited by said compound. 25. The method of Paragraph 23, wherein at least one strain in said plurality of cultures does not overexpress a gene product which is essential for proliferation of said organism.
26. A method of profiling a compound's activity comprising performing the method of Paragraph 1 on a first culture using a first compound; performing the method of Paragraph 1 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture. 27. A method of profiling a first compound's activity comprising growing an array of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each strain in said array overexpresses a different gene product which is essential for proliferation of an organism and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium. 28. The method of any one of Paragraphs 26 and 27, wherein said first compound is present in a crude or partially purified state. 29. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
30. The method of Paragraph 29, wherein at least one strain in said culture does not underexpresses a gene product which is essential for proliferation of said organism.
31. The method of Paragraph 29, wherein said strains which underexpresess said gene products comprise a nucleic acid complementary to at least a portion of a gene encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter. 32. The method of Paragraph 29, wherein said strains which underexpress said gene products express an antisense nucleic acid complementary to at least a portion of a gene encoding said gene product which is essential for proliferation of said organism, wherein expression of said antisense nucleic acid reduces expression of said gene product in said strain.
33. The method of Paragraph 29, wherein said identification step comprises determining the nucleotide sequence of a nucleic acid encoding said gene product in said strain which proliferated more slowly.
34. The method of Paragraph 29, wherein said identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more slowly.
35. The method of Paragraph 34, wherein the products of said amplification reaction are labeled with a detectable dye.
36. The method of Paragraph 29, wherein said identification step comprises performing a hybridization procedure.
37. The method of Paragraph 29, wherein said identification step comprises contacting a nucleic acid array with a nucleic acid encoding said gene product in said cell which proliferated more slowly.
38. The method of Paragraph 29, wherein said organism is selected from the group consistmg of bacteria, fungi, protozoa.
39. The method of Paragraph 29, wherein said compound is obtained from a library of natural compounds.
40. The method of Paragraph 29, wherein said compound is obtained from a library of synthetic compounds. 41. The method of Paragraph 29, wherein said compound is present in a crude or partially purified state.
42. The method of Paragraph 29, further comprising determining whether said gene product in said strain which proliferated more slowly in said culture has a counterpart in at least one other organism. 43. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organismwherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
44. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-100Ϊ2, and
14111-14944 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
45. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
46. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture. 47. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111- 14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800,
3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture. 48. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version
3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
49. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism; and contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.
50. A method of profiling a compound's activity comprising performing the method of Paragraph 29 on a first culture using a first compound; performing the method of Paragraph 29 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture. 51. A method of profiling a first compound's activity comprising growing an array of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said array comprises a plurality of strains wherem each strain underexpresses a different gene product which is essential for proliferation of an organism and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium. 52. The method of any one of Paragraphs 49 and 50, wherein said first compound is present in a crude or partially purified state.
53. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of culturescomprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism; contacting each of said plurality of cultures with a varying concentration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism ; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.
54. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism. 55. The culture of Paragraph 54, wherein said strains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.
56. The culture of Paragraph 54, wherein said strains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.
57. The culture of Paragraph 54, wherein said culture is a culture of an organism selected from the group consistmg of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kejyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli,
Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis,
Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
58. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed.
59. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed.
60. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801- 3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed.
61. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed.
62. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860/5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consistmg of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed. 63. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-
14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861- 5915, 10013-14110 and 14945-15778 is overexpressed.
64. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism.
65. The culture of Paragraph 64, wherein said strains which underexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter. 66. The culture of Paragraph 64, wherein said strains which underexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.
67. The culture of Paragraph 64, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens,
Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides,
Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis,
Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
68. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed.
69. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is underexpressed.
70. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801- 3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed.
71. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:
8-3795 is underexpressed.
72. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherem said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed.
73. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861- 5915, 10013-14110 and 14945-15778 is underexpressed. 74. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
75. The method of Paragraph 74, wherein the nucleotide sequence of each of the genes encoding an overexpressed gene product has been altered by replacing the native promoters of said genes with promoters which facilitate overexpression of said gene products.
76. The method of Paragraph 74, wherein the nucleotide sequence of each of the genes encoding an overexpressed gene product has been altered by inserting a regulatory element into the native promoters of said genes with a promoter which facilitates overexpression of said gene products. 77. The method of Paragraph 76, wherein said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a transcriptional activator, a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA and an upstream activating sequence. 78. The method of Paragraph 74, wherein the step of identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene comprises performing an amplification reaction and detecting a unique amplification product corresponding to said gene. 79. The method of Paragraph 75, wherein the native promoter of each of the genes encoding a gene product essential for proliferation is replaced with the same promoter.
80. The method of Paragraph 75, wherein the native promoters of the genes encoding gene products essential for proliferation are replaced with a plurality of promoters selected to give a desired expression level for each gene product. 81. The method of Paragraph 75, wherein said promoters which replaced the native promoters in each strain comprise regulatable promoters.
82. The method of Paragraph 75, wherein said promoters which replaced the native promoters in each strain each strain comprise constitutive promoters. 83. The method of Paragraph 74, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa.
84. The method of Paragraph 74, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called
Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans,
Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
85. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
86. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product correspondmg to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916- 10012, and 14111-14944 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
87. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
88. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least
70%) nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs,: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of
SEQ ID NOs: 8-3795 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
89. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
90. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consistmg of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and
14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778 is overexpressed. 91. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherem the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
92. The method of Paragraph 91, wherein the nucleotide sequence of each of the genes encoding an underexpressed gene product has been altered by replacing the native promoters of said genes with promoters which facilitate underexpression of said gene products. 93. The method of Paragraph 91, wherein the nucleotide sequence of each of the genes encoding an underexpressed gene product has been altered by inserting a regulatory element into the native promoters of said genes with a promoter which facilitates underexpression of said gene products.
94. The method of Paragraph 93, wherein said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a transcriptional activator, a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA and an upstream activating sequence.
95. The method of Paragraph 91, wherein the step of identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture by detecting the unique product corresponding to said gene comprises performing an amplification reaction and detecting a unique amplification product corresponding to said gene.
96. The method of Paragraph 92, wherein the native promoter of each of the genes encoding a gene product essential for proliferation is replaced with the same promoter.
97. The method of Paragraph 92, wherem the native promoters of the genes encoding gene products essential for proliferation are replaced with a plurality of promoters selected to give a desired expression level for each gene product. 98. The method of Paragraph 92, wherein said promoters which replaced the native promoters in each strain comprise regulatable promoters.
99. The method of Paragraph 92, wherein said promoters which replaced the native promoters in each strain each strain comprise constitutive promoters.
100. The method of Paragraph 91, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa.
101. The method of Paragraph 91, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli,
Haemophilus inβuenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
102. The method of Paragraph 91, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed. 103. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes and wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene. 104. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
105. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene. 106. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version
2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and
14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consistmg of SEQ ID NOS.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene. 107. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherem the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes , wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using
FASTA version 3.0178 to a polypeptide selected from the group consisting of
SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene. 108. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
109. The method of Paragraph 108, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.
110. The method of Paragraph 108 wherein: said nucleic acid sample is divided into N aliquots; said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another. 111. The method of Paragraph 109, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.
112. The method of Paragraph 108, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.
113. The method of Paragraph 111, wherein the native promoters for each of said genes were replaced with the same regulatable promoter. 114. The method of Paragraph 111, wherem more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.
115. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
116. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherem said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111- 14944 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction. 117. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction. 118. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group
Ϊ consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using
BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ
ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8- 3795 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction. 119. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-
14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains ; and determining the lengths of the amplification products obtained in said amplification reaction.
120. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least
25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
121. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products.
122. The method of Paragraph 121, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.
123. The method of Paragraph 121, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.
124. The method of Paragraph 121, wherein the native promoters for each of said genes were replaced with the same regulatable promoter. 125. The method of Paragraph 121, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.
126. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs. : 8-3795 is overexpressed or underexpressed. 127. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed or underexpressed. 128. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherem said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed. 129. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherem said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product correspondmg to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed.
130. A method for identifying the target of a compound which inhibits the proliferation of an orgamsm comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ED NOS.: 3796-3800, 3806-4860, 5916- 10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed.
131. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second culture or collection of strains comprise a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
132. A method for determimng the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
133. The method of Paragraph 132, wherein one member of each primer pair for each of said genes is labeled with a detectable dye. 134. The method of Paragraph 132 wherein: said nucleic acid sample is divided into N aliquots; said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another. 135. The method of Paragraph 134, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products. 136. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 is overexpressed or underexpressed.
137. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherem said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916- 10012, and 14111-14944 is overexpressed or underexpressed.
138. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
139. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least
70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs. 8-3795, a gene product encoded by a nucleic acid having at least 70%> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ
ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-
3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed. 140. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and
14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed. 141. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherem said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25%> amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-
14110 and 14945-15778 is overexpressed or underexpressed.
142. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction.
143. The method of Paragraph 142, wherein said primer pairs are divided into at least two sets, each primer pair comprises a primer which is labeled with a distinguishable dye, and the distinguishable dye used to label each set of primer pairs is distinguishable from the dye used to label the other sets of primer pairs. 144. The method of Paragraph 142 wherein: said nucleic acid sample is divided into N aliquots; said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another. 145. The method of Paragraph 144, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.
146. The method of Paragraph 142, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.
147. The method of Paragraph 146, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.
148. The method of Paragraph 146, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.
149. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consistmg of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed or underexpressed.
150. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherem said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed or underexpressed.
151. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ
ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
152. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed. 153. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%) nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111- 14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed.
154. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and
14945-15778 is overexpressed or underexpressed.
Brief Description of the Drawings Figures 1 A and IB illustrate one method for identifying amplification products which are undeπepresented or oveπepresented in a culture. Figures 2A and 2B illustrate another method for identifying amplification products which are undeπepresented or oveπepresented in a culture.
Figure 3 illustrates the results of a hybridization analysis where the antisense nucleic acid expressed by a strain in the culture is not complementary to all or a portion of the gene encoding the target of the compound (i.e. a nonspecific strain).
Figure 4 illustrates the results of a hybridization analysis where the antisense nucleic acid expressed by a strain in the culture is complementary to all or a portion of the gene encoding the target of the compound, the hybridization intensity for that strain will be intimately coπelated with the concentration of the compound (i.e. a specific strain).
Figure 5 A illustrates a method for replacing a promoter using a promoter replacement cassette comprising a 5' region homologous to the sequence which is 5' of the natural promoter in the chromosome, the promoter which is to replace the chromosomal promoter and a 3' region which is homologous to sequences 3' of the natural promoter in the chromosome.
Figure 5B illustrates a method for replacing a promoter using a promoter replacement cassette comprising a nucleic acid encoding an identifiable or selectable marker disposed between the 5' region which is homologous to the sequence 5' of the natural promoter and the promoter which is to replace the chromosomal promoter and a transcriptional terminator 3' of the gene encoding an identifiable or selectable marker.
Figures 6A and 6B depict the GRACE method for constructing a gene disruption of one allele of a gene (CaKRE9), and promoter replacement of the second allele of the target gene, placing the second allele under conditional, regulated control by a heterologous promoter.
Figure 7 A depicts growth of a wild-type strain and a CaHIS3 heterozygote strain as compared with a CaHISS GRACE strain constitutively expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of inhibitory levels of 3-aminotriazole. Figure 7B depicts growth of a wild-type strain, a haploinsufficient CaHIS3 heterozygote strain, and a CaHIS3 GRACE strain constitutively expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of an intermediate level of 3-aminotriazole. Figure 7C depicts growth of a wild-type strain, a haploinsufficient CaHIS3 heterozygote strain, and a CaHIS3 GRACE strain minimally expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of an intermediate level of 3-aminotriazole.
Figure 7D demonstrates the hypersensitivity of the CaHIS3 GRACE strain minimally expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of an intermediate level of 3-aminotriazole. Figure 8 presents a Northern Blot Analysis of CaHIS3, CaALRl, CaCDC24 and CaKRE9 mRNA isolated from GRACE strains to illustrate elevated expression under non-repressing conditions. Figure 9 presents conditional gene expression , using GRACE technology, with KRE1, KRE5, KRE6 and KRE9.
Figure 10 presents conditional gene expression using GRACE technology with CaKREl, CaTUBl, CaALGl, CaAURl, CaFKSl and CaSAT2.
Figure 11 illustrates an oligonucleotide comprising a lac operator flanked on each side by 40 nucleotides homologous to the promoter is the promoter which drives expression of the yabB yabCftsLftsI murE genes in an operon for use in inserting the lac operator into the promoter.
Figure 12 illustrates a microtitration plate which contains antibiotic and inducer at gradient concentrations in a matrix format in 10 times excess quantity. Figure 13 illustrates the results of an experiment demonstrating that at appropriate concentrations of mducer, cells which overexpress the defB gene product were able to grow at elevated concentrations of the antibiotic actinonin
Figure 14 illustrates the results of an experiment demonstrating that at appropriate concentrations of inducer cells which overexpress the folA gene product were able to grow at elevated concentrations of the antibiotic trimethoprim. Figure 15 illustrates the results of an experiment demonstrating that overexpression of the fabl gene confers resistance to triclosan, which acts on the gene product of the fabl gene, but does not confer resistance to cerulenin, trimethoprim, or actinonin, each of which act on other gene products. Figure 16 illustrates the results of an experiment demonstrating that overexpression of the folA gene confers resistance to trimethoprim, which acts on the gene product of the folA gene but does not confer resistance to triclosan, cerulenin, or actinonin, each of which act on other gene products.
Figure 17 illustrates the results of an experiment demonstrating that overexpression of the defB gene confeπed resistance to actinonin, which acts on the gene product of the defB gene but does not confer resistance to cerulenin, trimethoprim, or triclosan, each of which act on other gene products.
Figure 18 illustrates the results of an experiment demonstrating that overexpression of the fabB gene confeπed resistance to cerulenin, which acts on the gene product of the fabB gene, β keto-acyl carrier protein synthase but does not confer resistance to triclosan, trimethoprim, or actinonin, each of which act on other gene products.
Figure 19 illustrates the results of experiments in which a mixture of nine strains was grown wells in a 96 well plate in medium containing various concentrations of inducer and a sufficient concentration of actinonin, cerulenin, triclosan or trimethoprim to inhibit the growth of strains which do not overexpress the targets of these antibiotics.
Detailed Description of the Prefeπed Embodiment The present invention utilizes collections or cultures of strains comprising strains which either overexpress a different gene product which is required for cellular proliferation or underexpress a different gene product which is required for cellular proliferation (i.e. at least some of the strains in the culture overexpress or underexpress a gene product required for cellular proliferation). In some embodiments, the present invention uses collections or cultures of strains comprising both strains which overexpress gene products required for cellular proliferation and strains which underexpress the same gene products required for cellular proliferation. Preferably, each of the strains present in the culture or collection either overexpresses or underexpresses a different gene product which is required for cellular proliferation (i.e. all of the strains in the culture overexpress or underexpress a gene product required for cellular proliferation). The gene product which is overexpressed or underexpressed in each strain may be any gene product which is required for cellular proliferation. The gene product may be a nucleic acid or a polypeptide. As used herein the term "culture" refers to a plurality of strains growing in a single aliquot of a liquid growth medium and the term "collection" refers to a plurality of strains each of which is growing in a separate aliquot of liquid growth medium or a different location on a solid growth medium.
In some embodiments, if desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product which is required for cellular proliferation. In this embodiment, the gene products which are overexpressed or underexpressed in one or more of the strains may be functionally related or functionally unrelated. This may facilitate the identification of compounds when two or more gene products share similar functions in the cell or where the cell has multiple biochemical pathways which lead to a particular end product.
Alternatively, if the gene product to be overexpressed or underexpressed is encoded by a gene which is part of an operon containing a plurality of genes, the desired gene may be overexpressed or underexpressed while the remaining genes in the operon are expressed at levels where they do not impact the ability of the cell to grow in the presence of a particular compound. For example, the desired gene may be placed under the control of a regulatable promoter, a transcriptional terminator may be placed 3' of the desired gene and a promoter, preferably a constitutive promoter, may be placed 3' of the transcriptional terminator and 5' of the remaining genes in the operon. In some embodiments, the culture or collection of strains may comprise a strain which overexpresses or underexpresses a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795. In some embodiments, the culture or collection of strains may comprise strains which in aggregate overexpress or underexpress at least two gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least 10 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least 20 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least
30 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least 50 gene products whose activity or level is inhibited by a nucleic acid selected from the group consistmg of SEQ ED NOS.: 8-3795, at least 100 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least
300 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795 or more than 300 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, wherein each strain in the culture or collection of strains overexpresses or underexpresses a single gene product whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs. 8- 3795. Alternatively, if desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ED NOs. 8-3795.
In other embodiments, the culture or collection of strains may comprise a strain which overexpresses or underexpresses a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944. In some embodiments, the culture or collection of strains may comprise strains which in aggregate overexpress or underexpress at least two gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, at least 10 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, at least 20 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916- 10012, and 14111-14944, at least 30 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, at least 50 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, at least 100 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916- 10012, and 14111-14944, at least 300 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 or more than 300 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ EN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, wherein each strain in the culture or collection of strains overexpresses or underexpresses a single gene product encoded by a nucleic acid selected from the group consisting of SEQ ID NOs. 3796-3800, 3806-4860, 5916-10012, and 14111- 14944. Alternatively, if desired, one or more strains in the culture or collection of strains may overexpress or underexpress more than one gene product encoded by a nucleic acid selected from the group consisting of SEQ ID NOs. 3796-3800, 3806-
4860, 5916-10012, and 14111-14944.
In some embodiments the culture or collection of strains comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ED NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed. In some embodiments, the culture or collection of strains may comprise strains which in aggregate overexpress or underexpress at least two gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 10 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 20 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 30 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 50 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 100 gene products comprising an amino acid sequence selected from the group consistmg of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 300 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 or more than 300 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945- 15778, wherein each strain in the culture or collection of strains overexpresses or underexpresses a single gene product selected from the group consisting of SEQ ID NOs. 3801-3805, 4861-5915, 10013-14110 and 14945-15778. Alternatively, if desired one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product selected from the group consistmg ofSEQ ID NOs. 3801-3805, 4861-5915, 10013-14110 and 14945-15778.
In other embodiments, the culture or collection of strains comprises a strain in which at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least
300 or more than 300 gene products encoded by a homologous coding nucleic acid as defined above is overexpressed or underexpressed. If desired the culture or collection of strains may comprise one or more strains which overexpress or underexpress more than one gene product encoded by a homologous coding nucleic acid. In further embodiments, the culture or collection of strains comprises a strain in which at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300 or more than 300 homologous polypeptidesas defined above is overexpressed or underexpressed. If desired the culture or collection of strains may comprise one or more strains which overexpress or underexpress more than one homologous polypeptide.
For example, in some embodiments, the culture or collection of strains comprises a strain or a group of strains in which in aggregate at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300, or more than 300 gene products selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ED NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed, wherein each strain overexpresses or underexpresses one gene product. If desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs:
8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795.
In further embodiments, the culture or collection of strains comprises a strain or a group of strains in which in aggregate at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300, or more than 300 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ED NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed, wherein each strain overexpresses or underexpresses one gene product.
If desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions. In additional embodiments, the culture or collection of strains comprises a strain or a group of strains in which in aggregate at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300, or more than 300 gene products comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-
5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed, wherein each strain overexpresses or underexpresses one gene product. If desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as deteπnined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945- 15778.
The methods of the present invention may be used to identify the targets of compounds which inhibit the proliferation of any desired cell or organism. In some embodiments, the methods of the present mvention are employed to identify the targets of compounds which inhibit the proliferation of bacteria, fungi, or protozoans. In further embodiments, the methods of the present invention are employed to identify the targets of compounds which inhibit the growth of an organism selected from the group consisting oϊAnaplasma marginale, Aspergillus fumigatus, Bacillus anthracis,
Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus inβuenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae,
Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
Overexpression may be obtained using a variety of techniques familiar to those skilled in the art. For example, overexpression may be obtained by operably linking a gene encoding the gene product to a promoter which transcribes a higher level of mRNA encoding or comprising the gene product than does a wild type cell. A variety of promoters may be used to overexpress the gene product. The promoters used to overexpress the gene product may be relatively strong promoters, promoters which possess a moderate level of activity, or relatively weak promoters and may be either constitutive or regulatable promoters. In some embodiments, several strains, each of which overexpresses the gene product to a different extent, may be used in order to optimize the degree of overexpression of the gene product.
In some embodiments, each of the gene products required for proliferation may be placed under the control of several different promoters of varying strengths to create several different strains which express the gene product at varying levels. The level of expression of the gene product in each of the strains is compared to that in wild type cells in order to identify a promoter which provides a desired level of expression relative to wild type cells (i.e. a desired level of overexpression or underexpression). The strain having the desired level of expression is then included in a culture or collection of strains to be contacted with a test compound as discussed below.
The promoter is selected to be active in the type of cell in which the gene product is to be expressed. For example, for overexpression of the gene product in mammalian cells, the gene encoding the gene product may be operably linked to promoters such as the SV40 promoter, the metallothionine promoter, the MMTV promoter, the RSV promoter, the tetP promoter, the adenovirus major late promoter or other promoters known to those skilled in the art. In yeast, the gene encoding the gene product may be operably linked to promoters such as the CYC1, ADHI, ADHII, GAL1, GALIO, PH05, PGK or other promoters used in the art. Similarly, in bacteria, the gene encoding the gene product may be operably linked to the , SP6, T3, tic promoter, lac promoter, temperature regulated lambda promoters, the Bacillus aprE and nprE promoters (U.S. Patent No. 5,387,521), the bacteriophage lambda PL and PR promoters (Renaut, et al., (1981) Gene 15: 81) the trp promoter (Russell, et al., (1982) Gene 20: 23), the tac promoter (de Boer et al., (1983) Proc. Natl. Acad. Sci. USA 80:
21), B. subtilis alkaline protease promoter (Stahl et al, (1984) J. Bacteriol. 158, 411- 418) alpha amylase promoter of 5. subtilis (Yang et al., (1983) Nucleic Acids Res. 11, 237-249) or B. amyloliquefaciens (Tarkinen, et al, (1983) J. Biol. Chem. 258, 1007- 1013), the neutral protease promoter from B. subtilis (Yang et al, (1984) J. Bacteriol 160, 15-21), T7 RNA polymerase promoter (Studier and Moffatt (1986) J Mol Biol
189(1): 113-30), B. subtilis xyl promoter or mutant tetR promoter active in bacilli (Geissendorfer & Hillen (1990) Appl. Microbiol. Biotechnol. 33:657-663} Staphylococcal enterotoxin D promoter (Zhang and Stewart (2000) J. Bacteriol 182(8):2321-5), cap8 operon promoter from Staphylococcus aureus (Ouyang et al (1999) J. Bacteriol. 181(8):2492-500), the lactococcal nisA promoter (Eichenbaum
(1998) Appl Environ Microbiol. 64(8):2763-9), promoters from in Acholeplasma laidlawii (Jarhede et al., (1995) Microbiology 141 ( Pt 9):2071-9), porA promoter of Neisseria meningitidis (Sawaya et al., (1999) Gene 233:49-57), the fbpA promoter of Neisseria gonorrhoeae (Forng et al., (1997) J. Bacteriol. 179:3047-3052), Corynebacterium diphtheriae toxin gene promoter (Schmitt and Holmes (1994) J.
Bacteriol. 176(4):1141-9), the hasA operon promoter from Group A Streptococci (Alberti et al., (1998) Mol Microbiol 28(2):343-53), the rpoS promoter of Pseudomonas putida (Kojic and Venturi (2001) J. Bacteriol. 183:3712-3720), and the EPTG inducible promoter in ρLEX5BA (Krause et al., J. Mol. Biol. 274: 365 (1997), In another embodiment, which may be useful in Staphylococcus aureus, the promoter is a novel inducible promoter system, XylT5, comprising a modified T5 promoter fused to the xylO operator from the xylA promoter of Staphylococcus aureus. This promoter is described in U.S. Patent Application Serial Number 10/032,393, the disclosure of which is incorporated herein by reference in its entirety. In another embodiment the promoter may be a two-component inducible promoter system in which the T7 RNA polymerase gene is integrated on the chromosome and is regulated by /αcUV5/ lacO (Brunschwig, E. and Darzins, A. 1992. Gene 111:35-41, the disclosure of which is incoφorated herein by reference in its entirety) and a T7 gene 10 promoter, which is transcribed by T7 RNA polymerase, is fused with a lacO operator. In another embodiment the promoter may be the promoters from the plasmids pEPEF3 or pEPEF14, which harbor xylose inducible promoters functional in E.faecalis, described in U.S. Patent Application Serial No. 10/032,393, the disclosure of which is incoφorated herein by reference in its entirety. Other promoters which may be used are familiar to those skilled in the art. In fungi, the gene encoding the gene product may be operably linked to the CaACTl promoter (Morschhauser, Mol.
Gen. Genet. 257: 412-420 (1998), the disclosure of which is incoφorated herein by reference in its entirety), the tetracycline regulatable promoter described in U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001, the disclosure of which is incoφorated herein by reference in its entirety, or the promoters described in U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 , the disclosure of which is incoφorated herein by reference in its entirety, or other promoters familiar to those skilled in the art. It will appreciated that other combinations of organisms and promoters may also be used in the present invention.
In some embodiments, overexpression may be achieved by using homologous recombination to replace the natural promoter which drives expression of the gene required for proliferation with a regulatable promoter. For example, the methods described in U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application
09/948,993 (the disclosure of which is incoφorated herein by reference in its entirety) and U.S. Patent Application 09/948,993 (the disclosure of which is incoφorated herein by reference in its entirety) may be used to place the gene required for proliferation under the control of a regulatable promoter. U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial Number 09/815,242 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial Number 09/492,709 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial Number 09/711,164 (the disclosure of which is incoφorated herein by reference in its entirety), and U.S. Patent Application Serial Number 09/741,669 (the disclosure of which is incoφorated herein by reference in its entirety) disclose genes and gene products required for proliferation which may be used in any of the methods of the present invention.
Briefly, in some embodiments of these methods, the cells may be haploid, such as bacterial cells. A linear promoter replacement cassette comprising a regulatable promoter flanked by nucleotide sequences having homology to the natural promoter is introduced into the cell. In some embodiments, the cassette also comprises a nucleotide sequence encoding a selectable marker or a marker whose expression is readily identified. The cassette may be a double stranded nucleic acid or a single stranded nucleic acid as described in U.S. Patent Application Serial Number 09/948,993, the disclosure of which is incoφorated herein by reference in its entirety. Upon homologous recombination, the natural promoter is replaced with the regulatable promoter, leaving the gene required for proliferation under the control of the regulatable promoter. Strains in which the gene required for proliferation is under control of the regulatable promoter are grown under conditions in which the regulatable promoter provides a level of the proliferation-required gene product which is above the level in a wild type cell. For example, the strains may be grown in the presence of an inducer which induces expression from the regulatable promoter, or under conditions in which the action of a repressor on the regulatable promoter is reduced or eliminated.
Alternatively, rather than replacing the native promoters each of the genes encoding gene product required for proliferation with a single desired replacement promoter, a plurality of replacement promoters which provide desired expression levels for the gene products to be overexpressed or underexpressed are used. The method is performed as described above except that rather than using a single labeled primer complementary to a nucleotide sequence within the single replacement promoter, a plurality of labeled primers complementary to suitable nucleotide sequences in the plurality of replacement promoters are used.
Alternatively, in embodiments in which the level or activity of gene products required for proliferation is reduced by transcribing an antisense nucleic acid complementary to at least a portion of the genes encoding such gene products, the strains may be designed such that the length of the nucleotide sequence encoding the antisense nucleic acid is different for each gene. Amplification reactions are performed as described above using primers at each end of the gene encodmg the antisense nucleic acid such that the amplification product corresponding to each gene has a unique length or a dye which allows it to be distinguished from other amplification products of the same length. Alternatively, the lengths of the nucleotide sequences encoding the antisense nucleic acids may not be unique for each gene, but the primers used in the amplification reaction may be selected such that the length of the amplification product coπesponding to each gene is unique.
In another embodiment, the native promoters may be replaced with promoters which include therein or adjacent thereto a unique nucleotide sequence which is distinct from that present in the other replacement promoters in the strains in the culture or collection of strains. In this embodiment, each promoter includes or has adjacent thereto a unique "tag" which may be used to identify strains which proliferate more rapidly or more slowly in the culture or collection of strains. The tag may be detected using hybridization based methods or amplification based methods, including the amplification method which generates amplification products having a unique size for each proliferation required gene described above.
Alternatively, the native promoter which directs the transcription of the gene required for proliferation may rendered regulatable by inserting a regulatory element into the chromosome of the cell via homologous recombination such that the regulatory element regulates the level of transcription from the promoter. The regulatory element may be may be an operator which is recognized by a repressor (e.g. lac, tet, araBAD repressors) or a nucleotide sequence which is recognized by a transcriptional activator. In some embodiments, the regulatory element may be a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA or an upstream activating sequence. A linear regulatory element insertion cassette comprising a regulatory element flanked by nucleotide sequences having homology to the natural promoter is introduced into the cell. In some embodiments, the cassette also comprises a nucleotide sequence encoding a selectable marker or a marker whose expression is readily identified. The cassette may be a double stranded nucleic acid or a single stranded nucleic acid as described in U.S. Patent Application Serial Number
09/948,993, the disclosure of which is incoφorated herein by reference in its entirety. Upon homologous recombination, the regulatory element is inserted into the chromosome, leaving the gene required for proliferation under the control of the regulatory element. Strains in which the gene required for proliferation is under control of the regulatory element are grown under conditions in which the regulatable promoter provides a level of the proliferation-required gene product which is above the level in a wild type cell. For example, the stiains may be grown in the presence of an inducer which induces expression from the promoter, or under conditions in which the action of a repressor on the promoter is reduced or eliminated. It will be appreciated that the amplification method which generates amplification products having a unique size for each proliferation required gene may be used to detect strains which are oveπepresented or undeπepresented in the culture or collection of stiains. For example, if desired, primers complementary to a nucleotide sequence within the regulatory element may be used in the amplification reaction. The promoter replacement cassette or regulatory element insertion cassette may be a double stranded nucleic acid, such as an amplicon generated through PCR or other amplification methods, or a single stranded nucleic acid, such as an oligonucleotide. For example, single stranded nucleic acids may be introduced into the chromosome using the methods described in Ellis et al., PNAS 98: 6742-6746, 2001, the disclosure of which is incoφorated herein by reference in its entirety. In some embodiments, the cell into which the promoter replacement cassette or regulatory element insertion cassette is introduced has an enhanced frequency of recombination. For example, the cells may lack or have a reduced level or activity of one or more exonucleases which would ordinarily degrade the DNA to be inserted into the chromosome. In further embodiments, the cells may both lack or have reduced levels of exonucleases and express or overexpress proteins involved in mediating homologous recombination. For example, if the methods are performed in Escherichia coli or other enteric prokaryotes, cells in which the activity of exonuclease V of the RecBCD recombination pathway, which degrades linear nucleic acids, has been reduced or eliminated, such as recB, recC, or recD mutants may be used. In some embodiments, the cells have mutations in more than one of the recB, recC, and recD genes which enhance the frequency of homologous recombination. For example the cells may have mutations in both the recB and recC genes.
The promoter replacement or regulatory element insertion methods may also be performed in Escherichia coli cells in which the activity of the RecET recombinase system of the Rac prophage has been activated, such as cells which carry an sbcA mutation. The RecE gene of the rac prophage encodes ExoVIII a 5 '-3' exonuclease, while the RecT gene of the Rac prophage encodes a single stranded DNA binding protein which facilitates renaturation and D-loop formation. Thus, the gene products of the RecE and RecT genes or proteins with analogous functions facilitate homologous recombination. The RecE and RecT genes lie in the same operon but are normally not expressed. However, sbcA mutants activate the expression the RecE and RecT genes. In some embodiments, the methods may be performed in cells which carry mutations in the recB and recC genes as well as the sbcA mutation. The RecE and RecT gene may be constitutively or conditionally expressed. For example, the methods may be performed in E. coli strain JC8679, which carries the sbcA23, recB21 and recC22 mutations.
In some embodiments, the methods may be performed in Escherichia coli cells in which recombination via the RecF pathway has been enhanced, such as cells which carry an sbcB mutation. It will be appreciated that the recE and recT gene products, or proteins with analogous functions may be conditionally or constitutively expressed in prokaryotic organisms other than E. coli. In some embodiments, these proteins may be conditionally or constitutively expressed in Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens,
Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus inβuenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides,
Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella βexneri, Shigella sonnei, Staphylococcus epidermidis,
Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, or Yersinia pestis. For example, plasmids encoding these gene products may be introduced into the organism. If desired, the coding sequences encoding these gene products may be optimized to reflect the codon preferences of the orgamsm in which they are to be expressed. Similarly, in some embodiments, the organism may contain mutations analogous to the recB, recC, recD, sbcA or sbcB mutations which enhance the frequency of homologous recombination.
In further embodiments, the promoter replacement or regulatory element insertion methods may be conducted in cells which utilize the Red system of bacteriophage lambda (λ) or analogous systems from other phages to enhance the frequency of homologous recombination. The Red system contains three genes, γ, β and exo whose products are the Gam, Bet and Exo proteins (see Ellis et al. PNAS 98:6742-6746, 2001, the disclosure of which is incoφorated herein by reference in its entirety). The Gam protein inhibits the RecBCD exonuclease V, thus permitting Beta and Exo to gain access to the ends of the DNA to be integrated and facilitating homologous recombination. The Beta protein is a single stranded DNA binding protein that promotes the annealing of a single stranded nucleic acid to a complementary single stranded nucleic acid and mediates strand exchange. The Exo protein is a double-stranded DNA dependent 5 '-3' exonuclease that leaves 3' overhangs that can act as substrates for recombination. Thus, constitutive or conditional expression of the λ red proteins or proteins having analogous functions facilitates homologous recombination.
It will be appreciated that the λ Beta, Gam and Exo proteins, or proteins with analagous functions may be expressed constitutively or conditionally in prokaryotic organisms other than E. coli. In some embodiments, these proteins may be conditionally or constitutively expressed in Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, or Yersinia pestis. For example, plasmids encodmg these gene products may be introduced into the organism. If desired, the coding sequences encoding these gene products may be optimized to reflect the codon preferences of the organism in which they are to be expressed.
In some embodiments, the cells may have an increased frequency of homologous recombination as a result of more than one of the aforementioned characteristics. In some embodiments, the enhanced frequency of recombination may be a conditional characteristic of the cells which depends on the culture conditions in which the cells are grown. For example, in some embodiments, expression of the λ Red Gam, Exo, and Beta proteins or recE and recT proteins may be regulated. Thus, the cells may have an increased frequency of homologous recombination as a result of any combination of the aforementioned characteristics. For example, in some embodiments, the cell may carry the sbcA and recBC mutations.
In some embodiments, a linear double stranded DNA to be inserted into the chromosome of the organism is introduced into an organism constitutively or conditionally expressing the recE and recT or the λ Beta, Gam and Exo proteins or proteins with analogous functions as described above. In some embodiments, the organism may be Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis,
Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus inβuenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus,
Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, or Yersinia pestis. In some embodiments, the double stranded DNA may be introduced into an organism having the recBC and sbcA mutations or analogous mutations.
In other embodiments, a single stranded DNA to be inserted into the chromosome of the organism is introduced into an organism expressing the λ Beta protein or a protein with an analogous function. In some embodiments the single stranded DNA is introduced into an organism expressing both the λ Beta and Gam proteins or proteins with analogous functions. In further embodiments, the single stranded DNA is introduced into an organism expressing the λ Beta, Gam and Exo proteins or proteins with analogous functions. The λ proteins or analogous protems may be expressed constitutively or conditionally. In some embodiments, the organism may be Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, or Yersinia pestis.
In some embodiments, the linear nucleic acid may be introduced into the chromosome of a first organism which has an enhanced frequency of homologous recombination and then transfeπed to a second organism which is less amenable to direct application of the present methods. For example, the linear nucleic acid may be introduced into the chromosome of E. coli and transfeπed into a second organism via conjugation or transduction. After introduction into the second organism, the nucleic acid is inserted into the chromosome of the second organism via homologous recombination, thereby effectively transferring the regulatory element from the chromosome of the first organism into the coπesponding location in the chromosome of the second organism.
In other embodiments, the cells may be diploid cells, such as fungal cells. In some embodiments, one copy of the gene encoding the proliferation-required gene product may be disrupted, rendering it inactive. In further embodiments, one copy of the gene encoding the proliferation-required gene product may be disrupted and the other copy of the gene encoding the proliferation-required gene product may be placed under the control of a regulatable promoter. Such strains may be generated by disrupting the first copy of the gene encoding the proliferation-required gene product by homologous recombination using a disruption cassette comprising a nucleotide sequence encoding an expressible dominant selectable marker flanked on each side by nucleic acids homologous to the target sequence to be disrupted. The second copy of the gene encoding the proliferation-required gene product may be placed under the control of a regulatable promoter by homologous recombination using a promoter replacement cassette comprising a regulatable promoter flanked on each side by nucleic acids homologous to the natural promoter for the proliferation-required gene. The promoter replacement cassette may also include a nucleotide sequence encoding a selectable marker located 5' of the regulatable promoter but between the nucleic acids homologous to the natural promoter.
In other embodiments, overexpression may be achieved by operably linking the gene required for proliferation to a desired promoter in a vector. The vector may be a vector which replicates extrachromosomally or a vector which integrates into the chromosome. For example, if the vector is to be used in bacterial cells, the vector may be a pBR322 based vector or a bacteriophage based vector such as PI or lambda. If the vector is to be used in Saccharomyces cerevisae, it may be a vector based on the 2 micron circle or a vector incoφorating a yeast chromosomal origin of replication. If the vector is to be used in mammalian cells, it may be a retroviral vector, SV40 based vector, a vector based on bovine papilloma virus, a vector based on adenovirus, or a vector based on adeno-associated virus. If the vector is to be used in Candida albicans it may be a vector comprising a promoter selected from the group consisting of the CaPCKl, MET25, MAL2, PH05, GAL1.10, STE2 or STE3 promoters. In some embodiments, the vectors described in the following publications (the disclosures of which are incoφorated herein by reference in their entireties) may be used: CIplO, an efficient and convenient integrating vector for Candida albicans. Murad et al., Yeast 16(4):325-7 (2000); Transforming vector pCPW7, Kvaal et al., : Infect Immun 67(12):6652-62 (1999); Transforming vector pCWOPlό, Kvaal et al., :
Infect Immun 65(l l):4668-75 (1997); double-ARS vector, pRMl, to be used for direct cloning in Ca by complementation of the histidine auxotrophy of strain CA9, Pla et al. Gene 165(1):115-20 (1995); pMK16, that was developed for the transformation of C. albicans and carries an ADE2 gene marker and a Candida autonomously replicating sequence (CARS) element promoting autonomous replication (cited in Sanglard and Fiechter Yeast 8(12): 1065-75 (1992); A plasmid vector (denoted pRC2312) was constructed, which replicates autonomously in Escherichia coli, Saccharomyces cerevisiae and Candida albicans. It contains LEU2, URA3 and an autonomously replicating sequence (ARS) from C. albicans, Cannon et al, Mol Gen Genet 235(2-3):453-7 (1992); Expression vector (CIplO-MAL2p) for use in Candida albicans has been constructed in which a gene of interest can be placed under the control of the CaMAL2 maltase promoter and stably integrated at the CaRPlO locus (Backen et al. Yeast 16(12): 1121-9 (2000)); (Volker, R. S, A. Sonneborn, C. E. Leuker, and J. F. Ernst. 1997. Efglp, an essential regulator of moφhogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating moφhogenetic processes in fungi. EMBO 16:1982- 1991.); and A C. albicans transformation vector containing the C. albicans URA3 gene, a Candida ARS sequence, and a portion of the Saccharomyces cerevisiae 2 microns circle containing the replication origin was constructed. Goshorn et al. Infect Immun 60(3):876-84 (1992). A variety of other vectors suitable for use in foregoing organisms or in any other organism in which the present mvention is to be practiced are familiar to those skilled in the art.
Underexpression of the gene product may be obtained in a variety of ways. For example, in one embodiment underexpression of the gene product may be achieved by providing an agent which reduces the level or activity of the gene product within the cell. In one embodiment, the agent may comprise an antisense nucleic acid which is complementary to a nucleic acid encoding the gene product or complementary to a portion of a nucleic acid encodmg the gene product. For example, a nucleic acid which encodes the antisense nucleic acid may be operably linked to a regulatable promoter. When grown under appropriate conditions, such as media containing an inducer of transcription or an agent which alleviates repression of transcription, the antisense nucleic acid is expressed in the cell, thereby reducing the level or activity of the gene product within the cell. In some embodiments, the concentration of the mducer of transcription or the agent which alleviates repression of transcription may be varied to provide optimal results. Such methods have been described in U.S. Patent Application Serial Number 09/815,242 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial Number 09/492,709 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial Number 09/711,164 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial Number 09/741,669 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is incoφorated herein by reference in its entirety), or U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 the disclosure of which is incoφorated herein by reference in its entirety). Each of the Patent
Applications cited in the preceding sentence disclose genes and gene products required for proliferation which may be used in any of the methods of the present invention.
Alternatively, underexpression of a gene product required for proliferation may be achieved by constructing stiains in which the expression of the gene product is under the control of a constitutive or regulatable promoter using methods such as those described above with respect to methods in which the gene product is overexpressed. To provide cells which underexpress the gene product, the cells are grown under conditions in which expression the gene product is expressed at a level lower than that of a wild type cell. For example, the cells may be grown under conditions in which a repressor reduces the level of transcription from the regulatable promoter.
In other embodiments, underexpression may be achieved by operably linking the gene required for proliferation to a desired promoter in a vector as described above with respect to embodiments in which gene products required for proliferation are overexpressed. In some embodiments, the vector may be present in cells in which the chromosomal copy or copies of the gene has been disrupted.
Gene products required for proliferation may be identified using a variety of methods, including the methods described in U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial Number 09/815,242 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial Number 09/492,709 (the disclosure of which is incoφorated herein by reference in its entirety), U.S. Patent Application Serial Number 09/711,164 (the disclosure of which is incoφorated herein by reference in its entirety), and U.S. Patent Application Serial Number 09/741,669 (the disclosure of which is incoφorated herein by reference in its entirety). Each of the proliferation-required genes and gene products disclosed in the applications listed in the preceding sentence may be used in any of the methods of the present invention. Briefly, in one embodiment, gene products required for proliferation are identified by operably linking random genomic fragments to a regulatable promoter in a vector. The random genomic fragments may be generated by a partial digestion with a restriction enzyme, mechanical shearing, using techniques such as sonication and nebulization, or DNAsel digestion. Upon induction of transcription from the promoter with a suitable agent, the expression vectors produce an RNA molecule corresponding to the inserted genomic fragments. En those instances where the inserted genomic fragments are in an antisense orientation with respect to the promoter, the transcript produced is complementary to at least a portion of an mRNA encoding a gene product such that they interact with sense mRNA produced from various genes and thereby decrease the translation efficiency or the level of the sense messenger RNA (mRNA) thus decreasing production of the protein encoded by these sense mRNA molecules. In cases where the sense mRNA encodes a protein required for proliferation, cells grown under inducing conditions fail to grow or grow at a substantially reduced rate. Additionally, in cases where the transcript produced is complementary to at least a portion of a non-translated RNA and where that non- translated RNA is required for proliferation, cells grown under inducing conditions also fail to grow or grow at a substantially reduced rate. In contrast, cells grown under non- inducing conditions grow at a normal rate. The genes to which the antisense nucleic acids are complementary are then identified and utilized in the methods of the present invention.
Alternatively, genes required for proliferation may be identified by replacing the natural promoter for the proliferation required gene with a regulatable promoter as described above. The growth of such strains under conditions in which the promoter is active or non-repressed is compared to the growth under conditions in which the promoter is inactive or repressed. If the strains fail to grow or grow at a substantially reduced rate under conditions in which the promoter is inactive or repressed but grow normally under conditions in which the promoter is active or non-repressed, then the gene which is operably linked to the regulatable promoter encodes a gene product required for proliferation. For example, proliferation-required genes and gene products identified using promoter replacement are described in U.S. Patent Application Serial Number 09/948,993 (the disclosure of which is incoφorated herein by reference in its entirety) U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is incoφorated herein by reference in its entirety), and U.S. Patent Application Serial Number 10/032,585 filed December 20,
2001 (the disclosure of which is incoφorated herein by reference in its entirety). Each of the genes and gene products described in the applications listed in the preceding sentence may be used in any of the methods of the present invention.
The present invention includes a method for identifying the gene product on which a compound which inhibits the proliferation of an organism acts. The method employs a culture which comprises a mixture of strains of the organism. At least some of the strains in the culture overexpress a different gene product which is required for the proliferation of the organism. Preferably, each of the strains in the culture overexpresses a different gene product which is required for proliferation of the organism (i.e. all of the strains in the culture overexpress a gene product which is required for proliferation of the organism). Such strains may be obtained using the methods described above. The culture may comprise any number of strains. For example the culture may comprise at least two strains, at least 10 strains, at least 20 strains, at least 30, strains, at least 50 strains, at least 100 strains, at least 300 strains or more than 300 strains. In some embodiments, the culture may comprise strains which in aggregate overexpress all or most of the gene products required for proliferation of the organism.
The culture is contacted with a compound which inhibits proliferation of the organism. The compound may be a candidate drug compound obtained from any source. For example, the compound may be a compound generated using combinatorial chemistry, a compound from a natural product library, or an impure or partially purified compound, such as a compound in a partially purified natural extract. The culture is contacted with a sufficient concentration of the compound to inhibit the proliferation of strains of the organism in the culture which do not overexpress the gene product on which the compound acts, such that strains which overexpress said gene product on which the compound acts proliferate more rapidly in the culture than strains which do not overexpress said gene product on which said compound acts. Thus, after a sufficient period of time, the strain which overexpresses the gene product on which the compound acts will be more prevalent in the culture than strains which do not overexpress the gene product on which the compound acts.
In a preferred embodiment, the growth conditions and incubation period are selected so that only one strain, the strain overexpressing the target of the compound, is recovered from the culture. Thus, in one embodiment, a plurality of cultures containing a plurality of strains each of which overexpresses a different proliferation- required gene product may be grown in the presence of varying concentrations of the compound. In addition to varying the compound concentrations, in embodiments where expression of the proliferation-required gene product is under the control of a regulatable promoter, the plurality of cultures may be grown at varying concentrations of an agent which regulates the level of expression from the promoter, such as an inducer or an agent which reduces the effect of a repressor on transcription from the promoter. It will be appreciated, that the cultures may be grown in liquid medium in the presence of the compound whose target is to be identified (and where appropriate in the presence of an agent which regulates the level of expression from the promoter) or alternatively, a liquid culture comprising the stiains which overexpress the proliferation-required gene products may be grown in the absence of the compound whose target is to be identified and then introduced onto a solid medium containing the compound (and, where appropriate, also containing an agent which regulates the level of expression from the promoter).
The identity of the overexpressed gene product which is the target of the compound may be determined using a variety of methods. For example, in some embodiments of the present invention, the nucleic acids present in the culture or collection of strains which was contacted with the compound may be compared to the nucleic acids present in a control culture or collection of strains which was not contacted with the compound to identify nucleic acids which are oveπepresented in the culture or collection of strains contacted with the test compound relative to the control culture or collection of stiains. Alternatively, in some embodiments, the nucleic acids present in a culture or collection of strains contacted with the test compound may be analyzed to identify those nucleic acids which are present without comparison to a control culture or collection of strains. In some embodiments of the present invention, the strains which proliferated more rapidly in the culture or collection of strains ,i.e. strains having an enhanced ability to proliferate in the presence of a test compound relative to other strains in the culture or collection of strains, are identified as follows. Amplification products which are correlated with each of the overexpressed genes and which are distinguishable from one another are obtained from a culture or collection grown in the presence of a test compound. The amplification products are distinguished from one another to determine whether a particular amplification product is oveπepresented in the culture or collection of strains. In some embodiments, the amplification products coπesponding to each of the gene products have lengths which permit them to be distinguished from one another. In another embodiment, one or more of the amplification products have similar or identical lengths but are distinguishable from one another based on a detectable agent, such as a dye, attached thereto. In some embodiments, amplification products which are oveπepresented are identified by comparing the amplification products from the culture or collection of stiains which was contacted with the test compound to the amplification products from a culture or collection of strains which was not contacted with the test compound. Alternatively, amplification products which are oveπepresented may be identified by simply identifying the amplification products obtained from the culture or collection of strains contacted with the test compound (for example, only one or a few strains may have proliferated in the presence of the test compound). The above methods for generating distinguishable amplification products may be used in conjunction with any of the methods for generating stiains which overexpress gene products required for proliferation described herein in order to facilitate the identification of strains which proliferate more rapidly or more slowly in the presence of a test compound. For example, in some embodiments of the present invention, each of the native promoters of each of the genes encoding gene product required for proliferation are replaced by a single desired replacement promoter. After growth of the culture or collection of strains containing the strains in which the promoters have been replaced in the presence of a test compound for a desired period of time, an amplification reaction is performed on nucleic acids obtained from the culture as follows.
The nucleic acids from the culture or collection of strains may be divided into at least two aliquots if desired. In a prefeπed embodiment the nucleic acids from the culture or collection of strains are divided into four aliquots. A single primer complementary to a nucleotide sequence within the replacement promoter , within the proliferation required genes, or within nucleic acid sequences adjacent to the promoter or proliferation required genes is divided into at least two portions, one portion for each aliquot of nucleic acids. Each portion of the primer is labeled with a distinct detectable dye, such as the 6FAM™, TET™, VIC™, HEX™, NED™, and PET™ dyes obtainable from Applied Biosystems (Foster City, CA). For example, the DS-31 or DS-33 dye sets available from Applied Biosystems (Foster City, CA) may be used to label the primers. Alternatively, the HEX™, NED, JOE, TMR and TET™ dyes available from Amersham Biosciences may be used. Thus, if the nucleic acids from the culture are not divided into aliquots, a single primer labeled with a single dye may be used. If the nucleic acids from the culture are divided into aliquots, at least 2, at least 3, at least 4 or more than 4 primers labeled with distinguishable dyes may be used. Each of the portions of labeled primers are added to each of the aliquots of the nucleic acids from the culture or collection of stiains such that each aliquot of nucleic acid receives a single labeled primer with a single detectable dye thereon. In some embodiments, the primers are divided into 3 portions, 4 portions or more than 4 portions, with each portion having a dye which is distinguishable from the dyes on the other portions thereon.
Each of the aliquots of nucleic acids also receives a set of unlabeled primers, with each of the unlabeled primers being complementary to a nucleotide sequence within the promoter, within a nucleotide sequence which is unique to one of the genes encoding gene products required for proliferation which were placed under the control of the replacement promoter, or within nucleotide sequences adjacent to the promoter or proliferation required genes. Each of the aliquots receives primers unique to 1/N proliferation required genes which were placed under the control of the replacement promoter, where N is the number of aliquots (i.e. if the culture or collection of stiams consisted of 100 strains in which a gene required for proliferation was placed under the control of the replacement promoter and was divided into four aliquots, then each of the four aliquots of nucleic acids from the culture or collection of strains would receive primers complementary to 25 of the genes). The unlabeled primers are selected so that each will yield an amplification product having a length distinguishable from the length of the amplification product produced with the other unlabeled primers. Preferably, the amplification products are between about 100- about 400 nucleotides in length, but any lengths which may be distinguished from each other may be used. In addition, in some of the embodiments some of the amplification products may have identical or very similar lengths but be distinguishable from one another due to labeling with distinguishable dyes.
A nucleic acid amplification reaction is conducted on each of the nucleic acid aliquots. The amplification products are then separated by length to identify amplification products having increased representation in the culture or collection of strains (i.e. amplification products derived from cells which proliferated more rapidly in the culture or collection of stiams). The amplification products are then coπelated with the corresponding genes to determine which strains proliferated more rapidly in the culture or collection of strains. If desired, amplification products having increased representation in the culture may be identified by comparing the amplification products obtained from a culture or collection of strains which was contacted with the compound to amplification products obtained from a control culture or collection of strains which was not contacted with the compound. Alternatively, if desired, the amplification products which are obtained from a culture which was contacted with the compound may be directly identified without comparison to a control culture which was not contacted with the compound.
For example, in some embodiments, the amplification products from each of the nucleic acid aliquots are pooled and subjected to capillary electrophoresis. The amplification products are detected by detecting the fluorescent dyes attached thereto and their lengths are determined to identify those amplification products having increased or decreased representation in the culture or collection of strains. Figures
IA and IB illustrate one embodiment of this method in which the absence of an amplification product from an amplification reaction performed on a culture comprising a plurality of strains underexpressmg genes required for proliferation indicates that a test compound acts on the gene coπesponding to the missing amplification product. It will be appreciated that the method may also be used to identify an amplification product which is oveπepresented in an amplification reaction conducted on a culture or collection of strains overexpressing genes required for proliferation because the test compound acted on the coπesponding gene.
Alternatively, in another embodiment, a first amplification reaction is performed on nucleic acids obtained from a culture or collection of strains which was contacted with the compound using a first primer complementary to a nucleotide sequence present upstream or downstream of all of the overexpressed genes (such as a primer complementary to a nucleotide sequence in a replacement promoter upstieam of all of the overexpressed genes) and a set of primers complementary to a nucleotide sequence unique to each of the stiains (such as a primer complementary to a nucleotide sequence within each of the proliferation-required genes). One of the two amplification primers for each of the proliferation required genes is labeled with a dye as described above. Preferably, the common primer complementary to a nucleotide sequence upstream or downstream of all of the overexpressed genes is labeled with the dye. The primers used in the amplification reaction are designed so that the amplification product coπesponding to each proliferation-required gene has a unique length or a dye which allows it to be distinguished from other amplification products of the same length. A second amplification reaction is conducted on a control culture or collection of strains which was not contacted with the compound using the same primers as in the first amplification reaction. The amplification products from the first amplification reaction are compared to those from the second amplification reaction to identify one or more amplification products which are overrepresented in the culture or collection of strains. For example, the amplification products from the first amplification reaction may be run in a separate lane of a polyacrylamide gel or a separate capillary than the amplification products from the second amplification reaction and the two lanes or capillaries are compared to one another. If desired, in the embodiment where the amplification products from the first amplification reaction are run in a different lane or capillary than the amplification products from the second amplification reaction, the same dye may be used to label the primers in the first and second amplification reactions. Alternatively, if desired, different dyes may be used to label the primers in the first and second amplification reactions. If desired, in the embodiment where the amplification products from the first amplification reaction are run in a different lane or capillary than the amplification products from the second amplification reaction, the same dye may be used to label the primers in the first and second amplification reactions. Alternatively, if desired, different dyes may be used to label the primers in the first and second amplification reactions.
Alternatively, in some embodiments, the primers in the second amplification reaction are labeled with a different dye which is distinguishable from the dye used in the first amplification reaction. In this embodiment, the amplification reactions may be pooled and run in the same lane on a polyacrylamide gel or in the same capillary and the products from each amplification reaction are compared by comparing the amount of each dye present for each amplification product. Figures 2A and 2B illustrate one embodiment of this method in which the absence of an amplification product from the amplification reaction performed on a culture comprising a plurality of strains underexpressmg genes required for proliferation which was contacted with the compound indicates that a test compound acts on the gene coπesponding to the missing amplification product. It will be appreciated that the method may also be used to identify an amplification product which is overrepresented in an amplification reaction conducted on a culture or collection of strains overexpressing genes required for proliferation because the test compound acted on the coπesponding gene.
If desired, rather than dividing the culture into aliquots, individual amplification reactions may be conducted on nucleic acids obtained from the culture or collection of strains. Each amplification reaction contains primers which will yield an amplification product specific for only one of the proliferation required genes. The resulting amplification products from each of the individual amplification reactions are pooled and amplification products having increased representation in the culture are identified as described above.
In another embodiment, a culture or collection of strains in which gene products required for proliferation are overexpressed from regulatable promoters which replaced the native promoters of the genes encoding these gene products is allowed to grow in the presence of a test compound for a desired number of generations. Preferably, the culture or collection of strains is allowed to grow in the presence of the test compound for at least 20 generations. Nucleic acids are isolated from the culture or collection of stiams and an amplification reaction is performed using a primer which is complementary to a nucleotide sequence within the replacement promoter(s) or a nucleotide sequence adjacent to the a 5' end thereof and primers which are complementary to a nucleotide sequence within the proliferation required genes or nucleotide sequences adjacent thereto. The resulting amplification product(s) is directly sequenced using a primer complementary to a nucleotide sequence within the replacement promoter.
In one embodiment of the present invention, the vector containing the nucleotide sequence encoding the proliferation-required gene product is obtained from a strain which proliferated more rapidly in the culture using methods such as plasmid preparation techniques. Nucleic acid sequencing techniques are then employed to determine the nucleotide sequence of the gene which was overexpressed. Alternatively, the identity of the overexpressed gene product which is the target of the compound may be determined by performing a nucleic acid amplification reaction, such as a polymerase chain reaction (PCR), to identify the nucleotide sequence of the gene which was overexpressed. For example, aliquots of a nucleic acid preparation, such as a purified plasmid, from the strain which is recovered from the culture may each be contacted with pairs of PCR primers which would amplify a different proliferation-required gene to determine which pair of primers yields an amplification product.
Yet another method for determining the identity of the gene product which is the target of the compound involves obtaining a nucleic acid array, such as a DNA chip, which contains each of the proliferation-required genes which were overexpressed in the strains in the culture. Each proliferation-required genes occupies a known location in the array. A nucleic acid preparation, such as a plasmid preparation, from the recovered strain is labeled with a detectable agent, such as radioactive or fluorescent moiety, and placed in contact with the nucleic acid array under conditions which permit the labeled nucleic acid to hybridize to complementary nucleic acids on the aπay. The location on the aπay to which the labeled nucleic acids hybridize is determined to identify the gene which was overexpressed in the recovered strain. If desired the hybridized nucleic acids from a culture which was contacted with the compound may be compared to the hybridized nucleic acids from a J control culture which was not contacted with the compound. Alternatively, the hybridized nucleic acids from a culture which was contacted with the compound may be directly identified without comparison to nucleic acids from a control culture.
In some embodiments of the invention, more than one strain may proliferate more rapidly in the presence of the compound. This may result from a variety of causes. For example, the concentration of the compound may not have been high enough to restrict proliferation only to cells which overexpress one gene product (i.e. the target gene product). While strains which overexpress the target gene product will be the most prevalent strain in the culture, other strains may also have proliferated. In such instances, the identity of the gene product in the strain which is most prevalent in the culture may be identified by quantitating the levels of each of the genes encoding proliferation-required proteins in the culture. This may be accomplished by quantitative PCR, DNA sequencing, hybridization, or aπay technology as described above. In other instances, multiple stiains will exhibit more rapid proliferation in the culture as a result of a common functional attribute. For example, the stiams which proliferate more rapidly may each overexpress a gene product with a common enzymatic activity, such as serine protease activity for example. Alternatively, the strains which proliferate more rapidly may each overexpress a gene product with a common functional domain, such as a cAMP binding domain. In such instances, the common attribute of the strains which proliferate more rapidly may provide information as to the mode of action of the compound or the biochemical activity of the target of the compound. For example, if all of the overexpressed genes in the strains which proliferated more rapidly are serine proteases, the compound acts by inhibiting serine protease activity and the target protein is a serine protease. If desired, the compound may be derivatized and the efficacy of the derivatized compound against each of the strains which proliferated more rapidly may be assessed as described herein in order to identify derivatives which are capable of interacting with a wide range of targets sharing a common activity or binding site (i.e. derivatives which have a greater ability to inhibit the proliferation of all the strains than the original compound) or to identify derivatives having greater specificity for a desired target (i.e. derivatives which have a greater specificity for one of the strains than the original compound). For example, it is possible that a nonessential gene product expressed in the cell might also bind to the initial test compound in addition to the gene product required for proliferation. In such an instance, it is desirable to obtain a derivative of the initial test compound which is specific for the gene product required for proliferation. In addition, it is possible that two gene products required for proliferation might bind to the initial test compound but specificity for one of the gene products is desired.
Ill In some embodiments, rather than employing a single culture which contains multiple strains each of which overexpresses a proliferation-required gene product, the methods of the present invention may be performed using an array of individual strains (i.e. a collection of strains) each of which overexpresses a different proliferation-required gene product. For example, individual strains each overexpressing a different proliferation-required gene product may be grown in different wells of a multiwell plate. Each well is contacted with the compound (and, where appropriate an agent which regulates the level of expression from the promoter). The level of proliferation of the strains in each of the wells is determined to identify a strain which proliferated more rapidly. The identity of the overexpressed gene product in the strain that proliferated more rapidly is determined as described above.
In another embodiment, individual strains each overexpressing a different proliferation-required gene product (i.e. a collection of strains) are grown at different locations on a solid medium, such as an agar plate. The medium contains the compound and where appropriate an agent which regulates the level of expression from the promoter). The level of proliferation of each of the strains is determined to identify a strain which proliferated more rapidly. The identity of the overexpressed gene product in the strain that proliferated more rapidly is determined as described above.
The above methods may be used to prioritize compound development or to determine whether the compound has been previously identified or whether the target of the compound is the target of a previously identified drug. In particular, if the product is a natural product, it is advantageous to determine whether it has been previously identified prior to investing significant effort in developing it. Thus, in some embodiments of the present invention, the target of a partially purified or purified natural product or a compound produced by combinatorial chemistry is identified using the methods described above and compared to the targets of known drugs. If the target is identical to that of a known drug, further development of the compound is halted. In some embodiments of the present mvention, an aπay of stiains each of which overexpresses a different gene product (i.e. a collection of strains) is grown on solid medium containing a compound to be evaluated. The location of each strain in the aπay and the gene product overexpressed by that strain is known. The pattern of colonies which grow in the presence of the compound is evaluated and compared to the pattern of colonies which grow in the presence of previously identified drugs. If the pattern of colonies which grow in the presence of the compound being evaluated is the same as the pattern of colonies which grow in the presence of a previously identified drug, further development of the compound is halted. In another embodiment, the sequence of the gene product in a strain which proliferated more rapidly in the assays described above is compared to the sequence of gene products from heterologous organisms to determine the likely spectrum of species whose growth would be inhibited by the compound. If the gene product has a high degree of homology to gene products from heterologous species, it is likely that the compound would also inhibit the growth of these heterologous species. Homology may be determined using any of a variety of methods familiar to those skilled in the art. For example, homology may be determined using a computer program such as BLASTP or FASTA. The ability of the compound to inhibit the growth of the heterologous species may then be confirmed by comparing the growth of cells of the heterologous species in the presence and absence of the compound.
In some embodiments, the present invention uses collections or cultures of strains comprising both strains which overexpress gene products required for cellular proliferation and strains which underexpress the same gene products required for cellular proliferation. The culture or collection of strains is contacted with a compound and the nucleic acids present in the culture or collection of stiains are analyzed. Preferably, nucleic acids derived from overexpressing strains can be distinguished from those derived from underexpressmg strains. For example, the overexpressing stiains may be obtained using promoter replacement as described above while the underexpressmg stiains may be obtained by expressing antisense nucleic acids. Accordingly, in one embodiment, amplification primers may be designed which will uniquely amplify nucleic acids from the overexpressing strains or the underexpressmg strains. If a compound acts on a gene product which was overexpressed and underexpressed in the culture, then the amplification product obtained from the strain in the culture or collection which overexpressed gene product will be oveπepresented in the culture or collection while the amplification product obtained from the strain which underexpressed the gene product will be undeπepresented in the culture or collection. If desired, nucleic acids from a culture or collection which was contacted with the compound may be compared to nucleic acids from a control culture or collection which was not contacted with the compound. Alternatively, nucleic acids from a culture or collection which was contacted with the compound may be directly analyzed without comparison to a control culture or collection.
Cuπent methods for identifying the target of compounds which inhibit cellular proliferation are laborious and time consuming. The above methods may be employed to allow the targets of a large number of compounds to be rapidly identified. In such methods, the methods described above are simultaneously performed for each of a large number of compounds. For example, the compounds may be members of a library of compounds generated using combinatorial chemistry or members of a natural product library. In such methods, a plurality of cultures each comprising a plurality of strains each of which overexpresses a different gene product required for proliferation or a plurality of collections of individual strains each of which overexpresses a different gene product required for proliferation is obtained. Each culture or collection of strains is contacted with a different compound in the library and the target of the compound is identified as described above. In another embodiment of the present invention, the gene product on which a compound which inhibits the proliferation of an organism acts is identified using a culture which comprises a mixture of strains of the organism including strains which underexpress a different gene product which is required for proliferation of the organism (i.e. at least some of the strains in the culture underexpress a gene product which is required for proliferation of the organism). Preferably, each of the strains in the culture underexpress a different a gene product which is required for the proliferation of the organism (i.e. all of the strains in the culture underexpress a gene product which is required for the proliferation of the organism). Such strains may be obtained using the methods described above. The culture may comprise any number of strains. For example the culture may comprise at least two strains, at least 10 strains, at least 20 strains, at least 30, strains, at least 50 stiains, at least 100 stiains, at least 300 strains or more than 300 strains. In some embodiments, the strains in the culture in aggregate may underexpress all or most of the gene products required for proliferation of the organism. The culture is contacted with a compound which inhibits proliferation of the organism. The compound may be a candidate drug compound obtained from any source. For example, the compound may be a compound generated using combinatorial chemistry, a compound from a natural product library, or an impure or partially purified compound, such as a compound in a partially purified natural extract. The culture is contacted with a sufficient concentration of the compound to inhibit the proliferation of strains of the organism in the culture which underexpress the gene product on which the compound acts, such that strains which do not underexpress the gene product on which the compound acts proliferate more rapidly in the culture than strains which do underexpress said gene product on which said compound acts. Thus, after a sufficient period of time, the strain which underexpresses the gene product on which the compound acts will be less prevalent in the culture than strains which do not underexpress the gene product on which the compound acts. In one embodiment, the growth conditions and incubation period are selected so that only one strain, the strain underexpressmg the target of the compound, proliferates at a reduced rate in the culture. In another embodiment, the growth conditions may be selected so that the strain underexpressmg the target of the compound is not recovered from the culture. Thus, in one embodiment, a plurality of cultures containing a plurality of strains each of which underexpresses a different proliferation-required gene product may be grown in the presence of varying concentrations of the compound. In addition to varying the compound concentrations, in embodiments where expression of the proliferation-required gene product is under the control of a regulatable promoter, the plurality of cultures may be grown at varying concentrations of an agent which regulates the level of expression from the promoter, such as an inducer or an agent which reduces the effect of a repressor on transcription from the promoter. It will be appreciated, that the cultures may be grown in liquid medium in the presence of the compound whose target is to be identified (and where appropriate in the presence of an agent which regulates the level of expression from the promoter) or alternatively, a liquid culture comprising the strains which underexpress the proliferation-required gene products may be grown in the absence of the compound whose target is to be identified and then introduced onto a solid medium containing the compound (and, where appropriate, also containing an agent which regulates the level of expression from the promoter).
The identity of the underexpressed gene product which is the target of the compound may be determined using a variety of methods. For example, in some embodiments of the present invention, the nucleic acids present in the culture or collection of strains which was contacted with the compound may be compared to the nucleic acids present in a control culture or collection of strains which was not contacted with the compound to identify nucleic acids which are undeπepresented in the culture or collection of strains contacted with the test compound relative to the control culture or strains. Alternatively, in some embodiments, the nucleic acids present in a culture or collection of strains contacted with the test compound may be analyzed to identify those nucleic acids which are missing or present at reduced levels without comparison to a control culture or collection of strains.
In some embodiments of the present invention, the strains which proliferated more slowly in the culture or collection of strains ,i.e. strains having an decreased ability to proliferate in the presence of a test compound or which do not proliferate in the presence of a test compound, are identified as follows. Amplification products which are coπelated with each of the underexpressed genes and which are distinguishable from one another are obtained from a culture or collection grown in the presence of a test compound. The amplification products are distinguished from one another to determine whether a particular amplification product is undeπepresented in the culture or collection of strains. In some embodiments, the amplification products coπesponding to each of the gene products have lengths which permit them to be distinguished from one another. In another embodiment, one or more of the amplification products have similar or identical lengths but are distinguishable from one another based on a detectable agent, such as a dye, attached thereto. In some embodiments, amplification products which are undeπepresented are identified by comparing the amplification products from the culture or collection of strains which was contacted with the test compound to the amplification products from a culture or collection of strains which was not contacted with the test compound. Alternatively, amplification products which are undeπepresented in the culture or collection of stiains may be identified simply by determining which amplification products are missing or present at reduced levels in the culture or collection of strains. The above methods for generating distinguishable amplification products may be used in conjunction with any of the methods for generating strains which underexpress gene products required for proliferation described herein in order to facilitate the identification of strains which proliferate more slowly in the presence of a test compound.
For example, in some embodiments of the present invention, each of the native promoters of each of the genes encodmg gene product required for proliferation are replaced by a single desired replacement promoter. After growth of the culture or collection of strains containing the strains in which the promoters have been replaced in the presence of a test compound for a desired period of time, an amplification reaction is performed on nucleic acids obtained from the culture as follows. The nucleic acids from the culture or collection of strains are divided into at least two aliquots. In a prefeπed embodiment the nucleic acids from the culture or collection of strains are divided into four aliquots. A single primer complementary to a nucleotide sequence within the replacement promoter , within the proliferation required genes, or within nucleic acid sequences adjacent to the promoter or proliferation required genes is divided into four groups Each group is labeled with a distinct detectable dye, such as the 6FAM™, TET™, VIC™, HEX™, NED™, and PET™ dyes obtainable from Applied Biosystems (Foster City, CA). For example, the DS-31 or DS-33 dye sets available from Applied Biosystems (Foster City, CA) may be used to label the primers. Each of the groups of labeled primers are added to each of the aliquots of the nucleic acids from the culture or collection of strains such that each aliquot of nucleic acid receives a single labeled primer with a single detectable dye thereon.
Each of the aliquots of nucleic acids also receives a set of unlabeled primers, with each of the unlabeled primers being complementary to a nucleotide sequence within the promoter, within a nucleotide sequence which is unique to one of the genes encoding gene products required for proliferation which were placed under the control of the replacement promoter, or within nucleotide sequences adjacent to the promoter or proliferation required genes. Each of the aliquots receives primers unique to 1/N proliferation required genes which were placed under the control of the replacement promoter, where N is the number of aliquots (i.e. if the culture or collection of strains consisted of 100 strains in which a gene required for proliferation was placed under the control of the replacement promoter and was divided into four aliquots, then each of the four aliquots of nucleic acids from the culture or collection of strains would receive primers complementary to 25 of the genes). The unlabeled primers are selected so that each will yield an amplification product having a length distinguishable from the length of the amplification product produced with the other unlabeled primers. Preferably, the amplification products are between about 100- about 400 nucleotides in length, but any lengths which may be distinguished from each other may be used. In addition, in some of the embodiments some of the amplification products may have identical or very similar lengths but be distinguishable from one another due to labeling with distinguishable dyes.
A nucleic acid amplification reaction is conducted on each of the nucleic acid aliquots. The amplification products are then separated by length to identify amplification products decreased representation or which are absent in the culture or collection of strains. The amplification products are then correlated with the coπesponding genes to determine which strains proliferated more slowly in the culture or collection of strains. If desired, amplification products having decreased representation in the culture may be identified by comparing the amplification products obtained from a culture or collection of stiains which was contacted with the compound to amplification products obtained from a control culture or collection of stiains which was not contacted with the compound. Alternatively, if desired, the amplification products which are missing or present at reduced levels in a culture which was contacted with the compound may be directly identified without comparison to a control culture which was not contacted with the compound. For example, in some embodiments, the amplification products from each of the nucleic acid aliquots are pooled and subjected to capillary electrophoresis. The amplification products are detected by detecting the fluorescent dyes attached thereto and their lengths are determined to identify those amplification products having decreased representation in the culture or collection of strains. Figures IA and IB illustrate one embodiment of this method in which the absence of an amplification product from an amplification reaction performed on a culture comprising a plurality of stiains underexpressmg genes required for proliferation indicates that a test compound acts on the gene coπesponding to the missing amplification product.
Alternatively, in another embodiment, a first amplification reaction is performed on nucleic acids obtained from a culture or collection of strains which was contacted with the compound using a first primer complementary to a nucleotide sequence present upstieam or downstream of all of the overexpressed genes (such as a primer complementary to a nucleotide sequence in a replacement promoter upstream of all of the overexpressed genes) and a set of primers complementary to a nucleotide sequence unique to each of the strains (such as a primer complementary to a nucleotide sequence within each of the proliferation-required genes). One of the two amplification primers for each of the proliferation required genes is labeled with a dye as described above. Preferably, the common primer complementary to a nucleotide sequence upstream or downstream of all of the overexpressed genes is labeled with the dye. The primers used in the amplification reaction are designed so that the amplification product coπesponding to each proliferation-required gene has a unique length. A second amplification reaction is conducted on a control culture or collection of stiains which was not contacted with the compound using the same primers as in the first amplification reaction. The amplification products from the first amplification reaction are compared to those from the second amplification reaction to identify one or more amplification products which are undeπepresented in the culture or collection of strains. For example, the amplification products from the first amplification reaction may be run in a separate lane of a polyacrylamide gel or a separate capillary than the amplification products from the second amplification reaction and the two lanes or capillaries are compared to one another.
Alternatively, in some embodiments, the primers in the second amplification reaction are labeled with a different dye which is distinguishable from the dye used in the first amplification reaction. In this embodiment, the amplification reactions may be pooled and run in the same lane on a polyacrylamide gel or in the same capillary and the products from each amplification reaction are compared by comparing the amount of each dye present for each amplification product. Figures 2A and 2B illustrate one embodiment of this method in which the absence of an amplification product from the amplification reaction performed on a culture comprising a plurality of strains underexpressmg genes required for proliferation which was contacted with the compound indicates that a test compound acts on the gene corresponding to the missing amplification product.
If desired, rather than dividing the culture into aliquots, individual amplification reactions may be conducted on nucleic acids obtained from the culture or collection of stiains. Each amplification reaction contains primers which will yield an amplification product specific for only one of the proliferation required genes. The resulting amplification products from each of the individual amplification reactions are pooled and amplification products having decreased representation in the culture are identified as described above.
In one embodiment the representation of each strain in the culture may be assessed by hybridizing detectably labeled nucleic acids encoding the proliferation- required gene products, or portions thereof, obtained from the culture to an aπay comprising nucleic acids encoding the gene products required for proliferation or portions thereof. Each nucleic acid encoding a gene product required for proliferation or portion thereof occupies a known location on the array. The signal from each location on the aπay is quantitated to identify those nucleic acids encoding a proliferation-required gene product which are undeπepresented in the culture. If desired the hybridized nucleic acids from a culture which was contacted with the compound may be compared to the hybridized nucleic acids from a control culture which was not contacted with the compound. Alternatively, the hybridized nucleic acids from a culture which was contacted with the compound may be directly analyzed without comparison to nucleic acids from a control culture.
Alternatively, each strain underexpressmg a gene product required for proliferation may be constructed to contain a unique nucleic acid sequence (refeπed to herein as a "tag"). The tag may be included in the chromosome of each strain or in an extiachromosomal vector. For example, the tag could be included in a vector encoding an antisense nucleic acid complementary to a gene encoding a gene product required for proliferation or a portion of such a gene or the tag may be included in the antisense nucleic acid itself . The representation of each strain in the culture may be assessed by performing an amplification reaction using primers complementary to each of the tags and quantitating the levels of the resulting amplification products to identify a tag which is undeπepresented or absent from the culture. Since each tag coπesponds to one strain, the strain which is undeπepresented or absent from the culture may be identified. If desired the tags present in a culture which was contacted with the compound may be compared to the tags present in a control culture which was not contacted with the compound. Alternatively, the tags present in a culture which was contacted with the compound may be analyzed without comparison to a control culture.
It will be appreciated that, if desired, unique tags may also be used in embodiments in which gene products required for proliferation are overexpressed. In some aspects of such embodiments, the tags may be within or adjacent to the promoter which drives expression of the gene encoding the gene product. In such embodiments, the gene product which is overexpressed in strains which proliferate more rapidly in the culture may be identified by detecting the presence or amount of the unique tag coπesponding to that gene product in the culture. In some embodiments of the invention, more than one strain may proliferate less rapidly in the presence of the compound. This may result from a variety of causes. For example, the concentration of the compound may not have been high enough to reduce the proliferation only in cells which underexpress one gene product (i.e. the target gene product). While strains which underexpress the target gene product will be the least prevalent strain in the culture, other strains may also be undeπepresented. In such instances, the identity of the gene product in the strain which is least prevalent in the culture (or not recovered from the culture) may be identified by quantitating the levels of each of the genes encoding proliferation- required proteins in the culture. This may be accomplished by quantitative PCR, DNA sequencing, hybridization, or array technology as described above.
In other instances, multiple stiains will exhibit less rapid proliferation in the culture as a result of a common functional attribute. For example, the strains which proliferate less rapidly (or the strains which are not recovered from the culture) may each underexpress a gene product with a common enzymatic activity, such as serine protease activity for example. Alternatively, the strains which proliferate less rapidly
(or the strains which are not recovered from the culture) may each underexpress a gene product with a common functional domain, such as a cAMP binding domain. In such instances, the common attribute of the strains which proliferate less rapidly (or the strains which are not recovered from the culture) may provide information as to the mode of action of the compound or the biochemical activity of the target of the compound. For example, if all of the underexpressed genes in the strains which proliferated less rapidly are serine proteases, the compound acts by inhibiting serine protease activity and the target protem is a serine protease. If desired, the compound may be derivatized and the efficacy of the derivatized compound against each of the strains which proliferated more rapidly may be assessed as described herein in order to identify derivatives which are capable of interacting with a wide range of targets sharing a common activity or binding site (i.e. derivatives which have a greater ability to inhibit the proliferation of all the strains than the original compound) or to identify derivatives having greater specificity for a desired target (i.e. derivatives which have a greater specificity for one of the strains than the original compound).
In some embodiments, rather than employing a single culture which contains multiple strains each of which underexpresses a proliferation-required gene product, the methods of the present invention may be performed using an aπay of individual strains (i.e. a collection of strains) each of which underexpresses a different proliferation-required gene product. For example, individual strains each underexpressmg a different proliferation-required gene product may be grown in different wells of a multiwell plate. Each well is contacted with the compound (and, where appropriate an agent which regulates the level of expression from the promoter). The level of proliferation of the strains in each of the wells is determined to identify a strain which proliferated less rapidly or which did not proliferate at all.
The identity of the underexpressed gene product in the strain that proliferated less rapidly or which did not proliferate at all is determined as described above.
In another embodiment, individual stiains each underexpressmg a different proliferation-required gene product (i.e. a collection of stiams) are grown at different locations on a solid medium, such as an agar plate. The medium contains the compound and, where appropriate, an agent which regulates the level of expression from the promoter. The level of proliferation of each of the strains is determined to identify a strain which proliferated less rapidly (or a strain which is not recovered from the culture). The identity of the underexpressed gene product in the strain that proliferated less rapidly (or the strain which is not recovered from the culture) is determined as described above.
The above methods may be used to prioritize compound development or to determine whether the compound has been previously identified or whether the target of the compound is the target of a previously identified drug. In particular, if the product is a natural product is advantageous to determine whether it has been previously identified prior to investing significant effort in developing it. Thus, in some embodiments of the present mvention, the target of a partially purified or purified natural product or a compound produced by combinatorial chemistry is identified using the methods described above and compared to the targets of known drugs. If the target is identical to that of a known drug, further development of the compound is halted.
In some embodiments of the present invention, an array of strains each of which underexpresses a different gene product (i.e. a collection of strains) is grown on solid medium containing a compound to be evaluated. The location of each strain in the aπay and the gene product underexpressed by that strain is known. The pattern of colonies which grow less rapidly or fail to grow in the presence of the compound is evaluated and compared to the pattern of colonies which grow less rapidly or fail to grow in the presence of previously identified drugs. If the pattern of colonies which grow less rapidly or fail to grow in the presence of the compound being evaluated is the same as the pattern of colonies which grow less rapidly or fail to grow in the presence of a previously identified drug, further development of the compound is halted.
In another embodiment, the nucleotide sequence of the gene product in a strain which proliferated less rapidly (or a strain which was not recovered from the culture) in the assays described above is compared to the nucleotide sequence of gene products from heterologous organisms to determine the likely spectrum of species whose growth would be inhibited by the compound. If the gene product has a high degree of homology to gene products from heterologous species, it is likely that the compound would also inhibit the growth of these heterologous species. Homology may be determined using any of a variety of methods familiar to those skilled in the art. For example, homology may be determined using a computer program such as BLASTP or FASTA. The ability of the compound to inhibit the growth of the heterologous species may then be confirmed by comparing the growth of cells of the heterologous species in the presence and absence of the compound. Cuπent methods for identifying the target of compounds which inhibit cellular proliferation are laborious and time consuming. The above methods may be employed to allow the targets of a large number of compounds to be rapidly identified. In such methods, the methods described above are simultaneously performed for each of a large number of compounds. For example, the compounds may be members of a library of compounds generated using combinatorial chemistry or members of a natural product library. In such methods, a plurality of cultures each comprising a plurality of strains each of which underexpresses a different gene product required for proliferation or a plurality of collections of individual strains each of which underexpresses a different gene product required for proliferation is obtained. Each culture or collection of stiains is contacted with a different compound in the library and the target of the compound is identified as described above.
In some embodiments of the present invention, strains are constructed in which a nucleic acid complementary to a gene encoding a gene product required for proliferation, or a portion thereof (i.e. a nucleic acid encoding an antisense nucleic acid to the gene encoding the proliferation required gene product or a portion thereof) is operably linked to a regulatable promoter. A culture comprising a plurality of such stiains wherein each strain expresses an antisense nucleic acid against a different gene product required for proliferation is grown in the presence of varying levels of a compound which inhibits proliferation and in the presence of varying levels of an agent which regulates the level of transcription from the regulatable promoter. Nucleic acids samples are obtained from the culture, detectably labeled and hybridized to a solid support comprising nucleic acids containing the genes encoding the proliferation-required gene products or a portion thereof. The level of hybridization is quantitated for each nucleic acid encodmg each of the proliferation-required gene products to determine the rate at which each of the strains proliferated in the culture. If the antisense nucleic acid expressed by a strain in the culture is not complementary to all or a portion of the gene encoding the target of the compound (i.e. a nonspecific strain), then the hybridization intensity for that strain will not be coπelated with the concentration of the compound (see Figure 3), while if the antisense nucleic acid expressed by a strain in the culture is complementary to all or a portion of the gene encoding the target of the compound, the hybridization intensity for that strain will be intimately coπelated with the concentration of the compound (see Figure 4). In this manner, the target of the compound may be identified. It will be appreciated that, as described above, rather than growing the strains in a single culture, each strain may be grown in a different location on a solid medium or in a different well of a multiwell plate.
The methods described herein may be performed simultaneously for each of a plurality of compounds which inhibit proliferation to allow the targets of those compounds to be rapidly identified.
Some embodiments of the present invention are summarized on the following pages. It will be appreciated that the present invention may be applied to cultures of any organism and that any gene product required for proliferation of the organism may be overexpressed or underexpressed. Accordingly, the organisms and gene products described in the following examples are exemplary only and do not limit the scope of the present mvention.
Genes required for cellular proliferation for use in the present invention may be identified from the literature, may be identified using the following methods, or may be identified using other methods familiar to those skilled in the art. In some embodiments of the present invention, the culture comprises a strain in which a gene product selected from the group consisting of a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, and a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed. The identification of nucleic acids comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, nucleic acids comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944 and gene products comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 are described below.
EXAMPLE 1
Identification of Genes Required for Cellular Proliferation by Expressing Antisense RNA Complementary to at least a Portion of a Gene Required for Cellular
Proliferation Random genomic fragments are obtained from the organism in which it is desired to identify genes required for cellular proliferation. The random genomic fragments may be generated by a partial digestion with a restriction enzyme, mechanical shearing, using techniques such as somcation and nebulization, or DNAsel digestion. The random genomic fragments are operably linked to a regulatable promoter in a vector. In those instances where the inserted genomic fragments are in an antisense orientation with respect to the promoter, the transcript produced is complementary to at least a portion of an mRNA encoding a gene product such that they interact with sense mRNA produced from various genes and thereby decrease the translation efficiency or the level of the sense messenger RNA (mRNA) thus decreasing production of the protein encoded by these sense mRNA molecules. In cases where the sense mRNA encodes a protein required for proliferation, cells grown under inducing conditions fail to grow or grow at a substantially reduced rate. Additionally, in cases where the transcript produced is complementary to at least a portion of a non-translated RNA and where that non-tianslated RNA is required for proliferation, cells grown under inducing conditions also fail to grow or grew at a substantially reduced rate. In contrast, cells grown under non-inducing conditions grow at a normal rate. The genes to which the antisense nucleic acids are complementary are then identified and utilized in the methods of the present invention. Thus, to identify genes required for cellular proliferation, the extent of proliferation of cells containing the vectors in the presence of an agent which induces transcription from the regulatable promoter is compared to the extent of proliferation of cells in the absence of the agent. Those cells which grow well in the absence of the agent but exhibit significantly reduced proliferation in the presence of the agent contain a vector encoding an antisense nucleic acid complementary to at least a portion of a gene required for cellular proliferation.
The above method was used to identify genes required for cellular proliferation in Escherichia coli, Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis. The identification of genes required for cellular proliferation in E. coli, Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis has been described in the following U.S. Patent Applications, the disclosures of which are incoφorated herein by reference in their entireties: U.S.
Patent Application Serial Number 09/815,242, filed March 21, 2001; U.S. Patent Application Serial Number 09/492709, filed January 27, 2000; U.S. Patent Application Serial Number 09/711164, filed November 9, 2000; U.S. Patent Application Serial Number 09/741669, filed December 19, 2000 and U.S. Patent Application Serial Number 09/815,242 filed March 21, 2001. The methods used to identify these genes required for cellular proliferation are summarized below.
To identify genes required for proliferation of E. coli, random genomic fragments were cloned into the IPTG-inducible expression vector pLEX5BA (Krause et al, J. Mol. Biol. 274: 365 (1997), the disclosure of which is incoφorated herein by reference in its entirety) or a modified version of pLEX5BA, pLEX5BA-3' in which a synthetic linker containing a T7 terminator was ligated between the Pstl and Hindlll sites of pLEX5BA. In particular, to construct pLEX5BA-3', the following oligonucleotides were annealed and inserted into the Pstl and Hindlll sites of pLEX5BA: 5 ' -GTCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCCTTGAGGGGTTTTTTGA-
3 ' ( SEQ ID NO : 15779 ) CORRECT SEQ ID NOS TO BE INSERTED THROUGHOUT THE APPLICATION
5 ' -AGCTTC7AAAAAACCCCTCAAGGACCCGTTTAGAGGCCCCAAGGGGTTAT GCTAGACTGCA-3 ' ( SEQ ID NO : 15780 ) Random fragments of E. coli genomic DNA were generated by DNAsel digestion or sonication, filled in with T4 polymerase, and cloned into the Smal site of pLEX5BA or pLEX5BA-3'. Upon activation or induction, the promoter transcribed the random genomic fragments
To study the effects of transcriptional induction in liquid medium, growth curves were carried out by back diluting cultures 1 :200 into fresh media with or without 1 mM EPTG and measuring the OD450 every 30 minutes (min). To study the effects of transcriptional induction on solid medium, 102, 103, 104, 105, 106, 107 and 108 fold dilutions of overnight cultures were prepared. Aliquots of from 0.5 to 3 μl of these dilutions were spotted on selective agar plates with or without 1 mM IPTG. After overnight incubation, the plates were compared to assess the sensitivity of the clones to EPTG.
Of the numerous clones tested, some clones were identified as containing a sequence that inhibited E. coli growth after EPTG induction. Accordingly, the gene to which the inserted nucleic acid sequence coπesponds, or a gene within the operon containing the inserted nucleic acid, is required for proliferation in E. coli.
Nucleic acids required for proliferation of Staphylococcus aureus, Salmonella typhimurium, and Klebsiella pneumoniae were identified as follows. Randomly generated fragments of Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis genomic DNA were transcribed from inducible promoters.
In the case of Staphylococcus aureus, a novel inducible promoter system, XylT 5, comprising a modified T5 promoter fused to the xylO operator from the xylA promoter of Staphylococcus aureus was used. The promoter is described in U.S.
Patent Application Serial Number 10/032,393, the disclosure of which is incoφorated herein by reference in its entirety. Transcription from this hybrid promoter is inducible by xylose.
Randomly generated fragments of Salmonella typhimurium genomic DNA were transcribed from an IPTG inducible promoter in pLEX5BA (Krause et al, J. Mol. Biol. 274: 365 (1997) or a derivative thereof. Randomly generated fragments of Klebsiella pneumoniae genomic DNA were expressed from an IPTG inducible promoter in pLEX5BA-Kan. To construct pLEX5BA-kan, pLEX5BA was digested to completion with Clai order to remove the bla gene. Then the plasmid was treated with a partial Notl digestion and blunted with T4 DΝA polymerase. A 3.2 kbp fragment was then gel purified and ligated to a blunted 1.3 kbp kan gene from pKanπ. Kan resistant transformants were selected on Kan plates. Orientation of the kan gene was checked by Smal digestion. A clone, which had the kan gene in the same orientation as the bla gene, was used to identify genes required for proliferation of Klebsiella pneumoniae.
Randomly generated fragments of Pseudomonas aeruginosa genomic DΝA were transcribed from a two-component inducible promoter system. Integrated on the chromosome was the T7 RΝA polymerase gene regulated by lac JV5l lacO (Brunschwig, E. and Darzins, A. 1992. Gene 111:35-41, the disclosure of which is incoφorated herein by reference in its entirety). On a separate plasmid, a T7 gene 10 promoter, which is transcribed by T7 RΝA polymerase, was fused with a lacO operator followed by a multiple cloning site.
In the case of Staphylococcus aureus, a shotgun library of Staphylococcus aureus genomic fragments was cloned into the vector pXyIT5-P15a, which harbors the XylT5 inducible promoter. The vector was linearized at a unique BamHI site immediately downstream of the XyIT5 promoter/operator. The linearized vector was treated with shrimp alkaline phosphatase to prevent reclosure of the linearized ends. Genomic DΝA isolated from Staphylococcus aureus strain RΝ450 was fully digested with the restriction enzyme Sau3A , or , alternatively, partially digested with DNase I and "blunt-ended" by incubating with T4 DNA polymerase. Random genomic fragments between 200 and 800 base pairs in length were selected by gel purification. The size-selected genomic fragments were added to the linearized and dephosphorylated vector at a molar ratio of 0.1 to 1, and ligated to form a shotgun library. The ligated products were transformed into electrocompetent E. coli strain XLl-Blue MRF' (Stratagene) and plated on LB medium with supplemented with carbenicillin at 100 μg/ml. Resulting colonies numbering 5 x 10s or greater were scraped and combined, and were then subjected to plasmid purification. The purified library was then transformed into electrocompetent
Staphylococcus aureus RN4220. Resulting tiansformants were plated on agar containing LB + 0.2% glucose (LBG medium) + chloramphenicol at 15 μg/ml (LBG+CM15 medium) in order to generate 100 to 150 platings at 500 colonies per plating. The colonies were subjected to robotic picking and arrayed into wells of 384 well culture dishes. Each well contained lOOμl of LBG + CM 15 liquid medium.
Inoculated 384 well dishes were incubated 16 hours at 37°C, and each well was robotically gridded onto solid LBG + CM 15 medium with or without 2% xylose. Gridded plates were incubated 16 hours at 37°C, and then manually scored for aπayed colonies that were growth-compromised in the presence of xylose. Arrayed colonies that were growth-sensitive on medium containing 2% xylose, yet were able to grow on similar medium lacking xylose, were subjected to further growth sensitivity analysis as follows: Colonies from the plate lacking xylose were manually picked and inoculated into individual wells of a 96 well culture dish containing LBG + CM15, and were incubated for 16 hours at 37°C. These cultures were robotically diluted 1/100 into fresh medium and allowed to incubate for 4 hours at 37°C, after which they were subjected to serial dilutions in a 384 well aπay and then gridded onto media containing 2% xylose or media lacking xylose. After growth for 16 hours at 37°C, the aπays that resulted on the two media were compared to each other. Clones that grew similarly at all dilutions on both media were scored as a negative and were no longer considered. Clones that grew on xylose medium but failed to grow at the same serial dilution on the non-xylose plate were given a score based on the differential, i.e. should the clone grow at a serial dilution of 104 or less on the xylose plate and grow at a serial dilution of 108 or less on the non-xylose plate, then the coπesponding clone received a score of "4" representing the log difference in growth observed. For Salmonella typhimurium and Klebsiella pneumoniae growth curves were carried out by back diluting cultures 1:200 into fresh media containing 1 mM EPTG or media lacking EPTG and measuring the OD450 every 30 minutes (min). To study the effects of transcriptional induction on solid medium, 102, 103, 104, 105, 106, 107 and 108 fold dilutions of overnight cultures were prepared. Aliquots of from 0.5 to 3 μl of these dilutions were spotted on selective agar plates with or without 1 mM EPTG. After overnight incubation, the plates were compared to assess the sensitivity of the clones to EPTG.
Nucleic acids involved in proliferation of Pseudomonas aeruginosa were identified as follows. Randomly generated fragments of Pseudomonas aeruginosa genomic DNA were transcribed from a two-component inducible promoter system. Integrated on the chromosome was the T7 RNA polymerase gene regulated by lac\JV5l lacO (Brunschwig, E. and Darzins, A. 1992. Gene 111:35-41). On an expression plasmid there was a T7 gene 10 promoter, which is transcribed by T7 RNA polymerase, fused with a lacO operator followed by a multiple cloning site.
Transcription from this hybrid promoter is inducible by IPTG. Should the genomic DNA downstream of the promoter contain, in an antisense orientation, at least a portion of an mRNA encoding a gene product involved in proliferation, then induction of expression from the promoter will result in detectable inhibition of proliferation. A shotgun library oϊ Pseudomonas aeruginosa genomic fragments was cloned into the vectors pEP5, pEP5S, or other similarly constructed vectors which harbor the TllacO inducible promoter. The vector was linearized at a unique Smαl site immediately downstream of the Υlla' cO promoter/operator. The linearized vector was treated with shrimp alkaline phosphatase to prevent reclosure of the linearized ends. Genomic DNA isolated from Pseudomonas aeruginosa strain PAOl was partially digested with DNase I and "blunt-ended" by incubating with T4 DNA polymerase. Random genomic fragments between 200 and 800 base pairs in length were selected by gel purification. The size-selected genomic fragments were added to the linearized and dephosphorylated vector at a molar ratio of 2 to 1, and ligated to form a shotgun library. The ligated products were transformed into electrocompetent E. coli strain XLl-Blue MRF' (Stratagene) and plated on LB medium with carbenicillin at 100 μg/ml or Streptomycin 100 μg/ml. Resulting colonies numbering 5 x 10s or greater were scraped and combined, and were then subjected to plasmid purification. The purified library was then transformed into electrocompetent Pseudomonas aeruginosa strain PAOl. Resulting transformants were plated on LB agar with carbenicillin at 100 μg/ml or Streptomycin 40 μg/ml in order to generate 100 to 150 platings at 500 colonies per plating. The colonies were subjected to robotic picking and aπayed into wells of 384 well culture dishes. Each well contained 100 μl of LB + CB 100 or Streptomycin 40 liquid medium. Inoculated 384 well dishes were incubated 16 hours at room temperature, and each well was robotically gridded onto solid LB + CB100 or Streptomycin 40 medium with or without 1 mM IPTG. Gridded plates were incubated 16 hours at 37°C, and then manually scored for aπayed colonies that were growth-compromised in the presence of IPTG. Arrayed colonies that were growth-sensitive on medium containing 1 mM
IPTG, yet were able to grow on similar medium lacking IPTG, were subjected to further growth sensitivity analysis as follows: Colonies from the plate lacking IPTG were manually picked and inoculated into individual wells of a 96 well culture dish containing LB + CB100 or Streptomycin 40, and were incubated for 16 hours at 30°C. These cultures were robotically diluted 1/100 into fresh medium and allowed to incubate for 4 hours at 37°C, after which they were subjected to serial dilutions in a 384 well aπay and then gridded onto media with and without 1 mM EPTG. After growth for 16 hours at 37°C, the aπays of serially diluted spots that resulted were compared between the two media. Clones that grew similarly at all dilutions on both media were scored as a negative and were no longer considered. Clones that grew on
IPTG medium but failed to grow at the same serial dilution on the non-IPTG plate were given a score based on the differential, i.e. should the clone grow at a serial dilution of 104 or less on the IPTG plate and grow at a serial dilution of 108 or less on the EPTG plate, then the coπesponding clone received a score of "4" representing the log difference in growth observed. Following the identification of those vectors that, upon induction, negatively impacted Pseudomonas aeruginosa growth or proliferation, the inserts or nucleic acid fragments contained in those vectors were isolated for subsequent characterization. Vectors of interest were subjected to nucleic acid sequence determination. Nucleic acids involved in proliferation of E. faecalis were identified as follows. Randomly generated fragments of genomic DNA were expressed from the vectors pEPEF3 or pEPEF14, which contain the CP25 or P59 promoter, respectively, regulated by the xyl operator/repressor. Should the genomic DNA downstream of the promoter contain, in an antisense orientation, at least a portion of a mRNA encoding a gene product involved in proliferation, then induction of expression from the promoter will result in detectable inhibition of proliferation.
A shotgun library of E. faecalis genomic fragments was cloned into the vector pEPEF3 or pEPEF14, which harbor xylose inducible promoters. The vector was linearized at a unique Smal site immediately downstream of the promoter/operator. The linearized vector was treated with alkaline phosphatase to prevent reclosure of the linearized ends. Genomic DNA isolated from E. faecalis strain OG1RF was partially digested with DNase I and "blunt-ended" by incubating with T4 DNA polymerase. Random genomic fragments between 200 and 800 base pairs in length were selected by gel purification. The size-selected genomic fragments were added to the linearized and dephosphorylated vector at a molar ratio of 2 to 1, and ligated to form a shotgun library.
The ligated products were transformed into electrocompetent E. coli strain TOP10 cells (Invitrogen) and plated on LB medium with erythromycin (Erm) at 150 μg/ml. Resulting colonies numbering 5 x 105 or greater were scraped and combined, and were then subjected to plasmid purification.
The purified library was then transformed into electrocompetent E. faecalis strain OG1RF. Resulting transformants were plated on Todd-Hewitt (TH) agar with erythromycin at 10 μg/ml in order to generate 100 to 150 platings at 500 colonies per plating. The colonies were subjected to robotic picking and aπayed into wells of 384 well culture dishes. Each well contained 100 μl of THB + Erm 10 μg/ml. Inoculated 384 well dishes were incubated 16 hours at room temperature, and each well was robotically gridded onto solid TH agar + Erm with or without 5% xylose. Gridded plates were incubated 16 hours at 37°C, and then manually scored for aπayed colonies that were growth-compromised in the presence of xylose. Aπayed colonies that were growth-sensitive on medium containing 5% xylose, yet were able to grow on similar medium lacking xylose, were subjected to further growth sensitivity analysis. Colonies from the plate lacking xylose were manually picked and inoculated into individual wells of a 96 well culture dish containing THB + Erm 10, and were incubated for 16 hours at 30°C. These cultures were robotically diluted 1/100 into fresh medium and allowed to incubate for 4 hours at 37°C, after which they were subjected to serial dilution on plates containing 5% xylose or plates lacking xylose. After growth for 16 hours at 37°C, the aπays of serially diluted spots that resulted were compared between the two media. Colonies that grew similarly on both media were scored as a negative and corresponding colonies were no longer considered. Colonies on xylose medium that failed to grow to the same serial dilution compared to those on the non-xylose plate were given a score based on the differential. For example, colonies on xylose medium that only grow to a serial dilution of -4 while they were able to grow to -8 on the non-xylose plate, then the coπesponding transformant colony received a score of "4" representing the log difference in growth observed.
Following the identification of those vectors that, upon induction, negatively impacted E. faecalis growth or proliferation, the inserts or nucleic acid fragments contained in those expression vectors were isolated for subsequent characterization. The inserts in the vectors of interest were subjected to nucleotide sequence determination.
It will be appreciated that other restriction enzymes and other endonucleases or methodologies may be used to generate random genomic fragments. In addition, random genomic fragments may be generated by mechanical shearing. Sonication and nebulization are two such techniques commonly used for mechanical shearing of DNA. EXAMPLE 2
Nucleotide Sequence Determination of Identified Clones Transcribing Nucleic Acid Fragments with Detrimental Effects on Proliferation of Escherichia coli. Staphylococcus aureus, Salmonella typhimurium. Klebsiella pneumoniae. Pseudomonas aerueinosa or Enterococcus faecalis
The nucleotide sequences of the nucleic acid sequences which inhibited the growth of Escherichia coli were determined using plasmid DNA isolated using QIAPREP (Qiagen, Valencia, CA) and methods supplied by the manufacturer. The primers used for sequencing the inserts were 5' - TGTTTATCAGACCGCTT - 3' (SEQ ED NO: 15781) and 5' - ACAATTTCACACAGCCTC - 3' (SEQ ED NO: 15782).
These sequences flank the polylinker in pLEX5BA.
The nucleotide sequences of the nucleic acid sequences which inhibited the growth of Staphylococcus aureus were deteπnined as follows. Staphylococcus aureus were grown in standard laboratory media (LB or TB with 15 ug/ml Chloramphenicol to select for the plasmid). Growth was carried out at 37°C overnight in culture tubes or 2 ml deep well microtiter plates.
Lysis of Staphylococcus aureus was performed as follows. Cultures (2-5 ml) were centrifuged and the cell pellets resuspended in 1.5 mg/ml solution of lysostaphin (20 μl/ml of original culture) followed by addition of 250 μl of resuspension buffer (Qiagen). Alternatively, cell pellets were resuspended directly in 250 μl of resuspension buffer (Qiagen) to which 5-20 μl of a 1 mg/ml lysostaphin solution were added.
DNA was isolated using Qiagen miniprep kits or Wizard (Qiagen) miniprep kits according to the instructions provided by the manufacturer. The genomic DNA inserts were amplified from the purified plasmids by PCR as follows.
1 μl of Qiagen purified plasmid was put into a total reaction volume of 25 μl Qiagen Hot Start PCR mix. For Staphylococcus aureus, the following primers were used in the PCR reaction: pXylT5F: CAGCAGTCTGAGTTATAAAATAG (SEQ ID NO: 15783) LexL TGTTTTATCAGACCGCTT (SEQ ID NO: 15784)
Similar methods were conducted for Salmonella typhimurium and Klebsiella pneumoniae. For Salmonella typhimurium and Klebsiella pneumoniae the following primers were used: 5' - TGTTTTATCAGACCGCTT - 3' (SEQ ED NO: 15784) and
5'-ACAATTTCACACAGCCTC-3' (SEQ ID NO: 15782
PCR was carried out in a PE GenAmp with the following cycle times:
Step l. 95° C 15 min
Step 2. 94° C 45 sec Step 3. 54° C 45 sec
Step 4. 72° C 1 minute
Step 5. Return to step 2, 29 times
Step 6. 72° C IO minutes
Step 7. 4° C hold The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
For Pseudomonas aeruginosa, plasmids from transformant colonies that received a dilution plating score of "2" or greater were isolated to obtain the genomic
DNA insert responsible for growth inhibition as follows. Pseudomonas aeruginosa were grown in standard laboratory media (LB with carbenicillin at 100 μg/ml or
Streptomycin 40 μg/ml to select for the plasmid). Growth was carried out at 30°C overnight in 100 ul culture wells in microtiter plates. To amplify insert DNA 2 ul of culture were placed into 25 ul Qiagen Hot Start PCR mix. PCR reactions were in 96 well microtiter plates. For plasmid pEP5S the following primers were used in the PCR reaction:
T7L1+: GTCGGCGATATAGGCGCCAGCAACCG (SEQ ID NO: 15785) pStrA3: ATAATCGAGCATGAGTATCATACG (SEQ ID NO: 15786)
PCR was carried out in a PE GenAmp with the following cycle times:
Step 1. 95° C 15 min Step 2. 94° C 45 sec Step 3. 54° C 45 sec
Step 4. 72° C 1 minute
Step 5. Return to step 2, 29 times
Step 6. 72° C 10 minutes Step 7. 4° C hold
The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
The purified PCR products were then directly cycle sequenced with Qiagen
Hot Start PCR mix. The following primers were used in the sequencing reaction: T7/L2: ATGCGTCCGGCGTAGAGGAT (SEQ ID NO: 15787)
PCR was carried out in a PE GenAmp with the following cycle times:
Step l. 94° C 15 min
Step 2. 96° C 10 sec
Step 3. 50° C 5 sec Step 4. 60 C 4 min
Step 5. Return to step 2, 24 times
Step 6. 4° C hold
The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions. For E. faecalis, plasmids from transformant colonies that received a dilution plating score of "2" or greater were isolated to obtain the genomic DNA insert responsible for growth inhibition as follows. E.faecalis were grown in THB 10 μg/ml
Erm at 30°C overnight in 100 ul culture wells in microtiter plates. To amplify insert
DNA 2 ul of culture were placed into 25 μl Qiagen Hot Start PCR mix. PCR reactions were in 96 well microtiter plates. The following primers were used in the
PCR reaction: pXylT5: CAGCAGTCTGAGTTATAAAATAG (SEQ ID NO: 15783) and the pEP/pAKl primer.
PCR was carried out in a PE GenAmp with the following cycle times: Step l. 95° C 15 min Step 2. 94° C 45 sec Step 3. 54° C 45 sec Step 4. 72° C 1 minute Step 5. Return to step 2, 29 times Step 6. 72° C IO minutes
Step 7. 4° C hold
The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
The purified PCR products were then directly cycle sequenced with Qiagen Hot Start PCR mix. The following primers were used in the PCR reaction: pXylT5: CAGCAGTCTGAGTTATAAAATAG (SEQ ID NO: 15783) PCR was carried out in a PE GenAmp with the following cycle times: Step l. 94° C 15 min Step 2. 96° C 10 sec Step 3. 50° C 5 sec
Step 4. 60° C 4 min Step 5. Return to step 2, 24 times Step 6. 4° C hold
The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
The amplified genomic DNA inserts from each of the above procedures were subjected to automated sequencing. The nucleotide sequences of the antisense nucleic acids which inhibited the proliferation of Escherichia coli, Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis are listed in the accompanying Sequence Listing as SEQ ID
NOs.: 8-3795.
EXAMPLE 3 Comparison Of Isolated Nucleic Acids to Known Sequences The nucleic acid sequences of the subcloned E. coli genomic fragments obtained from the vectors discussed above were compared to known E. coli sequences in GenBank using BLAST version 1.4 or version 2.0.6 using the following default parameters: Filtering off, cost to open a gap=5, cost to extend a gap=2, penalty for a mismatch in the blast portion of run=-3, reward for a match in the blast portion of run=l, expectation value (e)=10.0, word size=ll, number of one-line descriptions=100, number of alignments to show (B)=l 00. BLAST is described in Altschul, J Mol Biol. 215 :403-
10 (1990), the disclosure of which is incoφorated herein by reference in its entirety. The vectors were found to contain nucleic acid sequences in both the sense and antisense orientations. The presence of known genes, open reading frames, and ribosome binding sites was determined by comparison to public databases holding genetic information and various computer programs such as the Genetics Computer Group programs FRAMES and CODONPREFERENCE. Clones were designated as "antisense" if the cloned fragment was oriented to the promoter such that the RNA transcript produced was complementary to the expressed mRNA (or non-translated RNA) from a chromosomal locus. Clones were designated as "sense" if they coded for an RNA fragment that was identical to a portion of a wild type mRNA from a chromosomal locus.
The nucleotide sequences of the subcloned fragments from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis obtained from the expression vectors discussed above were compared to known sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis and other microorganisms as follows. First, to confirm that each clone originated from one location on the chromosome and was not chimeric, the nucleotide sequences of the selected clones were compared against the Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis genomic sequences to align the clone to the coπect position on the chromosome. The NCBI BLASTN v 2.0.9 program was used for this comparison, and the incomplete Staphylococcus aureus genomic sequences licensed from TIGR, as well as the NCBI nonredundant GenBank database were used as the source of genomic data. Salmonella typhimurium sequences were compared to sequences available from the Genome Sequencing Center (http://genome.wustl.edu/gsc/salmonella.shtml), and the Sanger Centre
(http://www.sanger.ac.uk/projects/S__typhi). Pseudomonas aeruginosa sequences were compared to a proprietary database and the NCBI GenBank database. The E. faecalis sequences were compared to a proprietary database. The BLASTN analysis was performed using the default parameters except that the filtering was turned off. No further analysis was performed on inserts which resulted from the ligation of multiple fragments.
In general, antisense molecules and their complementary genes are identified as follows. First, all possible full length open reading frames (ORFs) are extracted from available genomic databases. Such databases include the GenBank nonredundant (nr) database, the unfinished genome database available from TIGR and the PathoSeq database developed by Incyte Genomics. The latter database comprises over 40 annotated bacterial genomes including complete ORF analysis. If databases are incomplete with regard to the bacterial genome of interest, it is not necessary to extract all ORFs in the genome but only to extract the ORFs within the portions of the available genomic sequences which are complementary to the clones of interest. Computer algorithms for identifying ORFs, such as GeneMark, are available and well known to those in the art. Comparison of the clone DNA to the complementary ORF(s) allows determination of whether the clone is a sense or antisense clone. Furthermore, each ORF extracted from the database can be compared to sequences in well annotated databases including the GenBank (nr) protein database, SWISSPROT and the like. A description of the gene or of a closely related gene in a closely related microorganism is often available in these databases. Similar methods are used to identify antisense clones coπesponding to genes encoding non-translated RNAs. Each of the cloned nucleic acid sequences discussed above which inhibited proliferation of Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis was used to identify the coπesponding Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis ORFs in the PathoSeq v.4.1 (March 2000 release) database of microbial genomic sequences. For this puφose, the NCBI BLASTN 2.0.9 computer algorithm was used. The default parameters were used except that filtering was turned off. The default parameters for the BLASTN and BLASTX analyses were: Expectation value (e)=10 Alignment view options: pairwise
Filter query sequence (DUST with BLASTN, SEG with others)=T
Cost to open a gap (zero invokes behavior)=0
Cost to extend a gap (zero invokes behavior)=0
X dropoff value for gapped alignment (in bits) (zero invokes behavior)=0 Show GI's in deflines=F
Penalty for a nucleotide mismatch (BLASTN only)=-3
Reward for a nucleotide match (BLASTN only)=l
Number of one-line descriptions (V)=500
Number of alignments to show (B)=250 Threshold for extending hits=default
Perform gapped alignment (not available with BLASTX)=T
Query Genetic code to use=l
DB Genetic code (for TBLAST[nx] only=l
Number of processors to use=l SeqAlign file
Believe the query defline=F
Matrix=BLOSUM62
Word Size= default
Effective length of the database (use zero for the real size)=0 Number of best hits from a region to keep=l 00
Length of region used to judge hits=20
Effective length of the search space (use zero for the real size)=0
Query strands to search against database (for BLASTjnx] and TBLASTX), 3 is both, 1 is top, 2 is bottom=3 Produce HTML output==F
Alternatively, ORFs were identified and refined by conducting a survey of the public and private data sources. Full-length gene protein and nucleotide sequences for these organisms were assembled from various sources. For Pseudomonas aeruginosa, gene sequences were adopted from the Pseudomonas genome sequencing project (downloaded from http://www.pseudomonas.com). For Klebsiella pneumoniae,
Staphylococcus aureus, Streptococcus pneumoniae and Salmonella typhi, genomic sequences from PathoSeq v 4.1 (Mar 2000 release) was reanalyzed for ORFs using the gene finding software GeneMark v 2.4a, which was purchased from GenePro Inc. 451 Bishop St., N.W, Suite B, Atlanta, GA, 30318, USA.
Antisense clones were identified as those clones for which transcription from the inducible promoter would result in the expression of an RNA antisense to a complementary ORF, intergenic or intiagenic sequence.
It will be appreciated that ORFs may also be identified using databases other than PathoSeq. For example, the ORFs may be identified using the methods described in U.S. Provisional Patent Application Serial Number 60/191,078, filed March 21, 2000, the disclosure of which is incoφorated herein by reference in its entirety. The ORFs which coπespond to the antisense nucleic acids which inhibited proliferation oϊ Escherichia coli, Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis are listed in the accompanying Sequence Listing as SEQ ID NOs.: 3796-3800, 3806-4860, and 5916-10012. The polypeptides encoded by the identified ORFs are provided in the accompanying Sequence Listing as SEQ ID NOs.: 3801-3805, 4861-5915, and 10013-
14110.
In other embodiments, the culture comprises a strain in which a gene product encoded by a homologous coding nucleic acid as defined above is overexpressed or underexpressed. In further embodiments, the culture comprises a strain in which a homologous polypeptide as defined above is overexpressed or underexpressed.
Homologous coding nucleic acids may be obtained as described in Example 4 below.
EXAMPLE 4 Identification of Homologous Coding Nucleic Acids. Homologous Antisense Nucleic Acids or Homologous Polypeptides
Homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides from other pathogenic microorganisms (including nucleic acids homologous to the nucleic acids of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-
10012, and 14111-14944, nucleic acids homologous to the antisense nucleic acids of SEQ ID NOs.: 8-3795, and polypeptides homologous to the polypeptides of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778) may be identified using methods such as those described below.
For example, in some embodiments, the proliferation-required nucleic acids, antisense nucleic acids, and polypeptides from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi, or Candida albicans described herein (including the nucleic acids of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, the antisense nucleic acids of SEQ ID NOs: 8-3795, and the polypeptides of SEQ ED NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945- 15778) may be used to identify homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides required for proliferation in prokaryotes and eukaryotes. For example, nucleic acids or polypeptides required for the proliferation of protists, such as Plasmodium spp.; plants; animals, such as Entamoeba spp. and Contracaecum spp; and fungi including Candida spp, (e.g, Candida albicans), Cryptococcus neoformans, and Aspergillus fumigatus may be identified. In one embodiment of the present mvention, monera, specifically bacteria, including both Gram positive and Gram negative bacteria, are probed to identify genes required for cellular proliferation. Likewise, homologous antisense nucleic acids may also be identified.
The genes and polypeptides required for the proliferation of Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa,
Staphylococcus aureus, Salmonella typhi, or Candida albicans (including the nucleic acids of SEQ TD NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, the sequences complementary to the nucleic acids of SEQ ID NOs.: 3796-3800, 3806- 4860, 5916-10012, and 14111-14944, and the polypeptides of SEQ ED NOs.: 3801- 3805, 4861-5915, 10013-14110 and 14945-15778) can be used to identify homologous coding nucleic acids or homologous polypeptides required for proliferation from these and other organisms using methods such as nucleic acid hybridization and computer database analysis. Likewise, the antisense nucleic acids which inhibit proliferation of Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis,
Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, or Salmonella typhi (including the antisense nucleic acids of SEQ ED NOs.: 8-3795 or the sequences complementary thereto) may also be used to identify homologous antisense nucleic acids using nucleic acid hybridization or computer database analysis.
For example, the nucleic acid sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhii, or Candida albicans (including the nucleic acids of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and the antisense nucleic acids of SEQ ID NOs. 8-3795) are used to screen genomic libraries generated from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi, or Candida albicans and other bacterial or fungal species of interest. For example, the genomic library may be from Gram positive bacteria, Gram negative bacteria or other organisms including Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae,
Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species, including coagulase negative species of Staphylococcus. In some embodiments, the genomic library may be from an organism other than E. coli. Standard molecular biology techniques are used to generate genomic libraries from various cells or microorganisms. In one aspect, the libraries are generated and bound to nitrocellulose paper. The nucleic acids of SEQ ED NOs. 3796-3800, 3806- 4860, 5916-10012, and 14111-14944 or SEQ ED NOs.: 8-3795, or portions thereof, can then be used as probes to screen the libraries for homologous sequences. For example, the libraries may be screened to identify homologous coding nucleic acids or homologous antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid selected from the group consisting of SEQ ID NOs.: 8-3795, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid complementary to one of SEQ ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75,
100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ED NOS.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-
4860, 5916-10012, and 14111-14944, and nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111- 14944.
The libraries may also be screened to identify homologous nucleic coding nucleic acids or homologous antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid selected from the group consisting of SEQ ID NOs.: 8-3795, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15,
20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid complementary to one of SEQ ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleic acid sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012,. and
14111-14944 and nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ED NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944.
The homologous nucleic coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides identified as above can then be used in the methods described herein. In some embodiments, the homologous coding nucleic acids, homologous antisense nucleic acids, or homologous polypeptides may be used to identify genes which are required for the proliferation of more than one microorganism.
Such genes are valuable targets for broad spectrum antibiotics effective against more than one microorganism.
For example, the preceding methods may be used to isolate homologous coding nucleic acids or homologous antisense nucleic acids comprising a nucleotide sequence with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of one of the sequences of SEQ ID NOS. 8-3795, fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof, and the sequences complementary thereto. The preceding methods may also be used to isolate homologous coding nucleic acids or homologous antisense nucleic acids comprising a nucleotide sequence with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of one of the nucleotide sequences of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100,
150, 200, 300, 400, or 500 consecutive nucleotides thereof, and the sequences complementary thereto. In some embodiments, the preceding methods may be used to isolate homologous coding nucleic acids or homologous antisense nucleic acids comprising a nucleotide sequence with at least 97%>, at least 95%>, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleic acid sequence selected from the group consisting of one of the sequences of SEQ ID NOS. 3796-3800, 3806-4860, 5916-10012, and 14111-14944, fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof, and the sequences complementary thereto. Identity may be measured using BLASTN version 2.0 with the default parameters. (Altschul, S.F. et al. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997), the disclosure of which is incoφorated herein by reference in its entirety). For example, the homologous polynucleotides may comprise a coding sequence which is a naturally occurring allelic variant of one of the coding sequences described herein. Such allelic variants may have a substitution, deletion or addition of one or more nucleotides when compared to the nucleic acids of SEQ ID NOs: 8-3795, SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 or the nucleotide sequences complementary thereto.
Additionally, the above procedures may be used to isolate homologous coding nucleic acids which encode polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25%ι amino acid identity or similarity to a polypeptide comprising the sequence of one of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 or to a polypeptide whose expression is inhibited by a nucleic acid of one of SEQ ID NOs: 8-3795 or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof as determined using the FASTA version 3.0t78 algorithm with the default parameters. Alternatively, protein identity or similarity may be identified using BLASTP with the default parameters, BLASTX with the default parameters, or TBLASTN with the default parameters. (Altschul, S.F. et al. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search
Programs, Nucleic Acid Res. 25: 3389-3402 (1997), the disclosure of which is incoφorated herein by reference in its entirety).
Alternatively, homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides may be identified by searching a database to identify sequences having a desired level of nucleotide or amino acid sequence homology to a nucleic acid or polypeptide involved in proliferation or an antisense nucleic acid to a nucleic acid involved in microbial proliferation. A variety of such databases are available to those skilled in the art, including GenBank and GenSeq. In some embodiments, the databases are screened to identify nucleic acids with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleic acid required for proliferation, an antisense nucleic acid which inhibits proliferation, or a portion of a nucleic acid required for proliferation or a portion of an antisense nucleic acid which inhibits proliferation. For example, homologous coding sequences may be identified by using a database to identify nucleic acids homologous to one of SEQ ID Nos. 8-3795, homologous to fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof, nucleic acids homologous to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, homologous to fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids homologous to one of SEQ ID Nos. 8-3795, homologous to fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof or nucleic acids homologous to the sequences complementary to any of the preceding nucleic acids. In other embodiments, the databases are screened to identify polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25 %> amino acid sequence identity or similarity to a polypeptide involved in proliferation or a portion thereof. For example, the database may be screened to identify polypeptides homologous to a polypeptide comprising one of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, a polypeptide whose expression is inhibited by a nucleic acid of one of SEQ ID NOs: 8- 3795 or homologous to fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of any of the preceding polypeptides. In some embodiments, the database may be screened to identify homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides from cells or microorganisms other than the Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, or Salmonella typhi species from which they were obtained.
For example the database may be screened to identify homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides from microorganisms such as Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae,
Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica,
Yersinia pestis or any species falling within the genera of any of the above species, including coagulase negative Staphylococcus. In some embodiments, the homologous coding nucleic acids, homologous antisense nucleic acids, or homologous polypeptides are from an organism other than E. coli. In another embodiment, nucleic acid arrays and microaπays can be employed to identify homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encodmg homologous polypeptides. Nucleic acid aπays are high density aπays of DNA samples deposited at specific locations on a glass chip, nylon membrane, or the like. An example of this technology is found in U.S. Patent No. 5807522, which is hereby incoφorated by reference. In such embodiments, an array comprising nucleic acids from an organism in which it is desired to identify a homologous coding nucleic acid, homologous antisense nucleic acid or nucleic acid encoding a homologous polypeptide is contacted with a detectable probe comprising the nucleic acid, or a portion thereof, for which it is desired to identify a homologue under conditions which permit the probe to specifically hybridize to the homologue.
For example, the aπays may consist of 12 x 24 cm nylon filters containing PCR products coπesponding to ORFs from the organism in which it is desired to identify the homologous nucleic acid. For example, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified in Anaplasma marginale, Aspergillus fumigatus,
Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kejyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Qyptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis,
Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae,
Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species, including coagulase negative Staphylococcus. Alternatively, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides can be identified by transcribing an antisense nucleic acid comprising a nucleotide sequence complementary to the proliferation-required sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae,
HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, or Salmonella typhi or a portion thereof in a heterologous cell or microorganism and determining whether the antisense nucleic acid inhibits the proliferation of the cell or microorganism. Alternatively, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides can be identified by transcribing a homologous antisense nucleic acid such as an antisense nucleic acid homologous to the nucleotide sequence complementary to one of SEQ ED NOs.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944, an antisense nucleic acid comprising a nucleotide sequence homologous to one of SEQ ED Nos.: 8-3795, or an antisense nucleic acid comprising a nucleotide sequence complementary to a portion of any of the preceding nucleic acids in a microorganism, such as the microorganism in which the homologous antisense nucleic acid was identified, and determining whether the proliferation of the microorganism is inhibited as described above. In another embodiment, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides can be identified by using the conserved portions of nucleotide sequences required for proliferation to generate degenerate primers for use in the polymerase chain reaction (PCR). The PCR technique is well known in the art. The successful production of a PCR product using degenerate probes generated from the nucleotide sequences identified herein indicates the presence of a homologous gene sequence in the species being screened. This homologous gene is then utilized in the present invention.
The nucleic acids homologous to the genes required for the proliferation of Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi or Candida albicans or the sequences complementary thereto may be used to identify homologous coding nucleic acids, nucleic acids encoding homologous polypeptides, or homologous antisense nucleic acids from cells or microorganisms other than
Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi or Candida albicans as described below. For example, the nucleic acids homologous to proliferation-required genes from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi or Candida albicans or the sequences complementary thereto may be used to identify homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides in Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli,
Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis,
Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any of the above species. In some embodiments of the present invention, the nucleic acids homologous to proliferation-required sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa,
Staphylococcus aureus, or Salmonella typhi (including nucleic acids homologous to one of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944) or the sequences complementary thereto (including nucleic acids homologous to one of SEQ ID NOs.: 8-3795) are used to identify proliferation-required sequences in an organism other than E. coli. In another embodiment of the present invention, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides are identified by transferring antisense nucleic acids complementary to the sequences identified as required for proliferation or portions thereof (including antisense nucleic acids comprising a nucleotide sequence complementary to one of SEQ ID
NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 or portions thereof, such as the nucleic acids of SEQ ID NOs.: 8-3795) to vectors capable of functioning within a species other than the species from which the sequences were obtained. For example, the vector may be functional in Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens,
Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides,
Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis,
Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. En some embodiments of the present mvention, the vector may be functional in an organism other than E. coli. As would be appreciated by one of ordinary skill in the art, vectors may contain certain elements that are species specific. These elements can include promoter sequences, operator sequences, repressor genes, origins of replication, ribosomal binding sequences, termination sequences, and others. To use the antisense nucleic acids, one of ordinary skill in the art would know to use standard molecular biology techniques to isolate vectors containing the sequences of interest from cultured bacterial cells, isolate and purify those sequences, and subclone those sequences into a vector adapted for use in the species of bacteria to be screened.
Vectors for a variety of other species are known in the art. For example, numerous vectors which function in E. coli are known in the art. Also, Pla et al. have reported an expression vector that is functional in a number of relevant hosts including: Salmonella typhimurium, Pseudomonas putida, and Pseudomonas aeruginosa. J. Bacteriol. 172(8):4448-55 (1990). Brunschwig and Darzins (Gene (1992) 111:35-4, the disclosure of which is incoφorated herein by reference in its entirety) described a shuttle expression vector for Pseudomonas aeruginosa. Similarly many examples exist of expression vectors that are freely transferable among various Gram-positive microorganisms. Expression vectors for Enterococcus faecalis may be engineered by incoφorating suitable promoters into a pAK80 backbone (Israelsen, H, S. M. Madsen, A. Vrang, E. B. Hansen and E. Johansen.
1995. Appl. Environ. Microbiol. 61:2540-2547, the disclosure of which is incoφorated herein by reference in its entirety).
Following the subcloning of the antisense nucleic acids complementary to proliferation-required sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas . aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa,
Staphylococcus aureus, Salmonella typhi, or Candida albicans or portions thereof into a vector functional in a second cell or microorganism of interest (i.e. a cell or microorganism other than the one from which the identified nucleic acids were obtained), the antisense nucleic acids are conditionally transcribed to test for bacterial growth inhibition. The nucleotide sequences of the nucleic acids from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans that, when transcribed, inhibit growth of the second cell or microorganism are compared to the known genomic sequence of the second cell or microorganism to identify the homologous gene from the second organism. If the homologous sequence from the second cell or microorganism is not known, it may be identified and isolated by hybridization to the proliferation-required Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalisEscherichia coli, Enterococcus faecalis, Haemophilus influenzae,
HeUcobacter pylori, Salmonella typhi or Candida albicans sequence of interest or by amplification using PCR primers based on the proliferation-required nucleotide sequence of interest as described above. In this way, sequences which may be required for the proliferation of the second cell or microorganism may be identified. For example, the second microorganism may be Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments of the present invention, the second microorganism is an organism other than E. coli.
The homologous nucleic acid sequences from the second cell or microorganism which are identified as described above may then be operably linked to a promoter, such as an inducible promoter, in an antisense orientation and introduced into the second cell or microorganism. The techniques described herein for identifying Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae,
Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi or Candida albicans genes required for proliferation may thus be employed to determine whether the identified nucleotide sequences from a second cell or microorganism inhibit the proliferation of the second cell or microorganism. For example, the second microorganism may be Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii,
Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments of the present invention, the second microorganism may be an organism other than E. coli.
Antisense nucleic acids required for the proliferation of microorganisms other than Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans or the genes coπesponding thereto, may also be hybridized to a microaπay containing the Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi, or Candida albicans ORFs (including the nucleic acids of SEQ ID NOs.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944) to gauge the homology between the Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans sequences and the proliferation-required nucleic acids from other cells or microorganisms. For example, the proliferation-required nucleic acid may be from Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis,
Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments, the proliferation-required nucleotide sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans or homologous nucleic acids are used to identify proliferation-required sequences in an organism other than E. coli. In some embodiments of the present invention, the proliferation-required sequences may be from an organism other than E. coli. The proliferation-required nucleic acids from a cell or microorganism other than Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans may be hybridized to the aπay under a variety of conditions which permit hybridization to occur when the probe has different levels of homology to the nucleotide sequence on the microaπay. This would provide an indication of homology across the cells or microorganisms as well as clues to other possible essential genes in these cells or microorganisms. EXAMPLE 5
Identification of Nucleic Acids Homologous to Nucleic Acids Required for the
Proliferation of E. coli in other Bacterial Species
Homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified as follows. The ability of an antisense molecule identified in a first organism to inhibit the proliferation of a second organism (thereby confirming that a gene in the second organism which is homologous to the gene from the first organism is required for proliferation of the second organism) was demonstrated using some of the antisense nucleic acids which inhibit the growth of E. coli. Expression vectors which inhibited growth of E. coli upon induction of antisense RNA expression with IPTG were transformed directly into Enterobacter cloacae, Klebsiella pneumonia or Salmonella typhimurium. The transformed cells were then assayed for growth inhibition according to the methods described above. After growth in liquid culture, cells were plated at various serial dilutions and a score determined by calculating the log difference in growth for INDUCED vs. UNTNDUCED antisense RNA expression as determined by the maximum 10 fold dilution at which a colony was observed. The results of these experiments are listed below in Table I. If there was no effect of antisense RNA expression in a microorganism, the clone is minus in Table I. In contrast, a positive in Table I means that at least 10 fold more cells were required to observe a colony on the induced plate than on the non-induced plate under the conditions used and in that microorganism.
TABLE I Sensitivity of Other Microorganisms to Antisense Nucleic Acids That Inhibit
Proliferation in E. coli
Thus, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides can be identified by measuring the ability of an antisense nucleic acid which inhibits the proliferation of Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans to inhibit the growth of other organisms. This may be evaluated by transforming the antisense nucleic acid directly into species other than the organism from which they were obtained. In particular, the ability of the antisense nucleic acid to inhibit the growth of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae,
Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris,
Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica,
Yersinia pestis or any species falling within the genera of any of the above species, may be evaluated. In some embodiments of the present mvention, the ability of the antisense nucleic acid to inhibit the growth of an organism other than E. coli may be evaluated. In such embodiments, the antisense nucleic acids are inserted into expression vectors functional in the organisms in which the antisense nucleic acids are evaluated.
It will be appreciated that the above methods for evaluating the ability of an antisense nucleic acid to inhibit the proliferation of a heterologous organism may be performed using antisense nucleic acids complementary to any of the proliferation- required nucleic acids from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans (including antisense nucleic acids complementary to SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, such as the antisense nucleic acids of SEQ ID NOs.: 8-3795) or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof, or homologous antisense nucleic acids.
Those skilled in the art will appreciate that a negative result in a heterologous cell or microorganism does not mean that that cell or microorganism is missing that gene nor does it mean that the gene is unessential. However, a positive result means that the heterologous cell or microorganism contains a homologous gene which is required for proliferation of that cell or microorganism. The homologous gene may be obtained using the methods described herein. For example, the homologous gene may be isolated by performing a PCR procedure using primers based on the antisense sequence which reduced the level or activity of the gene product encoded by the homologous gene or by performing a Southern blot.
Those skilled in the art will appreciate that an antisense molecule which works in the microorganism from which it was obtained will not always work in a heterologous cell or microorganism. EXAMPLE 6
Identification of Nucleic Acids Homologous to Nucleic Acids Required for the Proliferation oϊ Staphylococcus aureus in other Bacterial Species Nucleic acids homologous to proliferation-required nucleic acids from Staphylococcus aureus were identified as follows. Thirty-nine antisense nucleic acids which inhibited the growth oϊ Staphylococcus aureus were inserted into an expression vector such that their expression was under the control of a xylose-inducible Xyl-T5 promoter. A vector with Green Fluorescent Protein (GFP) under control of the Xyl- T5 promoter was used to show that expression from the Xyl-T5 promoter in Staphylococcus epidermidis was comparable to that in Staphylococcus aureus. The vectors were introduced into Staphylococcus epidermidis by electroporation as follows: Staphylococcus epidermidis was grown in liquid culture to mid-log phase and then harvested by centrifugation. The cell pellet was resuspended in 1/3 culture volume of ice-cold EP buffer (0.625 M sucrose, 1 mM MgCl2, pH=4.0), and then harvested again by centrifugation. The cell pellet was then resuspended with
1/40 volume EP buffer and allowed to incubate on ice for 1 hour. The cells were then frozen for storage at -80°C. For electroporation, 50 μl of thawed electrocompetent cells were combined with 0.5 μg plasmid DNA and then subjected to an electrical pulse of 10 kV/cm, 25 uFarads, 200 ohm using a biorad gene pulser electroporation device. The cells were immediately resuspended with 200 μl outgrowth medium and incubated for 2 hours prior to plating on solid growth medium with drug selection to maintain the plasmid vector. Colonies resulting from overnight growth of these platings were selected, cultured in liquid medium with drug selection, and then subjected to dilution plating analysis as described for Staphylococcus aureus above to test growth sensitivity in the presence of the inducer xylose.
The results are shown in Table II below. The first column indicates the Molecule Number of the Staphylococcus aureus antisense nucleic acid which was introduced into Staphylococcus epidermidis. The second column indicates whether the antisense nucleic acid inhibited the growth of Staphylococcus epidermidis, with a "+" indicating that growth was inhibited. Of the 39 Staphylococcus aureus antisense nucleic acids evaluated, 20 inhibited the growth oϊ Staphylococcus epidermidis.
TABLE II
Sensitivity of Other Microorganisms to Antisense Nucleic Acids That Inhibit
Proliferation oϊ Staphylococcus aureus
The above methods for identifying homologous genes using antisense nucleic acids complementary to any of the proliferation-required nucleic acids from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans, (including antisense nucleic acids complementary to SEQ ID NOs.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944, such as the antisense nucleic acids of SEQ ID NOs.: 8-3795) or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof, or homologous antisense nucleic acids.
Homologous nucleic acids may also be identified using complementation analyses.
EXAMPLE 7 Identification of Homologous Nucleic Acids by Functional Complementation
Homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified as follows. Gene products whose activities may be complemented by a proliferation-required gene product from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli,
Enterococcus faecalis, Haemophilus influenzae, HeUcobacter pylori, Salmonella typhi or Candida albicans or homologous polypeptides are identified using merodiploids, created by introducing a plasmid or Bacterial Artificial Chromosome into an organism having a mutation in the essential gene which reduces or eliminates the activity of the gene product. In some embodiments, the mutation may be a conditional mutation, such as a temperature sensitive mutation, such that the organism proliferates under permissive conditions but is unable to proliferate under non-permissive conditions in the absence of complementation by the gene on the plasmid or Bacterial Artificial Chromosome. Alternatively, duplications may be constructed as described in Roth et al. (1987) Biosynthesis of Aromatic Amino Acids in Escherichia coli and Salmonella typhimurium, F. C. Neidhardt, ed, American Society for Microbiology, publisher, pp. 2269-2270, the disclosure of which is incoφorated herein by reference in its entirety.
Such methods are familiar to those skilled in the art. Alternatively, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified by placing a gene required for proliferation or a nucleic acid complementary to at least a portion of a gene required for proliferation under the control of a regulatable promoter as described above, introducing a plasmid or Bacterial Artificial Chromosome into the cell, and identifying cells which are able to proliferate under conditions which would prevent or reduce proliferation in the absence of the plasmid or Bacterial Artificial Chromosome.
Homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified using databases as follows.
EXAMPLE 8 Identification of Homologous Nucleic Acids by Database Analysis As a demonstration of the database methodology used to find homologues to an essential gene, nine prokaryotic organisms were analyzed and compared in detail.
First, the most reliable source of gene sequences for each organism was assessed by conducting a survey of the public and private data sources. The nine organisms studied are Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pneumoniae and Salmonella typhi. Full-length gene protein and nucleotide sequences for these organisms were assembled from various sources. For Escherichia coli, Haemophilus influenzae and HeUcobacter pylori, gene sequences were adopted from the public sequencing projects, and derived from the GenPept 115 database (available from NCBI). For Pseudomonas aeruginosa, gene sequences were adopted from the Pseudomonas genome sequencing project (downloaded from http://www.pseudomonas.com'). For Klebsiella pneumoniae, Staphylococcus aureus, Streptococcus pneumoniae and Salmonella typhi, genomic sequences from PathoSeq v 4.1 (Mar 2000 release) was reanalyzed for ORFs using the gene finding software GeneMark v 2.4a, which was purchased from GenePro Inc. 451 Bishop St, N.W, Suite B, Atlanta, GA, 30318, USA.
Subsequently, the essential genes found by the antisense methodology were compared to the derived proteomes of interest, in order to find all the homologous genes to a given gene. This comparison was done using the FASTA program v3.3. Genes were considered homologues if they were greater than 25% identical and the alignment between the two genes covered more than 70% of the length of one of the genes. The best homologue for each of the nine organisms, defined as the most significantly scoring match which also fulfilled the above criteria, was reported in Table III. Table III lists the best ORF identified as described above (column labelled LOCUSID), the SEQ ED, % identity, and the amount of the protein which aligns well with the query sequence (coverage) for the gene identified in each of the nine organisms evaluated as described above.
Table IN lists the PathoSeq cluster ID for genes identified as being required for proliferation in Enterococcus faecalis, Escherichia coli, Pseudomonas aeruginosa, and Staphylococcus aureus using the methods described herein. As indicated in the column labelled PathoSeq cluster ID, these sequences share homology to one another and were consequently grouped within the same PathoSeq cluster. Thus, the methods described herein identified genes required for proliferation in several species which share homology. TABLE EH
-4 -4
-4 oe
oe ©
oe
oe
-4
oe oe
vo
Ul
© ©
©
Ul
©
-4
© oe
© vo
Isl
Ul
©
Isl
Ul
Isl
Ul Isl
Isl
Ul Ul
Isl
Ul
Isl
Ul
Isl
Ul -4
Isl
Ul oe
Isl
Ul vo
Isl
4-
©
Isl
4- Ul
Isl 4- -4
Isl
Isl Isl
Isl
Isl
Isl
Isl
Isl
Isl -4
©
Isl -4
Isl -4 Isl
Isl -4
Ul
Is,
-J 4-
Isl -4
Isl -4
Isl -4 -4
Isl -4 oe
Isl -4
Isl oe ©
Isl oe
Isl oe
Isl
Isl oe
Ul
Isl oe
Isl oe
Isl oe
Isl oe
-4
Isl oe oe
Isl oe vo
TABLE EV
Table VI A at the end of the present specification provides the SEQ ID NOs., clone names, and organisms for the sequences used in the above analysis. Table VI B at the end of the present specification provides the clone name, clone SEQ ID NO., PathoSeq locus, Gene SEQ ID NO. (protein) Genemarked gene and full length ORF protein SEQ ID NOs. for the sequences used in the above analysis. Table VI C at the end of the present specification provides the PathoSeq Gene Locus, nucleotide SEQ ID NOs. and Protem SEQ ID NOs. of the sequences used in the above analysis.
In some embodiments of the present invention, strains in which genes encoding gene products required for cellular proliferation under the control of a desired promoter, such as a constitutive or regulatable promoter which provides a desired level of expression, are constructed by replacing the natural promoter with the desired promoter through homologous recombination as described in Examples 9-13 below. It will be appreciated that although Examples 9-13 use Candida albicans as an exemplary organism, similar methods may be utilized in other organisms.
EXAMPLE 9 Construction of Strains which Overexpress or Underexpress Gene Products Required for Proliferation by Promoter Replacement
Strains which overexpress or underexpress gene products required for proliferation may also be constructed by replacing the promoters which naturally direct transcription of these gene products with promoters which provide the desired level of expression. As described above, such strains are useful in methods for identifying the targets of compounds which inhibit proliferation, as well as in methods for identifying genes encoding gene products required for proliferation.
For example, in some embodiments, the natural promoter may be replaced using techniques which employ homologous recombination to exchange a promoter present on the chromosome of the cell with the desired promoter. In such methodology, a nucleic acid comprising a promoter replacement cassette is introduced into the cell. As illustrated in Figure 5 A, the promoter replacement cassette comprises a 5' region homologous to the sequence which is 5' of the natural promoter in the chromosome, the promoter which is to replace the chromosomal promoter and a 3' region which is homologous to sequences 3' of the natural promoter in the chromosome. In some embodiments, the promoter replacement cassette may also include a nucleic acid encoding an identifiable or selectable marker disposed between the 5' region which is homologous to the sequence 5' of the natural promoter and the promoter which is to replace the chromosomal promoter. If desired, the promoter replacement cassette may also contain a transcriptional terminator 3' of the gene encoding an identifiable or selectable marker, as illustrated in Figure 5B. As illustrated in Figure 5 A and 5B, homologous recombination is allowed to occur between the chromosomal region containing the natural promoter and the promoter replacement cassette. Cells in which the promoter replacement cassette has integrated into the chromosome are identified or selected. To confirm that homologous recombination has occurred, the chromosomal structure of the cells may be verified by Southern analysis or PCR. In some embodiments, the promoter replacement cassette may be introduced into the cell as a linear nucleic acid, such a PCR product or a restriction fragment. Alternatively, the promoter replacement may be introduced into the cell on a plasmid. Figures 5 A and 5B illustrates the replacement of a chromosomal promoter with a desired promoter through homologous recombination. In some embodiments, the cell into which the promoter replacement cassette is introduced may carry mutations which enhance its ability to be transformed with linear DNA or which enhance the frequency of homologous recombination. For example, if the cell is an Escherichia coli cell it may have a mutation in the gene encoding Exonuclease V of the RecBCD recombination complex. If the cell is an Escherichia coli cell it may have a mutation that activates the RecET recombinase of the Rac prophage and/or a mutation that enhances recombination through the RecF pathway. For example, the Escherichia coli cells may be RecB or RecC mutants carrying an sbcA or sbcB mutation. Alternatively, the Escherichia coli cells may be recD mutants. In other embodiments the Escherichia coli cells may express the λ Red recombination genes. For example, Escherichia coli cells suitable for use in techniques employing homologous recombination have been described in Datsenko, K.A. and Wanner, B.L., PNAS 97:6640-6645 (2000); Murphy, K.C., J. Bact 180: 2053-2071 (1998); Zhang, Y., et al., Nature Genetics 20: 123-128 (1998); and Muyrers, J.P.P. et al., Genes & Development 14: 1971-1982 (2000), the disclosures of which are incorporated herein by reference in their entireties. It will be appreciated that cells carrying mutations in similar genes may be constructed in organisms other than Escherichia coli.
In some embodiments, the methods described in U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is incoφorated herein by reference in its entirety), the U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 (the disclosure of which is incorporated herein by reference in its entirety), and U.S. Patent Application 09/948,993 (the disclosure of which is incorporated herein by reference in its entirety), may be used to place the gene required for proliferation under the control of a regulatable promoter.
If the organism in which promoter replacement is to be performed is diploid, strains in which genes encoding gene products required for proliferation are under the control of a desired promoter may be constructed using the methods described in U.S.
Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is incorporated herein by reference in its entirety), and U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 (the disclosure of which is incorporated herein by reference in its entirety), disclose genes and gene products required for proliferation which may be used in any of the methods of the present invention.. In such methods, one chromosomal copy of a gene encoding a gene product required for proliferation is inactivated. For example, the gene may be inactivated by insertion of or replacement by a nucleotide sequence encoding a selectable or detectable gene product, such as a polypeptide which provides resistance to a drug or which allows growth under certain culture conditions. The other chromosomal copy of the gene encoding a gene product required for proliferation is placed under the control of a regulatable promoter by homologous recombination. The resultant strains may be used to identify genes which encode gene products required for proliferation and in the methods of the present invention. For example, one method of constructing diploid cells in which a gene encoding a gene product required for proliferation is under the control of a regulated promoter is depicted in Figures 6A and 6B. In the method illustrated in Figures 6A and 6B, one chromosomal copy of the essential Candida albicans gene CaKRE9 is disrupted using a cassette in which nucleic acid sequences homologous to the CaKRE9 gene flank a nucleic acid comprising the SATl gene, which is under the control of the ACT-1 promoter and the PCK1 terminator sequence, which is at the 3' end of the SATl gene. The presence of the Escherichia coli SATl gene within C. albicans allows acetylation of the drug rendering it nontoxic and permitting the strain to grow in the presence of streptothricin at a concentration of 200 micrograms per milliliter. Expression of the SATl gene in C. albicans is made possible by engineering the gene so that its DNA sequence is altered to conform to the genetic code of this organism and by providing a CaACTl promoter (Morschhauser et al. (1998) Mol. Gen. Genet. 257:412-420) and a CaPCKl terminator sequence (Leuker et a (1997) Gene 192: 235-40). This genetically modified marker is referred to as CaSATl which is the subject of a copending United States Patent Application, Serial No 09/785,669, filed February 16, 2001, Publication Number, US2001-0031724-A1, the disclosure of which is incorporated herein by reference in its entirety.
C. albicans is also sensitive to a second fungicidal compound, blasticidin, whose cognate resistance gene from Bacillus cereus, BSR, has similarly been genetically engineered for expression in C. albicans (CaBSRl), and has been shown to confer a dominant drug resistance phenotype. PCR amplification of either dominant selectable marker so as to include about 65 bp of flanking sequence identical to the sequence 5' and 3' of the C. albicans gene to be disrupted, allows construction of a gene disruption cassette for any given C. albicans gene.
By employing the method of Baudin et al. (1993, Nucleic Acids Research 21:3329-30), a gene disruption event can be obtained following transformation of a C. albicans strain with the PCR-amplified gene disruption cassette and selection for drug resistant transformants that have precisely replaced the wild type gene with the dominant selectable marker. Such mutant strains can be selected for growth in the presence of a drug, such as but not limited to streptothricin. The resulting gene disruptions are generally heterozygous in the diploid C. albicans, with one copy of the allelic pair on one homologous chromosome disrupted, and the other allele on the other homologous chromosome remaining as a wild type allele as found in the initial parental strain. The disrupted allele is non-functional, and expression from this allele of the gene is nil. By repeating this process for all the genes in the genome of an organism, a set of gene disruptions can be obtained for every gene in the organism. The method can also be applied to a desired subset of genes.
In the method illustrated in Figures 6 A and 6B, the second chromosomal copy of the Candida albicans CaKRE9 gene is placed under the control of a regulatable promoter using a promoter replacement cassette in which nucleic acid sequences homologous to the promoter region to be replaced flank a nucleic acid comprising the CaHIS3 gene (which encodes a selectable marker), the ADH terminator, which is at the 3' end of the CaHIS3 gene, and a tetracycline regulatable promoter (described below).
The tetracycline-regulatable promoter system was developed initially for S. cerevisiae but is modified for use in C. albicans. See Gari et al., 1997, Yeast 13:837- 848; and Nagahashi et al., 1997, Mol. Gen. Genet. 255:372-375. Briefly, conditional expression is achieved by first constructing a transactivation fusion protein comprising the E. coli TefR tetracycline repressor domain or DNA binding domain (amino acids 1- 207) fused to the transcription activation domain of S. cerevisiae GAL4 (amino acids 785-881) or HAP4 (amino acids 424-554), Multiple CTG codon corrections were introduced to comply with the C. albicans genetic code. The nucleotide sequences encoding the transactivation fusion proteins of E. coli TetR (amino acids 1-207) plus S. cerevisiae GAL4 (amino acids 785-881), and of E. coli TetR (amino acids 1-207) plus S. cerevisiae HAP4 (amino acids 424-554), both have been modified for proper expression in C. albicans. Constitutive expression of the transactivation fusion protein in C. albicans can be achieved by providing a CaACTl promoter and CaACTl terminator sequence. However, it will be appreciated that any regulatory regions, promoters and terminators, that are functional in C. albicans can be used to express the fusion protein. Thus, a nucleic acid molecule comprising a promoter functional in C. albicans, the coding region of a transactivation fusion protein, and a terminator functional in C. albicans can be used to obtain cells in which a gene encoding a gene product required for proliferation is under the control of a regulatable promoter. Such a nucleic acid molecule can be a plasmid, a cosmid, a transposon, or a mobile genetic element. In a preferred embodiment, the TetR-Gal4 or TetR-Hap4 transactivators can be stably integrated into a C. albicans strain, by using either ura3 and his3 auxotrophic markers.
The heterologous tetracycline promoter initially developed for S. cerevisiae gene expression contains an ADH1 3' terminator sequence, variable number of copies of the tetracycline operator sequence (2, 4, or 7 copies), and the CYC1 basal promoter. The tetracycline promoter has been subcloned adjacent to both CaHIS3 and CaSATl selectable markers in the orientation favoring tetracycline promoter-dependent regulation when placed immediately upstream the open reading frame of the gene of interest. PCR amplification of the C H/S3-Tet promoter cassette incorporates 65bp of flanking sequence homologous to the promoter sequence around nucleotide positions -200 and -1 (relative to the start codon) of the target gene, thereby producing a conditional promoter replacement fragment for transformation. When transformed into a C. albicans strain made heterozygous as described herein using the CaSATl disruption cassette, homologous recombination between the promoter replacement fragment and the promoter of the wild type allele generates a strain in which the remaining wild type gene is conditionally regulated gene by the tetracycline promoter. Transformants are selected as His prototrophs and verified by Southern blot and PCR analysis. In the method illustrated in Figures 6A and 6B, the promoter is induced in the absence of tetracycline, and repressed by the presence of tetracycline. Analogs of tetracycline, including but not limited to chlortetracycline, demeclocycline, doxycycline, meclocycline, methocycline, minocycline hydrochloride, anhydrotetracycline, and oxytetracycline, can also be used to repress the expression of the modified gene allele.
Alternative variants of the tetracycline promoter system, based upon a mutated tetracycline repressor (tetR) molecule, designated tetR', which is activated (i.e. binds to its cognate operator sequence) by binding of the antibiotic effector molecule to promote expression, and is repressed (i.e. does not bind to the operator sequence) in the absence of the antibiotic effectors, when the tetR' is used instead of, or in addition to, the wild-type tetR may also be used. For example, the method could be performed using tetR' instead of tetR in cases where repression is desired under conditions which lack the presence of tetracycline, such as shut off of a gene participating in drug transport (e.g. CaCDRl, CaPDR5, or CaMDRl). Also, the method could be adapted to incorporate both the tetR and tetR' molecules in a dual activator/repressor system where tetR is fused to an activator domain and tetR' is fused to a general repressor (e.g. CaSsrό or CaTupl) to enhance or further repress expression in the presence of the antibiotic effector molecules (Belli et al., 1998, Nucl Acid Res 26:942-947 which is incorporated herein by reference). These methods of providing conditional expression are also contemplated. The method may also be applied to haploid organisms by modifying the single allele of the gene via recombination of the allele with a promoter replacement fragment comprising a nucleotide sequence encoding a heterologous promoter, such that the expression of the gene is conditionally regulated by the heterologous promoter. By repeating this process for a preferred subset of genes in a haploid pathogenic organism, or its entire genome, a collection or a complete set of conditional mutant strains can be obtained. A preferred subset of genes comprises genes that share substantial nucleotide sequence homology with target genes of other organisms, e.g., C. albicans and S. cerevisiae. For example, the method may be applied to haploid fungal pathogens including, but not limited to, animal fugal pathogens such as Aspergillus fumigatus,
Aspergillus niger, Aspergillus flavis, Candida glabrata, Cryptococcus neoformans, Coccidioides immitis, Exophalia dermatiditis, Fusarium oxysporum, Histoplasma capsulatum, Phneumocystis carinii, Trichosporon beigelii, Rhizopus arrhizus, Mucor rouxii, Rhizomucor pusillus, or Absidia corymbigera, or the plant fungal pathogens, such as Botrytis cinerea, Eiysiphe graminis, Magnaporthe grisea, Puccinia recodita,
Septoria triticii, Tilletia controversa, Ustilago maydis, or any species falling within the genera of any of the above species. Similarly, the method may be applied to bacteria, including the bacterial species and genera discussed above.
It will be appreciated that the means to achieve conditional expression are not restricted to the tetracycline promoter system and can be performed using other conditional promoters. Such conditional promoter may, for example, be regulated by a repressor which repress transcription from the promoter under particular condition or by a transactivator which increases transcription from the promoter, such as, when in the presence of an inducer. For example, the C. albicans CaPCKl promoter is not transcribed in the presence of glucose but has a high level of expression in cells grown on other carbon sources, such as succinate, and therefore could also be adopted for conditional expression of the modified allele. To this end, it has been shown that both CaHISl and CaSATl are essential for growth on glucose-containing medium using the CaPCKl promoter as an alternative to the tetracycline promoter in the above description. In this instance, the CaPCKl promoter is heterologous to the gene expressed and not to the organism, and such heterologous promoters are also encompassed in the invention. Alternative promoters that could functionally replace the tetracycline promoter include but are not limited to other antibiotic-based regulatable promoter systems (e.g.,. pristinamycin-induced promoter or PIP) as well as Candida albicans conditionally-regulated promoters such as MET25, MAL2, PH05, GAL 1,10, STE2, or STE3.
Although not mandatory, performing the gene disruption first enables heterozygous strains to be constructed and separately collected as a heterozygote strain collection during the process of drug target validation. Heterozygous strains for a given gene express approximately half the normal diploid level of a particular gene product. Consequently, these strains provide constructions having a diminished level of the encoded gene product, and they may be used in the methods described herein. However, it is clear to those skilled in the art that the order of allele modification followed in this embodiment of the invention is not critical, and that it is feasible to perform these steps in a different order such that the conditional-expressing allele is constructed first and the disruption of the remaining wild type gene allele be performed subsequently. However, where the promoter replacement step is carried out first, it is preferable to delete sequences homologous to those employed in the gene disruption step.
Alternatively, conditional expression could be achieved by means other than the reliance of conditional promoters. For example, conditional expression could be achieved by the replacement of the wild type allele in haploid or heterozygous strains with temperature sensitive alleles derived in vitro, and their phenotype would then be analyzed at the nonpermissive temperature. In a related approach, in heterozygous strains, insertion of a ubiquitination signal into the remaining wild type allele to destabilize the gene product during activation conditions can be adopted to examine phenotypic effects resulting from gene inactivation.
In another alternative, a constitutive promoter regulated by an excisable transactivator can be used. The promoter is placed upstream to a target gene to repress expression to the basal level characteristic of the promoter. For example, if the strains are fungal organisms, a heterologous promoter containing lexA operator elements may be used in combination with a fusion protein composed of the lexA DNA binding domain and any transcriptional activator domain (e.g. GAL4, HAP4, VP16) to provide constitutive expression of a target gene. Counterselection mediated by 5-FOA can be used to select those cells which have excised the gene encoding the fusion protein. This procedure enables an examination of the phenotype associated with repression of the target gene to the basal level of expression provided by the lexA heterologous promoter in the absence of a functional transcription activator. The strains generated by this approach may be used in the present invention.
Alternatively, conditional expression of a target gene can be achieved without the use of a transactivator containing a DNA binding, transcriptional activator domain. A cassette could be assembled to contain a heterologous constitutive promoter downstream of, for example, the URA3 selectable marker, which is flanked with a direct repeat containing homologous sequences to the 5' portion of the target gene. Additional homologous sequences upstream of the target, when added to this cassette would facilitate homologous recombination and replacement of the native promoter with e above-described heterologous promoter cassette immediately upstream of the start codon of the target gene or open reading frame. Conditional expression is achieved by selecting strains, by using 5-FOA containing media, which have excised the heterologous constitutive promoter and URA3 marker (and consequently lack those regulatory sequences upstream of the target gene required for expression of the gene) and examining the growth of the resulting strain versus a wild type strain grown under identical conditions.
A specific application of the above method as used to construct modified alleles of the target gene CaKRE9 is provided in Example 10 below.
EXAMPLE 10 Construction of a Candida albicans Strain in which a Gene Encoding a Gene Product
Required for Proliferation is Under the Control of a Regulatable Promoter Oligonucleotide primers for PCR amplification of the SAT selectable marker used in Step 1 (i.e. gene replacement) contain 25 nucleotides complementary to the SAT disruption cassette in pRC18-ASP, and 65 nucleotides homologous to regions flanking the CaKRE9 open reading frame. Figures 6A and 6B illustrate the procedure for constructing Candida albicans strains in which a gene encoding a gene product is under the control of a regulatable promoter. As Figures 6A and 6B illustrate, the 2.2 kb cakre9Δ::SAT disruption fragment produced after PCR amplification and resulting gene replacement of the first wild type CaKRE9 allele via homologous recombination following transformation. PCR conditions were as follows: 5-50 ng pRC18-ASP, 100 pmol of each primer, 200 μM dNTPs, 10 mM Tris- pH 8.3, 1.5 mM MgC12, 50 mM
KC1, 1 unit Taq DNA polymerase (Gibco). PCR amplification times were: 5 min 94°C, 1 min 54°C, 2 min 72°C, for 1 cycle; 45 sec 94°C, 45 sec 54°C, 2 min 72°C, for 30 cycles. Transformation was performed using the lithium acetate method adapted for C. albicans, by Braun and Johnson, (Braun, B. R., and A. D. Johnson (1997), Control of filament formation in Candida albicans by the transcriptional repressor TUP 1 , Science
277:105-109), with minor modifications, including shorter incubation times at 30°C and 42 °C (1 hr and 5 min respectively) and a greater amount of material transformed (50 μg of ethanol-precipitated cakre9Δ::SAT ?CR product). Transformed cells were spread onto YPD plates and incubated overnight at 30 °C, providing a preincubation period for expression of SAT prior to replica plating onto YPD medium containing streptothricin
(400μg/ml). Streptothricin-resistant colonies were detected after 36 hr and cakre9Δ::SAT/CaKRE9 heterozygotes identified by PCR analysis using suitable primers which amplify both CaKRE9 and cakre9Δ::SAT alleles.
Oligonucleotide primers for PCR amplification of the conditional promoter used in Step 2 (i.e. promoter replacement) contain 25 nucleotides complementary to the
CαHiS3-marked tetracycline regulated promoter cassette in pBSK-ΗT4 and 65 nucleotides of homologous sequence corresponding to promoter regions -270 to -205, relative to the point of transcription initiation, and nucleotides 1-65 of the CaKRE9 open reading frame. The resulting 2.2 kb PCR product was transformed into the cakre9Δ::SAT/CaKRE9 heterozygous strain produced in step 1, and His+ transformants selected on YNB agar. Bonafide CaKRE9 strains containing both a cakre9Δ::SAT allele and CaHIS3-Tet-CaKRE9 allele were determined by PCR analysis. Typically, 2 independent strains are constructed and evaluated to provide a reliable determination of the terminal phenotype of any given drug target. Terminal phenotype is that phenotype caused by the absence of the gene product of an essential gene.
The phenotype of the resulting strain was evaluated as follows. EXAMPLE 11
Evaluation of Phenotype oϊ Candida albicans Strains in which a Gene Encoding a Gene Product Required for Proliferation is Under the Control of a Regulatable
Promoter Three independent methods were used to evaluate the phenotype of Candida albicans strains in which one copy of the CaKRE9 gene was disrupted and the other copy was under the control of a regulatable promoter. In the first, rapid determination of the strain's terminal phenotype was achieved by streaking approximately 1.0 X 106 cells onto both a YNB plate and YNB plate containing lOOμg/ml tetracycline and comparing growth rate after 48 hr at room temperature. For essential genes, such as
CaKRE9, no significant growth is detected in the presence of tetracycline. In the second approach, the essential nature of a gene may be determined by streaking the cells onto a casamino acid plate containing 625 μg/ml 5-fluororotic acid (5FOA) and 100 μg/ml uridine to select for ura" cells which have excised (via recombination between CaLEU2 sequence duplications created during targeted integration) the transactivator gene that is normally required for expression of the tetracycline promoter-regulated target gene. Again, whereas strains in which one copy of a gene which is not required for proliferation is disrupted and the other copy is under control of a regulatable promoter demonstrate robust growth under such conditions, the CaKRE9 strains prepared as described above fail to grow. Quantitative evaluation of the terminal phenotype associated with the CaKRE9 strain is performed using 2 x 103 cells/ml of overnight culture inoculated into 5.0 ml YNB either lacking or supplemented with 100 μg/ml tetracycline and measuring optical density (O.D.600) after 24 and 48 hr incubation at 30 °C. Typically, for strains in which a gene required for proliferation is under the control of an inducible promoter, no significant increase in optical density is detected after 48 hrs in the absence of inducer. Discrimination between cell death (cidal) and growth inhibitory (static) terminal phenotypes for a demonstrated essential gene is achieved by determining the percentage of viable cells (as judged by the number of colony forming units (CPU) from an equivalent of 2 x 103 washed cells at T=0) from the above tetracycline-treated cultures after 24 and 48 hours of incubation. Strains producing a cidal terminal phenotype are those which display a reduction in percent viable cells (i.e. < 2 x 103 CFU) following incubation under repressing conditions. To determine the variation in the level of a gene product under control of the tetracycline regulatable promoter the experiments described in Example 12 were performed.
EXAMPLE 12 Target Level Variation Under Induced and Repressed Conditions
Both a CaHIS3 heterozygote strain and a tetracycline promoter-regulated CaHIS3 strain in which one chromosomal copy of the CaHIS3 gene was disrupted and the other was under the control of a regulatable promoter were compared against a wild type (diploid) CaHIS3 strain for sensitivity towards the 3-aminotriazole (3-AT) (Figures 7A-7D). 3-AT is a competitive inhibitor of the enzyme encoded by CaHIS3, imidazoleglycerol phosphate dehydratase, and together serve as a model for a drug and drug target respectively. Overexpression, achieved by the constitutive expression level of CaHIS3 maintained by the tetracycline promoter, confers 3-AT resistance at concentrations sufficient to completely inhibit growth of both wild type and CaHIS3 heterozygote strains (Fig 7A). The phenotype observed is consistent with that expected in light of the predicted 7.5 fold overexpression oϊCaHIS3 determined by Northern bolt analysis (see Fig 8). A heterozygous CaHIS3 strain demonstrates enhanced sensitivity (i.e. haploinsufficient phenotype) to an intermediate 3-AT concentration unable to effect either wild type or tetracycline promoter-based overproducing CaHIS3 strains noticeably (Fig 7B). A third CaHIS3 expression level evaluated for differential sensitivity to 3-AT was produced by partial repression of the tetracycline regulated strain using a threshold concentration of tetracycline 0.1% that normally is used to achieve complete shut-off.
This level of CaHIS3 expression represents the minimum expression level required for viability and as predicted, demonstrates an enhanced drug sensitivity relative the heterozygous CaHIS3 strain at an intermediate 3-AT concentration (Fig 7C). Similarly, strain-specific drug resistance and sensitivity phenotypes to fluconazole and tunicamycin have been demonstrated by increasing and decreasing the level of expression of their respective known drug targets, CaERGll and CaALGl. Together these results demonstrate that three different levels of expression are achieved using the
C. albicans strain collection, and that they exhibit the predicted drug sensitivity phenotypes between known drugs and their known drug target. EXAMPLE 13
Identification of Candida albicans Genes which Encode a Gene Product
Required for Proliferation
Candida albicans genes which encode gene products required for proliferation were identified by constructing strains in which one chromosomal copy of a gene was disrupted and the other chromosomal copy of the gene was under the control of a regulatable promoter as described above. To identify genes which encode gene products required for proliferation, a strain containing the modified alleles of the gene was cultured under conditions wherein the second modified allele of the gene which is under conditional expression, was substantially underexpressed or not expressed. The viability and or growth of the strain was compared with that of a wild type strain cultured under the same conditions. A loss or reduction of viability or growth indicated that the gene product encoded by the gene is required for proliferation. The level of expression of the gene in strains prepared as described above can be less than 50% of the non-modified allele, less than 30%, less than 20%, and preferably less than 10%.
Depending on the heterologous promoter used, the level of expression can be controlled by, for example, antibiotics, metal ions, specific chemicals, nutrients, pH, temperature, etc.
For example, C. albicans conditional gene expression using the method described above was performed using CaKREl, CaKRES, CaKREό, and CaKRE9 (Fig.
9). CaKRE5, CaKREό, and CaKRE9 are predicted to be essential or conditionally essential (CaKRE9 null strains are nonviable on glucose but viable on galactose), in C. albicans as demonstrated by gene disruption using the Ura blaster method. CaKREl has been demonstrated as a nonessential gene using the Ura blaster method in C. albicans. Strains heterozygous for the above genes were constructed by PCR-based gene disruption method using the CaSATl disruption cassette followed by tetracycline regulated promoter replacement of the native promoter of the wild type allele. Robust growth of each of these strains suggests expression proceeds normally in the absence of tetracycline. When tetracycline is added to the growth medium, expression of these tetracycline promoter-regulated genes is greatly reduced or abolished. In the presence of tetracycline, the strains in which each of the three essential C. albicans genes cited above were under the control of a regulatable promoter stopped growing. As expected, only the CaKREl strain demonstrates robust growth despite repression of CaKREl expression.
To further examine the utility of the above method in target validation, growth of four additional strains in which expression of the known essential genes CaTUBl,
CaALG7, CaAURl, and CaFKSl, as well as the predicted essential gene CaSAT2, and CaKREl were under the control of a regulatable promoter were compared under inducing versus repressing conditions (Fig. 10 ). As expected, strains in which CaTUBl, CaALG7, CaAURl and CaFKSl were under the control of a regulatable promoter failed to grow under repressing conditions, unlike the strains in which the non- essential CaKREl was under the control of a regulatable promoter. Furthermore, as predicted, the strain in which the CaSAT2 gene was under the control of a regulatable promoter demonstrates essentiality of this gene in C. albicans. The CaSAT2 gene, which has been engineered as a dominant selectable marker for use in C. albicans, is a C. albicans gene that is homologous to a S. cerevisiae gene but is unrelated to the Satl gene of E. coli.
In all cases based on other disruption data that have been generated, this is the expected response if the tetracycline regulated gene is repressed to a level where it is nonfunctional in the presence of tetracycline. Furthermore, in applying the above methodology of conditional gene disruption to two additional C. albicans genes
(CaYPDl, and CaYNL194c) whose S. cerevisiae counterpart is known not to be essential, no inhibition of growth was observed when these strains were incubated in the presence of tetracycline. These results establish that the above method of conditional gene expression is a reliable indicator of gene essentiality. Furthermore, the utility of the present method, as a rapid and accurate means to identifying the complete set of essential genes in C. albicans, has been demonstrated by an analysis of the null phenotype of a large number of genes using the above two-step method of gene disruption and conditional expression. Target genes were selected as being fungal specific and essential. Such genes are referred to as target essential genes in the screening assays described below. A literature search identified reports of URA blaster-based gene disruption experiments on a total of 89 genes, of which 13 genes were presumed to be essential, based on the inability to construct homozygous deletion strains. The 13 genes are CaCCTδ (Rademacher et al., Microbiology, UK 144, 2951-2960 (1998)); CaFKSl (Mio et al., J. Bacteriol, 179, 4096-105 (1997); and Douglas, et al., Antimicrob Agents
Chemother 41, 2471-9 (1997)); CaHSP90 (Swoboda et al., Infect Immun 63, 4506-14 (1995)); CaKREό (Mio et al., J. Bacteriol 179, 2363-72 (1997)); CaNMTl (Weinberg et al., Mol Microbiol 16, 241-50 (1995)); CaPRSl (Payne et al., J. Med. Net. Mycol. 35, 305-12 (1997)); CaPSAl (Care et al., Mol Microbiol 34, 792-798 (1999)); CaRADό (Care et al., Mol Microbiol 34, 792-798 (1999)); CaSEC4 (Mao et al., J. Bacteriol 181,
7235-7242 (1999)); CaSEC14 (Monteoliva et al, Yeast 12, 1097-105 (1996)); CaSNFl (Petter et al., Infect Immun. 65, 4909-17 (1997)); CaTOP2 (Keller, et al., Biochem J., 329-39 (1997)); and CaEFT2 (Mendoza et al, Gene 229, 183-1991 (1999)). These 13 putatively essential genes and CaTUBl, CaALGl, and CaAURloϊ C. albicans are not initially identified by the above method. However, strains in which any one of these 17 genes are under the control of a regulatable promoter may be used in the methods of the present invention, for example, the CaTUBl, CaALGl, and CaAURl strains in Fig. 10 and the CaKREό strain in Fig. 9. Any of these 17 genes may be included as a control for comparisons in the methods described above, or as a positive control for essentiality in the collections of essential genes. The nucleic acid molecules comprising a nucleotide sequence corresponding to any of these 17 genes may be used in the methods of the present invention, as drug targets, or they may be included individually or in subgroups as controls in a kit or in a nucleic acid microarray.
Using methods such as those described above, the genes of SEQ ID Os: 14111-14944, which encode the polypeptides of SEQ ID ΝOs.: 14945-15778 were identified as being required for proliferation. Table VII, provided at the end of the present specification, lists the SEQ ID ΝOs. of the identified genes along with their Candida designation. The Candida designations provided in Table VII were formulated by identifying the Saccharomyces cerevisae gene which is homologous to the identified Candida albicans gene. The Candida designation also references the location of the homologous Saccharomyces cerevisae gene in the Saccharomyces cerevisae genom. For example, the Candida designation CaYAL038W means that the homologous Saccharomyces cerevisae gene was on yeast chromosome 1 (YB would mean yeast chromosome 2 etc), left arm of centromere (R means right arm of centromere), position 038, w for watson strand (c for crick strand). The homologous Saccharomyces cerevisae gene was identified from genome-www.stanford.edu/saccharomyces.
Homologous coding nucleic acids, homologous antisense nucleic acids and homologous polypeptides having homology to the genes of SEQ ID NOs: 14111-14944, nucleic acids complementary to SEQ ID NOs: 14111-14944, or the polypeptides of SEQ ID NOs.: 14945-15778 may be identified using any of the methods described above. An alternative method is available for assessing the essentiality of the modified gene in strains constructed as described above. Repression of expression of the modified gene allele within a strain constructed as described above may be achieved by homologous recombination-mediated excision of the gene encoding the transactivator protein. For example, where conditional expression of a target gene is achieved using the tetracycline-regulated promoter, constitutive expression (under nonrepressing conditions) may be repressed by homologous recombination-mediated excision of the transactivator gene (TetR-GAL4AD). In this way, an absolute achievable repression level is produced independently of that produced by tetracycline-mediated inactivation of the transactivator protein. Excision of the transactivator gene is made possible by virtue of the selectable marker and integration strategy used in strain construction.
Stable integration of the Cα t/&43-marked plasmid containing the TetR-GAL4AD transactivator gene into the CaLEW locus results in a tandem duplication of CaLEW flanking the integrated plasmid. Counterselection on 5-FOA-containing medium can then be performed to select for excision of the CaURA3-v sx eά transactivator gene and to directly examine whether this alternative repression strategy reveals the target gene to be essential.
Three examples of genes defined as essential on 5-FOA containing medium but lacking any detectable growth impairment on tetracycline supplemented medium are the genes, CaYCL052c, CaYNL194c and CaYJR046c. Presumably, this is due to the target gene exhibiting a lower basal level of expression under conditions where the transactivator gene has been completely eliminated than its gene product incompletely inactivated by addition of tetracycline. Thus, the method described above offers two independent approaches for the determination of whether or not a given gene is essential for viability of the host strain.
EXAMPLE 14 Promoter Replacement to Generate Cells Capable of Overexpressing or
Underexpressing a Gene Encoding a Gene Product Required for Proliferation A target for promoter replacement is selected. A promoter replacement cassette is obtained by inserting a nucleic acid comprising the rrnBTlT2 transcriptional terminator followed by the lac promoter into pACYC184 such that the rrnB terminator and lac promoter are positioned 3' of the CAT gene. The promoter replacement cassette
(CAT-rrnBTlT2-plac) is amplified by PCR. The PCR product is used as the template for another round of PCR using primers with 60-80 bp of homology to a target promoter (i.e. a promoter which directs expression of a gene encoding a gene product required for proliferation) and 20 bp of homology to the CAT/rrnBTlT2/plac template as described above. The region of homology is chosen such that upon homologous recombination, the CAT/rrnBTlT2/plac cassette replaces the promoter of the target gene but leaves its Shine-Delgarno motif untouched.
The promoter replacement cassette is transformed into competent JC8679. JC8679 is available from the E. coli genetics stock center. JC8679 allows recombination of short linear DNAs and also contains a lacY mutation which allows titratable regulation of the lac promoter. The transformed cells are plated onto LB/chloramphenicol plates containing various levels of IPTG to assure that the correct level of expression is achieved to allow survival. The correct integration of the promoter replacement cassette is confirmed by colony PCR. If desired, proper regulation of the target gene by the inserted promoter may be confirmed by testing the integrants for growth defects when inducer is absent or present at levels lower than that at which the original colonies were obtained. The inability to grow in the absence of inducer (IPTG) or in the presence of lower levels of the inducer than were used to obtain the clones confirms that the target gene is properly regulated by the inserted promoter. It will be appreciated that although the lac promoter and the strain JC8679 are used as examples, the method may be performed using any suitable regulatable promoter and organism or strain to generate cells which are capable of overexpressing or underexpressing a gene encoding a gene product required for proliferation.
EXAMPLE 15 Operator Insertion to Generate Cells Capable of Overexpressing or Underexpressing a Gene Encodmg a Gene Product Required for Proliferation
An oligonucleotide comprising a lac operator flanked on each side by 40 nucleotides homologous to the target promoter is designed. The target promoter is the promoter which drives expression of a gene encoding a gene product required for proliferation, such as the yabB yabCftsLftsI murE genes in an operon. The sequence of the oligonucleotide (SEQ ID NO. 15810) and locations of the regions homologous to the promoter are illustrated in Figure 11. The sequence of the promoter is also shown with the locations of the -10 and -35 regions indicated (SEQ ID NO. 15811). The single stranded oligonucleotide is transformed into a bacterium expressing the λ Beta and Gam proteins. The cells in the transformation mixture are diluted and plated on medium containing IPTG. Colonies in which the lac operator has integrated into the target promoter are identified by colony PCR. If desired, proper regulation of the target promoter by the inserted operator is confirmed by growing the identified colonies in medium containing or lacking IPTG. The colonies proliferate on medium containing IPTG but fail to grow on medium lacking IPTG, thereby confirming that the target promoter is properly regulated by the inserted operator. It will be appreciated that the preceding method may be performed with any target promoter and any operator to generate cells which overexpress or underexpress a gene encoding a gene product required for proliferation.
In the methods of the present invention, strains which overexpress or under express gene products required for proliferation are used to identify the gene product on which a compound which inhibits proliferation of an organism acts or to profile a compound's activity. Examples 16-18 describe methods for identifying the gene product on which a compound which inhibits the proliferation of an organism acts using cells which overexpress or underexpress a gene product required for proliferation. EXAMPLE 16
Strains in which a Gene Encoding a Gene Product Required for Proliferation is Overexpressed are able to Grow at Elevated Antibiotic Concentrations To confirm that cells which overexpress a gene product required for proliferation are able to grow at elevated antibiotic concentrations, 11 such genes from
Staphylococcus aureus which are the targets of known antibiotics were operably linked to the xylose inducible promoter XylT5 described above as follows. The genes and the antibiotics which target the products of these genes are listed in Table V below.
PCR primer pairs were designed for each of the 11 genes encoding a gene product required for proliferation oϊ Staphylococcus aureus as shown in Table V. The upstream primers for each gene included the native ribosomal binding sites (S-D sequences). In addition, restriction sites for appropriate restriction enzymes were designed into the primers to facilitate directional cloning of the genes. PCR reactions were carried out using Pfu DNA polymerase (Stratagene, San Diego) under the following conditions per 50 μl reaction: Pfu polymerase 2U, dNTP 200 μM, primers
400 nM each, S. aureus RN450 genomic DNA (template) 5-10 ng. The reaction involved an initial heating at 94°C for 5 min, followed by 25 cycles of 30 sec at 94°C/30 sec at 55°C/5 min at 72°C, and ending with 7 min of extension at 72°C.
The amplified genes were operably linked to the XylT5 promoter as follows. PCR products were cleaned using QIAGEN PCR Cleaning Kits and then were digested with the proper restriction enzymes. The resulting fragments were ligated overnight at 16°C with precut vector DNA containing the XylT5 promoter. Ligation mixtures were ethanol precipitated at -80°C for 20 min in the presence of 0.3 M sodium acetate. The precipitated DNA was spun down at 14,000 rpm for 30 min at 4°C and washed with 1 ml of 70% EtoH. The DNA pellets were air-dried and dissolved in EB or sterile water.
To transform Staphylococcus aureus cells, the precipitated DNA was mixed with 45 μl of electroporation competent cells and incubated at room temperature for 30 min. The DNA/cell mixtures were electroporated (settings: 2 volts, 25 μF, 200 Ω) in 2 mm cuvettes and mixed with 450 μl B2 medium containing 0.2 μg/ml chloramphenicol. The cells were incubated at 37°C with shaking for 90 min. Transformed cells were plated onto LB agar plates containing chloramphenicol (34 μg/ml) for the selection of plasmids. Several colonies for each cloning reaction were picked and streaked to obtain a pure culture. Colony PCR reactions using vector-specific primers were performed to verify the size and identity of the inserts.
155. Gene-walking sequencing was employed to completely sequence the entire insert for several clones of each cloned gene. This was carried out to avoid using a cloned gene whose DNA sequence was mutated during the PCR process.
To demonstrate that genes encoding gene products required for proliferation can confer resistance to their specific inhibitors upon induction at proper inducer levels, cells of each clone in which the genes were operably linked to the xylose inducible promoter were grown in LB medium with chloramphenicol (34 μg/ml) at a combination of differing antibiotic and inducer concentrations. This was accomplished by using microtitration plates (96 or 384 wells) which contained antibiotic and inducer at gradient concentrations in a matrix format in 10 times excess quantity (see Figure 12). Media containing inoculated cells (9 volume) was dispensed into the wells containing 1 volume of antibiotic/inducer for a final volume of 50 μl (for 384 well plates) or 200 μl
(for 96 well plates). The plates were incubated at 37°C with periodic shaking and growth of cells was monitored by automatic measurement of optical density at OD600 using a Ultramark reader. A clone over-expressing a particular gene was considered resistant to its specific antibiotic (inhibitor) if significant growth was observed at appropriate inducer concentrations in the presence of a particular concentration of antibiotic but not in the absence of inducer at that concentration of antibiotic.
The results are indicated in Figure 13 and Figure 14. As illustrated in Figure 13, at appropriate concentrations of inducer cells which overexpress the defB gene product were able to grow at elevated concentrations of the antibiotic actinonin, which acts on the defB gene product. Similarly, as illustrated in Figure 14, at appropriate concentrations of inducer cells which overexpress the folA gene product were able to grow at elevated concentrations of the antibiotic trimethoprim, which acts on the folA gene product.
Thus, elevated expression of a gene product required for proliferation enables cells to grow in the presence of antibiotic concentrations which inhibit or prevent growth of wild type cells. Table V - Essential Genes/Proteins and Specific Inhibitors
antibiotics unavailable commercially
THIS PAGE INTENTIONALLY LEFT BLANK.
EXAMPLE 17
Overexpression of Genes Encoding Gene Products Required for Proliferation Confers Specific Resistance to Antibiotics which Target the Overexpressed Gene Product To demonstrate that cells which overexpress a gene encoding a gene product required for proliferation are specifically resistant to antibiotics which target that gene product, the following experiments were performed. Several identical compound plates were prepared as described in Example 14 above in which different antibiotics were present in different wells. Media containing cells overexpressing different genes were separately dispensed into each one of these plates. Plate incubation and growth measurement were the same as described in Example 16 above. Growth was deemed specific if cells overexpressing one particular gene only gained resistance to antibiotics which target the product of the overexpressed gene but not to other antibiotics which target the products of genes which were not overexpressed.
As indicated in Figure 15 overexpression of the fabl gene conferred resistance to triclosan, which acts on the gene product of the fabl gene, enoyl-acyl carrier protein reductase. However, overexpression of the fabl gene did not confer resistance to cerulenin, trimethoprim, or actinonin, each of which act on other gene products.
Similarly, as indicated in Figure 16 overexpression of the folA gene conferred resistance to trimethoprim, which acts on the gene product of the folA gene, dihydrofolate reductase. However, overexpression of the folA gene did not confer resistance to triclosan, cerulenin, or actinonin, each of which act on other gene products.
As indicated in Figure 17 overexpression of the defB gene conferred resistance to actinonin, which acts on the gene product of the defB gene, peptide deformylase. However, overexpression of the defB gene did not confer resistance to cerulenin, trimethoprim, or triclosan, each of which act on other gene products.
As indicated in Figure 18 overexpression of the fabF gene conferred resistance to cerulenin, which acts on the gene product of the fabF gene, β keto-acyl carrier protein synthase II. However, overexpression of the fabF gene did not confer resistance to triclosan, trimethoprim, or actinonin, each of which act on other gene products.
Thus, overexpression of a gene encoding a gene product required for proliferation confers specific resistance to antibiotics which target the overexpressed gene product.
EXAMPLE 18 Selection of a Strain Overexpressing a Gene Encoding a Target Gene Product from a Mixture of Strains Overexpressing Genes Required for Proliferation To confirm that a strain expressing the gene product targeted by an antibiotic can be selected from a mixture of strains which each overexpress a different gene required for proliferation, the following experiment was performed. S. aureus strains overexpressing one of nine genes encodmg a gene product required for proliferation were constructed as described above. The nine overexpressed genes were fabF, defB, folA, fabl, ileS, fusA, gyrB, murA, rpoB. A mixture of the nine strains was grown wells in a 96 well plate in medium containing various concentrations of inducer and a sufficient concentration of actinonin, cerulenin, triclosan or trimethoprim to inhibit the growth of strains which do not overexpress the targets of these antibiotics.
Growth was observed in wells containing appropriate inducer concentrations and each one of the four antibiotics (See Figure 19). The cultures which grew in the presence of one of the antibiotics were analyzed as follows. The cultures were removed from the wells of the plate and single colonies were obtained by plating serial dilutions LB agar plates containing an appropriate antibiotic. Plasmids were isolated from at least 60 individual colonies for each culture and the genes which conferred antibiotic resistance were amplified by performing PCR reactions using vector-specific primers. The PCR products were then sequenced.
All of the plasmids obtained from the culture which grew in the presence of cerulenin contained the fabF sequence. Similarly, all of the plasmids obtained from clones which grew in the presence of triclosan contained the fabl gene. All of the plasmid obtained from colonies which grew in the presence of actinonin contained the defB gene. In addition, 81% of the plasmids obtained from colonies which grew in the presence of trimethoprim contained the folA gene. Growth conditions could be further optimized to provide 100% recovery of plasmids containing the folA gene.
These results demonstrate that a strain expressing the gene product targetted by an antibiotic can be selected from a mixture of strains which each overexpress a different gene required for proliferation.
EXAMPLE 19 Identification of Amplification Products Having Distinguishable Lengths As discussed above, plasmids in which antisense nucleic acids complementary to nucleotide sequences in the pbpC, secA, ylaO(Bs), yphC(Bs),trpS, polC, fabl, rpsR (Bs), fabF(yjaY), ileS, murC, fmhB, murA (Bs), murF(Bs), ftsZ, tufA, gyrA, rpoB, grlA or folA(dfrA) genes were transcribed from the XylT5 promoter were used to identify the foregoing genes as being required for proliferation. The sequences of the antisense nucleic acids are provided herein as follows:
tufA SEQ ID NO: 1359 ylaO SEQ ID NO: 1380 rpoB SEQ ID NO: 1392 polC SEQ ID NO: 1409 murC SEQ ID NO: 1416 fmhB SEQ ID NO: 1444 yphC SEQ ID NO 1463 gyrA SEQ ID NO 1483 ileS SEQ ID NO 1636 secA SEQ ID NO 1651 fabl SEQ ID NO 1697 murA SEQ ID NO 2086 grlA SEQ ID NO 2331 trpS SEQ ID NO 2505 folA SEQ ID NO 2526 pbpC SEQ ID NO 2634 fabF SEQ ID NO 2988 murF SEQ ID NO 3522 rpsR SEQ ID NO 3563 ftsZ SEQ ID NO 3598 Amplification primers were designed which would yield amplification products of the following lengths if the plasmid encoding the corresponding antisense nucleic acid is present in a mixture of nucleic acids: yphC 260bp secA 267bp folA 230 bp tufA 243bp fabl 220bp gyrA 225bp trpS 208bρ ileS 215bp fabF 189bp murF 203bp murA 176bp fmhB 181bp rpoB 159bp ylaO 169bp grlA 151bρ pbpC 156bp murC 129bp polC 145bp rpsR 109bp ftsZ 117bp
The 5' primer of each pair was complementary to a nucleotide sequence within the xylT5 promoter while 3' primer was complementary to a nucleotide sequence within the antisense clone. The 5' primer of each pair was identical for each amplification reaction. The nucleotide sequence GTTTCTT was appended on the 5' end of the 3' primers. One primer in each pair was labeled with either NIC or 6FAM.
Two sets of ten plasmids containing the antisense nucleic acids complementary to the genes listed in each of the columns above were mixed in equal amounts in 11 tubes except that either the plasmid encoding antisense nucleic acids complementary to a nucleotide sequence in the grlA gene or the plasmid encoding antisense nucleic acids complementary to nucleotide sequences in the fmhB gene were serially diluted two fold in each of the 11 tubes (i.e. the first tube had lOOpg of the grlA plasmid or the fmhB plasmid while the last tube had 0.1 Opg of the grlA plasmid or the fmhB plasmid). Amplification reactions were conducted on the mixtures and the amplification products were separated on a 5%> NuSieve 3:1 agarose gel (BioWhittaker Molecular Applications Rockland, ME). The levels of the 151bp or 181 amplification products for the grlA or fmhB primer respectively were specifically reduced in a stepwise fashion with increasing dilutions while the levels of the undiluted products remained constant. The assay readily detected a 10-fold decrease in template concentration reflected in the amplification products corresponding to the grlA or fmhB plasmids.
EXAMPLE 20 Selective Disappearance of Amplification Products Corresponding to Strains
Underexpressing a Gene Product on which a Compound which Inhibits Proliferation
Acts Strains of Staphylococcus aureus containing plasmids encoding antisense nucleic acids complementary to nucleotide sequences within the yphC, folA, fabl, trpS, fabF, murA, rpoB, grlA, murC or rpsR genes (described in Example 19 above) were mixed together in identical cultures such that the number of cells of each strain in the culture was identical. Each of the cultures containing the ten strains was contacted with one of the following antibiotics at one of the following concentrations: spectinomycin- 2.5, 5.0ug/ml mupriocin- 4.3, 8.6, 17.2ug/ml. cerulenin- 4.5, 9.0, 18.0ug/ml
Spectinomycin acts on the product of the rpsR gene, mupriocin acts on the product of the ileS gene and cerulenin acts on the product of the FabF gene. The middle concentration for each antibiotic is its IC50. The culture containing the ten strains were grown in rich medium (L-Broth; for antisense LB + chloroamphenicol to maintain antisense plasmid) until the cells reached early log phase then contacted with of one of the above-stated compounds at one of the concentrations listed above (preferably near IC50). The cultures were grown for a sufficient length of time to permit the compounds to specifically inhibit the growth of strains underexpressing their targets. Preferably the cultures were grown at least 16 hr, more preferably between 24 and 48 hrs. It is desirable to avoid allowing the culture to grow for time periods which might places selective pressure on the strains which could lead to false positives.
The cells were harvested by centrifugation and plasmid DNA was isolated from the cultures. PCR amplifications were performed as described in Example 19. Amplification products were run on NuSieve agarose gels as described above. The amounts of the amplification products corresponding to each antisense nucleic acid were determined and compared to those in a control culture which was not contacted with the drug or to the amounts of the amplification products corresponding to the other antisense nucleic acids which were not complementary to nucleotide sequences in the genes encoding the gene products on which the compounds act. In each case, only the amplification product corresponding to the target on which the antibiotic acts was not detectable on the gel.
It is desirable, in embodiments in which the level or activity of gene products is regulated by transcribing antisense nucleic acids complementary to gene products required for proliferation or by replacing the native promoters of such genes with regulatable promoters, to perform dose-response curve for the inducer used to induce transcription of the antisense nucleic acids or induce transcription from the regulatable promoter. In such embodiments, it is desirable to use the lowest concentration of inducer which provides optimal transcription levels for detecting the effects of a particular test compound while interfering as little as possible with the growth of strains which do not overexpress or underexpress the target on which the compound acts. It also desirable contact the cultures with varying amounts of test compounds to determine the optimal amounts for obtaining differential growth of strains which overexpress or underexpress the targets on which the compounds act. Preferably, if the strains overexpress gene products required for proliferation, the level of the compound is preferably about IC90 or above . Preferably, if the strains underexpress gene products required for proliferation, the level of the compound is preferably about IC50 or below . It will be appreciated that, if desired, the amplification products may be detected using the dyes described above. It will also be appreciated that amplification products may be detected using any desired amplification method including RT-PCR and PCR. It will be appreciated that no matter how detailed the foregoing appears in text, the invention can be practiced in many ways. As is also stated above, it should further be noted that the use of particular terminology when describing certain features or aspects of the present invention should not be taken to imply that the broadest reasonable meaning of such terminology is not intended, or that the terminology is being re-defined herein to be restricted to including any specific characteristics of the features or aspects of the invention with which that terminology is associated. Thus, although this invention has been described in terms of certain preferred embodiments, other embodiments which will be apparent to those of ordinary skill in the art in view of the disclosure herein are also within the scope of this invention. Accordingly, the scope of the mvention is intended to be defined only by reference to the appended claims and any equivalents thereof. All documents cited herein are incoφorated herein by reference in their entireties
TABLE VI A
SeqID Clone name Organism
1195 P1M10000060H02 Pseudomonas aeruginosa
1196 P1M10000060H04 Pseudomonas aeruginosa
1197 P1M10000061B04 Pseudomonas aeruginosa
1198 P1M10000061E04 Pseudomonas aeruginosa
1199 P1M10000061F04 Pseudomonas aeruginosa
1200 P1M10000062A12 Pseudomonas aeruginosa
1201 P1M10000062C03 Pseudomonas aeruginosa
1202 P1M10000062C04 Pseudomonas aeruginosa
1203 P1M10000062C07 Pseudomonas aeruginosa
1204 P1M10000062C12 Pseudomonas aeruginosa
1205 P1M10000062D07 Pseudomonas aeruginosa
1206 P1M10000062D08 Pseudomonas aeruginosa
1207 P1M10000062E08 Pseudomonas aeruginosa
1208 P1M10000062F06 Pseudomonas aeruginosa
1209 P1M10000062G11 Pseudomonas aeruginosa
1210 P1M10000062H01 Pseudomonas aeruginosa
1211 P1M10000062H04 pseudomonas aeruginosa
1212 P1M10000063F02 \Pseudomonas aeruginosa
1213 P1M10000063G02 Pseudomonas aeruginosa
1214 P1M10000063H02 Pseudomonas aeruginosa
1215 P1M10000064A10 Pseudomonas aeruginosa
1216 P1M10000064C02 Pseudomonas aeruginosa
1217 P1M10000064C03 Pseudomonas aeruginosa
1218 P1M10000064D03 Pseudomonas aeruginosa
1219 P1M10000064E05 Pseudomonas aeruginosa
1220 P1M10000064G12 Pseudomonas aeruginosa
1221 P1M10000064H07 Pseudomonas aeruginosa
1222 P1M10000065A04 Pseudomonas aeruginosa
1223 P1M10000065B07 Pseudomonas aeruginosa
1224 P1M10000065C03 Pseudomonas aeruginosa
1225 P1M10000065C05 Pseudomonas aeruginosa
1226 P1M10000065D06 Pseudomonas aeruginosa
1227 P1M10000065F01 Pseudomonas aeruginosa
1228 P1M10000065G06 Pseudomonas aeruginosa
1229 P1M10000065H07 Pseudomonas aeruginosa
1230 P1M10000066A10 Pseudomonas aeruginosa
1231 P1M10000066A11 Pseudomonas aeruginosa
1232 P1M10000066F04 Pseudomonas aeruginosa
1233 P1M10000067A05 Pseudomonas aeruginosa
1234 P1M10000067A06 Pseudomonas aeruginosa
1235 P1M10000067A08 Pseudomonas aeruginosa SeqID Clone name Organism
1318 P1M10000087C09 Pseudomonas aeruginosa
1319 P1M10000087E04 Pseudomonas aeruginosa
1320 P1M10000087F04 Pseudomonas aeruginosa
1321 P1M10000087F09 Pseudomonas aeruginosa
1322 P1M10000088A07 Pseudomonas aeruginosa
1323 P1M10000088D06 Pseudomonas aeruginosa
1324 P1M10000089C08 Pseudomonas aeruginosa
1325 P1M10000089D11 Pseudomonas aeruginosa
1326 P1M10000089G08 Pseudomonas aeruginosa
1327 P1M10000090B11 Pseudomonas aeruginosa
1328 P1M10000090F06 Pseudomonas aeruginosa
1329 P1M10000090F08 seudomonas aeruginosa
1330 P1M10000091D02 Pseudomonas aeruginosa
1331 P1M10000091E09 Pseudomonas aeruginosa
1332 P1M10000091G10 Pseudomonas aeruginosa
1333 P1M10000092B02 Pseudomonas aeruginosa
1334 P1M10000092B10 Pseudomonas aeruginosa
1335 P1M10000092D09 Pseudomonas aeruginosa
1336 P1M10000092E02 Pseudomonas aeruginosa
1337 P1M10000092F05 Pseudomonas aeruginosa
1338 P1M10000093 A03 Pseudomonas aeruginosa
1339 P1M10000093B09 Pseudomonas aeruginosa
1340 P1M10000093C08 Pseudomonas aeruginosa
1341 P1M10000093E09 Pseudomonas aeruginosa
1342 P1M10000093F03 Pseudomonas aeruginosa
1343 P1M10000093H07 Pseudomonas aeruginosa
1344 P1M10000094F04 Pseudomonas aeruginosa
1345 P1M10000094H03 Pseudomonas aeruginosa
1346 P1M10000095C01 Pseudomonas aeruginosa
1347 P1M10000095C09 Pseudomonas aeruginosa
1348 P1M10000095E04 Pseudomonas aeruginosa
1349 P1M10000095G04 Pseudomonas aeruginosa
1350 P1M10000096E04 Pseudomonas aeruginosa
1351 P1M10000096E12 Pseudomonas aeruginosa
1352 ID2 Pseudomonas aeruginosa
1353 4.1 Pseudomonas aeruginosa
1354 S1M10000001A05 Staphylococcus aureus
1355 S1M10000001A08 Staphylococcus aureus
1356 S1M10000001A09 Staphylococcus aureus
1357 S1M10000001A10 Staphylococcus aureus
1358 S1M10000001C06 Staphylococcus aureus
316 SeqID Clone name Organism
3696 S4M10000010D04 Salmonella typhimurium
3697 S4M10000010H04 Salmonella typhimurium
3698 S4M10000011D08 Salmonella typhimurium
3699 S4M10000011E08 Salmonella typhimurium
3700 S4M10000012B06 Salmonella typhimurium
3701 S4M10000012B12 Salmonella typhimurium
3702 S4M10000012D02 Salmonella typhimurium
3703 S4M10000013H02 Salmonella typhimurium
3704 S4M10000014B05 Salmonella typhimurium
3705 S4M10000014D04 Salmonella typhimurium
3706 S4M10000014D07 Salmonella typhimurium
3707 S4M10000014H02 Salmonella typhimurium
3708 S4M10000015B11 Salmonella typhimurium
3709 S4M10000015E09 Salmonella typhimurium
3710 S4M10000016A02 Salmonella typhimurium
3711 S4M10000018D09 Salmonella typhimurium
3712 S4M10000018E10 Salmonella typhimurium
3713 S4M10000018F10 Salmonella typhimurium
3714 S4M10000018G03 Salmonella typhimurium
3715 S4M10000018H04 Salmonella typhimurium
3716 S4M10000019F05 Salmonella typhimurium
3717 S4M10000019G04 Salmonella typhimurium
3718 S4M10000019G05 Salmonella typhimurium
3719 S4M10000019H06 Salmonella typhimurium
3720 S4M10000020A04 Salmonella typhimurium
3721 S4M10000020F05 Salmonella typhimurium
3722 S4M10000020G10 Salmonella typhimurium
3723 S4M10000022D04 Salmonella typhimurium
3724 S4M10000022D12 Salmonella typhimurium
3725 S4M10000022E12 Salmonella typhimurium
3726 S4M10000022G07 Salmonella typhimurium
3727 S4M10000022H06 Salmonella typhimurium
3728 S4M10000023F01 Salmonella typhimurium
3729 S4M10000024B02 Salmonella typhi munum
3730 S4M10000024C06 Salmonella typhimurium
3731 S4M10000024C11 Salmonella typhimurium
3732 S4M10000024F08 Salmonella typhimurium
3733 S4M10000024G01 Salmonella typhimurium
3734 S4M10000024G04 Salmonella typhimurium
3735 S4M10000024G09 Salmonella typhimurium
3736 S4M10000024H02 Salmonella typhimurium SeqID Clone name Organism
3778 S4M10000020F08 Salmonella typhimurium
3779 S4M10000021E07 Salmonella typhimurium
3780 S4M10000022B05 Salmonella typhimurium
3781 S4M10000025H11 Salmonella typhimurium
3782 S4M10000026B10 Salmonella typhimurium
3783 S4M10000026E03 Salmonella typhimurium
3784 S4M10000029A03 Salmonella typhimurium
3785 S4M10000029C11 Salmonella typhimurium
3786 S4M10000030F06 Salmonella typhimurium
3787 S4M10000032F03 Salmonella typhimurium
3788 S4M10000032G01 Salmonella typhimurium
3789 S4M10000034C05 Salmonella typhimurium
3790 S4M10000034H04 Salmonella typhimurium
3791 S4M10000035A09 Salmonella typhimurium
3792 S4M10000035B06 Salmonella typhimurium
3793 S4M10000035F01 Salmonella typhimurium
3794 S4M10000037A08 Salmonella typhimurium
3795 S4M10000037E03 Salmonella typhimurium
TABLE VI B
TABLE VI C
TABLE VII
Candida Candida
SEQ ID NO. designation SEQ ID NO. designation
14111 CaYDL105W 14151 CaYOL026C
14112 CaYJL090C 14152 CaYGR251W
14113 CaYLR127C 14153 CaYDR118W
14114 CaYNL151 C 14154 CaYJL085W
14115 CaYPL083C 14155 CaYDR052C
14116 CaYHR036W 14156 CaYGR002C
14117 CaYNL256W 14157 CaYLL004W
14118 CaYOL149W 14158 CaYOR075W
14119 CaYDR361C 14159 CaYMROOδW
14120 CaYDR407C 14160 CaYHR172W
14121 CaYBR070C 14161 CaYGL122C
14122 CaYOR148C 14162 CaYOR287C
14123 CaYJR041C 14163 CaYMR149W
14124 CaYGROΘOW 14164 CaYKR071C
14125 CaYBR123C 14165 CaYDR412W
14126 CaYHR118C 14166 CaYKR025W
14127 CaYKR063C 14167 CaYJR112W
14128 CaYOR004W 14168 CaYMR277W
14129 CaYML025C 14169 CaYKR083C
14130 CaYKL033W 14170 CaYNL245C
14131 CaYDR498C 14171 CaYNL181W
14132 CaYlROHC 14172 CaYNL260C
14133 CaYMR220W 14173 CaYDR365C
14134 CaYPR105C 14174 CaYNL149C
14135 CaYDL153C 14175 CaYGL029W
14136 CaYPL128C 14176 CaYOR057W
14137 CaYER026C 14177 CaYIL022W
14138 CaYKL004W 14178 CaYMR203W
14139 CaYMR200W 14179 CaYOR206W
14140 CaYPR165W 14180 CaYBR167C
14141 CaYHR007C 14181 CaYDR016C
14142 CaYJL087C 14182 CaYNL306W
14143 CaYLR229C 14183 CaYJR067C
14144 CaYER1 18C 14184 CaYDR362C
14145 CaYPL228W 14185 CaYLR355C
14146 CaYPL160W 14186 CaYLR105C
14147 CaYHR101C 14187 CaYML127W
14148 CaYML085C 14188 CaYPLOHC
14149 CaYBR243C 14189 CaYKL108W
14150 CaYLR342W 14190 CaYCR035C Candida Candida Q ID NO. designation SEQ ID NO. designation
14191 CaYML114C 14235 CaYLR002C
14192 CaYNL118C 14236 CaYJL061W
14193 CaYDR527W 14237 CaYLR071C
14194 CaYBR256C 14238 CaYML031W
14195 CaYGL233W 14239 CaYIL147C
14196 CaYLR103C 14240 CaYJL025W
14197 CaYOR340C 14241 CaYOR353C
14198 CaYPR175W 14242 CaYKR008W
14199 CaYJR093C 14243 CaYMR033W
14200 CaYCL031C 14244 CaYNL313C
14201 CaYML130C 14245 CaYGL225W
14202 CaYAL033W 14246 CaYNL308C
14203 CaYNL062C 14247 CaYDR353W
14204 CaYNL132W 14248 CaYIL068C
14205 CaYDL193W 14249 CaYPR190C
14206 CaYDR489W 14250 CaYOR174W
14207 CaYJL069C 14251 CaYDL150W
14208 CaYPL063W 14252 CaYAL041W
14209 CaYNL232W < 14253 CaYMR227C
14210 CaYNR054C 14254 CaYPL043W
14211 CaYGR245C 14255 CaYDR324C
14212 CaYPR162C 14256 CaYOL022C
14213 CaYHR058C 14257 CaYOL069W
14214 CaYKR081C 14258 CaYGR156W
14215 CaYNL240C 14259 CaYDL003W
14216 CaYPR168W 14260 CaYDR228C
14217 CaYKL099C 14261 CaYKR062W
14218 CaYLR008C 14262 CaYDR398W
14219 CaYOL142W 14263 CaYNL126W
14220 CaYDL015C 14264 CaYKL089W
14221 CaYDR472W 14265 CaYMR028W
14222 CaYNR046W 14266 CaYDR299W
14223 CaYDR473C 14267 CaYOL034W
14224 CaYGL207W 14268 CaYGR119C
14225 CaYHR088W 14269 CaYDL111C
14226 CaYIR015W 14270 CaYHR052W
14227 CaYHR197W 14271 CaYKL021C
14228 CaYMR218C 14272 CaYLL031C
14229 CaYKL182W 14273 CaYHR040W
14230 CaYDR325W 14274 CaYML015C
14231 CaYLL003W 14275 CaYIL004C
14232 CaYNR026C 14276 CaYDR302W
14233 CaYNL251C 14277 CaYPR133C
14234 CaYPL126W 14278 CaYDL195W Candida Candida
SEQ ID NO. designation SEQ ID NO. designation
14279 CaYCR052W 14323 CaYBR253W
14280 CaYFR042W 14324 CaYBR254C
14281 CaYNR017W 14325 CaYCL003W
14282 CaYOR254C 14326 CaYCL017C
14283 CaYFL029C 14327 CaYCL054W
14284 CaYBR265W 14328 CaYCR012W
14285 CaYNL312W 14329 CaYCR057C
14286 CaYBR155W 14330 CaYCR072C
14287 CaYGR280C 14331 CaYDL030W
14288 CaYJL203W 14332 CaYDL043C
14289 CaYIR012W 14333 CaYDL055C
14290 CaYMR093W 14334 CaYDL060W
14291 CaYPR137W 14335 CaYDL084W
14292 CaYLR298C 14336 CaYDL087C
14293 CaYBR192W 14337 CaYDL126C
14294 CaYPR112C 14338 CaYDL132W
14295 CaYLLOHW 14339 CaYDL141W
14296 CaYER082C 14340 CaYKL059C
14297 CaYDL217C 14341 CaYDL108W
14298 CaYFL035C 14342 CaYKL060C
14299 CaYOR262W 14343 CaYHR070W
14300 CaYLR323C 14344 CaYGR195W
14301 CaYAR007C 14345 CaYOL102C
14302 CaYBL023C 14346 CaYOR074C
14303 CaYBL026W 14347 CaYGL155W
14304 CaYBL030C 14348 CaYLR305C
14305 CaYBL035C 14349 CaYNL222W
14306 CaYBL040C 14350 CaYDR236C
14307 CaYBLOδOW 14351 CaYBL020W
14308 CaYBL076C 14352 CaYNL261W
14309 CaYBR002C 14353 CaYDR246W
14310 CaYBR029C 14354 CaYNL075W
14311 CaYBROδOC 14355 CaYOR145C
14312 CaYBR091C 14356 CaYOL077C
14313 CaYBR135W 14357 CaYBR257W
14314 CaYBR142W 14358 CaYHR170W
14315 CaYBR143C 14359 CaYNL263C
14316 CaYBR160W 14360 CaYKR068C
14317 CaYBR196C 14361 CaYPR016C
14318 CaYBR198C 14362 CaYGR172C
14319 CaYBR202W 14363 CaYHR089C
14320 CaYBR234C 14364 CaYMR197C
14321 CaYBR236C 14365 CaYHR188C
14322 CaYBR237W 14366 CaYPL266W Candida Candida
SEQ ID NO. designation SEQ ID NO. designation
14367 CaYBROHC 14411 CaYFL017C
14368 CaYCL059C 14412 CaYFL022C
14369 CaYDLOOδW 14413 CaYFL03δC
14370 CaYDL097C 14414 CaYFL045C
14371 CaYDL143W 14415 CaYFR004W
14372 CaYDL205C 14416 CaYFR037C
14373 CaYDL208W 14417 CaYFROδOC
14374 CaYDR002W 14418 CaYFR0δ2W
14375 CaYDR013W 14419 CaYDL029W
14376 CaYDR023W 14420 CaYDL147W
14377 CaΫDR037W 14421 CaYDL14δC
14378 CaYDR045C 14422 CaYDR060W
14379 CaYDR054C 14423 CaYDR062W
14380 CaYDR086C 14424 CaYDR211W
14381 CaYDR0δ7C 14425 CaYDR323C
14382 CaYDR091C 14426 CaYER025W
14383 CaYDR167W 14427 CaYER136W
14384 CaYDR172W 14428 CaYER171W
14385 CaYDR1δ9W 14429 CaYFLOOδW
14386 CaYDR196C 14430 CaYGLOOIC
14387 CaYDR212W 14431 CaYGLOOδC
14388 CaYDR233C 14432 CaYGLOHC
14389 CaYDR280W 14433 CaYGL022W
14390 CaYDR331W 14434 CaYGL044C
14391 CaYDR373W 14435 CaYGL048C
14392 CaYDR376W 14436 CaYGL068W
14393 CaYDR390C 14437 CaYGL097W
14394 CaYDR394W 14438 CaYGL112C
14395 CaYDR404C 14439 CaYGL120C
14396 CaYDR429C 14440 CaYGL130W
14397 CaYDR454C 14441 CaYGR029W
14398 CaYEL020W-A 14442 CaYGR060W
14399 CaYEL026W 14443 CaYGR094W
14400 CaYER003C 14444 CaYGR103W
14401 CaYER006W 14445 CaYGR185C
14402 CaYER012W 14446 CaYGR211W
14403 CaYER021W 14447 CaYGR218W
14404 CaYER036C 14448 CaYGR246C
14405 CaYER094C 14449 CaYGR2δ3C
14406 CaYER125W 14450 CaYHLOIδW
14407 CaYER148W 14451 CaYHROOδC-A
14408 CaYER159C 14452 CaYHR019C
14409 CaYFL002C 14453 CaYHR020W
14410 CaYFLOOδW 14454 CaYHR024C Candida Candida
SEQ ID NO. designation SEQ ID NO. designation
14456 CaYHR062C 14499 CaYKR086W
14456 CaYHR072W 14600 CaYLL018C
14457 CaYHR072W-A 14501 CaYLROOδW
14458 CaYHROSOC 14602 CaYLR009W
14459 CaYHR122W 14603 CaYLR022C
14460 CaYHR143W-A 14504 CaYLR026C
14461 CaYHR148W 14505 CaYLR051C
14462 CaYHR165C 14506 CaYLR060W
14463 CaYHR166C 14507 CaYLR078C
14464 CaYHR169W 14508 CaYLRIOOW
14465 CaYHR190W 14509 CaYLR116W
14466 CaYIL003W 14510 CaYLR117C
14467 CaYIL021W 14511 CaYLR129W
14468 CaYIL07δC 14512 CaYLR147C
14469 CaYIL07δW 14513 CaYLR153C
14470 CaYIL142W 14514 CaYLR163C
14471 CaYIROOδC 14516 CaYLR175W
14472 CaY!R022W 14516 CaYLR186W
14473 CaYJLOOIW 14517 CaYLR197W
14474 CaYJL014W 14518 CaYLR20δW
14475 CaYJLOδOW 14519 CaYLR222C
14476 CaYJL074C 14520 CaYLR259C
14477 CaYJL081C 14521 CaYLR276C
14478 CaYJL104W 14522 CaYLR277C
14479 CaYJL111W 14523 CaYLR291C
14480 CaYJL143W 14524 CaYLR293C
14481 CaYJL167W 14525 CaYLR347C
14482 CaYJL194W 14526 CaYLR378C
14483 CaYJR006W 14527 CaYLR397C
14484 CaYJR017C 14528 CaYML064C
14485 CaYJR064W 14529 CaYML069W
14486 CaYJR065C 14530 CaYML092C
14487 CaYJR072C 14531 CaYML093W
1448δ CaYJR123W 14532 CaYML12δC
14489 CaYKL012W 14533 CaYML126C
14490 CaYKL019W 14534 CaYMR113W
14491 CaYKL028W 14536 CaYMR131C
14492 CaYKL058W 14536 CaYMR146C
14493 CaYKL104C 14537 CaYMR208W
14494 CaYKL144C 14538 CaYMR213W
14495 CaYKL14δW 14539 CaYMR240C
14496 CaYKL172W 14540 CaYMR260C
14497 CaYKL210W 14541 CaYMR30δC
14498 CaYKR079C 14542 CaYMR314W Candida Candida
SEQ ID NO. designation SEQ ID NO. designation
14643 CaYNL002C 14567 CaYPL211W
14544 CaYNLOOδW 145δδ CaYPL235W
14545 CaYNL061W 14589 CaYPL252C
14546 CaYNL102W 14590 CaYPR019W
14547 CaYNL113W 14591 CaYPR025C
14548 CaYNL178W 14592 CaYPR034W
14549 CaYNL1δ9W 14593 CaYPROδδW
14550 CaYNL244C 14594 CaYPR0δ6W
14551 CaYNL247W 14596 CaYPR082C
14552 CaYNL287W 14596 CaYPR103W
14553 CaYNR043W 14597 CaYPR107C
14554 CaYOLOOδC 14598 CaYPRIOδW
14555 CaYOL010W 14599 CaYPRHOC
14556 CaYOL094C 14600 CaYPR113W
14557 CaYOL139C 14601 CaYPR176C
14558 CaYOR04δC 14602 CaYPR1δ3W
14559 CaYOROδδC 14603 CaYPR136C
14560 CaYOR063W 14604 CaYPR187W
14561 CaYOR103C 14605 CaYGL123W
14562 CaYOR116C 14606 CaYHR042W
14563 CaYOR117W 14607 CaYIL062C
14564 CaYOR1δ1C 14608 CaYJR042W
14565 CaYOR1δ7C 14609 CaYJR063W
14566 CaYOR1δ9C 14610 CaYJR076C
14567 CaYOR16δW 14611 CaYKL013C
14568 CaYOR194C 14612 CaYLR196W
14569 CaYOR207C 14613 CaYLR272C
14570 CaYOR210W 14614 CaYNR035C
14571 CaYOR217W 14615 CaYPROδδC
14572 CaYOR224C 14616 CaYDR397C
14573 CaYOR232W 14617 CaYAL032C
14574 CaYOR2δ9C 14618 CaYBR060C
14575 CaYOR261C 14619 CaYBR154C
14576 CaYOR272W 14620 CaYDL023C
14577 CaYOR294W 14621 CaYDROδδC
14576 CaYOR310C 14622 CaYDR23δW
14579 CaYOR33δC 14623 CaYDR267C
14580 CaYOR341W 14624 CaYDR460W
14581 CaYPLOIOW 14625 CaYEL032W
14582 CaYPL076W 14626 CaYER013W
14583 CaYPL094C 14627 CaYER048W-A
14584 CaYPL117C 14628 CaYER172C
14585 CaYPL122C 14629 CaYFR031C
14586 CaYPL131W 14630 CaYGL06δC Candida Candida
SEQ ID NO. designation SEQ ID NO. designation
14631 CaYGL073W 14675 CaYOR249C
14632 CaYGL091 C 14676 CaYOR250C
14633 CaYGL103W 14677 CaYOR267W
14634 CaYGL116W 14676 CaYOR370C
14636 CaYGL201 C 14679 CaYPL1δ1C
14636 CaYGL245W 14660 CaYPL204W
14637 CaYGL247W 14681 CaYPL209C
14638 CaYGR047C 14682 CaYPL242C
14639 CaYGR074W 14683 CaYPR048W
14640 CaYGR083C 14684 CaYPR0δ6W
14641 CaYGR12δC 14685 CaYPR17δW
14642 CaYHR074W 14686 CaYIL109C
14643 CaYHR107C 14687 CaYKL04δW
14644 CaYIL126W 1468δ CaYLR316C
14645 CaYJLOIOC 14669 CaYBR037W
14646 CaYJLOH C 14690 CaYGR04δW
14647 CaYJL026W 14691 CaYPL169C
14648 CaYJL039C 14692 CaYGR1δ6W
14649 CaYJL041W 14693 CaYNL131W
14650 CaYJR045C 14694 CaYLROδδW
14661 CaYKL049C 14696 CaYKL193C
14662 CaYKL1 δ2C 14696 CaYJR007W
14663 CaYKL1δ1W 14697 CaYJL034W
14654 CaYLR0δ6W 14693 CaYDL207W
14656 CaYLR116W 14699 CaYDL017W
14656 CaYLR223C 14700 CaYAL03δW
14657 CaYLR274W 14701 CaYBR033W
14658 CaYLR336C 14702 CaYBR1δ9W
14659 CaYML06δW 14703 CaYDR120C
14660 CaYML098W 14704 CaYER070W
14661 CaYMR043W 14706 CaYGL003C
14662 CaYMR112C 14706 CaYGL206C
14663 CaYMR281W 14707 CaYAL043C
14664 CaY R288W 1470δ CaYBL097W
14665 CaYMR290C 14709 CaYBLIOδC
14666 CaYMR309C 14710 CaYBR079C
14667 CaYNL039W 14711 CaYBROδδC
14668 CaYNLHOC 14712 CaYDL14δC
14669 CaYNL221C 14713 CaYDL166C
14670 CaYNL317W 14714 CaYDR145W
14671 CaYNR053C 14716 CaYDR170C
14672 CaYOL038W 14716 CaYDR301W
14673 CaYOR095C 14717 CaYDR631W
14674 CaYOR204W 14718 CaYFL024C Candida Candida
SEQ ID NO. designation SEQ ID NO. designation
14719 CaYFR002W 14763 CaYPR041W
14720 CaYGR264C 14764 CaYGR255C
14721 CaYHR023W 14766 CaYBROδδC
14722 CaYHR027C 14766 CaYER022W
14723 CaYJLOOδC 14767 CaYKL014C
14724 CaYJL033W 14763 CaYIL046W
14725 CaYJL054W 14769 CaYMROIδC
14726 CaYJL109C 14770 CaYNL2δOC
14727 CaYJL125C 14771 CaYML07δC
14728 Ca YJL156C 14772 CaYCR042C
14729 CaYJR002W 14773 CaYMR23δC
14730 CaYKL192C 14774 CaYIL026C
14731 CaYLL034C 14776 CaYPLOδδW
14732 CaYLR029C 14776 CaYGROOδC
14733 CaYLR167W 14777 CaYOL144W
14734 CaYLR243W 14773 CaYHROOδC
14735 CaYLR249W 14779 CaYGR013W
14736 CaYLR321 C 14760 CaYILHδC
14737 CaYLR383W 14781 CaYGR147C
14738 CaYMR239C 14782 CaYOR336W
14739 CaYNLOδδW 14783 CaYPR159W
14740 CaYNL163C 14764 CaYJL174W
14741 CaYNR03δW 147δ5 CaYOL130W
14742 CaYOL097C 14766 CaYNL04δW
14743 CaYOR260W 14767 CaYER007W
14744 CaYPL02δW 14788 CaYGL106W
14745 CaYPL153C 14789 CaYDL102W
14746 CaYPL210C 14790 CaYDL007W
14747 CaYPL217C 14791 CaYER031C
14748 CaYPROIOC 14792 CaYDR226W
14749 CaYPR144C 14793 CaYOR349W
14750 CaYPR169W 14794 CaYNL146C
14751 CaYDL140C 14796 CaYPR119W
14752 CaYDL031W 14796 CaYMROδδC
14753 CaYHR136C 14797 CaYFLOIδC
14764 CaYPL093W 14798 CaYNL23δW
14765 CaYKL035W 14799 CaYPL231W
14756 CaYDL058W 14800 CaYNL02δC
14757 CaYDR341C 14801 CaYJL141C
14758 CaYGL238W 14602 CaYLR306W
14769 CaYFR02δC 14603 CaYLR300W
14760 CaYNL172W 14304 CaYKL046C
14761 CaYDR190C 14605 CaYDR311W
14762 CaYELOδδC 14δ06 CaYDR449C o ro ro ro ϋ Φ t tt t t t t t t r
o z ,- Cv| ^ 10 D N ω ffl O ^ CNl CO ^ IΛ © N (IO ffi O ^ N CO ^ W O N CO CO O - C\J rt ^ W CD CO Cδ O - r«J CO }- in iO in U5 U) lO ) W CD CO © tO CO CD CD <O tD CO S N S S N N S S CO « CO CO OO OO CO CO CO CO CD O) CJ) Cn Q co oo co co co co co oo αD co co co co co co oo oo oo co co co co co oo co co co co co co rø ai
CO ιr>
CO S O - CNI O ^ O CO S OO CB O - CVI O ^ W D S O IS O T- N C ^ lO tD N O OJ O T- tVI C Tf in cD N O n O O O τ- - - - ^ - - - - τ- CM CNJ C < CM <N CM CSl ( CM CO C C CO C CO C C C r ^ rt t r ^ ^ ^ ^ ^ LO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO CO αD CO CO CO CO CO CO CO CO CO
h r}- OO t o
^ LO (D S CO ro O '^ CVI C ^ UI ID S OO Q O - OJ CO ^ U CD S OO ffi O r- C ' lO tO N CO CS O T- N CO ' lO tD CO
9§ CB CS O O O O O O O O O O t- T- - T- T- - T- r - T- CM OI tM N N I CM CN CM N n n c n t r C rt C
(»coooooroo)C!)cnci)C5fficarocn(3)coQCflO)cscBC5cncoc»o)roc5©

Claims

WHAT IS CLAIMED IS:
1. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
2. The method of Claim 1, wherein said culture includes at least one strain which does not overexpresses a gene product which is essential for proliferation of said organism.
3. The method of Claim 1, wherein said strains which overexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.
4. The method of Claim 1, wherein said strains which overexpress said gene products a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.
5. The method of Claim 1, wherein said identification step comprises determining the nucleotide sequence of a nucleic acid encoding said gene product in said cell which proliferated more rapidly in said culture.
6. The method of Claim 1, wherein said identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture.
7. The method of Claim 6, wherein the products of said amplification reaction are labeled with a detectable dye.
8. The method of Claim 1, wherein said identification step comprises performing a hybridization procedure.
9. The method of Claim 1, wherein said identification step comprises contacting a nucleic acid array with a nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture.
10. The method of Claim 1, wherem said organism is selected from the group consisting of bacteria, fungi, and protozoa.
11. The method of Claim 1, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia,
Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae,
Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae,
Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii,
Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
12. The method of Claim 1, wherein said compound is obtained from a library of natural compounds.
13. The method of Claim 1, wherein said compound is obtained from a library of synthetic compounds.
14. The method of Claim 1, wherein said compound is present in a crude or partially purified state.
15. The method of Claim 1, further comprising determining whether said gene product in said strain which proliferated more rapidly in said culture has a counterpart in at least one other organism.
16. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
17. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860,
5916-10012, and 14111-14944 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
18. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-
15778 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
19. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
20. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherem said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and
14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS. : 3796-3800, 3806-
4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
21. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
22. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining an array of strains on a solid growth medium wherein each strain in overexpresses a different gene product which is essential for proliferation of said organism contacting said array of strains with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly on said solid medium.
23. The method of Claim 21, wherein at least one strain in said array does not overexpresses a gene product which is essential for proliferation of said organism.
24. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, wherein each culture comprises a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism; contacting each of said cultures with a different concentration of said compound ; and identifying the gene product which is overexpressed in a strain whose proliferation is inhibited by said compound.
25. The method of Claim 23, wherein at least one strain in said plurality of cultures does not overexpress a gene product which is essential for proliferation of said organism.
26. A method of profiling a compound's activity comprising performing the method of Claim 1 on a first culture using a first compound; performing the method of Claim 1 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture.
27. A method of profiling a first compound's activity comprising growing an array of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each strain in said array overexpresses a different gene product which is essential for proliferation of an organism and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.
28. The method of any one of Claims 26 and 27, wherein said first compound is present in a crude or partially purified state.
29. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
30. The method of Claim 29, wherein at least one strain in said culture does not underexpresses a gene product which is essential for proliferation of said organism.
31. The method of Claim 29, wherein said strains which underexpresess said gene products comprise a nucleic acid complementary to at least a portion of a gene encodmg said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.
32. The method of Claim 29, wherein said strains which underexpress said gene products express an antisense nucleic acid complementary to at least a portion of a gene encodmg said gene product which is essential for proliferation of said organism, wherein expression of said antisense nucleic acid reduces expression of said gene product in said strain.
33. The method of Claim 29, wherein said identification step comprises determining the nucleotide sequence of a nucleic acid encoding said gene product in said strain which proliferated more slowly.
34. The method of Claim 29, wherem said identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more slowly.
35. The method of Claim 34, wherein the products of said amplification reaction are labeled with a detectable dye.
36. The method of Claim 29, wherein said identification step comprises performing a hybridization procedure.
37. The method of Claim 29, wherein said identification step comprises contacting a nucleic acid array with a nucleic acid encoding said gene product in said cell which proliferated more slowly.
38. The method of Claim 29, wherein said organism is selected from the group consisting of bacteria, fungi, protozoa.
39. The method of Claim 29, wherein said compound is obtained from a library of natural compounds.
40. The method of Claim 29, wherein said compound is obtained from a library of synthetic compounds.
41. The method of Claim 29, wherein said compound is present in a crude or partially purified state.
42. The method of Claim 29, further comprising determining whether said gene product in said strain which proliferated more slowly in said culture has a counterpart in at least one other organism.
43. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: ' obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organismwherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
44. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
45. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
46. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene products whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consistmg of SEQ ID NOs: 8-3795 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
47. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
48. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version
3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.:
3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consistmg of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-
15778 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.
49. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism; and contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.
50. A method of profiling a compound's activity comprising performing the method of Claim 29 on a first culture using a first compound; performing the method of Claim 29 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture.
51. A method of profiling a first compound's activity comprising growing an array of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said array comprises a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of an organism and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.
52. The method of any one of Claims 49 and 50, wherein said first compound is present in a crude or partially purified state.
53. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a plurality of culturescomprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism; contacting each of said plurality of cultures with a varying concentration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism ; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.
54. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism.
55. The culture of Claim 54, wherein said strains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.
56. The culture of Claim 54, wherein said strains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.
57. The culture of Claim 54, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis,
Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis .
58. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed.
59. A culture comprising a plurality of strains wherem each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed.
60. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed.
61. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed.
62. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860,
5916-10012, and 14111-14944 under moderate conditions is overexpressed.
63. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945- 15778 is overexpressed.
64. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism.
65. The culture of Claim 64, wherein said strains which underexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.
66. The culture of Claim 64, wherein said strains which underexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.
67. The culture of Claim 64, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis,
Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis,
Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
68. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed.
69. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is underexpressed.
70. A culture comprising a a plurality of strains wherem each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801- 3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed.
71. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consistmg of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is underexpressed.
72. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796- 3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed.
73. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915,
10013-14110 and 14945-15778 is underexpressed.
74. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherem the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
75. The method of Claim 74, wherein the nucleotide sequence of each of the genes encoding an overexpressed gene product has been altered by replacing the native promoters of said genes with promoters which facilitate overexpression of said gene products.
76. The method of Claim 74, wherein the nucleotide sequence of each of the genes encoding an overexpressed gene product has been altered by inserting a regulatory element into the native promoters of said genes with a promoter which facilitates overexpression of said gene products.
77. The method of Claim 76, wherein said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a transcriptional activator, a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA and an upstream activating sequence.
78. The method of Claim 74, wherein the step of identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene comprises performing an amplification reaction and detecting a unique amplification product corresponding to said gene.
79. The method of Claim 75, wherein the native promoter of each of the genes encoding a gene product essential for proliferation is replaced with the same promoter.
80. The method of Claim 75, wherein the native promoters of the genes encoding gene products essential for proliferation are replaced with a plurality of promoters selected to give a desired expression level for each gene product.
81. The method of Claim 75, wherein said promoters which replaced the native promoters in each strain comprise regulatable promoters.
82. The method of Claim 75, wherein said promoters which replaced the native promoters in each strain each strain comprise constitutive promoters.
83. The method of Claim 74, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa.
84. The method of Claim 74, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae,
Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
85. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
86. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111- 14944 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
87. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801- 3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
88. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
89. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
90. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778 is overexpressed.
91. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product coπesponding to each of the overexpressed genes ; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
92. The method of Claim 91, wherein the nucleotide sequence of each of the genes encoding an underexpressed gene product has been altered by replacing the native promoters of said genes with promoters which facilitate underexpression of said gene products.
93. The method of Claim 91, wherein the nucleotide sequence of each of the genes encoding an underexpressed gene product has been altered by inserting a regulatory element into the native promoters of said genes with a promoter which facilitates underexpression of said gene products.
94. The method of Claim 93, wherein said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a transcriptional activator, a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA and an upstream activating sequence.
95. The method of Claim 91, wherem the step of identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture by detecting the unique product corresponding to said gene comprises performing an amplification reaction and detecting a unique amplification product corresponding to said gene.
96. The method of Claim 92, wherem the native promoter of each of the genes encoding a gene product essential for proliferation is replaced with the same promoter.
97. The method of Claim 92, wherein the native promoters of the genes encoding gene products essential for proliferation are replaced with a plurality of promoters selected to give a desired expression level for each gene product.
98. The method of Claim 92, wherein said promoters which replaced the native promoters in each strain comprise regulatable promoters.
99. The method of Claim 92, wherem said promoters which replaced the native promoters in each strain each strain comprise constitutive promoters.
100. The method of Claim 91, wherein said organism is selected from the group consistmg of bacteria, fungi, and protozoa.
101. The method of Claim 91 , wherem said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus,
Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia,
Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, HeUcobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii,
Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.
102. The method of Claim 91, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed.
103. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes and wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-
10012, and 14111-14944 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
104. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
105. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
106. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111- 14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806- 4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806- 4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product coπesponding to said gene.
107. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising: obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes , wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778 is underexpressed; contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.
108. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
109. The method of Claim 108, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.
110. The method of Claim 108 wherein: said nucleic acid sample is divided into N aliquots; said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.
111. The method of Claim 109, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.
112. The method of Claim 108, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.
113. The method of Claim 111, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.
114. The method of Claim 111, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.
115. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary, to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
116. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111- 14944 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
117. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-
3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherem the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
118. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
119. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
120. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of
SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
121. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products.
122. The method of Claim 121, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.
123. The method of Claim 121, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.
124. The method of Claim 121, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.
125. The method of Claim 121, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.
126. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed or underexpressed.
127. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherem said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806- 4860, 5916-10012, and 14111-14944 is overexpressed or underexpressed.
128. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
129. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of
SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed.
130. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed.
131. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising: obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound; obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound; performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction; and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product coπesponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second culture or collection of strains comprise a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
132. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
133. The method of Claim 132, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.
134. The method of Claim 132 wherein: said nucleic acid sample is divided into N aliquots; said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.
135. The method of Claim 134, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.
136. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed or underexpressed.
137. A method for determimng the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916- 10012, and 14111-14944 is overexpressed or underexpressed.
138. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
139. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed.
140. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%> nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111- 14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806- 4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806- 4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed.
141. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism; performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of
SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013- 14110 and 14945-15778 is overexpressed or underexpressed.
142. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction.
143. The method of Claim 142, wherein said primer pairs are divided into at least two sets, each primer pair comprises a primer which is labeled with a distinguishable dye, and the distinguishable dye used to label each set of primer pairs is distinguishable from the dye used to label the other sets of primer pairs.
144. The method of Claim 142 wherein: said nucleic acid sample is divided into N aliquots; said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.
145. The method of Claim 144, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.
146. The method of Claim 142, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.
147. The method of Claim 146, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.
148. The method of Claim 146, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.
149. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed or underexpressed.
150. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and
14111-14944 is overexpressed or underexpressed.
151. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ
ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
152. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8- 3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed.
153. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed.
154. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising: obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism; performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-
15778 is overexpressed or underexpressed.
EP02728338A 2001-02-09 2002-02-08 Methods for identifying the target of a compound which inhibits cellular proliferation Withdrawn EP1360335A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US26763601P 2001-02-09 2001-02-09
US267636P 2001-02-09
PCT/US2002/003987 WO2002086097A2 (en) 2001-02-09 2002-02-08 Methods for identifying the target of a compound which inhibits cellular proliferation

Publications (1)

Publication Number Publication Date
EP1360335A2 true EP1360335A2 (en) 2003-11-12

Family

ID=23019593

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02728338A Withdrawn EP1360335A2 (en) 2001-02-09 2002-02-08 Methods for identifying the target of a compound which inhibits cellular proliferation

Country Status (4)

Country Link
EP (1) EP1360335A2 (en)
JP (1) JP2004528846A (en)
CA (1) CA2436216A1 (en)
WO (1) WO2002086097A2 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2003231152A1 (en) 2002-04-26 2003-11-10 Bristol-Myers Squibb Company Novel essential fungal polynucleotides, polypeptides, and methods of use
EP1953550A4 (en) * 2005-11-10 2010-04-14 Nat University Of Corp Hiroshi Method and agent for immobilizing protein via protein bound to silicon oxide containing-substance
US8637249B2 (en) 2008-11-14 2014-01-28 Gen-Probe Incorporated Compositions, kits and methods for detection of Campylobacter nucleic acid

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO02086097A3 *

Also Published As

Publication number Publication date
WO2002086097A8 (en) 2004-11-25
WO2002086097A3 (en) 2003-03-06
CA2436216A1 (en) 2002-10-31
JP2004528846A (en) 2004-09-24
WO2002086097A2 (en) 2002-10-31

Similar Documents

Publication Publication Date Title
US20220228154A1 (en) Methods for Screening Bacteria, Archaea, Algae, and Yeast Using CRISPR Nucleic Acids
Redenbach et al. A set of ordered cosmids and a detailed genetic and physical map for the 8 Mb Streptomyces coelicolor A3 (2) chromosome
Lambert et al. Characterizing the flagellar filament and the role of motility in bacterial prey‐penetration by Bdellovibrio bacteriovorus
Belitsky et al. An lrp-like gene of Bacillus subtilis involved in branched-chain amino acid transport
Wainwright et al. A conserved DNA sequence is required for efficient gonococcal pilin antigenic variation
Papavinasasundaram et al. Mycobacterial recA is cotranscribed with a potential regulatory gene called recX
Dougherty et al. Identification of Haemophilus influenzae Rd transformation genes using cassette mutagenesis
WO2002077183A2 (en) Identification of essential genes in microorganisms
Braunstein et al. Genetic methods for deciphering virulence determinants of Mycobacterium tuberculosis
Narberhaus et al. Three disparately regulated genes for σ32‐like transcription factors in Bradyrhizobium japonicum
Yu et al. Genome-wide enrichment screening reveals multiple targets and resistance genes for triclosan in Escherichia coli
JP2003518386A (en) Genes identified as required for the growth of Escherichia coli
Homuth et al. The genes lepA and hemN form a bicistronic operon in Bacillus subtilis
Zhuang et al. EcI5, a group IIB intron with high retrohoming frequency: DNA target site recognition and use in gene targeting
Tabatabai et al. Molecular analysis of the two‐component genes, ompR and envZ, in the symbiotic bacterium Xenorhabdus nematophilus
Yao et al. Gene targeting using randomly inserted group II introns (targetrons) recovered from an Escherichia coli gene disruption library
Novakova et al. Characterization of a regulatory gene essential for the production of the angucycline-like polyketide antibiotic auricin in Streptomyces aureofaciens CCM 3239
KR102615448B1 (en) Compositions and methods for the production of compounds
Argueta et al. Identification of Nostoc punctiforme akinete‐expressed genes using differential display
EP1360335A2 (en) Methods for identifying the target of a compound which inhibits cellular proliferation
Minnig et al. In Bacillus subtilis W23, the duet σXσM, two sigma factors of the extracytoplasmic function subfamily, are required for septum and wall synthesis under batch culture conditions
AU2002258395A1 (en) Methods for identifying the target of a compound which inhibits cellular proliferation
Lee et al. A multidrug efflux system is involved in colony growth in Streptomyces lividans
US20030027286A1 (en) Bacterial promoters and methods of use
Chaussee et al. Characterization of the recD gene of Neisseria gonorrhoeae MS11 and the effect of recD inactivation on pilin variation and DNA transformation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030812

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060901