CA2436216A1

CA2436216A1 - Methods for identifying the target of a compound which inhibits cellular proliferation

Info

Publication number: CA2436216A1
Application number: CA002436216A
Authority: CA
Inventors: Grant J. Carr; Howard H. Xu; Gordon J. Foulkes; Carlos Zamudio; Robert Haselbeck; Kari L. Ohlsen; Judith W. Zyskind; Daniel Wall; John D. Trawick; Robert T. Yamamoto; Terry Roemer; Bo Jiang; Charles Boone; Howard Bussey
Original assignee: Individual
Current assignee: Elitra Pharmaceuticals Inc
Priority date: 2001-02-09
Filing date: 2002-02-08
Publication date: 2002-10-31
Also published as: JP2004528846A; WO2002086097A3; WO2002086097A2; WO2002086097A8; EP1360335A2

Abstract

The present invention relates to cultures or collections of strains which overexpress or underexpress gene products required for the proliferation of an organism. The present invention also includes methods for identifying the target on which a compound which inhibits the proliferation of an organims acts and methods for identifying the extent to which a strain is present in a culture or collection of strains.

Description

DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

~~ TTENANT LES PAGES 1 A 293 NOTE : Pour les tomes additionels, veuillez contacter 1e Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:

METHODS FOR IDENTIFYING THE TARGET OF A COMPOUND WHICH
INHIBITS CELLULAR PROLIFERATION
Back ound of the Invention Many important therapeutic compounds act by reducing or eliminating the activity or level of a gene product required for cellular proliferation. For example, most antibiotic compounds act by reducing or eliminating the activity or level of gene products which are required for the proliferation of a pathogenic organism.
Similarly, compounds used to treat or ameliorate cancer also reduce or inhibit the activity or level of a gene product required for cellular proliferation.
Current drug discovery methods involve screening large number of prospective therapeutic compounds to identify those that are effective therapeutic agents or that can be optimized to provide an effective therapeutic agents.
For example, the compounds to be evaluated for therapeutic activity may be members of a library of compounds generated by combinatorial chemistry or members of a library of natural products.
Unfortunately, current methods are laborious and time consuming and may yield compounds which have already been identified or which act on gene products which are already targeted by an existing therapeutic agent. Accordingly, there is a need for rapid screening techniques which yield novel compounds or compounds which act on novel targets.
In addition, a large number of compounds have been identified which have antimicrobial activity but which cannot be administered to individuals suffering from infection due to the fact that their targets are unknown. Accordingly, there is a need for methods which permit the identification of the target on which a compound with antimicrobial activity acts.
Field of the Invention The present invention provides reagents and methods for identifying the target of a compound which reduces the activity or level of gene products required for cellular proliferation. In addition, the present invention provides reagents and methods for identifying novel therapeutic compounds or compounds which act on novel targets.
Sequence Listing The present application is being filed along with 4 copies of a CD-ROM
marked "Copy 1,""Copy 2," "Copy3" and "CRF" containing a Sequence Listing in electronic format. The copies of the CD-ROM each contain a file entitled 028vpc-final.txt created on February 8, 2002 which is 36,220,587 bytes in size. The information on these duplicate CD=ROMs is incorporated herein by reference in 'its entirety.
Definitions As used herein, the terminology "proliferation-required" or "required for proliferation" encompasses instances where the absence or substantial reduction of a gene transcript and/or gene product completely eliminates cell growth as well as instances where the absence of a gene transcript and/or gene product merely reduces cell growth.
By "E. coli or Escherichia coli" is meant Escherichia coli or any organism previously categorized as a species of Shigella including Shigella boydii, Shigella flexneri, Shigella dysenteriae, Shigella sonnei, Shigella 2A.
By "homologous coding nucleic acid" is meant a nucleic acid homologous to a nucleic acid encoding a gene product whose activity or level is inhibited by a nuclei acid selected from the group consisting of SEQ ID NOs.: 8-3795 or a portion thereof., In some embodiments, the homologous coding nucleic acid may have at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70%
nucleotide sequence identity to a nucleotide sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof. In other embodiments the homologous coding nucleic acids may have at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, at least 70% , at least 60%, at least 50%, or at least 40% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of the nucleotide sequences complementary to one of SEQ ID NOs.: 8-3795 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof. Identity may be measured using BLASTN version 2.0 with the default parameters or tBLASTX with the default parameters. (Altschul, S.F. et al.
Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997), the disclosure of which ~is incorporated herein by reference in its entirety) Alternatively a "homologous coding nucleic acid" could be identified by membership of the gene of interest to a functional orthologue cluster. All other members of that orthologue cluster would be considered homologues. Such a library of functional orthologue clusters can be found at http://www.ncbi.nlrn.nih.~ov/COG. A gene can be classified into a cluster of orthologous groups or COG by using the COGNITOR program available at the above web site, or by direct BLASTP comparison of the gene of interest to the members of the COGS and analysis of these results as described by Tatusov, R.L., Galperin, M.Y., Natale, D. A. and Koonin, E.V. (2000) The COG database: a tool for genome-scale analysis of protein functions and evolution. Nucleic Acids Research v. 28 n.
l, pp.
33-36.
The term "homologous coding nucleic acid" also includes nucleic acids comprising nucleotide sequences which encode polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40°l0 or at least 25% amino acid identity or similarity to a polypeptide comprising the amino acid sequence of one of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 or to a polypeptide whose expression is inhibited by a nucleic acid comprising a nucleotide sequence of one of SEQ ID NOs: 8-3795 or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or consecutive amino acids thereof as determined using the FASTA version 3.0t78 algorithm with the default parameters. Alternatively, protein identity or similarity may be identified using BLASTP with the default parameters, BLASTX with the default parameters, TBLASTN with the default parameters, or tBLASTX with the default parameters. (Altschul, S.F. et al. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-(1997), the disclosure of which is incorporated herein by reference in its entirety).
The term "homologous coding nucleic acid" also includes coding nucleic acids which hybridize under stringent conditions to a nucleic acid selected from the group consisting of the nucleotide sequences complementary to one of SEQ ID NOS.:

3800, 3806-4860, 5916-10012, and 14111-14944 and coding nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequences complementary to one of SEQ ID NOS.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944. As used herein, "stringent conditions" means hybridization to filter-bound nucleic acid in 6xSSC at about 45°C
followed by one or more washes in O.IxSSC/0.2% SDS at about 68°C. Other exemplary stringent conditions may refer, e.g., to washing in 6xSSC/0.05%
sodium pyrophosphate at 37°C, 48°C, 55°C, and 60°C as appropriate for the particular probe being used.
The term "homologous coding nucleic acid" also includes coding nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleotide sequence selected from the group consisting of the sequences complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and coding nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25,.
30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequences complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944. As used herein, "moderate conditions" means hybridization to filter-bound DNA in 6x sodium chloride/sodium citrate (SSC) at about 45°C followed by one, preferably 3-5 washes in 0.2xSSC/0.1% SDS
at about 42-65°C.
The term "homologous coding nucleic acids" also includes nucleic acids a 30 comprising nucleotide sequences which encode a gene product whose activity may be complemented by a gene encoding a gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795. In some embodiments, the homologous coding nucleic acids may encode a gene product whose activity is complemented by the gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944.
In other embodiments, the homologous coding nucleic acids may comprise nucleotide sequences which encode a gene product whose activity is complemented by one of the polypeptides of SEQ ID NOs. 3801-3805, 4861-5915, 10013-14110 and 14945 15778.
The term "homologous antisense nucleic acid" includes nucleic acids comprising a nucleotide sequence having at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, or at least 40%
nucleotide sequence identity to a nucleotide sequence selected from the group consisting of one of the sequences of SEQ ID NOS. 8-3795 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or S00 consecutive nucleotides thereof. Homologous antisense nucleic acids may also comprising nucleotide sequences which have at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, or at least 40%
nucleotide sequence identity to a nucleotide sequence selected from the group consisting of the sequences complementary to one of sequences of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof.
Nucleic acid identity may be determined as described above.
The term "homologous antisense nucleic acid" also includes antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleotide sequence complementary to one of SEQ ID NOs.: 8-3795 and antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 8-3795. Homologous antisense nucleic acids also include antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944.
The term "homologous antisense nucleic acid" also includes antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleotide sequence complementary to one of SEQ ID NOs.: 8-3795 and antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 8-3795. Homologous antisense nucleic acids also include antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleotide sequence selected from the group consisting of SEQ
ID
NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and antisense nucleic acids which comprising nucleotide sequences hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or S00 consecutive nucleotides of one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944.
By "homologous polypeptide" is meant a polypeptide homologous to a polypeptide whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 or by a homologous antisense nucleic acid. The term "homologous polypeptide"
includes polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs: 8-3795 or by a homologous antisense nucleic acid, or polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide to a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a polypeptide whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs.: 8-3795 or by a homologous antisense nucleic acid.
Identity or similarity may be determined using the FASTA version 3.0t78 algorithm with the default parameters. Alternatively, protein identity or similarity may be identified using BLASTP with the default parameters, BLASTX with the default parameters, or TBLASTN with the default parameters. (Altschul, S.F. et al.
Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997), the disclosure of which is incorporated herein by reference in its entirety).
The term homologous polypeptide also includes polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and polypeptides having at least 99%, 95%,~at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a fragment comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778.
The term, Salmonella, is the generic name for a large group of gram-negative enteric bacteria that are closely related to Eschericlaia coli. The diseases caused by Salmonella are often due to contamination of foodstuffs or the water supply and affect .
millions of people each year. Traditional methods of Salmonella taxonomy were based on assigning a separate species name to each serologically distinguishable strain (Kauffinann, F 1966 The bacteriology of the Eftterobacteriaceae. Munksgaard, Copenhagen). Serology of Salmonella is based on surface antigens (O [somatic]
and H [flagellar]). Over 2,400 serotypes or serovars of Salrnonella are known (Popoff, et al. 2000 Res. Microbiol. 151:63-65). Therefore, each serotype was considered to be a separate species and often given names, accordingly (e.g. S. paratyplai, S.
typhimuriuna, S. typhi, S. enteriditis, etc.).
However, by the 1970s and 1980s it was recognized that this system was not only cumbersome, but also inaccurate. Then, many Salmonella species were lumped into a single species (all serotypes and subgenera I, II, and IV and all serotypes of Arizona) with a second subspecies, S. bongorii also recognized (Crow, et al., 1973, J.
Bacteriol. 115:307-315). Though species designations are based on the highly variable surface antigens, the Salmonella are very similar otherwise with a major exception being pathogenicity determinants.
There has been some debate on the correct name for the Salmonella species.
Currently (Brenner, et al. 2000 J. Clin. Microbiol. 38:2465-2467), the accepted name is Salmonella enterica. S. enterica is divided into six subspecies (I, S.
enterica subsp.
enterica; II, S. eraterica, subsp. salarnae; IIIa, S. enterica subsp. ar izonde; IIIb, S.
enterica subsp. diarizonae; IV, S. enterica subsp. houtenae; and VI, S.
enterica subsp.
indica). Within subspecies I, serotypes axe used to distinguish each of the serotypes or serovaxs (e.g. S. enterica serotype Enteriditis, S. enterica serotype Typhimurium, S.
enterica serotype Typhi, and S. enterica serotype Choleraesuis, etc.). Current convention is to spell this out on first usage (Salmonella enterica ser.
Typhimurium) and then use an abbreviated form (Salmonella Typhimurium or S. Typhimurium).
Note, the genus and species names (Salmonella enterica) are italicized but not the serotype/serovar name (Typhimurium). Because the taxonomic committees have yet to officially approve of the actual species name, this latter system is what is employed by the CDC (Brenner, et al. 2000 J. Clin. Microbiol. 38:2465-2467). Due to the concerns of both taxonomic priority and medical importance, some of these serotypes might ultimately receive full species designations (S.typhi would be the most notable).
Therefore, as used herein "Salmonella enterica or S. enterica " includes serovars Typhi, Typhimurium, Paratyphi, Choleraesuis, etc." However, appeals of the "official" name axe in process and the taxonomic designations may change (S

choleraesuis is the species name that could replace S. enterica based solely on priority).
By "inducer" is meant an agent or solution which, when placed in contact with a cell or microorganism, increases transcription, or inhibitor and/or promoter S cleaxance/fidelity, from a desired promoter.
As used herein, "nucleic acid" means DNA, RNA, or modified nucleic acids.
Thus, the terminology "the nucleic acid of SEQ ID NO: X" or "the nucleic acid comprising the nucleotide sequence" includes both the DNA sequence of SEQ ID
NO:
X and an RNA sequence in which the thymidines in the DNA sequence have been substituted with uridines in the RNA sequence and in which the deoxyribose backbone of the DNA sequence has been substituted with a ribose backbone in the RNA
sequence. Modified nucleic acids are nucleic acids having nucleotides or structures which do not occur in nature, such as nucleic acids in which the internucleotide phosphate residues with methylphosphonates, phosphorothioates, phosphoramidates, and phosphate esters. Nonphosphate internucleotide analogs such as siloxane bridges, carbonate bridges, thioester bridges, as well as many others known in the art may also be used in modified nucleic acids.
Modified nucleic acids may also comprise, a-anomeric nucleotide units and modified nucleotides such as 1,2-dideoxy-d-ribofuranose, 1,2-dideoxy-1-phenylribofuranose, and 1V~, N'-ethano-S-methyl-cytosine are contemplated for use in the present invention. Modified nucleic acids may also be peptide nucleic acids in which the entire deoxyribose-phosphate backbone has been exchanged with a chemically completely different, but structurally homologous, polyamide (peptide) backbone containing 2-aminoethyl glycine units.
As used herein, the terminology "overexpress" refers to strains which possess either a level of the gene product which is higher than the level possessed by wild type cells or an affinity for a test compound which is lower than the affinity of a wild type gene product, while the terminology "underexpress" refers to strains which possess a level of the gene product which is lower than the level possessed by wild type cells or an affinity for a test compound which is higher than the affinity of a wild type gene product.
Summary of the Invention Some aspects of the present invention are described in the following numbered paragraphs:
1. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.
2. The method of Paragraph 1, wherein said culture includes at least one strain which does not overexpresses a gene product which is essential for proliferation of said organism.
3. The method of Paragraph 1, wherein said strains which overexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.
4. The method of Paragraph 1, wherein said strains which overexpress said gene products a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.

5. The method of Paragraph 1, wherein said identification step comprises determining the nucleotide sequence of a nucleic acid encoding said gene product in said cell which proliferated more rapidly in said culture.
6. The method of Paragraph 1, wherein said identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture.
7. The method of Paragraph 6, wherein the products of said amplification reaction axe labeled with a detectable dye.
8. The method of Paragraph 1, wherein said identification step comprises performing a hybridization procedure.
9. The method of Paragraph 1, wherein said identification step comprises contacting a nucleic acid array with a nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture.

10. The method of Paragraph 1, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa.

11. The method of Paragraph 1, wherein said culture is a culture of an organism selected from the group consisting of Anaplasnta marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Cantpylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Cartdida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Ghlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coceidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoforrrtans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Esclaericlaia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneuntoniae, Listeria monocytogenes, Mycobacteriurrt leprae, Mycobacterium tuberculosis, Neisseria gortorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella nzultocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salrraonella bongori, Salmonella cholerasuis, Salmoraella enterica, Salmonella paratyplai, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus praeumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.

12. The method of Paragraph 1, wherein said compound is obtained from a library of natural compounds.

13. The method of Paragraph 1, wherein said compound is obtained from a library of synthetic compounds.

14. The method of Paragraph 1, wherein said compound is present in a crude or partially purified state.

15. The method of Paragraph 1, further comprising determining whether said gene product in said strain which proliferated more rapidly in said culture has a counterpart in at least one other organism.

16. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

17. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and 1 S identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

18. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

19. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ
ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed;

S
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

20. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

21. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

22. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining an array of strains on a solid growth medium wherein each strain in overexpresses a different gene product which is essential for proliferation of said organism contacting said array of strains with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism Which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly on said solid medium.

23. The method of Paragraph 21, wherein at least one strain in said array does not overexpresses a gene product which is essential for proliferation of said organism.

24. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a plurality of cultures, wherein each culture comprises a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism;
contacting each of said cultures with a different concentration of said compound ; and identifying the gene product which is overexpressed in a strain whose proliferation is inhibited by said compound.

25. The method of Paragraph 23, wherein at least one strain in said plurality of cultures does not overexpress a gene product which is essential for proliferation of said organism.

26. A method of profiling a compound's activity comprising performing the method of Paragraph 1 on a first culture using a first compound;
performing the method of Paragraph 1 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture.

27. A method of profiling a first compound's activity comprising growing an array of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein each strain in said array overexpresses a different gene product which is essential for proliferation of an organism and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.

28. The method of any one of Paragraphs 26 and 27, wherein said first compound is present in a crude or partially purified state.

29. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts .
proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

30. The method of Paragraph 29, wherein at least one strain in said culture does not underexpresses a gene product which is essential for proliferation of said organism.

31. The method of Paragraph 29, wherein said strains which underexpresess said gene products comprise a nucleic acid complementary to at least a portion of a gene encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

32. The method of Paragraph 29, wherein said strains which underexpress said gene products express an antisense nucleic acid complementary to at least a portion of a gene encoding said gene product which is essential for proliferation of said organism, wherein expression of said antisense nucleic acid reduces expression of said gene product in said strain.

33. The method of Paragraph 29, wherein said identification step comprises determining the nucleotide sequence of a nucleic acid encoding said gene product in said strain which proliferated more slowly.

34. The method of Paragraph 29, wherein said identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more slowly.

35. The method of Paragraph .34, wherein the products of said amplification reaction are labeled with a detectable dye.

36. The method of Paragraph 29, wherein said identification step comprises performing a hybridization procedure.

37. The method of Paragraph 29, wherein said identification step comprises contacting a nucleic acid array with a nucleic acid encoding said gene product in said cell which proliferated more slowly.

38. The method of Paragraph 29, wherein said organism is selected from the group consisting of bacteria, fungi, protozoa.

39. The method of Paragraph 29, wherein said compound is obtained from a library of natural compounds.

40. The method of Paragraph 29, wherein said compound is obtained from a library of synthetic compounds.

41. The method of Paragraph 29, wherein said compound is present in a crude or partially purified state.

42. The method of Paragraph 29, further comprising determining whether said gene product in said strain which proliferated more slowly in said culture has a counterpart in at least one other organism.

43. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of S said organismwherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and 1 S identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

44. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-1001'2, and 14111-14944 is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

45. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
S obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ
ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts 1 S proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

46. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70%
2S nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ
ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture, 47. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

48. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.:
3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed;

contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts S proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

49. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a plurality of cultures, each culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism; and contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.

50. A method of profiling a compound's activity comprising performing the method of Paragraph 29 on a first culture using a first compound;
performing the method of Paragraph 29 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture.

51. A method of profiling a first compound's activity comprising growing an array of strains on a first solid medium comprising said first compound and on a second solid medium comprising a second compound, wherein said array comprises a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of an organism and wherein said first compound and said second compound inhibit the proliferation of said organism; and comparing the pattern of strains which grow on said first solid medium with the pattern of strains which grow on said second solid medium.

52. The method of any one of Paragraphs 49 and 50, wherein said first compound is present in a crude or partially purified state.

53. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a plurality of culturescomprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism;
contacting each of said plurality of cultures with a varying concentration of a regulatory agent which regulates the level of expression of said gene products which are essential for proliferation of said organism ;
and identifying the gene product which is underexpressed in a strain whose rate of proliferation is reduced by said compound.

54. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism.

55. The culture of Paragraph 54, wherein said strains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

56. The culture of Paragraph 54, wherein said strains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.

57. The culture of Paragraph 54, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus funaigatus, Bacillus arathracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicaras, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermoradii, Candida kr°usei, Candida kefyr (also called Caradida pseudotropicalis), Candida dublinierasis, Chlamydia praeunaoniae, Chlarnydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringerts, Coccidiodes inamitis, Corynebacteriuna diptheriae, Cryptococcus neoforrnans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meniragitidis, Nocardia asteroides, Pasteurella laaemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomoraas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella fl'exrzeri, Shigella sonraei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.

58. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed.

59. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequenee selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed.

60. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed.

61. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as .determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs:
8-3795 is overexpressed.

62. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860,'5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed.

63. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25%
amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed.

64. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism.

65. The culture of Paragraph 64, wherein said strains which underexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

66. The culture of Paragraph 64, wherein said strains which underexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.

67. The culture of Paragraph 64, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus ahtlaracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Cafadida dubliniensis, Clzlamydia pneumoniae, Chlarnydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria naonocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimuriuna, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flextaeri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.

68. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed.

69. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is underexpressed.

70. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed.

71. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide 20~ sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs:
8-3795 is underexpressed.

72. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed.

73. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25%
amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed.

74. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

75. The method of Paragraph 74, wherein the nucleotide sequence of each of the genes encoding an overexpressed gene product has been altered by replacing the native promoters of said genes with promoters which facilitate overexpression of said gene products.

76. The method of Paragraph 74, wherein the nucleotide sequence of each of the genes encoding an overexpressed gene product has been altered by inserting a regulatory element into the native promoters of said genes with a promoter which facilitates overexpression of said gene products.

77. The method of Paragraph 76, wherein said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a transcriptional activator, a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA and an upstream activating sequence.

78. The method of Paragraph 74, wherein the step of identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene comprises performing an amplification reaction and detecting a unique amplification product corresponding to said gene.

79. The method of Paragraph 75, wherein the native promoter of each of the genes encoding a gene product essential for proliferation is replaced with the same promoter.

80. The method of Paragraph 75, wherein the native promoters of the genes encoding gene products essential for proliferation are replaced with a plurality of promoters selected to give a desired expression level for each gene product.

81. The method of Paragraph 75, wherein said promoters which replaced the native promoters in each strain comprise regulatable promoters.

82. The method of Paragraph 75, wherein said promoters which replaced the native promoters in each strain each strain comprise constitutive promoters.

83. The method of Paragraph 74, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa.

84. The method of Paragraph 74, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinuna, Clostridiurn diffcile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptoeoccus neoformans, Enterobacter cloacae, Enterococcus faecalis, Eraterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasrna capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella laaemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella borZgori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.

85. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

86. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not . overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which S proliferated more rapidly in said culture by detecting the unique product a corresponding to said gene.

87. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene 1 S product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-S91S, 10013-14110 and 14945-15778 is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

88. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ
ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

89. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

90. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed.

91. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:

obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

92. The method of Paragraph 91, wherein the nucleotide sequence of each of the genes encoding an underexpressed gene product has been altered by replacing the native promoters of said genes with promoters which facilitate underexpression of said gene products.

93. The method of Paragraph 91, wherein the nucleotide sequence of each of the genes encoding an underexpressed gene product has been altered by inserting a regulatory element into the native promoters of said genes with a promoter which facilitates underexpression of said gene products.

94. The method of Paragraph 93, wherein said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a transcriptional activator, a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA and an upstream activating sequence.

95. The method of Paragraph 91, wherein the step of identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture by detecting the unique product corresponding to said gene comprises performing an amplification reaction and detecting a unique amplification product corresponding to said gene.

96. The method of Paragraph 92, wherein the native promoter of each of the S genes encoding a gene product essential for proliferation is replaced with the same promoter.

97. The method of Paragraph 92, wherein the native promoters of the genes encoding gene products essential for proliferation are replaced with a plurality of promoters selected to give a desired expression level for~each gene product.

98. The method of Paragraph 92, wherein said promoters which replaced the native promoters in each strain comprise regulatable promoters.

99. The method of Paragraph 92, wherein said promoters which replaced the native promoters in each strain each strain comprise constitutive promoters.

100. The method of Paragraph 91, wherein said organism is selected from ~ the group consisting of bacteria, fungi, and protozoa.

101. The method of Paragraph 91, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Baeterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Cartdida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Catadida krusei, Candida kefyr (also called Candida pseudotropiealis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes intmitis, Coryttebacteriutrt diptheriae, Cryptococcus neoformans, Ertterobacter cloacae, Ertterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria rnonocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella rnultocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bortgori, Salmonella claolerasuis, Salmonella eraterica, Salmonella par~atyphi, Salmonella typhi, Salmonella typlaimuriurra, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexraeri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneurnoraiae, Streptococcus mutans, Treponema pallidurn, Yersinia S enterocolitica, and Yersinia pesos.

102. The method of Paragraph 91, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed.

103. A method for identifying the gene product on which a compound ' which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the 1 S underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes and wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

104. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed;
contacting said culture With a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

105. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ
ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

106. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

107. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes , wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013 14110 and 14945-15778 is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

108. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism;

performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.

109. The method of Paragraph 108, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.

110. The method of Paragraph 108 wherein:
said nucleic acid sample is divided into N aliquots;
said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1lN of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.

111. The method of Paragraph 109, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.

112. The method of Paragraph 108, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.

113. The method of Paragraph 111, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.

11A~. The method of Paragraph 111, whexein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.
115. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed or underexpressed;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
116. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product encoded by a 4.7 nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is ovexexpressed or underexpressed;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
117. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said oxganism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.:
3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is~ present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
118. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ
1D NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
119. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%
nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.:
SO

3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
120. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
121. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;
obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;
performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;
performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;

and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products.
122. The method of Paragraph 121, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.
123. The method of Paragraph 121, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.
124. The method of Paragraph 121, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.
125. The method of Paragraph 121, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.
126. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;

obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;
performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;
performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;
and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: ~-3795 is overexpressed or underexpressed.

127. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;
obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;
performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;
performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;
and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ
ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed or underexpressed.
128. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;
obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;
performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;

performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;
and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the taxget of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
129. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;
obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;

performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;
performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;
and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed.
130. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;
obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;
performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths ~of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;
performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;
and comparing the amount of each amplification product in said- first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ II? NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ >D NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed.
131. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;
obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;
performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;
performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;
and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second culture or collection of strains comprise a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID
NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
132. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.
133. The method of Paragraph 132, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.
134. The method of Paragraph 132 wherein:
said nucleic acid sample is divided into N aliquots;
said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to I/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.
135. The method of Paragraph I34, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.
136. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed or underexpressed.
137. A method for determining the extent to which each of a plurality of S strains axe present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed or underexpressed.
138. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of sand organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
139. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture 1 S or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70°lo nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ
ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed.
140. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required fox proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed.
141. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
142. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising 'the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction.
143. The method of Paragraph 142, wherein said primer pairs are divided into at least two sets, each primer pair comprises a primer which is labeled with a distinguishable dye, and the distinguishable dye used to label each set of primer pairs is distinguishable from the dye used to label the other sets of primer pairs.
144. The method of Paragraph 142 wherein:
said nucleic acid sample is divided into N aliquots;
said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1!N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.
145. The method of Paragraph 144, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.
146. The method of Paragraph 142, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.
147. The method of Paragraph 146, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.
148. The method of Paragraph 146, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.
149. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: g-3795 is overexpressed or underexpressed.
150. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed or underexpressed.
151. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ
ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
152. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70%
nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as deternnined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ
ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed.
153. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.:

3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed.
154. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product Which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.:
3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.
Brief Description of the Drawings Figures 1A and 1B illustrate one method for identifying amplification products which are underrepresented or overrepresented in a culture.

Figures 2A arid 2B illustrate another method for identifying amplification products which are underrepresented or overrepresented in a culture.
Figure 3 illustrates the results of a hybridization analysis where the antisense nucleic acid expressed by a strain in the culture is not complementary to all or a portion of the gene encoding the target of the compound (i.e. a nonspecific strain).
Figure 4 illustrates the results of a hybridization analysis where the antisense nucleic acid expressed by a strain in the culture is complementary to all or a portion of the gene encoding the target of the compound, the hybridization intensity for that strain will be intimately correlated with the concentration of the compound (i.e. a specific strain).
Figure SA illustrates a method for replacing a promoter using a promoter replacement cassette comprising a 5' region homologous to the sequence which is 5' of the natural promoter in the chromosome, the promoter which is to replace the chromosomal promoter and a 3' region which is homologous to sequences 3' of the natural promoter in the chromosome.
Figure SB illustrates a method for replacing a promoter using a promoter replacement cassette comprising a nucleic acid encoding an identifiable or selectable marker disposed between the 5' region which is homologous to the sequence 5' of the natural promoter and the promoter which is to replace the chromosomal promoter and a transcriptional terminator 3' of the gene encoding an identifiable or selectable marker.
Figures 6A and 6B depict the GRACE method for constructing a gene disruption of one allele of a gene (CaKRE9), and promoter replacement of the second allele of the target gene, placing the second allele under conditional, regulated control by a heterologous promoter.
Figure 7A depicts growth of a wild-type strain and a CaHIS3 heterozygote strain as compared with a CaHIS3 GRACE strain constitutively expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of inhibitory levels of 3-aminotriazole.

Figure 7B depicts growth of a wild-type strain, a haploinsufficient CaHIS3 heterozygote strain, and a CaHIS3 GRACE strain constitutively expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of an intermediate level of 3-aminotriazole.
Figure 7C depicts growth of a wild-type strain, a haploinsufficient CaHIS3 heterozygote strain, and a CaHIS3 GRACE strain minimally expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of an intermediate level of 3-aminotriazole.
Figure 7D demonstrates the hypersensitivity of the CaHIS3 GRACE strain minimally expressing the tetracycline promoter-regulated imidazoleglycerol phosphate dehydratase, in the presence of an intermediate level of 3-aminotriazole.
Figure 8 presents a Northern Blot Analysis of CaHIS3, CaALRl, CaCDC24 and CaKRE9 mRNA isolated from GRACE strains to illustrate elevated expression under non-repressing conditions.
Figure 9 presents conditional gene expression , using GRACE technology, with KRE1, KRES, KRE6 and KRE9.
Figure 10 presents conditional gene expression using GRACE technology with CaKREI, CaTUBl, CaALG7, CaAURI, CaFKSl and CaSAT2.
Figure 11 illustrates an oligonucleotide comprising a lac operator flanked on each side by 40 nucleotides homologous to the promoter is the promoter which drives expression of the yabB yabC ftsL ftsl nzurE genes in an operon for use in inserting the lac operator into the promoter.
Figure 12 illustrates a microtitration plate which contains antibiotic and inducer at gradient concentrations in a matrix format in 10 times excess quantity.
Figure 13 illustrates the results of an experiment demonstrating that at appropriate concentrations of inducer, cells which overexpress the defB gene product were able to grow at elevated concentrations of the antibiotic actinonin Figure 14 illustrates the results of an experiment demonstrating that at appropriate concentrations of inducer cells which overexpress the folA gene product were able to grow at elevated concentrations of the antibiotic trimethoprim.

Figure 15 illustrates the results of an experiment demonstrating that overexpression of the fabl gene confers resistance to triclosan, which acts on the gene product of the fabI gene, but does not confer resistance to cerulenin, trimethoprim, or actinonin, each of which act on other gene products.
Figure 16 illustrates the results of an experiment demonstrating that overexpression of the folA gene confers resistance to trimethoprim, which acts on the gene product of the folA gene but does not confer resistance to triclosan, cerulenin, or actinonin, each of which act on other gene products.
Figure 17 illustrates the results of an experiment demonstrating that overexpression of the detB gene conferred resistance to actinonin, which acts on the gene product of the defB gene but does not confer resistance to cerulenin, trimethoprim, or triclosan, each of which act on other gene products.
Figure 18 illustrates the results of an experiment demonstrating that overexpression of the fabB gene conferred resistance to cerulenin, which acts on the gene product of the fabB gene, (3 keto-acyl carrier protein synthase but does not confer resistance to triclosan, trimethoprim, or actinonin, each of which act on other gene products.
Figure 19 illustrates the results of experiments in which a mixture of nine strains was grown wells in a 96 well plate in medium containing various concentrations of inducer and a sufficient concentration of actinonin, cerulenin, triclosan or trimethoprim to inhibit the growth of strains which do not overexpress the targets of these antibiotics.
Detailed Description of the Preferred Embodiment The present invention utilizes collections or cultures of strains comprising strains which either overexpress a different gene product which is required for cellular proliferation or underexpress a different gene product which is required for cellulax proliferation (i.e. at least some of the strains in the culture overexpress or underexpress a gene product required for cellular proliferation). In some embodiments, the present invention uses collections or cultures of strains comprising both strains which overexpress gene products required for cellular proliferation and strains which underexpress the same gene products required for cellular proliferation.
Preferably, each of the strains present in the culture or collection either overexpresses or underexpresses a different gene product which is required for cellular proliferation S (i.e. all of the strains in the culture overexpress or underexpress a gene product required for cellular proliferation). The gene product which is overexpressed or underexpressed in each strain may be any gene product which is required for cellular proliferation. The gene product may be a nucleic acid or a polypeptide. As used herein the term "culture" refers to a plurality of strains growing in a single aliquot of a liquid growth medium and the term "collection" refers to a plurality of strains each of which is growing in a separate aliquot of liquid growth medium or a different location on a solid growth medium.
In some embodiments, if desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product which is required for cellular proliferation. In this embodiment, the gene products which are overexpressed or underexpressed in one or more of the strains may be functionally related or functionally unrelated. This may facilitate the identification of compounds when two or more gene products share similar functions in the cell or where the cell has multiple biochemical pathways which lead to a particular end product.
Alternatively, if the gene product to be overexpressed or underexpressed is encoded by a gene which is part of an operon containing a plurality of genes, the desired gene may be overexpressed or underexpressed while the remaining genes in the operon are expressed at levels where they do not impact the ability of the cell to grow in the presence of a particular compound. For example, the desired gene may be placed under the control of a regulatable promoter, a transcriptional terminator may be placed 3' of the desired gene and a promoter, preferably a constitutive promoter, may be placed 3' of the transcriptional terminator and S' of the remaining genes in the operon.

In some embodiments, the culture or collection of strains may comprise a strain which overexpresses or underexpresses a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795. In some embodiments, the culture or collection of strains may comprise strains which in aggregate overexpress or underexpress at least two gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least 10 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least 20 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least 30 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least 50 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least 100 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, at least 300 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795 or more than 300 gene products whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOS.: 8-3795, wherein each strain in the culture or collection of strains overexpresses or underexpresses a single gene product whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs.

3795. Alternatively, if desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product whose activity or level is inhibited by a nucleic acid selected from the group consisting of SEQ ID NOs. 8-3795.
In other embodiments, the culture or collection of strains may comprise a strain which overexpresses or underexpresses a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944. In some embodiments, the culture or collection of strains may comprise strains which in aggregate overexpress or underexpress at least two gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN
NOs.:
3796-3800, 3806-4860, 5916-10412, and 14111-14944, at least 10 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, at least 20 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, at least 30 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN
NOs.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944, at least 50 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, at least 100 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, at least 300 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN
NOs.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944 or more than 300 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ IN NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, wherein each strain in the culture or collection of strains overexpresses or underexpresses a single gene product encoded by a nucleic acid selected from the group consisting of SEQ ID NOs. 3796-3800, 3806-4860, 5916-10012, and 14111-14944. Alternatively, if desired, one or more strains in the culture or collection of strains may overexpress or underexpress more than one gene product encoded by a nucleic acid selected from the group consisting of SEQ ID NOs. 3796-3800, 3806-4860, 5916-10012, and 14111-14944.
In some embodiments the culture or collection of strains comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed. In some embodiments, the culture or collection of strains may comprise strains Which in aggregate overexpress or underexpress at least two gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 10 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at Least 20 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 30 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 50 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 100 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, at least 300 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 or more than 300 gene products comprising an amino acid sequence selected from the group consisting of SEQ IN NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, wherein each strain in the culture or collection of strains overexpresses or underexpresses a single gene product selected from the group consisting of SEQ
ID
NOs. 3801-3805, 4861-5915, 10013-14110 and 14945-15778. Alternatively, if desired one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product selected from the group consisting of SEQ ID NOs. 3801-3805, 4861-5915, 10013-14110 and 14945-15778.
In other embodiments, the culture or collection of strains comprises a strain in which at Least one, at least 10, at Least 20, at least 30, at Least 50, at least 100, at least 300 or more than 300 gene products encoded by a homologous coding nucleic acid as defined above is overexpressed or underexpressed. If desired the culture or collection of strains may comprise one or more strains which overexpress or underexpress more than one gene product encoded by a homologous coding nucleic acid. In further embodiments, the culture or collection of strains comprises a strain in which at least one, at least 10, at least 20, at least 30, at least S0, at least 100, at least 300 or more than 300 homologous polypeptidesas defined above is overexpressed or underexpressed. If desired the culture or collection of strains may comprise one or more strains which overexpress or underexpress more than one homologous polypeptide.
For example, in some embodiments, the culture or collection of strains comprises a strain or a group of strains in which in aggregate at least one, at least I0, at least 20, at least 30, at least 50, at least 100, at least 300, or more than 300 gene products selected from the group consisting of a gene product having at least 70%
nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70%
nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25%
amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed, wherein each strain overexpresses or underexpresses one gene product.

If desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ TD
NOs:
8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs:
8-3795.
In further embodiments, the culture or collection of strains comprises a strain or a group of strains in which in aggregate at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300, or more than 300 gene products encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ TD NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed, wherein each strain overexpresses or underexpresses one gene product.
If desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at Ieast 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.~ 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID
NOS.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions.
In additional embodiments, the culture or collection of strains comprises a strain or a group of strains in which in aggregate at least one, at least 10, at least 20, at least 30, at least 50, at least 100, at least 300, or more than 300 gene products comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID
NOs:
3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed, wherein each strain overexpresses or .underexpresses one gene product.

If desired, one or more of the strains in the culture or collection of strains may overexpress or underexpress more than one polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778.
The methods of the present invention may be used to identify the targets of compounds which inhibit the proliferation of any desired cell or organism. In some embodiments, the methods of the present invention are employed to identify the targets of compounds which inhibit the proliferation of bacteria, fungi, or protozoans.
In further embodiments, the methods of the present invention are employed to identify the targets of compounds which inhibit the growth of an organism selected from the group consisting of Anaplasrna marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter eloacae, Enter~coccus faecalis, Enterococcus faecium, Escherichia coli, HaemoplZilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumorziae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aetzcginosa, Salmonella bongori, Salmonella clzolerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typlaimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, S7Zigella dysenteriae, Shigella flexneri, Shigella soranei, Staphylococcus epiderrnidis, Streptococcus pneunioniae, Streptococcus rrautarZS, Treponerna pallidurn, Yersinia enterocolitica, and Yersinia pestis.
Overexpression may be obtained using a variety of techniques familiar to those skilled in the art. For example, overexpression may be obtained by operably linking a gene encoding the gene product to a promoter which transcribes a higher level of mRNA encoding or comprising the gene product than does a wild type cell. A
variety of promoters may be used to overexpress the gene product. The promoters used to overexpress the gene product may be relatively strong promoters, promoters which possess a moderate level of activity, or relatively weak promoters and may be either constitutive or regulatable promoters. In some embodiments, several strains, each of which overexpresses the gene product to a different extent, may be used in order to optimize the degree of overexpression of the gene product.
In some embodiments, each of the gene products required for proliferation may be placed under the control of several different promoters of varying strengths to create several different strains which express the gene product at varying levels. The level of expression of the gene product in each of the strains is compared to that in wild type cells in order to identify a promoter which provides a desired level of expression relative to wild type cells (i.e. a desired level of overexpression or underexpression). The strain having the desired level of expression is then included in a culture or collection of strains to be contacted with a test compound as discussed below.
The promoter is selected to be active in the type of cell in which the gene product is to be expressed. For example, for overexpression of the gene product in mammalian cells, the gene encoding the gene product may be operably linked to promoters such as the SV40 promoter, the metallothionine promoter, the MMTV
promoter, the RSV promoter, the tetP promoter, the adenovirus major late promoter or other promoters known to those skilled in the art. In yeast, the gene encoding the gene product may be operably linked to promoters such as the CYC1, ADHI, ADHII, GAL1, GAL10, PHOS, PGK or other promoters used in the art. Similarly, in bacteria, the gene encoding the gene product may be operably linked to the , SP6, T3, trc promoter, lac promoter, temperature regulated lambda promoters, the Bacillus aprE
and nprE promoters (U.S. Patent No. 5,387,521), the bacteriophage lambda PL
and PR
promoters (Renaut, et al., (1981) Gene 15: 81) the trp promoter (Russell, et al., (1982) S Gene 20: 23), the tac promoter (de Boer et al., (1983) Proc. Natl. Acad.
Sci. USA 80:
21), B. subtilis alkaline protease promoter (Stahl et al, (1984) J. Bacteriol.
158, 411-418) alpha amylase promoter of B. subtilis (Yang at al., (1983) Nucleic Acids Res. 11, 237-249) or B. amyloliquefaciehs (Tarkinen, et al, (1983) J. Biol. Chem. 258, 1013), the neutral protease promoter from B. subtilis (Yang et al, (1984) J.
Bacteriol.
160, 15-21), T7 RNA polymerase promoter (Studier and Moffatt (1986) J Mol Biol.
189(1):113-30), B. subtilis xyl promoter or mutant tetR promoter active in bacilli (Geissendorfer & Hillen (1990) Appl. Microbiol. Biotechnol. 33:657-663), Staphylococcal enterotoxin D promoter (Zhang and Stewart (2000) J. Bacteriol.
182(8):2321-S), cap8 operon promoter from Staphylococcus aureus (Ouyang et al., (1999) J. Bacteriol. 181(8):2492-500), the lactococcal nisA promoter (Eichenbaum (1998) Appl Environ Microbiol. 64(8):2763-9), promoters from in Acholeplasma laidlawii (Jaxhede et al., (1995) Microbiology 141 ( Pt 9):2071-9), porA
promoter of Neisseria mehihgitidis (Sawaya et al., (1999) Gene 233:49-57), the fbpA
promoter of Neisseria gonorrhoeae (Forng et al., (1997) J. Bacteriol. 179:3047-3052), Corynebacterium diphtheriae toxin gene promoter (Schmitt and Holines (1994) J.
Bacteriol. 176(4):1141-9), the hasA operon promoter from Group A Streptococci (Alberti et al., (1998) Mol Microbiol 28(2):343-53), the rpoS promoter of Pseudomonas putida (I~ojic and Venturi (2001) J. Bacteriol. 183:3712-3720), and the IPTG inducible promoter in pLEXSBA (Krause et al., J. Mol. Biol. 274: 365 (1997), In another embodiment, which may be useful in Staphylococcus aureus, the promoter is a novel inducible promoter system, XylTS, comprising a modified TS promoter fused to the xyl0 operator from the xylA promoter of Staphylococcus aureus.
This promoter is described in U.S. Patent Application Serial Number 10/032,393, the disclosure of which is incorporated herein by reference in its entirety. In another embodiment the promoter may be a two-component inducible promoter system in which the T7 RNA polymerase gene is integrated on the chromosome and is regulated by lacUVSl lac0 (Brunschwig, E. and Darzins, A. 1992. Gene 111:35-41, the disclosure of Which is incorporated herein by reference in its entirety) and a T7 gene promoter, which is transcribed by T7 RNA polymerase, is fused with a lac0 S operator. In another embodiment the promoter may be the promoters from the plasmids pEPEF3 or pEPEFl4, which harbor xylose inducible promoters functional in E. faecalis, described in U.S. Patent Application Serial No. 10/032,393, the disclosure of which is incorporated herein by reference in its entirety. Other promoters which may be used are familiar to those skilled in the art. In fungi, the gene encoding the 10 gene product may be operably linked to the CaACTI promoter (Morschhauser, Mol.
Gen. Genet. 257: 4I2-420 (1998), the disclosure of which is incorporated herein by reference in its entirety), the tetracycline regulatable promoter described in U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001, the disclosure of which is incorporated herein by reference in its entirety, or the promoters described in U.S.
1S Patent Application Serial Number 10/032,S8S filed December 20, 2001 , the disclosure of which is incorporated herein by reference in its entixety, or other promoters familiar to those skilled in the art. It will appreciated that other combinations of organisms and promoters may also be used in the present invention.
In some embodiments, overexpression may be achieved by using homologous recombination to replace the natural promoter which drives expression of the gene required for proliferation with a regulatable promoter. For example, the methods described in U.S. Patent Application Serial No. 09/792,024 filed February 20, (the disclosure of which is incorporated herein by reference in its entirety), . U.S.
Patent Application Serial Number 10/032,S8S filed December 20, 2001 (the disclosure 2S of which is incorporated herein by reference in its entirety), U.S. Patent Application 09/948,993 (the disclosure of which is incorporated herein by reference in its entirety) and U.S. Patent Application 09/948,993 (the disclosure of which is incorporated herein by reference in its entirety) may be used to place the gene required for proliferation under the control of a regulatable promoter. U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is incorporated herein by reference in its entirety), U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 (the disclosure of which is incorporated herein by reference in its entirety), U.S. Patent Application Serial Number 09/815,242 (the disclosure of which is incorporated herein by reference in its entirety), U.S. Patent Application Serial Number 09/492,709 (the disclosure of which is incorporated herein by reference in its entirety), U.S. Patent Application Serial Number 09/711,164 (the disclosure of which is incorporated herein by reference in its entirety), and U.S. Patent Application Serial Number 09/741,669 (the disclosure of which is incorporated herein by reference in its entirety) disclose genes and gene products required for proliferation which may be used in any of the methods of the present invention.
Briefly, in some embodiments of these methods, the cells may be haploid, such as bacterial cells. A linear promoter replacement cassette comprising a regulatable promoter flanked by nucleotide sequences having homology to the natural promoter is introduced into the cell. In some embodiments, the cassette also comprises a nucleotide sequence encoding a selectable marker or a marker whose expression is readily identified. The cassette may be a double stranded nucleic acid or a single stranded nucleic acid as described in U.S. Patent Application Serial Number 091948,993, the disclosure of which is incorporated herein by reference in its entirety.
Upon homologous recombination, the natural promoter is replaced with the regulatable promoter, leaving the gene required for proliferation under the control of the regulatable promoter. Strains in which the gene required for proliferation is under control of the regulatable promoter are grown under conditions in which the regulatable promoter provides a level of the proliferation-required gene product which is above the level in a wild type cell. For example, the strains may be grown in the presence of an inducer which induces expression from the regulatable promoter, or under conditions in which the action of a repressor on the regulatable promoter is reduced or eliminated.
Alternatively, rather than replacing the native promoters each of the genes encoding gene product required for proliferation with a single desired replacement promoter, a plurality of replacement promoters which provide desired expression levels for the gene products to be overexpressed or underexpressed are used.
The method is performed as described above except that rather than using a single labeled primer complementary to a nucleotide sequence within the single replacement promoter, a plurality of labeled primers complementary to suitable nucleotide sequences in the plurality of replacement promoters are used.
Alternatively, in embodiments in which the level or activity of gene products required for proliferation is reduced by transcribing an antisense nucleic acid complementary to at least a portion of the genes encoding such gene products, the strains may be designed such that the length of the nucleotide sequence encoding the antisense nucleic acid is different for each gene. Amplification reactions are performed as described above using primers at each end of the gene encoding the antisense nucleic acid such that the amplification product corresponding to each gene has a unique length or a dye which allows it to be distinguished from other amplification products of the same length. Alternatively, the lengths of the nucleotide sequences encoding the antisense nucleic acids may not be unique for each gene, but the primers used in the amplification reaction may be selected such that the length of the amplification product corresponding to each gene is unique.
In another embodiment, the native promoters may be replaced with promoters which include therein or adj scent thereto a unique nucleotide sequence which is distinct from that present in the other replacement promoters in the strains in the culture or collection of strains. In this embodiment, each promoter includes or has adjacent thereto a unique "tag" which may be used to identify strains which proliferate more rapidly or more slowly in the culture or collection of strains. The tag may be detected using hybridization based methods or amplification based methods, including the amplification method which generates amplification products having a unique size for each proliferation required gene described above.
Alternatively, the native promoter which directs the transcription of the gene required for proliferation may rendered regulatable by inserting a regulatory element into the chromosome of the cell via homologous recombination such that the regulatory element regulates the level of transcription from the promoter. The regulatory element may be may be an operator which is recognized by a repressor (e.g. lac, tet, araBAD repressors) or a nucleotide sequence which is recognized by a transcriptional activator. In some embodiments, the regulatory element may be a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA
or an upstream activating sequence. A linear regulatory element insertion cassette comprising a regulatory element flanked by nucleotide sequences having homology to the natural promoter is introduced into the cell. In some embodiments, the cassette also comprises a nucleotide sequence encoding a selectable marker or a marker whose expression is readily identified. The cassette may be a double stranded nucleic acid or a single stranded nucleic acid as described in U.S. Patent Application Serial Number 09/948,993, the disclosure of which is incorporated herein by reference in its entirety.
Upon homologous recombination, the regulatory element is inserted into the chromosome, leaving the gene required for proliferation under the control of the regulatory element. Strains in which the gene required for proliferation is under control of the regulatory element are grown under conditions in which the regulatable promoter provides a level of the proliferation-required gene product which is above the level in a wild type cell. For example, the strains may be grown in the presence of an inducer which induces expression from the promoter, or under conditions in which the action of a repressor on the promoter is reduced or eliminated. It will be appreciated that the amplification method which generates amplification products having a unique size for each proliferation required gene may be used to detect strains which are overrepresented or underrepresented in the culture or collection of strains.
For example, if desired, primers complementary to a nucleotide sequence within the regulatory element may be used in the amplification reaction.
The promoter replacement cassette or regulatory element insertion cassette may be a double stranded nucleic acid, such as an amplicon generated through PCR or other amplification methods, or a single stranded nucleic acid, such as an oligonucleotide. For example, single stranded nucleic acids may be introduced into the chromosome using the methods described in Ellis et al., PNAS 98: 6742-6746, 2001, the disclosure of which is incorporated herein by reference in its entirety.

In some embodiments, the cell into which the promoter replacement cassette or regulatory element insertion cassette is introduced has an enhanced frequency of recombination. For example, the cells may lack or have a reduced level or activity of one or more exonucleases which would ordinarily degrade the DNA to be inserted into the chromosome. In further embodiments, the cells may both lack or have reduced levels of exonucleases and express or overexpress proteins involved in mediating homologous recombination. For example, if the methods are performed in Escherichia coli or other enteric prokaryotes, cells in which the activity of exonuclease V of the RecBCD recombination pathway, which degrades linear nucleic acids, has been reduced or eliminated, such as recB, recC, or recD mutants may be used. In some embodiments, the cells have mutations in more than one of the recB, recC, and recD genes which enhance the frequency of homologous recombination.
For example the cells may have mutations in both the recB and recC genes.
The promoter replacement or regulatory element insertion methods may also be performed in Escherielaia coli cells in Which the activity of the RecET
recombinase system of the Rac prophage has been activated, such as cells which carry an sbcA
mutation. The RecE gene of the rac prophage encodes ExoVIII a 5'-3' exonuclease, while the RecT gene of the Rac prophage encodes a single stranded DNA binding protein which facilitates renaturation and D-loop formation. Thus, the gene products of the RecE and RecT genes or proteins with analogous functions facilitate homologous recombination. The RecE and RecT genes lie in the same operon but are normally not expressed. However, sbcA mutants activate the expression the RecE
and RecT genes. In some embodiments, the methods may be performed in cells which carry mutations in the recB and recC genes as well as the sbcA mutation. The RecE
and RecT gene may be constitutively or conditionally expressed. For example, the methods may be performed in E. coli strain JC8679, which carnes the sbcA23, recB21 and recC22 mutations.
In some embodiments, the methods may be performed in Escherichia coli cells in which recombination via the RecF pathway has been enhanced, such as cells which carry an sbcB mutation.

It will be appreciated that the recE and recT gene products, or proteins with analogous functions may be conditionally or constitutively expressed in prokaryotic organisms other than E. coli. In some embodiments, these proteins may be conditionally or constitutively expressed in Anaplasma marginale, Aspergillus fumigatus, Bacillus artthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Casrdida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlanaydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium di~cile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faeealis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobaeter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobaeterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salnaoraella paratyphi, Sal»aonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus rnutans, Treponema pallidum, Yersinia enterocolitica, or Yersinia pestis. For example, plasmids encoding these gene products may be introduced into the organism. If desired, the coding sequences encoding these gene products may be optimized to reflect the codon preferences of the organism in which they are to be expressed. Similarly, in some embodiments, the organism may contain mutations analogous to the recB, recC, recD, sbcA or sbcB
mutations which enhance the frequency of homologous recombination.
In further embodiments, the promoter replacement or regulatory element insertion methods may be conducted in cells which utilize the Red system of bacteriophage lambda (~.) or analogous systems from other phages to enhance the frequency of homologous recombination. The Red system contains three genes, 'y, [3 and exo whose products are the Gam, Bet and Exo proteins (see Ellis et al.
PNAS
98:6742-6746, 2001, the disclosure of which is incorporated herein by reference in its entirety). The Gam protein inhibits the RecBCD exonuclease V, thus permitting Beta and Exo to gain access to the ends of the DNA to be integrated and facilitating homologous recombination. The Beta protein is a single stranded DNA binding protein that promotes the annealing of a single stranded nucleic acid to a complementary single stranded nucleic acid and mediates strand exchange. The Exo protein is a double-stranded DNA dependent S'-3' exonuclease that leaves 3' overhangs that can act as substrates for recombination. Thus, constitutive or conditional expression of the ~, red proteins or proteins having analogous functions facilitates homologous recombination.
It will be appreciated that the ~, Beta, Gam and Exo proteins, or proteins with analagous functions may be expressed constitutively or conditionally in prokaryotic organisms other than E. coli. In some embodiments, these proteins may be conditionally or constitutively expressed in Anaplasma marginale, Aspergillus fumigatus, Bacillus antlzracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Carzdida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliernzondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneunzoniae, Chlamydia trachornatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coceidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enteroeoccus faecalis, Enterococcus faeciuzn, Eschericlaia coli, Haemoplzilus influenzae, Helieobaeter pylori, Histoplasnza capsulatum, Klebsiella pneumoniae, Listeria morzocytogenes, Mycobacterium leprae, Mycobacteriunz tuberculosis, Neisseria gorzorrhoeae, Neisseria nzeningitidis, Nocardia asteroides, Pasteurella haeznolytica, Pasteurella multocida, Pneurnocystis carizzii, Proteus vulgaris, Pseudomoraas aeruginosa, Salmonella bongori, Salmonella clzolerasuis, Salntozzella erzterica, Salmonella paratyphi, Salnzonella typhi, Salmonella typhimuriunz, Staphylococcus aureus, Moxarella catarrlzalis, Shigella boydii, Shigella dysenteriae, Slzigella flexneri, Shigella soranei, Staplaylococcus epidermidis, Streptococcus pneumoniae, Streptococcus rnutans, Treponerna pallidurra, Yersinia enterocolitica, or Yersinia pestis. For example, plasmids encoding these gene products may be introduced into the organism. If desired, the coding sequences encoding these gene products may be optimized to reflect the codon preferences of the organism in which they are to be expressed.
In some embodiments, the cells may have an increased frequency of homologous recombination as a result of more than one of the aforementioned IO characteristics. In some embodiments, the enhanced frequency of recombination may be a conditional characteristic of the cells which depends on the culture conditions in which the cells are grown. For example, in some embodiments, expression of the ~, Red Gam, Exo, and Beta proteins or recE and recT proteins may be regulated.
Thus, the cells may have an increased frequency of homologous recombination as a result of any combination of the aforementioned characteristics. For example, in some embodiments, the cell may carry the sbcA and recBC mutations.
In some embodiments, a linear double stranded DNA to be inserted into the chromosome of the organism is introduced into an organism constitutively or conditionally expressing the recE and recT or the ~. Beta, Gam and Exo proteins or proteins with analogous functions as described above. In some embodiments, the organism may be Anaplasrna marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrccta (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida gur.'lliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridiunz botulinurn, Clostridium di~cile, Clostridium perfringens, Coccidiodes inamitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Esclaerichia coli, Haernopl:ilus influenzae, Helicobacter pylori, Histoplasma capsulaturra, Klebsiella przeumorziae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria rneningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella ntultocida, Prteuntocystis carirtii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salntonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimuriunt, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sortnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutants, Treponema pallidunt, Yersinia ertterocolitica, or Yersinia pestis. In some embodiments, the double stranded DNA may be introduced into an organism having the recBC and sbcA mutations or analogous mutations.
In other embodiments, a single stranded DNA to be inserted into the chromosome of the organism is introduced into an organism expressing the ~, Beta protein or a protein with an analogous function. In some embodiments the single stranded DNA is introduced into an organism expressing both the ~. Beta and Gam proteins or proteins with analogous functions. In further embodiments, the single stranded DNA is introduced into an organism expressing the ~, Beta, Gam and Exo proteins or proteins with analogous functions. The ~, proteins or analogous proteins may be expressed constitutively or conditionally. In some embodiments, the organism may be Anaplasma marginale, Aspergillus funtigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Gandida albicans, Cartdida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefjrr (also called Cartdida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium di~cile, Clostridium perfringens, Coccidiodes irnmitis, Corynebacteriurn diptheriae, Cryptococcus neoformans, Ertterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemopltilus influertzae, Helicobacter pylori, Histoplasrrta capsulatum, Klebsiella pneutrtottiae, Listeria ntonocytogertes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gottorrhoeae, Neisseria mertirtgitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carirZii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella claolerasuis, Salmonella enterica, Sadrnonella paratyphi, Salmonella typhi, Salmonella typhimuriuna, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexraeri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus muta>zs, Treponema pallidum, Yersiraia enterocolitica, or Yersinia pesos.
In some embodiments, the linear nucleic acid may be introduced into the chromosome of a first organism which has an enhanced frequency of homologous recombination and then transferred to a second organism which is less amenable to direct application of the present methods. For example, the linear nucleic acid may be introduced into the chromosome of E. coli and transferred into a second organism via conjugation or transduction. After introduction into the second organism, the nucleic acid is inserted into the chromosome of the second organism via homologous recombination, thereby effectively transfernng the regulatory element from the chromosome of the first organism into the corresponding location in the chromosome of the second organism.
In other embodiments, the cells may be diploid cells, such as fungal cells. In some embodiments, one copy of the gene encoding the proliferation-required gene product may be disrupted, rendering it inactive. In further embodiments, one copy of the gene encoding the proliferation-required gene product may be disrupted and the other copy of the gene encoding the proliferation-required gene product may be placed under the control of a regulatable promoter. Such strains may be generated by disrupting the first copy of the gene encoding the proliferation-required gene product by homologous recombination using a disruption cassette comprising a nucleotide sequence encoding an expressible dominant selectable marker flanked on each side by nucleic acids homologous to the target sequence to be disrupted. The second copy of the gene encoding the proliferation-required gene product may be placed under the control of a regulatable promoter by homologous recombination using a promoter replacement cassette comprising a regulatable promoter flanked on each side by nucleic acids homologous to the natural promoter for the proliferation-required gene.

The promoter replacement cassette may also include a nucleotide sequence encoding a selectable marker located S' of the regulatable promoter but between the nucleic acids homologous to the natural promoter.
In other embodiments, overexpression may be achieved by operably linking S the gene required for proliferation to a desired promoter in a vector. The vector may be a vector which replicates extrachromosomally or a vector which integrates into the chromosome. For example, if the vector is to be .used in bacterial cells, the vector may be a pBR322 based vector or a bacteriophage based vector such as P1 or lambda.
If the vector is to be used in Saccharomyces cerevisae, it may be a vector based on the 2 micron circle or a vector incorporating a yeast chromosomal origin of replication. If the vector is to be used in mammalian cells, it may be a retroviral vector, SV40 based vector, a vector based on bovine papilloma virus, a vector based on adenovirus, or a vector based on adeno-associated virus. If the vector is to be used in Candida albicans it may be a vector comprising a promoter selected from the group consisting 1S of the CaPCKI, MET2S, MAL2, PHOS, GAL1,10, STE2 or STE3 promoters. In some embodiments, the vectors described in the following publications (the disclosures of which are incorporated herein by reference in their entireties) may be used: CIplO, an efficient and convenient integrating vector for Candida albicans.
Murad et al., Yeast 16(4):325-7 (2000); Transforming vector pCPW7, Kvaal et al., :
Infect Immun 67(12):6652-62 (1999); Transforming vector pCWOPI6, Kvaal et al., Infect Immun 6S(11):4668-75 (1997); double-ARS vector, pRMI, to be used for direct cloning in Ca by complementation of the histidine auxotrophy of strain CA9, Pla et al., Gene 16S(1):115-20 (1995); pMKl6, that was developed for the transformation of C. albicans and carnes an ADE2 gene marker and a Candida 2S autonomously replicating sequence (CARS) element promoting autonomous replication (cited in Sanglard and Fiechter Yeast 8(12):1065-75 (1992); A
plasmid vector (denoted pRC2312) was constructed, which replicates autonomously in Escherichia coli, Saccharomyces cerevisiae and Candida albicans. It contains LEU2, URA3 and an autonomously replicating sequence (ARS) from C. albicans, Cannon et al., Mol Gen Genet 235(2-3):453-7 (1992); Expression vector (CIplO-MAL2p) for use ' 98 in Candida albicans has been constructed in which a gene of interest can be placed under the control of the CaMAL2 maltase promoter and stably integrated at the CaRPlO Locus (Backen et al., Yeast 16(12):1121-9 (2000)); (Volker, R. S., A.
Sonneborn, C. E. Leuker, and J. F. Ernst. 1997. Efglp, an essential regulator of morphogenesis of the human pathogen Candida albicans, is a member of a conserved class of bHLH proteins regulating morphogenetic processes in fungi. EMBO
16:1982-1991.); and A C. albicans transformation vector containing the C. albicans gene, a Candida ARS sequence, and a portion of the Saccharomyces cerevisiae 2 microns circle containing the replication origin was constructed. Goshorn et al., Infect Immun 60(3):876-84 (1992). A variety of other vectors suitable fox use in foregoing organisms or in any other organism in which the present invention is to be practiced are familiar to those skilled in the art.
Underexpression of the gene product may be obtained in a variety of ways.
For example, in one embodiment underexpression of the gene product may be achieved by providing an agent which reduces the level or activity of the gene product within the cell. In one embodiment, the agent may comprise an antisense nucleic acid which is complementary to a nucleic acid encoding the gene product or complementary to a portion of a nucleic acid encoding the gene product. For example, a nucleic acid which encodes the antisense nucleic acid may be operably linked to a regulatable promoter. When grown under appropriate conditions, such as media containing an inducer of transcription or an agent which alleviates repression of transcription, the antisense nucleic acid is expressed in the cell, thereby reducing the level or activity of the gene product within the cell. In some embodiments, the concentration of the inducer of transcription or the agent which alleviates repression of transcription may be varied to provide optimal results. Such methods have been described in U.S. Patent Application Serial Number 09/815,242 (the disclosure of which is incorporated herein by reference in its entirety), U.S. Patent Application Serial Number 09/492,709 (the disclosure of which is incorporated herein by reference in its entirety), U.S. Patent Application Serial Number 09/711,164 (the disclosure of which is incorporated herein by reference in its entirety), U.S. Patent Application Serial Number 09/741,669 (the disclosure of which is incorporated herein by reference in its entirety), U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is incorporated herein by reference in its entirety), or U.S.
Patent Application Serial Number 10/032,585 filed December 20, 2001 the disclosure of which is incorporated herein by reference in its entirety). Each of the Patent Applications cited in the preceding sentence disclose genes and gene products required for proliferation which may be used in any of the methods of the present invention.
Alternatively, underexpression of a gene product required for proliferation may be achieved by constructing strains in which the expression of the gene product is under the control of a constitutive or regulatable promoter using methods such as those described above with respect to methods in which the gene product is overexpressed. To provide cells which underexpress the gene product, the cells are grown under conditions in which expression the gene product is expressed at a level lower than that of a wild type cell. For example, the cells may be grown under conditions in which a repressor reduces the level of transcription from the regulatable promoter.
In other embodiments, underexpression may be achieved by operably linking the gene required for proliferation to a desired promoter in a vector as described above with respect to embodiments in which gene products required for proliferation are overexpressed. In some embodiments, the vector may be present in cells in which the chromosomal copy or copies of the gene has been disrupted.
Gene products required for proliferation may be identified using a variety of methods, including the methods described in U.S. Patent Application Serial No.
09/792,024 filed February 20, 2001 (the disclosure of which is incorporated herein by reference in its entirety), U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 (the disclosure of which is incorporated herein by reference in its entirety), U.S. Patent Application Serial Number 09/815,242 (the disclosure of which is incorporated herein by reference in its entirety), U.S. Patent Application Serial Number 09/492,709 (the disclosure of which is incorporated herein by reference in its entirety), U.S. Patent Application Serial Number 09/711,164 (the disclosure of which is incorporated herein by reference in its entirety), and U.S. Patent Application Serial Number 09/741,669 (the disclosure of which is incorporated herein by reference in its entirety). Each of the proliferation-required genes and gene products disclosed in the applications listed in the preceding sentence may be used in any of the methods of the present invention. Briefly, in one embodiment, gene products required for proliferation are identified by operably linking random genomic fragments to a regulatable promoter in a vector. The random genomic fragments may be generated by a partial digestion with a restriction enzyme, mechanical shearing, using techniques such as sonication and nebulization, or DNAseI digestion. Upon induction of transcription from the promoter with a suitable agent, the expression vectors produce an RNA molecule corresponding to the inserted genomic fragments. In those instances where the inserted genomic fragments are in an antisense orientation with respect to the promoter, the transcript produced is complementary to at least a portion of an mRNA
encoding a gene product such that they interact with sense mRNA produced from various genes and thereby decrease the translation efficiency or the level of the sense messenger RNA (mRNA) thus decreasing production of the protein encoded by these sense mRNA molecules. In cases where the sense mRNA encodes a protein required for proliferation, cells grown under inducing conditions fail to grow or grow at a substantially reduced rate. Additionally, in cases where the transcript produced is complementary to at least a portion of a non-translated RNA and where that non-translated RNA is required for proliferation, cells grown under inducing conditions also fail to grow or grow at a substantially reduced rate. In contrast, cells grown under non-inducing conditions grow at a normal rate. The genes to which the antisense nucleic acids are complementary are then identified and utilized in the methods of the present invention.
Alternatively, genes required for proliferation may be identified by replacing the natural promoter for the proliferation required gene with a regulatable promoter as described above. The growth of such strains under conditions in which the promoter is active or non-repressed is compared to the growth under conditions in which the promoter is inactive or repressed. If the strains fail to grow or grow at a substantially reduced rate under conditions in which the promoter is inactive or repressed but grow normally under conditions in which the promoter is active or non-repressed, then the gene which is operably linked to the regulatable promoter encodes a gene product required for% proliferation. For example, proliferation-required genes and gene products identified using promoter replacement are described in U.S. Patent Application Serial Number 09/948,993 (the disclosure of which is incorporated herein by reference in its entirety) U.S. Patent Application Serial No. 09/792,024 filed February 20, 2001 (the disclosure of which is incorporated herein by reference in its entirety), and U.S. Patent Application Serial Number 10/032,585 filed December 20, 2001 (the disclosure of which is incorporated herein by reference in its entirety). Each of the genes and gene products described in the applications listed in the preceding sentence may be used in any of the methods of the present invention.
The present invention includes a method for identifying the gene product on which a compound which inhibits the proliferation of an organism acts. The method employs a culture which comprises a mixture of strains of the organism. At least some of the strains in the culture overexpress a different gene product which is required for the proliferation of the organism. Preferably, each of the strains in the culture overexpresses a different gene product which is required for proliferation of the organism (i.e. all of the strains in the culture overexpress a gene product which is required for proliferation of the organism), Such strains may be obtained using the methods described above. The culture may comprise any number of strains. For example the culture may comprise at least two strains, at least 10 strains, at least 20 strains, at least 30, strains, at least 50 strains, at least 100 strains, at least 300 strains or more than 300 strains. In some embodiments, the culture may comprise strains which in aggregate overexpress all or most of the gene products required for proliferation of the organism.
The culture is contacted with a compound which inhibits proliferation of the organism. The compound may be a candidate drug compound obtained from any source. For example, the compound may be a compound generated using combinatorial chemistry, a compound from a natural product library, or an impure or partially purified compound, such as a compound in a partially purified natural extract. The culture is contacted with a sufficient concentration of the compound to inhibit the proliferation of strains of the organism in the culture which do not overexpress the gene product on which the compound acts, such that strains which overexpress said gene product on which the compound acts proliferate more rapidly in the culture than strains which do not overexpress said gene product on which said compound acts. Thus, after a sufficient period of time, the strain which overexpresses the gene product on which the compound acts will be more prevalent in the culture than strains which do not overexpress the gene product on which the compound acts.
In a preferred embodiment, the growth conditions and incubation period are selected so that only one strain, the strain overexpressing the target of the compound, is recovered from the culture. Thus, in one embodiment, a plurality of cultures containing a plurality of strains each of which overexpresses a different proliferation-required gene product may be grown in the presence of varying concentrations of the compound. In addition to varying the compound concentrations, in embodiments where expression of the proliferation-required gene product is under the control of a regulatable promoter, the plurality of cultures may be grown at varying concentrations of an agent which regulates the level of expression from the promoter, such as an inducer or an agent which reduces the effect of a repressor on transcription from the promoter. It will be appreciated, that the cultures may be grown in liquid medium in the presence of the compound whose target is to be identified (and where appropriate in the presence of an agent which regulates the level of expression from the promoter) or alternatively, a liquid culture comprising the strains which overexpress the proliferation-required gene products may be grown in the absence of the compound whose target is to be identified and then introduced onto a solid medium containing the compound (and, where appropriate, also containing an agent which regulates the level of expression from the promoter).
The identity of the overexpressed gene product which is the target of the compound may be determined using a variety of methods. For example, in some embodiments of the present invention, the nucleic acids present in the culture or collection of strains which was contacted with the compound may be compared to the nucleic acids present in a control culture or collection of strains which was not contacted with the compound to identify nucleic acids which are overrepresented in the culture or collection of strains contacted with the test compound relative to the control culture or collection of strains. Alternatively, in some embodiments, the nucleic acids present in a culture or collection of strains contacted with the test compound may be analyzed to identify those nucleic acids which are present without comparison to a control culture or collection of strains.
In some embodiments of the present invention, the strains which proliferated more rapidly in the culture or collection of strains ,i.e. strains having an enhanced ability to proliferate in the presence of a test compound relative to other strains in the culture or collection of strains, are identified as follows. Amplification products which are correlated with each of the overexpressed genes and which are distinguishable from one another are obtained from a culture or collection grown in the presence of a test compound. The amplification products are distinguished from one another to determine whether a particular amplification product is overrepresented in the culture or collection of strains. In some embodiments, the amplification products corresponding to each of the gene products have lengths which permit them to be distinguished from one another. In another embodiment, one or more of the amplification products have similax or identical lengths but are distinguishable from one another based on a detectable agent, such as a dye, attached thereto. In some embodiments, amplification products which are overrepresented are identified by comparing the amplification products from the culture or collection of strains which was contacted with the test compound to the amplification products from a culture or collection of strains which was not contacted with the test compound.
Alternatively, amplification products which are overrepresented may be identified by simply identifying the amplification products obtained from the culture or collection of strains contacted with the test compound (for example, only one or a few strains may have proliferated in the presence of the test compound). The above methods for generating distinguishable amplification products may be used in conjunction with any of the methods for generating strains which overexpress gene products required for proliferation described herein in order to facilitate the identification of strains which proliferate more rapidly or more slowly in the presence of a test compound.
S For example, in some embodiments of the present invention, each of the native promoters of each of the genes encoding gene product required for proliferation are replaced by a single desired replacement promoter. After growth of the culture or collection of strains containing the strains in which the promoters have been replaced in the presence of a test compound for a desired period of time, an amplification reaction is performed on nucleic acids obtained from the culture as follows.
The nucleic acids from the culture or collection of strains may be divided into at least two aliquots if desired. In a preferred embodiment the nucleic acids from the culture or collection of strains are divided into four aliquots. A single primer complementary to a nucleotide sequence within the replacement promoter , within the 1S proliferation required genes, or within nucleic acid sequences adjacent to the promoter or proliferation required genes is divided into at least two portions, one portion for each aliquot of nucleic acids. Each portion of -the primer is labeled with a distinct detectable dye, such as the 6FAMTM, TETTM, VICTM, HEXTM, NEDTM, and PETTM
dyes obtainable from Applied Biosystems (Foster City, CA). For example, the DS-or DS-33 dye sets available from Applied Biosystems (Foster City, CA) may be used to label the primers. Alternatively, the HEXTM, NED, JOE, TMR and TETTM dyes available from Amersham Biosciences may be used. Thus, if the nucleic acids from the culture are not divided into aliquots, a single primer labeled with a single dye may be used. If the nucleic acids from the culture are divided into aliquots, at least 2, at 2S least 3, at least 4 or more than 4 primers labeled with distinguishable dyes may be used. Each of the portions of labeled primers are added to each of the aliquots of the nucleic acids from the culture or collection of strains such that each aliquot of nucleic acid receives a single labeled primer with a single detectable dye thereon. In some embodiments, the primers are divided into 3 portions, 4 portions or more than lOS

portions, with each portion having a dye which is distinguishable from the dyes on the other portions thereon.
Each of the aliquots of nucleic acids also receives a set of unlabeled primers, with each of the unlabeled primers being complementary to a nucleotide sequence within the promoter, within a nucleotide sequence which is unique to one of the genes encoding gene products required for proliferation which were placed under the control of the replacement promoter, or within nucleotide sequences adjacent to the promoter or proliferation required genes. Each of the aliquots receives primers unique to 1!N
proliferation required genes which were placed under the control of the replacement promoter, where N is the number of aliquots (i.e. if the culture or collection of strains consisted of 100 strains in which a gene required for proliferation was placed under the control of the replacement promoter and was divided into four aliquots, then each of the four aliquots of nucleic acids from the culture or collection of strains would receive primers complementary to 25 of the genes). The unlabeled primers are selected so that each will yield an amplification product having a length distinguishable from the length of the amplification product produced with the other unlabeled primers. Preferably, the amplification products are between about about 400 nucleotides in length, but any lengths which may be distinguished from each other may be used. In addition, in some of the embodiments some of the amplification products may have identical or very similar lengths but be distinguishable from one another due to labeling with distinguishable dyes.
A nucleic acid amplification reaction is conducted on each of the nucleic acid aliquots. The amplification products are then separated by length to identify amplification products having increased representation in the culture or collection of strains (i.e. amplification products derived from cells which proliferated more rapidly in the culture or collection of strains). The amplification products are then correlated with the corresponding genes to determine which strains proliferated more rapidly in the culture or collection of strains. If desired, amplification products having increased representation in the culture may be identified by comparing the amplification products obtained from a culture or collection of strains which was contacted with the compound to amplification products obtained from a control culture or collection of strains which was not contacted with the compound. Alternatively, if desired, the amplification products which are obtained from a culture which was contacted with the compound may be directly identified without comparison to a control culture which was not contacted with the compound.
For example, in some embodiments, the amplification products from each of the nucleic acid aliquots are pooled and subjected to capillary electrophoresis. The amplification products are detected by detecting the fluorescent dyes attached thereto and their lengths are determined to identify those amplification products having increased or decreased representation in the culture or collection of strains, Figures 1A and 1B illustrate one embodiment of this method in which the absence of an amplification product from an amplification reaction performed on a culture comprising a plurality of strains underexpressing genes required for proliferation indicates that a test compound acts on the gene corresponding to the missing amplification product. It will be appreciated that the method may also be used to identify an amplification product which is overrepresented in an amplification reaction conducted on a culture or collection of strains overexpressing genes required for proliferation because the test compound acted on the corresponding gene.
Alternatively, in another embodiment, a first amplification reaction is performed on nucleic acids obtained from a culture or collection of strains which was contacted with the compound using a first primer complementary to a nucleotide sequence present upstream or downstream of all of the overexpressed genes (such as a primer complementary to a nucleotide sequence in a replacement promoter upstream of all of the overexpressed genes) and a set of primers complementary to a nucleotide sequence unique to each of the strains (such as a primer complementary to a nucleotide sequence within each of the proliferation-required genes). One of the two amplification primers for each of the proliferation required genes is labeled with a dye as described above. Preferably, the common primer complementary to a nucleotide sequence upstream or downstream of all of the overexpressed genes is labeled with the dye. The primers used in the amplification reaction are designed so that the amplification product corresponding to each proliferation-required gene has a unique length or a dye which allows it to be distinguished from other amplification products of the same length. A second amplification reaction is conducted on a control culture or collection of strains which was not contacted with the compound using the same primers as in the first amplification reaction. The amplification products from the first amplification reaction are compared to those from the second amplification reaction to identify one or more amplification products which are overrepresented in the culture or collection of strains. For example, the amplification products from the first amplification reaction may be run in a separate lane of a polyacrylamide gel or a separate capillary than the amplification products from the second amplification reaction and the two lanes or capillaries are compared to one another. If desired, in the embodiment where the amplification products from the first amplification reaction are run in a different lane or capillary than the amplification products from the second amplification reaction, the same dye may be used to label the primers in the first and second amplification reactions. Alternatively, if desired, different dyes may be used to label the primers in the first and second amplification reactions. If desired, in the embodiment where the amplification products from the first amplification reaction are run in a different lane or capillary than the amplification products from the second amplification reaction, the same dye may be used to label the primers in the first and second amplification reactions. Alternatively, if desired, different dyes may be used to label the primers in the first and second amplification reactions.
Alternatively, in some embodiments, the primers in the second amplification reaction are labeled with a different dye which is distinguishable from the dye used in the first amplification reaction. In this embodiment, the amplification reactions may be pooled and run in the same lane on a polyacrylamide gel or in the same capillary and the products from each amplification reaction are compared by comparing the amount of each dye present for each amplification product. Figures 2A and 2B
illustrate one embodiment of this method in which the absence of an amplification product from the amplification reaction performed on a culture comprising a plurality of strains underexpressing genes required for proliferation which was contacted with the compound indicates that a test compound acts on the gene corresponding to the missing amplification product. It will be appreciated that the method may also be used to identify an amplification product which is overrepresented in an amplification reaction conducted on a culture or collection of strains overexpressing genes required for proliferation because the test compound acted on the corresponding gene.
If desired, rather than dividing the culture into aliquots, individual amplification reactions may be conducted on nucleic acids obtained from the culture or collection of strains. Each amplification reaction contains primers which will yield an amplification product specific for only one of the proliferation required genes. The resulting amplification products from each of the individual amplification reactions are pooled and amplification products having increased representation in the culture are identified as described above.
In another embodiment, a culture or collection of strains in which gene products required for proliferation are overexpressed from regulatable promoters which replaced the native promoters of the genes encoding these gene products is allowed to grow in the presence of a test compound for a desired number of generations. Preferably, the culture or collection of strains is allowed to grow in the presence of the test compound for at least 20 generations. Nucleic acids are isolated from the culture or collection of strains and an amplification reaction is performed using a primer which is complementary to a nucleotide sequence within the replacement promoters) or a nucleotide sequence adjacent to the a 5' end thereof and primers which are complementary to a nucleotide sequence within the proliferation required genes or nucleotide sequences adjacent thereto. The resulting amplification products) is directly sequenced using a primer complementary to a nucleotide sequence within the replacement promoter.
In one embodiment of the present invention, the vector containing the nucleotide sequence encoding the proliferation-required gene product is obtained from a strain which proliferated more rapidly in the culture using methods such as plasmid preparation techniques. Nucleic acid sequencing techniques are then employed to determine the nucleotide sequence of the gene which was overexpressed.

Alternatively, the identity of the overexpressed gene product which is the target of the compound may be determined by performing a nucleic acid amplification reaction, such as a polymerase chain reaction (PCR), to identify the nucleotide sequence of the gene which was overexpressed. For example, aliquots of a nucleic acid preparation, such as a purified plasmid, from the strain which is recovered from the culture may each be contacted with pairs of PCR primers which would amplify a different proliferation-required gene to determine which pair of primers yields an amplification product.
Yet another method for determining the identity of the gene product which is the target of the compound involves obtaining a nucleic acid array, such as a DNA
chip, which contains each of the proliferation-required genes which were overexpressed in the strains in the culture. Each proliferation-required genes occupies a known location in the array. A nucleic acid preparation, such as a plasmid preparation, from the recovered strain is labeled with a detectable agent, such as radioactive or fluorescent moiety, and placed in contact with the nucleic acid array under conditions which permit the labeled nucleic acid to hybridize to complementary nucleic acids on the array. The location on the array to which the labeled nucleic acids hybridize is determined to identify the gene which was overexpressed in the recovered strain. If desired the hybridized nucleic acids from a culture which Was contacted with the compound may be compared to the hybridized nucleic acids from a control culture which was not contacted with the compound. Alternatively, the hybridized nucleic acids from a culture which was contacted with the compound may be directly identified without comparison to nucleic acids from a control culture.
In some embodiments of the invention, more than one strain may proliferate more rapidly in the presence of the compound. This may result from a variety of causes. For example, the concentration of the compound may not have been high enough to restrict proliferation only to cells which overexpress one gene product (i.e.
the target gene product). While strains which overexpress the target gene product will be the most prevalent strain in the culture, other strains may also have proliferated. In such instances, the identity of the gene product in the strain which is most prevalent in the culture may be identified by quantitating the levels of each of the genes encoding proliferation-required proteins in the culture. This may be accomplished by quantitative PCR, DNA sequencing, hybridization, or array technology as described above.
In other instances, multiple strains will exhibit more rapid proliferation in the culture as a result of a common functional attribute. For example, the strains which proliferate more rapidly may each overexpress a gene product with a common enzymatic activity, such as serine protease activity for example.
Alternatively, the strains which proliferate more rapidly may each overexpress a gene product with a common functional domain, such as a cAMP binding domain. In such instances, the common attribute of the strains which proliferate more rapidly may provide information as to the mode of action of the compound or the biochemical activity of the target of the compound. For example, if all of the overexpressed genes in the strains which proliferated more rapidly are serine proteases, the compound acts by inhibiting serine protease activity and the target protein is a serine protease. If desired, the compound may be derivatized and the efficacy of the derivatized compound against each of the strains which proliferated more rapidly may be assessed as described herein in order to identify derivatives which are capable of interacting with a wide range of targets sharing a common activity or binding site (i.e.
derivatives which have a greater ability to inhibit the proliferation of all the strains than the original compound) or to identify derivatives having greater specificity for a desired target (i.e. derivatives which have a greater specificity for one of the strains than the original compound). For example, it is possible that a nonessential gene product expressed in the cell might also bind to the initial test compound in addition to the gene product required for proliferation. In such an instance, it is desirable to obtain a derivative of the initial test compound which is specific for the gene product required for proliferation. In addition, it is possible that two gene products required for proliferation might bind to the initial test compound but specificity for one of the gene products is desired.

In some embodiments, rather than employing a single culture which contains multiple strains each of which overexpresses a proliferation-required gene product, the methods of the present invention may be performed using an array of individual strains (i.e. a collection of strains) each of which overexpresses a different ~ proliferation-required gene product. For example, individual strains each .
overexpressing a different proliferation-required gene product may be grown in different wells of a multiwell plate. Each well is contacted with the compound (and, where appropriate an agent which regulates the level of expression from the promoter). The level of proliferation of the strains in each of the wells is determined to identify a strain which proliferated more rapidly. The identity of the overexpressed gene product in the strain that proliferated more rapidly is determined as described above.
In another embodiment, individual strains each overexpressing a different proliferation-required gene product (i.e. a collection of strains) are grown at different locations on a solid medium, such as an agar plate. The medium contains the compound and where appropriate an agent which regulates the level of expression from the promoter). The level of proliferation of each of the strains is determined to identify a strain which proliferated more rapidly. The identity of the overexpressed , gene product in the strain that proliferated more rapidly is determined as described above.
The above methods may be used to prioritize compound development or to determine whether the compound has been previously identified or whether the target of the compound is the target of a previously identified drug. In particular, if the product is a natural product, it is advantageous to determine whether it has been previously identified prior to investing significant effort in developing it.
Thus, in some embodiments of the present invention, the target of a partially purified or purified natural product or a compound produced by combinatorial chemistry is identified using the methods described above and compared to the targets of known drugs. If the target is identical to that of a known drug, fizrther development of the compound is halted.

In some embodiments of the present invention, an array of strains each of which overexpresses a different gene product (i.e. a collection of strains) is grown on solid medium containing a compound to be evaluated. The location of each strain in the array and the gene product overexpressed by that strain is known. The pattern of colonies which grow in the presence of the compound is evaluated and compared to the pattern of colonies which grow in the presence of previously identified drugs. If the pattern of colonies which grow in the presence of the compound being evaluated is the same as the pattern of colonies which grow in the presence of a previously identified drug, further development of the compound is halted.
In another embodiment, the sequence of the gene product in a strain which proliferated more rapidly in the assays described above is compared to the sequence of gene products from heterologous organisms to determine the likely spectrum of species whose growth would be inhibited by the compound. If the gene product has a high degree of homology to gene products from heterologous species, it is likely that the compound would also inhibit the growth of these heterologous species.
Homology may be determined using any of a variety of methods familiar to those skilled in the art. For example, homology may be determined using a computer program such as BLASTP or FASTA. The ability of the compound to inhibit the growth of the heterologous species may then be confirmed by comparing the growth of cells of the heterologous species in the presence and absence of the compound.
In some embodiments, the present invention uses collections or cultures of strains comprising both strains which overexpress gene products required for cellular proliferation and strains which underexpress the same gene products required for cellular proliferation. The culture or collection of strains is contacted with a compound and the nucleic acids present in the culture or collection of strains are analyzed. Preferably, nucleic acids derived from overexpressing strains can be distinguished from those derived from underexpressing strains. For example, the overexpressing strains may be obtained using promoter replacement as described above while the underexpressing strains may be obtained by expressing antisense nucleic acids. Accordingly, in one embodiment, amplification primers may be designed which will uniquely amplify nucleic acids from the overexpressing strains or the underexpressing strains. If a compound acts on a gene product which was overexpressed and underexpressed in the culture, then the amplification product obtained from the strain in the culture or collection which overexpressed gene product S will be overrepresented in the culture or collection while the amplification product obtained from the strain which underexpressed the gene product will be underrepresented in the culture or collection. If desired, nucleic acids from a culture or collection which was contacted with the compound may be compared to nucleic acids from a control culture or collection which was not contacted with the compound.
Alternatively, nucleic acids from a culture or collection which was contacted with the compound may be directly analyzed without comparison to a control culture or collection.
Current methods for identifying the target of compounds which inhibit cellular proliferation are laborious and time consuming. The above methods may be employed to allow the targets of a large number of compounds to be rapidly identified. In such methods, the methods described above are simultaneously performed for each of a large number of compounds. For example, the compounds may be members of a library of compounds generated using combinatorial chemistry or members of a natural product library. In such methods, a plurality of cultures each comprising a plurality of strains each of which overexpresses a different gene product required for proliferation or a plurality of collections of individual strains each of which overexpresses a different gene product required for proliferation is obtained.
Each culture or collection of strains is contacted with a different compound in the library and the target of the compound is identified as described above.
In another embodiment of the present invention, the gene product on which a compound which inhibits the proliferation of an organism acts is identified using a culture which comprises a mixture of strains of the organism including strains which underexpress a different gene product which is required for proliferation of the organism (i.e. at least some of the strains in the culture underexpress a gene product which is required for proliferation of the organism). Preferably, each of the strains in the culture underexpress a different a gene product which is required for the proliferation of the organism (i.e. all of the strains in the culture underexpress a gene o product which is required for the proliferation of the organism). Such strains may be obtained using the methods described above. The culture may comprise any number of strains. For example the culture may comprise at least two strains, at least 10 strains, at least 20 strains, at least 30, strains, at least 50 strains, at least 100 strains, at least 300 strains or more than 300 strains. In some embodiments, the strains in the culture in aggregate may underexpress all or most of the gene products required for proliferation of the organism.
The culture is contacted with a compound which inhibits proliferation of the organism. The compound may be a candidate drug compound obtained from any source. For example, the compound may be a compound generated using combinatorial chemistry, a compound from a natural product library, or an impure or partially purified compound, such as a compound in a partially purified natural extract. The culture is contacted with a sufficient concentration of the compound to inhibit the proliferation of strains of the organism in the culture which underexpress the gene product on which the compound acts, such that strains which do not underexpress the gene product on which the compound acts proliferate more rapidly in the culture than strains which do underexpress said gene product on which said compound acts. Thus, after a sufficient period of time, the strain which underexpresses the gene product on which the compound acts will be less prevalent in the culture than strains which do not underexpress the gene product on which the compound acts. In one embodiment, the growth conditions and incubation period are selected so that only one strain, the strain underexpressing the target of the compound, proliferates at a reduced rate in the culture. In another embodiment, the growth conditions may be selected so that the strain underexpressing the target of the compound is not recovered from the culture. Thus, in one embodiment, a plurality of cultures containing a plurality of strains each of which underexpresses a different proliferation-required gene product may be grown in the presence of varying concentrations of the compound. In addition to varying the compound concentrations, in embodiments where expression of the proliferation-required gene product is under the control of a regulatable promoter, the plurality of cultures rnay be grown at varying concentrations of an agent which regulates the level of expression from the promoter, such as an inducer or an agent which reduces the effect of a repressor on transcription from the promoter. It will be appreciated, that the cultures may be grown in liquid medium in the presence of the compound whose target is to be identified (and where appropriate in the presence of an agent which regulates the level of expression from the promoter) or alternatively, a liquid culture comprising the strains which underexpress the proliferation-required gene products may be grown in the absence of the compound whose target is to be identified and then introduced onto a solid medium containing the compound (and, where appropriate, also containing an agent which regulates the level of expression from the promoter).
The identity of the underexpressed gene product which is the target of the compound may be determined using a variety of methods. For example, in some embodiments of the present invention, the nucleic acids present in the culture or collection of strains which was contacted with the compound may be compared to the nucleic acids present in a control culture or collection of strains which was not contacted with the compound to identify nucleic acids which are underrepresented in the culture or collection of strains contacted with the test compound relative to the control culture or strains. Alternatively, in some embodiments, the nucleic acids present in a culture or collection of strains contacted with the test compound may be analyzed to identify those nucleic acids which are missing or present at reduced levels without comparison to a control culture or collection of strains.
In some embodiments of the present invention, the strains which proliferated more slowly in the culture or collection of strains ,i.e. strains having an decreased ability to proliferate in the presence of a test compound or which do not proliferate in the presence of a test compound, are identified as follows. Amplification products which axe correlated with each of the underexpressed genes and which are distinguishable from one another are obtained from a culture or collection grown in the presence of a test compound. The amplification products are distinguished from one another to determine whether a particular amplification pxoduct is underrepresented in the culture or collection of strains. In some embodiments, the amplification products corresponding to each of the gene products have lengths which permit them to be distinguished from one another. In another embodiment, one or more of the amplification products have similar or identical lengths but are distinguishable from one another based on a detectable agent, such as a dye, attached thereto. In some embodiments, amplification products which are underrepresented are identified by comparing the amplification products from the culture or collection of strains which was contacted with the test compound to the amplification products from a culture or collection of strains which was not contacted with the test compound. Alternatively, amplification products which are underrepresented in the culture or collection of strains may be identified simply by determining which amplification products are missing or present at reduced levels in the culture or collection of strains. The above methods for generating distinguishable amplification products may be used in conjunction with any of the methods for generating strains which underexpress gene products required for proliferation described herein in order to facilitate the identification of strains which proliferate more slowly in the presence of a test compound.
For example, in some embodiments of the present invention, each of the native promoters of each of the genes encoding gene product required for proliferation are replaced by a single desired replacement promoter. After growth of the culture or collection of strains containing the strains in which the promoters have been replaced in the presence of a test compound for a desired period of time, an amplification reaction is performed on nucleic acids obtained from the culture as follows.
~5 The nucleic acids from the culture or collection of strains axe divided into at least two aliquots. In a preferred embodiment the nucleic acids from the culture or collection of strains are divided into four aliquots. A single primer complementary to a nucleotide sequence within the replacement promoter , within the proliferation required genes, or within nucleic acid sequences adjacent to the promoter or proliferation xequired genes is divided into four groups Each group is labeled with a distinct detectable dye, such as the 6FAMTM, TETTM, VICTM, HEXTM, NEDTM, and PETTM dyes obtainable from Applied Biosystems (Foster City, CA). For example, the DS-31 or DS-33 dye sets available from Applied Biosystems (Foster City, CA) may be used to label the primers. Each of the groups of labeled .primers are added to each of the aliquots of the nucleic acids from the culture or collection of strains such that each aliquot of nucleic acid receives a single labeled primer with a single detectable dye thereon.
Each of the aliquots of nucleic acids also receives a set of unlabeled primers, with each of the unlabeled primers being complementary to a nucleotide sequence within the promoter, within a nucleotide sequence which is unique to one of the genes encoding gene products required for proliferation which were placed under the control of the replacement promoter, or within nucleotide sequences adjacent to the promoter or proliferation required genes. Each of the aliquots receives primers unique to 1/N
proliferation required genes which were placed under the control of the replacement promoter, where N is the number of aliquots (i.e. if the culture or collection of strains consisted of 100 strains in which a gene required for proliferation was placed under the control of the replacement promoter and was divided into four aliquots, then each of the four aliquots of nucleic acids from the culture or collection of strains would receive primers complementary to 25 of the genes). The unlabeled primers are selected so that each will yield an amplification product having a length distinguishable from the length of the amplification product produced with the other unlabeled primers. Preferably, the amplification products are between about about 400 nucleotides in length, but any lengths which may be distinguished from each other may be used. In addition, in some of the embodiments some of the amplification products may have identical or very similar lengths but be distinguishable from one another due to labeling with distinguishable dyes.
A nucleic acid amplification reaction is conducted on each of the nucleic acid aliquots. The amplification products are then separated by length to identify amplif cation products decreased representation or which are absent in the culture or collection of strains. The amplification products are then correlated with the corresponding genes to determine which strains proliferated more slowly in the culture or collection of strains. If desired, amplification products having decreased representation in the culture may be identified by comparing the amplification products obtained from a culture or collection of strains which was contacted with the compound to amplification products obtained from a control culture or collection of strains which was not contacted with the compound. Alternatively, if desired, the amplification products which are missing or present at reduced levels in a culture which was contacted with the compound may be directly identified without comparison to a control culture which was not contacted with the compound.
For example, in some embodiments, the amplification products from each of the nucleic acid aliquots are pooled and subjected to capillary electrophoresis. The amplification products are detected by detecting the fluorescent dyes attached thereto and their lengths are determined to identify those amplification products having decreased representation in the culture or collection of strains. Figures 1A
and 1B
illustrate one embodiment of this method in which the absence of an amplification product from an amplification reaction performed on a culture comprising a plurality of strains underexpressing genes required for proliferation indicates that a test compound acts on the gene corresponding to the missing amplification product.
Alternatively, in another embodiment, a first amplification reaction is performed on nucleic acids obtained from a culture or collection of strains which was contacted with the compound using a first primer complementary to a nucleotide sequence present upstream or downstream of all of the overexpressed genes (such as a primer complementary to a nucleotide sequence in a replacement promoter upstream of all of the overexpressed genes) and a set of primers complementary to a nucleotide sequence unique to each of the strains (such as a primer complementary to a nucleotide sequence within each of the proliferation-required genes). One of the two amplification primers for each of the proliferation required genes is labeled with a dye as described above. Preferably, the common primer complementary to a nucleotide sequence upstream or downstream of all of the overexpressed genes is labeled with the dye. The primers used in the amplification reaction are designed so that the amplification product corresponding to each proliferation-required gene has a unique length. A second amplification reaction is conducted on a control culture or collection of strains which was not contacted with the compound using the same primers as in the first amplification reaction. The amplification products from the first amplification reaction are compared to those from the second amplification reaction to identify one or more amplification products which are underrepresented in the culture or collection of strains. For example, the amplification products from the first amplification reaction may be run in a separate lane of a polyacrylamide gel or a separate capillary than the amplification products from the second amplification reaction and the two lanes or capillaries are compared to one another.
Alternatively, in some embodiments, the primers in the second amplification reaction are labeled with a different dye which is distinguishable from the dye used in the first amplification reaction. In this embodiment, the amplification reactions may be pooled and run in the same lane on a polyacrylamide gel or in the same capillary and the products from each amplification reaction are compared by comparing the amount of each dye present for each amplification product. Figures 2A and 2B
illustrate one embodiment of this method in which the absence of an amplification product from the amplification reaction performed on a culture comprising a plurality of strains underexpressing genes required for proliferation which was contacted with the compound indicates that a test compound acts on the gene corresponding to the missing amplification product.
If desired, rather than dividing the culture into aliquots, individual amplification reactions may be conducted on nucleic acids obtained from the culture or collection of strains. Each amplification reaction contains primers which will yield an amplification product specific for only one of the proliferation required genes. The resulting amplification products from each of the individual amplification reactions are pooled and amplification products having decreased representation in the culture are identified as described above.
In one embodiment the representation of each strain in the culture may be assessed by hybridizing detectably labeled nucleic acids encoding the proliferation-required gene products, or portions thereof, obtained from the culture to an array comprising nucleic acids encoding the gene products required for proliferation or portions thereof. Each nucleic acid encoding a gene product required for proliferation or portion thereof occupies a known location on the array. The signal from each location on the array is quantitated to identify those nucleic acids encoding a proliferation-required gene product which are underrepresented in the culture.
If desired the hybridized nucleic acids from a culture which was contacted with the compound may be compared to the hybridized nucleic acids from a control culture Which was not contacted with the compound. Alternatively, the hybridized nucleic acids from a culture which was contacted with the compound may be directly analyzed without comparison to nucleic acids from a control culture.
Alternatively, each strain underexpressing a gene product required for proliferation may be constructed to contain a unique nucleic acid sequence (referred to herein as a "tag"). The tag may be included in the chromosome of each strain or in an extraehromosomal vector. For example, the tag could be included in a vector encoding an antisense nucleic acid complementary to a gene encoding a gene product required for proliferation or a portion of such a gene or the tag may be included in the antisense nucleic acid itself . The representation of each strain in the culture may be assessed by performing an amplification reaction using primers complementary to each of the tags and quantitating the levels of the resulting amplification products to identify a tag which is underrepresented or absent from the culture. Since each tag corresponds to one strain, the strain which is underrepresented or absent from the culture may be identified. If desired the tags present in a culture which was contacted with the compound may be compared to the tags present in a control culture which was not contacted with the compound. Alternatively, the tags present in a culture which was contacted with the compound may be analyzed without comparison to a control culture.
It will be appreciated that, if desired, unique tags may also be used in embodiments in which gene products required for proliferation are overexpressed. In some aspects of such embodiments, the tags may be Within or adjacent to the promoter which drives expression of the gene encoding the gene product. In such embodiments, the gene product which is overexpressed in strains which proliferate more rapidly in the culture may be identified by detecting the presence or amount of the unique tag corresponding to that gene product in the culture.
In some embodiments of the invention, more than one strain may proliferate less rapidly in the presence of the compound. This may result from a variety of causes. For example, the concentration of the compound may not have been high enough to reduce the proliferation only in cells which underexpress one gene product (i.e. the target gene product). While strains which underexpress the target gene product will be the least prevalent strain in the culture, other strains may also be underrepresented. In such instances, the identity of the gene product in the strain which is least prevalent in the culture (or not recovered from the culture) may be identified by quantitating the levels of each of the genes encoding proliferation-required proteins in the culture. This may be accomplished by quantitative PCR, DNA sequencing, hybridization, or array technology as described above.
In other instances, multiple strains will exhibit less rapid proliferation in the culture as a result of a common functional attribute. For example, the strains which proliferate less rapidly (or the strains which are not recovered from the culture) may each underexpress a gene product with a common enzymatic activity, such as serine protease activity for example. Alternatively, the strains which proliferate less rapidly (or the strains which are not recovered from the culture) may each underexpress a gene product with a common functional domain, such as a cAMP binding domain.
In such instances, the common attribute of the strains which proliferate less rapidly (or the strains which are not recovered from the culture) may provide information as to the mode of action of the compound or the biochemical activity of the target of the compound. For example, if all of the underexpressed genes in the strains which proliferated less rapidly are serine proteases, the compound acts by inhibiting serine protease activity and the target protein is a serine protease. If desired, the compound may be derivatized and the efficacy of the derivatized compound against each of the strains which proliferated more rapidly may be assessed as described herein in order to identify derivatives which are capable of interacting with a wide range of targets sharing a common activity or binding site (i.e. derivatives which have a greater ability to inhibit the proliferation of all the strains than the original compound) or to identify derivatives having greater specificity for a desired target (i.e. derivatives which have a greater specificity for one of the strains than the original compound).
In some embodiments, rather than employing a single culture which contains multiple strains each of which underexpresses a proliferation-required gene product, the methods of the present invention may be performed using an array of individual strains (i.e. a collection of strains) each of which underexpresses a different proliferation-required gene product. For example, individual strains each underexpressing a different proliferation-required gene product may be grown in different wells of a multiwell plate. Each well is contacted with the compound (and, where appropriate an agent which regulates the level of expression from the promoter). The level of proliferation of the strains in each of the wells is determined to identify a strain which proliferated less rapidly or which did not proliferate at all.
The identity of the underexpressed gene product in the strain that proliferated less rapidly or which did not proliferate at all is determined as described above.
In another embodiment, individual strains each underexpressing a different proliferation-required gene product (i.e. a collection of strains) are grown at different locations on a solid medium, such as an agar plate. The medium contains the compound and, where appropriate, an agent which regulates the level of expression from the promoter. The level of proliferation of each of the strains is determined to identify a strain which proliferated less rapidly (or a strain which is not recovered from the culture). The identity of the underexpressed gene product in the strain that proliferated less rapidly (or the strain which is not recovered from the culture) is determined as described above.
The above methods may be used to prioritize compound development or to determine whether the compound has been previously identified or whether the target of the compound is the target of a previously identified drug. In particular, if the product is a natural product is advantageous to determine whether it has been previously identified prior to investing significant effort in developing it.
Thus, in some embodiments of the present invention, the target of a partially purified or purified natural product or a compound produced by combinatorial chemistry is identified using the methods described above and compared to the targets of known drugs. If the target is identical to that of a known drug, further development of the compound is halted.
In some embodiments of the present invention, an array of strains each of which underexpresses a different gene product (i.e. a collection of strains) is grown on solid medium containing a compound to be evaluated. The location of each strain in the array and the gene product underexpressed by that strain is known. The pattern of colonies which grow less rapidly or fail to grow in the presence of the compound is evaluated and compared to the pattern of colonies which grow less rapidly or fail to grow in the presence of previously identified drugs. If the pattern of colonies which grow less rapidly or fail to grow in the presence of the compound being evaluated is the same as the pattern of colonies which grow less rapidly or fail to grow in the presence of a previously identified drug, further development of the compound is halted.
In another embodiment, the nucleotide sequence of the gene product in a strain which proliferated less rapidly (or a strain which was not recovered from the culture) in the assays described above is compared to the nucleotide sequence of gene products from heterologous organisms to determine the likely spectrum of species whose growth would be inhibited by the compound. If the gene product has a high degree of homology to gene products from heterologous species, it is likely that the compound would also inhibit the growth of these heterologous species. Homology may be determined using any of a variety of methods familiar to those skilled in the art. For example, homology may be determined using a computer program such as BLASTP
or FASTA. The ability of the compound to inhibit the growth of the heterologous species may then be confirmed by comparing the growth of cells of the heterologous species in the presence and absence of the compound.

Current methods for identifying the target of compounds which inhibit cellular proliferation are laborious and time consuming. The above methods may be employed to allow the targets of a large number of compounds to be rapidly identified. In such methods, the methods described above are simultaneously performed for each of a large number of compounds. For example, the compounds may be members of a library of compounds generated using combinatorial chemistry or members of a natural product library. In such methods, a plurality of cultures each comprising a plurality of strains each of which underexpresses a different gene product required for proliferation or a plurality of collections of individual strains each of which underexpresses a different gene product required for proliferation is obtained. Each culture or collection of strains is contacted with a different compound in the library and the taxget of the compound is identified as described above.
In some embodiments of the present invention, strains are constructed in which a nucleic acid complementary to a gene encoding a gene product required for proliferation, or a portion thereof (i.e. a nucleic acid encoding an antisense nucleic acid to the gene encoding the proliferation required gene product or a portion thereof) is operably linked to a regulatable promoter. A culture comprising a plurality of such strains wherein each strain expresses an antisense nucleic acid against a different gene product required for proliferation is grown in the presence of varying levels of a compound which inhibits proliferation and in the presence of varying levels of an agent which regulates the level of transcription from the regulatable promoter.
Nucleic acids samples are obtained from the culture, detectably labeled and hybridized to a solid support comprising nucleic acids containing the genes encoding the proliferation-required gene products or a portion thereof. The level of hybridization is quantitated for each nucleic acid encoding each of the proliferation-required gene products to determine the rate at which each of the strains proliferated in the culture.
If the antisense nucleic acid expressed by a strain in the culture is not complementary to all or a portion of the gene encoding the target of the compound (i.e. a nonspecific strain), then the hybridization intensity for that strain will not be correlated with the concentration of the compound (see Figure 3), while if the antisense nucleic acid expressed by a strain in the culture is complementary to all or a portion of the gene encoding the target of the compound, the hybridization intensity for that strain will be intimately correlated with the concentration of the compound (see Figure 4).
In this manner, the target of the compound may be identified. It will be appreciated that, as described above, rather than growing the strains in a single culture, each strain may be grown in a different location on a solid medium or in a different well of a multiwell plate.
The methods described herein may be performed simultaneously for each of a plurality of compounds which inhibit proliferation to allow the targets of those compounds to be rapidly identified.
Some embodiments of the present invention are summarized on the following pages. It will be appreciated that the present invention may be applied to cultures of any organism and that any gene product required for proliferation of the organism may be overexpressed or underexpressed. Accordingly, the organisms and gene products described in the following examples are exemplary only and do not limit the scope of the present invention.
Genes required for cellular proliferation for use in the present invention may be identified from the literature, may be identif ed using the following methods, or may be identified using other methods familiar to those skilled in the art. In some embodiments of the present invention, the culture comprises a strain in which a gene product selected from the group consisting of a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944, and a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID
NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed. The identification of nucleic acids comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, nucleic acids comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and gene products comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 are described below.
E~~AMPLE 1 Identification of Genes Required for Cellular Proliferation by Expressin~~Antisense RNA Complementary to at least a Portion of a Gene Required for Cellular Proliferation Random genomic fragments are obtained from the organism in which it is desired to identify genes required for cellular proliferation. The random genomic fragments may be generated by a partial digestion with a restriction enzyme, mechanical shearing, using techniques such as sonication and nebulization, or DNAseI
digestion. The random genomic fragments are operably linked to a regulatable promoter in a vector. In those instances where the inserted genomic fragments are in an antisense orientation with respect to the promoter, the transcript produced is complementary to at least a portion of an mRNA encoding a gene product such that they interact with sense mRNA produced from various genes and thereby decrease the translation efficiency or the level of the sense messenger RNA (mRNA) thus decreasing production of the protein encoded by these sense mRNA molecules. In cases where the sense mRNA encodes a protein required for proliferation, cells grown under inducing conditions fail to grow or grow at a substantially reduced rate. Additionally, in cases where the transcript produced is complementary to at least a portion of a non-translated RNA and where that non-translated RNA is required for proliferation, cells grown under inducing conditions also fail to grow or grew at a substantially reduced rate.
In contrast, cells grown under non-inducing conditions grow at a normal rate. The genes to which the antisense nucleic acids are complementary are then identified and utilized in the methods of the present invention. Thus, to identify genes required for cellular proliferation, the extent of proliferation of cells containing the vectors in the presence of an agent which induces transcription from the regulatable promoter is compared to the extent of proliferation of cells in the absence of the agent. Those cells which grow well in the absence of the agent but exhibit significantly reduced proliferation in the presence of the agent contain a vector encoding an antisense nucleic acid complementary to at least a portion of a gene required for cellular proliferation.
The above method was used to identify genes required for cellular proliferation in Escherichia coli, Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis. The identification of genes required for cellular proliferation in E. coli, Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis has been described in the following U.S. Patent Applications, the disclosures of which are incorporated herein by reference in their entireties: U.S.
Patent Application Serial Number 09/815,242, filed March 21, 2001; U.S. Patent Application Serial Number 09/492709, filed January 27, 2000; U.S. Patent Application Serial Number 09/7II164, filed November 9, 2000; U.S. Patent Application Serial Number 09/741669, filed December 19, 2000 and U.S. Patent 1S Application Serial Number 09/815,242 filed March 21, 2001. The methods used to identify these genes required for cellular proliferation are summarized below.
To identify genes required for proliferation of E. coli, random genomic fragments were cloned into the IPTG-inducible expression vector pLEXSBA
(Krause et al., J. Mol. Biol. 274: 36S (1997), the disclosure of which is incorporated herein by reference in its entirety) or a modified version of pLEXSBA, pLEXSBA-3' in which a synthetic linker containing a T7 terminator was ligated between the PstI and HindIII
sites of pLEXSBA. In particular, to construct pLEXSBA-3', the following oligonucleotides were annealed and inserted into the PstI and HindIII sites of pLEXSBA:
5'-GTCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCCTTGAGGGGTTTTTTGA-3' (SEQ ID N0: 15779) CORRECT SEQ ID NOS TO BE INSERTED
THROUGHOUT THE APPLICATION
5'-AGCTTCAAAI~AACCCCTCAAGGACCCGTTTAGAGGCCCCAAGGGGTTAT
GCTAGACTGCA-3' (SEQ ID N0: 15780) Random fragments of E. coli genomic DNA were generated by DNAseI
digestion or sonication, filled in with T4 polymerase, and cloned into the SrnaI site of pLEXSBA or pLEXSBA-3'. Upon activation or induction, the promoter transcribed S the random genomic fragments To study the effects of transcriptional induction in liquid medium, growth curves were carried out by back diluting cultures 1:200 into fresh media with or without 1 mM
IPTG and measuring the OD4so every 30 minutes (min). To study the effects of transcriptional induction on solid medium, 10z, 103, 104, 105, 106, 10' and 108 fold dilutions of overnight cultures were prepared. Aliquots of from 0.5 to 3 ~,l of these dilutions were spotted on selective agar plates with or without 1 mM IPTG.
After overnight incubation, the plates were compared to assess the sensitivity of the clones to IPTG.
Of the numerous clones tested, some clones were identified as containing a sequence that inhibited E. coli growth after IfTG induction. Accordingly, the gene to which the inserted nucleic acid sequence corresponds, or a gene within the operon containing the inserted nucleic acid, is required for proliferation in E.
coli.
Nucleic acids required for proliferation of Staphylococcus aureus, Salmonella typhimurium, and Klebsiella pneumoniae were identified as follows. Randomly generated fragments of Staphylococcus aureus, Sahrtonella typhimuriunt, Klebsiella pneumoniae, Pseudomonas aeruginosa or Ettterococcus faecalis genomic DNA were transcribed from inducible promoters.
In the case of Staphylococcus aureus, a novel inducible promoter system, XylTS, comprising a modified TS promoter fused to the xyl~ operator from the xylA
promoter of Staphylococcus aureus was used. The promoter is described in U.S.
Patent Application Serial Number 10/032,393, the disclosure of which is incorporated herein by reference in its entirety. Transcription from this hybrid promoter is inducible by xylose.
Randomly generated fragments of Sahnottella typhimuriutn genomic DNA
were transcribed from an IPTG inducible promoter in pLEXSBA (Krause et al., J.

Mol. Biol. 274: 365 (1997) or a derivative thereof. Randomly generated fragments of Klebsiella pneumoraiae genomic DNA were expressed from an IPTG inducible promoter in pLEXSBA-Kan. To construct pLEXSBA-kin, pLEXSBA was digested to completion with CIaI in order to remove the bla gene. Then the plasmid was treated with a partial NotI digestion and blunted with T4 DNA polymerise. A 3.2 kbp fragment was then gel purified and ligated to a blunted 1.3 kbp kin gene from pKan~.
Kin resistant transformants were selected on Kan plates. Orientation of the kin gene was checked by Smal digestion. A clone, which had the kin gene in the same orientation as the bla gene, was used to identify genes required for proliferation of Klebsiella pneumoniae.
Randomly generated fragments of Pseudomonas aeruginosa genomic DNA
were transcribed from a two-component inducible promoter system. Integrated on the chromosome was the T7 RNA polymerise gene regulated by lacLJVSl lac0 (Brunschwig, E. and Darzins, A. 1992. Gene 111:35-41, the disclosure of which is 1 S incorporated herein by reference in its entirety). On a separate plasmid, a T7 gene 10 promoter, which is transcribed by T7 RNA polymerise, was fused with a lacO
operator followed by a multiple cloning site.
In the case of Staphylococcus aureus, a shotgun library of Staphylocoecus aureus genomic fragments was cloned into the vector pXyITS-PlSa, which harbors the XyITS inducible promoter. The vector was linearized at a unique BamHI site immediately downstream of the XyITS promoter/operator. The linearized vector was treated with shrimp alkaline phosphatase to prevent reclosure of the linearized ends.
Genomic DNA isolated from Staphylococcus aureus strain RN4S0 was fully digested with the restriction enzyme Sau3A , or , alternatively, partially digested with DNase I
and "blunt-ended" by incubating with T4 DNA polymerise. Random genomic fragments between 200 and 800 base pairs in length were selected by gel purification.
The size-selected genomic fragments were added to the linearized and dephosphorylated vector at a molar ratio of 0.1 to 1, and ligated to form a shotgun library.

The ligated products were transformed into electrocompetent E, coli strain XL1-Blue MRF' (Stratagene) and plated on LB medium with supplemented with carbenicillin at 100 ~g/ml. Resulting colonies numbering 5 x 105 or greater were scraped and combined, and were then subjected to plasmid purifcation.
The purified library was then transformed into electrocompetent Staphylococcus auf°eus RN4220. Resulting transformants were plated on agar containing LB + 0.2% glucose (LBG medium) + chloramphenicol at 15 ~g/ml (LBG+CM15 medium) in order to generate 100 to 150 platings at 500 colonies per plating. The colonies were subjected to robotic picking and arrayed into wells of 384 well culture dishes. Each well contained 100.1 of LBG + CM15 liquid medium.
Inoculated 384 well dishes were incubated 16 hours at 37°C, and each well was robotically gridded onto solid LBG + CM15 medium with or without 2% xylose.
Gridded plates were incubated 16 hours at 37°C, and then manually scored for arrayed colonies that were growth-compromised in the presence of xylose.
Arrayed colonies that were growth-sensitive on medium containing 2% xylose, yet were able to grow on similar medium lacking xylose, were subjected to further growth sensitivity analysis as follows: Colonies from the plate lacking xylose were manually picked and inoculated into individual wells of a 96 well culture dish containing LBG + CM15, and were incubated for 16 hours at 37°C. These cultures were robotically diluted 1/100 into fresh medium and allowed to incubate for 4 hours at 37°C, after which they were subjected to serial dilutions in a 384 well array and then gridded onto media containing 2% xylose or media lacking xylose. After growth for 16 hours at 37°C, the arrays that resulted on the two media were compared to each other. Clones that grew similarly at all dilutions on both media were scored as a negative and were no longer considered. Clones that grew on xylose medium but failed to grow at the same serial dilution on the non-xylose plate were given a score based on the differential, i.e. should the clone grow at a serial dilution of 10~ or less on the xylose plate and grow at a serial dilution of 108 or less on the non-xylose plate, then the corresponding clone received a score of "4" representing the log difference in growth observed.

For Salrraonella typlzirnurium and Klebsiella pneumoraiae growth curves were carried out by back diluting cultures 1:200 into fresh media containing 1 mM
IPTG or media lacking IPTG and measuring the OD4so every 30 minutes (min). To study the effects of transcriptional induction on solid medium, 10z, 103, 104, 105, 106, 10' and 10$
fold dilutions of overnight cultures were prepared. Aliquots of from 0.5 to 3 ~1 of these dilutions were spotted on selective agar plates with or without 1 mM IPTG.
After overnight incubation, the plates were compared to assess the sensitivity of the clones to IPTG.
Nucleic acids involved in proliferation of Pseudomoraas aeruginosa were identified as follows. Randomly generated fragments of Pseudomonas aeruginosa genomic DNA were transcribed from a two-component inducible promoter system.
Integrated on the chromosome was the T7 RNA polymerase gene regulated by lacWSl lac0 (Brunschwig, E. and Darzins, A. 1992. Gene 111:35-41). On an expression plasmid there was a T7 gene 10 promoter, which is transcribed by T7 RNA
polymerase, fused with a lac0 operator followed by a multiple cloning site.
Transcription from this hybrid promoter is inducible by IPTG. Should the genomic DNA downstream of the promoter contain, in an antisense orientation, at least a portion of an mRNA encoding a gene product involved in proliferation, then induction of expression from the promoter will result in detectable inhibition of proliferation.
A shotgun library of Pseudo~raonas aeruginosa genomic fragments was cloned into the vectors pEPS, pEPSS, or other similarly constructed vectors which harbor the T7lac0 inducible promoter. The vector was linearized at a unique SmaI site immediately downstream of the T7facO promoter/operator. The linearized vector was treated with shrimp alkaline phosphatase to prevent reclosure of the linearized ends.
Genomic DNA isolated from Pseudonaonas aeruginosa strain PAO1 was partially digested with DNase I and "blunt-ended" by incubating with T4 DNA polymerase.
Random genomic fragments between 200 and 800 base pairs in length were selected by gel purification. The size-selected genomic fragments were added to the linearized and dephosphorylated vector at a molar ratio of 2 to 1, and ligated to form a shotgun library.

The ligated products were transformed into electrocompetent E. coli strain XLl-Blue MRF' (Stratagene) and plated on LB medium with carbenicillin at 100 ~.glml or Streptomycin 100 ~g/ml. Resulting colonies numbering 5 x 105 or greater were scraped and combined, and were then subjected to plasmid purification.
The purified library was then transformed into electrocompetent Pseudonaonas aerugiraosa strain PA01. Resulting transformants were plated on LB agar with carbenicillin at 100 ~glml or Streptomycin 40 ~,glml in order to generate 100 to 1 SO
platings at S00 colonies per plating. The colonies were subjected to robotic picking and arrayed into wells of 384 well culture dishes. Each well contained 100 ~,1 of LB +
CB 100 or Streptomycin 40 liquid medium. Inoculated 384 well dishes were incubated 16 hours at room temperature, and each well was robotically gridded onto solid LB + CB100 or Streptomycin 40 medium with or without 1 mM IPTG. Gridded plates were incubated 16 hours at 37°C, and then manually scored for arrayed colonies that were growth-compromised in the presence of IPTG.
1 S Arrayed colonies that were growth-sensitive on medium containing 1 mM
IPTG, yet were able to grow on similar medium lacking IPTG, were subjected to further growth sensitivity analysis as follows: Colonies from the plate lacking IPTG
were manually picked and inoculated into individual wells of a 96 well culture dish containing LB + CB100 or Streptomycin 40, and were incubated for 16 hours at 30°C.
These cultures were robotically diluted 1!100 into fresh medium and allowed to incubate for 4 hours at 37°C, after which they were subjected to serial dilutions in a 384 well array and then gridded onto media with and without 1 mM IPTG. After growth for 16 hours at 37°C, the arrays of serially diluted spots that resulted were compared between the two media. Clones that grew similarly at all dilutions on both media were scored as a negative and were no longer considered. Clones that grew on IPTG medium but failed to grow at the same serial dilution on the non-IPTG
plate were given a score based on the differential, i.e. should the clone grow at a serial dilution of 104 or less on the IPTG plate and grow at a serial dilution of 108 or less on the IPTG plate, then the corresponding clone received a score of "4"
representing the log difference in growth observed.

Following the identification of those vectors that, upon induction, negatively impacted Pseudomofaas aerugiraosa growth or proliferation, the inserts or nucleic acid fragments contained in those vectors were isolated for subsequent characterization.
Vectors of interest were subj ected to nucleic acid sequence determination.
Nucleic acids involved in proliferation of E. faecalis were identified as follows. Randomly generated fragments of genomic DNA were expressed from the vectors pEPEF3 or pEPEFI4, which contain the CP25 or P59 promoter, respectively, regulated by the xyl operator/repressor. Should the genomic DNA downstream of the promoter contain, in an antisense orientation, at least a portion of a mRNA
encoding a gene product involved in proliferation, then induction of expression from the promoter will result in detectable inhibition of proliferation.
A shotgun library of E. faecalis genomic fragments was cloned into the vector pEPEF3 or pEPEFI4, which harbor xylose inducible promoters. The vector was linearized at a unique SmaI site immediately downstream of the promoter/operator.
The linearized vector was treated with alkaline phosphatase to prevent reclosure of the linearized ends. Genomic DNA isolated from E, faecalis strain OG1RF was partially digested with DNase I and "blunt-ended" by incubating with T4 DNA polymerase.
Random genomic fragments between 200 and 800 base pairs in length were selected by gel purification. The size-selected genomic fragments were added to the linearized and dephosphorylated vector at a molar ratio of 2 to 1, and ligated to form a shotgun library.
The ligated products were transformed into electrocompetent E. coli strain TOP10 cells (Invitrogen) and plated on LB medium with erythromycin (Erm) at ~,g/ml. Resulting colonies numbering 5 x 105 or greater were scraped and combined, and were then subjected to plasmid purification.
The purified library was then transformed into electrocompetent E. faecalis strain OG1RF. Resulting transformants were plated on Todd-Hewitt (TH) agar with erythromycin at 10 ~,g/ml in order to generate 100 to 150 platings at 500 colonies per plating. The colonies were subjected to robotic picking and arrayed into wells of 384 well culture dishes. Each well contained 100 p.1 of THB + Erm 10 ~g/ml.
Inoculated 384 well dishes were incubated 16 hours at room temperature, and each well was robotically gridded onto solid TH agar + Erm with or without 5% xylose.
Gridded plates were incubated 16 hours at 37°C, and then manually scored for arrayed colonies that were growth-compromised in the presence of xylose.
Arrayed colonies that were growth-sensitive on medium containing 5% xylose, yet were able to grow on similar medium lacking xylose, were subjected to further growth sensitivity analysis. Colonies from the plate lacking xylose were manually picked and inoculated into individual wells of a 96 well culture dish containing THB
+ Erm 10, and were incubated for 16 hours at 30°C. These cultures were robotically diluted 1/100 into fresh medium and allowed to incubate for 4 hours at 37°C, after which they were subjected to serial dilution on plates containing 5% xylose or plates lacking xylose. After growth for 16 hours at 37°C, the arrays of serially diluted spots that resulted were compared between the two media. Colonies that grew similarly on both media were scored as a negative and corresponding colonies were no longer , considered. Colonies on xylose medium that failed to grow to the same serial dilution compared to those on the non-xylose plate were given a score based on the differential. For example, colonies on xylose medium that only grow to a serial dilution of ~-4 while they were able to grow to -8 on the non-xylose plate, then the corresponding transformant colony received a score of "4" representing the log difference in growth observed.
Following the identification of those vectors that, upon induction, negatively impacted E. faecalis growth or proliferation, the inserts or nucleic acid fragments contained in those expression vectors were isolated for subsequent characterization.
The inserts in the vectors of interest were subjected to nucleotide sequence determination.
It will be appreciated that other restriction enzymes and other endonucleases or methodologies may be used to generate random genomic fragments. In addition, random genomic fragments may be generated by mechanical shearing. Sonication and nebulization are two such techniques commonly used for mechanical shearing of DNA.

Nucleotide Sequence Determination of Identified Clones Transcribing Nucleic Acid Fragments with Detrimental Effects on Proliferation of Eschericlaia coli.
Stazrhylococcus aureus Salrnonella typhimurium Klebsiella prZeumoniae, Pseudomonas aeru~inosa or Enterococcus faecalis The nucleotide sequences of the nucleic acid sequences which inhibited the growth of Escherichia coli were determined using plasmid DNA isolated using QIAPREP (Qiagen, Valencia, CA) and methods supplied by the manufacturer. The primers used for sequencing the inserts were 5' - TGTTTATCAGACCGCTT - 3' (SEQ
m NO: 15781) and 5' - ACAATTTCACACAGCCTC - 3' (SEQ ID NO: 15782).
These sequences flank the polylinker in pLEXSBA.
The nucleotide sequences of the nucleic acid sequences which inhibited the growth of Staphylococcus aureus were determined as follows. Staphylococcus aureus were grown in standard laboratory media (LB or TB with 15 ug/ml Chloramphenicol IS to select for the plasmid). Growth was earned out at 37°C overnight in culture tubes or 2 ml deep well microtiter plates.
Lysis of Staphylococcus aureus was performed as follows. Cultures (2-5 ml) were centrifuged and the cell pellets resuspended in 1.5 mg/ml solution of lysostaphin (20 ~1/ml of original culture) followed by addition of 250 p,1 of resuspension buffer (Qiagen). Alternatively, cell pellets were resuspended directly in 250 ~1 of resuspension buffer (Qiagen) to which S-20 ~,1 of a 1 mg/ml lysostaphin solution were added.
DNA was isolated using Qiagen miniprep kits or Wizard (Qiagen) miniprep kits according to the instructions provided by the manufacturer.
The genomic DNA inserts were amplified from the purified plasmids by PCR
as follows.
1 p1 of Qiagen purified plasmid was put into a total reaction volume of 25 p1 Qiagen Hot Start PCR mix. For Staphylococcus aureus, the following primers were used in the PCR reaction:
pXylTSF: CAGCAGTCTGAGTTATAA.AATAG (SEQ ID NO: 15783) LexL TGTTTTATCAGACCGCTT (SEQ ID NO: 15784) Similar methods were conducted for Salmonella typhimurium and Klebsiella pneumoniae. For Salmonella typlaimurium and Klebsiella pneumoniae the following primers were used:
5' - TGTTTTATCAGACCGCTT - 3' (SEQ ID NO: 15784) and 5'-ACAATTTCACACAGCCTC-3' (SEQ ID NO: 15782 PCR was carned out in a PE GenAmp with the following cycle times:
Step 1. 95° C 15 min Step 2. 94° C 45 sec Step 3. 54° C 45 sec Step 4. 72° C 1 minute Step S. Return to step 2, 29 times Step 6. 72° C 10 minutes Step 7. 4° C hold The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
For Pseudomonas aerugiraosa, plasmids from transformant colonies that received a dilution plating score of "2" or greater were isolated to obtain the genomic DNA insert responsible for growth inhibition as follows. Pseudomonas aeruginosa were grown in standard laboratory media (LB with carbenicillin at 100 pg/ml or Streptomycin 40 ~,g/ml to select for the plasmid). Growth was carried out at 30°C
overnight in 100 u1 culture wells in microtiter plates. To amplify insert DNA
2 u1 of culture were placed into 25 u1 Qiagen Hot Start PCR mix. PCR reactions were in well microtiter plates. For plasmid pEPSS the following primers were used in the PCR
reaction:
T7L1+: GTCGGCGATATAGGCGCCAGCAACCG (SEQ ID NO: 15785) pStrA3: ATAATCGAGCATGAGTATCATACG (SEQ ID NO: 15786) PCR was carned out in a PE GenAmp with the following cycle times:
Step 1. 95° C 15 rnin Step 2. 94° C 45 sec Step 3. S4° C 4S sec Step 4. 72° C 1 minute Step S. Return to step 2, 29 times Step 6. 72° C 10 minutes S Step 7. 4° C hold The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
The purified PCR products were then directly cycle sequenced with Qiagen Hot Start PCR mix. The following primers were used in the sequencing reaction:
T7/L2: ATGCGTCCGGCGTAGAGGAT (SEQ ID NO: 15787) PCR was carried out in a PE GenAmp with the following cycle times:
Step 1. 94° C 1 S min Step 2. 96° C 10 sec Step 3. S0° C S sec 1S Step 4. 60 C 4 min Step S. Return to step 2, 24 times Step 6. 4° C hold The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
For E. faecalis, plasmids from transformant colonies that received a dilution plating score of "2" or greater were isolated to obtain the genomic DNA insert responsible for growth inhibition as follows. E. faecalis were grown in THB 10 p,g/ml Erm at 30°C overnight in 100 u1 culture wells in microtiter plates. To amplify insert DNA 2 u1 of culture were placed into 2S ~,1 Qiagen Hot Start PCR mix. PCR
2S reactions were in 96 well microtiter plates. The following primers were used in the PCR reaction:
pXyITS: CAGCAGTCTGAGTTATAAAATAG (SEQ ID NO: 15783) and the pEP/pAKl primer.
PCR was carned out in a PE GenAmp with the following cycle times:
Step I. 9S° C IS min Step 2. 94° C 45 sec Step 3. 54° C 45 sec Step 4. 72° C 1 minute Step 5. Return to step 2, 29 times Step 6. 72° C 10 minutes Step 7. 4° C hold The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
The purified PCR products were then directly cycle sequenced with Qiagen Hot Start PCR mix. The following primers were used in the PCR reaction:
pXylTS: CAGCAGTCTGAGTTATAAAATAG (SEQ ID NO: 15783) PCR was carned out in a PE GenAmp with the following cycle times:
Step 1. 94° C 15 min Step 2. 96° C 10 sec Step 3. 50° C 5 sec Step 4. 60° C 4 min Step 5. Return to step 2, 24 times Step 6. 4° C hold The PCR products were cleaned using Qiagen Qiaquick PCR plates according to the manufacturer's instructions.
The amplified genomic DNA inserts from each of the above procedures were subjected to automated sequencing. The nucleotide sequences of the antisense nucleic acids which inhibited the proliferation of Esclzerichia coli, Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aerugifiosa and Enterococcus faecalis are listed in the accompanying Sequence Listing as SEQ
ID
NOs.: 8-3795.

Comparison Of Isolated Nucleic Acids to Known Sequences The nucleic acid sequences of the subcloned E. coli genomic fragments obtained from the vectors discussed above were compared to known E. coli sequences in GenBank using BLAST version 1.4 or version 2Ø6 using the following default parameters: Filtering off, cost to open a gap=5, cost to extend a gap=2, penalty for a mismatch in the blast portion of run=-3, reward for a match in the blast portion of run=1, expectation value (e)=10.0, word size=11, number of one-line descriptions=100, number of alignments to show (B)=100. BLAST is described in Altschul, J Mol Biol.
215:403-(1990), the disclosure of which is incorporated herein by reference in its entirety.
The vectors were found to contain nucleic acid sequences in both the sense and antisense orientations. The presence of known genes, open reading frames, and ribosome binding sites was determined by comparison to public databases holding genetic information and 10 various computer programs such as the Genetics Computer Group programs FRAMES
and CODONPREFERENCE. Clones were designated as "antisense" if the cloned fragment was oriented to the promoter such that the RNA transcript produced was complementary to the expressed mRNA (or non-translated RNA) from a chromosomal locus. Clones were designated as "sense" if they coded for an RNA fragment that was identical to a portion of a wild type mRNA from a chromosomal locus.
The nucleotide sequences of the subcloned fragments from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis obtained from the expression vectors discussed above were compared to known sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis and other microorganisms as follows. First, to confirm that each clone originated from one location on the chromosome and was not chimeric, the nucleotide sequences of the selected clones were compared against the Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis genomic sequences to align the clone to the correct position on the chromosome. The NCBI BLASTN v 2Ø9 program was used for this comparison, and the incomplete Staphylococcus aureus genomic sequences licensed from TIGR, as well as the NCBI nonredundant GenBank database were used as the source of genomic data. Salmonella typhimurium sequences were compared to sequences available from the Genome Sequencing Center (http://genome.wustl.edu/gsc/salinonella.shtml), and the Sanger Centre (http://www.sanger.ac.uk/projects/S_typhi). Pseudomonas aeruginosa sequences were compared to a proprietary database and the NCBI GenBank database. The E.
faecalis sequences were compared to a proprietary database.
The BLASTN analysis was performed using the default parameters except that the filtering was turned off. No further analysis was performed on inserts which resulted from the ligation of multiple fragments.
In general, antisense molecules and their complementary genes are identified as follows. First, all possible full length open reading frames (ORFs) are extracted from available genomic databases. Such databases include the GenBank nonredundant (nr) database, the unfinished genome database available from TIGR
and the PathoSeq database developed by Incyte Genomics. The latter database comprises over 40 annotated bacterial genomes including complete ORF analysis. If databases are incomplete with regard to the bacterial genome of interest, it is not necessary to extract all ORFs in the genome but only to extract the ORFs within the portions of the available genomic sequences which are complementary to the clones of interest.
Computer algorithms for identifying ORFs, such as GeneMark, are available and well known to those in the art. Comparison of the clone DNA to the complementary ORF(s) allows determination of whether the clone is a sense or antisense clone.
Furthermore, each ORF extracted from the database can be compared to sequences in well annotated databases including the GenBank (nr) protein database, SWISSPROT
and the like. A description of the gene or of a closely related gene in a closely related microorganism is often available in these databases. Similar methods are used to identify antisense clones corresponding to genes encoding non-translated RNAs.
Each of the cloned nucleic acid sequences discussed above which inhibited proliferation of Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis was used to identify the corresponding Staplaylococcus aureus, Salmonella typlainaur ium, Klebsiella pneumoniae, Pseudomonas aeruginosa or Enterococcus faecalis ORFs in the PathoSeq v.4.1 (March 2000 release) database of microbial genomic sequences.
For this purpose, the NCBI BLASTN 2Ø9 computer algorithm was used. The default parameters were used except that filtering was turned off. The default parameters for the BLASTN and BLASTX analyses were:
Expectation value (e)=10 Alignment view options: pairwise Filter query sequence (DUST with BLASTN, SEG with others)=T
Cost to open a gap (zero invokes behavior)=0 Cost to extend a gap (zero invokes behavior)=0 X dropoff value for gapped alignment (in bits) (zero invokes behavior)=0 Show GI's in deflines=F
Penalty for a nucleotide mismatch (BLASTN only)=-3 Reward for a nucleotide match (BLASTN only)=1 Number of one-line descriptions (V)=500 Number of alignments to show (B)=250 Threshold for extending hits=default Perform gapped alignment (not available with BLASTX)=T
Query Genetic code to use=1 DB Genetic code (for TBLAST[nx] only=1 Number of processors to use=1 SeqAlign file Believe the query defline=F
Matrix=BLOSUM62 Word Size= default Effective length of the database (use zero for the real size)=0 Number of best hits from a region to keep=100 Length of region used to judge hits=20 Effective length of the search space (use zero for the real size)=0 Query strands to search against database (for BLAST[nx] and TBLASTX), 3 is both, 1 is top, 2 is bottom=3 Produce HTML output=F
Alternatively, ORFs were identified and refined by conducting a survey of the public and private data sources. Full-length gene protein and nucleotide sequences for these organisms were assembled from various sources. For Pseudomonas aeruginosa, gene sequences were adopted from the Pseudomonas genome sequencing project (downloaded from http://www.pseudomonas.com). For Klebsiella praeumoniae, Staphylococcus aureus, Streptococcus pneumoniae and Salmonella typlai, genomic sequences from PathoSeq v 4.1 (Mar 2000 release) was reanalyzed for ORFs using the gene finding software GeneMark v 2.4a, which was purchased from GenePro Inc.

Bishop St., N.W., Suite B, Atlanta, GA, 30318, USA.
Antisense clones were identified as those clones for which transcription from the inducible promoter would result in the expression of an RNA antisense to a complementary ORF, intergenic or intragenic sequence.
It will be appreciated that ORFs may also be identified using databases other than PathoSeq. For example, the ORFs may be identified using the methods described in U.S. Provisional Patent Application Serial Number 60/191,078, filed March 21, 2000, the disclosure of which is incorporated herein by reference in its entirety.
The ORFs which correspond to the antisense nucleic acids which inhibited proliferation of Escherichia coli, Staphyloc~ccus aureus, Salmonella typhimurium, Klebsiella pneumoraiae, Pseudornoraas aeruginosa or Eraterococcus faecalis are listed in the accompanying Sequence Listing as SEQ ID NOs.: 3796-3800, 3806-4860, and 5916-10012. The polypeptides encoded by the identified ORFs are provided in the accompanying Sequence Listing as SEQ ID NOs.: 3801-3805, 4861-5915, and 10013-14110.
In other embodiments, the culture comprises a strain in which a gene product encoded by a homologous coding nucleic acid as defined above is overexpressed or underexpressed. In further embodiments, the culture comprises a strain in which a homologous polypeptide as defined above is overexpressed or underexpressed.
Homologous coding nucleic acids may be obtained as described in Example 4 below.

Identification of Homologous Coding Nucleic Acids, Homologous Antisense Nucleic Acids or Homolo oug s Polypeptides Homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides from other pathogenic microorganisms (including nucleic acids homologous to the nucleic acids of SEQ ID NOs.: 3796-3800, 3806-4860, 10012, and 14111-14944, nucleic acids homologous to the antisense nucleic acids of SEQ ID NOs.: 8-3795, and polypeptides homologous to the polypeptides of SEQ ID

NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778) may be identified using methods such as those described below.
For example, in some embodiments, the proliferation-required nucleic acids, antisense nucleic acids, and polypeptides from Staphylococcus aureus, Salnaonella typhimurium, Klebsiella pneurnoniae, Pseudorraonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus ir~uenzae, Helicobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa,.
Staphylococcus aureus, Salmonella typlai, or Caradida albicaras described herein (including the nucleic acids of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, the antisense nucleic acids of SEQ ID NOs: 8-3795, and the polypeptides of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778) may be used to identify homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides required for proliferation in prokaryotes and eukaryotes. For example, nucleic acids or polypeptides required for the proliferation of protists, such as Plasmodium spp.; plants; animals, such as Eratamoeba spp. and Contracaecunr spp; and fungi including Candida spp., (e.g., Candida albicans), Cryptococcus neoforrnans, and Aspergillus fumigatus may be identified. In one embodiment of the present invention, monera, specifically bacteria, including both Gram positive and Gram negative bacteria, are probed to identify genes required for cellular proliferation. Likewise, homologous antisense nucleic acids may also be identified.
The genes and polypeptides required for the proliferation of Staplaylococcus aureus, Salmonella typhimuriuna, Klebsiella pneumorZiae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, Helicobacter pylori, Klebsiella praeumoraiae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi, or Candida albicans (including the nucleic acids of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, the sequences complementary to the nucleic acids of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, and the polypeptides of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778) can be used to identify homologous coding nucleic acids or homologous polypeptides required for proliferation from these and other organisms using methods such as nucleic acid hybridization and computer database analysis. Likewise, the antisense nucleic acids which inhibit proliferation of Staplzylococcus aureus, Salmonella typhimuriurn, Klebsiella pneumoniae, Pseudomonas aerugizzosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemoplzilus injZuenzae, Helicobacter pylori, Klebsiella pneumoniae, Pseudomorzas aerugirzosa, Staphylococcus aureus, or Salmonella typhi (including the antisense nucleic acids of SEQ II? NOs.: 8-3795 or the sequences complementary thereto) may also be used to identify homologous antisense nucleic acids using nucleic acid hybridization or computer database analysis.
For example, the nucleic acid sequences from Staphylococcus aureus, Salmonella typhimuriuzn, Klebsiella pneumorziae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia eoli, Enterococcus faecalis, Haemophilus influezzzae, Helicobacter pylori, Klebsiella pneunzoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhii, or Candida albicans (including the nucleic acids of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 and the antisense nucleic acids of SEQ ID NOs. 8-3795) are used to screen genomic libraries generated from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi, or Candida albieans and other bacterial or fungal species of interest. For example, the genomic library may be from Gram positive bacteria, Gram negative bacteria or other organisms including Anaplasma rnarginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burklaolderia cepacia, Campylobacter jejuni, Candida albicans, Carzdida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Carzdida dubliniensis, Chlamydia pneurnoniae, Chlamydia trachonzatus, Clostridium botulizzum, Clostridium docile, Clostridium pezfringens, Coccidiodes immitis, Coryrzebacterium diptheriae, Cryptococcus rZeoforrnaras, Enterobacter cloacae, Enterococcus faecalis, Eraterococcus faecium, Escherichia coli, Haemophilus influerazae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria merairagitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Praeumocystis carirtii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhirnurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus praeumoniae, Streptococcus mutans, Treporaema palliduna, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species, including coagulase negative species of Staphylococcus. In some embodiments, the genomic library may be from an organism other than E, coli.
Standard molecular biology techniques are used to generate genomic libraries from various cells or microorganisms. In one aspect, the libraries are generated and bound to nitrocellulose paper. The nucleic acids 0f SEQ ID NOs. 3796-3800, 4860, 5916-10012, and 14111-14944 or SEQ JD NOs.: 8-3795, or portions thereof, can then be used as probes to screen the libraries for homologous sequences.
For example, the libraries may be screened to identify homologous coding nucleic acids or homologous antisense nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid selected from the group consisting of SEQ TD NOs.: 8-3795, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid complementary to one of SEQ
ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at Ieast 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.:

3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a nucleic acid selected from the group consisting of SEQ ID NOS.: 3796-3800, 4860, 5916-10012, and 14111-14944, and nucleic acids comprising nucleotide sequences which hybridize under stringent conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111 14944.
The libraries may also be screened to identify homologous nucleic coding nucleic acids or homologous antisense nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid selected from the group consisting of SEQ ID NOs.: 8-3795, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid complementary to one of SEQ
ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOs. 8-3795, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleic acid sequences which hybridize under moderate conditions to a fragment comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ff~
NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a nucleic acid complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012,, and 14111-14944 and nucleic acids comprising nucleotide sequences which hybridize under moderate conditions to a fragment comprising at Ieast 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of the sequence complementary to one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944.
The homologous nucleic coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides identified as above can then be used in the methods described herein. In some embodiments, the homologous coding nucleic acids, homologous antisense nucleic acids, or homologous polypeptides may be used to identify genes which are required for the proliferation of more than one microorganism.
Such genes are valuable targets for broad spectrum antibiotics effective against more than one microorganism.
For example, the preceding methods may be used to isolate homologous coding nucleic acids or homologous antisense nucleic acids comprising a nucleotide sequence with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleotide sequence selected from the group consisting of one of the sequences of SEQ ID NOS. 8-3795, fragments comprising at least 10, I5, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof, and the sequences complementary thereto. The preceding methods may also be used to isolate homologous coding nucleic acids or homologous antisense nucleic acids comprising a nucleotide sequence with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70%
nucleotide sequence identity to a nucleotide sequence selected from the group consisting of one of the nucleotide sequences of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof, and the sequences complementary thereto. In some embodiments, the preceding methods may be used to isolate homologous coding nucleic acids or homologous antisense nucleic acids comprising a nucleotide sequence with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70% nucleotide sequence identity to a nucleic acid sequence selected from the group consisting of one of the sequences of SEQ ID
NOS.
3796-3800, 3806-4860, 5916-10012, and 14111-14944, fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof, and the sequences complementary thereto. Identity may be measured using BLASTN version 2.0 with the default parameters. (Altschul, S.F.
et al. Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997), the disclosure of which is incorporated herein by reference in its entirety). For example, the homologous polynucleotides may comprise a coding sequence which is a naturally occurring allelic variant of one of the coding sequences described herein. Such allelic variants may have a substitution, deletion or addition of one or more nucleotides when compared to the nucleic acids of SEQ ID NOs: 8-3795, SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 or the nucleotide sequences complementary thereto.
Additionally, the above procedures may be used to isolate homologous coding nucleic acids which encode polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid identity or similarity to a polypeptide comprising the sequence of one of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 or to a polypeptide whose expression is inhibited by a nucleic acid of one of SEQ ID
NOs:
8-3795 or fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids thereof as determined using the FASTA version 3.0t78 algorithm with the default parameters. Alternatively, protein identity or similarity may be identified using BLASTP with the default parameters, BLASTX with the default parameters, or TBLASTN with the default parameters. (Altschul, S.F. et al.
Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs, Nucleic Acid Res. 25: 3389-3402 (1997), the disclosure of which is incorporated herein by reference in its entirety).
Alternatively, homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides may be identified by searching a database to identify sequences having a desired level of nucleotide or amino acid sequence homology to a nucleic acid or polypeptide involved in proliferation or an antisense nucleic acid to a nucleic acid involved in microbial proliferation. A variety of such databases are available to those skilled in the art, including GenBank and GenSeq. In some embodiments, the databases are screened to identify nucleic acids with at least 97%, at least 95%, at least 90%, at least 85%, at least 80%, or at least 70%
nucleotide sequence identity to a nucleic acid required for proliferation, an antisense nucleic acid which inhibits proliferation, or a portion of a nucleic acid required for proliferation or a portion of an antisense nucleic acid which inhibits proliferation. For example, homologous coding sequences may be identified by using a database to identify nucleic acids homologous to one of SEQ ID Nos. 8-3795, homologous to fragments comprising at least 10, 15, 20, 25, 30, 35, 40, S0, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof, nucleic acids homologous to one of SEQ ID
NOS.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944, homologous to fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides of one of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, nucleic acids homologous to one of SEQ ID Nos. 8-3795, homologous to fragments comprising at least 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, 150, 200, 300, 400, or 500 consecutive nucleotides thereof or nucleic acids homologous to the sequences complementary to any of the preceding nucleic acids. In other embodiments, the databases are screened to identify polypeptides having at least 99%, 95%, at least 90%, at least 85%, at least 80%, at least 70%, at least 60%, at least 50%, at least 40% or at least 25% amino acid sequence identity or similarity to a polypeptide involved in proliferation or a portion thereof. For example, the database may be screened to identify polypeptides homologous to a polypeptide comprising one of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778, a polypeptide whose expression is inhibited by a nucleic acid of one of SEQ ID
NOs: 8-3795 or homologous to fragments comprising at least 5, 10, 15, 20, 25, 30, 35, 40, 50, 75, 100, or 150 consecutive amino acids of any of the preceding polypeptides.
In some embodiments, the database may be screened to identify homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides from cells or microorganisms other than the Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneurnoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influertzae, Helicobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, or Salm~nella typhi species from which they were obtained.
For example the database may be screened to identify homologous coding nucleic acids, homologous antisense nucleic acids or homologous polypeptides from microorganisms such as Anaplasma marginale, Aspergillus fumigatus, Bacillus anthraeis, Bactericides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Caradida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium docile, Clostridium perfringens, Coccidiodes irnmitis, Coryttebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enteroeoccus faecium, Escherichia coli, Haemophilus ir~uenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneuntoniae, Listeria tnonocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria tnenitzgitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneutnocystis carinii, Proteus vulgaris, Pseudonzonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Slaigella dysenteriae, Slaigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumorriae, Streptococcus mutans, Treponema pallidurn, Yersinia enterocolitica, Yersiraia pestis or any species falling within the genera of any of the above species, including coagulase negative Staphylococcus. In some embodiments, the homologous coding nucleic acids, homologous antisense nucleic acids, or homologous polypeptides are from an organism other than E. coli.
In another embodiment, nucleic acid arrays and microarrays can be employed to identify homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides. Nucleic acid arrays are high density arrays of DNA samples deposited at specific locations on a glass chip, nylon membrane, or the like. An example of this technology is found in LT.S. Patent No.
5807522, which is hereby incorporated by reference. In such embodiments, an array comprising nucleic acids from an organism in which it is desired to identify a homologous coding nucleic acid, homologous antisense nucleic acid or nucleic acid encoding a homologous polypeptide is contacted with a detectable probe comprising - the nucleic acid, or a portion thereof, for which it is desired to identify a homologue under conditions which permit the probe to specifically hybridize to the homologue.
For example, the arrays may consist of 12 x 24 cm nylon filters containing PCR
products corresponding to ORFs from the organism in which it is desired to identify the homologous nucleic acid. For example, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified in Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlarnydia pneumoniae, Clalarnydia trachornatus, Clostridium botulinum, Clostridium d fficile, Clostridium perfringens, Coccidiodes inamitis, Coryrzebacteriurn diptlzeriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haenzophilus ir~uenzae, Helicobacter pylori, Histoplasrna capsulaturn, Klebsiella przeumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria menirzgitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typlai, Salmorzella typhinzurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigeha dysenteriae, Shigella flexneri, Shigella sorznei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species, including coagulase negative Staphylococcus.
Alternatively, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides can be identified by transcribing an antisense nucleic acid comprising a nucleotide sequence complementary to the proliferation-required sequences from Staphylococcus aur~eus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Erzterococcus faecalis, Haemophilus influenzae, Helicobacter pylori, Klebsiella przeumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, or Salmonella typhi or a portion thereof in a heterologous cell or microorganism and determining whether the antisense nucleic acid inhibits the proliferation of the cell or microorganism.
Alternatively, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides can be identified by transcribing a homologous antisense nucleic acid such as an antisense nucleic acid homologous to the nucleotide sequence complementary to one of SEQ m NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, an antisense nucleic acid comprising a nucleotide sequence homologous to one of SEQ ID Nos.: 8-3795, or an antisense nucleic acid comprising a nucleotide sequence complementary to a portion of any of the preceding nucleic acids in a microorganism, such as the microorganism in which the homologous antisense nucleic acid was identified, and determining whether the proliferation of the microorganism is inhibited as described above.
1n another embodiment, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides can be identified by using the conserved portions of nucleotide sequences required for proliferation to generate degenerate primers for use in the polymerase chain reaction (PCR). The PCR technique is well known in the art. The successful production of a PCR product using degenerate probes generated from the nucleotide sequences identified herein indicates the presence of a homologous gene sequence in the species being screened. This homologous gene is then utilized in the present invention.
The nucleic acids homologous to the genes required for the proliferation of Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Esclaerichia coli, Enterococcus faecalis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staplaylococcus aureus, Salmonella typhi or Candida albieans or the sequences complementary thereto may be used to identify homologous coding nucleic acids, nucleic acids encoding homologous polypeptides, or homologous antisense nucleic acids from cells or microorganisms other than Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Eraterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haentophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typlti or Candida albicans as described below. For example, the nucleic acids homologous to proliferation-required genes from Staphylococcus aureus, Salmonella typhimuriutn, Klebsiella pneumoniae, Pseudomonas aeruginosa and' Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salmonella typhi or Candida albicans or the sequences complementary thereto may be used to identify homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides in Anaplasnta rnarginale, Aspergillus funtigatus, Bacillus attthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Cartdida dubliniensis, Chlantydia pneumoniae, Chlarnydia trachomatus, Clostridium botulinum, Clostridiunt difficile, Clostridium perfringens, Coccidiodes itnmitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Ertterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus infl'uenzae, Helicobaeter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrlaoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudornonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonrtei, Staphylococcus epiderntidis, Streptococcus pneunaoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis and any species falling within the genera of any of the above species. In some embodiments of the present invention, the nucleic acids homologous to proliferation-required sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Esehericlzia coli, Enterococcus faecalis, Haemophilus ir~uenzae, Helicobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, or Salmonella typhi (including nucleic acids homologous to one of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944) or the sequences complementary thereto (including nucleic acids homologous to one of SEQ
ID NOs.: 8-3795) are used to identify proliferation-required sequences in an organism other than E. coli.

In another embodiment of the present invention, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides are identified by transfernng antisense nucleic acids complementary to the sequences identified as required for proliferation or portions thereof (including antisense nucleic acids comprising a nucleotide sequence complementary to one of SEQ ID
NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 or portions thereof, . , such as the nucleic acids of SEQ ID NOs.: 8-3795) to vectors capable of functioning within a species other than the species from which the sequences were obtained. For example, the vector may be functional in Anaplasma marginale, Aspergillus funaigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Cantpylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Cartdida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneuntoniae, Chlamydia trachomatus, Clostridium botulirtunt, Clostridium difficile, Clostridium perfringens, Coccidiodes irnmitis, Corynebacterium diptheriae, Cryptococcus rteoformans, Ertterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haern~philus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria mortocyt~genes, Mycobacteriurit leprae, Mycobacterium tuberculosis, Neisseria gortorrhoeae, Neisseria rneningitidis, Noeardia asteroides, Pasteurella haemolytiea, Pasteurella ntultocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimuriurn, Staphylococcus aureus, Moxarella catarrhalis, Slzigella boydii, Shigella dyserateriae, Shigella jlexneri, Shigella sortnei, Staphylococcus epidermidis, Streptococcus pneumortiae, Streptococcus rnutans, Treportema pallidum, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments of the present invention, the vector may be functional in an organism other than E. coli. As would be appreciated by one of ordinary skill in the art, vectors may contain certain elements that are species specific.

These elements can include promoter sequences, operator sequences, repressor genes, origins of replication, ribosomal binding sequences, termination sequences, and others. To use the antisense nucleic acids, one of ordinary skill in the art would know to use standard molecular biology techniques to isolate vectors containing the sequences of interest from cultured bacterial cells, isolate and purify those sequences, and subclone those sequences into a vector adapted for use in the species of bacteria to be screened.
Vectors fox a variety of other species are known in the art. For example, numerous vectors which function in E. coli are known in the art. Also, Pla et al. have reported an expression vector that is functional in a number of relevant hosts including: Salmonella typhimuriurn, Pseudomonas putida, and Pseudomonas aeruginosa. J. Bacteriol. 172(8):4448-55 (1990). Brunschwig and Darzins (Gene (1992) 111:35-4, the disclosure of which is incorporated herein by reference in its entirety) described a shuttle expression vector for Pseudomonas aeruginosa.
1 S Similarly many examples exist of expression vectors that are freely transferable among various Gram-positive microorganisms. Expression vectors for Enterococcus faecalis may be engineered by incorporating suitable promoters into a pAK80 backbone (Israelsen, H., S. M. Madsen, A. Vrang, E. B. Hansen and E. Johansen.
1995. Appl. Environ. Microbiol. 61:2540-2547, the disclosure of which is incorporated herein by reference in its entirety).
Following the subcloning of the antisense nucleic acids complementary to proliferation-required sequences from Staphylococcus aureus, ~'almonetta typhimurium, Klebsiella pneumoniae, Pseudomonas. aeruginosa and Enterococcus faecalis, Eschericlaia coli, Enterococcus faecalis, Haemophilus influerzzae, Helicobacter pylori, Klebsiella pneumoniae, Pseudomonas aeruginosa, Staphylococcus aureus, Salnaonella typhi, or Caradida albicans or portions thereof into a vector functional in a second cell or microorganism of interest (i.e. a cell or microorganism other than the one from which the identified nucleic acids were obtained), the antisense nucleic acids are conditionally transcribed to test for bacterial growth inhibition. The nucleotide sequences of the nucleic acids from Staphylococcus aureus, Salntortella typhinturium, Klebsiella pfteumoniae, Pseudornoraas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, Helicobacter pylori, Salmonella typhi or Caradida albicans that, when transcribed, inhibit growth of the second cell or microorganism are compared to the known genomic sequence of the second cell or microorganism to identify the homologous gene from the second organism. If the homologous sequence from the second cell or microorganism is not known, it may be identified and isolated by hybridization to the proliferation-required °Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumortiae, Pseudomoraas aeruginosa, Enterococcus faecalisEsclaerichia coli, Enterococcus faecalis, Haemophilus influenzae, Helicobacter pylori, Salmonella typhi or Candida albicans sequence of interest or by amplification using PCR primers based on the proliferation-required nucleotide sequence of interest as described above. In this way, sequences which may be required for the proliferation of the second cell or microorganism may be identified.
For example, the second microorganism may be Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Cartdida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Cartdida kefyr (also called Candida pseudotropicalis), Candida dublirtiensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes intmitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faeciurn, Eseherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria rnonocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitides, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomoraas aeruginosa, Salmonella bongori, Salmonella cltolerasuis, Salmonella ertterica, Salmonella paratyphi, Salmonella typhi, Salrrtortella typhimurium, Staplaylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sorznei, Staphylococcus epiderrnidis, Streptococcus pneuntortiae, Streptococcus mutans, Treponema pallidum, Yersinia erzterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments of the present invention, the second microorganism is an organism other than E. coli.
The homologous nucleic acid sequences from the second cell or microorganism which are identified as described above may then be operably linked to a promoter, such as an inducible promoter, in an antisense orientation and introduced into the second cell or microorganism. The techniques described herein for identifying Staphyloeoccus aureus, Salmonella typhimuriunz, Klebsiella pneuntoniae, Pseudomonas aeruginosa and Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Pseudomonas aerugirtosa, Stapltylococcus aureus, Salmonella typhi or Candida albicans genes required for proliferation may thus be employed to determine whether the identified nucleotide sequences from a second cell or microorganism inhibit the proliferation of the second cell or microorganism. For example, the second microorganism may be Artaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dublinierzsis, Chlamydia pneumotziae, Chlamydia trachomatus, Clostridium botulinum, Clostridium di~cile, Clostridium perfringens, Coccidiodes imtnitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gortorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella rnultocida, Pneumocystis carinii, Proteus vulgaris, Pseudornorzas aeruginosa, Salrrzortella bongori, Salmonella cholerasuis, Salmorzella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhirnuriurn, Staphylococcus aureus, Moxarella catarrlaalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sorznei, Staphylococcus epiderrnidis, Streptococcus pneumoniae, Streptococcus mutans, Treponerna pallidurrz, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments of the present invention, the second microorganism may be an organism other than E. coli.
Antisense nucleic acids required for the proliferation of microorganisms other than Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, Helieobacter pylori, Salmonella typhi or Candida albicans or the genes corresponding thereto, may also be hybridized to a microarray containing the Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudornonas aeruginosa, Enterococcus faecalis Escherichia coli, Enterococcus faecalis, Haemoplailus influenzae, Helicobacter pylori, Salmonella typhi, or Candida albicans ORFs (including the nucleic acids of SEQ ID NOs.:

3800, 3806-4860, 5916-10012, and 14111-14944) to gauge the homology between the Staphylococcus aureus, Salrnorzella typhirnuriunz, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, Helicobacter pylori, Salmonella typhi or Candida albicans sequences and the proliferation-required nucleic acids from other cells or microorganisms. For example, the proliferation-required nucleic acid may be from Anaplasma margirzale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burklaolderia cepacia, Carnpylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Carzdida pseudotropicalis), Candida dubliniensis, Chlanzydia pneumoniae, Chlarnydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptlzeriae, Cryptococcus rzeoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Eschericlaia coli, Haernophilus influerrzae, Helicobacter pylori, Histoplasma capsulaturn, Klebsiella pneumoniae, Listeria monocytogeraes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haernolytica, Pasteurella multocida, Pneurnocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sortnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidurn, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species. In some embodiments, the proliferation-required nucleotide sequences from Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemophilus influenzae, Helicobacter pylori, Salmonella typhi or Candida albicans or homologous nucleic acids are used to identify proliferation-required sequences in an organism other than E. coli. In some embodiments of the present invention, the proliferation-required sequences may be from an organism other than E.
coli. The proliferation-required nucleic acids from a cell or microorganism other than Staphylococcus aureus, Salmonella typhimurium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haernophilus influenzae, Helicobacter pylori, Salmonella typhi or Candida albicans may be hybridized to the array under a variety of conditions which permit hybridization to occur when the probe has different levels of homology to the nucleotide sequence on the microarray. This would provide an indication of homology across the cells or microorganisms as well as clues to other possible essential genes in these cells or microorganisms.

Identification of Nucleic Acids Homologous to Nucleic Acids Required for the Proliferation of E. coli in other Bacterial Species Homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified as follows.
The ability of an antisense molecule identified in a first organism to inhibit the proliferation of a second organism (thereby confirming that a gene in the second organism which is homologous to the gene from the first organism is required for proliferation of the second organism) was demonstrated using some of the antisense nucleic acids which inhibit the growth of E. coli. Expression vectors which inhibited growth of E. coli upon induction of antisense RNA expression with IPTG were transformed directly into Enterobacter cloacae, Klebsiella pneumonia or Salmonella typhimuYium. The transformed cells were then assayed for growth inhibition according to the methods described above. After growth in liquid culture, cells were plated at various serial dilutions and a score determined by calculating the log difference in growth for INDUCED vs. UNINDUCED antisense RNA expression as determined by the maximum 10 fold dilution at which a colony was observed. The results of these experiments are listed below in Table I. If there was no effect of antisense RNA expression in a microorganism, the clone is minus in Table I. In contrast, a positive in Table I means that at least 10 fold more cells were required to observe a colony on the induced plate than on the non-induced plate under the conditions used and in that microorganism.
TABLEI
Sensitivity of Other Microorganisms to Antisense Nucleic Acids That Inhibit Proliferation in E. coli Mol. No. S. typhinaurium. cloacae I~ pneumoniae E

EcXA001 + _ -+

EcXA004 + _ --EcXA005 + + +

EcXA006 - -EcXA007 - + -EcXA008 + - +

EcXA009 _ - --EcXA010 + + +

EcXA011 - + -EcXA012 - + -EcXA013 + + +

EcXA014 + + -EcXAO 1 S + + +

EcXA016 + + +

EcXA017 + + +

EcXA018 + + +

EcXA019 + + +

EcXA020 + + +

EcXA021 + + +

EcXA023 + + +

EcXA024 + - +

EcXA025 - - -EcXA026 + + -EcXA027 + + -EcXA028 + - -EcXA029 - - -EcXA030 + + +

EcXA031 + - -EcXA032 + + -EcXA033 + + +

EcXA034 + + +

EcXA035 - - -EcXA036 + - +

EcXA037 + + -EcXA03 8 + + +

EcXA039 + - -EcXA041 + + +

EcXA042 - + +

EcXA043 - - -EcXA044 - - -EcXA045 + + +

EcXA046 - -- -EcXA047 + + -EcXA048 - - -EcXA049 + - -EcXA050 - - -EcXA051 + - -EcXA052 + - -EcXA053 + + +

EcXA054 - - +

EcXA055 + - -EcXA056 + ' - +

EcXA057 + + -EcXA058 - - -EcXA059 + + +

EcXA060 - - -EcXA061 - - -EcXA062 - - -EcXA063 + + -EcXA064 - - -EcXA065 + + -EcXA066 - - -EcXA067 - + -EcXA068 - - -EcXA069 - + -EcXA070 - - -EcXA071 + _ _ EcXA072 + - +

EcXA073 + + +

EcXA074 + + +

EcXA075 + - -EcXA076 - + -EcXA077 + + -EcXA079 + + +

EcXA080 + - -EcXA082 - + -EcXA083 - - -EcXA084 - + -EcXA086 - - -EcXA087 - - -EcXA088 - - -EcXA089 - - -EcXA090 - - -EcXA091 - - -EcXA092 - - -EcXA093 - - -EcXA094 + + +

EcXA095 + + -EcXA096 - - -EcXA097 + - -EcXA098 + - -EcXA099 - - -EcXA100 - ' -EcXA101 - ~ -EcXA102 - - -EcXA103 - + -EcXA104 + + +

EcXA106 + + -EcXA 107 - - -EcXA108 - - -EcXA109 - - -EcXAl 10 + + -EcXAl 11 - - -EcXAl 12 - + -EcXAl 13 + + +

EcXA114 - + -EcXAl l S - +

EcXAl 16 + + -EcXAl 17 + - -EcXAl 18 - - -EcXAI 19 + + -EcXA120 - - -EcXAl21 - -EcXA122 + - +

EcXA123 + -EcXAl24 - - -EcXA125 - - -EcXA126 - - -EcXA127 + + -EcXAl28 - - -EcXA129 - + -EcXA130 + + -EcXA 132 - - -EcXAl33 - - -EcXA136 - - -EcXAl37 - - -EcXA138 + - -EcXA139 - - -EcXA 140 + - -EcXA141 + -EcXA142 - - -EcXA143 - + -EcXA144 + + -EcXA145 - -EcXAl46 - - -EcXA147 - - -EcXA148 - - -EcXA149 + + +

EcXA 1 SO - - -EcXA151 + - -EcXA152 - - -EcXA153 + + -EcXA154 - - -EcXAl SS - - ND
~

EcXA156 ~ - + -EcXA157 - - -EcXA158 - - -EcXA159 + - -EcX.A160 + -EcXA162 - - -EcXA163 - - -EcXA164 - - -EcXA165 - - -EcXAl66 - - -EcXA167 - -EcXA168 - - -EcXAl69 - +

EcXA 171 - - -EcXA172 - - -EcXA173 - - -EcXA174 - - -EcXA175 - - -EcXAl76 - -EcXA 178 - -EcXA179 - -EcXAI 80 + _ _ EcXA 181 - - -EcXAl 82 - - -EcXAl 83 - - -EcXA184 - - -EcXAl 85 - - -EcXAl 86 - - -EcXAI 87 + + +

EcXA189 + _ _ EcXA190 + + +

EcXA191 + + -EcXA192 - + -Thus, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides can be identified by measuring the ability of an antisense nucleic acid which inhibits the proliferation of Staphylococcus aureus, Salmonella typhimuriuna, Klebsiella pneumoniae, Pseudornonas aeruginosa, Enterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haemoplailus influenzae, Helicobacter pylori, Salmonella typhi or Candida albicans to inhibit the growth of other organisms. This may be evaluated by transforming the antisense nucleic acid directly into species other than the organism from which they were obtained. In particular, the ability of the antisense nucleic acid to inhibit the growth of Anaplasnaa marginale, Aspergillus fumigatus, Bacillus arathracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Caradida albicans, Candida glabrata (also called Torulopsis glabrata), Caradida tropicalis, Candida parapsilosis, Candida guilliermoaadii, Candida krusei, Cajadida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Clalamydia trachonaatus, Clostridiurn botulinum, Clostridium difficile, Clostridiuna perfringeras, Coccidiodes inamitis, Corynebacterium diptheriae, Cayptococcus neofornaans, Enterobacter cloacae, Eaaterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatutn, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria naeningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, Yersinia pestis or any species falling within the genera of any of the above species.
may be evaluated. In some embodiments of the present invention, the ability of the antisense nucleic acid to inhibit the growth of an organism other than E. coli may be evaluated. In such embodiments, the antisense nucleic acids are inserted into expression vectors functional in the organisms in which the antisense nucleic acids are evaluated.
It will be appreciated that the above methods for evaluating the ability of an antisense nucleic acid to inhibit the proliferation of a heterologous organism may be performed using antisense nucleic acids complementary to any of the proliferation-required nucleic acids from Staphylococcus aureus, Salmonella typhimurium, Iflebsiella praeumoniae, Pseudornonas aeruginosa, Enterococcus faecalis, EschericlZia coli, Enterococcus faecalis, Haemoplrilus influerZZae, Helicobacter pylori, Salmonella typhi or Candida albicans (including antisense nucleic acids complementary to SEQ
ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, such as the antisense nucleic acids of SEQ ID NOs.: 8-3795) or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof, or homologous antisense nucleic acids.
Those skilled in the art will appreciate that a negative result in a heterologous cell or microorganism does not mean that that cell or microorganism is missing that gene nor does it mean that the gene is unessential. However, a positive result means that the heterologous cell or microorganism contains a homologous gene which is required for proliferation of that cell or microorganism. The homologous gene may be obtained using the methods described herein. For example, the homologous gene may be isolated by performing a PCR procedure using primers based on the antisense sequence which reduced the level or activity of the gene product encoded by the homologous gene or by performing a Southern blot.
Those skilled in the art will appreciate that an antisense molecule which works in the microorganism from which it was obtained will not always work in a heterologous cell or microorganism.

Identification of Nucleic Acids Homologous to Nucleic Acids Required for the Proliferation of Staphylococcus aureus in other Bacterial Species Nucleic acids homologous to proliferation-required nucleic acids from Staphylococcus aureus were identified as follows. Thirty-nine antisense nucleic acids which inhibited the growth of Staphylococcus aureus were inserted into an expression vector such that their expression was under the control of a xylose-inducibla Xyl-TS
promoter. A vector with Green Fluorescent Protein (GFP) under control of the Xyl-TS promoter was used to show that expression from the Xyl-TS promoter in Staphylococcus epidermidis was comparable to that in Staphylococcus aureus.

The vectors were introduced into Staphylococcus epidermidis by electroporation as follows: Staphylococcus epidernZidis was grown in liquid culture to mid-log phase and then harvested by centrifugation. The cell pellet was resuspended in 1/3 culture volume of ice-cold EP buffer (0.625 M sucrose, 1 mM MgCl2, pH=4.0), and then harvested again by centrifugation. The cell pellet was then resuspended with 1/40 volume EP buffer and allowed to incubate on ice for 1 hour. The cells were then frozen for storage at -80°C. For electroporation, 50 ~1 of thawed electrocompetent cells were combined with 0.5 p,g plasmid DNA and then subjected to an electrical pulse of 10 kV/cm, 25 uFarads, 200 ohm using a biorad gene pulser electroporation device. The cells were immediately resuspended with 200 ~1 outgrowth medium and incubated for 2 hours prior to plating on solid growth medium with drug selection to maintain the plasmid vector. Colonies resulting from overnight growth of these platings were selected, cultured in liquid medium with drug selection, and then subjected to dilution plating analysis as described for Staphylococcus aureus above to test growth sensitivity in the presence of the inducer xylose.
The results are shown in Table II below. The first column indicates the Molecule Number of the Staphylocoecus aureus antisense nucleic acid which was introduced into Staphylococcus epidermidis. The second column indicates whether the antisense nucleic acid inhibited the growth of Staphylococcus epidermidis, with a "+" indicating that growth was inhibited. Of the 39 Staphylococcus aureus antisense nucleic acids evaluated, 20 inhibited the growth of Staphylococcus epidermidis.
TABLE II
Sensitivitx of Other Microorganisms to Antisense Nucleic Acids That Inhibit Proliferation of Staphvlococcus aureus Mol. No. S. epidermidis SaXA005 +

SaXA007 +

SaXA008 +

SaXA009 +

Sa~A010 +

SaXA011 -SaXA0I2 -SaXA013 -SaXA015 +

SaXA017 -S aXA022 +

SaXA023 -SaXA024 -SaXA025 +

SaXA026 +

SaXA027 -SaXA027b -SaXA02c -SaXA028 -SaXA029 +

SaXA030 +

Sa.XA032 +

SaXA033 +

SaXA034 -SaXA035 +

SaXA037 +

SaXA039 -SaXA042 -SaXA043 -SaXA044 -SaXA045 +

SaXA051 +

SaXA053 -SaXA056b -SaXA059a +

Sa,XA060 -SaXA061 +

SaXA062 +

SaXA063 -SaXA065 -The above methods for identifying homologous genes using antisense nucleic acids complementary to any of the proliferation-required nucleic acids from Staphylococcus aureus, Salmoraella typhimut~ium, Klebsiella pneumoniae, Pseudomonas aeruginosa, Eraterococcus faecalis, Escherichia coli, Enterococcus faecalis, Haenaophilus influenzae, Helicobacter pylori, Salmonella typhi or Candida albicans, (including antisense nucleic acids complementary to SEQ ID NOs.:

3800, 3806-4860, 5916-10012, and 14111-14944, such as the antisense nucleic acids of SEQ ID NOs.: 8-3795) or portions thereof, antisense nucleic acids complementary to homologous coding nucleic acids or portions thereof, or homologous antisense nucleic acids.
Homologous nucleic acids may also be identified using complementation analyses.

Identification of Homologous Nucleic Acids by Functional Complementation Homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified as follows.
Gene products whose activities may be complemented by a proliferation-required gene product from Staphylococcus aureus, Salmonella typhirnurium, Klebsiella praeumoniae, Pseudomonas aeYUginosa, EnteYOCOCCUS faecalis, EscheYichia coli, Enterococcus faecalis, Haemophilus influerazae, Helicobacter pylori, Salmonella typlzi or Candida albicarZS or homologous polypeptides are identified using merodiploids, created by introducing a plasmid or Bacterial Artificial Chromosome into an organism having a mutation in the essential gene which reduces or eliminates the activity of the gene product. In some embodiments, the mutation may be a conditional mutation, such as a temperature sensitive mutation, such that the organism proliferates under permissive conditions but is unable to proliferate under non-permissive conditions in the absence of complementation by the gene on the plasmid or Bacterial Artificial Chromosome. Alternatively, duplications may be constructed as described in Roth et al. (1987) Biosynthesis of Aromatic Amino Acids in Escherichia coli and Salmonella typhimurium, F. C. Neidhardt, ed., American Society for Microbiology, publisher, pp.
I O 2269-2270, the disclosure of which is incorporated herein by reference in its entirety.
Such methods are familiar to those skilled in the art. Alternatively, homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified by placing a gene required for proliferation or a nucleic acid complementary to at least a portion of a gene required for proliferation under the control of a regulatable promoter as described above, introducing a plasmid or Bacterial Artificial Chromosome into the cell, and identifying cells which are able to proliferate under conditions which would prevent or reduce proliferation in the absence of the plasmid or Bacterial Artificial Chromosome.
Homologous coding nucleic acids, homologous antisense nucleic acids or nucleic acids encoding homologous polypeptides may be identified using databases as follows.

Identification of Homologous Nucleic Acids by Database Anal sis As a demonstration of the database methodology used to find homologues to an essential gene, nine prokaryotic organisms were analyzed and compared in detail.
First, the most reliable source of gene sequences for each organism was assessed by conducting a survey of the public and private data sources. The nine organisms studied are Eschericlzia coli, Haemophilus influenzae, Helicobacter pylori, Klebsiella pneumoniae, Pseudomoraas aeruginosa, Staphylococcus ~aureus, Streptococcus pneumoniae and Salmonella typhi. Full-length gene protein and nucleotide sequences for these organisms were assembled from various sources. For Escherichia coli, Haemophilus~influenzae and Helicobacter pylori, gene sequences were adopted from the public sequencing projects, and derived from the GenPept 115 database (available from NCBI). For Pseudomonas aeruginosa, gene sequences were adopted from the Pseudomonas genome sequencing project (downloaded from http://www.pseudomonas.com). For Klebsiella pneumoniae, Staphylococcus aureus, Streptococcus pneumoniae and Salmonella typhi, genomic sequences from PathoSeq v 4.1 (Mar 2000 release) Was reanalyzed for ORFs using the gene finding software GeneMark v 2.4a, which was purchased from GenePro Inc. 451 Bishop St., N.W., Suite B, Atlanta, GA, 30318, USA.
Subsequently, the essential genes found by the antisense methodology were compared to the derived proteomes of interest, in order to find all the homologous genes to a given gene. This comparison was done using the FASTA program v3.3.
Genes were considered homologues if they were greater than 25% identical and the alignment between the two genes covered more than 70% of the length of one of the genes. The best homologue for each of the nine organisms, defined as the most significantly scoring match which also fulfilled the above criteria, was reported in Table III. Table III lists the best ORF identified as described above (column labelled LOCUSID), the SEQ ID, % identity, and the amount of the protein which aligns well with the query sequence (coverage) for the gene identified in each of the nine organisms evaluated as described above.
Table IV lists the PathoSeq cluster ID for genes identified as being required for proliferation in Enterococcus faecalis, Esclaerichia coli, Pseudomonas aeruginosa, and Staphylococcus aureus using the methods described herein. As indicated in the column labelled PathoSeq cluster ID, these sequences share homology to one another and were consequently grouped within the same PathoSeq cluster. Thus, the methods described herein identified genes required for proliferation in several species which share homology.

o \ ~ M
p N
_Ci ~ M rt' M
Ci ~ 0 0 0 ~ o ~' ,--~ o0 O 01 ~O
O ~O \°~ \O \°~ ~O
tt v1 N Ov ~ ~O v~ N ~ ~ ~O d~ ~ ~ N
tn M M 00 lp M U1 l~ M N N
M M M M M M M
U ~ ~ 0 0 0 0 01 O~ 01 G1 O~ O~
_O N
'~~ ~ O ~ ~ N N ~ N ~ N vp H N due' U ~ ..N-. .-Na ,-,-Na ~ .N-~ ,.N-~

O l~ O ~O
O
o ~ o ~ o . O ~ 00 ~ O M
N ~--~ N
O O o ~ O~
N
W o o M o°o ~-~ t o ~ ~' 00 oyr oo ,.-, 00 a;~~ 'ON Md' Md' d'M~NdO"
o p 00 ~ O l~ ° OUP ° O 01 ~ Ov O~ N .-~~ . due' N M oo M O
O ..-r .-~ ..~ ,-i 0 0 -o 0 0 0 U .~
O w o O o O o O o O o O o O
v ~ \ o \ o \ o \ o \ o \ o 00 p ''."' ~ O r' M O '"' ~p O ~'' M p "'' ~ O '-' O
,_, O p O ,~ O ,-~ O ~ O M O o0 O ~ O ~ O ~ O ~ O ~ O ~ O
N ~, O ~ ~ N ° ~ 00 ~ ~ ~ ° ~ d' U V d' N M d' ~--~ ~ O M M
O O O O O
H ~ H ~ H ~ H ~ H~ ~ E~-' z~ z~ ~Z~ ~Z~~ ~Z~~ ~Z~~
w~~ w~~~ w~~~ w~ ~ w~ ~ w~ ~
o~, ~o~ ~o~ ~o~ ~o~ ~o~
A
A °0 0 0 '~ '°' '° °' V d ~ d ~ ~ d d W .-~ W m W ~n W ~-J W ~ W u, W

0 0 0 ~ o N .--y.-y~ V~ N
O ~ ~ o LD ~ o .~-~ o ~ 00 M ~ ~O M ~-r M
O ~D l~ M 01 ~ Ov d~
M M M
p ~ p~ ~ 00 0 01 O 00 0 00 o Q1 ''" ~ O N LC ~"~ Q1 ~f~ M ~ M ~ V1 ~ V7 pp N oo ~ ~n O O~ O Lp N N ~ d' M M M M M M
o 0 0 0 0 0 O
_O ~ \ ~ \ O ~ ~ ~ o ~ ~ ~ O~
l~ O 00 ~ o O l~ ~ ~O ~ d' N N N N N N
y ~ ,--~ .-i ,.-~ ,-a \O \O \~ \°~ \°~ \~ \~
°ef~ ~' Ov p ~ O O d' N M ~ ~ l~ v1 V 1 ~ \O O et ,~.~.y~'1 0~1 ~t~ .~~.~' M ~ d~
_~ '~ o O
.D
o _ o 0 0 0 c~
,.Op ~ o ~ o p o ~ o pp o O O \ l0 \ '"~ O~ \ 00 \ ..-~y°~r 1 dN' ~ 'M~' h dM M ~ ~t~
r.1 r-t .--i .-r - \ ~ \ \°
'Z" ~ O O l~ ~1 l~
p o o0 ~ Q\ o o0 ~ C1 N t~ O N M 00 'd~ M ~l7 lp ~f' ..-.i N Lp 01 M O ~1 O ~t ~ d' O
~-r ~ ~--~ .--m V o- - o - 0 0 0 0 0 O '~ o "'' o ~, o O o ~ o '"' o O o '"'' CS \ O \ O \ O ~ O ~ O ~ O ~ O
O C~ O r-r O O ~ 00 . O .--~ O O .--i M O r, O O
O d~ O ~ O Lp O N O ,~~..~ O ,~ O
r-~ yy-~i ~ .-a ~ ...-~ V~ ~ 00 "'~ ~ '" i ~D
O O O O O O O
.-a r-W --~ .~r .~~
p 0 0 ~v o OLD o OM \O~ON \OV~ 0 0~0,~, 0 0~0~
LD O M
t~j o ~ o M O ~!1 O 'd' o M O d' .-r .--i H H~-i I-~-1 H ~ F~-~~i 1~-1 ~-~-I
z~~ ~~~ ~~~ zap z~~
~o~ ~o~ ~o~ ~o~ ~o~ ~o~ ~o~
A N N N N N M
O O O O O O O
N O W ~t W O W O W ~-~ W o~ W ~n W

\°

O ~ M o ~ d~ o ~ ~ o ~ ~ o G1 c~i h ~ ~ N
M d~ M M
r-1 e-a r-i O - _\ o ~N
O O \ Q\ O O \ D1 d' N ~ ~ ~ M l0 ~ 00 ~ d~ c~ r-i 00 [~ l~ ~~ ,~-~ [w d~ y o0 ~1' M
O M M M M M M
o o 0 0 0 0 V
o ~ o ~ o ~ o ~ o ~ o O N \ \ \ \ \ \
?, ~ M M yo M ,.-~ N a1 N vD
i~., Ci M O ~O M d' N l~ ,M-, ~~ O~ 't~
M N N N N N
o 0o M ~-a O ~ o O o Q1 o O
y 'ZW O due" ~-N.~ N O~ ~n N
O
C ~ 'N'~
~
N O o ~O ~ M N

Qv o O
M N O M ~ O~ 00 O ?~ \O d~ 00 N M M
~' N .-' ''a "r N
S~ ~ o O o ~ o ~ o O ~ 00 \ ~-a ~ \ lp \ V7 \ Q\
M ~ 00 N G1 t~j M N M
N N
O
V o 0 0 0 0 0 0 O "" o O o O o O o O o O o .-r o O
C~ C3 \ O \ O \ O \ O \ O ~ O \ O
O ~ O r., N O .-~~ ~ O r, M O ,~ ~ O .--~ N O ~ ~ O ~ .-a y ~ O pp O ~ O ~ O ~p O O O oo O O
y0 ~ I~ ~ et O O O O O O O
\°
~ ~ o O ~ o O~ ~ 0 01 ~~ o D1 UO d~~dM~'OMN~ NN
O O O
H1 ~ H yE"'-1 ~-H-I ~ H
w~'~~ w~~~ w~~ ~~~~ ~~~ ~~~ w~~a~
~o~ ~o~ ~o~ ~o~ ~o~ ~o~ ~o~

W .v, W ~r W ~ W o~ W ~ W oo W
N N

o o - o o M o ~n o 0 O ~ V1 ~ ~ ~.,~ \ 01 .d. ~ ~ O
l~ N v0 C3 ,-M-i d~ M 'd Ci o ~ 0 0 0 0 0 00 O r-~ 01 ~ d~ N ~ ~ 01 O ~ O ~ o~ M o '-" 00 o O
[w 00 l0 M M ~D ~O O V1 ~ M ~ l~ N
O M M M M M M M
_ ~ 0 0 0 _O ~ \~ ~~ ~~ ~o ~~ ~o ~O
?1 ~ .-r M O M ,., O~ M M ~y O pp O ~D N ~D ~ ~n ~ I~ Ov N N M ~' ~ N
V
_ _ - Q 0 0 .-a M d' .-i N .-r O ~ 0 00 ~ I~ o t~ o O o O~ o O
l0 ~ M lp ~ M 00 ~1 V7 N ~t ~ '~ oho M O ~ O N ~ t~ ot~o .-a N N
O ~
.~
,~ rl Ch O ~D ~ O1 ~ I~ N
N ~ M d' ~ d' ~D N d' I~ d' p) ~ ~--r ~ .-~ .-a O ~ \0N0 o0~01 0~ 00 4~ d~ ~ M d' oo ~ op N
N ~ d' .-~ d' 00 N O l~ O
N
O ," o O o O o O o O o O o O o O
O ~ O O O O O O O O O O O O O O
O O~O~O~O~O,~_,O oNOOM
c,~ ~, ~ r", ~ r, ~ r,, ~p ,-a ~ r., d' O O O O O O O
o N ;" d' ° O~ Vo ° ~ ~O ° 00 N
V O M dM~ O N O N
O O O O O
~H e~-t 1~~.1 e~-I
z~ ~~~ ~~~ z~~ z~~
U ~ ~ U ~ ~ U ti ~ U v~ ~ U rig ~ o c~'n A
,..., ~~ ~. ~p o0 o M

N ~n W t~ W ~~ W N W ~ W ov W ~t W

0 0 ° 0 0 0 0 o ~ o °° ~ o Q' 00 0 0 ~ o °~ 00 0 ° o~ o t~ <r O .-. ~ o~ ~ ov yo ~t o ~t '"'' '"' Ci ,-~-a OU ~~ ~o~o ~OM1 ~O o0 ~0~1 00 ~ ~-~ ,(~- 0000 ,-~ dM~ yD
M M M M M
U a1 O ~ l~ C~ ~ ~-a O d~
O N
oy ~ d~ \p 00 ~ 01 ~ N ~ d' 00 O ~ N ~ N ~ N ~ Ov ~ N ~ M

°0 \ oo ~ o \° vv \° o \° o0 N oo ~ OWD d' dW1 ~ M
N ~ 0~1 ~ ~ M ~ ~ 0~1 ~ 0~0 ~ 0~1 y ~ ~-~~~ r C a ~ ,~ v~
_~ ~~ 0 0 0 N O ~ oho \° ~ \°
M o v o 0 0 0 . 0 0 p .O o ~ o ~ o ~ r~,~ o ~ M o ~ ~ o ~O M OM d. M ~f. M ~ N M d~
.-r .-a ~ .-i N .--i ~ ,-r .~-r H N ~ 0 0 0 0 O~oOMOo~~~o0011\
~_ ~
N ~ \O O d' .-~ M ~ N O M O~
~N ''~ ~ .--~ ~ O
\°
o a c o 0 0 0 s o0 00 ~ 00 00 0°0 00 0°0 o M o M o M o 00 o c~ o o, o .....
°' '~
o ~ o ~ o ~ o ~ o ~ o ~ o o 0 0 ~ o 0 .N ;~ \ oMO ~n o ~ 01 0 0 0 0 0~1 l~ o ~ N o ~ tn o oho V7 p ~ M ~ M ~ N d' ~ d~~ .N-a N O
O O O O O O O O
~N r1 r1 v~-1 ~-1 1~1 1~1 r1 ~Z~ z~ z~ z~ z~~ ~~~ ~Z~~
~o~ ~o~ ~o~.~o~ ~o~ ~o~ ~o~
A
o_ o o_ o o_ o_ o_ V ~ ~ ~ ~ d a, W o W ~-~ W N W oo W ~ W ~ W

\ _ \ \ -N 01 . d' N
O ~C ,°\~ ~ ,y0 '~ ~ 0 ~, M O d~ p d' oo d' O
C3 0 0 0 0 0 ~ o "" r--WD O~ 00 ~ O
O O ~ ~ ~ O ~ 01 ~ 01 ~ Q1 ~ ~ ~ O
~_ O ~ ~-' V7 01 00 l0 00 O M d' M ~ H~
N ~ dWn ~ oo ~M v~ ~ t~ N ~D N \O
M M M M M M M

\ \ \ \ \
O 5 O o0 a\ ~' ~-' O ~ o 0 0 ~ o ~ o ?~ ~ t~ ~D o0 ~O N o0 ~ ~O ~1 N
N ~ ~ ~ M ~ ~ N N
_ ~ \ ~ o l~ V' M O~ 'O 'O , ~ O
M f~ l0 01 d. ~ d~ 0O0 d~ V001 N .-~~ ..., .-r V1 .N
N
O
N N
H
O - _... O O O O
,~ ~, O ~ O ~ O ~ O O O
OV ~,O \ ~-~ O \ O \ t~ \ ~-r 01 \ N
d~ ~ ~O M ~ d~ v7 e-a ~ ~ ~ r~

O ~ ° ~ M ,°.\~ ~ 1C ° '-~ 00 ~ '~ I~ o ~ M
N ~ M ~ ~O O d' O d~ rN,, d~ ,-N~
V o 0 0 0 0 0 0 V ~N
o O \ O o O o O o O o O o O
p ~ Or'M OT-'pp Or'vp O~~~ O~'~ O~',~ O~'N
O ~p O .~ O ~~ O N O ~ O p~ O
r~; ~ ,-.r 00 ~'~ 00 ~ V~ '"~ ~O ~ V~ ~ 'd~ ~ ~i1 O O O O O O O
_ 0 0 0 .v N ~ ONO o O~ M o '-.i 01 0 ~ ~O o O M
N t~ O d' M M ~ ~ ~ M ~ N ~ M
O O O O O
w~~~ w~ ~ w~ ~ w~ ~ w~ ~ w~ ~ w~ ~
A
A

o w~, w~ w~ wo w~r w~, w N M W

_ o 0 0 0 o x o °~ ~t' o ° ~ ° °~ ~ °
°° ~t' ° °~ N
sz, V'o°' o ~ o oM o ~ ~ i° o Ct ~ d' d' M d' O -_ 0 0 0 0 O N O~ ~ N
~O M p O ~r vp ~r sC dW~ O N V1 t~ N n ~1 h N o0 ~ ~O
M M M M M M
o _o 0 0 0 0 O r~ O~ .-~ M V7 O
_O N \~ \°o \o~ \~ ~O
V7 ,-r ~ 01 O~ V~ l0 d' ~ M t~ N
C1 ~D M t~ oo d' ,.-. ~ O I~ in '~ O
N N N N N N
.-a ..-a ~ ~ .-r o - N l\ N
O ~ o ~ o ~ o ~ ~_ ~ o ~ o .-r 00 ~ O M d' ~O ~ M ~ M
O~ o~ O~ G~ N O

O~ d' . ~ d' ~ M l~ M
U o 0 0 0 0 0 .Q ~ o~ o~ 001 op~p ooMp O O \ \ \ ~ \ ~ \ ~"
v ?, ~ ~ c~~ ~ N ~ o ~ M due' N
_0 0 o ~ \ ~ \ ~ \° ~ \ °~° \° °a1°
v oo N v0 o O N oo _v~ i~ O_v N ~ ~ .-N., er N ei' ~ V1 N M N
r~ O '-r .--a ~N 1-~1 v--i !~~1 ~i r.i O C G C G G G
O '~ o ~~ o O o O o O o ~ o ~ o O
C) Ci \ O \ O ~ O ~ O ~ O ~ O ~ O
O~~ O~~ O~p~p O~~ O~N O~~ O~
O d' ~ O ~ O ~ O ~ O ~ O ~ O ~ O
d1 d, o O ,~ \ d1 O \ 0~0 ~ o ~
O ~ M ~ N N ~O ~ ~' ~ ~' d' M d' N .d. N V'1 M M O
O O O O O
H
z~~ z~~ ~~~ z~~ z~~

O O p .O-~ ""'O O
O O O O O O O
O fs.~ o w oo W ,-~ W N W O W ~ W
N ~n W W

o o 0 0 0 0 y O ~ ~ ~ ~ d' ~ M ~ N
o ~ M ~ M ~O M M
p M ~ M ~ ~ ~ d' O~

M d' M M M M

0~1 0~1 00 00 00 ~ o0 oOV

w ~ ~ O O ~1 O ~ O ~ 00 l~ G~ ~ d' l~ o V7 00 1 1~

M M M M ~ ~ M
M M M

o -...... \ o O O~ O~ O~ a1 O C1 O
~ ' O \ ~ \ ~ ~ ~ \
0~ O ~' o '-v N

?, ~o v0 00 ~t O O ~ y n o O N
~ N M l~ ~D d' ~ ~O

CS ~ ~ d' Q1 N N N

N N N N N N N

~ O o 0 \ \
0~1 0~1 O O

'ZS O~
N d' d' ~ M ~ due'~ d' ~

~s ~t ~ ~ ~ 'n '~'~ '"' O o ' _ N M
~ d ~

_ ~

r., o o -_ o 0 0 0 V

.p o c c O 00 01 l ~ 0~1 ~ \
\ \ \

O op M ~D --~ N oo ~n O M M N ~ d' ~ M

~ ~

O ~ ~ ~ ~ O O ~

~ r,,Ov .--~O .-a~O I~ N o0 M O~
N ~ ' ~

M ~ M o d N M O ~ O O

0 0 0 .-~ o .-a o v ~ 0 0 0 0 0 0 cc 0 0 0 0 0 0 0 O O 'p O 00 O d- O ~ O M O
~ ~' r., '"~ "'~ .-i O

c~ O pp O d- O ,.~ O ,.,O ~ O ~
~ ~D ~ l~ -~ ~p ~ l~ -~ N ~ h O O O O O O O

o o 0 o o o N 00 'ct , O O ~ N
~ d1 ~ ~ ~
O a1 O O

N O O ~ ~ ~ M ' N

M d d' d M ~ M M V1 d M
' O

O O O O O

~ ~ ~ ~ ~
~

z Z ~ ~ ~ z ~
~ ~ ~ ~ ~ ~ ~ ~

w w w w ~ w ~ w A o ~ ~o ~ ~o ~ ~o ~ ~o ~ ~o ~ ~o ~

~

N N d' ~n ~n ~O v0 O O O O O O O

W W W W W W W
-~ O 01 O

N O ~ M

o o o ~ , ~ ~

~ ,-..~ o N ~ ~ d' N O
M I\ I\

~ O O ~ O
n 1 1 0 , M M M M Wit' .

o O ,O \ O ~ ~ ~ ~ ~
O O ~ O O~

O o ~ o o o o o 'N y p O ~ -a .-.~N ~--iM ~--i l~ f~ t~
<f' O oo O 0o O O~ O o0 O op W O

M M M M M M

, V \ \

~ ~ O O l~
N ~ ~ ~ ~ ~ O 01 _O \ \ ~ ~ ~ ~ X

v~ onto00 ~ o~ ~ ~ d. ~ ~n N

N N N N N ~ N

p ~ \ o \ \ o ~ o O o 0~1 0 o o 0 0 o p ~ O oho 0~1 0~1 O~1 ~ ~

~ \ \ .-~ ~ ,n ~ op ~ ~
t M ~ ~ ~ O ~ ~ ~ ~ O N OMOM _ 0., CI '~ ,~ ..-~ ..-.~ N
~ N ~ N

a O

~p V7 O

U o o ~ 0 0 O o o o o O1 o ~ ~ O, O r, d' M N .-.~~ d.
d' ~ a1 ~ O~ ~ 01 ~ N M 00 ~ r N ~ ,.-~ ~--~ ~ .- r V7 l~ I~
p ~ ~ ~ ~ o o o o o ~ ~ ~ ~ ~

O .-~ N M ~ ~n ~O
N ~ M O ~ O ~ O o O ~ N N4 o h O O

~--i ~ ~ .-r O
- .

V o 0 0 0 o 0 0 v~

. .-i .~ O O O
CJ ~ O o o o o o \
O O O O O O

O O ~ N O ~ O pp O ~ O ~ O ly ~ ''" ~'' .-r '-' "'r O ~ O ~ O ~ O
O O ~ O
~

O ~ O ~ O ~ O ~ O ~ O

O

0 00 ~O o ~ o d. a M o M o O~ \ 'ct' O O 01 O~ O~ 01 O ~ ~ ~ ~ ~ ~ ~ ~ ~' M N M ~1'M' C) M M ~ M ~ M ~ M v r U 1 , O O O O O O O
H H

.N ~ ~ N ~ H

~ ~ '~ ~ ~ ~ ~
~ ~ ~

Z z ~ Z z ~ Z ~ z ~
~ ~ ~. ~ ~ ~ ~ ~ ~ w~ w w ~ w ~ w ~ w ~ w ~ ~o ~ ~o ~
o ~, ~o ~o ~ ~o ~ ~o ~ U ~ U
~ U U

U v~ U U U
U U U

A ~ ~ ~ ~ N N

O O O O O O O

W W W
M

N
W W W W ov N M d' ~n N o ~' O ~ ° d ~ ~ ~ M \ O
00 ~ a\
M pp N M M

Ci ~ ~ ~ -. - ~ O
00 O 00 Vp ~ 00 ~ ~ ~ ~ ~ N ~ O
~n WO N ~O ~ ~D ~' M
M
U ~ N M M M M
U o 0 0 ~ 0 0 O 5 ~ N ~D
O N \ ~
M NO d. M ~ N d. ~ M N M d.
N M N
N N N
O O \
p ,~ \ ~ o ~ ~ ~ O
M ~ M
N
O
.O
o p o ~ ~ ~ \ O
O p \ ~ M \ ~ o o~ N ,-r M ~ M ~ M ~ M
N ~ '"~ '-r O ~ o ~ o M ~ M
N ~ M l~ d0" O M
O
0 0 0 0 -- o 0 0 H
O ~ O p o ~ O p O ~ O ~-~ o0 O ~"' O O '"' M O W n O ~' op O ~' op O '""' N
O~ONOetOd'Od'OM v0 O O O O O O O
\°
. o ~ 0 0~1 l~ M O
O .~ ~ ~ M
,'~-i ~ 'J.t ~ ,~-t ~ ',yr ~ _ 'J.a H
w~~ ~~~~ w~~~ ~a~~ w~~~
~o~ ~o~ ~o~ ~o~ ~o~ ~o~ ~o~
N M M M M M d' O O O O O O O
N t~ W oo W N W o~ W o W et W o W

O~ h ~~ ~ N~~ '°~p~~ p~d' IoM
M O ~ O ~, O ~ O ~, O
CS M t d' ~t d' d' v o ~ cv o 0 0 ~ 0 0 0 0 pp ~~ [~ ~ 00 O 01 .-.~ O_ M ~ N ~ M
~D N oo N OW ~ N o0 N o0 N
M M M M M M M

O N \°
~?~ ~ M ~ ~ y~ ~ ~p ~ [y pp ~ 01 ~ O
N N N N N N
N N N N N N N
O ~ o O ~ o O o 01 o O \ 01 0 01 o O
N.~ ~ N O ~~~ ~d~" ~,°n~ ~d~' -a ~n ~ ~ ~Wn N .O 'd. ~ O
_~ N
U o 0 0 o C~
O O d' OWE d. ~O M ~.-~ O~ N ~n N d' M d d'dM'~D ~ ~ dM'd' dM.
N ..~ ~ ~ .-a ~ rr N ~ .-~ ~ .-a .-'' ~' N o o _ O ~ ~~ oppp 00 oOt\1 00 N
'"'.' N p~ ~ ~ ~ O~ dM' O ~n ~'"'., ~' ,.~-a N
V ,H o 0 0 0 O'V o0 o0 o'"' o""' o'~ o'.' o'-' O o O O O ~ \ O ~ \ O ~ \ O \ O
O O O pp O
O ~ O N O N O N O N O N O N
w ~ ~ ~ ~ N ~ ~ ~ N ~ h O O O O O O O
O O ~ O 01 O 01 O
G U N N M V'1 M ~O M O M ~O M d' o O O o o O o ~., C7 ~., C7 ~ C7 ~ C~ ~ C7 ~ C7 ~., C7 H ~ H ~ H ~ ~ ~ H ~ H ~ H
z~~ z>~ z~~ ~Z~~ z~~ z~~ z>~
wo ~ wo ~ wo ~ ~ov wo ~ wo ~ wo A ~ U v~ ~ U v~ ~ U v~ ~ U v~ ~ U =n ~ U crs 0 0 ~-a M W d- W ~ W O W ,--~ W N W d' W

O ~ ° ~ N ° ~ ~ ° ~ d' ° ~ M °
°~ pv ° Ov O
yi o ~ ~ d~ o~p d' p V~
O ~~ ~ M M d' U ,~
.-r d' 01 O
O O o O \ O o 01 0 ~ o O \ 01 pNp ~ pip Op0 ~ 00 I~ N
M M M M M
-o o 0 0 0 ~r 01 V7 ~ O d' O N \ ~ \ ~ ~ ~ ~ O ~ O ~ 01 0 0 0 0 "~ o '"~ o -.r ~O N ~ O ~O ~-~ ~O ~O N
N N M M O
N N N N M
\
0o d' N oo vWn O ~ \ d1 o Ov \ 01 \ I~ 0 01 o Ov O \O ~ Ov ~ a1 M ~ M ~ d' p) w--i '-r _ V
M
U o ~ o 0 p M c O\ N ~ 00 N O\
~.M ~ M~. ~p ~ . d' N
\ \ - \ \ \ \
x ~ o°o o C1 M o0 (T ~' ~O O, ~O o0 O1 V~ O ~ ~ O
N ~ ".~O .-~.yl. .-y ~ N M
V o 0 0 0 - c o 0 O '~ o '"~ o ".., o '""' o ,., o O o O o O
O \ O ~ O \ O \ O \ O \ O
O ~ O p O ,~ O d- O ~ O ,.-.i O M O
O ~ O ~ O ~ O ~ O ~ O ON0 0 O O O O O O

.N c 0~1 M c Oh1 N c O O c G\ O c a1 M \ 01 .-a c o0 O
O ~ M ~ M ~ N ~ N ~ N ~ N M
O O O O O O
~.., L7 ~,, L7 ~,, C7 ~., (~ ~.., C7 ~., L7 ~ C7 H ~ ,.E-~-~ ~ H ~ H ~ H ~ H
z~~ ~~~ z~~ z~~ z~~ z U r~ ~ U v~ ~ U v~ ~ U
A ~ ~U ~ ~ Wn ~ ~U v~
A ,~ ,-~ N

W ~o W r W ~d~ W ~n W ~ W ~
N

o ~ ~ ~ ~ oo n° due' o~o~ ~M
M M M
U
O O ° ~ ° .--~ ° ~ o0 ~ ~ ~ cn N d' ~ d' d' lD V~ M vD d' vD
U ~ ~ M M M ,,M.., .-,.M.,r _ O N ~ O ~ O~ o O~
o ~ '-"
N
O' ~ M ~ N N N
N N
O o ON1 o O o ~ o ~ o p ~ ~ ~ ~.-~ C1 d' N .-~ ~'' ~O
'Zt '-'~ O~ O d' d' O ~7 ~ M
d' ~ ,d' --i ~ N
O ~
O
~O

~O o ~ Q N ° ~ ° ~
~O O O ,r~ '~ I_~ O 01 ~ V~
w ?~ V1 V~ N M V-1 d' M d' M M
o N

O O ''nd' ~ .d ~ M
,.~.., ~ O

C3 o O \ O o O o O o O a O o O
O ~ O r' O ~' O "'-' .-a O '-' 01 O '-' .-r O "" O O
op O pp O ~ O r.., O pp O p~ O ~ O
O O O O O O O
' o ~ N o p U O O V7 O d' N due' N M
O O O - O
z~ ~~ ~~ ~~~ ~~~ z~
Wo ~ Wo ~ Wo ~ Wo ~ ~o~ Wo ~ Wo U v~ ~ U ~n ~ U r~ ~ U v~ ~ U ~ ~ U
A ~ ~ ~ ~ ~ we O w w w w w w w W o W ,--~ W M W O W N W ~n W ~O

o o vo ,.... ,-.
o ~ ~O ~ ~ ~
~ o oo M ~ N ~r V'l (V M ~ d' N ~

O 0 M p M
1 1 p M M M

U
Ct o ~ ~ o O \ ~ ~
~ ~ O
~

d ~ O N ,-~ M M O M v~
l\ M M M ~ V~ M

N M M lp M
M M M

U N ~--~

O O 00 O d o0 ~ ~ o ~ ~ O
N

O \ ~ ~ ~ ~ ~ l ~r V7 M O 0 ~ ~
Ci ~ ~ O M O ~ ~ ~ ~ N O ~ ~ M

O M M
N ~ N N ~ N

U -~ -as -~ ~
,- , ,- .-5 ~ ~ 00 O

o 0 0 ~

O M ~ N ~ d ~ M ~ M

N .--~ ,--, O C~ .-a ~ .-r M

M

r., o U

.p o ~

O ~
O

y Cj ~O O 00 O~
O O ~ W o ~
O O

N ~ ~ M ~ d.

N ~ p M o N O M N M o '- m -- m --i V o 0 0 o o a o o o o o \ o 0 o o o o o o 0 c~ ,-. ,-, .-. ,-. .-. o o O ~ O ~ O op O N O ~ O M ,-.
~

N O ~ O ~ O tn O pp O O O O O
r r pp O O O O O O O

N ~ 0 ~ 00 ~ d o d. o ~ ~ O

~, d 1 N M ~ '~h p U N M N M O M -~ M O
U O O ,-O

~ ~ H ~ ~ ~
~

H H H H H H
w~ ~ ~~ ~ w~ ~ wa ~ w~ ~

q ~ v ~ v ~ v ~ v ~ i ~ i ~ ~ ~ ~ ~ ~

ci~ U a ~ U ~ i r r g g A

p 0 0 0 0 0 0 C~
d W W W W W W W
~n ~D l~ M ~ O ~--0 0 ~ o 0 0 -i ~ N ~ M ~ ~. l~ '""' ~ N
M M V7 V7 M ~O
M M M d' M
p '~ O 01 ~ l~ ~ N
O \°O \~ \°~ \°~ \~ \O
y M (~ ~ M I~ d~ d' ~O vp ~"~ 01 ~ N
M ~i' ~ d' ~O I~ ~D ~O N V'7 ~ 01 M M M M M M
U N .~ ~ ~ .--i _. ~ o 0 00 00 t~ N I~
_O N \~ ~~ ~~ ~~ ~~ X01 ?~ ~ O d' ~ l0 t' D1 00 'off' O ~ 00 M
Ct ~D M 00 M N '~ O V~ d' ~n ~O o1 M V'1 ~--~ 01 M V1 U ,.N-a ,N-~ ~ ,.N-a O ~ \0~1 0~ o~ oOl~1 00010 0~0 M 0 M ~ ~ OM1 ~ Mp M ~ ~O
N
Ct ' o M
r" 0 0 0 0 0 0 00 01 0o d' N
..p ~ o ~ o ~ o ~ o ~ o p1 o pp O O ~ \ N \ ~ \ ~ \ N \ M
N ~ d' N M M M y M d' M M M M

N oo N 01 ~D O N Wit' N d' N
N ~ 00 M ~ M l0 ~ O ~ O \D
~H
V o o -o_ o 0 0 0 o.
O ~, o O o "'' o O o O o O o O o N
v a \ o \ o \ o \ o \ o \ o \ o p O ~ N O ~ N O ~ N O ~ N O ~ N O ~ ~ O
N
O O O O O O O
V o ~ 0 0 0 0 Nw O ° X41 °~~O ~ ~p0 \~~ \~ ~ \0~0 xG O O M M M M tM O t~ d' M O
O O O O O O
~N H r-I 1~I H e~ 1~1 ~Z~ ~~ ~~~ z~~ z~~
Wo~ Wo~°~' Wo ~ Wo ~ Wo ~ Wo ~ Wo A cn ~ U r~ F~ U tn ~ U v~ ~ U v~ ~ U m ~ U rn ~ U
A ~ ~ ~ ~ ~ ~ 00 U
d W N W v~ W I~ W o1 W M W oo W N

o x ,-~ o ° '..., ° ° ~, ° 00 o d o°v M M
_. 0o a 0 O O lp o M ~ ~ ~ 01 O ~ M ~ ~ 00 01 ~i' ~ ~O ~ ~O M d' M M M M M
U ~ ~ .--~ ..-a .-w--i p o _~ 0 0 O O 0~1 O
o "'r o '~ o o '~ 0 0 d~'M~ VO~1 ~O~OOd'MI~
N N N N N N
_ O o ~ o p o O o 00 0 00 O ~ \ ~ ~-.~ lp I~ ~ O M .-a N
MN~ 00d~ oMOMOm N
p ~
O \ pip ~ N
_~
~ O

_~ 0~1 o p c 0~1 c o1~0 ~ r, ~ ~p ~ 01 d' M d' 'n a, N
rr N
o __ _ d' l~ d' l~ N uM'1 O
V ,~ o ~ o o ~ o V ~, r..~ .-~ O O O O
Ci o O o O \ O \ O o O o O \ O
.-r .~ M , O O O r.., O O pp O O
-, O O O p~ O p~ O ~ O pp O pp O
O O O O O O O
_ _ M o QO
00 ,~ M
V ~ ~ d' O ~' M
p O O
H ~ H ~ H ~ ~ ~ H ~ ~ ~ H
~ z~
W p ~ W p ~ W o ~ W o ~ ' ~ O ~ W O ~ W O
U v~ ~ U ~ ~ U v~ ~ U v~ U ~ U v~ ~ U
O N
A pip ~ O O
O w w w w w w w N W M W N W d- W ~n W M W ~O W N

O ~ ~ ~ ~ O ~ ~ ~ ~ ~ ~
~ 0a oo n N M ~ tn N N o~o ~ ~ .-M

M M M M p M M
p M

U ,~ o \ 0 0 0 ~ O O O ~ ~ o CT O M 1p O N O 00 .--iM M O ~ t p \p N l~ O ~ 0 rt V~

~ p ~ ~ y ~

w ~ M M M M M M M
" -t ~

~1 N ~--a ~ ~ .-- m .-a .
U

N Ov O 01 a1 O

~O o ~ o o d ' v N

, -.

_ \ o 0 0 0 \ \ \ \
o O 0~0 O~
~

O p oo N N d' d' d' ~

tn otno~O p M ~ v~ ~O N

a ~ N ~ N .-~ N

~

~n N o0 ~ O
N

~ N ~ ,-r 0 0 o 0 0 0 \ \ \ \ \ \

"p o~ op op~p o~ o~ o i \ \

O ~ O
p O N ~ N M

"' ,~ M ~ ~ M ~ t ~ l~

o o 0 0 0 p 01 ~ d" ~D O O o O 01 O ~ 00 01 ~1 ONO
o N O~ O O ~ V1 'd' ~ d' ,~ 01 V' 01 ~ 00 ~n N N M

4~ ~ ~ V~ O ~O N M O p ~ ~
O '"'~ ,--~ .~ ,~ O O

V a c c c o c c ,N

.--i N
o o o \ o o o O O O O O O O

O O ,.~ O ..~O N O O O p~ O p~ O
~ N "~ .-r '"~ ,..., r.-i ~' ~' p O pp O ~ O tn O tn O ~ O \p O
p -~ , .~ O ~ a1 ~ O~ ,~ ~ '-w .

00 d p O O O O
O O O

'~

\o Wo o \~ \~
\o ~
o N N -~ ~ O ~ N ~ t ~ t~ ~ Ov O O
~ ~ ~ n N d V M tn M ~ ..-rM M i<1 d' N ~i" ~
O O O

H O O O O O
~ ~ ~ ~ t~

~ ~ ~ ~ ~ ~ ~

Z ~ z z z ~ ~ ~ z a O ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~
O O O O O O

N N

O O O O O O O

v _ _ _ _ W W W W W W W
M .-r O M ~ ~D ~

_ a\
O ,~'"" V'1 ° 01 V7 ° ~ ~7 ° ~ ~p o op ~. O ~.
C3 M ~ M M ~ ~ ~ M
p '~ 01 ~O 01 O O o 01 ~ W. 0 01 o O o O o 01 000 N d' r' ~ O M O m1 ~ ~O
v.~, ~ ~ M M M M M M
V N ~ .-~ ~--~ ,-, V o 0 O ~ o O o o0 0 01 0 01 0 0~1 0 01 r'~
N ~ I~ ~0. O
CS l'~ O d' ~, M M
N N N
_ 0 0 \° \°
O ~ o O o 0001 o O \ 0001 O O
N G1 ~ 01 M "1 M O M
-, ~.-~ N N
O _ o O
~D
~ N

U o o O o 00 O O O 00 ~ 00 ~ 00 N ~-~ 01 00 d' ~ M M M M N
V \ \ _ O ~ ~n \ O N_ 00 ~ 01 O off' ~1 ,..., O O O
O ~ o O o O o O o O o O o O o O
O V l~ p0 .-y1 00 .~ ~ .-,, N 00 r., M O r., M O ~ ~O O
V ~ O O M O
N N ~ M
N
O O O O O O O

y , o ~ o ~ ~ o O
~' ~ ~ N N
O ,M N M O Wit' O M
z z~~
U E~ U
A ~ ~o~ ~o~ ~o~ ~o~ ~o~ ~o~ Wo ~ ~ M
M M
O O O O O
v W M W N W oo W O W ~ W N W M

0 0 0 0 - o v \ o o ~ o N o ~ o ~ o N
O ~ 01 ~ ~ M~ N ~ N~ ~ ~ ~ ~ ~ ~ N O
N O ~I- O ~t ~ d' oo M
- ~ 0 0 0 0 '"' ~ ~p o0 O O
O O o O o O o 01 0 01 o a o O
M N N d~ WD ~fJ oo ~ ~n ~ d~
V~ O ~ o_o C~ d' t~ 00 ~D N h w ~ ~ M M M M M M
~1 U N ~ ~ ~ ~ ~--v .-a O ~ o ONO o O o 01 o Q1 o O~ o O
r'-' \ \ \ \ '-a ~.O d' N '~' l~ ~ ~O N ~ "'' Do ~t Ct N ~n .--~ V1 d. t~ d' l~ OWO d' M
U .N-as ~ ~ ~ ~ .-Na 00 M ~D
O O~ l\ d' r-., Vp ,~ l~ M O
C~ ~ 01 ~ ~ ~ O
~ p~ .-w .--a .--i N
o _o N o O
M pp O
~ N ~ M
C ~ r' v o o ~ o O O p~ M O~O O °O ,-~-r O
N ~ ~ M d' d' d' V~ d' M
rr o ro-r H
d' N OM0 ~ 01 0 1'\ d' "'~'' \O
N ~ O d, OOV1 N O d' O d' O
V ,N o 0 0 0 0 0 O 'v o O o .-a o O o O o O o O
v Ci \ O \ O \ O \ O \ O \ O
o ~ d. o ~ r, o ~ ~ o ~ ~ o ~ ~..~ a ~ ~ o ....r O O M O N O N O d- O ~ O
O O O O O O

N ~v 00 \ p~ p0 0 ~ p, o ~ 'p o 01 OO o O
V7 I~ ,..i V1 pp M
O ~ O ~ O ~ O ~ O M
w~ ~ w~ ~ w~ ~ w~ ~ w~ ~ w ~o~ ~o~ ~o~ ~o~ ~o~ ~o W o~ W M W .-~ W N W M W o0 _ O r ~ r ~

~ N

a a - \ 0 0 O
O

p O 0 0 ~ O

~O N ~ O ~ ~ lp M 00 p o0 V7 O ' v~ oo ~O N oo ~ ~D N v0 ~ v ~

M M M M M M
U ~ ~ ~--i .-r ~ .-w .-i o o _ o 0 0 0 O
\

O ~ o , N oo o ~ O - o o O
, O O~
o O

o ~-' \ \
~' -' O1 r ~ N r M ~ ~' N r N ~ N ~ N

a V ~ ~ ~ ~ N N

.- r r .r O ~ o o o o o o r ~ ~ ~ ~

N -~ N ~-r ~ ~--i 0., a ~n ~ ~n ,-.~ ~ .-r a a o ~ 0 M

~C a ~

o o o o c ~ p p ~
~ h o ,-~oy oo ~ oo ,.. r o ,n N
r ' ,-~ N ~ o O d' ,.-.

' d N ~O d r ~ ~
d _- -p> 0 0 0 0 0 0 x a r ~n O ~ M v~
r Ov O ~ O~ O~

N .-r01 O O r M O~ -r ~1 O 'O r '~ r '~ '~ '~' ' ~ d' '~' p) ~ N N ,- -~ ,.. o a .N ..~ ,~ -~ . ., 1~1 ~' r.1 1~1 1~ ~ 1~1 o N O O

w .-~ ~ M
a o o o ~ a o o O O O O O O O

N O O ~ O ~ O N O M O y. O
,~ .-, "a ,,~ .-~ r-.

O O O O M O M O M O M O M O
r-N ~ .-~ r1 v--1 v- W -r O

p O O O ~ Q

-- .

~ \ o r \ ~ ~ o~
r a"', O ~ ~' r ~ ~ ~ , ~ O
M M

V O ~ M r M ~ M O O
~ O O O

~ ~

z z ~o ~ ~o ~ ~o ~' ~o ~ ~o ~ ~o ~ ~o N N

N N N N N O O
O O O O O

O w w w w w w W W W W W W
W N a, ~ tr ~ v0 ..-r o ~ ,-~ o a' ov o °~ N \ o~, ~ \ ~ ,-, o o ,'~r, ~ ~ ~ i ~
O o - _.
~O \ O \ ~ \ O \ ~ \° ~
M ~ ~ ~ '-~ ~ p ~ V'7 ~ N ~D M
O 00 ,O~ l~ ~N, oo N l~ ~ ch ~ o0 M M M M M M
o -o 0 0 0 V ~ ~ ~ °~\, M
O ~ \ CT ~ 01 ~ Q1 \ O ~ Q\
0 0 0 0 '~ o rr ~O O o0 O 00 .-.i ~ O O
Gi .-r C~ Q1 ~O ~!1 ~O O ~!7 M
U ~ ,..N.4 .N-~
O ~ \ - 0 0 0 \° O \° ~ \° ~ \°
l~ ~ d' d' M ~ ~ O ~ N ~" ~ eMO
000 M O ~ 0~1 N O ~ ~ ~ 00 r~ p~ ".~ N r, N ~ ~-.r O
.O x _d N
o - o 0 0 0 \ \ \ \ \
o h o ~ o ~ o ~ o O O O N O °d. N N ~_ I~ h d' ;" ~ dN' ~n O <t M N ~p M N
o - o o 0 0 0 0 y oO~D100410oOo~_\0~01~~0 ,N ~ ~ ~D ~ ~ V-~. N ~O
O O "~ O .N-~
V o o - o 0 0 0 0 ,v~
O ~,, o O o ,-, o O o O o O o O o v CJ ~ O \ O ~ O ~ O \ O ~ O \ O
O ~ ~ O ~' Op O ~' ~p O ,r., 00 O "'~ ~p O ~' Op p "'' O O ~ O ~ O ~ O ~ O O O ~p O
O ~ O ~ O ~ O ~ O ~ O ~ O
V o o ~ 0 0 0 0 N w N ~ ~ 01 ~ ~ tn ~ 01 .-~ o Q1 N \ Oyn a l~ lp o v p o ~ ~ n N ~ o ~ ~ O c~yd r~

~N ~ ~ H H
H I-~-1 I-~i I-~-1 H ~ ~-~1 F-i A

0 0 0 0 o a woo woo w~o w~- wd- wo woo _ O \O p ~ \ \ ~ o ~ o r., o ~ ~ O O ~ ~

try ~ M ~ 00 N O et M d- V1 ~t7 vy ~,~~ M 'n ~ d' - N

op t~ t O O t , O ~ o O O \ o \ 0 o o o O ~ OQ~1 ~ ~ Q O

'N ~ M M N tn d' N t~ tp ~ ~D ~ M
00 Q1 ~O ~D t .-~ pp 1 ~ Q1 G

M M M n M _ M M
M

~

~ ~ ~ ~ ~ ~ O O

_O \ ~ ~ ~ ~ ~ ~
~

Wit' d' O ~D 41 M r., M
[y ~p ~ try ~ pp d~0d' O~O l~ d' l~

U ~ .-N-~ Q ~ .-N~

_\

o ~ o o o 0 p 0~1 p p Q1 0 00 ~ M V7 y D ~ V1 ~ M ~ ,O ~ M ~ V'1 ~ efi -, r, ~ .~ ,~ ~, , C3 O .-r .-a .-r .-~ ~ .-a ,-r o ~h ~1' O O O O O O O
~ ~ ~ ~ ~ ~

O o0 00 ~-. ~-, M O M O l~01 N ~ N d' O

M M _ ~O ~ N _ ~ ~ d' d' d.

N .-~ .-~ ~ .-r ~ rr ,-~

\ \ 0 0 CS O O O -~ M O
O ~ o ~ o o o o ~

p~ d' .~ v'y M d' N Q~ Lp O O 0o N ~ ~D

o t<, p M o ~ ~ Wit' ~ n ~t -., ,-.y ,-., .-..

V o 0 0 -- 0 0 0 0 O o o o o o o o :" O O O ,-.r O O O
G \ \ \ \ \ \ \
CS O O O O O O O

d' O 00 O O O N p .-.aO M O O C>
~' ~' ~' ~' "a Y"' "' tryO ~ O ~. O ,~ O o~O .-..~O t~ O
00 ~r 40 -i SO W G ,-~ tU-, ~O ,-t o0 ,.-a G? O O O O O O

..-i ..~ ,-~ ,-a ..~ .-.r -\ o 0 0 p~ \ ~ \ d. p ~,,_ ~ \ M o O O \ ~ Q1 C11 ~ ~ ~ ~ ~ N N ~ ~' ~ N ~

Vfl N ~ N ~ d ~ N d O O O O O O O

(;3 '~., ~", r'~.~ ',~ '~.~ 'fir '~.t ['~ ~U C'~ U~ CJ 'U

, 1-~-i H 1~-i ~ H H
L ~ ~
1~~1 W ~ W ~ W ~ W ~ W ~ W ~ W

A ~ ~ ~ ~ r~~ ~ ~
' ' U U ' U U

r U ~ U cs~U v~ tn v~

O N O Q O
A o0 00 0, o ~

<,,y V
d W W W W W M W W
N M tn ~ oo av o ~ <r ~ ~ O \ oV'o ~,,~ a oN, "~ o ~ ~ o O r., o oN, p, '~~ vQl., p~ ° O cM.y~ ~ '° ° ty°n M M
O
(~ Oo\O O V7 ~ ~ 00 (~ O 01 \p O ~--~ M o O \p d~ ~D ~ I~ ~ ~ ~~ I1 M O~ N o0 v N d- ~ M N M
M M M M M M
U N ~-~ .--r ,--i .r 001 ~ O
O ~ \~ \°O \°O~ \O \O
p ~ o o '-r o Ct d~° ~ O ~ O ~' Wit' ~ ~1' ~'' ~d' ~O ~O 'd' ~D
N N N N N
U '--.i ~ .--m-a O ~O l~ CT l~ N
\°O \~ \°OV \°01 \°01 ~l~ AGO
°v~ ~ I~ °.mn M O t~ O Ov O ~ Ov N ice. 000 ~D ~ d' O~n1 M O~nO ~n I~ i~ O I ~ M
..-m-.~ ,--~ ,-a ,--~ N
O O N ~ ~ ~ N
O
.O
_N N
o ~O o O o ~ ~ ~ o ~ ~ ~ ~ ~
N ~. ~' M O O ~ .~-~ ~ 01 pp M o0 N Ov N ~ iP1 V~ d' d~ M M M M d' l0 d. ~ d. ~!1 0 0 ~ 0 0 0 0 N ~ ~ ~ N~~ ~N o00 ~o~o oNo v ~ p ~D O~ d' 01 M Q ~O O l\ ~ ~ d1 M
O O ~ ,.-a .-.~ O
!~'~ ,~~' ~ r--I rr r1 ~ r-1 e-N
0 0 0 _- o 0 0 0 V ~N
O ~~ o ~' o ~' o O 0 '"'' o ~, o '"' o M
c~ ~ \ O \ O \ O \ O \ O \ O \ O
O~~ O~p~p O~p~p O~~ O~M O~~ O
~D 00 ~O ~D 'd' ~O 00 O O O O O O O
_O 0 o O ~ oo r, \ ~ ~ o ~ ~ a d O M ~ '-'~ lN0 ~' ~n N r. ~D ~O 01 \O
U U d' ~ N ~' N M O ~ M ~ M
O O O O O O
W W W W W W W
H ~ H ~ H ~ H ~ H ~ H ~ H
w~~~ ~~~ ~o~~ ~o~ wo A v~ ~ ~U v~ ~ ~ v~ ~ ~U ~n ~ ~ ~ ~ U ce'~ ~ U rig ~ U
A O O ~ N N N M
O O O O O O O
.-r ~ ~ ''r O w w ~ w w O W ~ W ~ w o0 N W N W W d~ W

0 0 oN
o x v~ ~ ° ~ d o "~ \ o o a Ov O ~p ~p ~p ~ooo ~O
~O N ~ N o0 ~ N ~ ~ ~ O O oo ~
01 00 O l~ M o0 M M N ~O
M M M M M
U N

O N

N ~p v0 pp M ~ t~ r.., O~
N oo ~ ~O y0 ~ ~D M ~n N N N N N
o o ~ c~ N
O ~ O.--~ ° p~ O o0~0 01 00 ~ O
N O,~ ~. ~ ~t v, p) ,.-~ .-r N
O ~

O
M \ o aC
CS . l\ ~-- ~ M
O O M o 41 ~ 0 01 N o C1 V' o O
V
N~ d~'"~NMd~'~t dN'd' N ~-~ ~ .-_ ~O o O N o ~ ~.-~ 0 O N N ~ ,.~.., due' ,.N-~
." ~ N ~ O O O
O Ci o O o O o O o O o O o O
O N M o .-, O O r,, ~ O '-, N O .--~ C1 O ~ ~D O °-, M O ~p O ~ O ~ O ~ O O O
r., ~!1 ~ ~p ~-' ~O '"' ~O
O O O O O O
_ _ N ~ O ° O~ l~ ° oo O
O ~ ~ ~ ~ N
O O O O
w~~ w~~~ w~~~ w~ ~ w~ ~ wo °' A
O O O_ O_ O O
U
W ~n W ~n W ~t W oo W ~ W vo o_ 0 0 0 O ~ ~ o ~ ~ \ ~ O o ~ ~ o ~ d, o ~ pp o 00 00 cT M N
o'-~o M ~ N O N oO~o d~ oNO d~ O vo o ~ ~ 0 0 0 0 y O O ~1 l~ N N
o O o O o ~ o ~ o O o O o O o O \ ,-, \ ~ \ \ \ ,-~ \ ~ \ ,-~
O
00 00 [~ M M ~ d~ M d~ N l~ V1 N l~ .--a V1 M d' d' M d' N N ~ d'0 M N N M d~ ef~
c~ ~ M M M M M M M M
H
V o o ~ 0 0 0 0 0 0 .-a O O O O O O O O
v~ o O o O o O o O o O o O o O o O o O o .--r \ .-~ \ ,-.~ \ H \ .~-, \ .--r \ ..-, \ .-~ \ .--r O O O O O O O O O O
M O M O t~ O N O 01 O O O ~ O ~ O V~ O ~D O
M ~ ~ ~ ~ H ~ ~ O ~ N ~"~ M ~' M '-~' N ~'' N
N N N N N N N N N N
H H ~ ~ H ~ ~ H
p ~ 0 0 0 O ooHp op~1 op o~ 00 0 V7 M d~ ~ LO ~D H H M ~ f~ N
v ~ ono M p N p d' ~ d~ ~ N ~ 'n H
N ~ N N
~-r .-~ .-a ~ H U'1 0 0_ 0 0 M o Od'o O o t~ 01 0 ~ N o ~ N l~ M t~ N t~ M
H
r" 0 0 0 0 0 o H a ~ o ~ o O o ~ o '~D O ~ o0 ~ O~ ~ I~ ~ O ~ O~
M M ~ N ~ N
H ~ H H ~ H
H

0) o ~ o ~ o O o ~ o °O ,-i ~ 00 ~ d1 M d~ M
M ~D N ~ N N d- .-M v~
c~ ~ ~ ~--r O .-r .~. ~ e-~ H '~r H r-~
0 0 ~ 0 0 0 0 O o0 l~ ~ N o0 o O o O~ o O~ o O~ o O o a1 o O o ,..~.~ \ \ \ \ ._.~ \ \ ,...., O ~t ~D O ~ oo O oo N ~n ~t ~n ~ M ~ oo M
O d~ M M O~ l~ ~--~ V1 ~O ~O ~-~ ~ O d' N d~
O O O O O O O O
W e~~. e~-1 e~-1 r~ e~ e~-1 v.-I v~l H
~_ O O O
v ~, vp ° ~ M ~ ~ O ~ o ~ \ ~ N a ~ ~ o ~M jN ~N pd~' .~-~d~~
O O O O O O
~A1 TN H H F~1 H H
H H H H H H H H H H
~~~~~Z~~z~~z~~z~~~~~~a~~Z~~z~~~
a ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W
A ~~~~~~~~U~a~~s~~~~~~v~~~~~~~~
o ~ 0 0 0 0 ~ 0 0 O ~C M ~ ~O ~C 01 ~ N ~ l~ ~ N Wd~ ~ o0 ~ M
C/Z d' C/~ ~1 CIA V7 C/~ V1 C/1 ~ V1 l~ C/~ H C/~ .-'~ C/~ r-i C/~ N

0 0 0 o p ~ o O o ~ 0 0~1 ~ o d. tn OM1 ~ \ O ~ o o ~ Ov ~ N 'n ~ ~ ~ M
M ~ M ~

" o O~ Q1 ~ O

N Cn ~n -~ O ,- W ~ ~ N
V 00 D1 00 Q1 O Gh ~ O
O ~

o ~ ~ ~
o N M ~ N M M ~ N ~ M l~ il~ N N
~D ~O

.--~ ~f' O O , O l~ M M t~ 01 t~
00 LD t~ d' d' d N N N N N ~n N
~

v M M M M M M M M
., 5 H ~ ~ ~ ~ ~ H
~

_ __ ~ 0 0 0 0 O O O .--~ .-1 O -a O O O
r~ O o O o O o o O o O o O o O o o O o O \ O \
\

O ~ \ r-a \ \ \ ..-r\ ,-a \ ..-i .-i .-i .-r r-~ ,-, ,-a O

O o 0 0 0 0 0 0 o N
1~ O ~ O tn oo ~ O d O M O M N O O
O O O

~ r., ,n ,~ ,~ .-, ,c~. op 4p , ~., '.., d. ,~ r, ... .-y , .. N N N N N N N N N N
~n , H H ~-1 e-W -i r-i e-i r--~ r-i e-w e~.' \. o \ ~ Q O O O

O
O a ~ ~

O ~ O ~ O ~ O O O O
O ~ ~ ' .

by O O v1 ,-~ M oo tr ~D t~ o0 M d Qv .- b N ~ ~ ~ ~ M ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ M
~ ~

v H

M ~ 00 ~ ~ 00 O N
M ~f7 O o o p ~ ~ ~ ~ ~ O Q O ~ O
~

" O O O O oo N
O oo \ d O \ N \ oo \
\ \

O O . ~ ~D M
V' N M V' ~. ~ N M
r ~? d y ~ .- ~ r y -~

07 e-~ e-a .-I -1 r-1 a--1 r-I

o ~ O ~ ~ p O O ~ O

~ l~ I'~ O H M ~D O 00 00 M

~ Ov C~ ~ 00 0 ~ O~ ~ Q~ ~ ~ Ov o ~ O~
0~ O 00 ~

py ~t M O d H N d- M oo ~ O ~ ~ N co to O ~t N M ~ M O O tn O tn y0 ~ tn N ~ M
~ d O ~ .-r ~ ~ ,-r ,-i .-.m-i .-r ~ ,-i ~ r~ .-~ ,-r p p ~ ~ ~ ~ p O ~ ~D 1~t H ~ ~ O~ O
~ ~ ~ Gn ~ ~ at ~ O ~ O ~ Q1 ~ ~ O
oo oo H O O O O 'r~~ O O O
~ M d- I1 o0 O H .-i O -~
d ~D 01 o0 O v~ ~ N
oo C 01 <t V1 ~ lp ~ C~ 00 00 M ~Pt 7 Ct 00 I~ l'~ d' d' O O Q O O O O O

-a .-t r-r H .-~ ~ .-y -r o 0 0 ~ O o _ o V

I~ ~ o ~ ~ ~ o M o Q1 m o ~ O o ~ OM1 ~, o O 41 ~ GT
o~0 01 O ~O ~ .-r try c~ tn ~ tp tp tp t~
d' ~ d' O O M d' M

U U d M M M M M ~ M ~ M ~ M ~ O N
~ ~

O O O O O O O O O

H

~ ~ ~ ~ ~ ~ ~
~ ~

H H H H H ~ H H
H H ~ ~ ~
~
~

~ ~~ ~z ~~ ~~
~z O W O ~ W ~ ~ W ~ W O v ~ W ~ ~ W
O W O W O O W
ue' O O

c ~ ~ F~U ~U ~U ~U ~
, E~
~
~

f~ U Ur~ c~ zr v~ rn r~ v~ r~
U U U U~
r~

H
p Q p O O O O O O O

U
~ d' ~ ~ ~ d '~
'ai M ~1 O ,-, o0 N , ~ N
a A V~ M VJ C/~ V~ I'~ C/~ C/1 C/~ C/) M M d C/~ d C/1 ~ ~O t~ 00 a o ~ o~ ~ ° ~ ~ °~ ~ o p D
O o 0 0 N M~ d'N d~'oMO dM'~
M M M M
p o 0 0 0 0 0 0 0 0 0 .-r ~ O O ~ O O ~-~ O
O ~ O ~ O o O o O o O o O o O o O o O o ~ O 0 O V7 O ~D O ~G O M O N O ~p O .-a O ~' O
N ,..~ N ,..., M .-~ p~ ~ ~p ~ N ~ tP~ rr N N N N N N N N N N
O
~ 00 ~ ~
"""
N ~ Q1 ~ pp ~ N

O
~O
r., 0 0 U
O O~ l~
O O o o ,..., V ~, M y0 t!7 O~ N , w ~ d 'd' due' N ~ V'1 N
N o 0 4>
Q ~ o ~ o ~ o p ~~ d, ~ N Q1 l N ~ d, N ~ ~ d.

,V 01 O ~ d' ~ a ~ 0 0 0 0 0 o~o~ ~M NM ~N
r~ ~ d' I~ 00 ~O d' O O O O O
o ~ ~ 0 0~1 ~ ~ ~ ,~ o U U O ~ O ~ ~~ M O V7 O O O O
I-~-1 F-~-1 I-~) 1~-i 1-~-I 1~-1 1~-1 I-~-1 I-~-1 ~ H
~~z~~~~~~~~~w~~zw~~za~~~~z~~z~~~
eye O
A Uv~.~U v~~U cr~~U ~a~Uv~~Uv~~Urn~Uv~~U v~~Uv~~
~, .~ N N N N N N N N
O O O O O O O O O O
0 ~ ~O ~ 00 ~ I~ ~ N W O ~ ,--~ ~ ~n ~ ~O ~ N d V7 r~ A V~ o0 C/~ Ov V~ N C/~ 'ct' C/~ d' c/~ V7 V~ ~D C/~ ~D C/~ t~ C/~ n o \ \ o 00 o d' 0 01 o O o ~O o 00 O ~ 00 p~ ~ 01 p' \ D1 ~ \ 01 ~ ~ 01 ~.,~
M
M M M M M
o ~ o_ 0 0 0 0 ~ o ~ 0 41 o O o ~ o ~ o O o 01 0 O \ \ ~ ~ \ \ \ .-, t~ N oo ~ ~ ~ N O~ d' O M M .-a dw0 N
--~ oo v_0 ~n O~ dwn N ~t d' a~ d' N I~ O d-M M M M M M M M

O ~ ~ N O O O O O O
v~ O o O o O o O o O o O a O o O o O o O o O ~ ,--~ \ r~, \ ~ \ .-r \ .-.i \ .-~ \ .-.i \ .-r \ .-i \ ~
~ O N O M O ~ O M O N O ~ O oo O m O d' O
tn .~ tn ~ p~ .--~ ~ ~ .-r ~ ~p ~ V7 ~ I~ ~ M
N N N N N N N N N N
~ o o ~ 0 0 0 'tt ~ ~ O~ ~ 0~1 O N Oy--~ ° , O ~P1 O ~ l~ M 0~1 ~ O
M ~ d' 0 ~ ~ M
5 ~ ~-i N N ~ N N
O ~
_~ '~ 0 0 N O ~ o Oy~ o 00 .p N N ~ N
r" 0 0 0 0 V
~O . ~ O~ 0 0~1 0 ~ o D1 O O M ~ d' ~ ~O
M ~!1 M
N Or d. ~O d. M M ~1 y p) rr n--i r-i 0 0 0 0 ~ ~ o ~a ~ M O~ N M d' Q1 ~O ~O
01 op M ~ ~ N ~ O Op d' p~ M O ~ M '"' O
O ~ O ~ p M ~ M ~ N ~ M ~ ~ ~ M
O O O ~ O
1.~ ~ ~ r-1 N r1 H ~ r-1 e-~ e-1 U .N ° 0 0 0 0 0 0 ~ o 0~1 0 01 0 01 0 01 o O o 00 0 01 0 01 o G1 0 V ~ \ \ ~ \ ,~
N ~O ~h o0 d' O ~ N d' d' l~ ~O N M ~n ~ ~ d' .-, oo N vW ~ ~n N M ~ d' ~n d' O I~ ~n t~ a1 d~
O O O O O d O O O
V o 0 0 ~ 0 0 0 0 0 ~ o ~ o ~ o ~ o ~ o ~ o ~ o ~ o O M ~ M '"" M ~ ~ O ~ 00 ,M_, ~O ~ C' ~ N
G U ~Y~ d'~ d'N Md' MN ON d'~ NM
,O O O O O O O O O
H ~ ~ H H
~~z~~~Z~~z~~z~~z~~z~~z~~z~~z~~z O °"W0 TWO TWO TWO TWO TWO TWO TWO TWO ~
~1 Uc~~UrsWUrs~~Ue~~Uc~~Uv~~Uva~U vaF-~Uva~Uc~~
M M M M M M M M M M
O O O O O O O O O O
U ~,,~
.-i ~ N ~ V7 ~ I~ ~ 00 ~ M ~ ~!1 ~ M
v-1 A cn o v~ o v~ o cn o rr~ o v~ o c~ ~ v~ .-~ v~ N v~ ~r o c c c c O ~ ~ ° O M ° ~ N ° ~ ~n ° ~ ~Y ° O~
M °yn ~--' ~ o ~. ,-y. 00 N M ~D M ~n O
0 0 ~ 0 0 0 0 O o O o ~ o t~ o ~ o ~ o ~ o ~ o O ,~ \ .--~
O ~-~ M M d' l~ o0 O ~ ~O lp ~ I~ 01 M l~
O M N d' M N ~ d' ~O l~ N W N ~O M N
c~ ~ M M M M M M M M
V ~ ~ ~ 0 0 0 0 0 0 0 O O O O O ~ O .-~ .-a O o O o O o O o O o O o O o O o O o O o O ~ .-a \ .-~ \ ..-~ \ ,-~ \ ,-~ \ ,--r \ ,~ \ ~ \ .--i \ ,-i O O O O O O O O O O
~ O O~ O ~p O O~ O ~p O t~ O o0 O O O O~ O d' O
M .-r [w--i ~ .~ ~ ~ p~ ~ y--~ ~ ~ ~ ~ tn N N N N N N N N N N
p ~ 0 0 0 0 ~ o p ~ON1 ~~ X01 X001 O .-r o 0 0 0 0 m o c'~n ~ ~ ~ m ~ °~n°
a ~t ~ ~n ,-, O
M
~M
G o o ~ ~ o 0 ~O d'c_~ Oc ~ Oc 0~1 \~ No M d' M M O ~O 'ct' M V7 N o 0 0 0 0 0 N
~O~O X01 X000 X01 ~O X01 oi~ d'0 ~~ ~M~ Ncn N 01 M O ~D 0 M ~ ~O
O ~ ~N-~ .-a V .N o o ~ 0 0 0 0 0 ~ o ,y0 M t~ O~ ~ O~ O 01 00 01 O o O~ 0 01 o C~ o O~ o Cn o O o 01 o O~ o O~ o O ,~ \ \ \ \ \ \ r, M N l~ N d' 01 I~ O ~O O M N ~ O d' O ~ d' 01 l~
0~
0o d' ~ ~n l~ N M ~ O M ~ dwn o0 .-~ ~O ~-~ ~O ~D N
N ~ ~ N
v~ O O O O O O O O O O
.--a ~
V ~ 0 0 0 0 0 0 ~ o O M o l~ O o 01 N o l~ M o 01 ~ 0 01 ~ ~ 01 ,_, 00 t~ I~ O~ ..'' O ~ V7 O M ~' M o0 O N O N p0 M O M O ~D O M
H ~ H ~ H ~ H ~ H ~ ~ ~ E~
~~z~~z~~~~~z~~z~~~~~z~~z~~~>~~
o °'W0 °"Wo ~'WO °"W0 ~WO ~WO ~WO ~WO ~WO ~'~
A U vy U v? ~ U vW U v~ ~ U crW U ~n ~ U vW U c~ F~ U vW U cn "'' 0 0 0 0 0 0 0 0 0 0 Ov ~ ~ ~ Q\ ~ ,-~ ~ N ~ d' ~ N ~ M
as ~~, ~~ ~o~ ~~ ~O ~~ ~~ ~M ~M ~M

o ~ o o ~ o r., N M ,..., O ~ O\ o ~ ,~ o l'~~ O o ~ O o O o ~ o O
0~0 ~' O N M ~ ~ ~ ~ ~ d.
C3 '~' M d' d' M M M
V ~ 0 0 0 'N O O ~ t~
O ~ O ~ O~ ~ 01 p o 0 0 ~ due' d0' ~ N M
M M M
0 0 0 0 0 0 0 0 ~ o O O O O O O O O O O
O o O o O o O o O o O o O o O o O o O
O ~ ~-~ \ ,-r \ ,-, \ ,-.a \ ,.-i \ ,.-i \ ,-. \ .-a \ .-r \ ,--i ,yes ~ M O N O (~ O ~ O ~p O ~ O O O \p O O O
M ~--~ Q1 ~ M ~ O ~ ~D ~ 00 ~ d_' ~-' N r"' O
N N N N N N N N N
o _o _o o ~ 0 0 0 \~ \~ \O \~ \~ \°~ \°O
'Z3 ~~p O oo l~ oo ~-a O ~ ~ O~ N o0 ~ M ~ N ~ M ~ N ~ d' p V1 ~ M
5 e~ N ~ ~ ~ ~--i ~ N

p ~ o O
~M
U o 0 ,.p ~ o ~ o ~ o O o ~ o Mp O O O \ O \ v7 \ r-r 00 \ O \ ,--~
N ~ ~ d. V'' M M d. 00 M M M
o ~ ~ ~ 0 0 N
\~ \°~ \°~ \°~ \°~ \°O
N ~ O M O d. N N O M ~ ~. Q1 M .--~
u~ .-~ ~ ~ .-a ~ O
,~ 0 0 0 0 ~ o O O o0 .-i N O
p O o O o o0 o O o O o 00 o O
r, \ r., \ \ ,..., \ ,~ \ \ r., d'N MO l~M VIM d'0 010 M ~ M ~ M ~ d' O V1 O O O O O O
V o o ~_ 0 0 0 N w N \ Ov O \ ~ N o O ~ o ~ ~ \ ~ ~ \ O
.0V d0' ON OM 'd ON OdM' C7 HCW.7 HC~ ~U ~U HC7 ~U ~C7 ~U NC7 ~~~~~z~~~~~z~~z~~~~~~~~z~~z~
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
~1 U vi ~ U v~ ~ U v~ ~ U vW U v~ ~ U v~ ~ U c~ ~ U v~ ~ U v~ F~ U
o° o °o °o °o °o °o °0 0 U
O ~M ~ ~~n boo ~o, ~~o ~c~ ~~r ~.-as ~~- ~~ ~~ ~~ ~~ ~~. ~~, ~.~ ~N

o_ o ~ o 0 O ~ l~ ~ Oy ° ~ ~t ~ IyD \ 0,.~ ,d, ~ ~ M
Ct '~' d' M M M M M
V ~ o ~ 0 0 0 0 0 00 ~ l~ N 01 O 01 V ~O \~ ~~ ~~ ~~ ~~ ~d \001 N M O M M O d' ~ ~ ~O 00 M ~ Ov N~ ~t ~ M 01 d' ~ M (T ~ 01 ~O ~ d' M M M M M M M
N '-I W --~ r~ H H
0 0 0 ~ 0 0 0 0 0 O ~ .-, O O O O O O O
v~ o O o O o O o O o O o O o O o O o O o O
O ~ ~ ,.-a \ r-.~ \ ~ \ ,--~ \ ..-~ \ ,-i \ ,-~ \ ,~ \ .--i O O O O O O O O O O
p~ O ~ O t~ O O O N O V1 O O O V1 O M O .-i O
Or ~ 01 ~ d' "'~ O ~ op .-..~ M ,-a M ~ ~~ ~ \p .-~ O ~ N ~-i V7 M V7 V7 ~ N N V7 V'1 N N N N N N N N N N
o ~ o O ~o~o~ o_~~~o Ov M l~ 'd' O M ~ '~h ~ d' N

O O o 000 p ~ pp O
M
~ O
.,~, 0 0 0 0 o ~ o ~ o ~ o O O ~ \ N \ ~ \ ~
0o m N due' Ov M O~ .~
-M-~ ~ ,-~-i q) \° \ \ ~ \°
0v N oo t~ l~
\°°° \~ \°~ \~ \~ \~
OM ~~ NN ~~ ~d~' ~c~n O O O
O .-, ~ .~-m--a ~ ~v t~ M O O 01 O ~ 0 01 0 00 o O \ O o O\
~ 00 .-~ O ~ l~ ~ N ~ O
N Ct N d' N M ~t d' ~t vD N v~
O O O O O

N ~, d' ° ~ 00 ° ~ tn ° o ~i ° o p~ °
~ pp ° 01 O '"~ ~ a1 d' M C~ l~ N V~ M
O M o d' O M o ~ o d' O d' I-~-1 I-~1 1-~1 1-~-1 1-~-1 1-N-1 H ~ H ~ 1-~-1 ~z~~~Z~~z~~~z~~~~~~~~z~~~~~z~~~a i ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A rra ~ U rn ~ U vW U va ~ U r~ ~ U cry ~ U v~ ~ U v~ ~ U v~ ~ U v~ ~ U
°o °o °o °o o °o o °o °o °o C Q~, N Q~, ~ ~ 00 ~ N ~C N ~ ~O ~ ~ ~ t~ ~ N ~ O
A C/~ N C/~ N C/~ N C/~ M C/~ d' C/~ d' C/~ V' C/~ V7 C/~ 00 Tfl 01 0 0 0 0 ~ o N o .--v o ~ ° .d. ° c'<1 0 l~ ° O
O ~ N ~ ~ O ~ ~ C1 ~ ~ d. \ O ~ \ ~ ~.,~ \ O
N ~ N M o N ~ N
~ M M d' M '~' M
V ~ 0 0 0 0 0 0 O ~O ~O 01 .-r V7 V'7 O
V ~~ o ~ o O o ~ o ~ o ~ o O o ~ o O
O \ ~ ,~ \ \ \ \ ,--i \ \ ~
~ dw0 M O l~ O Ov 01 dwn ~ d~ N ~O o0 d~ ~ M O V1 d' M N ~ M ~ d' 00 W
~ ~ M M M M M M M M
° \° \° \ \ \ \° \° \ \°

o O o O o O o O o O o O o O o O o O ~ O
-.i \ .-r \ ~ \ ,~ \ '-r \ .-i \ ,--~ \ .-~ o O O O O O O O O O O
[~ O 00 O ~p O M O d~ O ~D O ~n O ~n O 00 O 00 O
~ N N N N N N N N N N
0 0 0 \ ~ O
0~0 ~ o O o ~~~0 OO~ O~N~ OM o'~'o~ l~N
O ~ ~ N N
C~ 'D \ oho o0 ~ o0 N ~ M ~ N
.-r O
.p.0 o O~O \pN1 a D1 0 01,--ao O
O ~ ~ N N ~-, due. 01 IZ, ~t dWD ~t M N
-r .-m-, d' M
M
C~ ~ Op ~ p o O~ ~ O
N ~ O ~' ~ due' M
p ~' O ~--~ ,..., _ ~ M ~ O
0 00 o a1 0 01 0 00 o O~ o O o 01 o O
C3 \ \ \ \ \ \ ,., ~ \ .-.i N ~D M O O .--~ d' d' N ~D Q1 N O o0 M O~
O N ~ ~' N ~J' O O O O O O O O
rC' ~ o ~ o V o0 Ov N o ~-~ o N o V7 o O
o pp o p1 N o O ~ \ 01 ~ \ Ov ~ \ 01 N \ O
O w ~ N M o ~ m ~ Q N p ~ M ~V
O O O O O O O
~..~ C7 ~ C7 ~., C7 ~... C7 ~ C7 ~ C7 ~ C7 ~., C7 ~, C7 ~., C7 H '"' H ~ H ""' H '"'' H '"' H ''""' H '"" H ~ H '"''' H "' ~z~~z~~z~~z~~z~~z~~z~~z~~z~~z~
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A ca ~ U c~ E~ U vW U vW U c~ ~ U v~ ~ U vW U v~ ~ U v~ ~ U vW U
~wc ~ ~o ~o mo ~ vo °o o° °o o °o o °o °0 0 0 U
N ~ l0 ~ ~ ~ 00 ~C O ~ M ~ I~ ~ M ~ ~O 'Q, 00 C/~ 01 Cf~ ~ C/~ O C/~ O V1 .-i C/~ ~ C/1 ~ C!~ M C/~ ~h Cl~ ~

O ~ ~-a ° ~ I~ ° ~ Cv ~ ~ M ° o N ° ~ ~p o ~ d' pip d' ~ ~O ~ M
M M M M M M

U
O ~ ~ ~O ~ rr O
V ~ 01 o p 01 Ov o O o O
O ~ 1p ~ ~ N
..-~ V~ N d' ~ d' l~ d' ONO ~
~ ~D M M ~O M M
r'L.. t~ ,~" M M M M M M
0 0 0 0 0 0 0 ~ o O .-~ O O O O O ~ M ~ O
O ~ ~ O o O o O o O o O o O o O o O o O o O
O O O O O O O O O O
O O ~ O N O M O M O ~p O ~p O V'1 O ~ O N O
01 ~-~ M ~ M ~ M ~ N ~ 01 '"'~ d' ~"~ M ~ O ~i O
N N N N N N N N N N
O \ ~ -\ 0 0 0 O
O ~ o O~ 0 01 o O~ ~ t~ _ o o ~ 01 o G~
~~ M ~ Q1 M 01 ~ O N ~O ~ ~ ~ 00 d' O~
~ O
O , ,_, M M
~O ~ M
~ M ~p U o 0 0 ~ ~ o o p o p o ~ o p o p o O O ~ \ ~, M ~ ~ ~O ~ M \ r-r .-,, ~ r-a .-~
O M
N Fy 'O d' d' M d' d' tn d' M d' ~D M
o~ op~1 0~ 00 O ~ d' ~ l~ ~ ~ ~-w Q1 ~
~ M ~ Wit' O ~O
_ ~ ~ p O
," N
O ~ 0 01 \ ~ 0 01 o O \ O
N ~ N V~'1 ~~ N~ ~~ 0~0 O O O O O
o 0 V'1 °~ 01 M o 01 N ° 01 ~ o o ,_, 0 01 ~ o U U O ~ ~ M '~d' ~' ~ ~ O ~ ~1' d' .O O O O O O O
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A v? ~ U v~ ~ U v~ ~ U cn F-~ U v~ ~ U c~ ~ U v~ ~ U cn ~ U cn ~ U crs ~ U

G1 ~ 01 ~ d- ~ ~ ~C O\ ~ N ~ O ~ d' ~ ,-r ~ M
aA ~~ ~~ ~~ ~~ ~o~ ~p ~~ ~~ ~M ~M

0 0 \ 0 0 0 0 0 O ~ d' ° o r.., ° ~ d' ° ~ t~ ° ~ o0 ~ N o0 ~
'n N ~ ~ ~O
~N ~d~' ~~ o~oM ~~D pM o~od' (~N
M 'd' M M
M M M M
V ~ o o ~ 0 0 0 0 N h l~ 00 M O1 O
O O \° (~ ~ O~ 0 01 \ 01 0 l~ ~ 01 o O~
M ~ ~h ~D Q1 V~ M 01 ~O ~w~ ~ M ~D 00 N M O N ~ d' ~ d' N M ~ ~D O N
M M M M M M

O O O ~ O O O O O
o O o O o O o O o O o O o O o O o O o O
,~ \ ,-a \ ~ \ ~ \ .-a \ .-r \ .-a \ r-., \ ,~ \ ..
O O O O O O O O O O
O ~ p ~ O M O N O ~ O ~ O
N N N N N N N N N N
o o c 0 0 0 ~ ° o ° ~ I~ N ~ vo d~ N ~ ~ o00 ~ ~G ~ M ~ ~ ~ N
-i N .-a _CS ' 0 0 0 0 0~1 \ O ~ o M 00 M V1 '.'a d' N
_~ N ~O ~ l~ M ~ ~D
U c o 0 0 C3 ~ o O o l~ o N
O O ~D ~ O~ O ~ 01 O\ ~ 00 t' ~ 01 w ~ O N ~D d' d' M ~O M
o c o 0 ~ ° O O p1 N ~n due' O M oo ~n ,.-a p1 O
O
V , 0 0 0 o ~ o ~ o ~ o ~ o ~ o ~ o M l0 V'1 l~ I~ V7 ~ O d' M Q~ N ~O d' l~ M ~ N d' d' 01 h 00 ~ d' M ~ ~D
t~ 00 N d' I~ 00 o O O o O o 0 0 0 0 0 0 ~ 0 0 O o0 . 0~1 0 0~1 ~o ONo ~ ~p ~Oo l~Oo O ~0 00 U p M N oo d' o vD Wit' M d' ~ d' M N d' O o O O O O O O O O
z~ z~ z~ z~~z~~z~~~'~~z~
ego TWO TWO TWO TWO TWO TWO TWO TWO TWO TWO
A r~ ~ U v~ ~ U c~ ~ U r~ ~ U vW U w ~ U ~n ~ U vW U cn (~ U v~ ~ U
'"'' 0 0 0 0 0 0 0 0 0 0 O ~~r ~~ boo ~,-. ~~., d~ ~,.-a ~N ~~ ~,-.
a ~ C/~ M C/~ M C/~ M C/~ d' C/~ 'd' C/~ d' C/~ V7 C!~ V1 vm v~ ~

° \°
O ~O N
O ~ N o ~ "1 \ l~ O o Ov ~ 0 41 ,~, c p M p dwt ~I' M M
G ~ ~ -\ 0 0 ~O M V1 00 O O n O~ \ O o Qv o Q1 y ~ ~ O ~ N
~ M M M M

.-~ O O O O O O O O O
O ~ O ~ O o ~ o O o O o O o O o O o O
O ~ 0 0 0 \ ~ \ ~ \ ~ \ r., \ ~ \ ~ \ .--i t~ O N O d- O o0 O 01 O N O ~n O M O N O M O
p'J r-~ ...-~ .--~ pp r, p_p ~ op .--y~ .--i d~ ,_, N ,~~
.... c~ N N N N N N N N N N
-, .-~ ,-, ,-~ ~ ,~ .-i r~ .~.-~ .-..

O .~ o_ ~ ~ ~ o ~ o v ~ ON1 4'~ ~ ~ ONO due' 01 01' O dN' 5 p) ~ .-r ~ ~.-~ N

0 M o d.

U ~ o .D ~ 0 0~1 0 01 v o N ~ M d. O d.
0o O~ O N
o p~ o op o O o O
p ~ \ \ ~ ~ ~ ~ N .-, O d. 0~1 ~ ~-Nr d. O d.
O
_.. - 0 0 o ", O d' 00 O O \ O o 01 o C1 V 00 O d' M .~~ 00 ~D ~D ~ Cf V7 p O O

.--mY o0 N .v V~ \ p~ M ° 00 M ° O~ O o Q1 d. o ~ ~ \ Q1 .--~ l~ N
O O ~ O ~ d N O in m ~t M d~
O O O O O O
1-~-I 1-~-1 !-~-i F~~-1 I-HI ~ H ~ H ~ 1-~-I 1-1 I-~-1 ~~>~~~~z~~~~~z~~~~~z~~~~~~>~~~
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A v~ ~ U cn ~ U cn ~ U v~ ~ U c~ ~ U vW U ~n ~ U vW U v~ ~ U ~n ~ U

M ~ ~D ~ 00 ~ M ~ d' ~ 01 ~ 00 ~ O ~ M
I~ A Vl l~ C/~ I~ V1 l~ V1 01 CJ~ Q\ Cl~ 01 C/~ O C/~ ~ C/~ ~ C/~ M

o ~ o ~ o N o O o O
O ~ N \ O ~ \ O ~ \ 01 d. \ O ~, \ O
N ~ M p M ~ M ~ V1 M d' M M
H r~ ~--t e~ e--~

O O O O N O~ O~
V ~ o O o O o O o 01 0 ~ o ~
O \ ,...~ \ ,.-~ \ ~
M ~ ~ N ~ M ~ ~G o0 N
00 ~ ~ N ~ M ~ M O ~h ~ ~n M M M M M M

O O O O O O ~ O O O O
o O o O o O o O o O o O o O o O o O o O
O ~ \ ,-r \ ,.-.~ \ ,~..~ \ ,-r \ ,-, \ ,-.a \ ,.-i \ ,--~ \ .-, \ ~

N O ~ O O O oo O Q\ O ~ O N O oo O M O M O
O, Ci 'w--i e-.~ ~ ,~ rr N rr N ~ O .-v O ~ ~t ~ V'1 ~ 00 N N N N N N N N N N
O - \ 0 0 O d' O~ O
O .~ o ~ o ~ ~ o O
d0 t~ M ~ due' ,.-, ~
a ~ o O~ 00 ' o O
~M
w, -- 0 0 0 0 0 V
.D p N o O ~ o O ~ o ~ ~ o O ~ o O
w ~ M N M M ~ M d. N M N
p) ~ ~ .-a o O ~ ~ O ~ O~ \° O \ O
d' 00 d' M O ~ ~ V) ~ ~
t~ N ~ M ~' ~ O ~
O ~ O O
0 0 ~ 0 0 0 V ;~ O M o0 d' 01 O
O Ci ~ O ~ l~ o O~ o C1 0 01 o O
O ~ d' N ~ o0 ~O o0 l~ Qo I~ 01 00 d' 01 d' N N l~ d' l~ M h ~t lW O
O O O O O O
v--I r-1 r-1 e--r r-1 r~
0 0 ~ 0 0 ~ N
U O ~ N N M V M N M 01 O O O O O
H"" H'"'' E~~ H'r" ~~ ~~ H~ E~~ E~
~z~~z~~z>~z~~~~~~~~z~~z~~z~~~>
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
1 v~ ~ U v~ ~ U vW U vW U crW U v~ ~ U rn ~ U w ~ U vW U vy U
o °o o °o °o o °o °o °o °o U
~o ~ oo ~ a, d M ~ ~~, ~ oo ~ ov d ~ ~ ~ d a, I~ A C/~ M C/~ M C/1 M C/1 d' C/~ ~' C/~ V7 C/~ V'~ C/~ 10 C/~ ~O C/~ l~

0 0 0 0 o d o 0 O N M ~ N l~ O ~p ~p d.
~ ~ ~ ~ o o \
~ ~ ~ ~ ~ ~ O

am ~~ o~ ~M ~o ~M ~~ Dm ~

Ct ~' M d' M M M M d' ' G ~ o o ~ o ~

O ov oo N
O ~ 01 o O o\ 0 01 \ \ ~ N oo --~ O N o0 O V
N N

N d' V7 M V7 M d' I~ M

~ M M M M
M M

O O O O O O O ~ O O
o o O o o O o o o O o o o O
O O ~ O ~ ~ ~ O O
~ ~ y--i -r y-r ~

O ~ ~ ~ ~ .-~ .-r O O . O O
~ ~-r O O O O O
O

O ~ O lp 01 00 l~ 00 ~t t!1 l0 ' O O O O O O O O O
' "~ --~

W d' t~ l~ M rt M lr ~ ~ Q~ 01 01 3 ~ e-~ ~ .-i ~--y -~ ~ ~

M M M ~ ~ N N M M M
N N N N N N N N N N

00 N d' M o 0 0~1 ~ o o ~ o o ~ o ~
~ ~ ~

O mm o ~~ 0m ~~ M c~
.~o o O ~

~ M c ~ o O

N

O
~

-o y - - y e3 ~ 0 01 M
O 0 ~ O~ 0 0 01 o ~

O ~ .-~ a1 (\ O O
' O ' N
~

M M d M M M ~
M d 0o d' M N
O 0 01 0 o O\ 0 0 o O~
~ 01 00 00 O ,., i,~ 01 ~ M
~ M O M

O ~ O

G ~ c c c o 0 0 0 V ' ' ~O

. V 0o d M ~O N o 0 01 1 0 01 o 0 00 0 o o0 o I~ 01 I~
G~

O O O d' d' ~ O N l~ N M M
p~ .--~ h ~ d- oo N N ~n ~W O v0 ~ ~ l~ ~ ~t CS N ~n O ~ M dW

O O O O O O O O

.-r .--i ~ ~ ~ ~ .-r \ \ \ -0 M i ~ v r o ~ ~ . , N 01 N \ O ~ 0 M ~ O ~ o ~ ~ O~ o 01 a o \ O
~ 01 o0 I~ Ov , N N M ~""' N oo p~ O vp N N
O '-' ~ N M O N M M
'~ ~ M ~

c~ d' M d' N M N o O
U M

O O O O O O O O

rt .~-t ~ rr ~-r .-~

~ ~ ~ ~ ~ ~ H ~ H ~ H
~ ~ ~

H H H H H ~~~ ~z> ~z~ ~~~ ~z>
~~~ ~z~ ~~~ ~z~ ~z>

~'WO ~WO ~WO ~WO ~WO ~WO ~WO ~WO ~Wo ~Wo v ~ ~ ~ ~ ~ ~ ~ W ~
~ U U
F

~ U v~ cry rsa v~ v~ va rr v~
U v? U U U U U - U

O ~C ~ W O ~ ~ ~ ,--,WO ~
N ~n t~ 01 O

A C/~ Cf1 cf~ c/~ V~ C/~ c/~ C1.1 C/~ V~
00 00 00 00 00 01 O .-. N N

O C V~ ~ o N ° ~ vp o ~
~ d' ~ ~D

U
O M N ~ ~ N N
O ~O ~ ~ o ~ o ~ o ~ ~ ~ ~ ~ o ~
00 l~ N ~ d~ ~ N l~ l~ ~O O ~ ~-~ O N
~ N M M O ~~ ~N ~ ~ N ~N 00 (M ~O M d~
c.~ ~ M M M M M M M M
0 0 ~ o ~ o o ~ o O O O O O .-i .--i ~ O ~ O
V 5 o O o O o O o O o O o O o O o O o O o O
O ~ ~ ,~ \ ,.-i \ ~ \ ,-~ \ .-a \ ,-r \ ~ \ .-.i \ .~-r O O O O O O O O O O
~ O m O M O W O oo O O~ O O O .-a O N O Q~ O
r.,, ~--i O .-a N ~ 0o ~ M ~ M ..-~ d' ~--r ~i' ~--~ d' ~-, N ,~
V~ N d~ ~O ~O ~O ~D ~G v7 N N N N N N N N N N
-° 0 0 0 O ~ o ~-O-.i o ~ O ~ ~
M OM MO V1 C~ OW O~ON
N N N N
O
.p _~ 4) .p ~ o~ 001 op~p op~p o0 O O ~O ~ N °p\ d1 p°~p M ,°.~., N
O M M ~t N N ,d ~ ~ d' 0W' 0 0 0 0 ~ c 00 0~ op~1 000 0~ 00 N ~ ~O ~ 01 lp ~ l~ O Ov Q~ V7 l~ O~
N ~ l~ M r~ M ~ d~ ~ tn ~ ~~ N M
O ~N N
~ ~N
~N -.~ ~ 0 0 O ,V o0 ~t 01 01 ~O v--~ O~
o O o O o O~ 0 01 0 ~ o O o O~
,~ ~ ,..~ \ _ \ \ \ .r, pip (~y ~ M O ~ l~ ~D M ~ O ~O
O O O O O O O
o \ \ 0 0 N ~. V'1 ° ~ (w ° ~ O ° ~ O~ ° ~ 00 0 0~1 V O p M o M M d~ M l0 .-N~ N
o O O O O
-., ~, C7 ~ C7 ~ C7 ~..~ C'7 ~., U ~ C7 ~., C7 ~., U ~, U ~., C7 f~~ E~~ ~~ E~~ H~ E1~ H~ ~,~ E~~ H
~z>~z~~~~~z~~z~~z~~z~~z~~z~~z~
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
W n ~ U vW U vW U v~ ~ U vW U cn ~ U v~ ~ U vW U vy U ~ ~ U
o~ ~ o, av ~ ov o~ o~ o~ cT
0 0 °o °o °o °o °o °o °o °o N ~ ~t ~ N ~ a1 ~C ~ ~ r-~ r~ r~ r.-~
aA ~M
2m o~ o~°' ,--,o o \o°°, NO Ode NM
M M d0' V a o 0 0 0 0 0 O ~O O ~ M N Ov o O~ o O o l~ o O o O o O~
O ~ O \ \ r-r \ \ ,--i \ ,-, O ~ ~ ~n ~~ l~ oo ~ ,-a ~O Wit' O
~M ~V) ~M ~NM 01 d' d' r.~. ~ ~ M M M M M M
V o 0 0 0 0 0 ~ ~ 0 0 O O O ~ O O .~-~ O O O
o O o O o O o O o O o O o O o O o O o O
O ~ \ ,~ \ ,-~ \ '~.i \ .-r \ ~ \ ,-i \ .-.i \ ,.-, \ v--w \ r.a ~D O O O O O ~ O N O oo O ~ O N O O~ O O O
O ~ 01 ~-a ~ ~ .-a ~ tI~ .--~ O ~ N ,--i N ~ op ~~~~ p~
... 5 N N N N N N N N N N
.-. ~ ~ .-i ,.-~ ..-~ ,-, p ~ 0 0 0 0 O o ~ o O o ~ o ~
\ \ \ \
O .~ o o ,-~ o ~ o NN ~~ ~NM ~M
5 c~ N ~ N

4; O ~ \ G~1 M
v o 0 0 0 ~O o ~ o ~ ~ O ~ O
N ~ O M ~ N M ~ .-. ~ N
N' 0 0 0 N
SZ, ~ ~ 0~0 ~ O ~ O
N ~..WO M ~ O_ O
N ~ O M ~ d' N ft r V ,~ 0 0 0 0 0 0 0 o ~ o d1 o O o 000 0 0~1 o O o O
-, \ \ \ ,~ \ ,..., O ~O oo N O oo I~ oW0 ~ N ~--~ tT N
N
00 M l~ d' ~f' ~n l~ M ~ d' o~ d' 00 d' O O O O O O O

N ~, V7 ~ ~ ~~~ o ~ ~ ~ G~
O oo N O ~t N M
O O O
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
P1 vW U v~ ~ U r~ ~ U v~ ~ U v~ ~ U c~ ~ U cn ~ U vW U cn ~ U r~ ~ U

0 ~~D d~ ~o ~d- boo d~t boo dov a a ~ ~ ~ O C/~ N V1 N V1 N C/~ M ~ M C!~ M C/~ ~O C/W p N M O d' ~ d' C3 M OMO m 00 v--I H ri r-i O O O
O N ,-~ ,-~ h ~O ~O
U O \°00 ~O \°O \°01 ~01 ~h O N w h ~D O~ 00 ~ N ~ O~ t~
OMO M N d' ~ d' 00 M ~ M N M
M M M M M M
V o 0 0 0 0 0 0 0 0 0 O O O O O O O O O ~ O
U v~ o O o O o O o O o O o O o O o O o O o O
O ~ ~ ~--~ \ .--i \ ~ \ r-, \ .--~ \ ~ \ ~ \ ~ \ .--i \ .-, O O O O O O O O O O
rr O M O d' O ~ O ,-~ O N O ~n O N O O~ O O O
01 00 00 00 ~ OW--~ O_1 ~ O_W"~ O ~ 01 ~
N N N N N N N N N N
p p ~ o o ~ ~ ~ 0 0 \° ~ \° ~ \° ~ \° h \° ~ \° O
\°
d' V7 M 0o N ~ h O 01 N o0 ~ ~ O M ~h N
~ M ~ M ~ M ~ M ~ d' ~ d' O d' ~ d' '~ ~ ~ e-~ r~ .-a N .-w N O N o ~ O o h M
U o 0 0 0 .p ~ o ~ o ~ o ~ o ~ o O O N \ ~ \ d, \ ~ \ N
w ?~ ~O M lp d' O M ~ d' V1 O
A, d' M d' M M
p) r~ r-~ r-1 r1 r-I
0 0 ~ o N
fZ, ~ ~ O ~ 00 ~ O ~ ONO ~ 01 N ~ N M ,-.' N M N can ~-' ,.~- N
0 0 0 ~ 0 0 C~ h ~ O 00 0 00 o O~ 0 01 o O o O~ o ~T
,.~
O O V7 \G h M ~ ~ ~ N h 01 N ~ h d' V~ M ~ M ~O ~h d' d' 01 d' O O O O O O
0 0 ~ ~ 0 0 o O o ~ o ~ o ~ o ~ o O ~ ~ O~ O ~ ~ O ~ h M ~ 01 ~ ~ d1 ~ ~ 01 U G O M ~ M d' M ~ ~ O ~ N d' O O O O O O
H ~ H ~ N ~ H ~ H ~ H ~ H ~ H ~ H ~ H
~~~~~~~~~~z~a~~~~z~~z~~z~~z~~z>
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A vW U v~ ~ U crW U vW U v~ ~ U v~ ~ U vW V v~ F-'~ U vW U rn ~ U
,.., 0 0 0 0 0 0 U
~~1 r~n° ~od'o cn o ~o'°o r~° ~~ ~o ~

O~ O~ ~ ~\oNO ~o ~ No C~ f3. O~ '!~ 0 00 l~ O ~ o M M M
CS
0 0 0 ~ o o O o ~ o ~ o O o ~
O O \ ,--a M d~ ~ d~ O ~D ~ ~O oo t~
N d~ V1 d~ d' M d' M ~1~ .l~- M
~ M M M M M
0 0 0 0 ~ 0 0 0 0 0 O .~ O O O O O O O
u~ o O o O o O o O o O o O o O o ~ o O o O
O \ .--~ \ ~ \ r.r \ ~ \ .-w \ ~ \ .-~ \ ~
O O O O O O O O O O
~ O .-~i O M O vp O ~ O V~ O ~Y O O O ~ O N O
M ~ ~ ~-' ~ ~'-' O ~ O ~ ~O ~ O ~ O ~ O

a o °~ \ O
~~ M 00 O_ ~ M t°n d' [~ ~ M r°..~ 01 ~p 01M QM ~N ONId' 0~1M
~ N N ,--i (y .-~ ,~ ,-a O ~ ~ oNo M o0 ~M
~ a U o 0 0 ,.pp ~~ o ~ o p o pip O O M \ N
M ~ V7 M M O
N .-~ ~ ~i o ,.°\~ M d' 0) SZ, ~ \ 0~1 ~ O ~ O ~ l~ ~ G1 ° 00 lp ~ d~ ~ ~ M ~°r~
O l0 N M O M o ~t~ ~ M
Ci ~ ,.~, .~~ ~ ~ O
V .N o 0 0 0 0 0 0 0 O 01 N O o0 00 lp O o O o O o o0 o O o O o 01 o Q1 0 00 r., \ ,..~ \ \ ,-~ \ ,~
0o M ~ ~ oo O M N ~-a ~O l~ dWO O N O
N C OW O ow0 0o V~ d~ d~ ~ ~h oo ~' 00 W d~ d' w O O O O O O O O

o ~ o N o ~ o ~ o ~ o ~
01 ~ ~ 1~ ~ \ 00 O \ 01 ~ ~ (~ ~ ~ 01 O N ~ ~O °~ t~ ~ oo ~ M oo ~
G C) d~ ~ O M ~h M ,"'~ M N d' O N
p O O O O O O
.H
~z~~~~~z~~z~~z~~z~~z~~z~~z~~z~
~w ~ ~w ~ ~w ~ ~w ~ ~w ~ ~w ~ ~w ~.w ~ ~w ~ ~w ~~O~~O~~O~~O~~O~~O~~O~~O~~O~~O

do, ~~n ~o dM ~~ ~a~ d~ doo Via, ra A W o rn ~n cn ~ ~ Do c/~ oo v~ oo v~ oo v~ o, rs~ oW~ o, o O o 0 o~ o~ ~ ,--.° ~w° ° ~n°
0 M l~, N l~ M ~
C3 M M M d' O H H ~ H
0 0 ~ ~ o O 01 l~ I~ M .'-mn o ~ o l~ o ~ o O o O o 00 O 'O \ \ \ \ H \ .
'N ~ O 01 ~O l~ \D V~ d' ~ O ~ 41 M
d N M M N N d' M ~. M N V'1 M M
v 5 ~ M M M M M M
H ~ H H
V o o ~ 0 0 0 ~ 0 0 0 O O O .--i O O O .-~ ~ O
c~ o O o O o O o O o O o O o O o O o O o O
p ~ \ ~-r \ ,~ \ H \ .-, \ ,-i \ .~~ \ ,-.i \ .--i \ .
O O O O O O O O O O
V'1 O ~ O 00 O M O H O ~ O O O M O 00 O . N O
N N N N N N N N N N
-.a ,-., .-i .-~ ,-~ ,.-i ,-.a r, ,-~ ..-a O M O ~t O
O ~ ~ o ~ ~ o ~ H o O ~ o O o M ~ M ~ M ~ d' ~ M
~ N ~--~ N H ,~ H
C Ci H ~--~ H H .-, o N
M o O
~N ~N
H
H H
U ~ o .p ~ o ~ o ~ o p O O \ H \ ~ \ H
w ~ ~ N M M d' d' H H H
H ~ H
v' o N
p ~ o ~ _ o ~
o~oN N_~
N r-I
.c~ 0 0 0 0 0 0 0 V ,~ H ~D O ~' h .~-~ H
0 00 o OZ o O o 00 o t~ o O o O~
r., \ ~ \ r.., d' l~ I~ N ~ ~ ~ M O ~n t~ \O ~ M
0~0 M OMO N ~ ~D ~ 00 O~
O o o o O O O
H H H H H H H
H H
N WG ° ~ ~-'' ° ~
U COt N M MO M O ~ M Cf O O O O
~ r~ r-V H H H
E1~ h~ E1~ H~ H~ H~ E~~ ~~ H~ H
~z~~z~~z~~z~~z~~~~~z~~~a~~~~z>
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
v~ ~ U vW U vW U vW U vW U v~ E~ U v~ ~ U v.~ ~ U ~n ~ U v~ ~ U

U
~o ~~r ~~ ~,-. ~~ ~~ do, ~o dN ~c~
I~ A Vl N C/] N C/~ N V7 M C/~ M C/~ M C/~ M C/~ d' ~ <i' V] d' 0 0 0 ~ o d. c O N c ~ M c ~
M 00 l0 ~' d' O d' l~ N ~
N '~h ~n M M
C1 ~ M M M M M

v ~ 0 00 00 ~ ~ ov o ov 0 0 o d1 0 ~ o O o O o 01 0 0~ o o~
~o \ ,-, \ \ \ ,-, \ ,.-.
oo I~ l~ ~ M ~--~ WO O~ t~ cT O ~' ~h ~n 'ct N lp ~ ~D oMO d' . t~ 00 d' O~ v1 O~ V~
r'L., 5 .C' M M M M M M M M

O O O O O O
v~ o O o O o O o O o 0 o O o O o O o O ~ O
.-, \ ..-.~ \ ~ \ .--i \ ~ \ ~ \ .-r \ ~ \ r-, o 00 O O O ~ O V> O lp O ~ O N O ~ O l~ O 00 O
Ct °~ ~ ~D ~D ~O O ~ 01 ~ M ~ ~n ~ V7 r-' N N N N N N N N N N
p ~ o o 0 0 0 0 ~ \ ~ \ O \ ~
'~2 ~~ N M ~ M ~ ~ 000 M ~ ~ M ~ N
p~ M ~' op 00 00 N
C Ct ~ ~--~ .-~ .--i o O
O d' ~ m \ \ \ \ \
a ~~, ,°~ oo cn o 000 ..p ~ o O o p~ o p~ 0 0 o p~
O O ~ \ ~ ~ \ ~, V7 ~ M
.-r N N N
~v ~ M t1' ~ d' M d' V7 N V1 M
N o ~ 0 0 N
00 0~ 00 oOM1 00 \ ~-~ O l~ ~ ~O ~ ~-.r 00 ~ due' N d' N M ~ M
rr ~ O
v ~N - ~ o O 01 01 N ~ O M ~O
o O o ~ o ~ o O o O o O o G~ o Q1 -..~ \ \ \ ,..a ~ ,..~ \ r, ~ O a\ t~ oo N WO d' (~ d' ~ ~ t~ N ~
M l~ OD V') .--i 1p ~ d' o0 V1 o0 d' V~ V7 V'1 V7 O O O O O O O O
V o o ~ 0 0 N ~, (~ ~ t~ 00 \ O ~ ~ 01 d' ~ ~ N
O ~N Nd~n' .-~,O ~d~n NM
O O O O O
H "'' ~ ~ H '"' E~ ~ ~ ~ E~ ~ E~ ~ E-~ ~ E~
~z~~~~~z~~z~~~~~z~~z~~~>~z~~~~
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A c~~U v~E.~Urr~~Ucn~Ucn~U v~~UvW U ~n~UvWU v~~U
H N N N N N N N N M M
O O O O O O O O O O
U
0 ~ N W o ~ ~ ~ o ~.1~1 v» rn~ ~~ c~~ vm ~~ ~o'no ~~ ~o ~o 0 0 0 ~ o ~ 0 0 0 o o o O o o o ~' o o ~ o O ~ ~ ~ ~ O ~ ~ O M ~ ~ \
~ ..., O ~ ~ ~ ~ ~n 00 ~ ~ O G1 O~ ~n 01 d~ oo ,~ N , ,~ ,~ D ,.., N _ V~" o ~ o d' ~ '~ ~ v h M 'd' o M O o o ~
~ o o o , V

Ct M M d' d' M M M M M
' V ~ c c c o a c c ~

' v o \~ \~ \~' \~ \ \ \' ,~-~ ~r d' ~n v~ ~n vG ~
so ~ ~ ~ t~ oo om ~t v N ~ N M N d' ~ M
CI' rv ~O M N d' cr M M M
t~ M M M M M M M
.C' y.' N r-1 W -1 r-I r1 e-r v--1 V a c c o c o ~ c c c .-, 0 0 0 ~ o ..~ 0 0 0 00 00 00 00 00 00 00 00 ~o ~o \ ,-. \ \ \ ,-. \ \ \ ,-, \ o ,-. ,-. ,-. .~ .-i ~ p 0 O~ N M o0 N 01 O O o0 O~ O
O O O O O O O O O
-i -tn ~p \p N_ ,-, p~ O ,-. ,-i ., N
~ ,--i -~ -~ rr ~ ~ ,-i ~
, N N N N N N N N N N

0 0 ~ o ~ 0 0 O
_ O o o ~ ~ o ~ o ~ o o ~ ~ ~ ~ ~ ~

'ZS M ~ 00 1~ O~ O ~ oo y G
bp ~ N ,.-~ ~ ~ ~

N O~ ~0~ ~~ ~M MO~ ~ 0~ ONOM
M

a N 0 ,~ l O O 0 ~ --~ r, ,-m O ,--, ~ o ~

_ , c O
O

r ~ O
N

_ 0 0 ~ 0 0 ,.p~ op~p o~ op o~ o~

~ M '~ N Q1 ~ ~
M M ~ \O 00 d' M N 00 d' ~ ~ ~ V' M

N
O

N o 0 0 0 0 0 0 o o o ~ o o o ~ o ~ ~ ~ ~

O o0 v~ l~ N_ N ~ N
o0 ~p p~ M oo 0 e1 O
\O N ~ d' ~ dW
d' ~h d' .-r ~ O .-, N

,r ,--~ oo O~ ~ ~t N O o0 o O o 0 01 o o 0 o O o ~ Q1 t~ 01 00 M O~ d' ~ O~ O O ~n O~ O
N v0 O v~ v~ N

~~ ~~ ~N ~ ~~ ~M N ~~ ~~
~ ~

v p O .
O O p O O 1 O O
O O

W

V o 0 0 0 0 0 0 0 0 O d' M ~ o0 M N O N \ ~
~ O ~ ~ c ~ ~ ~ ~ ~

O M 01 ~O .-i O~ ,_, M N O l~
~ ~ O ~ ~ 01 ~ 00 ~ ~ ~
M

O ~ O ~ M ~ O O ~

O O O O O O

H I--1 1-1 t-i h-1 1-1 F-1 1-I F-1 h-1 ~~~ ~z> ~~~ ~z~ ~~~ ~~~ ~~~ ~z~a ~~~ ~z~
'" W W W W W W W W W W

~ O ~ ~ ~ O ~ ~ ~ ~
A O ~ O O O ~ O O O o ~ F~ W ~ ~ W ~ F~ ~ ~

v~ c~ v v~ c~ U v~ v~ c~ v~
U U U U U v U U U U

M M M M M M M M M M

H
O O O O O O O O O O

U

N ~ ~ ~ O ~C ~ ~ O ~ ~ M
A C/~ O ,-~ C/~ l~ a1 C!~ ~ C/~ C/~
O C/~ C/~ N VI C/~ ~ C/~ ~t -~ ~ N M d' _ O ~ d~ ~ ~ p~ \ O N ~ ~ ~ ~ ~ d' ° O M
.~ 00o m CS M M M M M M
V a o 0 0 0 0 0 0 0 l~ l0 ~--~ O ~ l~ O~
V ~O ~ ~ o ~ ~ O o 0 0 ~ ~ ~ o ~
C~ O v0 ~ ~ ~ ~n ~-~ ~n O WO M d~ N
N M N N N ~n ~ L~ N v~ ~ v7 N M ~M d~
M M M M M M M M
r V o 0 0 0 0 0 0 0 0 0 O O O O O O O O O O
O ~ O ~ O o O o O o O o O o O o O o O
O O O O O O O O O O
~ O N O l~ O vD O V~ O \p O ~O O ~ O ~ O tn O
Ct N N o0 00 N in ~ \O ~"' l~ ~~ r '"'' d~ r' ~p ~D ~ dwn ~n N N N
N N N N N N N N N N
0 0 ~ o 0 0 r, O
\° O \ O ~ O~ ~ O
M M l~ (V ~ G1~ l0 00 00 ~ V7 O M
~o~o'r o~o'D o~ o~o~' ~, o~ ~-~ ,--. N ~ ,-... ,-.
~ o y O
_N
r" o 0 0 _ o 0 0 V
CS ~ o M o ~ o ~-w o l~ o O~ 0 00 OV ~ N ,°~~ O,--~ M N O,-~ op N oo ~ I~ o N O
N M N ~ M M V7 ~'1 ~ M d' H
~' ~ o 0 N ,_, ~O
N ~ ~ ~ N N d~~
N ~ ,-~ N 01 .-.a O

U ~~ po\p \p ~ ~ 00 W
c ~ c ~ _ o O _ 0 0 0 O N O ~ l~ ~ 01 V~1 v~ V~ d' ~o O O O O
0 0 0 0 0_ 0 0 N ~, 00 \ 01 p~ ~ O~ ,d. o O~ o ~ o O o Ov o Ov 00 ~ '.-W~ M
U O O M ,-M~~' ~ 00 ~ .~M-' ~ N 'd d~ dOy M N
O O O O O O O
H ~ H ~, H ~, ~~~~z~~z~~z~~~~~z~~z~~z~~~Z~~~~
s ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A vW U vW U vW U v~ ~ U v~ ~ U c~ ~ U ~n ~ U m E~ U v~ ~ U v~ ~ U
f..1 M M M M M M M M M M
~D ~ I~ ~ O ~ ~ ~ O ~ V7 ~ ~D ~ C1 ~ .-i ~, .r A G~ d' Cf~ d' C/I ~ C/~ ~n C/W O C/~ ~O C/1 v0 CJWO ~ l~ C/~ 00 o~ N~o'r~,\~~o ~~\~~\~~\o~\~ o\°o ~ t~j ~ M ~ M ~ N ~ t~ ~ N ~ due' o M
MMd'd'cf~MM C' V ~ 0 0 0 0 0 ~ 0 0 0 O ~O N N O d' ~ 01 ~O
O ~~ 0 01 0 ~ o ~ o ~ 0 01 o O o ~ o O~ o O
O O \ \ ~-.~ \ \ \ \ r-, \ \ \ ..
w ~ t~ M N l~ o0 0o O~ N O Wit' ~n ~ Ov oo ~ ~ oo N
~ ~D ~ M O M O M ~ l~ ~ ~O ~ ~ d' N d' r'L., t~ ,L" M M ~ M M M M M M
V o 0 0 0 ~ 0 0 0 0 0 O O O ~ O ~ O O O O
o O o O o O o O o O o O ~ O o O ~ O ~ O
O O O O O O O O O O
\p O ~ O V7 O vD O (~ O ~ O V7 O \D O o0 O o0 O
j~ r., ~~ ,-, pp r, pp .--~ 00 ,--~ N r~-i N '.-~ N ~-r p ~
M M M M M M M d' N N N N N N N N N N
p ~ o ~ 0 0 0 0 0 O ~ o ~ o ~ o ~ o ~ o ~ o ~ o 2t ~pp 01 M V1 00 V~ p~ d~ t~ M l~ WO O
N ~ o~o~ OM ~N ~-~~N
~ N ~-~ N N N N N N
_~ N O O O O
~ O ~ p O ~ ~ O p [n O
.p ~ M~ d~N ~I~ ,n, M M U'7 ~!1 o ~ o o a ~ 0 0 ,.p ~ o ~ o ~ o ~ o ~ o O o ~ o ~ o ~
O O N N oo s0 0:i t~ O~ ~ O p r' N ,o.\-y0 00 00 ~D d' O O ~ d~
N ~ N d' ~. N M N V1 N dWD ~1 ~n ~ M d. M
~' \ \ o N
o ~ o ~ o ~ ~ ~ ~ O ~ a1 o o .~ o p~ 01 O ~O ~O O .-.~ 01 l~ d' d' ~ 00 N ~ ,-t~~ ~n N M O M O ~n N ~n ~ d~
.-m--~ .-, r, O
~5 ~ ~ 0 0 0 0 0 0 ~ o ,r 01 O O o0 01 ~~-~ O v0 01 M
O o ~ 0 01 o Q~ 0 00 0 01 o O o O o O~ o O~ o O~
r., \ ~, l~ O V7 O~ O N O1 ~ ~ N ~ 00 N M M ~O C~ M ~D O~
O ~D N M M ~ M M O l~ 00 (~ 00 ~D ~ rh O d' l~ M
~D 00 QO 00 00 QO I~ V1 O O O O O O O O O O
~-r ~--~ ~ ~ ~ ~ ~ ~ e-r o ~ o N o ~ o ~ o ~ o O o ~ o O
O M \ 01 N ~ 00 ~, \ 01 M \ O N \ 01 ~ \ O
O M M .--~ ~ O M O ~ O ~n "'~' u'~ ,.., O
U U N ~ M M d' M d~ N ~ ~ M ~ M N N M
~O O O O O O O O O
E~.,-~ CW.7 H C~7 H CW.7 ~ ~ (~..~- CW7 ~ C.W7 ~ CW7 ~ CW.7 ~ C,W7 (-N
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ ~ O ~ W O ~ W O
~1 v~ ~ U vW U rr~ ~ U vW U vW U vy U v~ ~ U v~ ~ U vW U vy U
H M M M M M M M d~ d' <t' r, r-~ O O O O O O O O O O
N ~ M ~ V'1 ~ I~ ~ 01 ~C o0 ~ 01 ~ O ~ 00 ~C ~~-~
A V! o0 Cl~ 00 C/~ OO V1 00 C/~ 00 C/~ 01 C/~ Q1 VI O Vl O G~ N

o \ \ a O ~ M ~ ~ N ~ ~ N ~ ~ 01 ~ o ,.-~ o N o~'o O ~ ~ Od'1 V~1 O O
CJ M M M M
o ~ 0 0 O M d' O1 O
V ,~ o O o l~ O~ 01 o O
d~ ~ oo vD l~ t~ ~ ~ oo N
M d' M N M N M ~o O t~
M M M M M
0 0 0 0 0 0 0 ~ o O ~ O O O O O ~ O O
O ~ O ~ O ~ O o O o O o O o O o O o O
O ~ 0 0 0 0 \ .-a \ r, \ .--~ \ ~ \ .-a \ ..-r O O d- O M O 01 O ~ O N O M O M O ~ O lp O
~3 O ~ o~ ~ DD ~-a t~ ~ 00 r.~ pp .-~ pp ,--~ pp ,-r pp ~ Op N N N N N N N N N N

~ \ ~ \ O
'Z3 ~pp ~ 0o l~ 01 d' p '~ l~ ~ M M
d O ~ O ~ O ~ O ~ 01 M
~N N N N N

O
c~ ~ M
~ ~ a v o 0 0 ,.p ~ o p o ~ o p O O ~ \ ~ ~ \ ~ \ ~
N ~ ~ ~ .-Ny ~O ~ N
~' o \ \ o N
\°~ \~ \~ \°o \~
dvo' ~ dv~' ~ 'V cOVy dot' ~ ~ O ~
O O O ~ N
C1 ~ 0 0 0 O O
O ~ o O~ o O ~ O o O
N ~ vp ~ O ~ m O O O O
V o 0 0 0 0 N w ,~ ~ 01 ~ 0 00 ~, o O ~ 0 01 ~ o O~
U O N N ~ O N ~ N N ~t O
O O O O O
~N ~ H ~ ~ H
H H H H H H H H H H
~z~~z~~~~~z~~~~~~~~z~~z~~~~~~~
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
v~ F.~ U vW U r~ ~ U cn ~ U vW U rn ~ U v~ ~ U ~n ~ U vW U rn F-~ U
H d' dwt ~t ~ d~ dwr d' d' I~ ~ N ~ ~D ~ oo ~ d' ~ ~n ~ ~ ~ t~ ~ N ~ ~n A C/~ N V~ M C/~ M C/~ M C/~ 'd' C/~ d' C/~ d' C/~ d' C/~ l!~ C/~ V1 N N O N ~ M ~ M ~ N ~ M
d~ M d' M M M M
o ~ o o ~ 0 0 0 0 00 V1 ~ 41 N o0 V1 ~!'t o ~ o ~ o ~ o ~ o ~ o ~ o ~ o ~ o WtwD d~ ~1 O ~ O o0 d~ ~ O M V~ N M M d' d~
0o N ~n N oo ~t v0 d' I~ ~n ~n M .-~ d~ N ~t ~O ~O
N
M M M M M M M M M

.-~i O O O .~-~ O O .-a o O o O o O o O o O o O o O o O o O o O
p ~ \ .-r \ .-~ \ .-, \ r, \ ..-i \ .-~ \ ~ \ .-, \ r-, \ .-, O O 01 O ~t O O O M O et O d~ O V1 O ~,p O [~ O
A, Ci ~ l~ ~n M N ~ N ~ ~O ~ ~O ~ ~ ~~ ~O ~-' ~D ~C N '.r ~ .-~ ~ ~ .-r .-~i N N N N N N N N N N
0 ~ o ~_ 0 0 0~ o 0 0 O ~ o ~ o ~ o ~ ~ ~ o ~ o ~ ~ ~ o '1~ ~~ 0 v0 O~ ~ ~t a~ M N N .-, oo ~ .--~ t~ N M
~ N ~ N ~ M ~ V7 ~ \O ~ N ~ M ~ ~t~
v .~
M
M
"" \° \° \° \° \°
o M o ~ o O o ~ o 0 O O ~ Q1 N \ 01 ~ \ ~ d' \ l~ \ G1 N d~ oo a\ O
N M M ~ M V1 N N M M
o \ \ 0 0 d o~ o~ ~0~1 ~0~1 ~n O ~t N M ~ O ~ ,-, °, t~ ~!~ l~ v~ l~ v~ N M N d~
O O O
o ~ 0 0 0 ~ ~ 0 0 ,r M oo d' ~ O O V~ d~
o O~ 0 01 0 D1 0 01 o O o O~ o O~ o O o O
,~ \ \ \ r..., \ ,~
~n d~ oo ~n ~ Ov O O~ ~-~~ ~ oo ~ O oo O N ~ N
O ~n O d- O N N M N ~n ~ d~ M N ~ d' O O O O O O O O O

N .v o0 0 ~ O~ \ 0~0 tn \ ~ ~ o ~ ~ \ ~ ~,,~ a 0~1 ~. 0 0~1 O N N d~D~ oo ,N-, d ~ ~ ,-N- ~ O M O 'd O O O O O O O
z~~z~~z~~z~~z~~z~~z~~~~~z~~z~
~s ~ W O ~ W O ~ W O ~ W O ~ ~ O ~ W O ~ W O ~ W O ~ W O ~ W O
v~ ~ U rr~ ~ U ~ ~ U vW U c~ ~ U v~ ~ U c~ ~ U v~ ~ U v~ ~ U v~ F~ U
d' d~ d' et d' d' ~t dwt 'd' U
M ~ \O ~ .-i ~ N ~ M ~ 00 ~ ~ ~ N ~ M
ra A ~ ~ v~ ~ vi ~ v~ oo v~ Do v~ Do v~ Do v~ a\ r~ o, rn ov o ~ ~ ~ °~ ~ o o ~ o ~ ~ o ~ 0 0 0 ~ d' p N p ~ p M
o ~ o U
CJ
M N 01 01 V7 d' h OW O N M t~ O O~
N~ ~MM Nd' d'M ~V' d'M lDd' 'd'M
M M M M M M M
V o 0 0 0 0 0 0 0 0 0 C) c~ o O o O o O o O o O o O o O o O o O o O
O ~ \ .-i \ .--i \ ~ \ ,...~ \ .~ \ .-r \ .-~ \ ,-~ \ .-~1 \ .-O O ~ O o0 O 01 O ~ O d' O ~p O oo O ~ O ~ O
N N N N N N N N N N
0 0 0 ~ o p O .--i M I~ N
\° O \° ~ \° ~ \°
O o .ø N '~ t~ l~ O 00 01 01 ~ M ~ d' ~ N ~ N ~ N
u~ N .-~ N .-a N N
a ~
o . ~ N o ~ l' \ O
N
M ~M
C) ~ o 0 ~ c O~O ~O ~ O~ O\ c OMO
d~'N uN~~M MN
N e-~ .-, N
N o ~ o 0 00 l~ 00 f~ ~ \° 001 ~ O ~ l~ \° 01 ~ 00 0~0 ~~~~N ~ NO
4) r, ~ ,--~ ~ N M
~N H ~ H H
0 0 ~ 0 0 0 0 0 N O 00 O I~ 41 O u'7 o O~ o O o 00 o O o O~ 0 01 0 00 o Q1 ...., \ \ ,-..~
~n d' ~ a1 ~ oo ~ M d~ M v0 O oo t~ N o0 ~ M ~ ~1 ~ M ~ ~O ~ M ~ ~ ~ N ~ M
O O o O o o O O
o ~ o 0 O ° ~ ,-~ ~ ,.o-~ d. ° ~ ~ ° l~ ~ ° Ov M
wD .-~ O
O O M ~ M O d. o N O M d' ~f' O O O O O O
~z~~z~~z~~z~~z~~z~~~~~z~~z~~z~
O ~~O
v~ F~ U cn ~ U v~ ~ U crs ~ U v~ ~ U v~ ~ U v~ ~ U w ~ U vy U v~ ~., U
~, ~t ~r ~n ~ ~n v~ ~n ~n ~n ~n C ~~n ~~ ~o, ~~ ~o~ ~,-. ~M ~~n ~~c ~o, a A c/~ O> C!1 01 Ci~ O C/~ N V1 N C/~ ~t C/~ tt C/2 d' ~ d' C/~ <Y

0 0 ~ ~ ~ o O ~ O~ ° ~ d' ° ~ l~ ° ~ O ° ~ M ~ h ~.
° O~
M ~ ~ ~ N M O O ~ N ~ M
C3 ~' M d' M M d' 'd' 00 .--W1 01 O h 00 O ~ O~ \° 01 \° G~ ~ O~ ~ O o 01 0 01 N ~D h ~ o0 d' M h oo ~--~ Cv ~
~N h ~ d' O d' ~ d' ~ M O M O d' v~'" t~ ~ M M M M M M M
V o 0 0 0 0 0 0 0 0 0 O .--i O O O O O O O
o O o O o O o O o O o O o O o O o O o O
-~ \ r., \ ,..r \ ~ \ ..-i \ ~ \ ..~ \ ,-. \ ,-..~ \ ,--a O O ~ O ~ O .-~ O d' O d' O V7 O ~O O (~ O 0o O
V~ <_t' V_~ d' DD ~ o~
N N N N N N N N N N
a o o ~ ~ o O ~ \~ \O oON1 00 0~ o~ \O
'Zy ~~ C1 \p N cf ~ lp ~ M r' M ~' M ~ O
~'d' ~M ~M ~M ~d' ~M
5 N N N ~ ~'-i .--r ,-a ,--.i a~
_~ '~ 0 0 0 ' 001 Ooh 01000 H
h ~ ~ M ~p d' r., 0 0 0 o pip o p~p o p p N ~ M N d°~ N M o0 :V o 0 0 001 , oO~1 0~ o~ o O ~ d' ~O M d' ~-i n!1 00 ~ O ~
N ~ O~ N O d' N M N M N M
.-, ,-.~ ,-, ,-i 0 0 0 ~ o ~ o 00 M O~ ~ O 00 ~-r M
0 01 0 00 o O~ o O~ o O o 01 o O o O
,..., \ \ ,~ \ ,..., p> O h ~ oo h t~ N O O o0 ~ V1 N ~O M Ov O~ h 00 d' M ~!7 ~ V7 41 d' 41 d' Q1 V7 01 d' W ~ O O O o o O O O
0 0 \ \ o oOh1 Oo001~,oOM1 hoO
O ~ ~ d. '~' ~ M O M O N p M
O O O O O O
H ~ H ~ H ~ H ~ H ~ H ~ H ~ ~ ~ H ~ H
~z~~z~~z~~~~~z~.~z~~z~~~~~z~~z~
a '3"W O ~ ~ O ~ W O ~ W O ~ W O ~ W O ~ W O ~ '~ O ~ W O ~ W O
A vW U vW U cn ~ U vW U vW U v~ ~ U cn ~ U w ~ U v~ ~ U v~ ~ U
o_ o_ o_ o_ o_ o_ o_ o_ o_ o_ V
' d' ~ ..~ ~ ~n ~' t~ ~ O d' ~-, ~ N '~ M ~ d~
V1 U1 c!1 ~n C/W p V1 ~O Vl ~O C/1 h C/~ h C!~ h V~ h C/~ h o ~ 0 0 0 -mn o o 0 O~ O\o ~~~ o oMO Mo0\°O
41 ~ 00 M o0 d' ~ M
O M M M M M
O O ~ 0 0 0 0 l0 00 00 O 01 U O ~ O~ \ G1 \ t~ ~ O ~ 01 00 l~ O O~ (~ d' M O N M
M N lp M 00 M o0 l~ ~O V7 V o 0 0 0 0 0 0 0 0 0 O N ~--~ O O O O O . O O
U c~ ~ ~ o O o O o O o O o O o O o O o O o O
O ~ o \ .-~ \ ,-, \ .--i \ .-i \ .-~ \ .-~ \ .-i \ ,--~ \ .--i O O O O O O O O O O
C~ O ~ O o0 O ~D O oo O O~ O t~ O O~ O N O O O
O 00 ~-~ V'1 ~~ ~ ~ O ~ I~ ~"~ N ~ M ~ d' .-~ M ~ M ~
N N N N N N N N N N
o ~ o ~ 0 0 ~ ° 0 00 p ~ oo °p\~ ~ N ~t ~ d. M o ~ N ~ ~ ~ d' ~ M ~ M ~ d' N N ~-~ N ~ ~ N
O ~

0 ~ O o~0 D\ ~
..O ~ ~' ~n N ~O
o ~ °~~. oo d~
o O O o O ~ 0 01 ~ \ 00 ~ \ O
MoMO ~N ~M ~N
rr :" 0 0 ~ ~ O
N
N
O
'N r-1 H
o O ~ 0 01 0 01 ~ O o O~ o O\
01 ,-~ N N ~ d' 00 ~ t~ 00 ~ M ~ M ~ I~ ~ V7 ~ N
o O O O o o 0 0 0 U
O o O ~ o O ~ o O ~ o O N \ O

U U N ~ 'ch M ~ ~ ~ M yD
O O O O O
H ~ E~ ~ ~ ~ ~ ~ H ~ H ~ H ~ H
~~'>~~~~z>~z~~z~~~~~z~~z~~z~~z~
ca ~ W O ~ W O ~ w O n~, W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A cn ~ U v~ ~ U v~ ~ U v~ ~ U vW U w ~ U v~ ~ U cs~ E~ U r~ ~ U vy U
H ~n ~ ~W un U
~O ~C v0 ~ N ~ a~ ~ O ~ N ~ d' '~ ~D ~ N
L~ A C/~ l~ V~ ~ ~l! o0 C/~ Ov C!~ Ov C!~ .-~ C/~ r-, C/~ ~--~ C/1 ~ C/] N

_ N
_ ~ \ o o ~ 0 0 000~1~OoOM1 O ~D d' 00 O~ N 00 ~O l~ M d' M
A, N M N 00 M \O d' ~O V1 ~O ~ M M
N d' M M M M M
V ~ 0 0 0 ~ o 0 0 0 0 , O O O ~ O .-i O O O O
o O o 0 o O o ~ o O o O o O o O o O o O
O ~ \ .-r \ ~ \ ~ \ .-i \ .-.i \ .--, \ .--i \ .-~ \ ~.-i p~ O O O ~ O ~ O M O ~ O N O M O ~t O ~ O
N ~ ~ ~~ O ~ O ~ 01 ~ Q~ ~ 01 ~-~ 01 ~ 01 '-.W O
r., t~ N N N N N N N N N N
\~ \~ \°~ \o \°~
~t 00 M ''~ d' N O M 01 ~ l0 O
N 0~1~ NOM NO~ NO~ O~OM
5 v~ 0) ~ N N N
a ~
O
.O
.," 0 0 0 0 O
O ~ \O o ~ N o 0~0 01 0 01 O o O
~N
0~., M
w y o O o O
NN

01 l~ I~ O l~
O ~ \ O~ \ 01 \° 01 \° O o C~
O o o _ 0 0 o~Od~' ~ 01~ ~~ O~o DD
W ~ O O O O O
Nw M~o Mo ~ ~~0~0 W O O N O ~n O M
z~~z~ z~ z~~z~~z~~z~~~~~z~~~~
a ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A v~ ~ U v~ ~ U c~ ~ U ~n ~ U vW U vW U v~ I~ U vW U v~ ~ U cn ~ U
0 0 0 0 0 0 0_ o_ o_ o_ ~N ~~ d~
as ~N ~M ~M ~M
22s 0 0 ~ 0 0 0 0 0 O ~C M °C Ov N ° 0 ~ \ 01 ~ ° O~ '~' ° ~ O
° ~ N o '_' o N v0 op l~ N O oo O oo ~ ~ dye M
,~ oo M O N ~ d~ G1 d~ oo N O M l' d. O d' O O o 0 0 0 ~ 0 0 0 0 ~n oo N O O M oo O
o O o ~ o O o ~ o O o ~ o ~ o O o O
O \ ,--~ \ \ ,-.~ \ \ ,-.a \ \ \ ~
O
Vy oo ~t ~n W d- oo dwo ~O N o~ oo ~n o 00 ,~ o~
~ M N ~t t d- ,d M m ~n M d~ ~ d~ ~ ~t r'L., va ,Z' M M M M M M M M M
V o ~ 0 0 0 0 0 0 0 0 O O O O O O O O
o O o O o O o O o O o O o O o O o O o O
O \ .-, \ .-~ \ ~ \ .-~ \ ~ \ ,--~ \ .-r \ ~.-~ \ ,-i O O O O O O O O O O
N O ~t O M O N O ~ O N O .-~ O v0 O et O M O
~ ~O ~ 01 ~--i 01 ~-~ C1 r' O~ ~ t~ '"'i M ~~ M ~ M ~ M .--i N V~ v~ vWn N N N N N N N N N N
o \ \ ~ 0 0 0 00 op o001 0~ ~ 01 O O
O ~~_ ~ '-a ~ '~ ~ ~ .o-r O [~ O op ~ ~ M ~ O1 O O
W ~-r 00 M ~ M ~ M N ~t ~ ~t 0., Ci C
O
.O
N N
o p ~ pip o Ot~ ~ 010 c O
O ,~, 00 'O O_ r, t~ ~O ~-' ~O
M M ~ M M M 'd' M
N ,., o N
py N o p~ o p~ o ~ o a1 01 ~ N O
O ~ M M ~ ~ ~ N N can ~ ~f' N d~
O N O N O
'"'' ~ o 0 0 0 0 0 0 0 O N ~O 00 O 01 O
o O o O o 01 0 o0 o O o 01 o O o O
,~ ~ ,-~ \ ~ \ r, \ \ r., ~ r, V N .--W' M ~O ~O O O O ~G ~O .-~ 00 d' d' O ~1 O
N
.-~ ~t dw~ ~t ~ l~ M O~ N oo ~n o~ ~~ v0 vW0 v~
y vo ~ ~ ~n ~ ~wc 0 0 ~ 0 0 0 0 ~N ~. N ° ~ l~ ° o O °_ ~ 'd' ° ~ vp ° ~ p~
o ~ 01 0 ~ O o or O N M O N 01 d' d' M V~ N ~ M O ~i' ,_M.., M
O O O O O O O O
H~ ( ~ H~ F~~ E~~ E~~ ~~ E~~ ~~ H
~a~W a ~ W ~ ~o,W ~ ~ W ~ ~ W ~ ~o-~W ~ ~ ~ ~ ~ W ~ ~ ~ ~ ~ W
ee ~ O ~ O u~ O a~ O ~ O ~ O u~ O ~ O ~ O ~ O
v~ ~ U v~ ~ U v~ ~ U cs~ ~ U v~ ~ U v~ ~ U v~ ~ U vW U ~ ~ U c~ ~ U
.-, .~ ,-. ,.-m--~

G ~d. ~~t. ~o, ~,-. ~N ~~n d~
as ~~ ~~ ~~ ~o~ ~o~ ~o~ ~,--~ C/~N C/~N C/~N

O~S' V~o~\,~ OO~r ~O°~\,r My--~ N~~ r~~ ~',°\~~ MOO\O
~ M ~ N ~ M ~ ~ ~ ~~ ~ ~p p o 0 0 0 0 0 0 ~ 01 01 ~--~ M 00 .-a p o O~ o O~ o ~ o O o ~ o ~ o O
O O \ \ \ \ ~
'N ~ N M N N r OW D ~ ~ N O r ~ 00 ~W_G d' o_0 v0 d' ~ M o0 00 ~D 00 ~O
M M M M M M M
V o 0 0 0 0 0 0 0 0 0 O O ~--~ O O O O .-a ~ O
O ~ O o O o O o O o O o O o O o O o O
O ~ o o \ ,--~ \ ,--i \ ,--~ \ ~ \ ~ \ .--~ \ ,--i N O G1 O o0 O r O o0 O r O ~p O v7 O O O ~ O
p .-~ ~n v~ M d' d' d' d' M M
N N N N N N N N N N

O ~ o ~ o Op~1 0 ~ \ ~ \° 00 ~ 01 ~ ~ ~ O
O ~~ r_ oo r O r n s0 0o O ~ N oo ~
~ M ~ M ~ M ~ d' ~ d' ~ ~O ~ M ~ M
p) .-~ ~ .-i .-a .-~ ~ ~ .-r Ci O ~~--~ ~ ~~-~ V~ V'~ .-r H O ~ o pNp ~ o ONO N ~ oN0 r ~''~ ~o ~ ~ M
\ \ \ \ \
°O O ~ l~
..Q ~ o r o N o 00 0 01 o r O O \ \ ~"~ r,, \ ~
U ~ ~ M ~t ~ ~ ~ ~ ~ N N
N
p) ~ ~ ~.-~ ~--i ~' 0 0 0 0 0 0 N
p~ ~ \°o~0 0 ~ \~ \°C1 \~ \O
O o r r ~ ~O ~ ~ N sp ~D ~
O M O ~ O ~ O ~ N M N
p w~' H e-1 e-~ e-r .--~
- ~ O 41 O M
o C1 o O o O o O~ o O o O~ o O o O
,.~ \ ,..,.~ \ \ ,~ \ \ ,~ \ ,~
p> l0 d' N dWD lp ~O V7 r N 01 M d' V'7 ~ M
v0 W O ~t O ~t N r N r r o0 0o v0 0o v0 O O O O O O O O
V o 0 0 0 0 0 0 0 N ~, ~ ~ ~ t~ \ ~ ,~, a o~0 ~ o ~ ~ \ ~ ~ \ O~ O o 01 O o O
v O OM NN dr'O dM'~ dM'd~0' M~ NdM' NO
O O O O O O O O
O ~ O ~ O ~ ~ ~ ~ ~ O ~ ~ ~ O ~ O
H
~~~~~Z~~z~~z~~~~~z~~z~~z~a~~~~z~
ca ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A v~ ~ U v~ ~ U cn ~ U v~ ~ U v~ ~ U ca ~ U v~ ~ U vW U vW U vy U
,..., r r r r r r r r ~ r 0 0 0 0 0 0 0_ o_ o_ o_ U
o0 a A Cl~ N V1 M Cl~ M C/~ ~t V1 ~n Cl~ V7 C/~ ~ C~l~

\ \

O o 00 l~ _ d' N o ~ 0 o ~p O
~ ~ o ~
~

l~ O d' ,--W O
O O ~ O O O ~, ~ ~ ~

M d d' d' d' d' V ~ o o ~ 0 0 0 0 0 ~ o 00 V7 ~D O\ 01 e-~ ~' O
o o ~ o o ~ o o o O~ o o o O
~ ~ ~ ~ O ~ O O \ .-.r \ ~ \ ~
~ ~

O O ~ ~ ~ M ~ t~ ~ ov 0 N dwO
w ~ ~O o0 o~ o~ 00 o0 ov ~
N 00 O 0~

~ t~. O N O ~ M O O O ~o ~ ~
vo d ~ ~ ~ t~ N

M M M ~ N N N N N M
M M M M M M M M

V c o o c c c ~ o 0 0 0 0 ~ ~
0 0 0 0 0 O o o 0 o c 0 o O
0 0 O O .. O O \ ,~
\ \ \ -. -.
\ \

.-~ \ ,-. \ \ ,-. .--. ..., ..- , , 0 ,-. 0 0 0 0 0 0 0 0 0 ~n v0 ~ O op O~ ~ O
N M O d' V~ O O O O
O O O

N n ,-, ~n ~n ,-a ,-, r, ~ ,--~ N ~
.-.m .-a ~ ,~ .-. .-~ ~--~ .-~

N N N N N N N N N N

,., ~

p ~ 0 0 0 0 0 0 0 0 0 o ~ o o ~ o 0 0 ~ o o o O ~ 0 ~ ~

l~ ~D ~O V7 ~D 01 M d' 00 00 .-~ N ~ ' ~ ~ M ~h ~ ~O d' .-a ~ ~O O ~O d ~O ~O ~O
M ~ ~ V1 l0 ~D
Q~ O~ 00 e-w ~ e-i V~ V~ V~ V1 o N O c O c d, o~p ~ c O

~
' d N d M

_ -V o 0 0 0 O o o o 0 o o ~ ~ 0 ~ ~
' O v 00 l~ ~O 01 V M .--i M 00 N .-~ 1 d' d' d' ~D ~ d.
N d' Q' ~ ~' d. ~ d.
~

N r., .-i N ~ ~--i ~' 0 0 0 0 ~ ~ o ~ o ~ o o o ~ o o o ~ O ~ ~

O ~ 00 O~ ~ M .-~
~ !7 O O ~ ~ I~ d' ~ O ~
~

O O p ~ ~

O

o ~ 0 0 0 0 0 0 0 0 V
.N 01 O O Q1 a O O o O 01 O O O

o 1 o o ~ ~ ~ ~
O~ o r., ,~.~ .-a M V~ ~D 00 d' ~ ~O l~ 00 O 00 d' l~ V7 V7 .-r O ~O ~ 01 ~
' ~

~ O~ O~ 01 N N N ~ N N M
~p ~p I~ ~O o0 01 ~ o0 t O
~ vo V~

~ ~p d' d' ~ ~n n n ~ O O
O O O O O O O O

0 0 0 0 0~ ~ o G ~ ~p ~ ~O O O1 O
0 01 ~ ~ ~ ~ ~ ~ M o 00 O ~ 0 o 0 ~

O ~ M ~ ~

O ~ M M ~ M M M
~ ~

O O O O O O O

H H H ~ H H ~ H H H

~z~ ~z~ ~~'~ ~z~ ~z~ ~~a ~~~ ~z~ ~~~ ~z~
W W

TWO ~WO ~WO ~WO ~WO ~WO ~WO ~WO O ~
~ o vW ~ ~ W W ~ v~ vW vW vW
U U E~ U U U
U

U v~ v~ v v v~
U U U

r '~ 0 0 0 0 0 0 0 0 0 O ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ l~
~

as ~ .-i N ~ O ,.-i N M n 22s c c a c c o c o c o ~ ~ o ~ ~ o ~ ~ o ~ o 0 0 ~ o ~ ~ \ o ~~ \ ~ M \ ~ o 0 o ° o ~ o ~ o ~ o ~ ~ m O ~t d~ M d~ d' d' d' d~ d~
°' 0 0 0 0 0 0 0 0 0 0 0 Wo 00 ,-. v0 ,-, ,~ N vW0 00 o ~ o ~ o O o a1 o O o O o a1 0 ~ o O o O ~O \ \ \ ,.-i \ \ ,~ \ .-r \ \ \ ,-i v»0 vG OW ~ d' OWD O N ,--~ d~ N m M o0 ~ l~ ~ l~
~ ~O .--m0 ,-~ o0 ,-, v7 N o0 N l~ N ~ N ~n N ~ ~h d~
N N N N N N N N N N d' M M M M M M M M M M

-~ N .-a O ,~ ,-.m--i O ,-w O
erg o O o O o O o O o O o O o O o O o O ~ O
.--i ~ .-r \ ~ \ ,-~ \ .-~i \ ~ \ ~ \ ..

N O M O ~ O (~ O oo O O~ O O O ~ O N O M O
N ~ N ~ N ""~ N ~ N '"'~ N T-~ M ~ M ~ M ~'~ M T'-~
N N N N N N N N N N
p ~ o ~ 0 0 0 0 0 0 0 0 O o0~1 0~ o~ oo~p o~ o~ op o~ o~ o p ~ ~ \ \ \ \ \ \ r, N M v0 .-~~ O o ~ ,-, t~ N ~n ~ M
~~4 N ~ .~~~~ ~ O ~ d. ,n ~ t~~ O~ ~O oW O ~ d~ ~ d~ O M
~D ~O ~D Ov 0o O1 01 ~ V~ Ov C CS ~n ~n V7 ,~ ,-.~ ~ ,~ .--Wn ~ -o N O M o ~ ~ o O l~ \ t~ ~O o .D
d- ~D O ~ d~ ~ M
r., - o 0 0 0 0 0 0 0 0 Ci ~~' oI~ oO 0M 0O o~ ON 0d' 001 0l~
0 o N N oo ~ ~ av ~ ~ o~ ~ \ O ~ \ o~ ~ \ O M \ o~ \ ov O ~ O oo O l~ ~O N
N ~ d'0 d~ d' M M d. ~D dNWn d' ~O V~ M V~ d~ ~ M
O
o ~ o o ~ ~ 0 0 0 0 O 01 l~ t~ 01 O ~ 00 o0 O~ o O o O~ ~ O~ o O~ \ O~ o O o 4\ \ 01 o h dwn ~ N WO o~ N N ~ Ov N O ~ N N M O~ ~ d~
~ d~ ~ d' ~ V7 0 l~ ~ ~n ~ ~O ~ d~ ~ d' N M
0 0 0 0 ~ 0 0 0 0 0 O ;~ V7 N .-y~ ~-.i ~ ~--~ O M o~J
C) C3 0 ~ 0 0 o O o ~ o ~ o ~ o ~ o ~ o O o CO
~ N N N d~ O~ ~O d- l~ d~ C~ ~ O v~ ,--~ ,.-~ N ~n ~ N
M l~ M ~O M l~ M ~O M 00 M t~ d~ 00 d~ l~ d~ ~O d~ ~n N h N ~ N ~ N
O O O O O O O O O O
o \ \ o ~ o \ \ o ~N ~. N ~ ~ .~-~ ~ O O o G~1 ~ o ~ .--i a ~ ~ o Wp c O d~ c ~ M c O d~ ~ d~ ..-a d. ~ ~ oo '"~ ,--~ M M M N M N M oo ,~ v~
U V M ~ M N M ~ O ~ ~ ~ M ~ M ~ M ~ M ~ O M
O o O o o O o O O o ~., U ~ C7 ,~ U ~ C7 ~., U ~., U ~..~ U ~ C7 ~..~ U ~., U
~, ~ z ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A vW U vW U vW U vy U vy U crW U cn ~ U ~n ~ U r~ ~ U rn ~ U
h",, ~ t~ 00 00 00 00 0~ 00 00 00 oo ~ 01 ~ O ~ N ~ M ~ ~n W O ~ t~ ~ o0 ~ O
,_l A rm o, v~ o, vi o v~ o vi o rn o c~ o v~ o v~ o v~ ,-i o ~ 0 0 0 0 ~ o O ~ O N Vo d' Q\ M M
~ ~ ~ ~ ~ ~ o o ~ ~ ~ ~ ~

~ N ~ M ~ N
M N ~ N ~

~

a M M M M M M M M

' ~ o ~ 0 0 0 0 ~ o I~ O~ 01 M M M N N o0 o o ~ o o ~ o o ~ o o O o O ~ ~ O~ ~ O ~ ~ ~ ,-, O1 ~ ~ ~ ~
~

p O \G ,-~ 'd' , .-~ V7 M 01 V~ V7 O\ ~ 00 N v1 V'1 v0 ~ M ~D M ~ M 00 N M ~ d' M
d ~O d ~D l~

M M M M M M M M M

o _ o o O o o o O o o O o O o O O O O O O

O [~ 00 Q1 ~ M ~ O O l0 l~
O O O O O -, O O O
-a -r ~ --, ~ l ~

a M M .-r M lp I~ t 01 ,-, O D
'r ~ . ~

N N N N N N N N N N

.-r ~ .-i ,--, r, ,--i ,-, r, p ~ 0 0 0 ~ 0 0 0 ~ o ~

_ O
O

O o ~ \ o ~ o o ~ ~ ~ ~ ~
0 ~ ~ ~ 0 ~ 0 .-.ro 0 ~ 0 .-a ~'p oo ~ ~O ~t d' dwn o V1 ~ ~ ~O WO
N M .-~ oo G O I~ ~
O ~1 00 o0 ~ .-yr~ N ~ N V N
Q1 M ~ y~ o0 O M .-i o0 00 O
~ 00 00 O t~

~ ~ ~--~ N ~ N ~ N ~ ~ N
N
~

L ~ ~n ,~ ,~ ,.~ ,-r ,~ r, a a 0 0 o ,N ~D _ M
O a ~ c c ~ 0M0 l~ ~

5 M lp N
M M
~O ~D

~
N

aC .-.
a w; 0 0 0 0 0 0 0 0 -"p opNp o~ o~ o~ o~p o~ o~ op ~ ~ ~ M o ~ ~
~ -, -O M ,_, 00 l~ ~ y p t~ N
O N ' O , p n ~- p d' ,..., N d, ~ ~I N M ,d. M V~ d' ~ M d d d p,, ~ ~ ~ ~ ~ O~ ~ ~ ~ ~ ~
~ ONO 0 01 0 O~ 0 O~ O

~

0o ~ ~ 0 ~ N O ~ N ~ ~
M N y~ 00 N M oo N M M d O N o o O
M ~ N M V~

a ,~ .~ ,-.
~

V ~ o ~ 0 0 0 0 t~ v0 N o0 ~n N Ov 0 0 O1 o o l~ o o O o 00 O \ O~ \ 01 \

r., r, ~n N O~ l~ C~ N a\ O
O~ O~ M O l~ t~

~ ~D ~ 0~0 0~1 i~
d d' M I\ d V lp O O O O O
S O
O

V o 0 0 0 0 0 0 0 0 N ~ ~ \ ~ ~ ~ ~ 0 ~ ~ o ~
~ ~ 0~1 0 o o 0~1 o O \
~ 01 l~ O a1 O
' . a1 N ~ N W n O 01 O M O ,-, x ~ O M N O '~ ''' vp O ''' d' '-C1 .-~ M N M ,--~ N M M ~ N M O
U M d M d N

O O O O O O O O O

a ~ ~ ~ ~ ~ ~ ~ ~ ~
~

E~ EH H H H E~ H
~z~ ~z~ ~z~ ~z~ ~z~ ~z> ~~Z~ ~~~ ~z~ ~z~

~'Wo ~WO ~Wo ~WO ~WO ~Wo ~WO ~Wo ~~'o ~Wo ~1 w v~ v~ v~ c~ v~ vW cn c~ cn ~ E~ ~ ~ ~ ~ U ~ ~ ~
U U U U U U U U U

,"., 00 00 00 00 00 00 00 00 00 00 O ~,-. ~~r ~~n boo ~~t dM ~o~ ~N ~v~ ~ov A C/~ C/~ (/~ C/~ C/~ C/~ C/~ C/~ C/~ C/~
~--~ ...a .-~ ~ N M M 'd' d "d' 00 .-~ N ~ ' ~ ~ M ~h ~ ~O d' .-a ~ ~O O ~O d ~O ~O ~O
M ~ ~ V1 l0 ~D
Q~ O~ 00 e-w ~ e-i V~ V~ V~ V1 - \

. o ~ o ~

' M _ 000 ~ dN' ~
O d' M
d' I ' M M M
M M

0001 0~ 00 00 00 O

~n ~ d' ~D oo o0 N w O Ov O~
O vp dw h d' M N M M M
M

V c a a o 0 0 0 0 0 0 V ~ O O
o o O o o O o o o O o o O o O O O O \ O -r O
\ \ \ ~
~ .--i O ~ ~ \ .-, \ \ .-~ \ .--i r-.i .
,-~ .-r ~

O O O O O O O O O O
C~ .-~ N oo p~ O ~ O Q1 N O M
O O O O O O O O

W O l~ t~ ,~ ,--~ N N ,-y p D ,-m _G
~ -a ,~ ,--i ,~-i ,--~ -w .-~

N N N N N N N _ _ N
N N

-~ \ o \ 0 0 O 00 l~ ~ O l~ d' O ~ \ O~ o 00 0 o p 01 00 d' ~ ~ ~ d' ~
N d' M

~ p~ .-, ~ ,--~ ~ N N

O M
o h ~M

.-r .O o o ~ ~

~t ~ O O
M ~. N
~' M M ~ M

N

O ~ 0 01 0 00 o O

' ' V~ ~ d O
d. d O

O o0 N Ov O O~

0 O o op ~ o ~ O ~
O O p~ o0 0 l~ ~h Vt M d' W 1' W M 00 N ~D v O
' N
M

-r M V7 M M M V1 ~p d ~!1 O O O O O O

U 00 ~ ~ o ~ o o p~ , ~ ~ \ ~
, 0 o 01 \
00 O O~

~ ~ N M
o" O ~ a M ~t N
N ~ M

v O d O O O O
O

.-i ~ ~ ~ rr ~ ~ ~ ~ ~ '~ ~ ~

~z~ ~
z z z ~ ~z ~~ ~z ~z ~WO ~WO ~Wo ~WO ~WO ~Wo ~Wo ~WO ~WO ~~o W W ~ W ~ ~ ~ ~ v~ vW cry U U U ~ U ~
U U

A U U v~ cr v~ cry v v U U

~ ~ ~ ~ W ~ ~ O ~ ~ ~ ~
~ N

a~ ~ N ~t ~n D oo ~

0 0 o c c N ,..., ~ 1D 00 O M
O ~ ~ ~ M ~ M
~
~ ~ ~

~ ~ ~ ~ ~ M ~ p M
~ tM ~ ~ ~

Ct M M M M M d' ~

o \ o O N ~n M

G o o o a1 o O ~ O\ O

M

01 d' l~
d' ~

N d' N M
u~ M M M M
~

0 0 0 0 0 0 o o 0 0 0 o p o \ ,-. 0 0 \ .~ O \ ~ O 0 \ ,-. 0 \ \ \ \ \
,-, ,-a ,-, ,.-~ ,--.

o 0 0 0 0 0 0 0 0 0 0 ~

O O .~ N l~ N ~ O O O~ oo O~
O O p O ' O O O O
' ., -i CS 00 00 00 ~ ~ d' <T .--~ M M , O
,--~ ~ ~ ~ .-H d ,., .

N N N N N N N N N N

O
~ o~ o~ o~ o oo 0~ c O p . ~ l~ ~ -~ .. ~n G~ ~
'Z3 op t~ -i M ~G O
by V~
~

N O d' l~ O~ Q1 01 I~ _ ~ V~ M M t\ M 00 ~O

N .-~ ,-r ,~ ~ ,.-r ,-r O

~t O

o o p o c p~
~ O

O M r' ~n ~O
O O ", ~h 01 ~ '-' '-' M N
M (~

O .d d.
'd \ \ \ \ \

N O N O o0 Sy \ G1 \ \ O \ \ 00 ~ p~ ~ O
~

Nd' O~~ ~M ~~ d'M

N ..., ~ O O N

O ~ ~

O
O o o o O \ \
~ ~ O O O~

W O d' ~ ~ N ~
N l~ O ~O

~ ~ ~ M ~ ~
t~ d' 01 N

O O O O O

~ o 0 0 0 0 0 _ ~n O l~ N O o p~
d' ~ ~ ~ ~ ~ ~
~ ~ ~ o ~

U ~ ~G O O M M _ O~
O d' t~ M ~I' V'1 M N O O O O O
O O

z~ z~ z~ z~ z~ z~ z~

~ ~ ~
W

~Wo ~Wo ~WO ~WO ~WO ~WO ~WO ~Wo O ~Wo ~

~ ~ ~ ~ U ~ ~ U W ~ va v~
U U U F~ ~
U U

A c~ v~ v~ r~ ca r~ v v~
U U U

00 00 00 a\ O~ Ov o~ o~ o, Q, U

O ~ ~ ~ d' ~ ~ a1 ~ Wn ~ N ~
V~ -, M C/~ l~ V~ O Cf~ C/~ o0 01 V~ C/~ O C/~ O C/~ ,~ N V~
01 01 O ,.-~ ~t o ~ M ~ °° oo ~ ~ ~ o ~ ~ \ o~ ~ 0 0 Od' O~M V1M Od. o0~i' M M
pj- - 0 0 0 0 0 0 G
v O d' O n 00 ~n o ~ o l~ o O o ~ o ~ o O
O \ \ \ ,-~ \ \ \ .-1 O ~W O ~ ~n o0 ~ ~' ~G ~O O l~
O N oo ~n ~n ~n dw0 M d' ~O d' M M M M M M
0 0 0 0 0 0 0 ~ 0 0 O .-~ O O O O O
0 0 0 0 o O o 0 o O o O o O o O o O o O
O ~ \ ~.-i \ .--i \ .-r \ ~ \ ,-~ \ .-r \ .-a \ .~ \ r, \ ,-.
O O O O O O O O O O
p O [~ O ~ O V'1 O ~O O M O ~ O ~ O lp O ~ O
pp ~-a pp ~ V7 ~~ ~1 ,.-~ V1 ~ N ~ N .--~ N ,~ N ,.., N .-r ~ a ,~ ,-a d' ~t d' ~' d' d' d' d' N N N N N N N N N N
p ~ o ~ 0 0 0 0 ~n o t~ ~ ,-< <°yn ,°.~ ~ o~
N O~O~ 01M ~~ ~M p V1 N r., N
.O ~ O d' l\
d' d' '" ~ N l0 w, o o - 0 0 0 0 0 \ \ \ \ \ \ \
op~p op~p o~ o~ o~ op o O \ O \ \ ~ ~ d' ~ O~ ~ ~-' 4'7 M d. N V7 00 M M O d. d. d. ~ N

N
\°~ \~ \~ \~ \o \°
t~ ~y N M ~ 01 ~ ~ ~ ~O d' ~ ~ t~
00 M N M o ~t ~ M N ~t ~ d' c~ ~ .-i ~ ~-.~ O .-m V o 0 0 ~ 0 0 0 V ;~ .-i N ~ 00 01 00 00 o O~ o C~ o O o (~ o O~ o O~ o O~
--~
00 .-~ oo O OWE O d' ~--~ ,--~ o0 o0 lp M ~ M M d' M ~ d' ~O <t' ~D N V7 O O O O O O O
V o 0 0 0 0 0 ~o O~O~o ~ ~o ~~0 010 ~~o\°O
O O ~ O O 00 ~D M 00 (~ 00 ~ l~ '"' U U ,-.y' ,.-~ M M <i' N M ~. d' N d' O O O O O O
z~~z~~~'~~z~~z~~~~~z~~z~~~~~z~
a ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
vW U vW U v~ ~ U cry ~ U v~ ~ U ~ ~ U cry ~ U c~ ~ U v~ ~ U v~ (~ U
O~ ~ Ov C~ ~ 0~1 N N O O
O O O O O O O O O O
O d~O doo <C,-~ d~n ~~D ~O~ ~,-a ~N dM ~~D
rr~ ~ wo v~ owe owe ov r~ owe o c~ o rn o ~ o 0 0 0 0 0 ~ 0 0 O x 01 ° ~ M ° ~ l~ ° ~ ~~ ° ~ ~-" ~ ~ ~
° O ~
~M p~pN Od' ~M
C3 ~ M M M d' M M d' M
V ~ 0 0 0 0 0 0 p ~~, W O N o0 ,--~ 00 V o Q1 0 ~ o O o ~ o t~ o O \ \ \ ,--~
00 ~-~ O ~ t~ Ov N v0 ~O N ~ d' N N ~D M M y0 ~ ~t N l~ Oyt ~ M M M M M M

O O O O O O O O O O
u~ o O o O o O o O o O o O o O o O o O o O
O ~ ~ ~-r \ ~ \ .-a \ .-a \ .-~ \ .-~ \ .-a \ ~ \ ~.-i O O O O O O O O O O
00 O o0 O p~ O ~t O V'1 O vD O t~ O lp O l~ O o0 O
N '"~ p_~ ~ p_~ ..-i ~ ~ ~ ~--i ~ ~ .-~ ~ pp ~ OO ~-a o0 .., 5 N N N N N N N N N N
p ~ 0 0 0 0 0 0 0 0 o~ 001 00 0~ ~O o0 00 001 "p ~ l~ N O .-~ ~ 00 O~ Ov d' ~ ~O V~ 01 ~ N 00 O ~ 00 ~ O ~ O N t~ ~ o0 Ov ~ l~ N
N ~--~ N N .-i ~ ~ ~-a _Ct ' p M
_~ N
~ p U o 0 0 0 0 op~p o~p o~ oOp o0 p p \ \ ~ ~ \ ~ \ ~ N \ ~
O NdO. Min ~d0.

01 0 0~0 o O o O~ \ O \ ~ \ O~
N ~O O ~h ~O '-' Ov N O~ ~n w1 N M ~n .-~
N ~O ~ N O ~n yt O ~n ,-~-i d' ~ M
O ~ O .-m-, ~ ~N
~ 0 0 0 0 0 0 0 0 a1 N ~O O~ a1 O 00 p a ~ o O o 00 o O~ o (~ o O o 01 o O
-~ \ \ \ \ ,...~ \ \ ,~
M O ~O l~ M o0 00 01 d' O ~ N d' N O Ov ~N ~M d~.''n ~I~ ~ V~ ~N

.-r O' o Q1 ~ o O M o ~ l~ o O O o O V~ o O O o U ~ N l~ ~ N ~ 0 M dN' M N 4'1 O d' M M
O o O O O O o U ~ C7 C7 C7 U C7 ~, U ~ U U ~ C7 H ~ ~ ~ ~ ~ H ~ H ~ H ~ H ~ ~ ~ H
~~~~~~~z~~~~~~~~~~~z~~z~~~~~z~
c~a TWO TWO TWO TWO TWO TWO TWO TWO TWO TWO
A vW U vW U cry ~ U v~ ~ U vW U vW U c~ ~ U v~ ~ U v~ ~ U cry ~ U

O ~~ ~N d~n ~~t ~~o ~ov d~t ~av ~~ boo a I~ C/1 O C/~ M C/~ M C/~ 'ch V1 d' VI d' C/Wn cn ~n rr»c vwo o~

o ~ o o ,-. o o~
0 0 0 0 ~ ~ o 00 a, 0 00 O O d' d' d' d' M
M M M M

V o 0 0 0 0 ~ 0 0 0 0 O ~ O O O O O O O O
U o O o o o O o o O o 0 0 0 ~
O O O ~ 0 0 O
~

..-i ~ ~ ~ ~ ~ .-w ~ ~

O O O O O O O O O O
~p 0o O ~ O ~D t~ t~ oo G~ N
O O O O O O O O O

'~' N ~ ~ ~O
~ ~

N N N N N N N N N N

O
~

O M
O

N

NO
et N , y .
O

_N
N

~O \ O
~

O
,~ ~ o0 N ,., N

N

O

C~

N
O

,r O ~n O o0 o o o o o ~ ' d- N M ~ O~ O Ov O~ O

y ~f' d' d' ~ ~O
~ M N ~O ~O M

O O O O O

o o ~O O~ O

~ M ~ ~
' l\ N
M

U O ~ ,-, ,..., M

O O O

.N H N

~~ ~ ~~ z~ z~ ~~ ~~ ~~ z~ z~
~

~z ~ ~ ~ ~ ~ ~ ~ ~ ~
~ Z ~ ~ ~ ~ ~ ~ ~ ~
~

~w ~.w ~w ~w ~w ~w ~w ~w ~.w ~w o o o o o o o o o A ~~ ~~o ~~ ~~ ~~ ~~ ~~ ~~ ~~ ~~

o O o o O o 0 0 0 U

N ~ ~ ~ t~ ~ ~ N ~ ~ ~ ~ ~
A V~ M ~O V~ ~ C/~ N M V~ N
O C/~ C/~ ~ C/~ M C/~ Vl Wit' CiWO
r, ,--~ N '~t ~' o ~ oo ° °~ ,-, ° °~ d.
o m M M d' M M
a ~ ~ c o_ O ~ o ~ o ~ o ~ o ~ o O o O
O \ \ \ \ \ , N t~ ~ ~D N N ~ ~ M O M ~
O~ ~D ~ d' d' ~ '~' l~ M o0 M M M M M M

O ~ ~ O O O O O O O
o O o O o O o O o O o O o O o O o O o O
.-~ \ ~-, \ .-, \ ,-~ \ ,-. \ ,-, \ ..-. \ ~ \ .~ \ r-..
0 0 0 0 0 0 0 0 o o O O ~ O ~D O .-a O t~ O O O .-i O O~ O O O N O
CS ~ ~ ~ ~ ~ ~ ~ N ~ M ~ M ~ M
N N N N N N N N N N

o O o O
O ~ M ~O

~ a ~ N ~ a1 o O
<J. o c O \ Ov O ,~, 00 N O pp ~O ~.
?, M ~ ~ M ~ V7 O
a>
O ~ o Q1 0 00 ~ O ~ a1 M ~ d' O
O
\°
01 M O~ 00 O~ O~ O
O "' o Q1 0 01 o t'~ 0 01 o O~ o Q1 o O
r, l~ o0 0o O Q1 O O ~ ~n M l~ N Wit' ~t ,y ~ y0 ~ ~ ~ d' Oy0 ~ d' ~ l~ ~ l~
O O O O O O O
e~ ~ ~ W --i e.r e-~
\° \° \°
U p~ d' ~ d' O Q1 ~ 0 01 M o 01 O \ r' M o I~ ~ ~ O~ ~. 0 01 ~. op N r, O ~p ~p oo pp I~ ~ Ov U O d' V~ M '~t' r., M ,~ N ~--~ d' N 4'~
,O O O O O O O
~w~~~w~~~w~~w~~~w~ ~w~ ~w~ ~w~ ~w~ ~w~
~e ~, O ~, O ~, O ~, O ~, O ~, O ~, O ~, O ~, O ~, O
A cn ~ U cn ~ U c~ ~ U vW U vW U c~ ~ U cn ~ U vi ~ U cri ~ U rn ~ U
E,.r ~ N N N N N N N N N
O_ O O_ O_ O_ O O O O O
V r~ ~ ~ r~ ~ ~ N ~ M ~ .-~ ~ N
Wn ~ O ~ ,-~ ~ N
Cfl ~O Vl O ~!1 O V1 N Cil M CJ~ M C/~ M C/7 d' C/~ d' C/~ d~

O N ~ N d' M
~ ~ ~ ~
~ ~

~ ~N ~m ~N o~oM oMp~
N

o M M M M M
o o ~ 0 0 0 0 0 0 l~ O O1 O
V o o ~ o o O o o o 0~ o ~ ~ O \ ~ O \ O
\ \ \
-..

o \ \ \ ,~ .-.i , ,..-.

O O M .--m1~t O~ ~ v0 ~
~ N N M dW N

~ oo N d' t~ N oo t~ N N ~ N
N oo o0 c~ M M M M M M M M
~

0 0 ~ o 0 o n o 0 0 ,...,O .--~ .-~ O ~ O O O O
o o ~ o o O o o o O o o O o O O O O O O

O ~ \ ~ \ \ .-~ \
~ ~-r .~ ,-a M '.-a M ~ O V1 lp l~ 00 O O ~
O O O O O O O O

,..., d. ~. ~. d.
,~ ,_, ,_, ,..., N N N N N N N N N
N N N N N N N N N N

O

ue' N
M

_ V1 o ~ o <t ~

..O pp N N
~ d' Do ~
N O~ N M
t~ ~p M M

N

C~ 0 0 0 0 (~

M ~ N

N

O

N

c o 0 0 0 ~

M t~ I O M
O ~ 01 ~ ~ 0 00 o O O~ 00 O

0 0 0 _ ' ~ ~

I~ d' <f M M
d' ~D M
DD

O O O O O

V o 0 0 0 ~ o O ~ ~ ~ N M O O \
~ ~ ~ ~ O
~ ~ _0.., ~ ~ N , N

V ~ M ~ .~ M M
~ M M

O O O O O O O

~--i r1 ~-i !N 1~'1 r-1 ~I

~ ~

H ~ H H ~ H H H H H
~ ~ ~

~~~ ~ ~W~ ~W~ ~W~ ~W~ ~W~ ~W~ ~ ~~~
W~ W~

0 a,, 0 0 0 0 0 ~, ~ O
0 ~, O O

~,~ ~,~ ~,~ ~,~ ~,~ ~,~ ~ ~ ~~ ~~
U U m U v~ U U
U

cn v~ v~ v~ ~n v~
U U U U A

N N N N N N N N N N

O O O O O O O O O O

l~ ~ N ~ ~ l~ ~ ~ ~ ,-~ ~ ~ ~ ~
~O Ov O N ~a'1 as O ~ N o ~ ~p °~ 00 d. o ~ ~ ~ O
ll\O d. O d. ~ M O d.
M d' M ~1' _ ~ 0 0 o O o ~ o O o ~ o ~
O \ ~ \ \ ,-, .-r ,~.~ d' 00 OWE ~ O I~
~D V7 V1 00 M N d' M ~
p> d' N ~O d' N
M M M M M

O O O N O O .~ O O
o O o O o O o O o O o O o O o O o O o O
O ~ \ .-r \ .-r \ ..-a \ ,~ \ .--~ \ ~ \ .-~ \ ~ \ ~
O O O O O O O O O O
N O M O 00 O ~ O p~ O O1 O M O o0 O 00 O O O
N N N N N N N N N N

o Od'0 o O
~'0 vd''s '~ d. d. N d- dN' .-i .-~ N
a ~
CI ' ~ o O
~O ~ ~ ~ 00 ~ ~ O
N ~ ~ M
o 0 0 U
.p ~ o p o ON1 o O
O O 01\~-~ O\_ V7\, d' M V~ d' d. M
N
o ~ 0 0 O ~ \~ 0 0~0 V700~0 pp00 l~ 00 N M _ N ~ N d' 01 d' O d' O ~h \° \ ~ \°
C1 ~ 00 ~ V1 O
O ~ 0 00 0 01 0 01 o O
N C3 l~ ~ 0~1 dN' ~ <h ~ V~'7 O O O O

.y ~0 0~1 O\0~0 ~o ~ Oo 00 01o O
O M d' N d' 00 M N ~f. M ~.
O O O O O
~, O ~., U ~..~ U ~., V ~., U ~ O ~ C7 ~., C7 ~., C7 ~.., C7 z~ z~ z~~~Z~~z~~~~~z~~z~~z~~z~
~w~~~w~~w~ ~w~ ~.w~ ~w~ ~w~ ~w~ ~w ~.w~
~, O ~, O ~, O ~, O ~, O ~, O ~, O ~, O ~, O ~, O
A r~ ~ U vW U v~ ~ U ~n ~ U v~ ~ U c~ ~ U vW U ra ~ U vW U vy U
N N N N N N N N N N
O O O O O O O O O O
o0 ~ O ~ O ~ ~-, ~ M ~ Wit' ~ ~O ~ l~ ~ N
a A r~ ~ ~ ~ v~ oo ~ 0o v~ oo w oo v~ oo v~ oo cn a, v~ o, o~ ~ ~ oW~ o ~ ~ 0 a ~ , , ' N

Od 01M OM O

CI d' M d' M

o ~ 0 0 O O O O I~ O
0 0 0 Q.

0 0 0 o ~

y 0 ~n O N M ~D
~ d' ~

~G ~ M N ~ M
~ ~ M

ry M N M M M
t~ M
~

0 0 0 0 0 0 ~ o ,~ .-.
o0 o0 o0 o0 o0 o0 o0 o0 o0 o0 o ~ y ,-r y y ,-.iy \ y ,~ y \ .-. y ~ ,.-~ ,.-~ ,~ .--. .-i ,-.

O tf~O l00 l~O ~O 00O 01O OO V1O MO

O O ~ ~ ~ ~ .-~ ~p n ~ M
~ .-i ~ ~ ..-~ ~O ~--m ~O ~
Ct ~ ~ ~D ~O 'd' l~ l~ I t O N N N N N
N N N N N

O ~ o ~ ~ o ~ o o ~ ~ ~ ~
~

'ZS ~_ ~_O N ~ l~ N ~ M l~
~ O o0 o0 M O O M
V ~h N

~ ~ N O ~ ~ o ~

N N N ~ N N
0>

a ~ ,~ .-, ,-~ ,~ ,.-.
c~

O~O N
o ono pp M
~n a\

M M

Yv o 0 O

p o o ~ ~ r ,. p , \ o O ~
p M cMn 0~

0. ~

' o ~ sc N 0 \ 00 O \ o \
o ~ M .--~ ~
~ M M
~

O O N

, O 01 O l~ l~
o ~ C1 o o Q\ ~

O
~ ~ ~ ~
N

~O ~ l~ O1 d' d' ~

O O O O O

0 0 0 0 o a ~ ~, ~ N \ ~ lp " \ c c ~ c o ~ ~ oho ~ 01 ' N ~C oo N -~ O
a ~ o ~

o d M M M d .
v~

,~

~ ~ W W ~ W W W W W

~., ~ C ~... ~, ~ ~ 7 ~, ~., ~., C ,~ C C C C ~ C C C C

H H ~ H H ~ ~ H H ~ H ~ ~ H
~ ~ ~ ~ ~

~z~ ~z~ ~~> ~z~ E ~z~ ~z~ ~z~ ~~~ ~~~
~z~

~WO ~WO ~Wo ~Wo ~WO ~WO ~Wo ~WO ~Wo ~Wo ~ ~ ~ ~ ~ ~ ~ U ~ ~ U ~
U U U

A c~ v~ ~n m v~ ~ m cry v~ v~
U U U U U

N N N N N N N N N N

O O O O O _O _O O_ _O O

U _ _ _ _ O ~ ~ ~ ~ ' ~ ~ ~ ~
~

~ 00 oo 00 M d ~O O ~n O
l~ C/~ V C/~ C/~
' ' V

A C/~ C/~ C/.1 C/~ Cf~ C/~ M ~ d 7 O\ 01 O ~ M M d O ~ O ~ O N o ~ ~ o ~ M o O
r.,' D1 d' 000 M 01 M l~ d' M M M M
e-i r~i CV1 ~t o - - 0 0 O . ~ 01 G O ~ 01 \ 01 0 01 0 l~
O o NM N~ ~M ~dN
M M M M
V o 0 0 0 0 0 ~ ~ 0 0 O O O O O O O ~ O O
o O o O o O o ~ o O o O o O o O o O o O
O ~ ~ .-, \ ,-r \ ,~ \ ,-r \ .-~ \ .-~ \ ~ \ ,.-a \ ~ \ ~
O O O O O O O O O O
O ~n O vD O I~ O W O I~ O oo O O~ O O O .-~ O
O M ~ M ~ M ~ M .--y0 ~-~ ~O ~ t0 ~ ~O ~-r l~ ~
N N N N N N N N N N
r o ~ o ~ ~ O o ~ o O ~ ~ M O M M M
pp o0 00 00 01 O ' 0 0 O
.p ~ ~ ~O ~ N
N ~M
.,., - 0 0 U
O O 'O 00 a1 ~ l\ O
.w ?~ ~ d' 00 N
.r p) :'" 0 0 0 N
p ~ o ~ 0 0 0_ O ~ V'1 M 00 M
N ~ N ~ .-. Q\
-i ~ O
U N o a o 0 0 0 V O I~ . O I~ O N
o O o 00 o O o O~ 0 00 o O
~ \ \ ,-, \ \ \ ,~
I~ ~n ~U G~ O~ O t~ O~ O N l~ N
N Gt ~ ~ N M ~O LD d' ~ O d' O M
O O O O O O
,~C> yp Q1 O M
N ~. ~ ° G1 ~ ~ 01 M ° 01 N ~ '"'' o M ~D M ~ O
O N d' M M O M Q1 d' ,M_, N
O O O O O
H ~ H ~ H ~ H ~ H ~ H ~ H ~ H ~ H ~ H
~~~~z~~z>~z~~z~~~~~~~~z~~z~~z~
as ~'W O ~'W O ~ W ~ ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
ci ~ U rig L~ U r~ ~ U va ~ U r~ ~ U v~ ~ U v? ~ U c~ ~ U c~ ~ U va ~ U
H M M M M M M M M M M
O O O O O O O O O O
N d, ~ ~ \O ~ 00 ~ O ~ 00 ~ 01 ~ O ~ N ~ d' A C!~ N c/~ ~n C/~ W C/~ ~ C/~ o0 C/~ o~J V~ oo V1 01 C/~ O~ C/1 O~

o~ ~ro ~\~ ,~\~ p\
Q' ~M hM ~N ON1~

M M M

O
~ ~ ~ o o ~ o V ~
O

I~ N ue O
I~ ~ ~

~ ~O v ' d' N
N 1 d d-w d' M M M

V o 0 0 0 0 0 0 0 0 0 O O O O O O O O O O
u~ o O o o o O o o O o o o O o O O O O O O

0 0 0 0 0 ~ ~ ~ O ~
O ~ ~ ~

~ O O O O O O O O

Ct N N N N N N N N N N

o O o oho N N ~ N

N ~ ~ ~ ~

O
~

_Ci \ o :

O o 0o v 0 l~

..O W O 1 p ~ N ~p M

.p ~ \
~ ON1 ~

O ~ _O O
O y l~ .., ? N M V7 , d' ~O M
-v ~; o 0 0 0 O o~ 00 0~ 00000 O
~

N ~M ~N
~ O

p~ O .--m , y o ~ ~ 0 O~
~ ~

O O~ ~ ~ N
N

O ~O M
M

~ p O O O

N M pp ~ ~. M
~ ~ 0 ~ o o ~ ~ ~

. d' O O ~ 01 Ov O I~ M N ~ M
~ N

U N M M M M O
U p O O O

~ ~ ~ ~ ~ ~ ~ ~ ~ ~

z z z z z ~ ~Z ~z ~~Z ~z ~Wo ~WO ~WO ~WO ~WO ~WO ~WO ~WO ~Wo ~Wo ~ ~ ~ ~ ~ ~ ~ ~ ~ U ~
U U U U

A v~ c~ rr~ v? va v~ v~ v~ v~ v~
U U U U U

O ~ ~O ~ ~ ~ 00 ~ ~ N ~ ~ ~ d' ~
~ I~ O M M l~

a ~ ~, ~ ~, ~ .-.~C/~ C/~ C/~ C/~ C/~ Ci~
A p ~ N N N M M M

o ~ 0 0 0 0 O ~ O ~ ~ O ° .O-~ 00 ° ~ l~ ° ~ M ° ~ ~
° ~
~, O\ M 0'00 M O d' OV~O dl~. l\ 00 01 M
0 0 0 0 0 0 ~ o U .~ pp N O O O ~ ~ M
o ~ o O o O o O o O o l~ o O o ~
O \ \ ,--i \ ,--~ \ ,~ \ ,..~ \ \ ,--i ~D N v1 v0 d' ~ 1~ oo ~n N v0 ~ v~ d' ~ ~n N d' M d' ~' d' ~ N ~D N ~O N d' M M d' M
M M M M M M M M
V o ~ 0 0 0 0 0 0 0 0 O O ~ O O O O O O O
o O o O o O o O o O o O o O o O o O o O
O ~ ~ ,.., \ ..~ \ .--~ \ ,-i \ .-~ \ ~ \ ~ \ .--i \ ~
O O O O O O O O O O
N O V7 O ~ O (~ O ~n O d~ O O~ O ~ O N O M O
~ 01 ~ 00 ~ 00 .--y~ .-i h .-r l~ ~ \O ~ l_~ e-~ l~ ~ l~ .-i .., c~ N N N N N N N N N N
p ~ o 0 0 0 0 ~ o '~3p ~ \ ~ o O \ ~ o ~ o G1~1 o O o O
~~ ~n ,-~ M ~ N d- ~ l~ O O I~ Ov ~ ~t 5 N ON ~ ~ N ~ ~ d' d- O N
N
v~ ~ N
C3 ' \ o O
M M l~ N o O~
..O I~ 'd' v0 d' N O ~ ~ 01 ~ ~ Q1 Ov .v ~ M M d' M d. d' d' M
4) ~' ,-.m N
N ~ o 0 0 0 0 00 O l~ O
O ~ 01 ~ O ~ 01 ~ O
p ~ o ~.-i o o ~ o ~ o .-a d' V7 M ~ ~ d' M M
M d' d' Gt ~ o .N-~ .N-~ ~ O
V ~N oo N ~ ~ O o0 0 01 o O o O~ o O o 01 o O o O o o0 ,~ \ \ ,.~ \ \ ,~ \ ,~
\p ~ V7 tn M O 00 O 01 M l~ V7 00 00 01 M 0~1 ~ ~ V'1 0~1 l' l~ I\ ~ d' ~ M 00 N
O O O O O O O O
U ~ l~ O l~ 00 00 O o O ~ o ~ ~ o O O o O~
~~O d~'M~d~''d~' ~,d~' ~d~'' ~M N~
O O O O O O
H ~ H ~ H ~ H ~ H ~ H ~ H ~ (~ ~ H ~ H
~z~~z~~z~~z~~z~~z~~z~~z~~z~~z~
O u~', W O ~ W O ~ W O ~ W O
A cry ~ U v~ ~ U v~ ~ U v~ ~ U v~ ~ U v~ ~ U v~ ~ U ca ~ U r~ F~ U m ~ U
~r ~t ~t ~t ~t ~t O ~, O ~ l~ ~ 00 ~ ~ ~ O ~ N ~a M ~ O ~ O~ ~ M
A V~ d' C/~ d' V~ d' C/~ d' C/~ v'~ V~ ~n V~ ~n C/~ ~O C/~ ~O C!~ l~

N \ O N M
O ~ ~n ~ ~ 0 0 ~ O~ \ ~ '", c ~ N o ~ N o N p~pN ~~ ~M pM
M M M M d' U ~ \ o 0 C1 ~ °p~ O1 M M
4 'O pp 01 O~ O~
~V~1 ~d' O~OM
~ N V1 V1 M
M M M M
0 0 0 0 ~ o 0 0 0 0 O O O O .--~ O ~-r O O O
o O ~ O ~ O o O ~ O Q O ~ O o O o O o O

~ O ~ O o O O O N O N O O O O~ O ~ O ~ O
Ct ~-~, .-~-r d' ~ d' d' d' dN' Wit' ~O
N N N N N N N N N N
_ O d.
O
O
N
_ \°
.p ~ ~ M 01 O
V o N
~. O~
MM
~Q1 N
M

N
N N ~ M
~N
O
0 0- - o 0 0 d' O l~ d' o ~ ~ ~ ~ ~ ~ O o M ~O V7 M ~ 01 O M C~ 00 I~ V7 --y] M M M N O~ N 00 M O1 M
O o 0 0 .-r 0 0 \ \ \ o ' 0 0~0 O\O
O O N M N N N ,d. N N M N M

h-~~i ~ H ~ F-Hi ~ H ~ t~-I I-~i I-~-1 ~ H ~ FH-11 1-~-I
i ~ W O ~ W O ~ W O u~, W O ~ W O u~, W O ~ W O ~ W O n~, W O ~ W O
v~ ~ U tn ~ U rr~ ~ U v~ ~ U ~n ~ U vW U vW U cn ~ U vW U vy U
N N N N N N N N
O O O O O O O O O O
~O ~ 01 ~ O ~ .-~ ~ N W O ~ l~ ~ 00 ~ N
A CJ~ I~ C!~ l~ V1 l~ C/~ 00 L/1 00 C/~ 0o C/~ 0o V1 00 C/~ Ov C/~ O

O ~ 00 ~ ~ oo ~ ~ ~p o ~ ~ o oho ~N
M M M M
r-1 N
O O O
O O ~ O ~ o ~ \ ~ O
O
O ~ O ~ I~ d' ~ due' O ~
M M M M M
V o 0 0 0 0 0 0 0 ~ o O O .-w O O ~ O O ~ O
o O o O o O o O o O o O o O o O o O o O

O O ~ O O O l~ O o0 O N O M O 01 O .-r O [~ O
l0 ~ lp .--mD .-~ l~ ~ t~ ~--i O .--~ .-r .-w M .~
C3 y0 N ~O ~D ~ ~O ~O d' V 1 N N N N N N N N N N
\ ~ c o O
O ~ o ~ o ~ o ~ o ~ o ~
tP~ M .-a ~ lp ~ ~ M l~ OM ~ l0 O ~ ~ 00 ~ O
~ a N O
.p N
r" o - 0 0 0 0 \ \ \ \ \
O 01c~ ~OM1 c0~0 c010c0~0 U ~ Ch ~ 'd' M M M ~ M d' V1 N
.-m--m--m-r v--r p7 e-w--~ ~ .-~
o p' ~ o ~ o ~ o ~ o ~ o O ~ ~ o0 M ~
O O ~ O
r-i r-1 r-, r-1 r-1 \°
G ° N N U
O 'r C3 Ci o O o O o O o 01 \ O~
M ON ~ ~ due' d' V~ t~ ~n d' a~
O O O O O

N \ OM1 \ OM1 0 0~1 0 0~0 Q1 ~
V O M ~ O ~t v0 N
O O O O
H ~ ~ ~ H ~ E-~ ~ E-~ ~ H ~ H ~ H
~z~~~~~~~~~~~z~~~~~~~~z~~z~~z~a i ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ ~ O ~ W O ~ W O ~ ~ O
A rri ~ U v? ~ U v~ ~ U va ~ U r~ ~ U v? ~ U va ~ U rr~ ~ U v~ ~ U v~ F~ U
0 0_ o_ o o_ 0 0 0 0 0 V
O ~M W o ~~ ~,-.
as C/~O r/1N V1N C/~M C/1 d' V1~ C~/1~ C~/1~ V~1~

~ o o ~ ., ~ ~
~ ~ ~ 0~1 ~ D1 O M M ~N r o~pN
~ M ~M ~~

M M M M M

O 00 l~ (~ O I~ 00 V ~ o ~ \
O ~ ~

l~ M N \O O ~O Q1 M ~ l~ O M

_ ~ M N N N ~n ~
N ~ ~ d' N ~n O O O O O O O O O O

o O o o o O o o o O o o O o ~ .-~ O O \ .--aO O \ ~ O \ .-~ O
\ \ \ \ \ \
.-. ,-i ,-~ ,-~ ~ .-.

O O O O O O O O O O O
~

~ O M ~t vp t~ 01 O~ O ~ O N
O O O O O O O O
- ' i -r., p p p ,-~ . d p .
,y W W ~p y , , . N N N N N N N N N N

., --m , ,-~ ,.-m -, o ~ o 0 0 ~

O o o ~ o o ~ ~ ~ ~

,~ G1 V7 ~ M ~ V7 ~ M pp O ~ N
M ~ M ~ ~
N ~O

5 ~ ~ .-~ w --~

p) ~
a O o o o o ~ ~ O

O N O~ N
N I~ N
~ ~ N
~

N N n r., 0 0 O o ~ o .O O

V O~ .-~
~ O Wn M

iy ~D d ~1 M M O N
O \oo \G~ \~ \O \O~
~ ~

~ ~ O

N
I~ O M
~ O

O O ~ ~

.--m r ~

I~ ~D O D
~ 0 o t~ o o 00 O O~

O
N N ~ M
~ d o~ d' ' DD

O O O O

0 'O M ~O M \
\ \ o O~

.. O M N M N N
~ N ~
0o O

O

O O O O

~ ~ H ~ ~ ~ ~ ~ ~ ~ H ~ H
~ ~ ~

H H ~z~ ~~~ E H E E ~z~ ~z>
~z~ ~z~ ~z~ ~z~ ~z~ ~z~

~Wo ~WO ~WO ~WO ~WO ~WO ~Wo ~WO ~WO ~~o A v~ ~n m c~ en v~ v~ v~ v~ v~
~ ~ ~ ~ ~ ~ E~ ~ ~ ~
U U U U U U U U U U

v~ ~n ~n ~ ~ w o w o U

A ~o'no ~~ ~~ c~eao~,~o ~o ~o r~o ~o ~o o ~ 00 ~ o vo ,~
0 o \
' o ~ ~M ~O
~

N M p p M M M M

N o 0 U ~ ~ ~ N
O o O

O ~O

~N

M M

0 0 0 ~ 0 0 0 0 0 v~ o0 00 00 00 00 00 00 00 00 00 y \ \ -r W
~ \ ,., y ,-. y y y ,-. y ,-, .-. 0 . 0 0 ,-. ,-. 0 .-i 0 0 0 M O ~ N ~p (~ 01 O ~ N O O
O O O O O O O -.a O
v ~

~ '..,~ ~ ~ ,-~ ~ ~ ,-~ oo co ~, ~
r., r., ,-~ ~--~ .-, , N N N N N N N N N N

~_ .--i ON ~1' M

O

\ ~ M
\

0 ~ y -r ~ 0 y , 00 o -O t o ..O O N
~ N ~ ~p N l~ ~i' l~ V~
M

U

O O

,v ~

N
oo ~N

\ \ \ \
U O O --i o0 M
~

o O o . o o 00 O '" \ O o O
U \ O
\

~ ,., ,-i ,-, O~ ~O ~~ p~pN NN
O v1 O
d' O O O O O

~ ~ 0 ~, ~
o 0~0 0 o ~ 0~1 O

O ~O ~ M M o0 V ~ N M N N
d' N ~
N M

C~ O O O O

z~ z~ z~ z~ ~ ~~ z~ ~~

~ ~ ~ ~ ~ ~ ~ ~ ~ ~
~ ~ ~ ~ ~ ~ ~ ~ w~

w ~w ~w ~w ~w ~rw ~w ~w ~w ~
~, ~, ~, ~, ~, ~, ~, ~, ~, ~, o o o o o o o o o o W ~ ~ ~ U v~ r~ cs~ vW w ~ v~
U ~ F~ ~ U U F~
U U U U

A v v~ v~ v~
U U

U

O ~ 01 ~ ~ ~ d' ~ ~ O ~C ~ ~ ~ ~
A C/~ O M C/~ ~ C/] ~ 01 L/~ ~O
O C/~ C/~ ~ C/I N C/~ V1 M C/~
~--~ r, ~ N N M

0 0 ~ 0 0 0 0 O~ ~N~~ ~~~M~~~MM~~M..O-i 0~
OM O V~ ~d' ~d' M M d' ~l' d' M M
r1 r1 r-1 r-1 r1 v--0 ~-1 V O o 0 0 0 0 0 ~ o p ~~ 00 v0 ~ ~n ~O O N O
O o ~ o Q' o ~ o ~ o ~ o ~ o O o O
p O \ \ \ \ \ \ \ ,-i \ .-a w ~ t~ ov ~ Ov N vD wt m O~ ,-.~ ~ N O 00 vG
~ M ~ d' V> m V7 M ~O O ~O O ~O M ~O
~ M M M M M M M M
V o 0 0 0 0 0 0 0 0 0 O ~ O O O O ~ .-i N O
v~ o O o O o O o O o O o O o O o O o O o O
O ~ ~ r.., \ .-., \ ~ \ ,--~ \ ,-w \ ~ \ ,-r \ .--r \ ,...1 \ .--r O O O O O O O O O O
~ O M O ~ O 00 O O O ~ O lp O l~ O 00 O 00 O
V7 V7 ~_W O ~ ~_ ~ N_ ~ N ~ N ~ M
N N N N N N N N N N
o ~ o 0 0 ~ o p ~ \~o~\~o~\o o~\~o,O-ai O 01 00 V1 ~!1 ~--~ M ~p tn M O~ V7 0~ l~
N ~ O M ~ ~ O ~ O ~ N ~ ~ ~ N ~ O M
a ~ ~ ~ ~ ~ ~ ~ N
,_~ ~ ~ 0 0 o O
H
N ~D M
.-r r., 0 0 0 0 0 V
o~ o~ op~p o~ op O O ~p °~\. ~_ °~\. d' p°\p ~p o~\, t~ p°~~ ~
V ~ ~ M M d' d. M N d' O M
N
N '-' ~.-.i .-r ~ ~--i ' 0 0 0 0 0 0 0 N
Fs, ~ \ 01 ~ a1 \ Ov ~ Cv ~ O ~ 0~1 O p~ d'N Md' ~M ~N d'd' NO X01 N ~ 0d- Od' Nd' OM ~V1 N~ -MrM
O o 0 0 0 0 0 N a1 ~ l~ N O
o O~ o O1 0 01 0 00 o O o O
,.-~ \ r., O d' O oo vO v0 C~ d' O v0 d' N
p ~ ~ d' v~ ~n N v'1 l~ ~O ~O ~ l~
v~ O O O O O O
-, V o 0 0 0 0 0 0 0 N~ M\~ ~o ~No O~1 ~\Dl Oo ~ ~\oN0 O N d. O d. NO d. 'ct' M O V 1 .-~-~ ~ ~ d. d. ~f' O O O O O O O O
aH H ~ H H H ~ ~ H
H ~ H ~ H ~ H ~ ~ ~ H ~ ~ H ~ H ~ H
~z~~~~~z~~z~~~Z~~z~~z~~z>~z~~z~
ea ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A vW U vW U v~ ~ U ra ~ U vW U r~ ~ U rsW U ~n ~ U rs~ ~ U vW U
0 0 0 0 0 o a o 0 0 I~ ~ N ~ 00 ~ M ~ 01 ~ e--WC 'v' ~ M ~ d' ~l A v~ M v~ ~n v»n . rr~ wn ~ v» v~ ~ v.~ owe o, v~ N

O ~ 00 ~ ~ 00 ~ ~ V7 0 ~ N ° ~ ~ \ 0~1 ~ o O ~ 0 0~1 l0 ~ ~V~ p~pM ' ~M
C3 ~ M d' M M M M M
Ci ~ .-r ,--~ ,--~ ,-.a ,.~ .-r ~- \ ~ 0 0 0 O ~ D1 t0 M ~ N O ~h w-a o ~ o ~ o ~ o O o O o ~ o N o O
0 O \ \ \ \ ,-, \ ,-. \ \ ,-, \ ,-r 'N ~ d~ M M 01 O 01 ~D ~ a1 d' ~ ~O l~ M N O
~ oo ~ ~n ~t t~ N ~ o0 01 v~ oo t~ ~M I~ O N
M M M M M M M M
V o 0 0 0 0 0 0 0 0 0 O ~ O ~ ~ N O
U ~ 0 0 o Q o ~ o ~ o ~ ~ ~ a o o ~ o ~ o O
O O O O O O O O O O
~1 O t~ O O O 'd~ ~ N O N O M O ~n O N O ~O O
~ N ,_, N r.., ~ ,_, N ~ ~~ .--a O ~ [w .-i .-i ,--~ ~ .-r tn ~.-w Ci tp ~ ~~ N N l~ N M d~ M
u~ N N N N N N N N N N
r~, ,--~ ~.-~ r--~ ~ ,-, ..~ ,-r .-.w <r O ~\~ 00\0010oo~DO o~0000~01 'ti ~0 d~ N ~ ~ ~ ~ ~ ~t ~ 00 N O ~
,..a Q1 01 00 N .-O V~ l~
M ~ O ~ ~ 01 N \ O
~Q1 N ~D ~ ~ V1 ~ M
r ~," o -o - 0 0 0 0 .p ~ 0001 001 000 000 o OM o0 O O V1 \ M \ 01 ~ M \ l~ \ r"' 01 ~ rr -, [~ O 00 01 N
W
Q, N ~ ~1 d~ ~ M d- ~ ~ M
N o 0 0 0 0 0 0 00 000 000 0000 0~ 00 ~O ~ ~ 01 l~ 0o p l~ ~D O O
~O M ~ t~ N N ~ ~O ~ M
Ct ~ r., ~-, ~ ~--i .-, ,.-a O
V .N o o °~ ,°_\., 00 N ~ M O

0 01 o O o 00 o O o 01 0 01 o Q1 0 ~°-~ o O
r, \ \ ,..~ \ \ \ \ ,~ \ ,~
01 (~ O oo O ~n M N ~w 01 N ~ ~ o0 41 M N ~O
N C3 N ~G ~O d~ 00 M M 00 V 1 lp M M 00 ~D '~ N l~ ~O
O O O O O O O O O

o p1 o N o O o 01 0 lp o V1 o d~ o N ~ 01 ~ ~ M ~ ~ O ~ ~ t~ ~ ~ ~O ~ ~ N \ Q1 ~ \ O ~ \ 01 O l~ d' '-~ ~ l0 O V~ ~ 01 M d' ~ et M M M
U G ,-w d' ~ N M ~ M M M ~ O ~ d~ M N M
O O O O O O O O
~Z~ z~ z~ z~ ~~ z~~z~~~~~~~~z~
a ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A vW U vW U r~ ~ U v~ ~ U vW U vW U v~ ~ U ~ ~ U v~ ~ U cn ~ U
rj N N N N N N N N N N
r~
N ~ O ~C O ~ ~ ~ M ~ V~ ~ O1 ~C M
A C/~ l0 C/~ 'r C/~ l~ C/~ 00 C/~ 00 C/~ o0 C/~ O C/.1 D C/> M C/~ M

O t N ~
~ ~ o o ~ O

~ ~ Wit' M tP1 M ~O

~3 Q1 ~ ~ d1 O o 01 0 o o ~ o ~ ~ ~

01 l~ 01 C~ M I~
~ N M I~ M

N M N N O N N
d' N ~

M M ~ M M M
M

0 0 0 0 ~ 0 0 0 0 O O O O ~ O ~ O ~ O
o O o o o O o o o O o o O o O O O O O O

O O O O O O O O O O
~ O op ~O l0 O ~ O O N M O 00 O O O O O O O

~ ~O M ~ M 1 o '_' N
~'-' O

C3 N N N N N ~ N N N N
N

ool~0 001 0 M ~ ' N
~

o) ~ 00 d ~ 01 O

y a o \~ o~o O

v0 d' ~ O~n ~ ~Y

Ci t~ C
... O O
..p 00 O1 O ' d ~
~ N o0 M d' ;." M N
~' N r, ' \ - ~ o N
O a ~ 0 0 ~ 010 001 M
~ O dM' ct\r1 N
~D

N .-.i ~ N
a O
u ~

~ ~i -\

O O N
O o O o I~ o 0 01 Ct O~

M ~ ~ l~
00 O l~
N ~D ~O
I~ N

O O O

d ~O d' ~p ~ ~
~ ~ Q1 , ~ ~ O
O M

O O O

~ ~ ~ ~ ~ ~ ~ ~ H

~z~ H H H ~ H H H H ~z>
~z~ ~z~ ~z> ~z~ ~z~ ~z~ ~z~ ~z> W
W W

~WO ~WO ~WO ~WO ~WO ~Wo ~WO o O ~
~ W ~ ~ ~ ~ ~ U ~ ~ o U vW cs~ v~
U ~ ~
U U

A cn v cry v~ v~ v~ v~
U U U U U

M M M

O O O O O O O O O O

U

O ~ N ~ ~ ~ M ~ ~ ~ d- ~ ~ ~ ~
d' O~ N O ~n C/~ t~
C!~ M V~
N t~

A C/~ C/~ C/~ c!~ C/~ C/~ C/~
d' d- l~ oo O~ ,-~ N

N o ~p o N
O ~ ~ M ,.~", o ~ O
~ d' o0 M
_ e-i r1 d' ~O \ ~ o ~ o ~ O~ N ~ M O~ ~' N N O~
~ ~p M ~ ~O M M M d' I~ ~O
N ~t d' N M d' ~ M M M M M
V o 0 0 0 0 0 0 0 ~ o O O O O N ~ O ~ O
o O o O o O o O o O o O o O o O o O o O
O ~ \ ~ \ ..-i \ ~ \ ,-. \ '~-~ \ ,-~ \ ,-i \ r, \ ,--~ \ .-, O O O O O O O O O O
00 O M O O O 00 O [~ O v7 O 01 O M O [~ O M O
O .-r l0 v--i [v .-~ ~ .-1 pp ~ lp ~ p~ ~ .-m--~ ~ ~ N ~
C ~ W O v0 ~D d' d' lW0 l~
N N N N N N N N N N

~ ~ O ~ O o0 od~o ~' O ~n N
5 ~
O O
_ O o O~
~D ~ O M
_N N

.p ~ ~ ~ ~ 00 O ~ 01 pp ~-~ M M
V ?~ pp ~t V7 ~' N ~ ~' N
p ~ o ~ 0 00 N ~ r., M

V o \ .\
V ,~ d' O O
O O \ 00 o O o 00 O WD N M o0 M O
~ d' ~ d' ' \ ~-'~ ~ ° O 00 ° ~ M
~M MM MO~
,O O O O O
z~~~~ ~~~z~~~'~~z~~~~
eat ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
v~ ~ U v~ ~ U v~ ~ U v~ ~ U cry ~ U v~ F~ U v~ ~ U vW U vW U vy U
,.., ~--m.-i ~ ~ r-, N N N O
O O O O O O , O O O O
~d' ~~ X01 ~~n ~~ ~C' ~~ ~N
A V~ .-t V1 Wit' C/~ ~n C/~ ~D Va l~ C/~ a1 Va O Va N C/~ M C!~ O

o ~ o - 0 0 O ~ l~ ~ 00 l~ ° ~ O o ~ ~p \ ~ N \ ~ N o 00 d' O M O ~h 01 M 00 N ONO l~
M ~~ ~~ M M M
0 0 0 0 - -b v ~ ~ o°\o ~ o ~°\n °v~

o a~ o t~ o a~ o O o 01 0 p \ \ \ \ ,-~
01 M I~ l~ V7 O N 00 ~ M V»O
d' l~ N M N d' WD t~ M N l~
M M M M M M
V o 0 0 0 0 0 0 0 0 0 O N ~ O N O O O O
o O o O o O o O o O o O o O o O o O o O
,.-~ \ .--i \ .-, \ ,-i \ ,-~ \ ,-a \ .--i \ .--i \ ,-~ \ .-r O O O O O O O O O O
~~ O w O p1 O O O ~ O ~ O O~ O ~ O v7 O l~ O
01 ~ d' ~ ~ .-~ N .-i N ,--~ M .-i M ~ V'7 ~ V~ ~-~ M .--~
O
N N N N N N N N N N
--m-.i .-, ,--, ,-~ ,-~ r., ,-0 0 0 0 0 ~_ O ~ \ ~ o ~ o ~ o ~ o ~ o \O ~O t~ tn N M N M ~"'' ~O
O M O M ~ ~'1' ~ M ~ M ~ M
N N ''..' ,-~ .~ N
N o ovOo d' OM1 ~ OM1 a Gv p o 0 O ,~ l~ M M l~ \O l~
C~ ~ ~ ~t dO' ~n ~ N
:r \ o 0 0 0 0 M ,~ o0 ~O ~h N \ ~ \° I~ 0 01 o O~ \ O~ o p ~ ~G O~ ~ N ~h ~O t~ d- oo °~n ~ N
N
O M O~ M 01 V~ N M O N
~' \°
~N 00 01 l~ 01 O O ~n O ~ o a1 0 ~ o C1 o Ov o O o o0 0 l~
Md' X01 NM ~N ~~ O~OOM
~ l~ N M N M
O O O O O O O

' N o 0~0 ~ ONO ~ ~ ~. ~ ,..., G O M dN' N M N ~ O M ~O N
O O O O O O
.H N H
H ~ H ~ E1 ~ H ~ H ~ (~ ~ E ~ H ~ H ~ H
~z~~z~~z~~~>~~~~~~~~~~z~~z~~~~
a ~ W O ~ W O ~ W O u°~, W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A vW U vi ~ U vW U vW U vW U v~ ~ U v~ ~ U vW U r~ ~ U vW U
o °o °o °o °0 0 0 0 0 0 O O O O N O O N N N
O 'Q;oo ~O boo X01 boo dN ~C~ ~~ ~N ~o0 A V7 N Cl~ M Cf~ ~n C!~ ~!1 VI o0 C/~ d' C/~ O\ C/~ d~ V~ Q1 Ci~ ~O

Qv w Q1 N 41 M O~ M O ~ ~ M ~ ~ O N
M M M d~ M M d' M

O p~ O~ l~ d' O O O
o Q1 0 ~ o ~ o ~ o O o O o O
O O \ \ \ \ ~ ~-r \ .-a M N t~ dW ~ Owe ~--~ ~ N N l~ ~h N M OWO Ov N oo M ~ ~h ~ ~i' M M M M M M
0 0 ~ 0 0 0 0 0 0 0 o O o O o O o O o O o O o O o O o O o O
O .3' ~ r-, \ ~ \ ~ \ .-~~ \ e--a \ r, \ ,--i \ .-i ~ ,-~ \ ,~-i O O O O O O O O O O
O M O O O '~-~ O ~ O O O ~ O l~ O M O N O
l~ ~ Q1 ~ 00 ~ 00 '-, 00 ~ 01 ~-i O ~ 01 ~--~ M ~..~ d~
,., ~ N N N N N N N N N N

o V7 ~ M
00 M pip M 01 VN1 N d~
N
~ d N M
~ O
~ o ~ \ oho d.
M
~ O ~D
U o 0 0 0 oONO o~ 001 oO~1 O H N ,o-~-~ \O \ N \ .-a w ?1 ~O M M M d~ ~ Vd'~1 M

M N M ~ ~ o d' .-r ~--~ O ,., ° \ \ \°
~H N O l~ O1 O O
o O o O o 01 o I~ o O o O
,~ \ ,~ \ \ _ \ ,-~ \ ,~
O p~ 00 ~ ,M_, l~ V'1 M ONO M ~ d~ N N
~ M ~O 00 V~ I~ 00 O O O O O
.-.~ .-r V o 0 0 0 ~ 0 0 0 H O~ ° ~ Q~ ° °~ pp °~ 01 ~ ° 01 M
° O~ 00 \ 01 00 °~ ~ M o U O O N O M O M d, V'7 e-l~~~ M O d~ .-i O N V~1 O O O O O O O O
,H ~ N H ~ H H H
H ~ ~ ~ H ~ H ~ ~ ~ H ~ H ~ H ~ ~ ~ H
~z~~~~~z~~z~~~~~z~~z~~z~~~~~z~
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A v~ ~ U vW U ~ ~ U vU~ U ~ ~ U rn ~ U v~ ~ U v~ ~ U rr~ ~ U vW U
p N O N O O ~ ~ N N
U
oo ~ ,-, ~ ~t ~ ~ ~ M ~ o0 a A C/~ N G~ ~D C/WO C/2 vC C/~ G1 C/~ N C/~ 00 C/~ N C/~ N C/~ M

0 o c o 0 o ~ o a °° 00 o Q' N o ~ "~ \ oho d. o ~ tjj M dN' ~ M
C3 ''~' M M d' M d' p M ~ O M
.O ~ ~ ~ ~ ~ o p o _ 0 0 0 01 N M N dW0 ~ M
01 lp d' ~ M
M M M M
V o 0 0 0 0 0 0 ~ 0 0 O O O O O O O N O O
o O o O o O o O o O o O o O o O o O o O
.--~ \ '-a ~ ~ \ ~ \ .-.i \ ,.-i \ .-.a \ .--~ \ rr O O O O O O O O O O
0o O ~ O t~ O o0 O V~ O N O ~O O ~ O ~1 O (~ O
O r~ M ~ M ~ ~ .-1 ~ .-~ ~ ~ M .~ M .-r w, ~ N N N N N N N N N N
.-i ,-~ r, ~ ,~ ,-, ~ ,.-i ,-, p ~ o 0 0 0 ~ o \~ \~ \°O \°~ \~ \O
'ZS ~~p ~O O ~ l~ 01 d' N ~O M ~1 I~
N N ~ ~ N d' d' a CS

p N
G ~ 0 0 y \ o~00 O o O
'" M 01 M N
N ~ M d' V1 t!7 O d' N
00 ~ 0~0 ~ O
O~ N
N
V ,N o \ o ~ 0 0 ," N 00 01 M ~ 00 o O o O~ o Q1 0 01 o O o 01 ,.~ \ \ \ \ ,.~
d' vp d' 00 l~ M O O t~ N 01 l~
N Ci ~ N ~ N N l~ 00 ~O OW O I~ M

V o ~ 0 0 0 00 ~ ~ M ~ ~ 01 ~ ~ N ° ~ ~ o O
--~ 00 o0 ~D M ~' ,_, ~h M 1p N O ~n d' p0 M
rr .-.i ~z~~z~~z~~z~~~Z~~z~~~Z~~z~~z~~z~
c TWO TWO TWO TWO TWO TWO u°~,WO TWO u°~,WO TWO
vWU w~U v~E~Uv~E.~U v~E~U vW UtnE~Ur~~U v~~UrrW U

N N N o N ON N N ON NO
O ~ N ~ ~t ~ ~O ~ 00 ~ d~ ~ O~ ~ O ~ d' '~ l~
A Vl d' Cl~ V7 Cl~ ~ C/~ .--~ C/~ N C/~ M C/7 V C/»O C/> 01 C/~ ~p _ y \ - \ ~ \ \
Q

o~ o o ---, , O 01 ~ M M . 00 ~ '_'~
~ ~ ~ ~ a 00 ~ ,. 00 M ~ 0 ~ d' N
M

00 00 O l 0 00 M M <t' M 0 M
M

V o 0 0 0 0 ~

O O ~ ~O h ~ N
o O o o 0 00 o 0 ~--a ~ O1 41 O \ ,-~ \
O ~O ~ <Y O o4 ~ h 'N ~O N M O N
~ M

~y ~ In O M ~ M O 00 ~ ~O M V7 ~ M M M M M
rte., v~
~

0 0 0 0 0 ~ ~ o 0 O ~ ~ O O O .-i O O d' u~ o O o o o O o o O o o o O o O O O \ O O ~ ~ O
~ ~ ~ ~
--i O ~ ~--~~ ~ ~ .--~e--i .--a .-a ~ O .
~ rr .r O O O O

O O O O O C1 V~ lp N O M
p~ h op ~O ~ O O O O
O O O O O

M ~ ~ ~ ~ ~ O N N ~'' N
~ ~ '~ '"~ ,-, 00 00 0~ 00 00 00 0~ o~ a~ a\
N N N N N N N N N N

- 0 o 0 O o0 o~ 001 001 00~o o0 ~

'Z3 ~ 00 M ~ d' M
'S'p h ~ ~O V~ h M ~ p ~ O N
~ M M

-~ N N r" ~''~ ~' ~
N

O
'N~ O ~
~ O

~ O
h ~O
0o ~p h N N

r., o o -o 0 0 y CS N o0 01 00 ~ o a Q1 h 01 00 \
O~

G M ~ M M ~
~ M M N
N

w if lp M M

0 0 0 o p 1~ \ \ \ 00 \ ~

O

~ ~ O O cn ~ d' ~ O M M ~
M ~O M ~
d' ~ ~ p ~

o O o o o ~ 0 o OM1 0 O O~ 41 01 \

i ,., y O~ ~n dw0 N ,-i Cv Own h M N N ~ d' Ov 01 Ov ,-r ,-.~ v0 h N 01 in ~n N V7 ~ 00 h ~ 00 ~G d' V7 r., O O

O O O O O

c O ~D N Ov Oh c c c c ~ ~ O

V d. Mif1 pM _ MM N1p O d' 01 d' O O O O O O
' ~ ~ ~ ~ ~ ~ ~ ~ ~

z ~ ~Z~ ~ ~~Z ~~ ~z ~z ~z ~z ~ ~ ~ ~ ~ ~ ~ ~ ~ ~
~ ~ ~ ~

w w w ~rw ~w ~w ~w ~w ~w ~w o o o o o o o o ~, ~, o o ~, ~, ~, ~, ~, ~, ~, ~, w ~ w ~ ~ ~ ~ ~ ~ U ~ v U ~
U U ~ U
U

A v~ tn c~ c~ v~ c~ rrs ~
U U U U

.~-~ r, ~ N N M M M M M

H e-i ~ ~ .-i rr ~ ~ ~ r-i r~ O O O O O O N O O O

V

O ~ 00 ~ ~ ~ ~n ~ ~ .~ ~C ~ ~ O
d' h lD M ~n C/~

A, C!~ Vl Vl C/~ C/1 C/~ C!~ C!~ C!~
~O o0 01 N M O M h 00 0 o a c o O M ~1 ~O o0 O ~ ,-.~ ° ~ Y1 ° ~ ~D ° ~ 01 ~ ~ t~ ° 01 od'0 0 o00 M ~ M O V1 M M M d' M
.-1 r1 r-1 r~ r~i _ o o~ o~ 001 0~
C~ V1 N ~' ~ 00 ~ oo d' M ~1' ~ V7 ~
M M M M
0 0 0 0 0 0 ~ o 0 O O O O O .-~ O O ~ O
o O o O o O o O o O o O o O o O o O o O
O ~ ~ ~.-~ \ ~ \ rr \ .-r \ .-.~ \ .-.i \ r., \ ~ \ .-.i O O O O O O O O O O
M O t~ O M O ~p O I~ O ~ O M O N O ~ O l~ O
~ .--m-.i \O rr N ~ ~1' .-r d' ,--a d' ~ ~' r-.r d' ,~ t~ r, Q1 01 O O~ 01 01 Q~ 01 41 01 N N M N N N N N N N

M ~ ~ d' N d' ~ ~ ~ a~ u'W'1 N .~0 01 d' O~O d' O~ M G1 d' O~0 ~' 01 d' 5 ~ ...-~ ~ O
Ci CS ~ ~ V7 ~ .-a p M
M
_N ~ ~p M
~ p V d' N
p ~ ~ Ov \ Ov p o 0 o ~, m dM. ~i o o~
o ~ \ ~

~ n a O ~ \° l~ \° O~
O ~ O 01 O M ~n ~G
O O
~_ o _o o _0 0 0 ~,., c O c ~ \ l~ \ Ov r"i c ~ c ~ c O ~. 0v ~ t~ N 01 O M M O '~ N O
U U .--t d' M M N N ~--r M ~-' ~ ,_, V~ N V1 O O O O O O O
e--W -I r~1 v-1 ~-..1 r-1 1-~-I ~ H ~ H ~ H ~ 1-~-1 I-I Y-~-1 ~ H ~ FH-i 1-H-I
~z~~~~~z~~~~~z~~~~~z~~z~~~~~z>
~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A v~ ~ U vW U v~ F U ca ~ U v~ ~ U vW U vW U v~ ~ U c~ F~ U ~ ~ U
,..i dwt dwn ~n ~n ~n ~n ~n ~n N N ~ ON N N N N N N
M ~ O~ ~ ~O ~ l0 ~ 00 ~ M ~ 01 ~ ~ ~ 00 -1 A v~ o rwo v~ oo r~ o v~ o v~ ,-..~ v? M va d- va ~n va ~

O ~ N ~ ~ M
~M
a v~ N
U O \° ~ o O o N N N ~ d0' M M
o~ o ~ ~ 0 0 0 0 0 O O ~ ~-~ O O O O O O
c O o O o O o O o O o O o O o O o O o O
-i \ r, \ ,.-~ \ ,--i \ ,-r \ .-~ \ .-~ \ .~ \ .--~

M O N 0 N O N O ~ O M O O O ~D O \p O p~ O
w., c~ N N N N N N N N N N
p ~ ~ o o_ o O ~ ~ ~ o ~ o doo' ~ O o dt~' o,.-~O M
~ 4~ ~ ~--~ N
a ~
' ~_ o O l~ 0 01 ~.-~ o O O~ ~O N
y ~ d' ~ M
v., 0 0 0 .p ~~ o ~ o p~ o O ~ 01 ~ N
N ~ '~-r M M dN' ~ M
N
y o O
N O M
N
CJ ~ o G ~ ~ O
Q V o ~ o ~ o rte., S~ O~O V1 01 N
O O O

01 ~ o l~
W .o ~ o m a ~.., C7 ~ C7 ~ C7 ~., C7 ~ C7 ~ C7 ~ 'U ~ U' ~., C7 ~ C7 H ~ H ~ H ~ H ~ ~ ~ H ~ H ~ H ~ H ~ H
~~~~z~~~~~z~~~Z~~~~~z~~z>~z~~z~
O
A cry ~ U v~ ~ U v~ ~ U v~ ~ U v~ ~ U vW U v~ ~ U v~ ~ U rrW U v~ ~ U
0 0 o N o 0 0 0 0 0 ~A ~~ ~:~ r~r~c r~r~~ ~~ ~~~-, ~~ ~~ c~e~~ r~r~°

°
\
0 00 ° ~r o ,~ \ o, o ~ oo ~ r-, ~ N
o M o '~
p ~~ ,-. 0o d' O \ p o ~ o --~ M d' oo t~ 00 .-a ~ d' M M
V o 0 0 -- \ _. 0 0 0 ~ ~ o O O O .--~ O .--~ ~ ~ .-a r"' \ .-~ \ ~ \ .-i O ~ o ~ o ~ o ~ o O o ~ o ~ o ~ o O o O o O

N O o0 O O O V~1 O o0 O O~ O ~ O V~ O V7 O ~ O
p ~r p ~ N ~ .-r ..~ rr '-.r O ~ .-~ ~--i ~ ~--~ p~ r'a M ~
O O O O O O (~
M M M M M M N N N N
N
~_ ø
O
~D
_~ N

U o p _~O o ,.Ø,, p\ \ ~ ,~ ° 00 :v, ~ O ~-~ M d' ~ M
d' N ~'' rM.., N
O ~ o O o 01 M d' a1 ~n C3 ~ r~., O

U .~ ° d' ,v O
4 ~ ° o d' O
00 ~1' l~ ~1 O
o °~ \°~ N
N :.~~.~ 00 ~ ~ '~'~ ~ 00 V O N o0 N y O N
O O O
~z~~
ee ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A cs~ ~ U v~ ~ U rr~ ~ U v~ ~ U rn ~ U cry ~ U ~ ~ U v,~ ~ U rr~ ~ U v~ ~ U
,..., oo a1 aw, o o ,-a .-~ ,-. ,-, N N pN ON N N N
G fir. ~o, ~N ~~-~ ~~ do, ~~ ~~r ~~c ~~c a A C/~ N C/~ N V~ V7 C/~ l~ C/~ O C/~ M C/~ N C/~ l~ C/~ l~ C/~ 00 o ~ ,n o °° ~r o ~ m ~
M M d' o M
0 o O o Q1 01 00 00 ~D M O OO
N N M N V7 ~ N
M M M

O O O O O O ~ O O O
o O o O o O o O o O oo O o O o O o O o O
\ .-~ \ .-, \ .-r \ .--i \ .--N O W O I~ O t~ O o0 O vp O o0 O .-a O o0 O ~O O
~ rr N ,--~ N .-r ~ WO ~ ~' ~ l~ ~ ~O ~ op ~-i I~ 00 01 O l~ 00 00 00 00 00 N N N M N N N N N N

o ~ o M ~

H
_v ~ ~p M
w U _o .O '~ ~ 01 O
O~ d' .v N
:" o N
O ~ o ~ 0 000 N ~ 00 M I~ d' ~ 0 0 0 0 O
o ~ o ~ o ~ o O
~ N O d0- ~ ~ ~ d' O O O O
.-r o \ o 00 \ 0'00 00 a ~ 10 c 0~1 V OCR .Nd. N ~ M ~ dd~' O O O
H ~ E~-~ ~ H ~ H ~ ~ ~ H ~ H ~ H ~ H
~~Z~~z~~z~~z>~~~~~~~z~~~~~z~~z~
i ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
~1 vW U ~ ~ U cs~ ~ U c~ ~ U vW U v~ ~ U vW U vW U v~ ~ U v~ ~ U
N N N N N N N N N N
N ON N N N O O O N O
,~~1 vwc v~o v,M v» v~oo ~~ ~oNO c~m°

Mho o °' °' err' .o v ° y o °

~o i~ ~ i M M M
r~

O O O .-~ '--i .-i O N ~ O
O ~ ~ ~ o ~ o ~ 0 0 0 ~ 0 0 0 ~ 0 0 0 ~ o O

O M O V7 O pv O M O ~ O ~ O ~ O vp O (1 O
01 01 d' l~ ~ V~ ~ M ~ M ~ M ~~ ~D
N N N N N N ~ O O
N H ~ H ~ ~ H ~ H ~ Y~
O O

O . ~ o~ ~
d' ~ M
_O ~ o O O N
~O ~ ~p M
_N N ~p M
o ,p ~. o pip o ~ o O O O Oy d' N O_, °pv M N d. N ~ M
p) ~ r--w O ~ N
~ ~i' V ,~ o 0 Q1 O~ M
O ~ o O o ~ o O
M N
mn ~n O O O
V o 0 d. o ONO d, o O
U O O M M d' ,O O O
~z~~z~~z~~z~~z~~z~~z~~z~~~Z~~z~
~w ~ ~w ~ ~w ~ ~rw ~ ~rw ~ ~w ~ ~w ~ ~w ~ ~w ~ ~w ~e ~ O~ O~ O~ Ou, Oar O~ O~ O~ O~ O
~1 r~~Uv~~Ur~~Uva~Ura~Uv~~Uv~~UvWUw~UvWU
p,H O O ~ N N
M M M M M M O O O O
r~- O O N O O N O O O O
V
O d ~ ~ ~ W o ~ M ~ ~ ~ d- ~ o ~ .-, r1 A cry o v~ o cn rn v~ ov rn a, rr~ N v~ ,-~ v~ M cmn v~ o~

o ~ ~ °~\.
~M

o ~~ ~ ~ ~o ~ o~
o O~ \° ~ \ °° \ 01 o~o~ ~cMn ~~ n~ o~o~t0 N d~ M ~O ~h M M M M M
V o 0 0 0 0 0 0 0 ~ o O O O ~ O O N N O O
o O o O o O o O o O o O o O o O o O o O
r., \ '-, \ ~ \ .-a \ .-, \ .-.~ \ .--~ \ ,--i O O O O O O O O O O
I~ O M O 00 O t~ O .--i O 00 O M O [~ O 01 O O O
Ci ''' ~ ,-r ~ tn ~ o0 ~ ~D .--i ~O ~ O '-' l~ r'' l~ r"' pp "' O ~ O O N O O O
N N M N M M N M M M

M O
O .~ M O ~ ~ op\ o ~ M ~ d~
~ 4Wp M
r., 0 0 ~ 00 ~h O O N \ O O o O~
O
N M M M
N
p) O
due' m ,..'~" s ~ .~-r 0 0 0 0 0 ~ ~ c t~ M t~ o0 l~ N 0l o ~ o ~ o ~ 0 00 0 01 o I~ 0 01 o O
p a \ \ \ \ \ \ \ \ '..r O I~ ~O ~ d' N ~ ~ N ~h O O O d' O
V~ ~ N ~ M ~ V~ ~ ~n M ~ d~ ~ d~
O O O O O O O O

\ \
,~~1 O
y ~ \ O N o _ ~~dy~ N N
O O
z~ z~ z~ ~~~z~~z~~~Z~~~Z~
>~ ~~ ~~ ~~ > ~
i ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O ~ W O
A v~ ~ U rn ~ U vW U vW U v~ ~ U vW U vW U v~ ~ U vW U v~ ~ U
0 0 0 0 0 0 0 0 ° o O ~ N ~ ~ ~ M ~ O~ ~ N ~ ~n ~ ~n ~ oo ~ ~t ~ O
A Vj l~ C/~ ~ C/~ ~ c/~ ,.-~ Cf~ M V7 N t/~ t~ C/~ O~ V1 O V~ M

0 o a o 0 o ~ ,n o °' ~ o ° d. o °' ~ \ o°~, ", 0 0 ~ M ~n oho ~n ~ N
C3 ~ M M M M M
0 0 0 ~ 0 0 0 O m oo N ~t O .-~~ M
V ~ o ~ o ~ o ~ o ~ o O o ~ o O
O \ \ \ \ \ .-~
M O ~ 00 l0 01 1O l~ d' \O M ~ 00 N
N ~ M ~ d~ O V~ M d' M l~ M N ~ N
r~ p ~ M M M M M M M

O O O O O O ~ ~ O O
U ~ o O o O o O o O o O o 0 o O o O o O o O
O ~ ~ .-, \ .~r \ ~ \ .-r \ ~ \ .-~ \ ..-r \ .-r \ .-~ \ ..-r O O O O O O O O O O
M O ~ O ~ O O O N O N O M O D1 O V7 O M O
00 ,-~ O ,.~ 00 ,-a p~ ~ d1 ~ p ..-~ 0 .-~ N ~ d- .-..~ ..-a ~
O O 01 O O O ~-w ~ ~ o~ O
M N M M M M M N N M
O
\°O \~ \°O~ \°O
d' ~
0o M v1 ~ M ~ N N
~ a ~ Q1 o N
O M
y~ M ~p N ~p M

~O ~ °001 °0~1 °O
O O M N
w ?1 M M V1 ~ V1 M
° \ \ \ \° \°
~_ 0 0 0 0 0 A, ~ \Ch \°O \°~ \0~1 \000 \°O
4) ON1 d' ~ M ~ O ~O ~ ~ ~ M
N
O O O O O

o0 ~O 01 N ~ 00 d' O ~ p\ ~ Q1 ~ 01 ~ 01 ~ 00 ~ 01 o O
00 00 0o O~ O O t~ N ~O I~ ~O d~ M ~
°; '~ o°o m oo~o M ~ ~n oho ~n ~ ~t ~ t~ ~ ~n Nw N° ~ 1~~~ N~~ 00\~ Oo\°
U U N ~ N M N ~ O ~ N N
O O O O O
H
z~~z~~z~~z~~~~~z~~~~~z~~~~
TWO TWO TWO TWO TWO TWO TWO TWO TWO TWO
v~ ~ U v~ ~ U v~ ~ U v? ~ U vW U r~ ~ U vW U vW U rr~ ~ U vW U
H O ~ ~ N N N N M d' d~
rr ~ ~ .-~ ~ ~--m--i r-~ O O O O O O O O O O
O ~ 00 ~ M ~ M ~ O ~ 00 ~ N ~ t~ ~ M ~ V'7 C/~ 00 C/~ r~~~ C/~ M C/~ N C/~ M Cf~ ~ V1 t~ t/1 ~ C/~ M C/~ lp o "~
~ \
o~

N
C

N
M

M

0 0 0 0 0 0 0 ~ 0 0 O O O O O O O O O O
U o O o o o O o o o O o o O o O O \ O O ~ O \ O
\ ~ ~ ~

r-r .-.r ~ ,-a .-i ,-r ~ .-r V7 (~ O ~O p~ N M O t~ N O ~
O O O O O O O r-, O 'ch O
N r-r M d' tn N l0 ~ ~.-i V~
~ ~ ~ ~ ~ ~-, ~--~

~NS N M M M N M N OM OM N

O o .

~
N

~ _ y O

.D

_N
N

r., 0 0 v O 0 o a1 O ~ M
.v O M
d' ~ M

O

a V o 0 N

, O
O
O 00 I~

N O N
l~

M M M
N

O O

N l~ l~
w ~

O M O
~

O O

~ ~ ~ ~ H H H ~ H ~ ~ H
~ ~ ~

H H H H ~z~ ~z~ ~z~ ~~~ ~~~ ~z~
~z~ ~z~ ~z~ ~z~

~Wo ~WO ~Wo ~Wo ~~'o ~Wo ~WO ~WO ~WO ~Wo ~ ~ ~ v~ ~n v~ r~ v~ rn vW c~
U ~ F~ ~ ~ F~ ~ ~ U ~
U U U U U U U U

gin- ~ ~ ~ ono 00 ~ N N

0 , 0 0 0 0 0 0 0 0 0 ~ '~ ~ ~ ~ ~

~ N ~ ~ ~ oo M a\ O~ oo O M
N O

A Cl~ C/~ C/~ C/~ C/~ C/~ C/~ C/~ ~ ~O C/~
l~ ~ N V7 l~ N ~O p1 .-i o 00 ~ m c ~

M M

M

O O O O ~ O O .-i o O o o O ~ o o O o o o O
O o O O O
O

tn M V1 V1 M N O V7 ~Y O O
O O O O O O O

-~ N .--t~ M l~ V~ ~p M '~
C3 .-w ~ -~ ~ ~ '"~ '"'i C1 ~ -~ 00 ~--~ ~O

,-~ .-r l M . N M N N
M M N M

O ~p O ~ 00 N

~
N

o .N N \
O o0 ~p ~ M
~

~
N

O

o _O M
M

~

O ~ Op ~

'n N N
~ N

H

O
N

U
o O N M
O

V O

H H ~ H H H H ~ H

W W W

~'WO ~WO ~WO ~WO ~Wo ~Wo o O o i ~ W ~ ~ ~U ~ ~ ~
~ v~F~Ucr v~F
~U ~U

A c U v v~ v~ c~ ~ .
U v~ U U U
~

~ ~ d O ~~ dw boo ~o~ ~n~ ,- ,-. ~o ~C~
a~1 wN rnoo cr~o, woe v~O mo ~M cn~, r~~

O~ 0~0~0 ~N~~
~ Q1 ~ O~ p~ 01 p~ 00 ~ 01 p 01 Ct '~'~ d- M M M M M M d' ~ O
U ~ ~ 0 0 0 0 U ~ l~ ~ V7 l~ N
o ~ o ~ o ~ o ~ o O ~ ~ I~ O ~O l~
~ 01 ~' ~ d' ~ ~n N M M 't N ~ ~D ~ ~O
~ M M M M M

OM1 ~ p~1 O O
O ~ o o \ \ "'~ o ~ oo ~, ~n ~.,~ I~ N w ~ N
~ M ~ d' ~ V~ ~ M
N N N M N
0 0 0 0 0 ~ ~ c O 01 ~p l~ 01 l~ O M O
0 01 0 01 0 01 0 01 0 01 o O o G1 o O
,~ \ \ ,~
~~ ~t ~n o0 0o CT ,-r o0 ,-.~ N v0 00 ~--~ N I~
~O~ O~ ~~ 01~ pNpM
5 0~ N N .-~ ~ .-'' N .-~ ~--i C3 Ci .--i ~ '.-a ' o 0 0 0 O o O pp o ONO t~ o O .-r o 00 ~5 N

U o 0 0 O O M o ~ 01 00 ~ ,-y0 a1 O~ 00 O
U
N ~ O d' d' M M d' d' d' N
O o0~1 00 00 00 00 00 pyD \C M .-i N .-, Q1 cr et cV d' ~
v»p ~ l~ ~ oo N_ t~ o d' M t~
O O

O C3 ~ 01 ~ 01 \ ~ o O
M M 00 lp 0o tn ~n ~n O M N d' O O O O
.-, ,~ ,.-a r, V o 0 0 0 0 ~ o ~ o o p o p o O o O o O o O o O o O o O
M O '..~ N O ..-W' O r--i 'n O ~ O O .--WY O ~ ~ O .--~ ~ O .--i ~ O 'r O N O ~ O ~ O ~ O N O ~'-~ O N O d' O ~ O
w .U Op ~ 00 ~-, 00 ~--~ 00 ~ O ~ NO .-~ NO .--~ ~ ~ NO ~.-i ~rW ~ CW ~ a~W ~ c-~W ~ ~W ~ ~W ~ cs~W ~ v'W'~ a~W ~
O ~ O ~ O ~ O ~ O ~ O u, O ~ O ~ O
U v~ ~ U v.~ ~ U v~ ~ U v~ ~ U v~ ~ U v~ ~ U
N O~ 01 O~ O_ ~D ~h M
O O O O O N N N N
O_ O O O_ O O_ O O O_ O O O O O O O O O
W oo W N W t~ W oo W O W oo W N W l~ W O~

o ~ 0 0 0 ~ o O
O pp ~ p~ pp M ~ Q> O Q\ O M ~ ~ ~ Op W M M M d' d' M M M
.-r r-~ H '~-i r-i r--~ r-~
G ~ ~ ~ o o ~ o U ~ ~ et' N l~ ~ a\
o O o ~ o ~ o ~ o ~ o O O \ ~
~M ~O~ M~' o~oM ~N
M M M M M M
V o 0 0 0 0 0 O ~ ~ ~ ~ ~ ~ ~ O

?, ~ N M ~--~ l~ l~ M
V_~ d. O d' 01 ~t O N N M N ~p \O
p 01 M t~ M rM., O
N N N N M M N
O ~ ~ O ~ I~ I~ oo v0 0 01 o O o 00 o O~ o l~ o D1 o O~
O ~ \ \ ,-..r ~p O~ oo N ~t M o0 N N N ~ d' ~ M
~ N d' ~_ '~ o o _~ ~ _~ ~ o O \O \°O o0 00 00 00 00 'c~ ~ ~D ° ,~ ~O ° rr ~0 O .-..~ O O ,-.a h1 O ~ r'' O ~ ~ O .-.~ C'1 N ~ N O M O d' O M O d' O
~D .~--yD ~ ~ ~-r ~O
p 0 0 ~ 0 0 'p ~ \° ~ \ \
<h p V7 ~ O ~ ~ ~ l~ °O M
~H ~ NM ~N '-rM lO~y ~~ O
R, ~n ~ M ~n d~ ~n p) .--~ ~ .-r H
\° \° ~ ~ \° \ \°
O O 01 O N l~ ~O
0 op o O o 00 o p o [~ o p~ a O~
p ~ \ \ ,~ \ ~ ,~
.r p~ 01 vD ~_ M d' d' d' N lWD dW I~ ~ O
N ~ N N N I~ o M .M-y0 01 N O d. O V1 V 5 0 ~ o o ~ 0 0 O ~ O .°-~~~ M I~ ~ ~ l~ M ~O I~ N 01 l~ 01 Gt ~~ ~n ~ M O N O ~ M M ~ N O N
O O O O O O O
0 0 ~ ~ o ~ ~ o o p o p o O o d o O \ ~ o O o 0~1 N ~, ~O O ,-~i ~ O .-, N O ,~-~ V~ O ,...~ 00 ,_, ~ V~ .-, 00 N
U N o M ~ ~ ~ ~ ~ N ~ O ~''~ ~ ~ N ~ O
O O O O O O O O O
E~-~ ~ H ~ H ~ E~-~ ~ H ~ H ~ H ~ E~-i ~ H ~
~~~~~~~~~~z~~~~~z~~z~~~~~z~~
rig W U ~' W ~U °' W U °' W ~ v~ ~ ~ v~ ~ U cs~ W U vi W ~U ci~
W U v~
N O N ~O M u1 N N N
A
O O O O O O O O O O
0 0 0 o z z z z z z W O W .-~ W O W oo ~ N ~ Wit' ~ N ~ ~O O~

0 0 ~ ~ 0 0 0 O ~ ~ M Cv d' ~O 00 l~ .-~
~ ~ ~ ~ ~
~ ~ ~ ~

p ~ ~ ~~ 0 0~1 ~

1 O o 1 CS M d' M M d' O M M
~ M

p ~ o o ~ ~ o p ~ o ~ o o ~ o ~ o ~ o ~

p N

M ~ ~ ~ d' N M

N ~ ~D ~ N ~O ~O
M M M M M M

.-m -- m r 0 0 0 ~ o ~C~ M ~ V'ti'' M 0d'0 ~ N ~ V'1 M

CS V 01 o 00 ~-..~ 00 M N N N

p ~ o v Wt 01 t~ 01 p o o Q1 o o 00 0 01 0 0 ~ 0 01 0 O \ O 00 Q ~ \
\ ,~
~

, dW N o0 ~ ~D M N ~ M o0 Ov d~
'~ ~ ~n O 01 t~

ct N o ~ 00 O vD ~ ~ M O N ~ l~
vp N

,~ N .-~ N ,~ ,--~ N

0 0 ~ o ~ o ~ o o_ O O

p o o o O o o O o O o o O o O o p p O O N O es O O ~ O
~ ~ O
y O ~ ~ O ~ O O O ~ O .-, O ~ ~ d' O
..p .-~ .-.i ~ ~ O d' '.. ~ O ~ O
~ ~ O ~ O ~ O N
O O O

N ~ ~O ~O ~ ~D l~ l~ t~ ~ e--WO
~ v--W ~ ~ ~ .-~ ~--W

v o 0 0 0 "pp o pMp o o oho .~ ~ ~
o ' Mp ~
h o '~ y O
. o ~ ~ d' o ~. N
v ~ ~ N
M

, .,'"., ~ 0 0 0 0 0 N
0 0~o o o o~p o pN1 0 o Op o O \ \ 0~o \
\

,..,, r, ~ O '_~ N O ~ oo d' Omn ~''~
O M M ~ N ~O m ~ l~ N
I~ o0 O 01 M l~

N 1 .-r r, .-r 0 --i 0 1 O O

H

V -o 0 0 0 0 0 , o ~ o ~ o o ~ o o 0~1 0 ~ O~p p p~ N O O ~ M M 1D ~ ~ ~D ~ 00 M ~ 00 ~ l~ M
M N

~ ~ ~ ~ ~ ~

O O O O O O O

o ~ o o ~ o a o y 0 0 ~ ~ ~ M N d' ~.
y ~ ~ ~ ~
o ~

O ~' O ~ ~O '"'' ~p N ~n ~p '~ ~p O
~ ~O l~ t~ d' ~

U C~ ~t N ~ M O ~ O ~ d' N O
~ N ~ ~

O O O O O O O O

1-~f H F-~-1 1-~-I7-~-I H ~ 1-~-I1-~i F~-i H
~ z z ~ ~
~

z~ ~z~ ~z~ ~z~ ~z~ ~z~ ~ ~ ~ ~
~ W W W ~ ~ ~ W
W W W

Wo ~WO o ~ O ~ o ~ O ~
~ o ~ O ~ o ~
~ ~ ~ ~ ~ ~ ~

~1 m ~ rep v~ v~ v~ U v~ v~ rs~
~ U U U U U v~ U U
U

H
O O O O O O O O O

e-i ~ ~--m r w --r .-r .-1 z z z z z z z z z ~ ~ ~ oo ~O 0 0 00 N M ~ 1 1 0 0 0 0 0 0 ~ ~ c O 00 t~ t~ O O~ o O o ~ o O
O ~ ~ ~ ~ ~ M o ~ ~ ~ ~ ~ '°\p ~ ~ vp ~ ~ ~D ~ O p O 00 O O lp O
O a1 p~ a0 ~ ~t p~ ~t p~ d' p~ 'd' l~ ,-W~ ~ l~ ,--~
d' M M M M M M M M
V ~ o ~ o ~ 0 0 0 0 v .~ O N o0 0o O O v0 d~
O ~ ~ o ~ o p~ o Q\ o O o O o ~ o O W--~ d' e-d'a ~ ~ ~ 010 O ~ ~ O .--~ ~ M lN0 M
~O ~D ~D N ~ ~D ~ 1D
~ M M M M M M M

O N d' O O OW1 l~ O~ o O o O 01 O~ O~
O ~ \ ~ ~' \ '-' ~ c O O N N N
ONO M d' O Od'O O Od'O ~p Od'O ~O O d' ~r Ci ,--~ ~ 00 00 00 M
N N N N N N

O~°d\.°p\1~~~001 O
I~ O~ 00 0 01 ~ O1 o O o O~ o O
'pa ~O ~n O ~n OW O OWD a1 0o a\ Ov N N
M ~P't ~1' ~ ~f' ~ d' ~ d' N O~ O~ a1 ' 0 0 0 N O ~ \°O \°N \O
O ~. ~ O ~ ~ O
O ~ O ~ p~
\O ~ ~ ~-r \ - \ \ \
01 01 O ~ o o p~ ~ p1 ~ o p ~ a O
~ M ~ M ,d M ~ M ~ N
0 0 0 0 ~ o 0 p ~ oO~1 00~o 00 00 00 00 00 O ~ ~ °d\. N ~ M °~\. '"'' M °~\. r' M N r"' M M "_' I~ ,-M- M ~ d' ~ 'c1' ~ <t' ~ V N
~h O .-r O O O O
0 0 0 - - o 0 0 0 0 O ~' ~ ~ O ~ C1 ~ Q1 ~ Q1 ~ O1 ~ 01 y ~ °~. ~'' ,~ N .-~ N ~ ~ ,~ ~ l~ d' M ~O
~O ~ ~O ~ l~ t~ d' ~ M
O O O O O O O
0 0 0 ~ 0 0 0 0 0 0 O ~ '~ '-' O N ~ ~ ~ ~ ~ '~ ~ ~ ~ ~ ~ ~ N M O ~ ~ O
U C> N ~ N ~ O ~' O d' O d' O d' d' ~ d~ ~ M
O O O O O O O O O
~H H H ~ ~ ~ H H
~~z~~z~~~~~~~~z~~z~~z~~~Z~~z~
craw ~ a1W ~ aiW ~ ~W ~ a~W ~ a~W ~ crW ~ a-~W ~ a-~W ~
O ~ O ~ O ~ O ~ O ~ O u, O ~ O ~ O
U v~ ~ U cn ~ U v~ ~ U v~ ~ U c~ F~ U v~ ~ U v~ ~ U v~ ~ U v~ ~ U
~ ~ ~ ~ ~ ~ ~ M
N l~ N l~
O O O O ~ ~ O O O
O O O O O
o z zp., ~ ~ ~ ~ H H H
a ~ O Wo v~ oo v~ ~n ra v~ rr~ v~ r~

0 0 0 ~ o ~N o p o p o O o O o O
O ~ V1 O ,.--y0 O ,.-i ~ O ~r ~ O ~ M O
~ O ~ O ~ O ~ O ~ O
o G ~ Op et ~--i O ~~ o ~ o ~ o .,"O O (~ l~ O ~n O
~ Wit' ~ V1 ~ d' .M-~

o O
O ~ o \ \ ,--, d' ~ M ~ N
CS pip ~ 0~0 M
M
O ~ 00 O~ ~ d' 01 01 01 ~ 01 ~ O
~~ 01 O oo N N ~ d' ~n oo O~
O v0 O d' ~n N ,~ ,~ .-i N N
' 0 0 O
N ~ O ~ ~ 00 ~D ~ ~ ~ 00 r., 0 0 O
o ~ o OO~i~,WO
~.~. M ~ d' ,°\-i O N O
O ~ o O o O ~ (\ 01 d' N O
O
~ oNo O y ~ O O
e~ ~H 1"a r1 r-1 e~l O O
O ~ O
O
N CS ~ d' Vl ~f'~
O O
c c \ \ o O~ ~ \ ~ ~ o O~ ~,~ 0 01 ~ o V ~ O ~ O ~ N ~ O ~ N
,O O O O O O
r ~z~~z~~z~~z~~~~
~.w ~ ~w ~ ~w ~ ~w ~ ~w o ~, o ~, o ~, o ~, o A ca ~ U v~ ~ U v~ ~ U v~ ~ U v~ ~ U
m ~ ~ ~i N m U
O H H H H E~-a o N o ~ a N o O~ ~V> ,~~,~-~ ~~ ~O 000 00 ~ O ~ t~ ~ O ~ 00 N .°d.
M
o_ N M ~ N
M M
V o 0 0 U
O ~O o0 00 M \ N \ M
~?~ ~ ~. e1' ,~ ~O ~ l0 N ~ N ~ N ~ N
p ~ 0 0 0 0 ~ o O a O o O o O o O o O a O
O ~ O ~ O ~ O ~ O ~ O ~ O ~
''w N '"i VN'1 '~ V' '_'~ V7 '"i '"'i ~ '"'~ lO0 ~ ~ O O O O O O O O

O ~ N
,.p ~ O M
y N l~
r., 0 0 0 .p ~ o M o N o O O ~ \ ~ \ ~
0\
N ~ oM0 O~ M l~ d' O~
N
H o 0 ~ N ~ m N ~. ~ ~ O ~ N
O ,-r ,-O o M
O O
o ~ o o N o ~ 0 00 ~~H' 0~00~ ~OM1 ~O l~
O
v 0 o W W o W o H ~ H ~ E~ ~ H ~ F_' W ~ E~ W H H ~ W ~' W
W ~a~~ W ~~ W ~~W ~~~~a~~ W ~c~~~
A ci~ ~U CW7 ~ v~ ~U CW7 ~ vs ~U CW7 ~ voU ~ v~ ~U ~ rig ~ CW7 ~ v~ ~U ~ v~
00 0 0, ,-, .-~ v~ ,-.
U
4 ~ d a fa w as w a~ w w a., a..

N o d~ M ~ o t~ ~D
d~ \ l~ \ V7 o N \ d~ o I
Q, ~ M O ~ N ~ O
.-i ~ O
d~ M M M d~
r-i _0 0 0 V ~ M M o M N
o_ O O
N
v~., ~ M M M
~ M ~ N
G 5 M o d' M o N M
O ~ \ ~ \ ~ o N Q\ O M ~ ~ O o0 l~ ~-., 0~1 O~ .-~ O I~
N N N N
O ~ - ~ 0 0 0 0 0 0 O\°O \°O\°O \°O \°O
\°O\°O\O
o ~ o ~ o ~ o ~ o ~ o ~ o ~ o y O O O O O O O
r., O N O M O d. O N O ~p O ~ O
O O O O O O O
~ _ o d' l~
N O 01 ~ I\ O 00 d.

d N
N ~ ~' o a N c M
O ~ M 00 d, Ov o 0 0 0 O ON' o M o ~ o d~ o d~

O
o 0 0 W
M ~o N
M
O O

.U \~ \~\°~ \N o d~~ \°
N N p~ ~ (°w d~ ~ ~ 01 ~O O M
V ~ p~ ~ p~ M ~ o D1 V O O O O O
Ct (v-~ ~ E~-~ ~ H ~ H ~ E~-~ ~ H ~ L~-~ ~ H
W ~~.~ W ~ ~ ~ ~ ~ ~ ~ov~ ~ ~ ~ W
A
M 00 ~ M d' O~ M
N
M M ~ d~ d~ d~ d~
A

," o M c ox ,~~.v, M..
m ov ~ o o> o0 M
O
d' a1 M
d' O M

O
M
N

O o O d O o O o O \ O o O o O o O o ~bp ~ Op ~ ~ Op ~ O O ~ ~, p ~ N p ~ ~,,~ O ~ d' O ~ v1 O ~ ~p O
O O O O O O O O O
Ci O N V1 ~ ~ ~ ~l1 V7 V7 V~
O
O
'O
_N
~ N
c M
O ~O ~' M
ono p~
.N N O
M
N
v .N

W
a ~' o M M o w I~ 00 O 01 M 00 p ~ O O
r., W W
W a ~ ~ ~ ~ ~ ~ ~ ~ C7 ~ ~., C7 ~., C7 ~
~H ~ ~ ~~ z z~ z~ z~
~ O W ~ O W W ~ O W ~ O W ~ O W ~ O W W ~ O W ~ O W ~ O W
A r~ U ~ v~ U C7 ~ v~ U W n U ~ m U ~ v~ U C7 F~ v~ U ~ v~ U ~ ~ U C7 0 0 ~ °
~r ~t TWO Wo ~ t~ 00 ~A

N o ~O o N
M O . ~p ~ O
O
M M
U CS M M
o_ G~1 ~ ~ ONO
N
d. ~h ~ M M M
U
O
M

?~ ~ ~ N
o \ o o 0 0 0 0 O \ O o O \ O o O o O o O o O
t~ O o0 O 01 O O O .~ O N O M O d' --. ~ ,-~ oo r-' oo ~" oo ~' 00 O O O O O O O O
N O \ M \ N
N pOp ~ 0~1 N N l~
v o due' \° N

v~ O
U .N o U ~ o ~ o N
O U
W ~ o O
s0 00 t0 o N
V M \ ~ \ N ~ ~ o N o N
--y~ °p0 l~ O 0o ~p O ~p d.
O ~ o0 M O h dt~. O~ O

W a ~ W ~ .-~ .-. ,-. ,-.
~~~~w~~~ ~~~ w~~~w~~ w~~~ w~
a C~!1 ~ 00 O~ N
M OM1 O p ,..~., N 0 P~, P~., P~.~ P~-~ P~.~ P~-~ P~-~

o ~ o N o M
O .~ N vp N O ,°.\.., O~ ~ o~ ~ 00 v ~ '~' N
O
O ~ l~

v o N
~ a o ~ 0 0 0 0 0 0 0 0 o °o\°oo°oo°oo °oo°oo oo°oo ~~11 O ~ ~ O ~ ~p O ~ l~ O ~ 0o O ~ p~ O ~ O O ~ r., O ~ N O
N O O O O O O O O
~, C3 Ci V7 ~n ~ ~n v7 V7 V7 N O ~ d' o N
N
.," 0 0 ,.O ~ \ MO o N
O
w (~, N ,--r M o0 H e-~
r~ r~
N
U
,5 O w ~ N
U ~ ~ 00 O

M ~O o l~
o ~ ~ °r\,, M ~ o U
Ct w w w O w O w O
~ z~~z~~z~~z~~ z~~z~~ z~~z~~
oww ~ow ~OW ~Ow ~owW ~ow ~oww ~ow ~ow A U C7 ~ v~ U ~ v~ U ~ ~ U ~ v? U C7 ~ erg U ~ v~ U C7 (~ c~ U ~ rr~ U C7 ~n 00 N M t~ ~O d' 00 M M d' <h L7 ~D ~ 00 A P~-~ P~, P~-. P~-~ P~.~ P~-~ P~., o ~ 0 0 N o M o N o N o M o O ~ 1p M V7 °p\~ ~ t°I~ ~ ~p M
O~ ~ I~ ~ O~ ~ U ~ O~

N
~n Ov N N
O .O \ \ o N pip N ~ M pOp M M M
O d' U v~ o M
_O \
M 0~1 0 ~ ~ 0 0 0 0 0 0 0 O \ O o O o O o O o O o O o O o _ '_' O '"' O '"'~ O '"~ O ''~ O '""' p ""~ O '" '~ O
M O et O v~ O ~p O l~ O op O p~ O O O
~ N O O O O O O O
Ct Ct V7 V7 ~ N V~ V~ l!7 I~

O o d0' o M o due' N N I~ ~ ~O ~ C~
C) ~O
O O
U
N
.._., 0 0 00 t~
N o N o N
O N M N l~ V7 O o0 N
U .H
O
0 0 0 ~ o O t~
M o M o M o M o M o w ~ Q1 ~ I~ G_1 N O_ O l~ oo D1 O~
O O O O O
W ~ W ~ W W ~ ,-. ,-. .-.
H ~ H ~ H ~ H ~ N ~ H ~ H ~ H
~Z~~z~~ ~Z~~z~~~Z~~ ~Z~> z~~
c W ~ O W ~ O W W ~ O W ~ O W ~ O W W ~ O W W ~ O W W ~ O W
A ~ r~ U ~ v~ U C7 ~ cn U ~ m U ~ c~ U C7 ~ cn U C7 ~ c~ U C7 ~ rn U C7 00 ~ ov M ,-~ 00 00 o~oc~ o°°,°oo °aa M \° ~ ~ dM' o A, Mo~no~ ~~ 000 C3 ~' M M M
O

O .~ N
O O
O
N
O
v d.

O O N

O O ~ O o O o O o O o O o O o O o O
r'' p ,., O ".~ O '-~ O ~ O ''."' O ".~ O ''.~ O '."
.~4 ,...., O N O M O d. O ~ O ~p O ~ O pp O
O "'~ O '_'' O ''..' O '.." O '-' O '..~ O '-' O 'r' C O ~n ~n ~n V> ~n ~n V~ ~n O ~ o .pa O N
~O
N
~4 '~O
N
N
O
N

O
N
N \° ~ \ ~. o ~ o M
N . r" p°0 01 ~ O O N vp 00 ~ ~D ~ ~G O ~ 00 c~
O O O O W W O
1-~-i F-1 1-~-1 1-~-I I-~-1 1-~-i hN-1 ~ H ~ I-~1 ~ w ~;~ ~~~
A
N M M d' O
27s 0 0 0 0 o _ ,°-~~ o°~0 0 o ~ o N o d~ o ~ ~ 00 O ~ O °p~p O ~ 01 a°\p oo °~\~ O~ N
OM1 Ov ~ oo l~ Ov O Ov CN1 Gv O N
O
dN~ ~
M
U o O '"' d' ,~O ~ o O
~i M
0 0 \ _ 0 0 0 o O o O o O \ O o O o O o O o Oy p ,-, O p ,-i .-~ O ~~-~ N O ~--~ M O ~ d' O ~-~ ~n O ~ ~O O
O '-' ,-r ~' ~ ~' ,--y-' .-y' ~ r'' r"~ r' a Ct v~ mn ~ ~ ~n v~ ~n O o dy -D
~, N '"'' ,.p ~ \ N \ M
O o O ~ ~ O O ~
o p N c N Y' ~ M I' c N
.-I~-~ O ~ 0001 ~ 0~1 ~~-i ~ O
o O O o M o M
O ~ ~ ~ ~D oho ,'" ~ ~ ~ O
O
~ ~ O
U
\° M \° dN' \° ~ \° d' \° N \° 00 N
N ;~ p~ M p~ ~ °~f~ ~ l~ ~. d' N ~oP1 O ~ 00 M G~ ,-, O~ ,--~ ~ ~t ~ N
w O O O O O O
,'7~i 'U
1~-1 F~-1 1~H-1 H 1-~-1 I-~-1 F~~~i ~a >
~ow ~owW ~owW ~oww ~oww ~oww ~oww ~o 1 cry U ~ m U C7 ~ cn U C7 ~ m U C7 ~ v~ U C7 ~ v~ U C7 ~ v~ U C7 ~ m U
oA

o ~ o o a\ oQ
~ ,-~ ~
O

C! ~ M M M

O

O

M

~

D ~ o ~

~ ~ O

CL ~ M d' N N N

O \ O \ O \ \ O \ \ O \ O
O O O

p ~ O '"'O '""'O O ~' O O .-rO '"'' .'.' ' '"' ~

~ O pp G1 O .--i N M O d.
O O O O O ".~
a N ~ .--~ .-~ N N N N ' N
r"' ''..' '"' '"~ ''.'''-~ N ~-r --m --a C3 Ct ~ ~n ~n ~ ~n ~n ~n ~n p o M

N o d O ' ~O

N

''" 0 0 0 U
.D ~ ~ ~ M \ d.
~ 0 O o . ~ N O
'" ~ ~
'N ~ 00 ~1 00 _ e"a H

H H H

O O~ O

l~ d' o M
~ O ~

W N

O O

N N O r., ,--~

O o O o O o d' o M
w \
~

O O~ ~~ X000 p \O
~

O O O O

o ~

00 d' V o ~ ~ M ~ l~ o ~ \ ~O

r., ~, ~
Q o o .-r \p l~
~~ O 0~1 O
O 00~ 0 ~ ~
O

d 1 , ' ' _, d O O W O W O O O

N

O

~~'Q W ~~O ~ ~ ~~'O ~~O W
W W O O W W ~' W W W W
W

rn ~ v~ 7 v~ v~ 7 tn ~ C7 v~ ~ cn U U ~ U U ~ U U ~ U
C7 C ~ C ~ C7 000 0~o N dN' O

as w ~ a.. ~ w w w w o M o ~ o o ~ ~ ~n ~ t~
a' °° o °' o °' o>

o 0 U o O
O N o V7 ~O
0 0 ~ ~ 0 0 o O o O \ O \ O o O o O o O o O o O
~~ O ~ O ~p O ~ O pp O ~ O O O ,..., O N O
N ~ ''' N '"'' N r, N ''i N ''_' N '"' M ''' M r., M '-' ~L ~ Ct ~n ~ ~ v~ ~n v~ V~ ~n O
.p _N N
~ N

U
M o N
M_ N
N

O., ~ o ~ o N
~ N ~ Ov c~ ~ O
~' ' N 1-~ 1~1 V ~H
H
,y ~ O
v N ~ M
o M o ~ o V p o~0 ~ ~ ~ 0~1 w ~ ~ w ~ w w w w w H ~ H ~ H ~ H ~ H ~ ~ ~ H ~ H
~ z~~ z~~z~~ z~~z~~~Z~~z~~z~~~Z
oww ~oww ~ow ~oww ~oW ~ow ~ow ~Ow ~Ow U C7 ~ v~ U C7 ~ v~ U ~ v~ U C7 ~ v~ U ~ v~ U ~ v~ U ~ c~ U ~ v~ U
N , ~ ~ ~ ~ 000 O O ~ ~ ~ ~ N N
M M M M M M M
A

0 0 -_ o o d~~ o ~ o M
.--~ O M
O ~C ~ ~ ,.N.., ~ tn O O~
r-t M c~r1 M M
N
V
O
O O
U
v p ~ o 0 0 0 0 0 0 0 O o O o O o O \ O o O \ O o O o O
O ''' O '""' O r, O '"' O ~' O ''' O '"' O r"'' .~ M O ~. O ~ O ~p O l~ O pp O Cv O O O ,., N ~ M "~ M "~ M '~ M ~~ M '"~ M '~ M ~"~ d~ ' ~ d' O Ci V7 V~ V1 V~ ~ N V~ V7 V~
O
N

O
..p ~ o N o M
O
O ." ~_b 01 00 Q1 %v ~ V'7 O~ M l~
41 O"
0 0_ N ~ OM o M O O~
,.~-i ~ ~-~.a ~--i 01 O
V ~N
O
o -~ \ \°
cn o O
U
~ tn o d' o V'1 ~ M
o, . N ~ .-~ ~ ~O ~ d' O
U O d' ~ M ~ O ~ ~ ~ N
V O O O O O
W a ~ W W .-~ .-. .-. W W
~~~z~~~~~ ~~~ z~~ ~Z~~z~~zr~
~ O W W ~ O W ~ O W ~ O W W ~ O W W ~ O W W ~ O W ~ O W ~
A ~ U C7 ~ ~ U ~ v? U ~ ~ U C7 ~ v~ U C7 ~ v~ U C7 ~ v~ U ~ v~ U ~ v~
d' 01 d' N M M al M d' d' ~ ~ ~ ~ I~
A

_ o- o- ° 0 0 0 o, ~r, oo r V~ O
O ~ ° M N ° M O ° N ,-i ° N O \ M ,.,.., pNp ~ ~ ~ ~ ~ 01 ~ CT o D1 ~ 01 M M M M d' M
.-~m--~ .~~ ~-r e--i N
O ~~ . o M
V O O~
Uti o U r d' O
O ~ ~ N o p ~ o 0 0 0 0 0 0 o O o O o O o O o O o O o O o bll O ~ N O ~ M O ~ d. O ~ ~ O ~ ~p O ~ r O ~ 00 O
~' ,--a d' ~ d' .-~ ~ '-~, d' ,.-~ d' ~ y , e--~ .--i r-i rr r~ .-w ~ O N
O ~ -0 0 y0 N due' <t o M ~O
..o ~ ~ oo ~ ov ~ r N ~ ~ .-i .p ~ c d O
O
N

c ~ c O ~ N o m ~C? O O
O ~ O O
-_.
o ~ o 0 ~ M N O m M O~ O p~
v, O O
~-r .-.s o 0 0 0 V ~ o0 O O
\° \° M \° ~G _ \ N \° v-~ \° .ct \°
d'~ ~O~ ~oNV °oOr1 0~1 O N r,., ,., O O N
O O O O O O
w ~ ~ w ~, ~ ~ ~ .., ~ z~~ z~> z~> ~~>
oww ~oww ~ow ~oww ~oww ~oww ~Oww ~ow A U C7 ~ v~ U C7 ~ rn U ~ v~ U C~ ~ =n U C7 ~ r~ U C5 ~ m U C~ ~ v~ U C7 y ~o ~ r .-, ~t ~t U M ~ M m m m A

O ~ M \ 'd' ~ ~O \o O ~ N N V7 p~ M ~t tn O~ o~ .n d.
~ O~ O~

o N
\

M
.
v ~

o \
o _ N N

U o O
M

O ~ Q
?~ ~ O

~
~

Ci O o O o O o O o O o o O o O o O O O O

~p ~ O '"' O '." O '""' O '" O O '."'O ''.'~O
'"'' ~ '_' O O O O O O O O
"'' ' ~ p> r-~ ~ ~ ~ r-i ~ ~ ~ .-r C3 O V~ V7 N V~ ~ V~ In V7 O n ~ M

V~ N

.," o U

p Q M

N
~

F. N ~ M

, d o ~

~r o M
N ~ D\
O ~

tt O

O o 0 Q ~, O
O ~ M

O O

O O

W ~

0 0 0 0~

C~ O \ M \ ~ \ N

O ue ~

O
~ . d ~ 00 ' ~

v W 0 0 o W W W W o W et '-, ,-... ,-, H ~ H ~ ~ H ~ ~ ~
H H

~e ~ ~ ~ ~ ~ W ~ ~ ~ ~ ~
~ ~ ~ W ~ ~ W ~ ~ ~
W W

. o-~ ~ o-~ a, ~ a~
~ ~O~ ~O~ ~O~~ ~O~~ ~O~ ~O~ ~O~ ~O~ ~

~

c~ r t~ o r., ~n dw n o0 A

o ~ o ~ \ ~ o cM~, a ~ o N
° ~ ~ ° ° ~ ~ °
O d- 'd' M d' d' d' ~--1 r-1 r--1 rW --1 O
v ~ dN' o dM' d0' VMO
o ~ 0 0 0 O l~ 00 N o0 ", N ~ ~ O ~ ~ ~ ~ ~ ~ l N N N N N N
M M M M M M

V
c~ ~ d' o dN' o dN~ o ~ o d' pp 01 00 ON1 N O N Ov N Ov N C1 O
N N N N N N
N N N N N N
0 0 \ - - \ 0 0 0 a p o p o O o Q o O o O \ O
O ''..~ O ''~ O r., O ".~ O '-' O '"' O '"' O o0 O p~ O O O r., O N O M O
V~ H V7 ~ N V7 O \ ~O
_N N
0 0 \-.pO~Nc d.o l~ c d.a M
M ~ M ~ M

H
a 0 0 fLN~\M\~o ~o ~~~~~\°lM0 M~ ~O ~O ~~ ~~ .M-rr~
.--i ~ ~ ~ '-r V, O Ct \ 00 \ d' \ vp o d. o ~ o N o N ~ N t~ ~ ~ d' o N ov ~ N O oo ~T

O O O O O O O
0 0 0 0 ~ o V ~--i 01 0 l~ o V> ~ o l~ 01 ~p ~ t~ \ 00 \ \O \ V7 \ l~ o w ~ Mr' ~O d0'O d'~ dN'O dM'~
V O ~ M ~ M r' M '"" M M ~ M M
O O O O O O O
w w z~~ z~~
owW~~ W~~'~ w ~ w ~r w~~ ~~~.~
N

a A ai a., w a~ w a.. w o o -\ ~ o ~ \ v0y o \ oho 0 , a o o o 0 o ~ ~
~ 0 ~ o O

, 0 0 ~ o\

O
ue ue ~ ' l ' . d \ " o ~Oo ~ ~ ~O o Vo ' d \ \ \

o N O O O~ O t~ pip O N ~ ~ ~ o0 O O O

rr .-a O O O
.-~ ~

M M M M

M M

o \ 0 ~ o ~ o ~ o ~ o ~ o ~ o ~O V7 O M r~ ~ l~ ~D V7 O O ~ ~ O

M . ,-~ ~ ,.-r r-.~ M .-, r'' Ci O ~ N N N N

M N N N N N

~ O o O o O o O o O o O o O
o 'Zt ~ O O O O O O
O

~ ~ ~ pp p~ O
-' "' " ' '"' p~ ~ ~p ~p ~O ~p l0 ""~ ~ ' ' .--r r, a ~

O \

w v o 0 0 o ~ o ~ ~ ~ a ~~

V ~ ~ O1 ~G I~
~ O ~ O ~.

p) .-r Q O O O O O O

~N ~O ~OO\ ~O ~O ~O 00 ~ ~O
o H
O ~ ~ O O ~ ~ O
O ~ O

~ H H H

' H ~ H ~ H H

O O
\ \ \ \ \
O O O O O

O ~ '~f'o d'o d' ~ N ~ d'o l0 ~ V7 CJ

0o a\ l~ ~ N ~ Wit' N O O~ O 00 w 01 O~ ~ ~ ~ ~ ~
~ O.-r O~ Or, O O O O O O

_ o 0 0 0 0 C~ o N d'o ~ ~ ~ o V7 ~G ~ ~O\ ~O \ ~O~ ~O~ o0 ~ I~

O ~ ~p I~ o0 ~ O p O ~ O p~ ~ ~ N p~
O er d' d' d' ~t O p~ C~ O

p~ ,~ ,-i O O O O O O

_ ~ ~

~ ~ ~ ~ ~ ~ ~ H ~ H ~

W

A ~ 7 ciWU ~ ci~ 7 vi ~ v~ ~ v~ 7. v~ U
C ~ C U ~ U U U ~ C7 O~ O -i N M 'd' N N N

N N N

~_, o ~ o o ~ o \° ~ o ~ o ~ \ ~O o t~ 0 01 O ~ 00 O p~ °p~~ O O M 00 ~ ~ ~ O
CI~~''MMM MMMM
0 0 0 0 0 ~ o_ ~l N V~'1 0 ~O o '~~' o V') o lp O o0 M ~ .-r O o0 ~ l~ ~ ~O
A, ~ O~ 00 O~ O~ O_10 O_~~ O~~ M
M M M M M M M M

o0 l~ o0 M ~D
O ~ o ~ o ~ o ~' \° ~O \° 'd' o d' O ~ M
N ~ N O N O N O

O \° O \° O \° O \ O \ O \ O \°
o ~ o ~ o r"~ o ~ o ~ o r",~ o O O O O O O O
'.., O N O M O d- O ~ O ~p O ~ O pp ~
N ~ N ~ ~ ~ ~ N
O o ON1 M O
O
.,., o 0 0 0 0 0 0 V \ \ ~ ~ ~O v7 l~
~O~ ~~ ~Ny1'yO~M ~M
O ?~ M ~O 01 01 O~ ~ 0~1 01 Q1 ~ d' ~ d' ~ O
~. p~ N 01 ~ 01 ~ 01 ~ 41 ~' 01 ~' 41 d' o ~ o ~ o ~ o ~ o ~ \° ~ o ~ O M O N O ~ O oo O l~ ~°p vG O N
N ~ ~ o ~ o ~ ~ ~ ~ O o O ~ O ~ O

o °~ ~ l~ o O V~ 00 VCi \V10 ~Do ~\l~o '~h o O ~ O O Q1 ~ 00 ,-i t~ '~ 01 tn M tI> 01 N ~
O O O O O O O

o l~ \ ~ o ~O o ~ o ~G o 1~ ~ 01 _,,~ O M ~ ~ O ~ O 00 O 01 O O O V'1 O M O M ~ M O M O M o M ~ M O M
o O O o O o O o -. .-, ,--m, ,-~ ~ .-. r, E-~, ~ ~ ~ H ~ H ~ H
~~'owW~owW~ow~~~'ow~~ow~~ow~~ow~~
A cn U L7 ~ v~ U C~ ~ v~ U C7 ~ v~ U C7 E~ v~ U C7 ~ v~ U C7 ~ cn U C7 ,....., v~
N N N N N N N N
~A

o \ 0 0 0 oho o ~ \ ~ y0 o tn o d' O ~ ~ ~ p ~ O ~ ~ N
O ,-a p ,--a O 0o t~
C3 ~ d~ d' M M
V ~ o ~ o°o N
o~o,°.\~~~~o M M M
U \ 0 0 0 D\
OU ~ o \O o ~ tn M
O ~ ~ ~ 0 0 l~ O Ov ~ O
V~' N N N
r, O o O o O o O o O o O o O o O
~~ O p~ O p O ,.~ O N O M O d~ O N O
N ~ [~ '~ 00 '"~ 00 '_'~ 00 '"~ 00 ''~ 00 V~ V~ V~ V7 V7 V7 O o 0 O \ N o M
"O ~ ~ oho ~ ono r, N
V o o , o .per\l~o d'o ?~ O ~ O ~ O
N rr .-.r N ~w' ~"' ;v o o -.. 0 0 0 o ~ ~ ~ \ due' O M O ~ O ~ O M
O ''-~ O ~ O ~--~ N
rr ~ rr o ' 0 0 0 p ~ \ O o d~~ o ~ \° d0~
t~ o ~n ~' ~h v~
N ~ O ~ O~
O O O
0 o c o pp .-~ O
a N
O M O M O M ~ O
O .--i d~ ~ ~~ ~ d~ ~ N N
v W ~ 0 0 0 0 -. r., ,~ ~ ~ 7 E'"''-~ ~ H ~ N ~ H ~ H ~ H
W~~w~~w~~~ w A
N N N M M M M
A

° ° ° ° ° ° o-o M ~ d' o l~ \° M ~ ~ ~ ~ o l~
O ~ 01 H l~ °O 01 O ~O off. O ~ V~ ~ 00 O
I\O O~ ~O 0~1 popO~ C11 ~O
M d' M ~ M M M
y-1 e--W -1 r-1 r-1 H r-1 U .~ M v~ d' d' M 01 V~'7 ~ d' o~--~O N o00 M M M M
H H ~ H

O ~ \° \° o O M l~ ~ O WG O
H

o O o O o O o O o O o O o O o 'ZS ~bp ~O O ~-~ l~ O .--~ 00 O ~-.' Ov O ~ O O H H O ~-r N O =--~ M O
H H H H H H ~ H

0., O Ci m V> m ~n v~ ~n ~n ~n o N ~ ~ ~ ~ h H
N H '""
\° \°
U o 0 0 .O ~ o N \ OM ~ ~ \ ~ o ,d.
O ° ° ° O
0~0 0 iy Vy H ~t N M d. ''._' r, r, .-. ,-.
p) H H H .-a H
O O O O O
t3, ~N , o d' ~ ~' ~ l~ ~ M ~ ~O p O NCO o~oN ~t0 ~o'~o ~~ MO
,.._, ~ N H .-~ H H
e~-1 r-I v--1 H H r-1 H H H H H H
° - ° ° O
V, p ~ o M o N \ <t. ~ d.
N ~ O 0~1 O ~ ~ N
O O O O
V ~ M ~ d' o (~ o M o V7 . N .--~ p °p ~ O M ~. H p~ o0 O
O O O O O~ M O ~ 00 0~,~o Ov N O
O O O H O O W O ~ W
E-i H Ewe E-~ H (-i H
'" ~a'' ~ ~ ~ W ~~" ~ W ~ O W W ~°" O W ~ ~°~' O W ~°" O
W W ~ O
ce ~ O W u~ O W ~ O W ~ a~ a~ a>
~1 c~ U C'7 ~ ~ U ~7 ~ v~ U C~ ~ ~n U ~7 ~ v~ U C7 ~ rri U ~ m U C7 ~ ~n U
"' ~ M ~ o O
a A a~ a~ a~ w a~ as w a~

~ ° ~
CS M M M M M

U .~ o d' M
p . o o_ o N M Q' ~ 01 d' 01 M M M
V o 0 U
O ~ ~ ~ ~ d' ~ a1 N I~
M M
p ~ ~ 0 0 0 ~ o 0 O O O O O O O O O O O O O O O O

~ N
C3 Ci ~ v~ v~ ~n ~n ~n ~n ~n \°
a .O o l~0 ' O
'' ~ 'n o G o 0 0 N ~ o ~ ~ o M
N ~ ~~ NOl\1 OOM1 N

\ \ \ \
O ~ ° N ° ~ o ~ o ~ o due' o v~ O ~ 00 ~ t~
.' N ~-.~ N N

,5 O
O
~ a1 O

o O o ~ \ ~ \ 0~p .
N ;r N O M O ~. t~ ~ O v) U O O O ~ O M O M O d' Q1 U
O O O O O

H ~ H ~ H ~ H ~ ~ ~ H ~ H ~ H
z~>z~~~~~ z~~ ~~~z~~
A ~~'o~~~o~~~o~~o~~o~~~o~~~o~~o~
00 ~n ,-. p~ ~. ,-~ Do N
O d ~ ~ ~ d ,.~ A w a~ as a~ a~ as as as d' \ d' ~ ~ o d' ~ M

qy 0 ~ ~ 0 ~ V1 ' 0~0 0 O

w O O 00 00 - ~ ~
~
, , d' d' M M M
~
CS

O

N O
v M M
p o 0 ~

N ~ N

M M

O
O M o N

\

O
O
O

Ct O O o O o O o O \ \ O o O o O O O

p '~ O '"'O '"'O '"'O O '~ O ~' O
, ~' '"' ''.'' gy O O O O O O O

N O N N O

N N N N

0., ~ ~n ~ ~n ~m ~n ~n ~n ~

~

_ o N o dN'o M
O

.p 0~1~ O~ ,-~-~O
~

O

v o 0 0 o M o \ \

O d' M N
~p M M ~ ~O
~

N

~

_ o due' N M o Wt' O

~ ~ ~ ~ N ~
~ ~ O

O ~ O

e~

O ~ M ~ M ~ N

O
N N

vp t~
O O
O O

O O

U
d' o d' o ~ ~ N o ~t'o M

O m ~ N O
O l~
O

O ..-a O O O O O O

w ~ ~, ~, w ~ ,~ w a E

"

z ~~ z ~~ z ~~ ~ ~~z ~~ z ~~ z ~~z ~

w w w w w w w w ~ gow ~ ~ow ~ ~ow ~ ~o ~ow F~ ~ow ~ ~o ~ ~

A ~ m v~ vi v~ v~ 7 rn v~ cry U U U U U U U

o ~ 0 ~ ~ ~ , 0 o O\ O O O .-i ~ N N

A

N ~ ~ o o ,~ ~ ~ °~. 00 0 ~, oo ~ a\ ~ o d' Ov V .~ v~ ~ M
O O d.
M~ O
M M
V o 0 0 \ \ \
O ~ o 'd' ~ o M
01 M l~ ~' 01 O
Ct rN.., ~ ,.N.., N M N
p ~ o o ~ ~ 0 0 0 0 o O o O a O o O o O \ O o O o O o N O ,--~ M O ,-, d' ~ '-, 'n p0 ~-y0 O ~-~ l~ O
~ N N N N N N N N
0., C~ t ~n ~n ~n ~mn ~n ~n v~

w o _m ~ o>

,.p ~ o M o ~ o O
O ~ M l~ M C~1 d' Ov N ,--~ r-I r~
;v o 0 0 \ \ \
o N
O N 00 °a1 O d' Cv O
.~-~ 01 ~O O~ 01 O

O w 00 ~ 0 00 V ~ ~ N o N ~ M
O ono N
N Q\ l~ ~
O O O

v ~ N o ~ ~ ~ o °O ~O O°~. MO
M O ~M p~ ~ O
O W W O O ~
H ~ H ~ H ~ H ~ H ~ H ~ H
~~~.>~~~W ~~
A
00 01 lp o0 M ~ M O
N N M M M d' d' d' A P-~ P~, P~., P~..~ P~-~ P~-~ P~-~ P~-~

o, a M

O ~ o M o U O ,-r ~O 00 O O

M

M M

o O

U o M ~ M

O

M O M

N

N

O O\ ~ \ O \ O

,...,o ,.~p ,-~p pp ~ O O
O O

--m--y --~ N ~
~ ~

c~

O

.p H

V o 0 ,., o M
o M \ M

O
p ~

p O

N ~ ,..., d' ~ ,--.

N

O ~ o V'7 \ ~D

M N o~
O vO

o~

r, ,-, o y O o ~ o o~
'v \ M

M

O oo r, N N M
O O
.-a O

W O~ O
~

o o O o _ o ~O
M

~
~

O O~
O . M

V ~ ~ O
~ O
O

~ ~

H H H
w z p~ z ~~ z ~

a M

O

d' A p., P-~ P~

TABLE IV
PathoSeqEnterococcuEscherichiaPseudomonas Staphylococcus Clusters faecaliscoli aeruginosa aureus TD

15 EFA102326ECOl0I796 PAE100280 SAU102515 2286 EFA103268EC0103265 PAE104314 ~ SAU101756 4948 EFAIOlI60EC0103242 PAE104320 SAU100547 1721 EFAl01686EC0100663 SAU101996 PathoSeqEnterococcuEscherichiaPseudomonas Staphylococcus Clusters faecaliscoli aeruginosa aureus ID

911 PAElOS432 SAU1020S4 1337 EC0102S62 SAUl00S67 1350 EC0100930 PAE103901 ' 2156 EFAlOlISO SAU101271 PathoSeqEnterococcuEscherichiaPseudomonas Staphylococcus Clusters faecaliscoli aeruginosa aureus ID

3460 EFA102023 SAUl0I399 DEMANDE OU BREVET VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVET COMPREND
PLUS D'UN TOME.

~~ TTENANT LES PAGES 1 A 293 NOTE : Pour les tomes additionels, veuillez contacter 1e Bureau canadien des brevets JUMBO APPLICATIONS/PATENTS
THIS SECTION OF THE APPLICATION/PATENT CONTAINS MORE THAN ONE
VOLUME

NOTE: For additional volumes, please contact the Canadian Patent Office NOM DU FICHIER / FILE NAME
NOTE POUR LE TOME / VOLUME NOTE:

Claims

WHAT IS CLAIMED IS:

1. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

2. The method of Claim 1, wherein said culture includes at least one strain which does not overexpresses a gene product which is essential for proliferation of said organism.

3. The method of Claim 1, wherein said strains which overexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

4. The method of Claim 1, wherein said strains which overexpress said gene products a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.

5. The method of Claim 1, wherein said identification step comprises determining the nucleotide sequence of a nucleic acid encoding said gene product in said cell which proliferated more rapidly in said culture.

6. The method of Claim 1, wherein said identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture.

7. The method of Claim 6, wherein the products of said amplification reaction are labeled with a detectable dye.

8. The method of Claim 1, wherein said identification step comprises performing a hybridization procedure.

9. The method of Claim 1, wherein said identification step comprises contacting a nucleic acid array with a nucleic acid encoding said gene product in said cell which proliferated more rapidly in said cell culture.

10. The method of Claim 1, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa.

11. The method of Claim 1, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus arathracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia traclaomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacteriuna diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneunaoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia eraterocolitica, and Yersinia pestis.

12. The method of Claim 1, wherein said compound is obtained from a library of natural compounds.

13. The method of Claim 1, wherein said compound is obtained from a library of synthetic compounds.

14. The method of Claim 1, wherein said compound is present in a crude or partially purified state.

15. The method of Claim 1, further comprising determining whether said gene product in said strain which proliferated more rapidly in said culture has a counterpart in at least one other organism.

17. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

19. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain in said culture overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture.

23. The method of Claim 21, wherein at least one strain in said array does not overexpresses a gene product which is essential for proliferation of said organism.

24. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a plurality of cultures, wherein each culture comprises a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism;

contacting each of said cultures with a different concentration of said compound; and identifying the gene product which is overexpressed in a strain whose proliferation is inhibited by said compound.

25. The method of Claim 23, wherein at least one strain in said plurality of cultures does not overexpress a gene product which is essential for proliferation of said organism.

26. A method of profiling a compound's activity comprising performing the method of Claim 1 on a first culture using a first compound;
performing the method of Claim 1 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture.

28. The method of any one of Claims 26 and 27, wherein said first compound is present in a crude or partially purified state.

29. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

30. The method of Claim 29, wherein at least one strain in said culture does not underexpresses a gene product which is essential for proliferation of said organism.

31. The method of Claim 29, wherein said strains which underexpresess said gene products comprise a nucleic acid complementary to at least a portion of a gene encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

32. The method of Claim 29, wherein said strains which underexpress said gene products express an antisense nucleic acid complementary to at least a portion of a gene encoding said gene product which is essential for proliferation of said organism, wherein expression of said antisense nucleic acid reduces expression of said gene product in said strain.

33. The method of Claim 29, wherein said identification step comprises determining the nucleotide sequence of a nucleic acid encoding said gene product in said strain which proliferated more slowly.

34. The method of Claim 29, wherein said identification step comprises performing an amplification reaction to identify the nucleic acid encoding said gene product in said cell which proliferated more slowly.

35. The method of Claim 34, wherein the products of said amplification reaction are labeled with a detectable dye.

36. The method of Claim 29, wherein said identification step comprises performing a hybridization procedure.

37. The method of Claim 29, wherein said identification step comprises contacting a nucleic acid array with a nucleic acid encoding said gene product in said cell which proliferated more slowly.

38. The method of Claim 29, wherein said organism is selected from the group consisting of bacteria, fungi, protozoa.

39. The method of Claim 29, wherein said compound is obtained from a library of natural compounds.

40. The method of Claim 29, wherein said compound is obtained from a library of synthetic compounds.

41. The method of Claim 29, wherein said compound is present in a crude or partially purified state.

42. The method of Claim 29, further comprising determining whether said gene product in said strain which proliferated more slowly in said culture has a counterpart in at least one other organism.

43. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organismwherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

44. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is underexpressed;

contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

45. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ
ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is~
underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

46. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:

obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70%
nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN
version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

47. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%
nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than~
strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

48. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.:
3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress said gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture.

50. A method of profiling a compound's activity comprising performing the method of Claim 29 on a first culture using a first compound;
performing the method of Claim 29 on a second culture using a second compound; and comparing the strains identified in said first culture to the strains identified in said second culture.

52. The method of any one of Claims 49 and 50, wherein said first compound is present in a crude or partially purified state.

55. The culture of Claim 54, wherein said strains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

56. The culture of Claim 54, wherein said strains which overexpresess said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.

57. The culture of Claim 54, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.

59. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs.:
3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed.

61. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs:
8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed.

62. A culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.:

3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed.

65. The culture of Claim 64, wherein said strains which underexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a regulatable promoter.

66. The culture of Claim 64, wherein said strains which underexpress said gene products comprise a nucleic acid encoding said gene product which is essential for proliferation of said organism operably linked to a constitutive promoter.

67. The culture of Claim 64, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringers , Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.

69. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ TD NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is underexpressed.

71. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 With the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs:
8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is underexpressed.

72. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ TD NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.:

3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is underexpressed.

73. A culture comprising a a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 2S%
amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-S91S, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-S91S, 10013-14110 and 14945-15778 is underexpressed.

75. The method of Claim 74, wherein the nucleotide sequence of each of the genes encoding an overexpressed gene product has been altered by replacing the native promoters of said genes with promoters which facilitate overexpression of said gene products.

76. The method of Claim 74, wherein the nucleotide sequence of each of the genes encoding an overexpressed gene product has been altered by inserting a regulatory element into the native promoters of said genes with a promoter which facilitates overexpression of said gene products.

77. The method of Claim 76, wherein said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a transcriptional activator, a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA
and an upstream activating sequence.

78. The method of Claim 74, wherein the step of identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene comprises performing an amplification reaction and detecting a unique amplification product corresponding to said gene.

79. The method of Claim 75, wherein the native promoter of each of the genes encoding a gene product essential for proliferation is replaced with the same promoter.

80. The method of Claim 75, wherein the native promoters of the genes encoding gene products essential for proliferation are replaced with a plurality of promoters selected to give a desired expression level for each gene product.

81. The method of Claim 75, wherein said promoters which replaced the native promoters in each strain comprise regulatable promoters.

82. The method of Claim 75, wherein said promoters which replaced the native promoters in each strain each strain comprise constitutive promoters.

83. The method of Claim 74, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa.

84. The method of Claim 74, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigatus, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermoradii, Caradida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemopltilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogertes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.

86. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

87. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain overexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the overexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which do not overexpress said gene product on which said compound acts, such that strains which overexpress said gene product on which said compound acts proliferate more rapidly than strains which do not overexpress said gene product on which said compound acts; and identifying the gene product which is overexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

92. The method of Claim 91, wherein the nucleotide sequence of each of the genes encoding an underexpressed gene product has been altered by replacing the native promoters of said genes with promoters which facilitate underexpression of said gene products.

93. The method of Claim 91, wherein the nucleotide sequence of each of the genes encoding an underexpressed gene product has been altered by inserting a regulatory element into the native promoters of said genes with a promoter which facilitates underexpression of said gene products.

94. The method of Claim 93, wherein said regulatory element is selected from the group consisting of a regulatable promoter, an operator which is recognized by a repressor, a nucleotide sequence which is recognized by a transcriptional activator, a transcriptional terminator, a nucleotide sequence which introduces a bend in the DNA
and an upstream activating sequence.

95. The method of Claim 91, wherein the step of identifying the gene product which is underexpressed in a strain which proliferated more slowly in said culture by detecting the unique product corresponding to said gene comprises performing an amplification reaction and detecting a unique amplification product corresponding to said gene.

96. The method of Claim 92, wherein the native promoter of each of the genes encoding a gene product essential for proliferation is replaced with the same promoter.

97. The method of Claim 92, wherein the native promoters of the genes encoding gene products essential for proliferation are replaced with a plurality of promoters selected to give a desired expression level for each gene product.

98. The method of Claim 92, wherein said promoters which replaced the native promoters in each strain comprise regulatable promoters.

99. The method of Claim 92, wherein said promoters which replaced the native promoters in each strain each strain comprise constitutive promoters.

100. The method of Claim 91, wherein said organism is selected from the group consisting of bacteria, fungi, and protozoa.

101. The method of Claim 91, wherein said culture is a culture of an organism selected from the group consisting of Anaplasma marginale, Aspergillus fumigates, Bacillus anthracis, Bacterioides fragilis Bordetella pertussis, Burkholderia cepacia, Campylobacter jejuni, Candida albicans, Candida glabrata (also called Torulopsis glabrata), Candida tropicalis, Candida parapsilosis, Candida guilliermondii, Candida krusei, Candida kefyr (also called Candida pseudotropicalis), Candida dubliniensis, Chlamydia pneumoniae, Chlamydia trachomatus, Clostridium botulinum, Clostridium difficile, Clostridium perfringens, Coccidiodes immitis, Corynebacterium diptheriae, Cryptococcus neoformans, Enterobacter cloacae, Enterococcus faecalis, Enterococcus faecium, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Histoplasma capsulatum, Klebsiella pneumoniae, Listeria monocytogenes, Mycobacterium leprae, Mycobacterium tuberculosis, Neisseria gonorrhoeae, Neisseria meningitidis, Nocardia asteroides, Pasteurella haemolytica, Pasteurella multocida, Pneumocystis carinii, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella bongori, Salmonella cholerasuis, Salmonella enterica, Salmonella paratyphi, Salmonella typhi, Salmonella typhimurium, Staphylococcus aureus, Moxarella catarrhalis, Shigella boydii, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, Staphylococcus epidermidis, Streptococcus pneumoniae, Streptococcus mutans, Treponema pallidum, Yersinia enterocolitica, and Yersinia pestis.

102. The method of Claim 91, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is underexpressed.

103. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes and wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

107. A method for identifying the gene product on which a compound which inhibits proliferation of an organism acts comprising:
obtaining a culture comprising a plurality of strains wherein each strain underexpresses a different gene product which is essential for proliferation of said organism and wherein the nucleotide sequence of each of the underexpressed genes has been altered so as to include a nucleotide sequence which can be used to generate a unique product corresponding to each of the overexpressed genes , wherein said culture comprises a strain in which a gene product comprises a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is underexpressed;
contacting said culture with a sufficient concentration of said compound to inhibit the proliferation of strains of said organism which underexpress said gene product on which said compound acts, such that strains which underexpress said gene product on which said compound acts proliferate more slowly than strains which do not underexpress the gene product on which said compound acts; and identifying the gene product which is underexpressed in a strain which proliferated more rapidly in said culture by detecting the unique product corresponding to said gene.

109. The method of Claim 108, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.

110. The method of Claim 108 wherein:
said nucleic acid sample is divided into N aliquots;
said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.

111. The method of Claim 109, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.

112. The method of Claim 108, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.

113. The method of Claim 111, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.

114. The method of Claim 111, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.

115. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed or underexpressed;
performing an amplification reaction using a set of primer pairs which are complementary, to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.

116. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed or underexpressed;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.

117. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.

118. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70%
nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed;

performing an amplification reaction using a set of primer pairs which axe complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.

119. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%
nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.

120. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism , wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.

121. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;
obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;
performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;
performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;
and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products.

122. The method of Claim 121, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.

123. The method of Claim 121, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.

124. The method of Claim 121, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.

125. The method of Claim 121, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.

126. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;
obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;
performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;

performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;
and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID
NOs.: 8-3795 is overexpressed or underexpressed.

127. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;

obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;

performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;
performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;
and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed or underexpressed.

128. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;
obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;
performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;
performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;
and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.

129. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;
obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;
performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;
performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;

and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product selected from the group consisting of a gene product having at least 70% nucleotide sequence identity as determined using BLASTN
version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8 3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed.

130. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;
obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;
performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;
performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;
and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second cultures or collection of strains comprise a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID
NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ
ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed.

131. A method for identifying the target of a compound which inhibits the proliferation of an organism comprising:
obtaining a first nucleic acid sample comprising nucleic acids from a first culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains wherein each strain overexpresses or underexpresses a different gene product which is required for proliferation of said organism and wherein said culture or collection of strains has been contacted with said compound;
obtaining a second nucleic acid sample comprising nucleic acids from a second culture or collection of strains wherein said culture or collection of strains comprises the same strains as said first culture or collection of strains wherein said second culture or collection of strains has not been contacted with said compound;

performing a first amplification reaction on said first nucleic acid sample using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains;
performing a second amplification reaction on said second nucleic acid sample using the same set of primer pairs used in said first amplification reaction;

and comparing the amount of each amplification product in said first amplification reaction to the amount of that amplification product in said second amplification reaction, wherein an increased level of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products and a decreased level of of an amplification product in said first amplification reaction relative to said second amplification reaction indicates that the gene product corresponding to said amplification product is the target of said compound if said culture or strain overexpresses said gene products, wherein said first and second culture or collection of strains comprise a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.

132. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:

obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction.

133. The method of Claim 132, wherein one member of each primer pair for each of said genes is labeled with a detectable dye.

134. The method of Claim 132 wherein:
said nucleic acid sample is divided into N aliquots;
said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.

135. The method of Claim 134, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.

136. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed or underexpressed.

137. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed or underexpressed.

138. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.

139. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70%
nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN
version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed.

140. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:

obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed.

141. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which transcribe an antisense nucleic acid complementary to a different gene product which is required for proliferation of said organism;
performing an amplification reaction using a set of primer pairs which are complementary to nucleotide sequences within or adjacent to the nucleic acids which encode said antisense nucleic acids, wherein the members of said set of primer pairs are designed such that each primer pair would yield an amplification product having a length distinguishable from the lengths of the amplification products from the other primer pairs if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and determining the lengths of the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.

142. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction.

143. The method of Claim 142, wherein said primer pairs are divided into at least two sets, each primer pair comprises a primer which is labeled with a distinguishable dye, and the distinguishable dye used to label each set of primer pairs is distinguishable from the dye used to label the other sets of primer pairs.

144. The method of Claim 142 wherein:
said nucleic acid sample is divided into N aliquots;
said amplification reaction is performed on each aliquot using primer pairs complementary to nucleotide sequences within or adjacent to 1/N of the genes which encode said gene products, wherein one of the members of each primer pair in each aliquot is labeled with a dye and wherein the dyes on the primers in each aliquot are distinguishable from one another.

145. The method of Claim 144, further comprising pooling the amplification products from each of the aliquots prior to determining the lengths of the amplification products.

146. The method of Claim 142, wherein the native promoters of said genes which encode said gene products have been replaced with a regulatable promoter and one of the primers in said primer pairs is complementary to a nucleotide sequence within said regulatable promoter.

147. The method of Claim 146, wherein the native promoters for each of said genes were replaced with the same regulatable promoter.

148. The method of Claim 146, wherein more than one regulatable promoter was used to replace the promoters of said genes such that some of said genes are under the control of a different regulatable promoter.

149. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:

obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product whose activity or level is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 is overexpressed or underexpressed.

150. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 is overexpressed or underexpressed.

151. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising an amino acid sequence selected from the group consisting of SEQ
ID NOs.: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.

152. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product selected from the group consisting of a gene product having at least 70%
nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid having at least 70% nucleotide sequence identity as determined using BLASTN
version 2.0 with the default parameters to a nucleic acid encoding a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795, a gene product having at least 25% amino acid identity as determined using FASTA version 3.0t78 with the default parameters to a gene product whose expression is inhibited by an antisense nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8 3795 under stringent conditions, a gene product encoded by a nucleic acid which hybridizes to a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs.: 8-3795 under moderate conditions, and a gene product whose activity may be complemented by the gene product whose activity is inhibited by a nucleic acid comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 8-3795 is overexpressed or underexpressed.

153. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product encoded by a nucleic acid comprising a nucleotide sequence selected from the group consisting of a nucleic acid comprising a nucleic acid having at least 70%
nucleotide sequence identity as determined using BLASTN version 2.0 with the default parameters to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944, a nucleic acid comprising a nucleotide sequence which hybridizes to a sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under stringent conditions, and a nucleic acid comprising a nucleotide sequence which hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOS.: 3796-3800, 3806-4860, 5916-10012, and 14111-14944 under moderate conditions is overexpressed or underexpressed.

154. A method for determining the extent to which each of a plurality of strains are present in a culture or collection of strains comprising:
obtaining a nucleic acid sample comprising nucleic acids from a culture or collection of strains wherein said culture or collection of strains comprises a plurality of strains which overexpress or underexpress a different gene product which is required for proliferation of said organism;
performing an amplification reaction using primer pairs which are complementary to nucleotide sequences within or adjacent to the genes which encode said gene products, wherein said primer pairs are designed such that each primer pair would yield an amplification product which is distinguishable from the amplification products produced by the other primer pairs on the a basis selected from the group consisting of length, detectable label and both length and detectable label if a strain comprising the nucleotide sequences complementary to said primer pair is present in said culture or collection of strains; and identifying the amplification products obtained in said amplification reaction, wherein said culture comprises a strain in which a gene product comprising a polypeptide selected from the group consisting of a polypeptide having at least 25% amino acid identity as determined using FASTA version 3.0t78 to a polypeptide selected from the group consisting of SEQ ID NOs.:
3801-3805, 4861-5915, 10013-14110 and 14945-15778 and a polypeptide whose activity may be complemented by a polypeptide selected from the group consisting of SEQ ID NOs: 3801-3805, 4861-5915, 10013-14110 and 14945-15778 is overexpressed or underexpressed.