EP1337668A2 - Verfahren zur detektion von methylierungszuständen zur toxikologischen diagnostik - Google Patents

Verfahren zur detektion von methylierungszuständen zur toxikologischen diagnostik

Info

Publication number
EP1337668A2
EP1337668A2 EP01996625A EP01996625A EP1337668A2 EP 1337668 A2 EP1337668 A2 EP 1337668A2 EP 01996625 A EP01996625 A EP 01996625A EP 01996625 A EP01996625 A EP 01996625A EP 1337668 A2 EP1337668 A2 EP 1337668A2
Authority
EP
European Patent Office
Prior art keywords
protein
precursor
kinase
subunit
factor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01996625A
Other languages
English (en)
French (fr)
Inventor
Alexander Olek
Christian Piepenbrock
Kurt Berlin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Epigenomics AG
Original Assignee
Epigenomics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Epigenomics AG filed Critical Epigenomics AG
Publication of EP1337668A2 publication Critical patent/EP1337668A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/142—Toxicological screening, e.g. expression profiles which identify toxicity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the methylation states of toxicologically relevant genes are determined and the data acquired in this process are summarized for methylation patterns.
  • comprehensive prognostic statements can be made about the toxicological properties of substances.
  • a method is to be presented which enables the methylation positions of the genes to be examined to be analyzed to a large extent.
  • P- er ⁇ P- 1 P- er c P ⁇ ⁇ sQ 02 O C ⁇ ⁇ Q ⁇ o; r et P 1 CQ es s rt C ⁇ es rt iQ Q-DJ rt $. ⁇ rt P rt N es C ⁇ ⁇ PP "CQ rt es P 1 u • ⁇ > Q ⁇ N er N ⁇ md I- 1 o P- CU ⁇ g ⁇ » c CL vQ P- ⁇ P- P- P- ⁇ ! P 1 P CL ⁇ er n ⁇ • ⁇ P ⁇ d
  • P- t ⁇ CQ s P- ⁇ ⁇ es es P- ⁇ ⁇ P- ⁇ • ö 1 rt ⁇ ⁇ P es iQ ⁇ 1 co ⁇ ⁇ ⁇ C ⁇ ⁇ 3 er ⁇ P- 1 P 1 • rt ⁇ 1 es C ⁇ ⁇ P ⁇ es P- 3 er ⁇ co P- "d 1 1 es 1 rt P, rt f Hi
  • Fluorescence-labeled probes have been used in many cases for scanning an immobilized DNA array.
  • the simple attachment of Cy3 and Cy5 dyes to the 5-OH of the respective probe is particularly suitable for fluorescent labels.
  • the fluorescence of the hybridized probes is detected, for example, using a confocal microscope.
  • the dyes Cy3 and Cy5, among many others, are commercially available.
  • Matrix-assisted laser desorption / ionization mass spectrometry is a very powerful development for the analysis of biomolecules (Kara, M. and Hillenkamp, F. (1988), Laser desorption ionization of proteins with molecular asses exeeding 10,000 daltons. Anal. Che. 60: 2299-2301).
  • An analyte is in embedded a light absorbing matrix. The matrix is evaporated by a short laser pulse and the analyte molecule is thus transported unfragmented into the gas phase. The ionization of the analyte is achieved by collisions with matrix molecules.
  • An applied voltage accelerates the ions into a field-free flight tube. Due to their different masses, ions are accelerated to different extents. Smaller ions reach the detector earlier than larger ones.
  • Genomic DNA is obtained by standard methods from DNA from cell, tissue or other test samples. This standard methodology can be found in references such as Fritsch and Maniatis eds. , Molecular Cloning: A Laboratory Manual, 1989.
  • the present invention is intended to provide a method which is suitable for the diagnosis of methylation states of genes with toxicological relevance.
  • the invention is based on the finding that cytosine methylation states in particular are particularly suitable for diagnosing changes in the expression of genes with toxicological relevance.
  • the present invention describes a method for
  • a genomic DNA sample is preferably chemically treated in such a way that at the 5'-position unmethylated cytosine bases are converted into uracil, thymine or another base which is not similar to cytosine in terms of hybridization behavior. This is understood below as chemical pretreatment.
  • the base sequence of a part of the chemically treated DNA is determined and the methylation states characteristic of the sample are inferred.
  • fragments are preferably first amplified from the chemically pretreated genomic DNA using preroligonucleotides.
  • More than 10 different fragments that are 100-2000 base pairs long are preferably amplified.
  • the amplification is carried out by means of the polymerase chain reaction (PCR), a thermostable DNA polymerase preferably being used.
  • PCR polymerase chain reaction
  • the set of primer oligonucleotides comprises at least two oligonucleotides, the sequences of which are each reversely complementary or identical to a section of the sequences of the genes to be examined that is at least 18 base pairs long.
  • the preroligonucleotides are preferably characterized in that they contain no CpG dinucleotide.
  • At least one of the two primer oligonucleotides used to amplify a specific section of the chemically pretreated DNA preferably contains identifiable markings.
  • the labels of the amplified products are fluorescent labels.
  • the labels of the amplificates are radionuclides.
  • the markings of the amplificates are detachable molecular fragments with a typical mass, which are detected in a mass spectrometer.
  • the amplicons, fragments of the amplicons or probes complementary to the amplicons are detected in the mass spectrometer.
  • the fragments generated have a single positive or negative net charge for better detectability in the mass spectrometer.
  • MALDI matrix-assisted laser desorption / ionization Mass spectrometry
  • ESI electrospray mass spectrometry
  • At least one primer oligonucleotide is bound to a solid phase during the amplification.
  • the probe oligonucleotides or PNA oligomers are preferably bound to a solid phase at defined locations.
  • oligonucleotides and / or PNA oligomer sequences are arranged on a flat solid phase in the form of a rectangular or hexagonal grid.
  • the solid phase surface preferably consists of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver or gold.
  • the amplificates are hybridized to a set of at least 10 oligonucleotide or the PNA oligomer probes.
  • the amplificates serve as samples that hybridize to oligonucleotides previously bound to a solid phase.
  • Hybridization in the sense of this invention is to be understood as binding with the formation of a duplex structure of an oligonucleotide to a completely complementary sequence in the sense of the Watson-Crick base pairings in the sample DNA. The non-hybridized fragments are then removed.
  • Said oligonucleotides comprise at least one base sequence with a length of 13 nucleotides, which is reverse complementary or identical to a section of the base sequences of the genes to be examined.
  • the cytosine of the CpG dinucleotide is the 5th to 9th nucleotide from the 5 'end viewed from the 13s.
  • the said PNA oligomers comprise at least one base sequence with a length of 9 nucleotides, which is reverse complementary or identical to a section of the base sequences of the genes to be examined, which contains at least one CpG dinucleotide.
  • the cytosine of the CpG dinucleotide is the 4th to 6th nucleotide as seen from the 5 'end of the 9 mer.
  • the non-hybridized amplificates are removed.
  • the hybridized amplificates are detected.
  • markings attached to the amplifiers can be identified at any position of the solid phase at which an oligonucleotide sequence is located.
  • the method is preferably used to diagnose and / or predict adverse events for patients or individuals, these adverse events being associated with the diagnosis of toxicologically significant parameters.
  • the method is used for the diagnosis and / or prognosis of adverse events for patients or individuals, these adverse events being related to the diagnosis of toxicologically important parameters.
  • the set of genes to be examined includes at least one of the genes in Tab. 1 genes or sequences that are identical in the area of the exons or at least 85% homologous to those in Tab. 1 genes listed.
  • Lactotransferrin precursor Lactoferrin precursor
  • Apolipoprotein A-I precursor (APOAI) X00566
  • Apolipoprotein A-II precursor (APOAI I) X00955 Apolipoprotein C-III precursor (APOCIII) X01388
  • CSF1 CSF
  • CSF CSF
  • FAC1 familial intrahepatic cholestasis 1 protein
  • VEGFD C-FOS-induced growth factor
  • Complement component 4 binding protein alpha C4B binding protein; C4BPA
  • IGF2 Insulin-like growth factor II
  • GM-CSF CSF2 M11220 epidermal growth factor precursor (EGF);
  • GGFHPP2 Glial growth factor 2 precursor
  • T cell specific Rantes protein precursor sis delta
  • small inducible cytokine A5 SCYA5
  • SYA5 small inducible cytokine A5
  • IGFBP1 Placenta protein 1 (PP12) M31145
  • VEGF Vascular Endothelial Growth Factor Precursor
  • VPF Vascular Permeability Factor
  • HGF Hepatocyte growth factor
  • Thymosin beta-10 TMSB10; THYB10; PTMB10 M92381
  • Interferon gamma-induced protein precursor (gamma-IPIO) X02530
  • OX40 ligand OX40L
  • GP34 tax-transcriptionally activated glycoprotein 1
  • TGF-beta3 transforming growth factor beta 3 J03241
  • Delta-like protein precursor U15979; Z12172 Insulin-like growth factor IA precursor (IGF1A); IGFBP1; So atomedin C + insulin-like growth factor I (IGF1) 27544 + M37484 CG chemokine-eotaxin precursor; eosinophil chemotactic protein; small inducible cytokine All (SCYA11) D49372; Z75669;
  • Interleukin-1 receptor antagonist protein precursor IL-1RA; IRAP
  • MIC1 macrophage inhibitor cytokine 1
  • Eosinophil Gramule Major Basic Protein Precursor (MBP); Affiliation-associated major-basic protein; bone marrow proteoglycan 2 Y00809 Insulin-like growth factor-binding protein 3 precursor (IGF-binding protein 3;
  • IGFBP3 IGFBP3
  • IBP3 IBP3
  • M31159 M35878 cellular retinoic acid binding protein II (CRABP2)
  • CRABP2 cellular retinoic acid binding protein II
  • Corticotropin-releasing factor precursor Corticotropin release factor (CRF); Corticotropin release hormone (CRH) V00571
  • Interferon gamma precursor IFN-gamma; IFNG; Immune interferon X01992; M29383
  • Interleukin-2 precursor IL-2
  • T cell growth factor TCGF
  • Interleukin-1 alpha precursor IL-1 alpha
  • ILlA Interleukin-1 alpha precursor
  • IL-4 Hematopoietin-1 X02851 interleukin-4 precursor
  • BSF-1 B cell stimulation factor 1
  • Interleukin-6 precursor IL-6
  • BCF2 B cell stimulation factor 2
  • IFNB2 Interferon beta-2
  • Hybridoma growth factor X04602 14584 Interleukin-5 precursor (IL-5); T cell
  • TRF substitution factor
  • IL-12B cytotoxic lymphocyte maturation
  • NKSF2 M65290 Interleukin-12 alpha subunit precursor
  • IL-12A cytotoxic lymphocyte maturation
  • NKSF1 M65291 Pancreatitis Associated Protein 1 Precursor D13510
  • Alpha-1-acid-glycoprotein-1 precursor (AGP1);
  • Prostaglandin G / H synthasel (PGH synthase-1;
  • 5-hydroxytryptamine ID receptor (5-HT-ID; HTR1D); Serotonin receptor M89955
  • Dopamine beta hydroxylase (DBH); Dopamine beta monooxygenase precursor X13255
  • EPOR Erythropoietin Receptor M60459 cation-independent mannose-6-phosphate receptor precursor (Cl Man-6-P receptor; CI-MPR); Insulin- like growth factor II receptor (IGFR II) Y00285; J03528
  • ACTRIIA Activin receptor type II precursor
  • Retinoid X receptor GAMMA RXR-GAMMA
  • TEZ transcriptional enhancer factor
  • LDL receptor Low-density lipoprotein receptor
  • Sulfonylurea receptor 2A (SUR2A) AF061323
  • SUR Sulfonylurea receptor
  • CTNNA1 Alphal catenin
  • Cadherin-associated Cadherin Alphal catenin (CTNNA1); Cadherin-associated
  • Integrin-alpha-9 (ITGA9); Integrin alpha RLC D25303; L24158 interzullar adhesion molecule 1 precursor (ICAM1); Main group rhinovirus receptor; CD54 antigen J03132
  • E-selectin precursor SELE
  • Endothelial Leukocyte Adhesion Molecule 1 ELAMl
  • Leukocyte endothelial cell adhesion molecule 2 LCAM2
  • CD62E antigen M30640 NADH-ubiquinone dehydrogenase-1-beta subcomplex 7 18kDa subunit (NDUFB7)
  • Complex-I-B18 CI-B18
  • Cell Adhesion Protein SQM1 M33374 Neural Cadherin Precursor N-Cadherin; NCAD
  • Cadherin 2 CDH2 M34064; X57548; X54315; S42303
  • Integrin alpha 5 (ITGA5); VLA5; CD49E antigen X06256
  • Fibronectin receptor beta subunit FNRB
  • Integrin alpha L (ITGAL); Leukozytahpsions-
  • LFA1 CDllA antigen Y00796 cadherin-6 precursor (CDH6); Kidney-cadherin
  • Cadherin 12 (CDH12); Brain cadherin precursor (Br-cadherin); neural cadherin 2 (N-cadherin 2) L34057; L33477
  • T-cadherin Cardiac cadherin (H-cadherin) L34058; U59289;
  • Cadherin 3 (CDH3); Placenta-cadherin precursor (P-cadherin; CDHP) X63629
  • CBP-I Placenta anticoagulant protein I
  • PAP-I Placenta anticoagulant protein I
  • PP4 Thromboplastin inhibitor
  • Anticoagulant alpha (VAC-alpha; anchorin CII X12454
  • Aminin alpha 1 subunit precursor (LAMA1);
  • FABP1 Liver Fatty Acid Binding Protein 1
  • LFABP LFABP
  • TNF-alpha stimulated ABC protein TSAP AF027302
  • Organic Cation Transporter Protein 2 (ORCTL2) AF037064 Organic Cation Transporter N2 (OCTN2) AF057164 MRP / Organic Cation Transporter (MOAT-B) AF071202 Adrenoleukodystrophy-Related Protein (ALDR) AJ000327 Skeletal Muscle Adenine Nucleotide (transliterate nucleotide) ANT1); Heart / skeletal muscle ADP / ATP carrier protein isoform Tl; ADP / ATP translocase 1 J02966
  • DDA Down-regulated protein in adenoma
  • UCP3 mitochondrial decoupling protein-3
  • CPTase mitochondrial carnitine palmitoyl transferase-II precursor
  • CPT2 mitochondrial carnitine palmitoyl transferase-II precursor
  • PTT Prostaglandin transporter
  • SLC21A2 dissolved carrier family 21 member 2
  • U70867 mitochondrial decoupling protein 2 U82819
  • Bile salt export pump (BSEP) AF091582
  • Anthracycline resistance associated protein (ERA) X95715 kidney transporter for organic cation X98333
  • MRP3 Multi-resistance associated protein 3
  • Antigen-peptide transporter 2 APT2
  • Peptide delivery factor 2 PSF2
  • TAP2 peptide transporter
  • MLR / TAP ATP-binding cassette subfamily B
  • ABCC3 HLA class II histocompatibility antigen DO-beta
  • Nucleotide sensitive chloride channel 1A Chloride ion current inducer protein (CLCI); Reticulocyte PICLN X91788 Transporter A for neutral amino acid (SATT); Alanine / Serine / Cysteine / Threonine Transporter (ASCT1) L14595 Monocarboxylate Transporter-1 (MCT1) L31801
  • CLCI Chloride ion current inducer protein
  • SATT Reticulocyte PICLN X91788 Transporter A for neutral amino acid
  • ASCT1 Alanine / Serine / Cysteine / Threonine Transporter
  • MCT1 Monocarboxylate Transporter-1
  • Ileal sodium-dependent bile salt transporter ISBT
  • Ileal sodium / taurocholate co-transporting polypeptide NTCP2
  • SLC10A2 U10417 sodium-dependent bile salt cotransporter hepatic natriu / taurocholate co-transporting polypeptide (NTCP)
  • GLYT-1 S70609 Cystic Fibrosis Transmembrane Conductivity Regulator
  • CFTR cAMP-dependent chloride channel M28668 channel-shaped multispecific transporter for organic anion
  • MRP2 Multi-resistance associated protein 2
  • U63970 multi-resistance channel-associated protein
  • Gap junction beta-l protein (connexin 32)
  • Cadherin 1 (CDH1); epithelial cadherin precursor (E-cadherin; CDHE); Uvomorulin (UVO); CAM 120/80 Z13009 smoothed; GX U84401
  • ⁇ phrin type A receptor 2 precursor epithelial cell kinase (ECK); Tyrosine protein kinase receptor ECK M59371 M36395 NADPH cytochrome p450 reductase S90469
  • NCK melanoma cytoplasmic src homolog HSNCK
  • Dual-specificity mitogen-activated protein kinase kinase-1 MAP kinase kinase 1; MAPKK 1; MKK1
  • extracellular signal-regulated kinase 1 ⁇ RK
  • JNK1 c-jun N-terminal kinase 1
  • Mitogen-activated protein kinase p38 MAP kinase p38
  • Cytokine suppressive "anti-inflammatory" drug-binding protein CSAID-binding protein; CSBP
  • MAX MAX interacting protein 2 (MXI2) L35253; L35263
  • Protein kinase C beta I (PKC-beta-1) M27545; X06318
  • Mitogen-activated protein kinase 9 MAP kinase 9; MAPK9; PRKM9; "c-jun" N-terminal kinase 2 (JNK2); JNK55 L31951
  • MAPK / ⁇ RK kinase 6 MAPK / ⁇ RK kinase 6; SAPKK3 U39657 p21 activated kinase gamma (PAK gamma; PAK2);
  • Mitogen-activated protein kinase P38 beta MAP Kinase P38 beta
  • MAPK / ERK kinase kinase 3 (MEK kinase 3; MEKK3) U78876 dual-specificity mitogen-activated protein kinase
  • MAP Kinase Kinase 2 (MAP Kinase Kinase 2; MAPKK 2); ERK activator kinase 2; MAPK / ERK Kinase 2 (MEK2) L11285 dual-specificity mitogen-activated protein kinase
  • MAP Kinase Kinase 5 (MAP Kinase Kinase 5; MAPKK 5) U25265 ribosomal protein S6 kinase II alpha 1 (S6KII-alpha 1); ribosomal S6 kinase 1 (RSK1) L07597 B lymphocyte germ center kinase (GC kinase) U07349
  • Protein tyrosine phosphatase MEG2 (PTPASE-MEG2) M83738 Protein tyrosine phosphatase alpha precursor (R-PTP-alpha; PTPRA; PTPA) M34668 diabetes-associated RAS (RADI) L24564
  • calbindin Avian-type vitamin .D-dependent calcium binding protein (CABP); D-28K X06661
  • Cell marker protein 1 HME1 AF029082 FKBP rapamycin associated protein (FRAP);
  • Zinc finger protein 37 (ZFP37); KRAB-zinc Region
  • CCAAT / enhancer-binding protein epsilon (C / EBP Epsilon; CEBPE) U48866; U48865
  • RPL6 60S ribosomal protein L6
  • TAXREB107 TAX-responsive enhancer element binding protein 107
  • Zinc finger protein 40 (ZNF40); human immunodeficiency virus type I enhancer binding
  • MBP-1 Complex binding protein 1 (MBP-1); positive regulator region II binding factor 1
  • N-oct3 Transcription factor N-oct3; N-oct5A &N-oct5B;
  • hypoxia-inducible factor 1 alpha ARNT interacting protein
  • DNA binding protein inhibitor Id-2 M97796 activating transcription factor 4 (ATF4);
  • Tax-responsive enhancer element B67 (TAXREB67); cAMP response element binding protein 2 (CREB2) D90209
  • HSF1 Heat shock factor protein 1
  • HSTF1 Heat shock transcription factor 1
  • TCF5 TCF5 M64673
  • FK506 binding protein 13 precursor FKBP13
  • FKBP2 Peptidyl prolyl cis trans isomerase (PPIase) M65128 cAMP response element binding protein (CRE-BPl); Transcription factor ATF2; HB16 M31630 cAMP Response Element Binding Protein (CREB) M34356 Initial Growth Response Protein 1 (EGR1); Transcription factor ETR103; KROX24; Zinc finger protein 225 (ZNF225); AT225 X52541; M62829 tristetraproline (TTP); TISll; ZFP36; Growth factor-inducible core protein 475 (NUP475) M92843 purine-rich single-stranded DNA-binding protein alpha (PURA) M96684 transcription factor-relB; I-rel M83221 cyclic AMP-dependent transcription factor ATF-3 (activating factor FACTOR 3) L19871 octamer-binding transcription factor 1 (oct-1; OTF1); Octamer binding protein NF-AI; P
  • PRB binding protein E2F1 Retinoblastoma binding protein 3 (RBBP3); Retinoblasto Associated Protein 1 (RBAP1); PBR3 M96577
  • Retinoic acid receptor alpha Retinoid X receptor alpha (RXRA) X52773
  • Methyl CpG binding protein 2 (MECP2) L37298
  • Precursor (ERP60); 58-kDa microsomal protein;
  • HSC70 interacting protein Progesterone receptor-associated P48 protein U28918
  • PAF-2 Peroxisome assembly factor-2
  • MMP-Xl Membrane type matrix metalloproteinase 1
  • TRIP1 Erythroid potentiating activity (EPA); Fibroblast collagenase inhibitor X03124 alpha-1-antichymotrypsin precursor (ACT) K01500 alpha-1-antitrypsin precursor; alpha-1-protease
  • DBPA DNA binding protein A
  • CSDA Cold Shock Region Protein A
  • Decoy receptor 3 (DCR3) AF104419
  • Replication factor C-36 kDa subunit RRC36
  • Replication factor C-38 kDa subunit RRC38
  • TOP2A DNA topoisomerase II alpha
  • PCNA cyclic nuclear antigen
  • TTT terminal deoxynucleotidyl transferase
  • DNTT M11722 K01919
  • XPG X-ray repair-complementing defective repair in Chinese hamster cells 5" (XRCC5) L20046; X69978
  • TAA Thyroid lupus autoantigen
  • CTCBF CTC box binding factor 85kDa subunit
  • Xeroderma pigmentosum group B complementary Protein XPB
  • ERCC3 "excision repair cross-complementing rodent repair deficiency complementation group 3"(ERCC3)
  • basilar transcription factor 2-89kDa subunit BTF2-p89; TFIIH-89kDa subunit
  • M31899 Ku-70kDa subunit ATP-dependent DNA helicase II 70kDa subunit
  • Lupus-ku autoantigen protein P70 Thyroid lupus auto antigen
  • CTC Box Binding Factor 75kDa Subunit CTC75 M32865; S38729
  • Ubiquitin-conjugating enzyme E2 17-kDa UBE2A Ubiquitin-protein ligase; Ubiquitin carrier protein; HR6A M74524
  • POLA DNA polymerase alpha catalytic subunit
  • MGMT 6-O-methylguanine DNA methyl transferase
  • XPD methylated DNA protein cysteine methyl transferase
  • XRCC221 Xeroderma pigmentosum group D complementary protein
  • HHR23B Xeroderma Pigmentosum Group C Repair Complementing Complex 58-kDa ProteinD21090 HHR23A; UV excision repair protein Protein RAD23A D21235 DNA-dependent protein kinase (DNA-PK) +
  • DNA-PK catalytic subunit U35835 + U47077
  • TDG thymine DNA glycosylase
  • Uracil DNA glycosylase precursor (UNG1) X15653
  • DNA (apurine or apyrimidine site) lyase
  • APE1 AP endonuclease 1
  • APEX apurinic / apyrimidine endonuclease
  • APEN APEX nuclease
  • REF1 X59764 X66133
  • DNase I Deoxyribonuclease I M55983 dual specificity protein phosphatase 9;
  • PRAD1 Parathyroid adenomatosis 1
  • CDK7 Protein kinase 7
  • CAK CDK activating kinase
  • CDK2 Cyclin-dependent protein kinase 2
  • Mitogen-activated protein kinase 2 (MAP kinase 2; MAPK 2); p42-MAPK M84489
  • Mitogen-activated protein kinase 3 (MAPK3; PRKM3);
  • MAPK1 extracellular signal-driven
  • ERK1 ERK1
  • Microtubule-associated protein-2 ERK1
  • MAP kinase 3 (MAPK3; p97-MAPK); PRKM5 X80692
  • CDK4 CDK4
  • CDC2 Cell division control protein 2 homolog
  • p34 protein kinase Cyclin-dependent kinase 1 (CDKl) X05360 extracellular signal-driven kinase 4 (ERK4)
  • ERK4 extracellular signal-driven kinase 4
  • MAPK4 MAP kinase 4
  • PRKM4 PRKM4 X59727
  • CDK5 Cell division protein kinase 5
  • tau protein tau protein
  • PSSALRE X66364 extracellular signal-driven kinase 6 (ERK6); Stress-activated protein kinase-3; Mitogen-activated protein kinase p38 gamma; (MAP kinase p38 gamma) X79483
  • CDKN1A Cyclin-dependent kinase inhibitor 1A
  • MDA6 Melanoma differentiation-associated protein 6
  • CDK-interacting protein 1 (CIP1); AF1; SDI1 U09579; L25610 weelHu CDK tyrosine 15 kinase; wee-1-like protein kinase U10564
  • CDKN2B Cyclin-dependent kinase 4 inhibitor 2B
  • pl4-INK4B Polytumor suppressor 2 (MTS2) U17075; L36844
  • DNA binding protein inhibitor ID-1 DNA binding protein inhibitor ID-1; Id-IH D13889
  • Prothymosin alpha (PROT-alpha; PTMA) M26708
  • GEF Growth inhibitor factor
  • MT-III Metallothionein-III
  • M93311 Growth inhibitor factor
  • HSP40 heat shock protein 1
  • DNAJ protein 40kDa heat shock protein 1 (HSP40); DNAJ protein
  • HDJ1 Homolog 1 (HDJ1; DNAJ1) D49547
  • HSP60 heat shock protein
  • HSPDl 60kDa heat shock protein
  • HSP90A heat shock protein A
  • HSP86 HSPCA X07270 27kDa heat shock protein
  • SRP27 Stress responsive protein 27
  • 24kDa estrogen-controlled protein HSPB1 X54079
  • Cytochrome P450 IIA6 (CYP2A6) + CYP2A7 + CYP2A13 + CYP2A7PT + CYP2A7PC M33318; M33316 + U22029 + U22030 + U22044
  • Cytochrome P450 IIB6 (CYP2B6) + CYP2B3 M29874; J02864 Cytochrome P450 IIIA3 (CYP3A3) + CYP3A4 + CYP3A5 + CYP3A7 M13785 + M18907 + J04813 + D00408 Cytochrome P450 IVA11 (CYP4A11) L04751
  • Cytochrome P450 VIIA1 (CYP7A1) X56088
  • DAMOX D-amino acid oxidase
  • Cytochrome P450 HEI CYP2E1 J02625 Cytochrome P450 IIF1 (CYP2F1) J02906
  • Cytochrome P450 IVB1 (EC 1.14.14.1) (P450-HP) J02871 cytochrome P450 IA2 (P450-P3) (P450-4) Z00036 plasma glutathione peroxidase precursor (GPXP; GPX3) D00632; X58295 natural killer cell enhancing factor (NKEFB) + thiol-specific antioxidant protein (TSA); Thioredoxin peroxidase 1 (TDPX1); Thioredoxin-dependent peroxide reductase 1 L19185 + Z22548; X82321
  • TDPX2 Thioredoxin peroxidase 2
  • TDPX2 Thioredoxin-dependent peroxide reductase 2
  • PAG Proliferation-associated gene
  • NKEFA natural killer cell enhancing factor A
  • GRase glutathione reductase
  • GSR GSR
  • GR X15722 microsomal glutathione S-transferase 12
  • Glutathione-S-transferase pi GSTP1; GST3 X08058; M24485 glutathione peroxidase (GSHPX1; GPX1) Y00483; M21304 glutathione-S-transferase theta 1 (GSTTl) X79389 methallothionein IH (MT1H); MetallothineinO (MT0) + MT1I; MT2 + MT1L + MT1R X64177 + X97260 + X76717 + X97261
  • Glutathione peroxidase gastrointestinal GSHPX-GI
  • Glutathione peroxidase-related protein 2 GPRP
  • X53463 heme oxygenase 1 HOl
  • Glutathione-S-transferase ul (GSTM1; GST1); HB
  • Glutathione-S-transferase AI GTH1; GSTA1; HA-
  • Subunit 1 GST-epsilon M25627 Glutathione-S-Transferase (GST) homolog U90313
  • Glutathione synthetase GSH synthetase
  • NAD H-dehydrogenase
  • Quinone reductase Quinone reductase
  • DT diaphorase Azoreductase
  • Phylloquinone reductase Phylloquinone reductase
  • Transcript 1 M60974 tumor necrosis factor alpha precursor (TNF-alpha;
  • Lymphotoxin alpha precursor (LT-alpha); Tumor-alpha
  • Necrosis factor beta (TNF-beta; TNFB) D12614 fas antigen ligand (FASL); Apoptosis antigen ligand (APTL; APT1LG1); TNFSF6 D38122; U08137
  • TNFR Tumor necrosis factor receptor
  • TNFR2 Tumor necrosis
  • TBP2 Factor binding protein 2
  • TFR1 Tumor necrosis factor receptor 1
  • TBP1 Tumor necrosis factor binding protein 1
  • CD120A-TNFR1 Tumor necrosis factor receptor 1
  • TBP1 Tumor necrosis factor binding protein 1
  • Antigen M33294 fasL receptor Apoptosis-supporting surface
  • Retinoic acid receptor beta (RXR-beta; RXRB) M84820; X63522;
  • CD27BP (Siva) U82938 Tumor Necrosis Factor Ty ⁇ -1 Receptor Associated
  • Interleukin-1 beta convertase precursor IL-1BC
  • IL-1 beta converting enzyme ICE
  • p45 IL-1 beta converting enzyme
  • Caspase-6 precursor (CASP6); Cysteine protease MCH2 isoforms alpha + beta U20536 + U20537 Caspase-4 precursor (CASP4); ICH-2 protease; TX protease; ICE (REL) -II + caspase-5 precursor
  • TNF-related apoptosis inducing ligand TRAIL
  • APO-2 ligand APO-2 ligand
  • Caspase-8 precursor (CASP8); ICE-like apoptotic protease 5 (ICE-LAP5); MORTl-associated CED-3 homolog (MACH); FADD homolog ICE / CED-3-like protease (FADD-like ICE; FLICE); apoptotic cysteine protease MCH-5 U60520; U58143;
  • NIP3 U15174 bcl2 homologous antagonist / killer (BAK) Ü23765; U16811;
  • X84213 induced myeloid leukemia cell differentiation protein MCL-1 L08246 BAD protein; bcl-2 binding component 6 (BBC6); bcl-2L8 U66879
  • BAG-1 BCL-2 binding Athanogen-1 (BAG-1); Glucocorticoid receptor-associated protein
  • Interferon-inducible RNA-dependent protein kinase (P68 kinase) M35663; U50648 inducible nitric oxide synthase (INOS); Type II NOS; Hepatocyte NOS (HEP-NOS) L09210
  • CLU Clusterin precursor
  • SP-40 Complement-associated protein SP-40
  • CLI Complement lysis inhibitor
  • APOJ Apolipoprotein J
  • TRPM2 Testosterone Repressed Prostate "Message” 2
  • SGP2 sulfated glycoprotein 2
  • GADD153 Growth style stand & DNA damage inducible Protein 153 (GADD153); DNA damage inducible
  • Inhibitor of apoptosis protein 1 (HIAPl; API1) + IAP homolog C; TNFR2-TRAF Signaling Complex Protein 1;
  • MYC Avian Myelocytomatosis Viral Oncogene Homolog
  • Subunit precursor (PDGFB; PDGF2); Bacaplermin; c-sis X02811 X02744; M12783 M16288 p53 cellular tumor antigen M14694 M14695
  • B-MYB MYB-related protein B
  • MYBL2 Avian Myeloblastosis Viral Oncogene Homologous Type 2 (MYBL2) X13293 Triiodothyronine Receptor; Thyroid hormone receptor
  • THRA1 v-erbA-related protein Protein ear-1 M24898 "jun” proto-oncogene; Avian Sarcoma Virus 17 Oncogene Homolog; Transcription factor AP-1 J04111 Insulin-like growth factor binding protein 2
  • IGFBP2 IGFBP2 M35410 c-myc purine binding transcription factor puf;
  • NDP kinase B Nucleoside diphosphate kinase B (NDP kinase B; NDKB)
  • BRCA2 Breast Cancer Type 2 Susceptibility Protein (BRCA2) U43746 fos-related antigen (FRA1); fosLl X16707 nucleus phosphoprotein B23; Nucleophosmin (NPM);
  • Numatrin M23613 c-myc binding protein MM-1 D89667 c-fos proto-oncogene; G0S7 protein K00650 met-proto-oncogene; Hepatocyte growth factor receptor precursor (HGF-SF receptor) J02958
  • NDKA Nucleoside diphosphate kinase A
  • NDP NDP kinase A
  • Tumor metastatic process-associated protein Tumor metastatic process-associated protein
  • Matrix metalloproteinase 11 MMP11
  • Stromelysin 3 X57766 box-dependent myc-interacting protein 1 U68485 H-ras proto-oncogene
  • transforming G protein V00574 protein tyrosine phosphatase PTEN mutates in various advanced cancers 1 (MMAC1)
  • GRP 78 Immunoglobulin heavy chain binding protein (BIP) M19645
  • Interleukin-10 precursor IL-10
  • Cytokine Synthesis Hem Factor M57627
  • TX Thioredoxin
  • ADF ATL-derived factor
  • SASP Surface Associated Sulphydryl Protein
  • ENOl surface Associated Sulphydryl Protein
  • NNE non-neural enolase
  • PPH Phosphopyruvate hydratase
  • Biliverdin reductase A precursor BLVRA; BVR
  • TAT U34877 tyrosine aminotransferase
  • I-tyrosine 2-oxoglutarate aminotransferase X52520
  • Phosphoglyceride kinase 1 (PGK1; PGKA); primer
  • Detection protein 2 PRP2
  • G6PD glucose-6-phosphate dehydrogenase
  • X03674 mitochondrial phosphoenolpyruvate carboxykinase-2
  • GTA Galactosyltransferase-associated protein kinase p58
  • Subunit 1 D13900 peroxisomal bifunctional enzyme L07077 peroxisomal acyl-CoA oxidase branched subunit (BRCOX) X95190
  • Cytochrome P450 XVIIA1 (CYP17A1) M14564 peroxisomal 3-ketoacyl-CoA thiolase precursor
  • PHA2 Lung group IB phospholipase A2 precursor
  • DHFR Dihydrofolate reductase
  • Thymidylate synthase (TYMS; TS) X02308 cytosolic thymidine kinase (TK1) K02581
  • UDP-glucuronosyltransferase-2B15 precursor UDP-glucuronosyltransferase-2B15 precursor
  • UGT2B15 + microsomal 2B10 precursor UGT2B15 + microsomal 2B10 precursor (UDPGT);
  • GLCLC GLCLC, GLCL (glutamate-cysteine ligase catalytic subunit, gamma-glutamylcysteine synthetase) M90656 gamma-glutamyl hydrolase precursor (GGH; GH); Folyl polygammaglutamyl hydrolase; gamma-glu-X carboxypeptidase; Conjugase U55206 3 '-phosphoadenosine-5' -phosphosulfate synthase 1
  • PAPS synthase 1 PAPSS1
  • PAPS synthetase 1 Sulfurylase Kinase 1 (SKI) Y10387 soluble glutamate oxaloacetate transaminase 1 (GOT1); cytoplasmic aspartate aminotransferase 1;
  • acyl-CoEnzyme-A-Oxidase S69189 "very-long-chain" -specific acyl-CoA-dehydrogenase precursor (VLCAD) D43682 glutamate-cysteine ligase regulatory subunit
  • Cytochrome P450 VA1 (CYP5A1) M80647 mitochondrial aldehyde dehydrogenase precursor (class 2); ALDHI; ALDH2 Y00109
  • DHICA 5, 6-dihydroxyindole-2-carboxylic acid oxidase precursor
  • TRP-1 Tyrosinase-related protein 1
  • Catalase B Glycoprotein-75 (GP75) X51420
  • TN Tenascin precursor
  • HXB Hexabrachion
  • cytotactin cytotactin
  • Neuronectin cytonectin
  • GMEM miotic endogenous antigen
  • Matrix Metalloproteinase 15 Z48482
  • Matrix Metalloproteinase 14 MMP14
  • D26512 Matrix Metalloproteinase 1 (MMP1) X54925 Vinculin M33308 Vimentin (VIM) X56134; M14144
  • Serum amyloid Al precursor SAA1 M23698 senescence marker protein 30 (SMP30); Regucalcin (RGN; RC) D31815
  • Ubiquitin "cross-reactive" protein precursor UCRP
  • alpha-inducible interferon Interferon-induced 17kDa protein
  • G1P2 G1P2
  • ISG15 M13755
  • LAMC2 Laminin gamma-2 subunit precursor
  • PAF1 peroxisome assembly factor 1
  • PXMP3 Peroxisomal membrane protein 3
  • PMP3 Peroxisomal membrane protein 3
  • PMP35 35kDa peroxisomal membrane protein
  • PX1 Peroxisome Biogenesis Disorder Protein 1
  • GAT2 mitochondrial glutamate oxaloacetate transaminase 2
  • Aspartate aminotransferase 2 Transaminase A M22632 nck, ash & phospholipase C gamma binding
  • NAP4 Protein
  • XPF Xeroderma Pigmentosum Group F Complementary Protein
  • ERCC4 DNA excision repair protein
  • Replication factor A protein 4 (RPA4; RFA) U24186 utY homolog (hMYH) U63329 beta Crystallin A4 (CRYBA4) U59057
  • Heat shock protein beta-3 (HSPB3); Heat shock 17kDa protein; HSPL27 U15590 probable protein disulfide isomerase P5 precursor D49489
  • HSP90 90kDa heat shock protein beta
  • HSP84 84kDa heat shock protein beta
  • HSPCB M16660 microsomal UDP-glucuronosyltransferase-1-6 precursor (UDPGT; UGT1.6; UGT1F; GNT1) J04093
  • Glutathione-S-transferase mu 3 (GSTM3); GST5 J05459
  • Cytochrome P450 1A1 (CYP1A1); P450-P1; P450 form 6; P450-C K03191
  • PPAR-alpha Peroxisome proliferator-activated receptor alpha
  • PDIR Protein Disulfide Isomerase Related Protein Precursor
  • Acyl-coenzyme A cholesterol acyltransferase (ACAT); Monocyte / macrophage serine esterase (hMSE); CES2 L07765 serum paraoxonase / aryl esterase 3 (PON3); Serum aryldiacylphosphatase 3; aromatic esterase 3 (A-esterase 3) L48516 cytochrome P450 XXIB (CYP21B); Steroid 21-hydroxylase; CYP21A2 M12792; M23280
  • Cytochrome P450 IID6 (CYP2D6); P450 DB1; Debrisoquine-4-hydroxylase M20403 microsomal UDP-glucuronosyltransferase 1-1 precursor (UDPGT; UGT1.1; UGT1A; GNTl); Bilirubin-specific isozyme 1 (hUG-BRl) M57899 microsomal UDP-glucuronosyltransferase-1-4-
  • HHSF4 Heat shock transcription factor 4 D87673 extracellular superoxide dismutase precursor (EC-SOD; SOD3) J02947
  • DNAJ protein homolog 2 (DNAJ2; hDJ2; HSJ2) D13388
  • DUP Downstream protein
  • MRP1 Mismatch Repair Protein 1
  • Heat shock 70kDa protein 4 HSPA4
  • HSP70RY HSPA4
  • CCT-theta CCTQ; CCT8; KIAA0002 D13627 mitochondrial stress 70 protein precursor;
  • GRP75 75kDa glucose controlled protein
  • PBP74 Peptide binding protein 74
  • MOT Mortalin
  • FLAP endonuclease 1 FLAP endonuclease 1 (FEN1); Maturation factor 1
  • MF1 L37374 FK506 binding protein 12 (FKBP12); Peptidyl prolyl cis trans isomerase (PPIase); Rotamase M34539; M80199;
  • HSF2 Heat shock factor protein 2
  • HSTF2 Heat shock transcription factor 2
  • ADPG 3-methyladenine DNA glycosylase
  • Calreticulin precursor CRP55
  • Calregulin HACBP
  • ERp60 52-kDa ribonucleoprotein autoantigen
  • Transformation-sensitive protein IEF SSP 3521.
  • Heat shock protein beta 2 (HSPB2); DMPK binding protein; MKBP S67070 alpha Crystallin A chain (CRYAA; CRYA1) U05569
  • Nicotinamide N-methyltransferase U08021 phenol sulfating phenol sulfotransferase 1 (PPST1); thermostable phenol sulfotransferase (TS-PST); HAST1 / HAST2; ST1A3; STP1 + PPST2; ST1A2; STP2 + monoamine sulfating phenol sulfotransferase U09031 + U28170 + L19956
  • DPD dihydropyrimidine dehydrogenase precursor
  • DPD dihydrouracil dehydrogenase
  • Dihydrothymin-N dihydropyrimidine dehydrogenase precursor
  • DTYD Dehydrogenase U09178 transcriptional regulator atrX; "X-Linked” - Helicase II (XH2); "X-linked” core protein (XNP);
  • PSMD2 proteasome regulatory subunit S2
  • TRIP2 Tumor Necrosis Factor Type 1 Receptor Associated Protein
  • DDBA pl27 55.11 protein U12596 damage-specific DNA binding protein pl27 subunit
  • T complex protein 1 delta subunit TCPl delta
  • CCT delta CCT delta
  • SRB Stimulator of RNA-binding tar
  • T complex protein 1 eta subunit TCPl eta
  • CCT-eta CCT-7
  • PBGD Porphobilinogen deaminase
  • HMBS Hydroxymethylbilane synthase
  • SOD2 superoxide dismutase-2 precursor
  • GRP94 94kDa glucose controlled protein
  • TRA1 Antigen 1
  • UNG2 uracil DNA glycosylase 2
  • T-complex protein 1-alpha subunit TCPl-alpha
  • T complex protein 1 gamma subunit TCPl gamma
  • Transcription factor IIH (TFIIH); 52-kDa "basic" - transcription factor 2 subunit (BTF2p52) Y07595
  • XRCC2 x-ray repair cross-complementing protein 2
  • Ubiqitin-conjugating enzyme E2-17-kDa (UBE2B);
  • Ubiquitin-protein ligase Ubiquitin-protein ligase
  • Ubiquitin carrier protein Ubiquitin carrier protein
  • Heat shock protein 40 homolog (HSP40 homolog); DNAJW U40992
  • FKBP51 51kDa-FK506 binding protein
  • Prolyl cis trans isomerase PPIase
  • rotamase PPIase
  • FKBP54 FFI antigen
  • HSP90 binding immunophilin U42031 hematopoietic progenitor kinase (HPK1) U66464
  • a set of genes is preferably examined for methylation, in which up to 25% of the tab. 1 genes listed are not included.
  • the chemically pretreated DNA sequence of the genes to be detected is preferably at least 95% correct with the correspondingly pretreated DNA sequence of the genes from Tab. 1 match. Sequences that are 100% identical in a section of the exon that is at least 25 base pairs long are referred to as homologous in this invention. This also applies to sequences whose homology can only be recognized by taking possible frame shifts into account.
  • the genomic sequences of the genes to be examined can be derived by comparing the respective cDNA sequences with publicly accessible databases in which genomic sequences are stored.
  • Example 1 Cultivation of HT-29 P208 cells, cell harvest and preparation of chromosomal DNA
  • HT-29 P208 cells (5x104 cells / ml) were seeded in culture dishes (33x5 cm) and grown for 5 days in DMEM / Ham's F-12 medium supplemented with 10% fetal bovine serum at 37 ° C and 5% CO 2 up to a 95% confluence (Campbeil-Thompson, M. and Bhardwaj, B., Cancer Research 2001, 61, 632-640). The cells were then incubated for 24 h in medium without bovine serum.
  • the cells were, in 3 parallel cultures for 6 h and 24 h, either with medium, medium supplemented with 10 ng / ml TGF-bl, medium supplemented with 10ng / ml IL-lb, medium supplemented with trichostatin (50 nM) and Medium supplemented with Milrinone (50 ⁇ M) incubated.
  • the medium-free cells were treated with trypsin, centrifuged and resuspended in 200 ⁇ l PBS buffer (Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989) and at -20 ° C. stored.
  • the chromosomal DNA was purified using a QIAamp kit according to the manufacturer's instructions (Qiagen, Hilden).
  • the DNA samples (20 ng) were digested with the restriction enzyme Mssl.
  • the digested DNA was chemically converted with hydrogen sulfite (bisulfite, disulfite) and a radical scavenger at elevated temperature (DE 10050942).
  • hydrogen sulfite bisulfite, disulfite
  • a radical scavenger at elevated temperature (DE 10050942).
  • the chemically pretreated DNA was then amplified in a polymerase chain reaction using a heat resistant DNA polymerase.
  • the multiplex PCR reactions were carried out with a thermal cycler (Eppendorf GmbH) using 10 ng of bisulfite-treated DNA, 6 pmol each of primer oligonucleotides (mixture of up to 32 individual primer oligonucleotides, see Table 3), each of 800 ⁇ M dNTP and 4.5 mM magnesium chloride.
  • the cycler program was as follows: Step 1, 14 min at 96 oC; Step 2, 60 sec 96 oC; Step 3, 45 sec 55 oC; Step 4, 75 sec 72 oC; Step 5, 10 min at 72 oC; steps 2 to 4 were repeated 39 times.
  • the DNA fragments of 64 different genes listed in Table 3 were amplified with 6 sets of multiplex PCR (mPCR) and bisulfite-treated DNA as a template, as described above.
  • mPCR multiplex PCR
  • the mPCR reactions (I, J, K, L, M, N) of the genomic, bisulphite-treated DNA were compared with the combination of Primer oligonucleotides performed as listed in Table 3.
  • primer pairs listed in Table 1 are particularly preferred.
  • Example 3 Determination of the methylation status of selected genes
  • the amplificates produced in Example 2 were hybridized with 512 oligonucleotides which were bound to a solid phase (Model, F. and Adorjan, P., Bioinformatics. 2001, 17 Suppl. 1, 157-164).
  • the solid phase loaded with oligonucleotides is referred to below as the oligonucleotide array.
  • the detectability of the hybridization product is based on Cy5 fluorescence-labeled primer oligonucleotides that were used for the amplification.
  • a hybridization reaction of the amplified DNA with the oligonucleotide for example
  • GTTTTTTTCGTTTTAGAG (sequence ID 6) only takes place if a methylated cytosine is present at the said site of the bisulfite-treated DNA.
  • the methylation status of the specific cytosine can thus be determined via the hybridization product.
  • This oligonucleotide is identical to the oligonucleotide which was previously used to analyze the methylated status of the sample, with the exception that the oligonucleotide carries a thymine base at the position to be analyzed instead of the cytosine base, for example GTTTTTTTTGTTTTAGAG (sequence ID 7).
  • a hybridization reaction therefore only takes place if one is not methylated cytosine is present at the position to be analyzed.
  • the fluorescence signals were detected by scanning the oligonucleotide arrays using the Genpix 4000A fluorescence scanner (Axon Instruments, USA). The fluorescence signals were quantified using the Genepix 3.0 analysis software (Axon Instruments, USA).
  • the DNA methylation patterns of HT29-P208 cells grown with cells treated with IL-Ib (interleukin) or TGF-bl (transforming growth factor) were determined.
  • the results obtained were stored in databases and the CpG dinucleotides with different methylation status were identified.
  • the methylation patterns were compared using cluster analyzes and statistical methods (Model, F. and Adorjan, P., Bioinformatics. 2001, 17 Suppl. 1, 157-164).
  • Example 4 Change in the methylation status in HT29 cells by exogenous cytokines and low-molecular-weight active substances.
  • Each of these detection oligonucleotides was designed to hybridize to bisulfite converted sequences located at CpG sites that were either unmethylated (TG) or methylated (CG) in their original state.
  • the hybridization conditions were selected to allow the detection of Show differences in single nucleotides of the variants TG and CG.
  • the ratios of the two signals were calculated based on the comparison of the intensities of the fluorescent signals.
  • the information is then determined in a weighted matrix (see FIG. 1, 2) with regard to the CpG methylation difference between two classes, treated and untreated HT29-P208 cells.
  • the p-weighted methylation (p-value ⁇ 0.05, F. Model, P. Adorjan, A. Olek, C. Piepenbrock, Feature selection for DNA methylation based cancer classification. Bioinformatics. 2001 Jun; 17 Suppl l: S157 -64) shows a clear distinction between the two groups, which can be seen from the different gray shading. A higher degree of methylation correlates with a darker gray value.
  • TGF-bl and IL-lb change the methylation status of different genes.
  • Genes that code for enzymes that catalyze the biotransformation of toxicological substances are particularly preferred in the analysis of changed methylation patterns, which in turn reflect changes in gene expression.
  • the genes of the cytochrome P450 family play a central role here. Animal experiments have shown, among other things, that one of the genes from this class, Cyplal, was induced after exposure of mice to beta-naphthoflavone (Arch Biochem Biophys 2000 Apr 1; 376 (1): 66-73).
  • the genomic DNA sequence encoding the cyplal gene must be identified. For this purpose, for example, the cDNA sequence (Genbank Acc.
  • NM_000499 can be compared with a genomic database (eg Genbank htgs), usually using the BLAST comparison algorithm, which is available on the Internet (www.ncbi.nlm.nih.gov), is used.
  • a genomic database eg Genbank htgs
  • the section of the genomic DNA that encodes Cyplal can be identified (Genbank Acc.AC020705).
  • Genomic sections in the area of the promoter and the first exon or intron are preferably examined for methylation differences, since relevant CpG dinucleotides, the methylation of which influences gene expression, are preferably found in these sections.
  • exon 1 (underlined) was located in the following genomic sequence section:
  • TATGTTAAATGGTATTGG and CATCCAAAAACTAT can be used, with which defined fragments with a length of 1316 base pairs can be amplified. These amplificates serve as probes which are hybridized to oligonucleotides previously bound to a solid phase, for example CTACCCCGTAATA, the cytosine to be detected being in position 837 of the amplificate is located.
  • the detection of the hybridization product is based on Cy3 or Cy5 fluorescence-labeled primer oligonucleotides that were used for the amplification.
  • a hybridization reaction of the amplified DNA with the oligonucleotide only occurs if there is a methylated cytosine in the bisulfite-treated DNA at this point. The methylation status of the respective cytosine to be examined thus decides on the hybridization product.
  • Example 6 Classification of a chemical substance into a toxicity class by determining the methylation pattern
  • the DNA methylation pattern of a group of exposed and a group of non-exposed organisms, for example experimental animals must first be examined. The results are stored in a database and the CpG dinucleotides identified, which are methylated differently between the two groups. Then the methylation pattern of the substance to be assessed is compared with known methylation patterns of other chemical substances. Information on the properties of the substance to be investigated can be obtained from the toxicological properties of those chemical substances with a similar methylation pattern.
  • the present invention also relates to a kit consisting of a reagent containing bisulfite, a set of primer oligonucleotides comprising at least two oligonucleotides, the sequences of which each correspond to at least one 18 base pair long section of the base sequences of the genes to be examined or complement them.
  • a kit consisting of a reagent containing bisulfite, a set of primer oligonucleotides comprising at least two oligonucleotides, the sequences of which each correspond to at least one 18 base pair long section of the base sequences of the genes to be examined or complement them.
  • tär for the production of the amplificates, oligonucleotides and / or PNA oligomers, a control nucleic acid and instructions for performing and evaluating the method described.
  • Weighted matrix of the methylation status (fluorescence signal CG-Oligo x (fluorescence signal CG-Oligo + fluorescence signal TG-Oligo) -1) of 40 CpGs in untreated HT29-P208 cells (A) and TGF-bl treated HT29-P208 cells (B) .
  • the numbers 1-3 indicate 3 independent experiments (cell treatments and methylation analysis).
  • Each horizontal bar represents a CpG whose
  • Methylation status with a significance of p ⁇ 0.05, is different in the two analysis groups. A higher degree of methylation corresponds to the darker shade of gray, a lower degree of methylation corresponds to the lighter shade of gray.
  • HT29-P208 cells A
  • IL-Ib treated HT29-P208 cells B
  • the numbers 1-3 indicate 3 independent experiments (cell treatments and methylation analysis).
  • Each horizontal bar represents a CpG whose methylation status, with a significance of p ⁇ 0.05, is different in the two analysis groups.
  • a higher degree of methylation corresponds to the darker shade of gray, a lower degree of methylation corresponds to the lighter shade of gray.
  • CpGs which are represented by the indicated oligo-SEQ IDs, were examined from the following genes: TGF-a (AI, oligo SEQ IDs 6, 7; A2, oligo SEQ IDs 8, 9), EGFR (B1, oligo SEQ IDs 20 , 21; B2, oligo SEQ IDs 22, 23), ANTl (Cl, oligo SEQ IDs 32, 33; C2, oligo SEQ IDs 34, 35) and E-Cadherin (Dl, oligo SEQ IDs 13, 14; D2, oligo SEQ IDs 15, 16).
  • the numerical values of the y-axis show the methylation status, calculated as the quotient of the fluorescence signal of the CG oligo over the sum of the fluorescence signals of the TG and CG oligo.
  • CpGs which are represented by the specified oligo-SEQ IDs, were examined from the following genes: EGFR (AI, oligo SEQ IDs 22, 23), ANTl (B1, oligo

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Die vorliegende Erfindung betrifft ein Verfahren zur toxikologischen Diagnostik. Einem Lebewesen oder einer Zellkultur, die zuvor einer bestimmten auf ihre toxikologische Wirkung zu untersuchende Substanz ausgesetzt wurden, wird eine DNA-Probe entnommen. Die in dieser Probe enthaltene DNA wird chemisch vorbehandelt und die Basenabfolge eines Teils der modifizierten DNA bestimmt. Daraus wird auf einen für die Probe charakteristischen Methylierungszustand oder ein charakteristisches Methylierungsmuster geschlossen. Durch den Abgleich mit Daten aus Methylierungszuständen anderer Proben wird auf die Einwirkung einer Substanz auf das Lebewesen oder die Zellkultur geschlossen und/oder mit anderen Substanzen in toxikologischer Hinsicht verglichen.

Description

Verfahren zur Detektion von Methylierungszustanden zur toxikologischen Diagnostik
Gebiet der Erfindung
Die nach den methodischen Entwicklungen der letzten Jahre in der Molekularbiologie gut studierten Beobachtungsebe- nen sind die Gene selbst, die Übersetzung dieser Gene in RNA und die daraus entstehenden Proteine. Wann im Laufe der Entwicklung eines Individuums welches Gen angeschaltet wird und wie Aktivieren und Inhibieren bestimmter Gene in bestimmten Zellen und Geweben gesteuert wird, ist mit Ausmaß und Charakter der Methylierung der Gene bzw. des Genoms korrelierbar. Insofern äußern sich pathogene Zustände in einem veränderten Methylierungsmuster einzelner Gene oder des Genoms .
In der vorliegenden Erfindung werden die Methylierungs- zustände von toxikologisch relevanten Genen bestimmt und die dabei erfassten Daten zu Methylierungsmustern zusara- mengefasst. Durch Vergleich der erhaltenen Muster mit entsprechenden Referenzproben können umfassende prognos- tische Aussagen über die toxikologischen Eigenschaften von Substanzen gemacht werden. Des weiteren soll ein Verfahren vorgestellt werden, welches die Analyse von Methy- lierungspositionen der zu untersuchenden Gene in grossem Umfang ermöglicht.
Stand der Technik
Die toxikologische Beurteilung von chemischen Substanzen wird gegenwärtig vor allem durch Versuche an Tieren durchgeführt. Tierversuche sind ethisch problematisch, ω ω f NJ P1 > cπ σ Cπ O cπ O Cπ
H3 ≤ K C 3 S tu ec Cd S tu M π s; s iQ O O Cß Dd Cπ CQ > rt CL CL CQ α iQ N
Φ φ Φ o φ cυ •< p- Φ es P- 1 3 P- φ c Φ Φ P- es •ü &) 1 CO rt d P cυ Φ Φ Φ d Φ
O P er H rt CQ CQ rt u3 es S •ü φ rt H CQ es Φ ** P- ω s rt p- CO Cυ er P rt es φ P- er CL P rt P- er Φ P er Φ Φ φ P1 er Ω CQ Φ φ Φ φ O 3 es Φ N es rt
3 φ p- *«• Hi • es O •<: s: rt P- o ^ er Φ ei- P) er rt d 3 CL Cß P- rt N N cυ
P- 1-3 P- TJ P" Hi P" cυ er Hi ^ P1 • P- C Φ CO p- er ιQ rt Φ f es • d φ d f^ P- CL N Ω cυ ^ P- Ω es Φ ^ P- rt Ω w o Φ P- s: es ^ er Φ P P rt tu es es Po φ ?v n Cu P- cu CQ rt ■< P1 ?v O •< φ Cπ Ω es 3 φ rt P- υ H CΛ Φ s: es Cυ P- ω Φ rt P Φ rt rt Cυ Ω cυ CO rt μQ 1 er rt P- Ω o rr <! J d •< o er < φ
3 Φ CQ P o d 3 o φ rt ^ rt P- O IS Φ P- sQ CQ Φ ^< es O Φ rt Cß ß * 3 o es
PJ 2 P rt CQ 3 P- P- ω P- rt P- es CQ φ φ P Hi φ Φ H rt IX P P- φ φ Ω Φ es CL
(-■ d S • P- iQ es rt p- f s < O O • P- es rt P- es o
0 φ es CQ es φ 03 es es N er H N Φ Φ α CO r° P- cu: o es er es P-
Cl es es CL φ α CΛ sQ l_l- ιQ rr σ <J G O rt es P- α P- ^ es P- rt P- a P- O CL φ Φ Φ d φ φ CO er cυ s: φ ><: σ er Φ es cυ L Φ Hi φ P- es es Φ P1 φ H < er d
P- rt •< 3 P- P > rt Φ o c Φ P- P cu P Ω o P O Φ rt o P P1 < es Φ CQ es
3 N Φ P- P er Ω O α Φ Φ & CQ d •< P d Ω Φ P- -Q rr φ o 3 CQ P rt CL
N rt P Ω et 0) P- CQ Φ rt er es rt 3 es er V d CQ cυ P- Φ es es W CU: Hi Cυ
P- er ■ : P- 1 P- er c P Φ Φ sQ 02 O Cυ ιQ Φ o ; r et P1 CQ es s rt Cυ es rt iQ Q- DJ rt $. α rt P rt N es Cυ Ό P P" CQ rt es P1 u • Ω > Q ^ N er N Φ m d I-1 o P- CU Φ g ^» c CL vQ P- Φ P- P- P- <! P1 P CL ^ er n Φ • φ P φ d
73 <! H rt CQ n iQ s 3 u H Φ vQ er P- es o o H φ * P- Φ Φ rt es φ es φ CΛ Φ o φ P- Φ ιQ C α es Φ P- Ω Φ 1 es es 3 o φ G es P- Φ er es H > P er 1-5 es iQ CL φ tu Hi G P- > s es er es TJ Ό P- rt • TJ Φ <J es o Φ er • er ** Φ Φ s: CQ s φ Φ u Φ rt O P- cπ P es p- er CΛ cυ x P- P h CL Φ
P1 P- 3 3 0» o. rt <! rt P- CO co 1 P- Q cυ: • P TJ rt er d Φ CQ G
P- 3 O ≤ Φ es es Φ Φ 3 O P- CO ω Hi P- rr rs es CL Ω d cυ P cυ: Φ Cυ er P CO 3
Φ O 3 Φ ι-g 0) P P P- P" CQ cυ P- rt Φ rt Φ er Hi CTi 3 φ rt N P-1 rt Φ er P c 0 er Φ Ω C rt P1 Ω ιQ CQ N P- rt P- P Φ P- > Φ Cß d: P1 φ Ω P CL
Φ 3 Ω Ω P> rt ^ er CQ d rt CO er Φ φ P- O Cu er es P Ώ ω rt CQ TJ iQ Φ es Φ P- es Cυ *< er Q Φ 3 rt O Ω P1 rt φ er es Φ es er ^ ιQ 50 CQ N3 Φ P- CU 3 es cυ φ
Φ i-1 r+ Φ TJ P P- U Φ er Φ Cυ: rt •σ P, Φ φ 1 Φ N rt VD P o P P- er Φ er
73 CΛ Φ O D P s: es N s P es H Cυ rt es P Ω d iQ Φ φ n es cυ Ω CL P- Cß rt m i to & α P- P- CQ P- es Φ es er u ►< es d <JD iQ P1 er d ω TJ Ω O Q O P- es P- es P Ω Hi iQ P P- Hi Φ P s, ? <! rt P1 ? — Φ ? P1 h er P er m ^ 3 3 P tQ φ er P- s: ua o P- (.; φ O: o O cυ Φ o • C0 u φ < Ω φ φ υ: P- rt O CO P" O Φ ^ PJ CQ <J Φ H es P es es Cfl P- rt es <! Ω es φ er P. CQ rt w
1 O H 3 Ό P- Φ s P- Ω o P- <! 3 Φ U3 α es P- es P- • cυ er es P CQ N o to Φ P- l-i Ω es rt ≤ Φ er es Φ Cυ P- to Φ Φ Φ es O P" P" d Cυ: D P- P- φ P1
P- Ϊ 0 d: er CQ Φ E φ φ P rt es <! es es H L es ω Φ o s: es es a 3 o es o
3 d t es Φ ω •ö P1 Φ es Ö P- Φ φ er cu Φ p- es CQ P- rt α es iQ
P" rt iQ Φ n Ω es a Cυ O O H H J- φ M H L φ rt CO Φ φ Φ 2. CO t i P- er 0) h-1 σ P- er ?ö > 3 H es er CL φ er CQ Φ φ CL P P o φ Cυ d CQ
Φ P d P- S P- Ω Φ Φ Φ Φ •« TS cυ Cυ Pl CO 3 es Φ O d er Cß es Ω
P- er es Ω > es er CQ H cu cυ er es o P1 o P- W d Ό o P d es P- Φ Cυ ? er ω P- rt er iQ rt ? i=; Cυ: • ≤: PO rt cπ Ω Ω Φ 3 P3 P- d Ω iQ TJ es P-1 O: Φ
TJ O φ CQ d • P- tu rt Hi C Φ 1 φ 1 er er CQ O P φ P- Φ 3 er Φ CO rt ^ es es
P- P" P o es es P1 P- Hi P1 es Φ rt P CU H Hi P rt es M O es φ O o d sQ cπ ? o Cπ P- Ω es 3 Cυ iQ es rt P- L cυ Ϊ P- Φ Φ «
I-1 ιQ 0 π c Φ 1 CQ cu es 1 iQ er υ P- es Φ CQ N Φ d s: P- O: Ω es o to P- er Ω 3 s Φ P1 CQ Φ i- Ω H CL es ? σ P- es Hl Φ r ei er φ •^ e
≤; to P- er iQ P- P- <5 rt Hi er es rt Φ P. Φ φ P. P es φ P- CQ
Φ Ω φ Φ es es CQ o Φ α s: rt rt Φ CQ P- P- P er Φ Φ es es s: φ
P- t α CQ s: P- Φ Ω es es P- Φ φ P- φ •ö 1 rt Φ Φ P es iQ Φ 1 co φ Φ Φ Cυ Ω 3 er φ P- 1 P1 • rt Φ 1 es Cυ Φ P φ es P- 3 er Φ co P- " d 1 1 es 1 rt P, rt f Hi
durch Amplifikation und Hybridisierung oder Sequenzierung nachgewiesen werden kann. Alle diese Techniken beruhen auf Basenpaarung, welche jetzt voll ausgenutzt wird. Der Stand der Technik, was die Empfindlichkeit betrifft, wird durch ein Verfahren definiert, welches die zu untersuchende DNA in einer Agarose-Matrix einschließt, dadurch die Diffusion und Renaturierung der DNA (Bisulfit reagiert nur an einzelsträngiger DNA) verhindert und alle Fällungs- und Reinigungsschritte durch schnelle Dialyse ersetzt (Olek, A. et al., Nucl. Acids . Res. 1996, 24,
5064-5066) . Mit dieser Methode können einzelne Zellen untersucht werden, was das Potential der Methode veranschaulicht. Allerdings werden bisher nur einzelne Regionen bis etwa 3000 Basenpaare Länge untersucht, eine glo- bale Untersuchung von Zellen auf Tausenden von möglichen Methylierungsanalysen ist nicht möglich. Allerdings kann auch dieses Verfahren keine sehr kleinen Fragmente aus geringen Probenmengen zuverlässig analysieren. Diese gehen trotz Diffusionsschutz durch die Matrix verloren.
Eine Übersicht über die weiteren bekannten Möglichkeiten, 5-Methylcytosine nachzuweisen, kann aus dem folgenden Ü- bersichtsartikel entnommen werden: Rein, T., DePamphilis, M. L., Zorbas, H., Nucleic Acids Res. 1998, 26, 2255.
Die Bisulfit-Technik wird bisher bis auf wenige Ausnahmen (z. B. Zechnigk, M. et al., Eur. J. Hum. Gen. 1997, 5, 94-98) nur in der Forschung angewendet. Immer aber werden kurze, spezifische Stücke eines bekannten Gens nach einer Bisulfit-Behandlung a plifziert und entweder komplett sequenziert (Olek, A. und Walter, J., Nat. Genet. 1997, 17, 275-276) oder einzelne Cytosin-Positionen durch eine „Primer-Extension-Reaktion" (Gonzalgo, M. L. und Jones, P. A., Nucl. Acids Res. 1997, 25, 2529-2531, WO-Patent 9500669) oder einen Enzymschnitt (Xiong, Z. und Laird, P. W., Nucl. Acids. Res. 1997, 25, 2532-2534) nachgewiesen. Zudem ist auch der Nachweis durch Hybridisierung beschrieben worden (Olek et al., WO 99 28498).
Weitere Publikationen, die sich mit der Anwendung der Bi- sulfit-Technik zum Methylierungsnachweis bei einzelnen
Genen befassen, sind: Xiong, Z. und Laird, P. W. (1997), Nucl. Acids Res. 25, 2532; Gonzalgo, M. L. und Jones, P. A. (1997), Nucl. Acids Res. 25, 2529; Grigg, S. und Clark, S. (1994), Bioassays 16, 431; Zeschnik, M. et al. (1997), Human Molecular Genetics 6, 387; Teil, R. et al . (1994), Nucl. Acids Res. 22, 695; Martin, V. et al. (1995), Gene 157, 261; WO 97 46705, WO 95 15373 und WO 45560.
Eine Übersicht über den Stand der Technik in der Oligomer Array Herstellung läßt sich aus einer im Januar 1999 erschienenen Sonderausgabe von Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999) und der dort zitierten Literatur entnehmen.
Für die Abtastung eines immobilisierten DNA-Arrays sind vielfach fluoreszenzmarkierte Sonden verwendet worden. Besonders geeignet für Fluoreszenzmarkierungen ist das einfache Anbringen von Cy3 und Cy5 Farbstoffen am 5-OH der jeweiligen Sonde. Die Detektion der Fluoreszenz der hybridisierten Sonden erfolgt beispielsweise über ein Konfokalmikroskop. Die Farbstoffe Cy3 und Cy5 sind, neben vielen anderen, kommerziell erhältlich.
Matrix-assistierte Laser Desorptions/Ionisations- Massenspektrometrie (MALDI-TOF) ist eine sehr leistungsfähige Entwicklung für die Analyse von Biomolekülen (Ka- ras, M. und Hillenkamp, F. (1988), Laser desorption ioni- zation of proteins with molecular asses exeeding 10000 daltons. Anal. Che . 60: 2299-2301). Ein Analyt wird in eine lichtabsorbierende Matrix eingebettet. Durch einen kurzen Laserpuls wird die Matrix verdampft und das Ana- lytmolekül so unfragmentiert in die Gasphase befördert. Durch Stöße mit Matrixmolekülen wird die Ionisation des Analyten erreicht. Eine angelegte Spannung beschleunigt die Ionen in ein feldfreies Flugrohr. Auf Grund ihrer verschiedenen Massen werden Ionen unterschiedlich stark beschleunigt. Kleinere Ionen erreichen den Detektor früher als größere.
Genomische DNA wird durch Standardmethoden aus DNA von Zeil-, Gewebe- oder sonstigen Versuchsproben gewonnen. Diese Standardmethodik findet sich in Referenzen wie Fritsch und Maniatis eds . , Molecular Cloning: A Laborato- ry Manual, 1989.
Gegenwärtig ist es nicht Stand der Technik, grosse Mengen von Proben hinsichtlich bedeutsamer Methylierungspositio- nen für die toxikologische Diagnostik zu untersuchen.
Aufgabenstellung
Die vorliegende Erfindung soll ein Verfahren bereitstel- len, welches sich zur Diagnose von Methylierungszustanden von Genen mit toxikologischer Relevanz eignet. Der Erfindung liegt die Erkenntnis zugrunde, dass sich insbesondere Cytosin-Methylierungszustände zur Diagnose von Expressionsveränderungen von Genen mit toxikologischer Relevanz besonders eignen.
Beschreibung
Die vorliegende Erfindung beschreibt ein Verfahren zur
Beurteilung toxikologischer Eigenschaften bestimmter Sub- CO O [SJ N3 P1 P1 π o Cπ O Cπ o cπ
to rt- <! P 3 P P rt Cu Pi rr T) er PO N cυ σ tr1 CU Cυ M Ω Φ M 3 P to CO
Ω d Φ d d φ d cu Φ es es Φ es P P Φ d: Φ d P- Φ d d P- ^ P- P- d d Ω rt er P 1-1 es Cß CQ es fr es fl α P Cυ: O P- Ω H CQ φ er CQ Pi es rt es es CQ es er 0)
P- s iQ rt IQ rt Ω φ Cυ Φ sQ CQ to ? P1 Φ iQ Φ o Φ rt iQ φ es
Φ iQ Φ to Φ φ CQ Φ ö er P P P- Φ rt TJ Φ CL N s: Φ P- t 3 CO s φ Φ P N
CL Φ es 3 P P 3 P a φ r es P Cυ P- es P- Φ d Φ CO er P- σ Φ P es φ φ CO CL d to er d P- P- es Φ rt Φ 3 es es CQ Φ P tr> es a rt Cß es es Ω Φ Cß u Cfl to φ er 3 d Cυ P1 cυ P- cu Φ rt Φ Φ er er CL CL
Φ er rt rt 3 1 rt rt TJ ∑ tu Φ es •« Cfl P φ : es es N er Cυ 1 ^ <! φ d
H P1 φ Φ P- rt φ P- P Φ cu er Φ CL s: S*τ es er cυ CO rt rt Φ to d P1 O CQ P σ
0 es P π- φ P cβ o es Cfl cυ P Ir1 φ Clf P1 P1 o ≤: Φ P P- es Ω cυ
CΛ CO es es Ω er o. Φ es to Cυ d P- 1 p- ^ o s: tx Φ es o Φ S er Cfl d Cß CΛ CL Φ iQ er Φ es CL rt P1 es to ^3 ÖS Ω ω CL Cu P- CO σ P iQ Φ er φ < Φ es φ Φ s: Cυ Φ Φ iQ φ er P- φ P f φ Φ d φ rt <
CQ es er o es CQ es er P- er P1 es φ φ d: d Φ φ P Φ o es es es er P- φ rt CO es s Ω Φ P H) rt ^ Q Cfl rt es P es h-1 Cß iQ O cυ ■<: φ P s; rt S Φ er S CQ o ^* < 3 φ Cfl φ CL o o TJ CQ 3 H Hi es Φ υ cυ Φ rt P" Φ rt P1 φ O: ÖS s; P- !θ es φ iQ CL Φ N P- P- N cυ
N P es es rt er o rt P- iQ CL P iQ P Φ vQ CΛ d L P s: P- Φ N d cn Φ d er φ CL N CL er ■<: Cfl er 3 P- φ CU Hi P1 d er f TJ Φ Φ P- co P P- CQ Ω P P es Φ Φ m ^ H CQ ■ : 3 Φ to υ P- to Φ φ d P1 LSI P Ω Pi rt er d TJ Φ es Cu P P1 P- φ rt P- Cfl er Ω rt P- rt P- iQ φ CL er Φ P- cu φ es P es TJ 3 d Φ p- Φ es P- tu es P e rt d Φ Φ P1 φ P- Cfl es P iQ
P- d Hl es Φ P • Φ d CU 3 Φ φ O o 3 es es P1 Φ es Ω CL Cß Hi er
> rt es P d P es Cfl CL φ es es CL es ^ o fV P- S! Φ er
H α N Φ Φ
Φ CL CL Ti d es ΓΛ d Φ φ et to Φ P- Hi N 3 d es P- P φ P- a d es P
P- \ Cυ P es iQ Ω es CD es P er CQ P^J P es CΛ d P- P1 Φ P P es CO CL es o CQ o iQ to er iQ cυ cυ Ω o d rt P CQ rt r LS] rt Φ er cυ CL er CQ N P1 CQ d er er P1 er 3 ir* iQ πd d Ω d hd d φ SI CL Cυ rt es φ t* Φ N d P- N Hl Hl Φ P- P Φ Φ cu er σ er P P es P1 d P- es CO
P Φ es d Cß Φ d o Cß Φ P- P- er es P P1 a Φ o iQ P1 to Φ d υ
Φ er to rt ξ CQ Φ P1 cυ P rt es Φ -> Cυ * > Φ er r rt CQ φ er d
73 P CL Φ cυ rt Cυ P1 rt P- sQ iQ rt rt cυ P Hl σ es Φ N d Cυ φ Cß CO Pl m P- s d Cυ: es P- Cυ es Φ rt φ rt -• o Hi G Φ a rt d P1 es P rt o <! φ Φ Hi es Ω es Φ Φ ≤; P- Cu P- P P > er Φ rt CL O Cu L m Φ CQ CL Φ er es CL es Ω P- o er P es P- er U: es d: d M CL es Φ
P M φ CL Φ Cfl Φ • P es p- 3 es cυ P1 rt er P α P φ N P r iQ P- es P- es ? o Hl P σ rt CL Φ CO ^ φ ** H P- rt es Φ Φ Hi P
P1 es Φ o cu CL d: a o es rt P- rt P • o P P P- er σ
P- s: o o es Φ P er > Cfl o a es CD φ CL TJ CL es CL Φ Φ
Ω P- CL M CL Φ es P Φ P- P- er P1 P- er Φ es P P- s; Φ s: rt er P φ P- φ P CL CO >n es Φ P- o Φ Φ er ** L Φ d: φ Φ d Cß P- φ
Φ ? P es P Φ P- cυ P er Φ iQ P rt P- υ es Hi rt es P fr es d s: s d P- Φ iQ o cυ Φ P P- Φ rt P er φ N er iQ IS f rt es CL P- rs Φ P es rt er to P <! co •^ φ es P- Φ es d •<: φ rt P- t, iQ P- H Φ rt Ω TJ Φ Φ Φ er o Ω rt 1 φ P- CL < P1 P- rt Φ o
Φ Φ φ fr rt er er 2 H es es cu es er ec Φ P- Φ 0 P- to er es
P es er ■ : Φ O Hl . Φ P- Cfl N
LSI r φ P Φ rt > < es P1 < rt er er d: N rt P • Φ ω P P-1 Φ CQ
Φ <! φ iQ P- Φ er Φ Φ er d Φ o es Q o Φ d Φ P- P TJ es φ H P- φ P ■<; er P es er "* Φ ÖS o a er P- es p- Φ Cu: Φ
• P CL φ P iQ P1 Ω cυ Φ Φ Φ J- ≤: • P > O es iQ es P. es N
1 f Φ 1 d P1 P- er es es P- φ ec Φ N rt Φ d CL P- d P. es Φ Φ cυ CL • es σ ?r Φ er d L Cυ P <j Hi es φ Hi
P" P- 1 1 Φ Φ a rt P Φ Φ es o d: 1 P- 1 Ω P 1 N rt ß N es P 1 1 er 1 > 1
Bevorzugt wird im ersten Verfahrensschritt eine genomische DNA-Probe derart chemisch behandelt, dass an der 5'- Position unmethylierte Cytosinbasen in Uracil, Thymin o- der eine andere vom Hybridisierungsverhalten her dem Cy- tosin unähnliche Base verwandelt werden. Dies wird im folgenden unter chemischer Vorbehandlung verstanden.
Bevorzugt wird dazu die oben beschriebene Behandlung genomischer DNA mit Bisulfit (Hydrogensulfit, Disulfit) und anschließender alkalischer Hydrolyse verwendet, die zu einer Umwandlung nicht methylierter Cytosin-Nukleobasen in Uracil führt.
Im zweiten Verfahrensschritt wird die Basenabfolge eines Teils der chemisch behandelten DNA bestimmt und auf für die Probe charakteristische Methylierungszustände geschlossen.
Bevorzugt werden in einem zweiten Verfahrensschritt zu- nächst aus der chemisch vorbehandelten genomischen DNA Fragmente unter Verwendung von Pri eroligonukleotiden amplifiziert .
Bevorzugt werden mehr als 10 unterschiedliche Fragmente amplifiziert, die 100 - 2000 Basenpaare lang sind.
In einer bevorzugten Variante des Verfahrens führt man die Amplifikation mittels der Polymerasekettenreaktion (PCR) durch, wobei vorzugsweise eine thermostabile DNA- Polymerase verwendet wird.
Erfindungsgemäss bevorzugt ist es, dass die Amplifikation von mehreren DNA-Abschnitten in einem Reaktionsgefäß durchgeführt wird. In einer bevorzugten Variante des Verfahrens umfasst der Satz von Pri eroligonukleotiden mindestens zwei Oligo- nukleotide, deren Sequenzen jeweils revers komplementär oder identisch zu einem mindestens 18 Basenpaare langen Abschnitt der Sequenzen der zu untersuchenden Gene sind. Die Pri eroligonukleotide sind vorzugsweise dadurch gekennzeichnet, dass sie kein CpG Dinukleotid enthalten.
Bevorzugt enthält mindestens eines der beiden zur Ampli- fizierung eines bestimmten Abschnitts der chemisch vorbehandelten DNA verwendeten Primeroligonukleotide identifizierbare Markierungen.
Erfindungsgemäss bevorzugt ist es, dass die Markierungen der Amplifikate Fluoreszenzmarkierungen sind.
Erfindungsgemäss bevorzugt ist es, dass die Markierungen der Amplifikate Radionuklide sind.
Erfindungsgemäss bevorzugt ist es, dass die Markierungen der Amplifikate ablösbare Molekülfragmente mit typischer Masse sind, die in einem Massenspektrometer nachgewiesen werden.
Erfindungsgemäss bevorzugt ist es, dass die Amplifikate, Fragmente der Amplifikate oder zu den Amplifikaten komplementäre Sonden im Massenspektrometer nachgewiesen werden.
Erfindungsgemäss bevorzugt ist es, dass zur besseren De- tektierbarkeit im Massenspektrometer die erzeugten Fragmente eine einzelne positive oder negative Nettoladung aufweisen.
Erfindungsgemäss bevorzugt ist es, dass man die Detektion mittels Matrix assistierter Laser Desorptions/Ionisations Massenspektrometrie (MALDI) oder mittels Elektrospray Massenspektrometrie (ESI) durchführt und visualisiert .
Erfindungsgemäss bevorzugt ist es, dass bei der Amplifi- kation mindestens ein Primeroligonukleotid an eine Festphase gebunden ist.
Vorzugsweise sind die Sondenoligonukleotide oder PNA- Oligomere an definierten Stellen an eine Festphase gebun- den.
Erfindungsgemäss bevorzugt ist ferner, dass unterschiedliche Oligonukleotid und/oder PNA-Oligomersequenzen auf einer ebenen Festphase in Form eines rechtwinkligen oder hexagonalen Gitters angeordnet sind.
Die Festphasenoberfläche besteht bevorzugt aus Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold.
Im dritten Verfahrensschritt hybridisiert man die Amplifikate an einen Satz von mindestens 10 Oligonukleotid o- der PNA-Oligomer Sonden. Die Amplifikate dienen dabei als Proben, die an vorher an einer Festphase gebundene Oligo- nukleotide hybridisieren. Unter Hybridisierung im Sinne dieser Erfindung ist eine Bindung unter Ausbildung einer Duplex-Struktur eines Oligonukleotids an eine vollständig komplementäre Sequenz im Sinne der Watson-Crick Basenpaarungen in der Proben DNA zu verstehen. Die nicht hybridi- sierten Fragmente werden anschließend entfernt.
Die besagten Oligonukleotide umfassen mindestens eine Basensequenz mit einer Länge von 13 Nukleotiden, die revers komplementär oder identisch zu einem Abschnitt der Basen- Sequenzen der zu untersuchenden Gene ist. Das Cytosin des CpG Dinukleotids ist das 5. bis 9. Nukleotid vom 5 '-Ende des 13 mers aus betrachtet. Für jedes CpG Dinukleotid ist ein Oligonukleotid vorhanden.
Die besagten PNA-Oligomere umfassen mindestens eine Ba- sensequenz mit einer Länge von 9 Nukleotiden, die revers komplementär oder identisch zu einem Abschnitt der Basensequenzen der zu untersuchenden Gene ist, der mindestens ein CpG Dinukleotid enthält. Das Cytosin des CpG Dinukle- otids ist das 4. bis 6. Nukleotid vom 5' -Ende des 9 mers aus gesehen. Für jedes CpG Dinukleotid ist ein Oligonukleotid vorhanden.
Im vierten Verfahrensschritt entfernt man die nicht hybridisierten Amplifikate.
Im letzten Verfahrensschritt detektiert man die hybridisierten Amplifikate.
Erfindungsgemäss bevorzugt ist es, dass an den Amplifika- ten angebrachte Markierungen an jeder Position der Festphase, an der sich eine Oligonukleotidsequenz befindet, identifizierbar sind.
Erfindungsgemäss bevorzugt ist die Verwendung eines Ver- fahrens zur Diagnose von Methylierungszustanden innerhalb einer Gruppe von Genen, die sich durch eine besonders gut dokumentierte Verbindung zu toxikologischen Prozessen auszeichnen.
Bevorzugt dient das Verfahren zur Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individuen, wobei diese nachteiligen Ereignisse im Zusammenhang mit der Diagnose toxikologisch bedeutender Parameter stehen. Erfindungsgemäss verwendet wird das Verfahren zur Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individuen, wobei diese nachteiligen Ereignisse im Zusammenhang mit der Diagnose toxikologisch bedeutender Parameter stehen.
Der zu untersuchende Satz von Genen umfasst mindestens eines der in Tab . 1 aufgeführten Gene oder aber Sequenzen, die im Bereich der Exons identisch oder zu mindestens 85% homolog zu den in Tab . 1 aufgeführten Genen sind .
Gene Name GenBank Accession # (s) Serotransferrin-Präkursor; Siderophilin;
Beta-1-metallbindendes Globulin 12530
Lactotransferrin-Präkursor; Lactoferrin X53961
Apolipoprotein E Präkursor (APOE ) M12529
Lipopolysaccharide-bindender Protein- Präkursor (LBP) M35533
B-Lymphozyt Kinase; Tyrosine-Protein-
Kinase BLK; p55-BLK Z33998
Apolipoprotein A-I Präkursor (APOAI ) X00566
Apolipoprotein A-II Präkursor ( APOAI I ) X00955 Apolipoprotein C-III Präkursor (APOCIII ) X01388
Endothelin 1 (ETl ) Y00749
Makrophagenkolonie-stimulierender
Faktor 1 (CSF1 ; CSF) M37435 familial intrahepatisches Cholestasis 1 Protein (FIC1) AF038007
Vaskulärer Endot el achstumsfaktor D
(VEGFD) ; C-FOS-induzierter Wachstumsfaktor
(FIGF) D89630
Komplement-Komponente-4-bindendes Protein alpha (C4B-bindendes Protein; C4BPA) ;
Prolin-reiches Protein (PRP) M31452
Insulin-ähnlicher Wachstumsfaktor II (IGF2) ;
Somatomedin A 29645 Granulozytenmakrophagenkolonie-stimulierender
Faktor (GM-CSF) ; CSF2 M11220 epidermaler Wachstumsfaktor-Präkursor (EGF) ;
Beta-Urogastron X04571 Hepatozyten achstumsfaktor-Aktivator
(HGF-Aktivator) D14012
Makrophage-"Inflammatory-Protein"-l-beta-
Präkursor (MlPl-beta) ; T-Zellen-Aktivierungs-
Protein 2 (AT2) ; PAT 744; H400; SIS-Gamma; Lymphozyt-Aktivierungs-Gen-1-Protein (LAG 1) ;
HC21; kleines induzierbares Cytokin A4
(SCYA4); G 26 T-Lymphozyt sekretorisches
Protein J04130
Glia achstumsfaktor-2-Präkursor (GGFHPP2) ; Neuregulin; Heregulin-Beta3 + "neuer
Differenzierungsfaktor" + Heregulin-alpha
L12260; L12261 + U02326 + M94165
T-Zellen-spezifischer Rantes-Protein-Präkursor; sis delta; kleines induzierbares Zytokin A5 (SCYA5) "Rantes pro-Inflammatory"-Zytokin M21121
Makrophagen-"Inflammatory"-Protein-l-alpha-
Präkursor (MlPl-alpha) ; Tonsillen-Lymphozyt-
LD78-Alpha-Protein; G0S19-l-Protein; PAT 464.2;
SIS-beta; kleines induzierbares Zytokin A3 (SCYA3) M23452
Onkostatin M (OSM) M27288
Insulin-ähnlichen-Wachstumsfaktor-bindendes
Protein 1 (IGFBP1) ; Plazenta-Protein 12 (PP12) M31145
Vaskulärer Endothelial-Wachstumsfaktor Präkursor (VEGF) ; Vaskulärer Permeabilitäts-Faktor (VPF) M32977 ; 27281
Hepatozyten-Wachstumsfaktor (HGF) ; Streufaktor
(SF) ; Hepatopoeitin A M60718
Thymosin Beta-10 (TMSB10; THYB10) ; PTMB10 M92381
Interferon Gamma-induzierter Protein-Präkursor (gamma-IPlO) X02530
Makrophagen "Inflammatory"-Protein 2 alpha
(MIP2-alpha) ; wachstumsreguliertes Protein Beta
(GRO-beta) X53799
OX40 Ligand (OX40L) ; GP34; tax-transkriptionell aktiviertes Glycoprotein 1 (TXGPl) X79929 transformierender Wachstumsfaftor Beta 3 (TGF-beta3) J03241
Delta-artiger Protein Präkursor (DLK) U15979; Z12172 Insulin-artiger Wachstumsfaktor-IA Präkursor (IGF1A); IGFBP1; So atomedin C + Insulinartiger Wachstumsfaktor I (IGF1) 27544 + M37484 CG Chemokin-Eotaxin-Präkursor; eosinophil chemotaktisches Protein; kleines induzierbares Zytokin All (SCYA11) D49372; Z75669;
Z75668
"Sonic Hedgehog" (SHH) L38518
Interleukin-1-Rezeptor-Antagonist Protein- Präkursor (IL-1RA; IRAP) 63099 Makrophage-Inhibitor Zytokin 1 (MIC1) AF019770 Erythropoietin M11319
Eosinophil "Granule-Major-Basic" Protein- Präkursor (MBP) ; Sch angerschafts-assoziiertes "Major-Basic-Protein; Knochenmarks-Proteoglykan 2 Y00809 Insulin-artigen Wachstumsfaktor-bindender Protein-3-Präkursor (IGF-bindendes Protein 3;
IGFBP3; IBP3) M31159; M35878 zelluläres Retinsäure-bindendes Protein II (CRABP2) M68867
Corticoliberin-Präkursor; Corticotropin- Freisetzungsfaktor (CRF) ; Corticotropin- Freisetzungshormon (CRH) V00571
Interferon-Gamma-Präkursor (IFN-gamma; IFNG) ; Immuninterferon X01992 ; M29383
Interleukin-2-Präkursor (IL-2) ; T-Zellen- Wachstumsfaktor (TCGF) A14844
Interleukin-1-alpha-Präkursor (IL-1 alpha; ILlA) ; Hematopoietin-1 X02851 Interleukin-4-Präkursor (IL-4); B-Zellen-Stimulierungsfaktor 1 (BSF- l);
Lymphozyt-Stimulierungsfaktor 1 M13982
Interleukin-6-Präkursor (IL-6) ; B-Zellen- Stimulierungsfaktor 2 (BSF2); Interferon-Beta-2 (IFNB2); Hybridom-Wachstumsfaktor X04602; 14584 Interleukin-5-Präkursor (IL-5) ; T-Zellen-
Substitutions-Faktor (TRF) ; eosinophiler
Differenzierungs-Faktor; B-Zellen-
Differenzierungsfaktor I X04688; J03478 Interleukin-12-Beta-Untereinheit-Präkursor
(IL-12B); zytotoxischer Lymphozyt-Maturations-
Faktor 40-kDa-Untereinheit (CLMF p40) ;
NK-Zellen-stimulierende Faktor-Untereinheit 2
(NKSF2) M65290 Interleukin-12 alpha Untereinheit Präkursor
(IL-12A) ; zytotoxsche Lymphozyt-Maturations-
Faktor 35-kDa Untereinheit (CLMF p35) ;
NK-Zellen-stimulierende Faktor-Untereinheit 1
(NKSF1) M65291 Pankreatitis-assoziierter Protein-1-Präkursor D13510
Alpha-1-Säure-Glycoprotein-l-Präkursor (AGP1) ;
Orosomucoid 1 (OMD1) X02544
C-reaktiver Protein-Präkursor X56692
Corticosteroid-bindendes Globulin J02943 Prostaglandin-Endoperoxide-Synthase-1-Präkursor;
Prostaglandin-G/H-Synthasel (PGH-Synthase-1;
PTGS1; PHS1); Cyclooxygenase-1 (C0X1) M59979
Amphiphysin (AMPH) U07616
5-Hydroxytryptamin-lD-Rezeptor (5-HT-lD; HTR1D) ; Serotonin-Rezeptor M89955
Neuromedin-B-Präkursor M21551
Haupt-Prion-Protein-Präkursor (PRP) ; PRP27-30;
PRP33-35C; ASCR M13667
Dopamin-Beta-Hydroxylase (DBH) ; Dopamin-Beta- Monooxygenase-Präkursor X13255
AIzheimer-Krankheit-Amyloid-A4-Protein-Präkursor;
ProteaseNexin-II (PN-II); APPI Y00264 membrangebundene & lösliche Catechol-O-
Methyltransferase (COMT) M65212 Flavin-enthaltende Amin-Oxidase-A; Monoa in-
Oxidase (MAO-A) M68840
Erythropoietin-Rezeptor (EPOR) M60459 kationunabhängiger Mannose-6-Phosphat-Rezeptor- Präkursor (Cl Man-6-P Rezeptor; CI-MPR) ; Insulin- artiger Wachstu sfaktor-II-Rezeptor (IGFR II ) Y00285; J03528
Aktivin-Rezeptor-Typ-II-Präkursor (ACTRIIA;
ACVR2 ) D31770
Retinoid-X-Rezeptor-GAMMA (RXR-GAMMA) U38480 transkriptioneller Enhancer-Faktor (TEFl) ;
Protein GT-IIC; Transkriptionsfaktor 13 (TCF13) M63896
Glucocorticoid-Rezeptor (GRL) M10901
Orphan-Zellkern-Hormon-Rezeptor BD73 L31785
"Low-Density"-Lipoprotein-Rezeptor (LDL Rezeptor;
LDLR) M28219
Sulfonylharnstoff-Rezeptor 2A (SUR2A) AF061323
Sulfonylharnstoff-Rezeptor (SUR) ;
ATP-bindendes Kassetten-Unterfamilie C (CFTR/MRP)
Mitglied 8 (ABCC8) L78207
Farnesol-Rezeptor HRR-1 U68233
Tyrosin-Protein-Kinase-Rezeptor UFO X66029
Colorectal-Krebs-Suppressor-Protein Präkursor (DCC) X76132
Vaskulär-Zellen-Adhäsions-Protein 1 X53051
Alphal-Catenin (CTNNA1) ; Cadherin-assoziiertes
Protein; alpha E-Catenin D13866; D14705; L23805; L22080
Integrin-alpha-9 (ITGA9) ; Integrin-alpha-RLC D25303; L24158 interzullärer Adhäsions-Molekül-1-Präkursor (ICAM1); Hauptgruppen-Rhinovirus-Rezeptor; CD54- Antigen J03132
Ras-verwandtes Protein RAB5A M28215
E-Selektin-Präkursor (SELE) ; Endothelial-Leukozyten- Adhäsions- Molekül 1 (ELAMl); Leukozyt-Endothelial- Zelladhäsion-Molekül 2 (LECAM2) ; CD62E Antigen M30640 NADH-Ubichinon-Dehydrogenase-1-beta-Subkomplex- 7 18kDa-Untereinheit (NDUFB7); Komplex-I-B18 (CI-B18); Zelladhäsions-Protein SQM1 M33374 Neural-Cadherin-Präkursor (N-Cadherin; NCAD) ; Cadherin 2 (CDH2) M34064; X57548; X54315; S42303
Zelloberflächen-Adhäsionsglycoprotein LFA-1/CR3/ pl50,95 beta-Untereinheit-Präkursor; LYAM1; Integrin-beta-2 (ITGB2) ; CD18-Antigen; Komplement-Rezeptor-C3-beta-Untereinheit M15395 Fibronektin-Rezeptor alpha-Untereinheit (FNRA) ;
Integrin-alpha 5 (ITGA5) ; VLA5; CD49E Antigen X06256
Fibronektin-Rezeptor beta-Untereinheit (FNRB) ;
Integrin-beta-1 (ITGB1); "Very-Late" Antigen-4-beta-Untereinheit (VLA4) ; CD29 Antigen X07979
Integrin-alpha-L (ITGAL) ; Leukozytahhäsions-
Glycoprotein-alpha-Untereinheit-Präkursor;
Leukozyt-funktionsassoziierte Molekül-1-alpha-
Kette (LFA1); CDllA Antigen Y00796 Cadherin-6-Präkursor (CDH6) ; Nieren-Cadherin
(K-Cadherin) D31784
Cadherin-11-Präkursor (CDH11) ; Osteoblast-
Cadherin (OB-Cadherin) ; OSF4 L34056
Cadherin 12 (CDH12) ; Gehirn-Cadherin Präkursor (Br-Cadherin) ; neurales Cadherin 2 (N-Cadherin 2) L34057; L33477
Cadherin 13 (CDH13) ; abgestumpfter Cadherin-
Präkursor (T-Cadherin) ; Herz-Cadherin (H-Cadherin) L34058; U59289;
U59288
Cadherin 3 (CDH3) ; Plazenta-Cadherin-Präkursor (P-Cadherin; CDHP) X63629
"Gap-Junction"-alpha-5-PROTEIN (Connexin 40) (CX40) L34954
Involucrin M13903
Fibrinogen-G-gamma-Polypeptid X51473; X02415
K02569 Plasma-Zellen-Membranglycoprotein PC-1; alkalische
Phosphodiesterase I; Nukleotid-Pyrophosphatase
(NPPase) M57736
Annexin V; Lipocortin V; Endonexin II; Calphobindin
I (CBP-I) ; Plazenta-Antikoagulanzprotein I (PAP-I); PP4; Thromboplastin-Inhibitor; vaskulär
Antikoagulanz-alpha (VAC-alpha; anchorin CII X12454
Aminin-alpha-1-Untereinheit-Präkursor (LAMA1) ;
Laminin-A-Kette X58531 intestinales Fettsäure-bindendes Protein 2 (FABP2; IFABP)+
Leber-Fettsäure-bindendes Protein 1 (FABP1; LFABP) M10050 + M10617
Natrium-unabhängiger Transporter für organisches
Anion; organisches Anion transportierendes Polypeptid
(OATP) ; SLC21A3 U21943 polyspezifischer Transporter für Nl (OCTN1) AB007448
TNF-alpha-stimuliertes ABC-Protein (TSAP) AF027302
Transporter-artiges Protein 2 für organisches Kation (ORCTL2) AF037064 Transporter für organisches Kation N2 (OCTN2) AF057164 MRP/Transporter für organisches Kation (MOAT-B) AF071202 Adrenoleukodystrophie-verwandtes Protein (ALDR) AJ000327 Skelettmuskel-Adenin-Nukleotid-Translokator 1 (ANT1) ; Herz/Skelettmuskel ADP/ATP Träger-Protein Isoform Tl; ADP/ATP-Translokase 1 J02966
"down-reguliertes" Protein in Adenoma (DRA) L02785 mitochondriales Entkopplungs-Protein-3 (UCP3) AF011449 mitochondrialer Carnitin-Palmitoyltransferase -II- Präkursor (CPTase; CPT2) M58581 mitochondriales "braunes Fettgewebe"-Entkopplungs-
Protein 1 (UCP1) U28480
Prostaglandin-Transporter (PGT) ; gelöstes Träger- Familie-21-Mitglied 2 (SLC21A2) U70867 mitochondriales Entkopplungs-Protein 2 (UCP2) ; UCPH U82819
Gallensalz-Export-Pumpe (BSEP) AF091582
Anthracyclineresistenz-assoziiertes Protein (ÄRA) X95715 Nieren-Transporter für organisches Kation X98333
Mehrfachresistenz-assoziiertes Protein 3 (MRP3); MLP2; ABCC3 Y17151
Antigen-Peptid-Transporter 2 (APT2) ; Peptid-Zufuhr- Faktor 2 (PSF2) ; in Antigen-Processing-2 involvierter Peptid-Transporter (TAP2) ; ATP-bindendes Kassetten-Unterfamilie-B-(MBR/TAP) -Mitglied 3 (ABCC3) ; HLA-Klasse-II-Histokompatibilitäts-Antigen DO-beta-
Ketten-Präkursor X66401; L09191;
L10287 putativer renaler Transporter-1 für organisches Anion (hROATl) AF057039 Chlorid-Leitfähigkeits-Regulierungs-Protein ICLN;
Nukleotid-sensitiver Chlorid-Kanal 1A; Chloride-Ion- Strom-Induktor-Protein (CLCI) ; Retikulozyt PICLN X91788 Transporter A für neutrale Aminosäure (SATT) ; Alanin/Serin/Cystein/Threonin-Transporter (ASCT1) L14595 Monocarboxylat-Transporter-1 (MCT1) L31801
Ileal Natrium-abhängiger Gallensalz-Transporter (ISBT) ; Ileal Natrium/Taurocholat-cotransportierendes Polypeptid (NTCP2) ; SLC10A2 U10417 Natrium-abhängiger Gallensalz-Cotransporter; hepatisches Natriu /Taurocholat-cotransportierendes Polypeptid (NTCP) ; SLC10A1 L21893
Natrium- & Chlorid-abhängiger Glycin-Transporter-1 (GLYT-1) S70609 Mukoviszidose-Transmembran-Leitfähigkeits-Regulator
(CFTR) ; cAMP-abhängiger Chlorid-Kanal M28668 kanalförmiger multispezificher Transporter für organisches Anion; Mehrfachresistenz-assoziiertes Protein 2 (MRP2); kanalförmiges Mehrfachresistenz- assoziiertes Protein U63970
Transporter für organisches Kation 1 U77086
"Gap Junction"-beta-l Protein (Connexin 32)
(CX32) (Leber-"Gap Junction"-Protein) X04325
Cadherin 1 (CDH1) ; epithelischer Cadherin-Präkursor (E-Cadherin; CDHE) ; Uvomorulin (UVO) ; CAM 120/80 Z13009 geglättet; GX U84401
Ξphrin Typ-A Rezeptor-2-Präkursor; epithelische Zell-Kinase (ECK) ; Tyrosin-Protein-Kinase-Rezeptor ECK M59371 M36395 NADPH-Cytochrom-p450-Reduktase S90469
NCK Melanom-zytoplasmisches-src-Homolog (HSNCK) X17576 JV18-1. HMAD-2 oder MADR2 oder SMAD2 U68018
Dual-Spezifitäts-Mitogen-aktivierte Protein-Kinase Kinase-1 (MAP Kinase Kinase 1; MAPKK 1; MKK1) ; extrazelluläre Signal-regulierte Kinase 1; ΞRK
Aktivator-Kinase 1 L05624
"c-jun"-N-terminale Kinase 1 (JNK1) ; JNK46 L26318
Mitogen-aktivierte Protein-Kinase p38 (MAP Kinase p38) ; Cytokin-unterdrückendes "anti-inflammatory"-Wirkstoff- bindendes Protein (CSAID-bindendes Protein; CSBP) ;
"MAX"-wechselwirkendes Protein 2 (MXI2) L35253; L35263
Protein-Kinase C beta I (PKC-beta-1) M27545; X06318
Mitogen-aktivierte Protein-Kinase 9 (MAP Kinase 9; MAPK9; PRKM9) ; "c-jun"-N-terminale Kinase 2 (JNK2) ; JNK55 L31951
"C-jun"-N-terminale Kinase 3 alpha2 (JNK3A2) ; PRKMIO
+ MAP Kinase p493F12 U34819 + U07620 dual-Spezifitäts-Mitogen-aktivierte Protein-Kinase Kinase 6 (MAP-Kinase Kinase 6; MAPKK 6; MKK6) ;
MAPK/ΞRK-Kinase 6; SAPKK3 U39657 p21-aktivierte Kinase-gamma (PAK-gamma; PAK2) ;
PAK65; S6/H4 Kinase U24153
Mitogen-aktivierte Protein-Kinase P38 beta (MAP Kinase P38 beta) ; Stress-aktivierte Protein-Kinase
2 (SAPK2) U53442
MAPK/ERK-Kinase Kinase 3 (MEK Kinase 3; MEKK3) U78876 dual-Spezifitäts-Mitogen-aktivierte Protein-Kinase
Kinase 2 (MAP Kinase Kinase 2; MAPKK 2); ERK-Aktivator-Kinase 2; MAPK/ERK Kinase 2 (MEK2) L11285 dual-Spezifitäts-Mitogen-akti ierte Protein-Kinase
Kinase 5 (MAP Kinase Kinase 5; MAPKK 5) U25265 ribosomale Protein-S6-Kinase II alpha 1 (S6KII- alpha 1) ; ribosomale S6 Kinase 1 (RSK1) L07597 B-Lymphozyt-Keimzentrums-Kinase (GC Kinase) U07349
YSK1; Ste20 & SPSl-verwandte Kinase D63780
Protein-Phosphatase 2B Regulierungs-Untereinheit;
Calcineurin-B-Untereinheit Isoform 1 M30773
Protein-Tyrosin-Phosphatase MEG2 (PTPASE-MEG2) M83738 Protein-Tyrosin-Phosphatase-alpha-Präkursor (R-PTP- alpha; PTPRA; PTPA) M34668 mit Diabetes assoziiertes RAS (RADI) L24564
CDC42-Homolog; G25K GTP-bindendes Protein
(Gehirn-Isoform + Plazenta-Isoform) M35543 + M57298 Calmegin D86322
Calbindin; Avian-Typ Vitamin-.D-abhängiges Calcium- bindendes Protein (CABP) ; D-28K X06661
Stratifin (SFN); 14-3-3 Protein Sigma; epithelisches
Zellmarker-Protein 1; HME1 AF029082 FKBP-Rapamycin-assoziiertes Protein (FRAP) ;
Rapamycin-Target-Protein L34075
Zink-Finger-Protein 37 (ZFP37); KRAB-Region-Zink-
Finger-Protein AF022158
CCAAT/Enhancer-bindendes Protein Epsilon (C/EBP Epsilon; CEBPE) U48866; U48865
Transkriptions-initiierender Faktor HD; TATA-Box-
Faktor; TATA-Sequenz-bindendes Protein (TBP) M34960
60S ribosomales Protein L6 (RPL6) ; TAX-responsives Enhancer-Element bindendes Protein 107 (TAXREB107) ;
Neoplasma-verwandtes Protein C140 X69391
DNA-bindendes Protein HIP116; ATPase; SNF2/SWI2- verwandtes Protein L34673
"Basic" Transkriptionsfaktor-2-4 -kDa-Untereinheit (BTF2p44) Z30094
Oktamer-bindender Transkriptionsfaktor 2
(oct-2; OTF2) ; Lymphoid-begrenzt Immunoglobulin-
Oktamer-bindendes Protein NF-A2; POU2F2 M36542
Zink-Finger-Protein 40 (ZNF40); menschliches Immunodefizienz-Virus-Typ-I-Enhancer-bindendes
Protein 1 (HIV-EP1) ; Haupt-Histokompatibilitäts-
Komplex bindendes Protein 1 (MBP-1) ; positive Regulator-Region-II-bindender Faktor 1
(PRDII-BF1) X51435 Nervensystem-spezifischer Oktamer-bindender
Transkriptionsfaktor N-oct3; N-oct5A & N-oct5B;
Gehirn-spezifisches Homöobox/POU-Region-Protein 2
(POU3F2) ; brn2; oct7 Z11933
Hypoxie-induzierbarer Faktor 1 alpha (HIFI alpha) ; ARNT-wechselwirkendes Protein; Mitglied von
PAS-Protein 1 (MOPl) U22431
CCAAT/Enhancer-bindendes Protein alpha (C/EBP alpha) U34070
Homeöobox-Protein MOX-2 (Wachstums-Arrest- spezifische Homöobox) X82629 endothelialer Transkriptionsfaktor GATA2 M68891
DNA-bindender Protein-Inhibitor Id-2 M97796 aktivierender Transkriptionsfaktor 4 (ATF4);
Tax-responsives Enhancer-Element B67 (TAXREB67); cAMP-Response-Element-bindendes Protein 2 (CREB2) D90209
Hitzeschockfaktor-Protein 1 (HSF1) ; Hitzeschock- Transkriptionfaktor 1 (HSTF1) ; TCF5 M64673
FK506-bindender Protein-13-Präkursor (FKBP13) ;
FKBP2; Peptidyl-Prolyl-cis-trans-Isomerase (PPIase) M65128 cAMP-Response-Element-bindendes Protein (CRE-BPl) ; Transkriptionfaktor ATF2; HB16 M31630 cAMP-Response-Element-bindendes Protein (CREB) M34356 Anfangswachstums-Response-Protein 1 (EGR1) ; Transkriptionsfaktor ETR103; KROX24; Zink-Finger- Protein 225 (ZNF225); AT225 X52541; M62829 Tristetraprolin (TTP); TISll; ZFP36; Wachstumsfaktor- induzierbares Kern-Protein 475 (NUP475) M92843 Purin-reiches einzelsträngige-DNA-bindendes Protein alpha (PURA) M96684 Transkriptionsfaktor-relB; I-rel M83221 zyklisches-AMP-abhängiger Transkriptionsfaktor ATF-3 (aktivierender Faktor FACTOR 3) L19871 Oktamer-bindender Transkriptionsfaktor 1 (oct-1; OTF1); Oktamer-bindendes Protein NF-AI; POU2F1 X13403 B-Zellen-Lymphoma-3-kodierendes Protein (bcl-3) M31732 Retinsäure-Rezeptor gamma 1 (RAR-gamma 1; RARG) M24857; M38258; M57707; M32074
PRB-bindendes Protein E2F1; Retinoblastom-bindendes Protein 3 (RBBP3) ; Retinoblasto -assoziiertes Protein 1 (RBAP1) ; PBR3 M96577
Retinsäure-Rezeptor alpha; Retinoid-X-Rezeptor alpha (RXRA) X52773
Haupt-Histokompatibilitäts-Komplex-Enhancer- bindendes Protein MAD3 M69043 fusionierend-bindendes Protein 2 (FBP2) U69126
Methyl-CpG-bindendes Protein 2 (MECP2) L37298
AP4 "basic" Helix-Loop-Helix DNA-bindendes Protein S73885 Hepatozyt-Kern-Faktor 4 (HNF4) ; Transkriptionsfaktor 14 X76930 Metall-Regulator-Transkriptionsfaktor X78710 Cockayne-Syndrom Gruppe A; WD-Repeat-Protein (CSA-Protein) U28413 RNase-L-Inhibitor X76388 40S ribosomales Protein S5 U14970 Glutamat-Pyruvat-Transaminase 1 (GPT1) ; Alanin- A inotransferase 1 (AAT1) D10355 Peptidylprolyl-cis-trans-Isomerase A (PPIase; PPIA) ; Rotamase; Ciclophilin A (CYPA) ; Cyclosporin- A-bindendes Protein Y00052 wahrscheinlicher Protein-Disulfid-Isomerase-ER-60-
Präkursor (ERP60) ; 58-kDa mikrosomales Protein;
Phospholipase C alpha D16234; Z49835; D83485; U42068
HSC70-wechselwirkendes Protein; Progesteron-Rezeptor- assoziiertes-P48-Protein U28918
Chaperonin-enthaltende T-Komplex-Polypeptid-1-beta-
Untereinheit (CCT-beta; CCTB; CCT2; TCPl-beta) ; 99D8.1 AF026293
Peroxisom-Assembly-Faktor-2 (PAF-2) ; Peroxisomal-Typ
ATPase 1; Peroxin-6; PEX6; PXAAA1 U56602 zelluläres Retinsäure-bindendes Protein S74445
Endothelin-umwandelndes Enzym 1 Z35307 Matrix-Metalloproteinase-14-Präkursor (MMP14);
MMP-Xl; Membran-Typ Matrix-Metalloproteinase 1
(MT-MMP1) D26512; X83535
Bleomycin-Hydrolase (BLM Hydrolase) X92106
Proteasom-Aktivator-HPA28-Untereinheit beta D45248 Plazenta-Plasminogen-Aktivator-Inhibitor 2 (PAI-2;
PLANH2); Monozyt ARG-Serpin; Urokinase-Inhibitor M18082; J02685 alpha-2-Makroglobulin-Präkursor (alpha-2-M) M11313
Gewebs-Inhibitor des Metalloproteinase 1 Präkursors
(TIMP1) ; Erythroid-potentierende Aktivität (EPA) ; Fibroblast-Kollagenase-Inhibitor X03124 alpha-1-Antichymotrypsin-Präkursor (ACT) K01500 alpha-1-Antitrypsin-Präkursor; alpha-1-Protease-
Inhibitor; alpha-1-Antiproteinase X02920
DNA-bindendes Protein A (DBPA) ; Kälteschock-Region- Protein A (CSDA) M24069
Decoy-Rezeptor 3 (DCR3) AF104419
T-Komplex-Protein 1 zeta-artige Untereinheit
(CCT-zeta-artig; TCPl-zeta-artig) ; TSA303; Testikel
-spezifisch TCP20# D78333 Chromatin-Assembly-Faktor-l-p48-Untereinheit
(CAF1 p48-Untereinheit) ; Retinoblastom-bindendes
Protein 4 (RBBP4); RBAP48; msil Protein-Homolog X74262
High-Mobility-Group-Protein HMG2 X62534
DNA-bindendes Protein UEV-1; UBE2V U49278 Aktivator-l-140-kDa-Untereinheit (AI 140-kDa-
Untereinheit) ; Replikationsfaktor C "large"-
Untereinheit; DNA-bindendes Protein PO-GA L14922
Replikationsfaktor-C-36-kDa-Untereinheit (RFC36) ; Aktivator-l-36-kDa-Untereinheit L07540
Replikationsfaktor-C-38-kDa-Untereinheit (RFC38) ;
Aktivator-l-38-kDa-Untereinheit L07541
Replikations-Protein-A-70-kDa-Untereinheit
(RPA70; REPAl; RF-A); einzelsträngige-DNA-bindendes Protein M63488
Aktivator-1-4O-kDa-Untereinheit (Al-40-kDa-
Untereinheit) ; Replikationsfaktor-C-40kDa-
Untereinheit (RFC40) ; RFC2 M87338
Aktivator-1-37kDa-Untereinheit; Replikationsfaktor- C-37kDa-Untereinheit (RFC37); RFC4 M87339
DNA-Topoisomerase I (T0P1) J03250
DNA-Topoisomerase II alpha (TOP2A) J04088 proliferierendes zyklisches Kern-Antigen (PCNA) ;
Zyklin M15796; J04718 DNA-Topoisomerase II beta (TOP2B) X68060
Replikations-Protein-A-14kDa-Untereinheit (RP-A)
(RF-A) ; Replikationsfaktor-A-Protein 3 L07493
DNA-Nukleotidylexotransferase; terminales
Additionions-Enzym; terminale Deoxynucleotidyl- transferase (TDT) ; terminale Transferase; DNTT M11722 ; K01919
DNA-Polymerase delta katalytische Untereinheit M80397
DNA-Topoisomerase III (TOP3) U43431
"excision repair cross-complementing rodent repair deficiency complementation group 6 (ERCC6 ) ; Cockayne-Syndrom-Protein 2 Typ B (CSB) L04791
Xeroderma-Pigmentosum Gruppe G komplementierendes
Protein (XPG) ; "X-ray repair-complementing defective repair in Chinese hamster cells 5" (XRCC5) L20046; X69978
Ku- (p70/p80) -Untereinheit; ATP-abhängige DNA- Helicase-II-86kDa-Untereinheit; Lupus-ku-Autoantigen-
Protein; Thyroid-Lupus-Autoantigen (TLAA) ; CTC-Box- bindende Faktor-85kDa-Untereinheit (CTCBF; CTC85) ;
Kern-Faktor IV M30938
Xeroderma-Pigmentosum-Gruppe B komplementierendes Protein (XPB) ; "excision repair cross-complementing rodent repair deficiency complementation group 3" (ERCC3); basilare Transkriptionsfaktor-2-89kDa- Untereinheit (BTF2-p89; TFIIH-89kDa-Untereinheit) M31899 Ku-70kDa-Untereinheit; ATP-abhängige DNA-Helicase- II-70kDa-Untereinheit; Lupus-ku-Autoantigen-Protein P70; Thyroid-Lupus-Auto-Antigen (TLAA) ; CTC-Box- bindende Faktor-75kDa-Untereinheit (CTC75) M32865; S38729
"X-ray repair-complementing defective repair in Chinese hamster cells 1" (XRCC1) M36089
Ubiquitin-konjungierendes Enzym E2 17-kDa UBE2A) ; Ubiquitin-Protein-Ligase; Ubiquitin-Träger-Protein; HR6A M74524
DNA-Polymerase alpha katalytische Untereinheit (POLA) X06745
6-O-Methylguanine-DNA-Methyltransferase (MGMT) ; methylierte-DNA-Protein-Cystein-Methyltransferase M29971 Xeroderma-Pigmentosum Gruppe D komplementierendes Protein (XPD) ; "X-ray repair-complementing defective repair in Chinese hamster cells 2" (XRCC2) X52221
"excision repair cross-complementing rodent repair deficiency complementation group 1" (ERCC1) M13194 mutL-Protein-Homologl (MLH1) ; Kolon-Krebs- Nonpolyposis-Typ-2-Protein (COCA2) U07418 UV-Exzisionsreparatur-Protein RAD23-Homolog B
(HHR23B) ; Xeroderma-Pigmentosum Gruppe C Reparaturkomplementierender Komplex 58-kDa ProteinD21090 HHR23A; UV-Exzisionsreparatur-Protein Protein RAD23A D21235 DNA-abhängige Protein-Kinase (DNA-PK) +
DNA-PK katalytische Untereinheit (DNA-PKCS) U35835 + U47077
DNA Schadens-Reparatur- & Rekombinations-Protein
52 (RAD52) U12134
Ataxia Telangiectasia (ATM) U33841 RAD50 U63139
DNA-Ligase IV (LIG4) ; Polydeoxyribonukleotid- Synthase X83441
DNA-Ligase III (LIG3) ; Polydeoxyribonukleotid- Synthase X84740 DNA-"Mis atch"-Repair-Protein MSH2 U04045; L47583
DNA-"Mismatch"-Repair-Protein MSH6; mutS-alpha-
160kDa-Untereinheit; G/T "Mismatch"-bindendes
Protein (GTMBP; GTBP) U54777 RecQ Protein-artig (DNA-Helicase Ql-artig) D37984
DNA Polymerase-beta-Untereinheit (DPOB) D29013
DNA-"Mismatch"-Reparatur-Protein PMS1 (PMS-1 -
Protein-Homolog 1) U13695
DNA-"Mismatch"-Reparatur-Protein PMS2 (PMS1- Protein-Homolog 2) U13696
ATP-abhängige DNA-Ligase I (LIG1) ; Polydeoxyribonu- kleotid-Synthase M36067
Xeroderma-Pigmentosum-Gruppe-A-komplementierendes
Protein (XPA) D14533 Schädigungs-spezifische DNA-bindende Protein-p48-
Untereinheit (DDBB P48); in Zusamenhang mit
Xeroderma Pigmentosum Gruppe E (DDB2) U18300
DNA-Reparatur-Protein XRCC4 U40622
G/T-"Mismatch"-spezifische Thymin-DNA-Glycosylase (TDG) U51166
DNA-Reparatur-Protein XRCC9 U70310
Endonuklease-III-Homolog 1; HNTH1; OCTS3 U79718
DNA-Reparatur-Protein komplementierende XP-C-Zellen;
Xeroderma Pigmentosum Gruppe C komplementierendes Protein (pl25) D21089
Uracil-DNA-Glycosylase-Präkursor (UNG1) X15653
DNA- (apurinisehe oder apyrimidinische Stelle) Lyase;
AP-Endonuklease 1 (APE1) ; apurinische / apyrimidinische Endonuklease (APEX) ; APEX Nuklease (APEN) ; REF1 X59764; X66133
DNA-Reparatur-Protein-RAD54-Homolog X97795 recA-artiges Protein HsRad51; DNA-Reparatur-Protein
RAD51-Homolog D13804
V(D)J Rekombinations-aktivierendes Protein 2 (RAG2) M94633 V(D)J Rekombinations-aktivierendes Protein 1 (RAGl) M29474
Muskel-spezifischer DNase-I-artiger Präkursor
(DNaselLl; DNL1L) ; DNase X X90392; L40817;
U06846
Deoxyribonuklease I (DNase I) M55983 dual-Spezifitäts-Protein-Phosphatase 9;
Mitogen-aktivierte Protein-Kinase-Phosphatase 4
(MAP-Kinase-Phosphatase 4 (MKP4) Y08302
Gl/S-spezifisches Cyclin D3 (CCND3) M92287 Gl/S-spezifisches Cyclin Dl (CCND1) ; Cyclin-
Parathyreoid-Adenomatose 1 (PRAD1) ; bcl-1 Onkogen X59798
Gl/S-spefisches Cyclin D2 (CCND2) + KIAK0002 M90813 + D13639
G2/Mitose-spezifisches Cyclin Bl (CCNB1) M25753
Gl/S-spezifisches Cyclin E (CCNE) M73812 G2/Mitose-spezifisches Cyclin Gl (CCNG1; CYCG1) U47413 Gl/S-spezifisches Cyclin C M74091
Cyclin K AF060515
Protein-Serin/Threonin-Kinase STK1; Zellteilungs-
Protein-Kinase 7 (CDK7); CDK-aktivierende Kinase (CAK) ; 39kDa-Protein-Kinase L20320
Cyclin-abhängige Protein-Kinase 2 (CDK2); p33-
Protein-Kinase M68520 extrazelluläre Signal-gesteuerte Kinase 2 (ERK2) ;
Mitogen-aktivierte Protein-Kinase 2 (MAP Kinase 2; MAPK 2); p42-MAPK M84489
Mitogen-aktivierte Protein-Kinase 3 (MAPK3; PRKM3) ;
MAPK1; extrazelluläre Signal-gesteuerte
Kinase 1 (ERK1) ; Microtubulus-assoziierte Protein-2
Kinase; Insulin-stimulierte MAP2 Kinase X60188 extrazelluläre Signal-gesteuerte Kinase 3 (ERK3) ;
MAP-Kinase 3 (MAPK3; p97-MAPK) ; PRKM5 X80692
CDC-artige Kinase 3 (CLK3) L29220
Zellteilungs-Protein-Kinase 4; Cyclin-abhängige
Kinase 4 (CDK4); PSK-J3 M14505 extrazelluläre Signal-gesteuerte Kinase 5 (ERK5) ;
BMKl-Kinase U25278
Zellteilungs-Kontroll-Protein-2-Homolog (CDC2) ; p34-Protein-Kinase; Cyclin-abhängige Kinase 1 (CDKl) X05360 extrazelluläre Signal-gesteuerte Kinase 4 (ERK4); MAP-Kinase 4 (MAPK4; p63-MAPK) ; PRKM4 X59727
Zellteilungs-Protein-Kinase 5 (CDK5) ; tau-Protein-
Kinase II katalytische Untereinheit (TPKII katalytische
Untereinheit) ; Serin/Threonin-Protein-Kinase
PSSALRE X66364 extrazellulär Signal-gesteuerte Kinase 6 (ERK6) ; Stress-aktivierte Protein Kinase-3; Mitogen- aktivierte Protein-Kinase p38 gamma; (MAP-Kinase p38 gamma) X79483
Serin/Threonin-Protein-Kinase PLK1 (STPK13) U01038
"Checkpoin "-Kinase 1 (CHK1) AF016582
Aurora- & IPLl-artige "Midbody"-assoziierte Protein-
Kinase 1 (AIM1) ; ARK2 AF008552
Cyclin-G-assoziierte Kinase (GAK) D88435 besonders AT-reiche Sequenz bindendes Protein 1
(SATB1) ; MAR/SAR-DNA-bindendes Protein M97287
Cyclin-abhängiger Kinase-Inhibitor 1A (CDKN1A) ;
Melanom-Differenzierungs-assoziiertes Protein 6 (MDA6) ;
CDK-wechselwirkendes Protein 1 (CIP1) ; AF1; SDI1 U09579; L25610 weelHu-CDK-Tyrosin-15-Kinase; wee-1-artige Protein- Kinase U10564
Cyclin-abhängiger Kinase-4-Inhibitor 2B (CDKN2B) ; pl4-INK4B; Polytumor-Suppressor 2 (MTS2) U17075; L36844
Helix-Loop-Helix-Protein HLH 1R21; DNA-bindender Protein-Inhibitor Id-3; HEIR-1 X69111
DNA-bindender Protein-Inhibitor ID-1; Id-IH D13889
Prothymosin alpha (PROT-alpha; PTMA) M26708
40S ribosomales Protein S19 (RPS19) M81757 p55CDC U05340 Zellteilungszyklus-Protein 25A (CDC25A) ; M-Phasen-
Induktor-Phosphatase 1 M81933
CDC25B; CDC25HU2; M-Phasen-Induktor-Phosphatase 2 M81934; S78187
CDC25C; M-Phasen-Induktor-Phosphatase 3 M34065
Wachstumsinhibitor-Faktor (GIF) ; Metallothionein-III (MT-III; MT3) D13365; M93311
CDC37 Homolog U63131
Zellzyklus-Protein-P38-2G4-Homolog; HG4-1 U59435 btg-Protein-Präkursor; NGF-induzierbares anti- proliferatives Protein PC3 U72649 RCL Wachstums-verwandtes c-myc-Responsiv-Gen AF040105
40kDa-Hitzeschock-Protein 1 (HSP40) ; DNAJ-Protein-
Homolog 1 (HDJ1; DNAJ1) D49547
60kDa-Hitzeschock-Protein (HSP60) ; HSPDl; 60kDa-
Chaperonin; mitochondrialer Matrix-Protein-Pl- Präkursor; p60 Lymphozyt-Protein; HUCHA60; GROEL M34664 90kDa-Hitzeschock-Protein A (HSP90A) ; HSP86; HSPCA X07270 27kDa-Hitzeschock-Protein (HSP27); Stress-responsives Protein 27 (SRP27); Estrogen-gesteuertes 24kDa- Protein; HSPB1 X54079
70kDa-Hitzeschock-Protein 1 (HSP70.1; HSPA1) M11717 Hitzeschock-70kDa-Protein 6 (Hitzeschock-70kDa- Protein B) X51757; M11236
Hitzeschock-Cognat-71kDa-Protein; Hitzeschock-70kDa Protein 8 (HSPA8; HSC70) ; HSP73 Y00371 Hitzeschock-verwandtes 70kDa-Protein 2 L26336 Haupt-Gewölbe-Protein (MVP) ; Lungen Resistenzverwandtes Protein (LRP) X79882 Thiosulfat-Sulfurtransferase; Rhodanese D87292 lösliche Epoxid-Hydrolase (SEH) ; Epoxid-Hydratase; zytosolische Epoxid-Hydrolase (CEH) ; EPHX2 L05779 Serum-Paraoxonase/Arylesterase 1 (PON1) ; Serum- Aryldiakylphosphatase 1; aromatische Esterase 1 (A-Esterase 1) M63012 polymorphe Arylamin-N-Acetyltransferase (PNAT) + monomorphe (MNAT) X14672; X17059
Chinon-Oxidoreduktase; NADPH: Chinon-Reduktase; Zeta-Crystallin (CRYZ) L13278; S58039 zytosolische Superoxid-Dismutase 1 (SOD1) K00065; X02317 Cytochrom P450 IB1 (CYP1B1) U03688
Cytochrom P450 IIA6 (CYP2A6) + CYP2A7 + CYP2A13 + CYP2A7PT + CYP2A7PC M33318; M33316 + U22029 + U22030 + U22044
Cytochrom P450 IIB6 (CYP2B6) + CYP2B3 M29874; J02864 Cytochrom P450 IIIA3 (CYP3A3) + CYP3A4 + CYP3A5 + CYP3A7 M13785 + M18907 + J04813 + D00408 Cytochrom P450 IVA11 (CYP4A11) L04751
Cytochrom P450 VIIA1 (CYP7A1) X56088
D-Aminosäure-Oxidase (DAMOX; DAO; DAAO) X13227
S-Mephenytoin-4-Hydroxylase; Cytochrom P450 IIC9 (CYP2C9) + CYP2C10 + CYP2C17 + CYP2C18 + CYP2C19 M21940 + M15331; M21939 + M61858 + M61854
Cytochrom P450 HEI (CYP2E1) J02625 Cytochrom P450 IIF1 (CYP2F1) J02906
Cytochrom P450 IVB1 (EC 1.14.14.1) (P450-HP) J02871 Cytochrom P450 IA2 (P450-P3) (P450-4) Z00036 Plasma-Glutathion-Peroxidase-Präkursor (GPXP; GPX3) D00632; X58295 natürliche Killerzellen verstärkender Faktor (NKEFB) + Thiol-spezifisches Antioxidans-Protein (TSA) ; Thioredoxin-Peroxidase 1 (TDPX1) ; Thioredoxin- abhängige Peroxid-Reduktase 1 L19185 + Z22548; X82321
Thioredoxin-Peroxidase 2 (TDPX2) ; Thioredoxin- abhängige Peroxid-Reduktase 2; Proliferation- assoziiertes Gen (PAG) ; natürliche Killerzellen verstärkender Faktor A (NKEFA) X67951 Glutathion-Reduktase (GRase; GSR; GR) X15722 microsomale Glutathion-S-Transferase 12 (GST12; MGST1) J03746; B28083
Glutathion-S-Transferase pi (GSTP1; GST3) X08058; M24485 Glutathion-Peroxidase (GSHPX1; GPX1) Y00483; M21304 Glutathion-S-Transferase theta 1 (GSTTl) X79389 Methallothionein IH (MT1H) ; MetallothineinO (MT0) + MT1I; MT2 + MT1L + MT1R X64177 + X97260 + X76717 + X97261
Glutathion-Peroxidase-Gastrointestinal (GSHPX-GI) ;
Glutathion-Peroxidase-verwandtes Protein 2 (GPRP) X53463 Häm-Oxygenase 1 (HOl) ; HSOXYGR X06985
Häm-Oxygenase 2 (H02) D21243; S34389
Dimethylanilin-Monooxygenase (N-Oxide bildend) 1
(EC 1.14.13.8); fetal hepatische Flavin- enthaltende Monooxygenase 1 (FMO 1) ; Dimethylanilin- Oxidase 1 M64082
Glutathion-S-Transferase ul (GSTM1; GST1) ; HB-
Untereinheit 4; GTH4 X68676; S01719
Glutathion-S-Transferase AI (GTH1; GSTA1) ; HA-
Untereinheit 1; GST-epsilon M25627 Glutathion-S-Transferase (GST) -Homolog U90313
Glutathion-Synthetase (GSH-Synthetase; GSH-S) ;
Glutathion-Synthase U34683
NAD(P)H-Dehydrogenase; Chinon-Reduktase; DT- Diaphorase; Azoreductase; Phyllochinon-Reduktase;
Menadion-Reduktase J03934
Wachstumsstillstand- & DNA-Schädigung-induzierbares
Protein (GADD45) ; DNA-Schädigung-induzierbares
Transkript 1 (DDIT1) M60974 Tumor-Nekrose-Faktor-alpha-Präkursor (TNF-alpha;
TNFA) ; Cachectin X01394
Lymphotoxin-alpha-Präkursor (LT-alpha) ; Tumor-
Nekrose-Faktor-beta (TNF-beta; TNFB) D12614 fas-Antigen-Ligand (FASL) ; Apoptosis-Antigen-Ligand (APTL; APT1LG1); TNFSF6 D38122; U08137
Tumor-Nekrose-Faktor-Rezeptor (TNFR) + Tumor-
Nekrose-Faktor Rezeptor 2 (TNFR2) ;Tumor-Nekrose-
Faktor-bindendes Protein 2 (TBP2) M32315 + M55994
Tumor-Nekrose-Faktor-Rezeptor 1 (TNFR1) ; Tumor- Nekrose-Faktor-bindendes Protein 1 (TBP1) ; CD120A-
Antigen M33294 fasL-Rezeptor; Apoptosis-unterstützendes Oberflächen-
Antigen fas; APO-1-Antigen; CD95-Antigen M67454
Retinsäure-Rezeptor beta (RXR-beta; RXRB) M84820; X63522;
S54072
Tumor-Nekrose-Faktor-Rezeptor-1-assoziiertes "Death"-
Domain-Protein (TNFRl-assoziiertes "Death"-Domain-
Protein; TRADD) L41690
CD27BP (Siva) U82938 Tumor-Nekrose-Faktor Tyρ-1-Rezeptor-assoziiertes
Protein (TRAP1) U12595
Caspase-2-Präkursor (CASP2) ; ICH-IL-Protease +
ICH-lS-Protease U13021 + U13022
Interleukin-1-beta-Convertase-Präkursor (IL-1BC) ; IL-1-beta-umwandelndes-Enzym (ICE) ; p45; Caspase-1
(CASP1) U13699; M87507; X65019
Caspase-6-Präkursor (CASP6) ; Cysteine-Protease MCH2- Isoformen alpha + beta U20536 + U20537 Caspase-4-Präkursor (CASP4) ; ICH-2-Protease; TX- Protease; ICE(REL)-II + Caspase-5-Präkursor
(CASP5); ICH-3-Protease; TY-Protease; ICE(REL)-III U28014 + U28015 Caspase-7-Präkursor (CASP7); ICE-artige apoptotische Protease 3 (ICE-LAP3) ; apoptotische Protease
MCH-3; CMH-1 U37448
TNF-verwandter Apoptosis-induzierender Ligand (TRAIL); APO-2-Ligand (AP02L) U57059
Caspase-8-Präkursor (CASP8) ; ICE-artige apoptotische Protease 5 (ICE-LAP5) ; MORTl-assoziiertes CED-3-Homolog (MACH) ; FADD-Homolog ICE/CED-3-artige Protease (FADD-artige ICE; FLICE) ; apoptotische Cysteine-Protease MCH-5 U60520; U58143;
X98172; AF00962 Apoptosis-Regulator bax L22474
Apoptosis-Regulator bcl-x Z23115; L20121;
L20122 Apoptosis-Regulator bcl-2 M14745
NIP3 (NIP3) U15174 bcl2 homologer Antagonist/Killer (BAK) Ü23765; U16811;
X84213 induziertes myeloid Leukämiezellen-Differentiations- Protein MCL-1 L08246 BAD-Protein; bcl-2-bindende Komponente 6 (BBC6) ; bcl-2L8 U66879
BCL-2-bindendes Athanogen-1 (BAG-1) ; Glucocorticoid-Rezeptor-assoziiertes Protein
RAP46 S83171; Z35491
Interferon-induzierbare RNA-abhängige Protein-Kinase (P68 Kinase) M35663; U50648 induzierbare Stickstoffmonoxid-Synthase (INOS) ; Typ II NOS; Hepatozyt NOS (HEP-NOS) L09210
Verteidiger gegen Zelltod 1 (DAD1) D15057
Clusterin-Präkursor (CLU) ; Komplement-assoziiertes Protein SP-40; Komplement-Lysis-Inhibitor (CLI) ;
Apolipoprotein J (APOJ) ; Testosterone-reprimiertes Prostata-"Message" 2 (TRPM2) ; sulfatiertes Glyco- protein 2 (SGP2) M74816
Wachstummsstilstand- & DNA-Schädigung-induzierbares Protein 153 (GADD153) ; DNA-Schädigungs-induzierbares
Transkript 3 (DDIT3) ; C/EBP homologes Protein
(CHOP) S40706; S62138
Inhibitor des Apoptosis-Protein 1 (HIAPl; API1) + lAP-Homolog C; TNFR2-TRAF Signalstoff-Komplex-Protein 1;
MIHC U45878 + U37546
Zytoplasmische Dynein "light chain" 1 (HDLC1) ;
Protein-Iinihibitor neuronaler Stickstoffmonoxid-
Synthase (PIN) U32944
Apoptosis-Inhibitor "survivin" U75285
Sentrin; Ubiquitin-artiges Protein SMT3C; Ubiquitin-
Ho ologie-Region-Protein PIC1; UBL1; SUMO-1; GAP modifizierendes Protein 1; GMP1 U83117
IEX-1L Anti-"Death"-Protein; PRG-1; DIF-2 AF039067;
AF071596
Poly(ADP-Ribose) Polymerase (PARP; PPOL ); ADPRT; NAD+ ADP-Ribosyltransferase; Poly (ADP-Ribose) Synthetase M18112; J03473
Avian Myelocytomatose virales Onkogene-Homolog (MYC) V00568 p53-assoziiertes mdm2-Protein Z12020; M92424 aus Blutplättchen gewonnener Wachstumsfaktor B
Untereinheit-Präkursor (PDGFB; PDGF2) ; Bacaplermin; c-sis X02811 X02744; M12783 M16288 p53 zelluläres Tumor-Antigen M14694 M14695
MYB-verwandes Protein B (B-MYB) ; Avian Myeloblastose virales Onkogen-Homolog-artige 2 (MYBL2) X13293 Triiodothyronin-Rezeptor; Thyroid-Hormon-Rezeptor
(THRA1) ; v-erbA-verwandtes Protein Protein ear-1 M24898 "jun" Proto-Onkogen; Avian-Sarkoma-Virus-17-Onkogen- Homolog; Transkriptionsfaktor AP-1 J04111 Insulin-artigen Wachstumsfaktor bindendes Protein 2
(IGFBP2) M35410 c-myc Purin-bindender Transkriptionsfaktor puf;
Nukleosid-Diphosphat-Kinase B (NDP-Kinase B; NDKB)
+ nm23-H2S L16785 + M36981
Abelson-Murine-Leukämie virales Onkogen-Homolog 1
(ABL1) M14752
Retinoblastom-assoziiertes Protein (RB1) ; PP110; P105-RB M15400
L-myc Proto-Onkogene (MYCL1) Ml9720
Brustkrebs-Typ-2-Suszeptibilitäts-Protein (BRCA2) U43746 fos-verwandtes Antigen (FRA1) ; fosLl X16707 Nukleus-Phosphoprotein B23; Nukleophosmin (NPM) ;
Numatrin M23613 c-myc-bindendes Protein MM-1 D89667 c-fos-Proto-Onkogen; G0S7 Protein K00650 met-Proto-Onkogen; Hepatozyt-Wachstumsfaktor- Rezeptor-Präkursor (HGF-SF Rezeptor) J02958
Nukleosid-Diphosphate-Kinase A (NDKA) ; NDP-Kinase A; Tumor-metastatischem Prozess-assoziiertes Protein; Metastase-Inhibiions-Faktor NM23 (NM23-H1) X17620
Matrix-Metalloproteinase 11 (MMP11) ; Stromelysin 3 X57766 Box-abhängiges myc-wechselwirkendes Protein 1 U68485 H-ras-Proto-Onkogen; transformierendes G-Protein V00574 Protein-Tyrosin-Phosphatase PTEN; mutiert in verschiedenen fortgeschrittenen Krebsen 1 (MMAC1) ; TEP1 U92436 Prostaglandin-G/H-Synthase-2-Präkursor
(PGH-Synthase-2; PGHS2; PTGS2); Cyclooxygenase 2
(COX2); Prostaglandin-Endoperoxid-Synthase 2 M90100
78-kDa Glucose-regulierter Protein-Präkursor
(GRP 78) ; Immunoglobulin-"heavy chain"-bindendes Protein (BIP) M19645
Komplement 3 (C3) K02765
Interleukin-10-Präkursor (IL-10) ; Cytokin-Synthese- Hem faktor (CSIF) M57627
Thioredoxin (TRDX; TXN) ; ATL-abgeleiteter Faktor (ADF) ; Oberflächen-assoziiertes Sulphydrylprotein (SASP) J04026 Enolase 1 alpha (ENOl) ; nicht-neurale Enolase (NNE) ; Phosphopyruvat-Hydratase (PPH) M14328
Biliverdin-Reduktase-A-Präkursor (BLVRA; BVR) U34877 Tyrosin-Aminotransferase (TAT); I-Tyrosin:2- Oxoglutarateaminotransferase X52520
Mskel-spezifische Kohlensäure-Anhydrase III (CA3) ; Carbonat- Dehydratase III M29458
Spermidine/Spermine-Nl-Acetyltransferase (SSAT) ; Diamine-Acetyltransferase; Putrescin-Acetyl- transferase M55580
L-Lactate-Dehydrogenase-H-Untereinheit (LDHB) Y00711
Phosphoglycerid-Kinase 1 (PGK1; PGKA) ; Primer-
Erkenungs-Protein 2 (PRP2) V00572 Glucose-6-Phosphat-Dehydrogenase (G6PD) X03674 mitochondriale Phosphoenolpyruvat-Carboxykinase-2-
Präkursor (PEPCK-M; PCK2) ; Phosphoenolpyruvat-
Carboxylase X92720
Galactosid 2-1-Fucosyltransferase 2; GDP-l-Fucose:beta-D-Galactosid 2-alpha-l-Fucosyl- transferase 2; Fucosyltransferase 2 (FUT2);
Sekretor Blutgruppe alpha-2-Fucosyltransferase;
Sekretor Faktor 2 (SE2) D87942
Galactosyltransferase-assoziierte Protein-Kinase p58 (GTA) ; Zellteilungszyklus-2-artige 1
(CDC2L1; CLK1) M37712
Adrenodoxin M34788
Alkohol-Dehydrogenase-alpha-Untereinheit + Alkohol-
Dehydrogenase 2 + Alkohσl-Dehydrogenase 3 M12271 + D00137
+ X04299
Alkohol-Dehydrogenase-5-chi-Polypeptid M30471
Alkohol-Dehydrogenase-Klasse-II-pi-Untereinheit M15943
Creatin-Kinase B-Kette L47647
Fettsäure- S80437 hepatische Triglycerid-Lipase (HTGL) X07228
Gallensalz-aktivierte Lipase M85201; M37044 mitochondriale Enoyl-CoA-Hydratase kurze
Untereinheit 1 D13900 peroxisomales bifunktionales Enzym L07077 peroxisomale Acyl-CoA-Oxidase-verzweigte-Unterein- heit (BRCOX) X95190
Acyl-CoA-Dehydrogenase-"long-chain-spezifischer
Präkursor (LCAD; ACADL) M74096
Alkohol-Sulfotransferase L20000 Ξstradiol-17-beta-Dehydrogenase 1 M36263
Cytochrom P450 XVIIA1 (CYP17A1) M14564 peroxisomaler 3-Ketoacyl-CoA-Thiolase-Präkursor
(PTHIO); peroxisomale 3-Oxoacyl-CoA-Thiolase; beta-Ketothiolase; Acetyl-CoA-Acyltransferase (ACAA) XI4813
3-Hydroxy-3-Methylglutaryl-CoEnzym-A-Reduktase
(HMG-CoA Reduktase; HMGCR) M11058
Lipoprotein-Lipase-Präkursor (LPL) M15856
Lunge Gruppe IB Phospholipase-A2-Präkursor (PLA2) ;
Phosphatidylcholin-2-Acylhydrolase M21054 mi ochondrialer Cytochrom-P450-XIA1-Präkursor;
P450(SCC) ; Cholesterol-Seiten-Kette-Spaltungs-
Enzym; Cholesterol-Desmolase CYP11A1 M14565
Dihydrofolat-Reduktase (DHFR) V00507
Thymidylat-Synthase (TYMS; TS) X02308 zytosolische Thymidin-Kinase (TK1) K02581
Ribonucleosid-Diphosphat-Reduktase-Ml-Untereinheit;
Ribonukleotid-Reduktase X59543 microsomale UDP-Glucuronosyltransferase-2B15-Präkursor (UDPGT) ;
UDPGTH-3;
UGT2B15 + microsomaler 2B10-Präkursor (UDPGT);
UGT2B10 + 2microsomal B8 Präkursor U08854; X63359; U06641; J05428; Y00317
GLCLC, GLCL (Glutamat-Cystein-Ligase katalytische Untereinheit, gamma-Glutamylcystein-Synthetase) M90656 gamma-Glutamyl-Hydrolase-Präkursor (GGH; GH) ; Folyl- polygammaglutamyl-Hydrolase; gamma-glu-X Carboxy- peptidase; Conjugase U55206 3 ' -Phosphoadenosin-5 ' -Phosphosulfat-Synthase 1
(PAPS-Synthase 1; PAPSSl) ;
PAPS-Synthetase 1; Sulfurylase-Kinase 1 (SKI) Y10387 lösliche Glutamat-Oxalacetat-Transaminase 1 (GOT1); zytoplasmische Aspartat-Aminotransferase 1;
Transaminase A M37400
Alkohol-Dehydrogenase-6 + Aldehyd-Dehydrogenase 1
(ALDH1) K03000 peroxisomale Acyl-CoEnzym-A-Oxidase S69189 "very-long-chain"-spezifischer Acyl-CoA- Dehydrogenase-Präkursor (VLCAD) D43682 Glutamat-Cystein-Ligase regulatorische Untereinheit
(GLCLR) ; gamma-Gluta ylcystein-Synthetase P48507 LOX (Protein-Lysin-6-Oxidase, Lysyl-Oxidase) M94054 Ornithin-Decarboxylase X16277
Corticosteroid-11-beta-Dehydrogenase-Isozym 2 U14631
Cytochrom P450 VA1 (CYP5A1) M80647 mitochondrialer Aldehyd-Dehydrogenase-Präkursor (Klasse 2); ALDHI; ALDH2 Y00109
5, 6-Dihydroxyindol-2-carbonsäure-Oxidase-Präkursor (DHICA-Oxidase) ; Tyrosinase-verwandtes Protein 1 (TRP-1); Catalase B; Glycoprotein-75 (GP75) X51420
Tenascin-Präkursor (TN) ; Hexabrachion (HXB) ;
Cytotactin; Neuronectin; GMEM; miotendinöses Antigen;
Gliom-assoziiertes extrazelluläres Matrix-Antigen X78565; M55618 Osteopontin-Präkursor (Knochen-Sialoprotein 1) X13694 ATP-bindender-Cassette-Transporter (ABCR) U88667 Gewebe-Inhibitor des Metalloproteinase-2-Präkursors (TIMP2) J05593
Matrix-Metalloproteinase 15 (MMP15) Z48482 Matrix-Metalloproteinase 14 (MMP14) D26512 Matrix-Metalloproteinase 1 (MMP1) X54925 Vinculin M33308 Vimentin (VIM) X56134; M14144
Serum-Amyloid- Al-Präkursor (SAA1) M23698 Seneszenz-Marker-Protein 30 (SMP30); Regucalcin (RGN; RC) D31815
Ubiquitin-"cross-reactive"-Protein-Präkursor (UCRP) ; alpha-induzierbares Interferon; Interferon-induziertes- 17kDa-Protein; G1P2; ISG15 M13755
Laminin-gamma-2-Untereinheit-Präkursor (LAMC2) Z15009 Peroxisom-Assembly-Faktor 1 (PAF1) ; Peroxisomales Membran-Protein 3 (PXMP3; PMP3) ; 35kDa peroxisomales Membran-Protein (PMP35) ;
Peroxin 2 (PΞX2) M86852 peroxisomales Membran-Protein 69 (PMP69) AF009746
Peroxisom-Biogenese-Störungs-Protein 1 (PEX1) AF026086 mitochondriale Glutamat-Oxaloacetat-Transaminase 2 (GOT2); Aspartat-Aminotransferase 2; Transaminase A M22632 nck-, ash- & Phoshpholipase-C-gamma-bindendes
Protein (NAP4) AB005216
N-Oxid-bildende Dimethylanilin-Monooxygenase 4; hepatische Flavin-enthaltende Monooxygenase 4 (FM04) Z11737
Xeroderma Pigmentosum Gruppe F komplementierendes Protein (XPF) ; DNA Exzisions-Reparatur-Protein ERCC4; ERCC11 L77890
Replikations-Protein-A-30kDa-Untereinheit;
Replikations-Faktor-A-Protein 4 (RPA4; RFA) U24186 utY-Homolog (hMYH) U63329 beta Crystallin A4 (CRYBA4) U59057
T-Komplex-Protein-1-epsilon-Untereinheit
(TCPl-Epsilon) ; CCT-epsilon (CCTE; CCT5) D43950 beta Crystallin Bl (CRYBB1) U35340 beta Crystallin B2 (CRYBB2) ; BP L10035 beta Crystallin B3 (CRYBB3; CRYB3) U71216 mitochondriales lOkDa Hitzeschock-Protein (HSP10); lOkDa-Chaperonin (CPN10) ; HSPE1 U07550
Hitzeschock-Protein beta-3 (HSPB3) ; Hitzeschock- 17kDa-Protein; HSPL27 U15590 wahrscheinlicher Protein Disulfid-Isomerase- P5-Präkursor D49489
90kDa-Hitzeschock-Proteinbeta (HSP90) ; 84kDa- Hitzeschock-Protein beta (HSP84); HSPCB M16660 mikrosomaler UDP-Glucuronosyltransferase-l-6-Präkursor (UDPGT; UGT1.6; UGT1F; GNT1) J04093
Glutathion-S-Transferase mu 3 (GSTM3) ; GST5 J05459
Cytochrom P450 1A1 (CYP1A1) ; P450-P1; P450 form 6; P450-C K03191
Peroxisom Proliferator-aktivierter Rezeptor alpha (PPAR-alpha; PPARA) L02932
Protein-Disulfid-Isomerase-verwandter Protein- Präkursor (PDIR) D49490 Leber-Carboxylesterase-Präkursor; Acyl-coEnzym A: Cholesterol-Acyltransferase (ACAT) ; Monozyt/Makrophage- Serin-Esterase (hMSE) ; CES2 L07765 Serum-Paraoxonase/Arylesterase 3 (PON3) ; Serum- Aryldiakylphosphatase 3; aromatische Esterase 3 (A-Esterase 3) L48516 Cytochrom P450 XXIB (CYP21B) ; Steroid-21-Hydroxy- lase; CYP21A2 M12792; M23280
Cytochrom P450 IID6 (CYP2D6) ; P450-DB1; Debrisoquine-4-Hydroxylase M20403 mikrosomaler UDP-Glucuronosyltransferase-1-1- Präkursor (UDPGT; UGT1.1; UGT1A; GNTl); Bilirubin- spezifisches Isozym 1 (hUG-BRl) M57899 mikrosomaler UDP-Glucuronosyltransferase-1-4-
Präkursor (UDPGT; UGT1.4; UGTID; GNTl); Bilirubin- spezifisches Isozym 2 (hUG-BR2) M57951 Flavin-enthaltende Amin-Oxidase B (MAOB) ; Monoamin-Oxidase M69177 eukaryotische Peptid-Ketten-Release-Faktor- Untereinheit 1 (ERF1) ; TB3-1; CH Protein M75715 mikrosomaler UDP-Glucuronosyltransferase-1-3- Präkursor (UDPGT; UGT1.3; UGT1C; GNTl) M84127 Struktur-spezifisches Erkennungs-Protein 1 (SSRPl) ; Rekombinations-Signal-Sequenz-Erkennungs-Protein; T160 M86737 mikkrosomaler UDP-Glucuronosyltransferase-1-2- Präkursor (UDPGT; UGT1.2; UGT1B; GNTl); HLUGP4 S55985 Thiopurin-S-Methyltransferase (TPMT) S62904 meiotisches Rekombinations-Protein-DMCl/LIM15- Homolog D63882
"shor "/branched-chain"-spezifischer Acyl-CoA- Dehydrogenase-Präkursor (SBCAD; ACADSB) ; 2-Methyl- "branched chain"-Acyl-CoA-Dehydrogenase (2-MEBCAD) U12778 Cytochrom-P450-XIB1-Präkursor (CYPllBl); Steroid-11- beta-Hydroxylase (S11BH) X55764 Cytochrom P450 IVA11 (CYP4A11) X71480 NADH-Cytochrom-B5-Reductase (B5R) ; DIA1 Y09501 Coproporphyrinogen-III-Oxidase-Präkursor (CPO) ; Coproporphyrinogenase; Coprogen-Oxidase (COX) Z28409 HOkDa-Hitzeschock-Protein (HSP110) ; 105kDa- Hitzeschock-Protein (HSP105) ; KIAA0201 D86956 Gamma Crystallin C (CRYGC; CRYG3; Gamma Crystallin 2 + Gamma Crystallin B (CRYGB; CRYG2); Gamma Crystallin 1-2 U66582 + M11971; M11970
Hitzeschock-Transkriptionsfaktor 4 (HHSF4) D87673 extrazellulärer Superoxid-Dismutase-Präkursor (EC-SOD; SOD3) J02947
DNAJ-Protein-Homolog 2 (DNAJ2; hDJ2; HSJ2) D13388
DNA "mismatch repair" Protein MSH3; divergentes
Upstream-Protein (DUP) ; "Mismatch Repair"-Protein 1 (MRP1) J04810
Protein-Disulfid-Isomerase-verwandter Protein-
ERP72-Präkursor J05016
Replikations-Protein-A-32kDa-Untereinheit (RPA32) ;
Replikations-Faktor A Protein 2 (REPA2; RPA2; RFA) J05249 Mehrfachresistenz-assoziiertes Protein 1 (MRP1) L05628
Calnexin-Präkursor (CANX) ;
Haupthistocompatibilitäts-Komplex Klasse I
Antigen-bindendes Protein p88; IP90 L10284; L18887;
M94859; M98452 Cyclophilin-40 (CYP40; CYPD); 40-kDa Peptidyl-Prolyl- cis-trans-Iso erase (PPIASE); Rotamase; Cyclophilin- verwandtes Protein L11667
Hitzeschock-70kDa-Protein 4 (HSPA4); HSP70RY;
Hitzeschock-70-verwandtes Protein APG-2 L12723 T-Komplex-Protein-1-theta-Untereinheit (TCPl-theta) ;
CCT-theta (CCTQ; CCT8); KIAA0002 D13627 mitochondrialer Stress-70-Protein-Präkursor;
75kDa Glucose-gesteuertes Protein (GRP75) ;
Peptid-bindendes Protein 74 (PBP74) ; Mortalin (MOT); HSPA9B L15189 p23; 23-kDa Progesteron-Rezeptor-assoziiertes
Protein L24804; L24805
FLAP Endonuklease 1 (FEN1) ; Maturations-Faktor 1
(MF1) L37374 FK506-bindendes Protein 12 (FKBP12) ; Peptidyl-Prolyl- cis-trans-Isomerase (PPIase) ; Rotamase M34539; M80199;
M92423; X55741; X52220
Hitzeschock-Faktor Protein 2 (HSF2) ; Hitzeschock- Transkriptionsfaktor 2 (HSTF2) M65217
3-Methyladenin DNA-Glycosylase (ADPG) ; 3-Alkyladenin
DNA Glycosylase; N-Methylpurin-DNA Glycosirase
(MPG) M74905
Calreticulin-Präkursor (CRP55) ; Calregulin; HACBP; ERP60; 52-kDa Ribonukleoprotein-Autoantigen
RO/SS-A M84739
Transfor ations-sensitives Protein IEF SSP 3521 . M86752 alpha-Crystallin-B-Untereinheit (alpha (B) -Crystallin; CRYAB; CRYA2); Rosenthal-Faser-Komponente S45630
Hitzeschock-Protein beta 2 (HSPB2); DMPK-bindendes Protein; MKBP S67070 alpha Crystallin A-Kette (CRYAA; CRYA1) U05569
Nicotinamid N-Methyltransferase (NNMT) U08021 Phenol-sulfatierende Phenol-Sulfotransferase 1 (PPST1) ; thermostabile Phenol-Sulfotransferase (TS-PST) ; HAST1/HAST2; ST1A3; STP1 + PPST2; ST1A2; STP2 + Monoamin-sulfatierende Phenol-Sulfotransferase U09031 + U28170 + L19956
NADP+ Dihydropyrimidin-Dehydrogenase-Präkursor (DPD) ; Dihydrouracil-Dehydrogenase; Dihydrothymin-
Dehydrogenase (DPYD) U09178 transkriptioneller Regulator atrX; "X-Linked"- Helicase II (XH2) ; "X-linked"-Kern-Protein (XNP) ;
RAD54L U09820
26S-Proteasom-Regulierungs-Untereinheit S2 (PSMD2) ; Tumor-Nekrose-Faktor-Typ-1-Rezeptor-assoziiertes Protein (TRAP2) ; 55.11 Protein U12596 Schädigungs-spezifisches DNA-bindendes Protein pl27 Untereinheit (DDBA pl27); DDB1 U18299
T-Komplex-Protein-1-delta-Untereinheit (TCPl-delta) ; CCT-delta (CCTD; CCT4); Stimulator von RNA- bindendendem tar (SRB) U38846 7, 8-Dihydro-8-Oxoguanin-Triphosphatase (8-Oxo- dGTPase) ; mutT-Homolog 1 (MTH1) D16581
150-kDa Sauerstoff-gesteuertes Protein ORP150 U65785 48-kDa FKBP-assoziiertes Protein (FAP48) U73704
T-Komplex-Protein-1-eta-Untereinheit (TCPl-eta) ; CCT-eta (CCTH; CCT7); HIV-1 NEF wechselwirkendes
Protein U83843
Catalase (CAT) X04076
Porphobilinogen-Deaminase (PBGD) ; Hydroxymethylbilan- Synthase (HMBS) ; pre-Uroporphyrinogen-Synthase X04808 Mn+ Superoxid-Dismutase-2-Präkursor (SOD2) X07834; X59445 94kDa-Glukose-gesteuertes Protein (GRP94); Endoplasmin-Präkursor; GP96-Homolog; Tumor-Rejektions-
Antigen 1 (TRA1) X15187; M33716 Uracil-DNA-Glycosylase 2 (UNG2) X52486
T-Komplex-Protein-1-alpha-Untereinheit (TCPl-alpha)
CCT-alpha (CCTA; CCT1) X52882
40S ribosomales Protein S3 (RPS3) X55715
47kDa-Hitzeschock-Protein-Präkursor; Collagen- bindendes Protein 1 (CBP1) ; Colligin 1 + Collagenbindendes Protein 2 (CBP2) X61598 + D83174
T-Komplex-Protein-1-gamma-Untereinheit (TCPl-gamma)
CCT-gamma (CCTG; CCT3) ; TRIC5 X74801; U17104
Transkriptionsfaktor IIH (TFIIH) ; 52-kDa-"basic"- Transkriptionsfaktor-2-Üntereinheit (BTF2p52) Y07595
"x-ray repair cross-complementing Protein 2" (XRCC2) Y08837
8-Oxyguanin-DNA-Glycosylase 1 (OGG1) ; mutM-Homolog
(MMH) Y11838
"3 -kDa Basic"-Transkriptionsfaktor-2-Untereinheit (BTF2p34) Z30093
N-Oxide-bildende Dimethylanilin-Monooxygenase 5; hepatische Flavin-enthaltende Monooxygenase 5
(FM05) ; Dirnethylanilin Oxidase 5 L37080
Ubiquitin-artiges Protein NEDD8 D23662 Mehrfachresistenz-Protein 3 (MDR3) ; P-Glycoprotein 3
(PGY3) M23234
Ubiqitin-konjugierendes Enzym E2-17-kDa (UBE2B) ;
Ubiquitin-Protein-Ligase; Ubiquitin-Träger-Protein;
HR6B M74525 p59-Protein; HSP-bindendes Immunophilin (HBI) ; wahrscheinliche Peptidyl-Prolyl-cis-trans-Isomerase
(PPIase) ; Rotamase; 52kDa-FK506-bindendes Protein
(FKBP52); FKBP59; HSP56; FKBP4 M88279
Hitzeschock-Protein-40-Homolog (HSP40 homolog) ; DNAJW U40992
51kDa-FK506-bindendes Protein (FKBP51) ; Peptidyl-
Prolyl-cis-trans-Isomerase (PPIase) ; Rotamase;
54kDa-Progesteron-Rezeptor-assoziiertes Immunophilin;
FKBP54; FFl-Antigen; HSP90-bindendes Immunophilin U42031 hämatopoietische Progenitor-Kinase (HPK1 ) U66464
SPSl/Ste20-Homolog KHS1 U77129 Leber-Glyceraldehyde-3-Phosphat-Dehydrogenase
(GAPDH; G3PDH) X01677 Gehirn-spezifische Tubulin-alpha-1-Untereinheit
(TUBA1 ) K00558 HLA Klasse I Histokompatibilitäts-Antigen-C-4-alpha-
Untereinheit ( HLAC) M11886
Cytoplasmisches beta-Aktin (ACTB) X00351 "23kDa highly basic"-Protein; 60S ribosomales
Protein L13A (RPL13A) X56932
40S ribosomales Protein S9 U14971
Ubiquitin M26880
Phospholipase A2 M86400 Hypoxanthin-Guanin-Phosphoribosyltransferase (HPRT ) V00530
Besonders bevorzugt wird der Methylierungszustand von im wesentlichen aller in Tab . 1 aufgeführten Gene untersucht .
Bevorzugt wird ein Satz von Genen auf Methylierung untersucht, in dem bis zu 25% der in Tab . 1 aufgeführten Gene nicht enthalten sind .
Bevorzugt ist ferner, dass mindestens 95% der in Tab . 1 aufgeführten Gene zusammen mit einer begrenzten Anzahl zusätzlicher nicht aufgeführter Gene auf ihren Methylierungszustand untersucht werden .
Bis zu 25% der in Tab . 1 aufgeführten Gene sind erfindungsgemäß durch einen kompletten Satz anderer nicht aufgeführter Gene ersetzt .
Bevorzugt stimmt die chemisch vorbehandelte DNA Sequenz der nachzuweisenden Gene mindestens zu 95% mit der entsprechend vorbehandelten DNA Sequenz der Gene aus Tab . 1 überein . Sequenzen, die in einem mindestens 25 Basenpaare langen Abschnitt des Exons zu 100% übereinstimmen, werden in dieser Erfindung als homolog bezeichnet. Dieses trifft auch auf Sequenzen zu, deren Homologie erst unter Berücksichtigung eventueller Frameshifts zu erkennen ist.
In den nachfolgenden Beispielen sind einige der zu untersuchenden Gene und ihre Bedeutung für toxikologische Pro- zesse aufgeführt.
Die genomischen Sequenzen der zu untersuchenden Gene können durch Vergleich der jeweiligen cDNA Sequenzen mit öffentlich zugänglichen Datenbanken, in denen genomische Sequenzen hinterlegt sind, abgeleitet werden.
Beispiel 1: Anzucht der HT-29 P208 Zellen, Zellernte und Präparation chromosomaler DNA
HT-29 P208 Zellen (5x104 Zellen/ml) wurden in Kulturschalen (33x5 cm) ausgesät und wuchsen für 5 Tage in DMEM/Ham's F-12 Medium, das mit 10% fötalem Rinderserum supplementiert wurde, bei 37 °C und 5% C02, bis zu einer 95%iger Konfluenz (Campbeil-Thompson, M. und Bhardwaj , B., Cancer Research 2001, 61, 632-640). Die Zellen wurden anschließend für 24 h in Medium ohne Rinderserum inkubiert. Nach erneutem Mediumswechsel wurden die Zellen, in jeweils 3 Parallelkulturen für 6h und 24h, entweder mit Medium, Medium supplementiert mit 10 ng/ml TGF-bl, Medium supplementiert mit lOng/ml IL-lb, Medium supplementiert mit Trichostatin (50 nM) und Medium supplementiert mit Milrinone (50 μM) inkubiert. Die mediumsfreien Zellen wurden mit Trypsin behandelt, zentrifugiert und in 200 μl PBS Puffer (Fritsch und Maniatis eds . , Molecular Cloning: A Laboratory Manual, 1989) resuspendiert und bei -20°C gelagert. Die chromosomale DNA wurde mit einem QIAamp Kit nach den Herstellerangaben (Qiagen, Hilden) aufgereinigt .
Beispiel 2: Herstellung von bisulphitbehandelter DNA und Durchführung der PCR-Reaktionen
Die DNA-Proben (20 ng) wurden mit dem Restriktionsenzym Mssl verdaut. Die verdaute DNA wurde mit Hydrogensulfit (Bisulfit, Disulfit) und einem Radikalfänger bei erhöhter Temperatur chemisch umgewandelt (DE 10050942) . Dabei werden alle nicht methylierten Cytosine nach alkalischer Hydrolyse in Uracil umgewandelt, welche in ihrem Basenpaarungsverhalten dem Thy idin entsprechen. 5- Methylcytosin wird dagegen unter diesen Bedingungen nicht modifiziert .
Die chemisch vorbehandelte DNA wurde dann unter Benutzung einer hitzebeständigen DNA Polymerase in einer Polymera- sekettenreaktion amplifiziert. Die Multiplex PCR Reaktionen wurden mit einem Thermocycler (Eppendorf GmbH) unter Verwendung von 10 ng bisulfitbehandelter DNA, jeweils 6 pmol Primeroligonukleotiden (Mischung von bis zu 32 einzelnen Primeroligonukleotiden, siehe Tabelle 3) , jeweils 800 μM dNTP und 4,5 mM Magnesiumchlorid durchgeführt. Das Cyclerprogramm war wie folgt: Schritt 1, 14 min bei 96 oC; Schritt 2, 60 sec 96 oC; Schritt 3, 45 sec 55 oC; Schritt 4, 75 sec 72 oC; Schritt 5, 10 min bei 72 oC; die Schritte 2 bis 4 wurden 39 mal wiederholt.
Die in Tabelle 3 aufgeführten DNA Fragmente von 64 verschiedenen Genen wurden mit 6 Sätzen Multiplex-PCR (mPCR) und bisulfitbehandelter DNA als Templat amplifiziert, wie oben beschrieben. Die mPCR Reaktionen (I, J, K, L, M, N) der genomischen, bisulphitbehandelten DNA wurde mit der Kombination von Primeroligonukleotiden durchgeführt, wie sie in Tabelle 3 aufgeführt ist. Es ist jedoch ebenfalls möglich, andere Primeroligonukleotide zur Amplifikation der genomischen, bisulphitbehandelten DNA in gleicher Weise zu verwenden. Besonders bevorzugt sind jedoch die in Tabelle 1 aufgelisteten Primerpaare.
Beispiel 3: Bestimmung des Methylierungsstatus ausgewählter Gene
Die in Beispiel 2 hergestellten Amplifikate wurden mit 512 Oligonukleotiden, die an eine Festphase gebunden wurden hybridisiert (Model, F. und Adorjan,P., Bioinforma- tics. 2001, 17 Suppl. 1, 157-164). Die mit Oligonukleoti- den beladene Festphase wird im folgenden Oligonukleotid- Array genannt. Die Detektierbarkeit des Hybridisie- rungsprodukts basiert auf Cy5 fluoreszenzmarkierten Primeroligonukleotiden, die für die Amplifikation verwendet wurden. Eine Hybridisierungsreaktion der amplifizierten DNA mit dem Oligonukleotid, zum Beispiel
GTTTTTTTCGTTTTAGAG (Sequenz ID 6) , findet nur dann statt, wenn ein methyliertes Cytosin an der besagten Stelle der bisulfitbehandelten DNA vorhanden ist. Somit kann der Methylierungsstatus des spezifischen Cytosins über das Hybridisierungsprodukt bestimmt werden. Um den Methylierungsstatus an der besagten Position zu verifizieren, befindet sich ein Oligonukleotid auf dem Oligonukleotid- Array, das es erlaubt das nicht methylierte Cytosin zu detektieren. Diese Oligonukleotid ist identisch zu dem Oligonukleotid, das vorher zur Analyse des methylierten Status der Probe verwendet wurde, mit Ausnahme dass das Oligonukleotid an der zu analysierenden Position eine Thyminbase an Stelle der Cytosinbase trägt, z.B. GTTTTTTTTGTTTTAGAG (Sequenz ID 7) . Somit findet eine Hybridisierungsreaktion nur dann statt, wenn ein nicht methyliertes Cytosin an der zu analysierenden Position vorhanden ist.
Die Detektion der Fluoreszenzsignale erfolgte durch Scan- nen der Oligonukleotid-Arrays mit dem Fluoreszensscanner Genpix 4000A (Axon Instruments, USA) . Die quantitative Bestimmung der Fluoreszenzsignale erfolgte mit der Analysesoftware Genepix 3.0 (Axon Instruments, USA).
Um die Metylierungsmuster einer bestimmten Behandlung der Zellen zuordnen zu können, wurden die DNA Metylierungsmuster von HT29-P208 Zellen gewachsen mit IL-lb (Inter- leukin) oder TGF-bl (Transforming Growth Factor) behandelten Zellen bestimmt. Die erhaltenen Ergebnisse wurden in Datenbanken gespeichert und die CpG Dinukleotide mit unterschiedlichem Methylierungsstatus wurden identifiziert. Die Methylierungsmuster wurden über Clusteranaly- sen und statistisches Verfahren vergleichen (Model, F. und Adorjan, P., Bioinformatics . 2001, 17 Suppl. 1, 157- 164) .
Beispiel 4: Veränderung des Methylierungsstatus in HT29- Zellen durch exogen Cytokine und niedermolekulare Wirkstoffe.
In diesem Beispiel wurden die PCR Produkte (siehe Tab 1) einer Anzucht Zellen (siehe Beipiel 1) , mit Cy5- fluoreszenzmarkierten Primern von bisulfitbehandelter DNA amplifiziert, gemischt, und auf Glassobjektträger hybri- disiert, die an jeder Postion ein Paar immobilisierter
Oligonukleotide trugen. Jedes dieser Detekionsoligonukle- otide wurde entworfen, um es gegen bei CpG Stellen befindliche Bisulfit konvertierte Sequenzen zu hybridisieren, die entweder im ursprünglichen Zustand unmethyliert (TG) oder methyliert (CG) vorlagen. Die Hybridisierungs- bedingungen wurden so ausgewählt, um die Detektion von Unterschieden bei Einzelnukleotiden der Varianten TG und CG aufzuzeigen. Die Verhältnisse der beiden Signale wurden basierend auf dem Vergleich der Intensitäten der flu- orezierenden Signale berechnet.
Die Information wird danach in einer gewichteten Matrix (s. Figur 1,2) bezüglich der CpG Methylierungsunterschie- de zwischen zwei Klassen, behandelte und nicht behandelte HT29-P208 Zellen bestimmt. Die p-Wert gewichtete Methy- lierung (p-Wert <0.05, F. Model, P. Adorjan, A. Olek, C. Piepenbrock, Feature selection for DNA methylation based cancer classification. Bioinformatics. 2001 Jun;17 Suppl l:S157-64) zeigt eine klare Unterscheidung zwischen den beiden Gruppen, was an der unterschiedlichen grauen Farb- Schattierung zu erkennen ist. Hierbei korreliert ein höherer Methylierungsgrad mit einem dunkleren Grauwert.
Die vergleichenden Untersuchungen des Methylierungsstatus der 64 Genfragmente (siehe Tabelle 1) von HT29-P208 Zel- len zeigten, dass sowohl IL-lb als auch TGF-bl zu einer Veränderung des Methylierungsstatus bestimmter Gene führt. Im Gegensatz zu den Kontrollen (HT29-P208 in Medium) konnte durch die Supplementierung des Mediums mit TGF-bl eine geringere Methylierung, durch die Supplemen- tierung des Mediums mit IL-lb eine höhere Methylierung verschiedener CpG-Positionen gefunden werden. Die Veränderungen im Methylierungsstatus waren nach einer Behandlungszeit von 24 h sichtbar (siehe Fig 1 und 2) . Nach 6h Behandlungszeit konnten keine signifikanten Methylierung- sunterschiede detektiert werden (Daten nicht gezeigt) .
Mit Ausnahme von CpG-Positionen des TGF-a Gens verändern TGF-bl und IL-lb den Methylierungsstatus unterschiedlicher Gene .
In Figur 3 ist der Methylierungsstatus ausgewählter CpGs für die Gene TGF-a, EGFR, ANT1 und E-Cadherin quantitativ dargestellt. Die Amplifikation dieser Genen erfolgte unter den in Beispiel 2 beschrieben Bedingungen. In Tabelle 2 sind die verwendeten Primersequenzen, ihre Seq ID, die Länge des PCR-Fragments, sowie die zur Methylierungsana- lyse verwendeten Oligonukleotide mit ihrer Seq ID zusammenfassend dargestellt. Die Bestimmung des Methylierungsstatus erfolgte durch die Berechung des Quotienten des Fluoreszenzsignals des CG-Oligos über der Summe der Fluoreszensignale des TG- und CG-Oligos. Somit kann der Methylierungsstatus zwischen 0 und 1 varieren, wobei 0 den minimalen und 1 den maximalen Methylierungstatus anzeigt. Für die hier untersuchten CpG-Positionen wurde in HT29-P208 Zellen, durch die Behandlung mit TGF-bl, eine signifikante Reduktion des Methylierungstatus ermittelt (siehe Fig 3) . Die Behandlung mit IL-lb führte hingegen zu keiner bzw. zu einer Erhöhung des Methylierungsstatus (siehe Fig. 3, AI u. 2, Bl u. 2, Dl) . In einem weiteren Experiment wurde der Einfluss von Milrinon und Trichosta- tin auf den Methylierungsstatus ausgewählter CpG- Positionen der Gene EGFR, ANTl und CDC25A untersucht. Die Behandlung der HT29-P208 Zellen mit Milrinon führte zu einer Verringerung, mit Trichostatin zu einer Erhöhung des Methylierungsstatus (siehe Fig. 4) .
Beispiel 5: Methylierungsanalyse des Cyplal Gens
Besonders bevorzugt in der Analyse von veränderten Methy- lierungsmustern, die wiederum Genexpressionsveränderungen widerspiegeln, sind Gene, die Enzyme kodieren, die die Biotransformation von toxikologischen Substanzen katalysieren. Eine zentrale Funktion kommen hierbei unter anderen den Genen der Cytochrom P450 Familie zu. In Tierversuchen konnte unter anderem gezeigt werden, dass eines der Gene aus dieser Klasse, Cyplal, nach Exposition von Mäusen mit beta-Naphtoflavon induziert wurde (Arch Bio- chem Biophys 2000 Apr 1; 376 (1) : 66-73) . Zur Methylierung- sanalyse muß zunächst die genomische DNA Sequenz, die das Cyplal Gen kodiert identifiziert werden. Dazu kann z.B. die cDNA Sequenz (Genbank Acc. NM_000499) mit einer genomischen Datenbank (z.B. Genbank htgs) verglichen werden, wobei in der Regel der BLAST Vergleichsalgorithmus, der über das Internet verfügbar ist (www.ncbi.nlm.nih.gov), verwendet wird. Im vorliegenden Fall kann so der Abschnitt der genomischen DNA, der Cyplal kodiert identifiziert werden (Genbank Acc.AC020705) . Bevorzugt werden ge- nomische Abschnitte im Bereich des Promoters sowie des ersten Exons bzw. Introns auf Methylierungsunterschiede untersucht, da relevante CpG Dinukleotide, deren Methylierung die Genexpression beeinflusst, bevorzugt in diesen Abschnitten zu finden sind. Im Beispiel des Cyplal Gens wurde Exon 1 (unterstrichen) im folgenden genomischen Sequenz abschnitt lokalisiert:
>genomische Region, die Exon 1 des Cyplal Gens enthält (Exonl hervorgehoben) catgccaaatggcactggggcttcgtgtcgtgccacagcgtggaccgaaaatgcgga cacatgcaggctgcctctcctcgcaggcagaagccacacgcagacctagacccttt gcaccgcatccccttattcaatcgcgcacccgccacccttcgacagttcctctccct ccaccccaaccccacgccgcgcgcgaggctggccctttaagagccccgccccgactc cctcccccctcgcgtgactgcgagcccccgcgccgggccggggaatgggtcggctgg gtggctgcgcgggcctccggtccttctcacgcaacgcctgggcaccgcgcctccggg ccaggtggggcggggacgggccgcctgacctctgccccctagagggatgtcgccggc gcacgcaagctagccgggggtagggtgggggctccgcgccaggtgccccctccgtgg tccctgggcccgagtctttccgtggccccccgccgccggatttctgtgctctgccaa tcaaagcactagccaccccgggagccaagagggaccctcaagggccggtgggtcctg gctggagggaccgcgcgttgcaatcagcactaaggcgatcctagaggctgcgaggag ccgctagtgagcgctcagcgagcctgccccttcgccatccattccgatccttcaatc aagaggcgcgaacctcagctagtcgcccgggctctgggggacaggtccagccccgcg gcgcctctggccttccggcccccgtgacctcagggctggggtcgcagcgcttctca cgcgagccgggactcagtaaccccgggaaggaggtcaccacggggcagccccgccc ccgcctgccgagtcctggtaggctgtagcgctggggaggcatctgcacgcccagcg ttccagtgggtgcaaaaatgacgaagaggagtccccgcgccccaggatggagcttcc cgtaccctctcttcgggctgtcctgggacttctccctcaagccccctcctcggctgg gttctgcactgcccttgggacgccttggaattgggacttccaggtgttcccagccc tcacccctctatgtacaggcaccgagatgtgtcccatagtgggttcttgcccaccc gaccccccacccccgccgccctccgccacctttctctccaatcccagagagaccag cccggttcaggctgcttctccctccatctcagctcgctccagggaaggaggcgtgg ccacacgtacaagcccgcctataaaggtgcagtacttcaccctcaccctgaaggtg acagttcttggatgttccctgatccttgtgatcccaggctccaagagtccaccct tcccagctcagctcagtacctcaggtgagttgctgggggacttctggcttgcccttt ctctcccaataaaaggaacattttggtgcctccaggacttcttaggtagctacctg tctagcacctccaaaaagggaggctcagagtgtttttagtgaccaggcagtctagcc ccctagtggggaaactgaggccaggggaagaggaggacttgcccatggtcccaca gctggtaccagacctctagatacagatggcatctcattcaggacttcaggaccca ggctccagctccatcccctagtgagtgtctccctgcctaccctggggcttccccat caaggccacctggcaggctggaatatgtgcagcccctccctcaggctttctgatgac aggggcttctccttgggtggacagggtggatggagggggtgggctgggttcttacca gctgtaccctgccctagcctaagaagctacccctggcagattttaccctcctaagg gtggcttgtcagtgctgagatgtcctagacagctgggacaatagaggcagatct gtgcaggagtcccaggcctttcctatctcattgaccatcttctttgtcctttg ctgggagacaatcagggtgacagattgccaactgcagggagctggaaatacca gtccctaaaaactcaccagtcacatctcccttggcctcctaccatcttacaaa ggctgcaggtccttgggatacccactgtgcagaaggggacaccatagcacacc aaagcctggcactgtcccctgttgactcagggatctagtgtgctttgatattt agcccctccaggaagcctccctccactataatacttgtggtaggaaccatccat ctccctgtcttgtgaggttctcctgtggggagcctaactggtaagactgtcagg ttccccacagcagatctgggttttctcttccctctggatccagctgggtactct gaactgagagatcttgtcttaccctctctcagatgttgaaattggaccccagaa aagtaaaatgtgcagtccaagatcactttgactagaatgttggtctactgacct ctagtccagggtaacaggcagagatgcctgatatgttggagagagtggtttatga atttaaacaccctttttaggtcaagcttacagagaaagtattgcctcagtttcct ttcagtttagatccattcctgatttccctgattccagtctggggttttcttacag cctagtgggaaccttccatttattctctgctctctggtaacctgcaaaagggggag gtccaaactgttcattcattgagaa
Sequenzabschnitt nach Bisulfitbehandlung und PCR Amplifi- zierung (die verwendeten Primeroligonukleotide und das analysierte CpG sind hervorgehoben) >cyplal sense-1 bisufit tatgttaaatggtattggggtttCGtgtCGtgttatagCGtggatCGaaaatgCG gatatatgtaggttgttttttttCGtaggtagaagttataCGtagatttagattt tttgtatCGtatttttttatttaatCGCGtattCGttatttttCGatagtttttt tttttttattttaattttaCGtCGCGCGCGaggttggttttttaagagtttCGtt tCGatttttttttttttCGCGtgattgCGagttttCGCGtCGggtCGgggaatgg gtCGgttgggtggttgCGCGggttttCGgttttttttaCGtaaCGtttgggtatCG CGttttCGggttaggtggggCGgggaCGggtCGtttgatttttgttttTtagaGgg atgtCGtCGgCGtaCGtaagttagtCGggggtagggtgggggtttCGCGttaggtg tttttttCGtggtttttgggttCGagttttttCGtggtttttCGtCGtCGgatttt tgtgttttgttaattaaagtattagttatttCGggagttaagagggatttttaaggg tCGgtgggttttggttggagggatCGCGCGttgtaattagtattaaggCGatttta gaggttgCGaggagtCGttagtgagCGtttagCGagtttgttttttCGttatttatt tCGattttttaattaagaggCGCGaattttagttagtCGttCGggttttgggggata ggtttagtttCGCGgCGtttttggtttttCGgttttCGtgattttagggttggggtC GtagCGttttttaCGCGaqtCGggatttagtaatttCGggaagqaggttattACGGG gtagtttCGttttCGtttgtCGagttttggtaggttgtagCGttggggaggtattt gtaCGtttagCGttttagtgggtgtaaaaatgaCGaagaggagttttCGCGtttta ggatggagtttttCGtatttttttttCGggttgttttgggattttttttttaagtt tttttttCGgttgggttttgtattgtttttgggaCGttttggaattgggatttttag gtgtttttagtttttatttttttatgtataggtatCGagatgtgttttatagtggg tttttgtttattCGattttttattttCGtCGtttttCGttatttttttttttaatt ttagagagattagttCGgtttaggttgtttttttttttattttagttCGttttaggg aaggaggCGtggttataCGtataagttCGtttataaaggtgtagtattttattttt attttgaaggtgatagtttttggatg
Um einen Teil des dargestellten genomischen Abschnitts nach der Bisulfitbehandlung zu amplifizieren können bei- spielsweise die beiden Primer mit der Sequenz
TATGTTAAATGGTATTGG und CATCCAAAAACTAT verwendet werden, mit denen sich definierte Fragmente der Länge 1316 Basenpaare amplifizieren lassen. Diese Amplifikate dienen als Sonde, die an vorher an einer Festphase gebundene Oligo- nukleotide, beispielsweise CTACCCCGTAATA, hybridisiert werden, wobei sich das nachzuweisende Cytosin an Position 837 des Amplifikats befindet. Der Nachweis des Hybridi- sierungs-produkts beruht auf Cy3 oder Cy5 fluoreszenzmarkierten Primeroligonukleotiden, die für die Amplifikation verwendet wurden. Nur wenn in der Bisulfit behandelten DNA an dieser Stelle ein methyliertes Cytosin vorgelegen hat, kommt es zu einer Hybridisierungsreaktion der ampli- fizierten DNA mit dem Oligonukleotid. Somit entscheidet der Methylierungsstatus des jeweiligen zu untersuchenden Cytosins über das Hybridisierungsprodukt .
Beispiel 6: Einordnung einer chemischen Substanz in eine Toxizitätsklasse durch Bestimmung des Methylierungs- musters
Um anhand des Methylierungsmusters eine Einordnung einer chemischen Substanz in eine bestimmte Klasse durchzuführen, bedarf es zunächst der Untersuchung der DNA- Methylierungsmuster einer Gruppe von exponierten und einer Gruppe von nicht-exponierten Lebewesen, etwa Ver- suchstieren. Die Ergebnisse werden in einer Datenbank abgespeichert und die CpG Dinukleotide identifiziert, die zwischen den beiden Gruppen unterschiedlich methyliert sind. Anschließend wird das Methylierungsmuster der zu beurteilenden Substanz mit bereits bekannten Methylie- rungsmustern anderer chemischer Substanzen verglichen. Aus den toxikologischen Eigenschaften derjenigen chemischen Substanzen mit ähnlichem Methylierungsmuster können Hinweise auf die Eigenschaften der zu untersuchenden Substanz gewonnen werden.
Gegenstand der vorliegenden Erfindung ist zudem ein Kit, bestehend aus einem Bisulfit enthaltenden Reagenz, einen Satz von Primeroligonukleotiden umfassend mindestens zwei Oligonukleotide, deren Sequenzen jeweils mindestens einen 18 Basenpaaren langen Abschnitt der Basensequenzen der zu untersuchenden Gene entsprechen oder zu ihnen komplemen- tär sind, zur Herstellung der Amplifikate, Oligonukleoti- de und/oder PNA-Oligomere, eine Kontrollnukleinsäure sowie einer Anleitung zur Durchführung und Auswertung des beschriebenen Verfahrens.
Legenden zu den Figuren:
Figurl
Gewichtete Matrix des Methylierungsstatus (Fluoreszenz- signal CG-Oligo x (Fluoreszenzsignal CG-Oligo + Fluoreszenzsignal TG-Oligo)-1) von 40 CpGs in unbehandelten HT29-P208 Zellen (A) und TGF-bl behandelten HT29-P208 Zellen (B) . Die Zahlen 1-3 kennzeichnen 3 unabhängige Experimente (Zellbehandlungen und Methylierungsanalyse) . Jeder waagerechte Balken repräsentiert ein CpG, dessen
Methylierungsstatus, mit einer Signifikanz von p<0,05, in den beiden Analysegruppen unterschiedlich ist. Ein höherer Methylierunggrad enspricht dem dunkleren Grauton, ein geringerer Methylierunggrad enspricht dem helleren Grau- ton.
Figur2
Gewichtete Matrix des Methylierungsstatus (Fluoreszenzsignal CG-Oligo x (Fluoreszenzsignal CG-Oligo + Fluores- zenzsignal TG-Oligo)-1) von 40 CpGs in unbehandelten
HT29-P208 Zellen (A) und IL-lb behandelten HT29-P208 Zellen (B) . Die Zahlen 1-3 kennzeichnen 3 unabhängige Experimente (Zellbehandlungen und Methylierungsanalyse) . Jeder waagerechte Balken repräsentiert ein CpG, dessen Me- thylierungstatus, mit einer Signfikanz von p<0,05, in den beiden Analysegruppen unterschiedlich ist. Ein höhere Methylierunggrad enspricht dem dunkleren Grauton, ein geringer Methylierunggrad enspricht dem hellerem Grauton.
Figur3 Quantitative Analyse des Methylierungsstatus (Fluoreszenzsignal CG-Oligo x (Fluoreszenzsignal CG-Oligo + Fluoreszenzsignal TG-Oligo)-1) von 8 CpGs in unbehandelten HT29-P208 Zellen (schwarze Säulen), TGF-bl (graue Säulen) und IL-lb (weiße Säulen) behandelten HT29-P208 Zellen. CpGs, die durch die angegebenen Oligo-SEQ IDs repräsentiert werden, wurden aus folgenden Genen untersucht: TGF- a (AI, oligo SEQ IDs 6, 7; A2, oligo SEQ IDs 8, 9), EGFR (Bl, oligo SEQ IDs 20, 21; B2, oligo SEQ IDs 22, 23), ANTl (Cl, oligo SEQ IDs 32, 33; C2, oligo SEQ IDs 34, 35) und E-Cadherin (Dl, oligo SEQ IDs 13, 14; D2, oligo SEQ IDs 15, 16) . Die Zahlenwerte der y-Achse zeigen den Methylierungsstatus, berechnet als Quotienten des Fluoreszenzsignals des CG-Oligos über der Summe der Fluoreszenz- Signale des TG- und CG-Oligos.
Figur4
Quantitative Analyse des Methylierungsstatus (Fluoreszenzsignal CG-Oligo x (Fluoreszenzsignal CG-Oligo + Fluo- reszenzsignal TG-Oligo)-1) von 4 CpGs in unbehandelten HT29-P208 Zellen (schwarze Säulen) , Trichostatin (graue Säulen) und Milrinon (weiße Säulen) behandelten HT29-P208 Zellen. CpGs, die durch die angegebenen Oligo-SEQ IDs repräsentiert werden, wurden aus folgenden Genen unter- sucht: EGFR (AI, oligo SEQ IDs 22, 23), ANTl (Bl, oligo
SEQ IDs 32, 33; B2, oligo SEQ IDs 34, 35) und CDC25A (Cl, oligo SEQ IDs 27, 28) . Die Zahlenwerte der y-Achse zeigen den Methylierungsstatus, berechnet als Quotienten des Fluoreszenzsignals des CG-Oligos über der Summe der Fluo- reszenzsignale des TG- und CG-Oligos.

Claims

Patentansprüche
1. Verfahren zur toxikologischen Diagnostik dadurch ge- kennzeichnet, dass folgende Verfahrensschritte ausgeführt werden: a) einem Lebewesen oder einer Zellkultur, die zuvor einer bestimmten auf ihre toxikologische Wirkung zu untersuchende Substanz ausgesetzt wurden, wird eine Probe entnommen, die DNA besagten Lebewesens oder der Zellkultur enthält; b) die in der Probe enthaltene DNA wird derart behandelt, dass methylierte Cytosinbasen zu einer anderen Basenabfolge an einer gegebenen Position in der be- sagten behandelten DNA führen als unmethylierte Cytosinbasen an einer gegebenen Position in besagter behandelter DNA; c) die Basenabfolge eines Teils der modifizierten DNA wird bestimmt und daraus auf einen für die Probe cha- rakteristischen Methylierungszustand oder ein charakteristisches Methylierungsmuster geschlossen; d) durch Abgleich mit Daten aus Methylierungszustanden anderer Proben wird auf die Einwirkung einer Substanz auf das Lebewesen oder die Zellkultur geschlossen und/oder die Einwirkung dieser Substanz auf das Lebewesen oder die Zellkultur im Vergleich zu anderen Substanzen in toxikologischer Hinsicht verglichen.
2. Ein Verfahren zur toxikologischen Diagnostik nach An- spruch 1, dadurch gekennzeichnet, dass der Methylierungszustand oder das Methylierungsmuster eines Satzes von Genen untersucht wird, der mindestens eines der im Folgenden aufgeführten Gene oder aber Sequenzen, die im Bereich der Exons identisch oder zu min- destens 85% homolog zu den im Folgenden aufgeführten Genen sind, umfasst: Gene Name GenBank Accession # (s)
Serotransferrin-Präkursor; Siderophilin; Beta-1-metallbindendes Globulin M12530 Lactotransferrin-Präkursor; Lactoferrin X53961 Apolipoprotein E Präkursor (APOE) M12529 Lipopolysaccharide-bindender Protein- Präkursor (LBP) M35533
B-Lymphozyt Kinase; Tyrosine-Protein- Kinase BLK; p55-BLK Z33998
Apolipoprotein A-I Präkursor (APOAI) X00566 Apolipoprotein A-II Präkursor {APOAII) X00955 Apolipoprotein C-III Präkursor (APOCIII) X01388 Endothelin 1 (ET1) Y00749 Makrophagenkolonie-stimulierender Faktor 1 (CSF1; MCSF) M37435 familial intrahepatisches Cholestasis 1 Protein (FIC1) AF038007
Vaskulärer Endothelwachstumsfaktor D (VEGFD) ; C-FOS-induzierter Wachstumsfaktor (FIGF) D89630
Komplement-Komponente-4-bindendes Protein alpha (C4B-bindendes Protein; C4BPA) ; Prolin-reiches Protein (PRP) M31452
Insulin-ähnlicher Wachstumsfaktor II (IGF2) ; Somatomedin A M29645
Granulozytenmakrophagenkolonie-stimulierender Faktor (GM-CSF); CSF2 M11220 epidermaler Wachstumsfaktor-Präkursor (EGF) ; Beta-Urogastron X04571
Hepatozytenwachstumsfaktor-Aktivator (HGF-Aktivator) D14012
Makrophage-"Inflammatory-Protein"-l-beta- Präkursor (MlPl-beta) ; T-Zellen-Aktivierungs- Protein 2 (AT2); PAT 744; H400; SIS-Gamma; Lymphozyt-Aktivierungs-Gen-1-Protein (LAG 1) ; HC21; kleines induzierbares Cytokin A4 (SCYA4); G 26 T-Lymphozyt sekretorisches Protein J04130 Gliawachstumsfaktor-2-Präkursor (GGFHPP2) ; Neuregulin; Heregulin-Beta3 + "neuer Differenzierungsfaktor" + Heregulin-alpha L12260; L12261 + U02326 + M94165 T-Zellen-spezifischer Rantes-Protein-Präkursor; sis delta; kleines induzierbares Zytokin A5 (SCYA5); "Rantes pro-Inflammatory"-Zytokin M21121 Makrophagen-"Inflammatory"-Protein-l-alpha- Präkursor (MlPl-alpha) ; Tonsillen-Lymphozyt- LD78-Alpha-Protein; G0S19-l-Protein; PAT 464.2; SIS-beta; kleines induzierbares Zytokin A3 (SCYA3) M23452 Onkostatin M (OSM) M27288
Insulin-ähnlichen-Wachstumsfaktor-bindendes Protein 1 (IGFBP1) ; Plazenta-Protein 12 (PP12) M31145 Vaskulärer Endothelial-Wachstumsfaktor Präkursor (VEGF) ; Vaskulärer Permeabilitäts-Faktor (VPF) M32977; M27281 Hepatozyten-Wachstumsfaktor (HGF) ; Streufaktor (SF); Hepatopoeitin A M60718
Thymosin Beta-10 (TMSB10; THYB10) ; PTMB10 M92381 Interferon Gamma-induzierter Protein-Präkursor
(gamma-IPlO) X02530 Makrophagen "Inflammatory"-Protein 2 alpha (MIP2-alpha) ; wachstumsreguliertes Protein Beta (GRO-beta) X53799
OX40 Ligand (OX40L) ; GP34; tax-transkriptionell aktiviertes Glycoprotein 1 (TXGP1) X79929 transformierender Wachstumsfaftor Beta 3 (TGF-beta3) J03241
Delta-artiger Protein Präkursor (DLK) U15979; Z12172 Insulin-artiger Wachstumsfaktor-IA Präkursor (IGF1A); IGFBP1; Somatomedin C + Insulinartiger Wachstumsfaktor I (IGF1) M27544 + M3748 CC Chemokin-Eotaxin-Präkursor; eosinophil chemotaktisches Protein; kleines induzierbares Zytokin All (SCYA11) D49372; Z75669;
Z75668
"Sonic Hedgehog" (SHH) L38518
Interleukin-1-Rezeptor-Antagonist Protein- Präkursor (IL-1RA; IRAP) M63099 Makrophage-Inhibitor Zytokin 1 (MIC1) AF019770
Erythropoietin M11319
Eosinophil "Granule-Major-Basic" Protein- Präkursor (MBP) ; Schwangerschafts-assoziiertes "Major-Basic-Protein; Knochenmarks-Proteo- glykan 2 Y00809
Insulin-artigen Wachstumsfaktor-bindender Protein-3-Präkursor (IGF-bindendes Protein 3; IGFBP3; IBP3) M31159; M35878 zelluläres Retinsäure-bindendes Protein II
(CRABP2) M68867
Corticoliberin-Präkursor; Corticotropin- Freisetzungsfaktor (CRF) ; Corticotropin- Freisetzungshormon (CRH) V00571
Interferon-Gamma-Präkursor (IFN-gamma; IFNG) ; Immuninterferon X01992; M29383
Interleukin-2-Präkursor (IL-2); T-Zellen- Wachstumsfaktor (TCGF) A14844
Interleukin-1-alpha-Präkursor (IL-1 alpha; ILlA) ; Hematopoietin-1 X02851
Interleukin-4-Präkursor (IL-4) ; B-Zellen- Stimulierungsfaktor 1 (BSF-1) ; Lymphozyt-Stimulierungsfaktor 1 M13982 Interleukin-6-Präkursor (IL-6) ; B-Zellen- Stimulierungsfaktor 2 (BSF2); Interferon-Beta-2
(IFNB2) ; Hybridom-Wachstumsfaktor X04602; M14584 Interleukin-5-Präkursor (IL-5) ; T-Zellen- Substitutions-Faktor (TRF) ; eosinophiler Differenzierungs-Faktor; B-Zellen- Differenzierungsfaktor I X04688; J03478 Interleukin-12-Beta-Untereinheit-Präkursor
(IL-12B) ; zytotoxischer Lymphozyt-Maturations- Faktor 40-kDa-Untereinheit (CLMF p40) ; NK-Zellen-stimulierende Faktor-Untereinheit 2
(NKSF2) M65290
Interleukin-12 alpha Untereinheit Präkursor
(IL-12A) ; zytotoxsche Ly phozyt-Maturations- Faktor 35-kDa Untereinheit (CLMF p35) ; NK-Zellen-stimulierende Faktor-Untereinheit 1 (NKSFl) M65291
Pankreatitis-assoziierter Protein-1-Präkursor D13510 Alpha-1-Säure-Glycoprotein-l-Präkursor (AGP1) ; Orosomucoid 1 (OMD1) X02544 C-reaktiver Protein-Präkursor X56692 Corticosteroid-bindendes Globulin J02943 Prostaglandin-Endoperoxide-Synthase-1-Präkursor; Prostaglandin-G/H-Synthasel (PGH-Synthase-1; PTGS1; PHS1); Cyclooxygenase-1 (COX1) M59979 Amphiphysin (AMPH) U07616
5-Hydroxytryptamin-lD-Rezeptor (5-HT-lD; HTRID); Serotonin-Rezeptor M89955 Neuromedin-B-Präkursor M21551
Haupt-Prion-Protein-Präkursor (PRP) ; PRP27-30; PRP33-35C; ASCR M13667
Dopamin-Beta-Hydroxylase (DBH) ; Dopamin-Beta- Monooxygenase-Präkursor X13255
AIzheimer-Krankheit-Amyloid-A4-Protein-Präkursor; ProteaseNexin-II (PN-II) ; APPI Y00264 membrangebundene & lösliche Catechol-O- Methyltransferase (COMT) M65212
Flavin-enthaltende Amin-Oxidase-A; Monoamin- Oxidase (MAO-A) M68840
Erythropoietin-Rezeptor (EPOR) M60459 kationunabhängiger Mannose-6-Phosphat-Rezeptor- Präkursor (Cl Man-6-P Rezeptor; CI-MPR) ; Insulinartiger Wachstumsfaktor-II-Rezeptor (IGFR II) Y00285; J0352S
Aktivin-Rezeptor-Typ-II-Präkursor (ACTRIIA; ACVR2 ) D31770
Retinoid-X-Rezeptor-GAMMA (RXR-GAMMA) U38480 transkriptioneller Enhancer-Faktor (TEF1) ; Protein GT-IIC; Transkriptionsfaktor 13 (TCF13) M63896 Glucocorticoid-Rezeptor (GRL) M10901 Orphan-Zellkern-Hormon-Rezeptor BD73 L31785 "Low-Density"-Lipoprotein-Rezeptor (LDL Rezeptor; LDLR) M28219
Sulfonylharnstoff-Rezeptor 2A (SUR2A) AF061323 Sulfonylharnstoff-Rezeptor (SUR) ; ATP-bindendes Kassetten-Unterfamilie C (CFTR/MRP) Mitglied 8 (ABCC8) L78207 Farnesol-Rezeptor HRR-1 U68233 Tyrosin-Protein-Kinase-Rezeptor UFO X66029 Colorectal-Krebs-Suppressor-Protein Präkursor (DCC) X76132
Vaskulär-Zellen-Adhäsions-Protein 1 X53051 Alphal-Catenin (CTNNAl) ; Cadherin-assoziiertes Protein; alpha E-Catenin D13866; D14705; L23805; L22080
Integrin-alpha-9 (ITGA9) ; Integrin-alpha-RLC D25303; L24158 interzullärer Adhäsions-Molekül-1-Präkursor
(ICAM1) ; Hauptgruppen-Rhinovirus-Rezeptor; CD54-Antigen J03132
Ras-verwandtes Protein RAB5A M28215 E-Selektin-Präkursor (SELE) ; Endothelial- Leukozyten-Adhäsions- Molekül 1 (ELAMl); Leukozyt-Endothelial-Zelladhäsion-Molekül 2
(LECAM2); CD62E Antigen M30640
NADH-Ubichinon-Dehydrogenase-1-beta-Subkomplex- 7 18kDa-Untereinheit (NDUFB7); Komplex-I-B18
(CI-B18); Zelladhäsions-Protein SQM1 M33374 Neural-Cadherin-Präkursor (N-Cadherin; NCAD) ; Cadherin 2 (CDH2) M34064; X57548; X54315; S42303
Zelloberflächen-Adhäsionsglycoprotein LFA-1/
CR3/pl50, 95 beta-Untereinheit-Präkursor;
LYAM1; Integrin-beta-2 (ITGB2) ; CD18-Antigen;
Komplement-Rezeptor-C3-beta-Untereinheit M15395
Fibronektin-Rezeptor alpha-Untereinheit (FNRA) ;
Integrin-alpha 5 (ITGA5) ; VLA5; CD49E Antigen X06256
Fibronektin-Rezeptor beta-Untereinheit (FNRB) ;
Integrin-beta-1 (ITGB1) ; "Very-Late"
Antigen-4-beta-Untereinheit (VLA4); CD29
Antigen X07979
Integrin-alpha-L (ITGAL) ; Leukozytahhäsions-
Glycoprotein-alpha-Untereinheit-Präkursor;
Leukozyt-funktionsassoziierte Molekül-1-alpha-
Kette (LFA1); CDllA Antigen Y00796 Cadherin- 6-Präkursor (CDH6) ; Nieren-Cadherin
(K-Cadherin) D31784
Cadherin-11-Präkursor (CDH11) ; Osteoblast-
Cadherin (OB-Cadherin) ; OSF4 L34056
Cadherin 12 (CDH12) ; Gehirn-Cadherin Präkursor
(Br-Cadherin) ; neurales Cadherin 2
(N-Cadherin 2) L34057; L33477
Cadherin 13 (CDH13) ; abgestumpfter Cadherin-
Präkursor (T-Cadherin) ; Herz-Cadherin
(H-Cadherin) L34058; U59289; U59288
Cadherin 3 (CDH3) ; Plazenta-Cadherin-Präkursor
(P-Cadherin; CDHP) X63629 "Gap-Junction"-alpha-5-PROTEIN (Connexin 40)
(CX40) L34954
Involucrin M13903
Fibrinogen-G-gamma-Polypeptid X51473; X02415 K02569
Plasma-Zellen-Membranglycoprotein PC-1; alkalische Phosphodiesterase I; Nukleotid- Pyrophosphatase (NPPase) M57736 Annexin V; Lipocortin V; Endonexin II; Calphobindin I (CBP-I) ; Plazenta-Antikoagulanz- protein I (PAP-I) ; PP4; Thromboplastin- Inhibitor; vaskulär Antikoagulanz-alpha
(VAC-alpha; anchorin CII X12454
Aminin-alpha-1-Untereinheit-Präkursor (LAMA1) ; Laminin-A-Kette X58531 intestinales Fettsäure-bindendes Protein 2
(FABP2; IFABP)+
Leber-Fettsäure-bindendes Protein 1 (FABP1; LFABP) M10050 + M10617
Natrium-unabhängiger Transporter für organisches Anion; organisches Anion transportierendes Polypeptid (OATP) ; SLC21A3 U21943 polyspezifischer Transporter für Nl (OCTN1) AB007448 TNF-alpha-stimuliertes ABC-Protein (TSAP) AF027302 Transporter-artiges Protein 2 für organisches Kation (ORCTL2) AF037064 Transporter für organisches Kation N2 (OCTN2) AF057164 MRP/Transporter für organisches Kation (MOAT-B) AF071202 Adrenoleukodystrophie-verwandtes Protein (ALDR) AJ000327 Skelettmuskel-Adenin-Nukleotid-Translokator 1
(ANTl); Herz/Skelettmuskel ADP/ATP Träger- Protein Isoform Tl; ADP/ATP-Translokase 1 J02966 "down-reguliertes" Protein in Adenoma (DRA) L02785 mitochondriales Entkopplungs-Protein-3 (UCP3) AF011449 mitochondrialer Carnitin-Palmitoyltransferase- II-Präkursor (CPTase; CPT2) M58581 mitochondriales "braunes Fettgewebe"-Ent- kopplungs-Protein 1 (UCP1) U28480 Prostaglandin-Transporter (PGT) ; gelöstes Träger-Familie-21-Mitglied 2 (SLC21A2) U70867 mitochondriales Entkopplungs-Protein 2 (UCP2) ; UCPH U82819
Gallensalz-Export-Pumpe (BSEP) AF091582 Anthracyclineresistenz-assoziiertes Protein
(ÄRA) X95715
Nieren-Transporter für organisches Kation X98333 Mehrfachresistenz-assoziiertes Protein 3
(MRP3) ; MLP2; ABCC3 Y17151
Antigen-Peptid-Transporter 2 (APT2) ; Peptid- Zufuhr-Faktor 2 (PSF2) ; in Antigen-Processing-2 involvierter Peptid-Transporter (TAP2) ; ATP- bindendes Kassetten-Unterfamilie-B- (MBR/TAP) - Mitglied 3 (ABCC3) ; HLA-Klasse-II-Histokompa- tibilitäts-Antigen DO-beta-Ketten-Präkursor X66401; L09191; L10287 putativer renaler Transporter-1 für organisches Anion (hROATl) AF057039
Chlorid-Leitfähigkeits-Regulierungs-Protein ICLN; Nukleotid-sensitiver Chlorid-Kanal 1A; Chloride-Ion-Strom-Induktor-Protein (CLCI) ; Retikulozyt PICLN X91788
Transporter A für neutrale Aminosäure (SATT); Alanin/Serin/Cystein/Threonin-Transporter (ASCT1) L14595 Monocarboxylat-Transporter-1 (MCT1) L31801 Ileal Natrium-abhängiger Gallensalz-Transporter (ISBT) ; Ileal Natrium/Taurocholat-cotrans- portierendes Polypeptid (NTCP2) ; SLC10A2 U10417 Natrium-abhängiger Gallensalz-Cotransporter; hepatisches Natrium/Taurocholat-cotrans- portierendes Polypeptid (NTCP) ; SLC10A1 L21893
Natrium- & Chlorid-abhängiger Glycin-
Transporter-1 (GLYT-1) S70609
Mukoviszidose-Transmembran-Leitfähigkeits- Regulator (CFTR) ; cAMP-abhängiger Chlorid-
Kanal M28668 kanalförmiger multispezificher Transporter für organisches Anion; Mehrfachresistenz-assoziiertes Protein 2 (MRP2) ; kanalförmiges Mehrfach- resistenz-assoziiertes Protein U63970
Transporter für organisches Kation 1 U77086
"Gap Junction"-beta-l Protein (Connexin 32) (CX32) (Leber-"Gap Junction"-Protein) X04325
Cadherin 1 (CDH1) ; epithelischer Cadherin- Präkursor (E-Cadherin; CDHE) ; Uvomorulin (UNO) ;
CAM 120/80 Z13009 geglättet; GX U84401
Ephrin Typ-A Rezeptor-2-Präkursor; epithelische Zell-Kinase (ECK) ; Tyrosin-Protein-Kinase- Rezeptor ECK M59371 M36395
NADPH-Cytochrom-p450-Reduktase S90469
NCK Melanom-zytoplasmisches-src-Homolog (HSNCK) X17576
JV18-1. HMAD-2 oder MADR2 oder SMAD2 U68018 Dual-Spezifitäts-Mitogen-aktivierte Protein- Kinase Kinase-1 (MAP Kinase Kinase 1; MAPKK 1; MKKl); extrazelluläre Signal-regulierte Kinase 1; ERK Aktivator-Kinase 1 L05624
"c-jun"-N-terminale Kinase 1 (JNK1) ; JNK46 L26318 Mitogen-aktivierte Protein-Kinase p38 (MAP Kinase p38) ; Cytokin-unterdrückendes "anti-inflammatory"-Wirkstoff-bindendes Protein (CSAID-bindendes Protein; CSBP) ; "MAX"-wechsel- wirkendes Protein 2 (MXI2) L35253; L35263 Protein-Kinase C beta I (PKC-beta-1) M27545; X06318 Mitogen-aktivierte Protein-Kinase 9 (MAP Kinase 9; MAPK9; PRKM9) ; "c-jun"-N-terminale Kinase 2 (JNK2) ; JNK55 L31951
"C-jun"-N-terminale Kinase 3 alpha2 (JNK3A2) ; PRKMIO + MAP Kinase p493F12 U34819 + U07620 dual-Spezifitäts-Mitogen-aktivierte Protein- Kinase Kinase 6 (MAP-Kinase Kinase 6; MAPKK 6; MKK6) ; MAPK/ERK-Kinase 6; SAPKK3 U39657 p21-aktivierte Kinase-ga ma (PAK-gam a; PAK2) ; PAK65; S6/H4 Kinase U24153
Mitogen-aktivierte Protein-Kinase P38 beta (MAP Kinase P38 beta) ; Stress-aktivierte Protein- Kinase 2 (SAPK2) U53442
MAPK/ERK-Kinase Kinase 3 (MEK Kinase 3; MEKK3) U78876 dual-Spezifitäts-Mitogen-aktivierte Protein- Kinase Kinase 2 (MAP Kinase Kinase 2; MAPKK 2) ; ERK-Aktivator-Kinase 2; MAPK/ERK Kinase 2
(MEK2) L11285 dual-Spezifitäts-Mitogen-aktivierte Protein- Kinase Kinase 5 (MAP Kinase Kinase 5; MAPKK 5) U25265 ribosomale Protein-S6-Kinase II alpha 1
(S6KII-alpha 1); ribosomale S6 Kinase 1 (RSKl) L07597 B-Lymphozyt-Keimzentrums-Kinase (GC Kinase) U07349 YSK1; Ste20 & SPSl-verwandte Kinase D63780 Protein-Phosphatase 2B Regulierungs-Untereinheit; Calcineurin-B-Untereinheit Isoform 1 M30773 Protein-Tyrosin-Phosphatase MEG2 (PTPASE-MEG2) M83738 Protein-Tyrosin-Phosphatase-alpha-Präkursor
(R-PTP-alpha; PTPRA; PTPA) M34668 mit Diabetes assoziiertes RAS (RADI) L24564 CDC42-Homolog; G25K GTP-bindendes Protein
(Gehirn-Isoform + Plazenta-Isoform) M35543 + M57298
Cal egin D86322
Calbindin; Avian-Typ Vitamin-D-abhängiges
Calcium-bindendes Protein (CABP) ; D-28K X06661
Stratifin (SFN) ; 14-3-3 Protein Sigma; epithelisches Zellmarker-Protein 1; HME1 AF029082
FKBP-Rapamycin-assoziiertes Protein (FRAP) ; Rapamycin-Target-Protein L34075
Zink-Finger-Protein 37 (ZFP37); KRAB-Region-
Zink-Finger-Protein AF022158
CCAAT/Enhancer-bindendes Protein Epsilon (C/EBP Epsilon; CEBPE) U48866; U48865
Transkriptions-initiierender Faktor HD;
TATA-Box-Faktor; TATA-Sequenz-bindendes Protein
(TBP) M34960
60S ribosomales Protein L6 (RPL6) ; TAX- responsives Enhancer-Element bindendes
Protein 107 (TAXREB107) ; Neoplasma- verwandtes Protein C140 X69391
DNA-bindendes Protein HIP116; ATPase;
SNF2/SWI2-verwandtes Protein L34673 "Basic" Transkriptionsfaktor-2-44-kDa-
Untereinheit (BTF2p44) Z30094
Oktamer-bindender Transkriptionsfaktor 2
(oct-2; OTF2); Lymphoid-begrenzt Immunoglo- bulin-Oktamer-bindendes Protein NF-A2; POU2F2 M36542
Zink-Finger-Protein 40 (ZNF40) ; menschliches
Immunodefizienz-Virus-Typ-I-Enhancer-bindendes
Protein 1 (HIV-EP1) ; Haupt-Histokompatibi- litäts-Komplex bindendes Protein 1 (MBP-1) ; positive Regulator-Region-II-bindender
Faktor 1 (PRDII-BF1) X51435
Nervensystem-spezifischer Oktamer-bindender
Transkriptionsfaktor N-oct3; N-oct5A &
N-oct5B; Gehirn-spezifisches Homöobox/ POU-Region-Protein 2 (POU3F2) ; brn2; oct7 Z11933
Hypoxie-induzierbarer Faktor 1 alpha
(HIFI alpha) ; ARNT-wechselwirkendes Protein;
Mitglied von PAS-Protein 1 (MOPl) U22431
CCAAT/Enhancer-bindendes Protein alpha (C/EBP alpha) U34070
Homeöobox-Protein MOX-2 (Wachstums-Arrest- spezifische Homöobox) X82629 endothelialer Transkriptionsfaktor GATA2 M68891
DNA-bindender Protein-Inhibitor Id-2 M97796 aktivierender Transkriptionsfaktor 4 (ATF4); Tax-responsives Enhancer-Element B67 (TAXREB67); cAMP-Response-Element-bindendes Protein 2 (CREB2) D90209 Hitzeschockfaktor-Protein 1 (HSF1) ; Hitzeschock-Transkriptionfaktor 1 (HSTF1); TCF5 M64673 FK506-bindender Protein-13-Präkursor (FKBP13) ; FKBP2 ; Peptidyl-Prolyl-cis-trans-Isomerase (PPIase) M65128 cAMP-Response-Element-bindendes Protein
(CRE-BPl); Transkriptionfaktor ATF2; HB16 M31630 cAMP-Response-Element-bindendes Protein (CREB) M34356
Anfangswachstums-Response-Protein 1 (EGR1) ; Transkriptionsfaktor ETR103; KROX24; Zink- Finger-Protein 225 (ZNF225); AT225 X52541; M62829 Tristetraprolin (TTP); TISll; ZFP36; Wachstumsfaktor-induzierbares Kern-Protein 475 (NUP475) M92843 Purin-reiches einzelsträngige-DNA-bindendes Protein alpha (PURA) M96684
Transkriptionsfaktor-relB; I-rel M83221 zyklisches-AMP-abhängiger Transkriptionsfaktor ATF-3 (aktivierender Faktor FACTOR 3) L19871 Oktamer-bindender Transkriptionsfaktor 1 (oct-1; OTF1) ; Oktamer-bindendes Protein NF-AI;
POU2F1 X13403
B-Zellen-Lymphoma-3-kodierendes Protein (bcl-3) M31732
Retinsäure-Rezeptor gamma 1 (RAR-gamma 1; RARG) M24857; M38258; M57707; M32074
PRB-bindendes Protein E2F1; Retinoblastom- bindendes Protein 3 (RBBP3) ; Retinoblastom- assoziiertes Protein 1 (RBAP1) ; PBR3 M96577
Retinsäure-Rezeptor alpha; Retinoid-X-Rezeptor alpha (RXRA) X52773
Haupt-Histokompatibilitäts-Ko plex-Enhancer- bindendes Protein MAD3 M69043 fusionierend-bindendes Protein 2 (FBP2) U69126
Methyl-CpG-bindendes Protein 2 (MECP2) L37298 AP4 "basic" Helix-Loop-Helix DNA-bindendes Protein S73885
Hepatozyt-Kern-Faktor 4 (HNF4); Transkriptionsfaktor 14 X76930 Metall-Regulator-Transkriptionsfaktor X78710 Cockayne-Syndrom Gruppe A; WD-Repeat-Protein (CSA-Protein) U28413 RNase-L-Inhibitor X76388 40S ribosomales Protein S5 U14970 Glutamat-Pyruvat-Transaminase 1 (GPTl); Alanin-
Aminotransferase 1 (AAT1) D10355
Peptidylprolyl-cis-trans-Isomerase A (PPIase; PPIA) ; Rotamase; Ciclophilin A (CYPA) ; Cyclosporin-A-bindendes Protein Y00052 wahrscheinlicher Protein-Disulfid-Isomerase- ER-60-Präkursor (ERP60) ; 58-kDa mikrosomales Protein; Phospholipase C alpha D16234; Z49835;
D83485; U42068 HSC70-wechselwirkendes Protein; Progesteron- Rezeptor-assoziiertes-P48-Protein U28918
Chaperonin-enthaltende T-Komplex-Polypeptid-1- beta-Untereinheit (CCT-beta; CCTB; CCT2; TCPl- beta) ; 99D8.1 AF026293
Peroxisom-Assembly-Faktor-2 (PAF-2) ; Peroxisomal-Typ ATPase 1; Peroxin-6; PEX6;
PXAAA1 U56602 zelluläres Retinsäure-bindendes Protein S74445 Endothelin-umwandelndes Enzym 1 Z35307
Matrix-Metalloproteinase-14-Präkursor (MMP14) ; MMP-Xl; Membran-Typ Matrix-Metalloproteinase 1
(MT-MMP1) D26512; X83535
Bleomycin-Hydrolase (BLM Hydrolase) X92106
Proteasom-Aktivator-HPA28-Untereinheit beta D45248 Plazenta-Plasminogen-Aktivator-Inhibitor 2 (PAI-2; PLANH2); Monozyt ARG-Serpin; Urokinase-
Inhibitor M18082; J02685 alpha-2-Makroglobulin-Präkursor (alpha-2-M) M11313 Gewebs-Inhibitor des Metalloproteinase 1 Präkursors (TIMP1) ; Erythroid-potentierende Aktivität (EPA) ; Fibroblast-Kollagenase- Inhibitor X03124 alpha-1-Antichymotrypsin-Präkursor (ACT) K01500 alpha-1-Antitrypsin-Präkursor; alpha-1- Protease-Inhibitor; alpha-1-Antiproteinase X02920 DNA-bindendes Protein A (DBPA) ; Kälteschock- Region-Protein A (CSDA) M24069 Decoy-Rezeptor 3 (DCR3) AF104419 T-Komplex-Protein 1 zeta-artige Untereinheit
(CCT-zeta-artig; TCPl-zeta-artig) ; TSA303; Testikel-spezifisch TCP20# D78333 Chromatin-Assembly-Faktor-l-p48-Untereinheit
(CAF1 p48-Untereinheit) ; Retinoblastom- bindendes Protein 4 (RBBP4) ; RBAP48; msil Protein-Homolog X74262
High-Mobility-Group-Protein HMG2 X62534 DNA-bindendes Protein UEV-1; UBE2V U49278 Aktivator-l-140-kDa-Untereinheit (AI 140-kDa- Untereinheit) ; Replikationsfaktor C "large"- Untereinheit; DNA-bindendes Protein PO-GA L14922 Replikationsfaktor-C-36-kDa-Untereinheit
(RFC36) ; Aktivator-l-36-kDa-Untereinheit L07540 Replikationsfaktor-C-38-kDa-Untereinheit
(RFC38) ; Aktivator-l-38-kDa-Untereinheit L07541 Replikations-Protein-A-70-kDa-Untereinheit
(RPA70; REPAl; RF-A); einzelsträngige-DNA- bindendes Protein M63488
Aktivator-l-40-kDa-Untereinheit (Al-40-kDa- Untereinheit) ; Replikationsfaktor-C-40kDa- Untereinheit (RFC40) ; RFC2 M87338
Aktivator-1-37kDa-Untereinheit; Replikations- faktor-C-37kDa-Untereinheit (RFC37) ; RFC4 M87339 DNA-Topoisomerase I (TOP1) J03250 DNA-Topoisomerase II alpha (TOP2A) J04088 proliferierendes zyklisches Kern-Antigen
(PCNA); Zyklin M15796; J0471Σ
DNA-Topoisomerase II beta (TOP2B) X68060 Replikations-Protein-A-14kDa-Untereinheit ( RP-A) (RF-A) ; Replikationsfaktor~A-Protein 3 L07493 DNA-Nukleotidylexotransferase; terminales Additionions-Enzym; terminale Deoxynucleotidyl- transferase (TDT); terminale Transferase; DNTT M11722; K01919 DNA-Polymerase delta katalytische Untereinheit M80397 DNA-Topoisomerase III (T0P3) U43431
"excision repair cross- complementing rodent repair deficiency complementation group 6" (ERCC6) ; Cockayne-Syndrom-Protein 2 Typ B (CSB) L04791
Xeroderma-Pigmentosum Gruppe G komplementierendes Protein (XPG) ; "X-ray repair-complementing defective repair in Chinese hamster cells 5" (XRCC5) L20046; X69978 Ku-(p70/p80) -Untereinheit; ATP-abhängige DNA- Helicase-II-86kDa-Untereinheit; Lupus- u- Autoantigen-Protein; Thyroid-Lupus-Autoantigen (TLAA) ; CTC-Box-bindende Faktor-85kDa-Unter- einheit (CTCBF; CTC85) ; Kern-Faktor IV M30938 Xeroderma-Pigmentosum-Gruppe B komplementierendes Protein (XPB) ; „excision repair cross- complementing rodent repair deficiency complementation group 3" (ERCC3) ; basilare Transkriptionsfaktor-2-89kDa-Untereinheit (BTF2-p89; TFIIH-89kDa-Untereinheit) M31899
Ku-70kDa-Untereinheit; ATP-abhängige DNA- Helicase-I1-70kDa-Untereinheit; Lupus-ku- Autoantigen-Protein P70; Thyroid-Lupus-Auto- Antigen (TLAA) ; CTC-Box-bindende Faktor- 75kDa-Untereinheit (CTC75) M32865; S38729
"X-ray repair-complementing defective repair in Chinese hamster cells 1" (XRCC1) M36089
Ubiquitin-konjungierendes Enzym E2 17-kDa UBE2A) ; Ubiquitin-Protein-Ligase; Ubiquitin- Träger-Protein; HR6A M74524
DNA-Polymerase alpha katalytische Untereinheit (POLA) X06745
6-O-Methylguanine-DNA-Methyltransferase (MGMT) ; methylierte-DNA-Protein-Cystein-Methyltrans- ferase M29971
Xeroderma-Pigmentosum Gruppe D komplementierendes Protein (XPD) ; "X-ray repair-complementing defective repair in Chinese hamster cells 2" (XRCC2) X52221
"excision repair cross-complementing rodent repair deficiency complementation group 1" (ERCC1) M13194 mutL-Protein-Homologl (MLH1) ; Kolon-Krebs- Nonpolyposis-Typ-2-Protein (C0CA2) U07418 UV-Exzisionsreparatur-Protein RAD23-Homolog B (HHR23B) ; Xeroderma-Pigmentosum Gruppe C Reparatur-komplementierender Komplex 58-kDa ProteinD21090 HHR23A; UV-Exzisionsreparatur- Protein Protein RAD23A D21235
DNA-abhängige Protein-Kinase (DNA-PK) + DNA-PK katalytische Untereinheit (DNA-PKCS) U35835 + U47077 DNA Schadens-Reparatur- & Rekombinations- Protein 52 (RAD52) U12134 Ataxia Telangiectasia (ATM) U33841 RAD50 U63139
DNA-Ligase IV (LIG4); Polydeoxyribonukleotid- Synthase X83441
DNA-Ligase III (LIG3) ; Polydeoxyribonukleotid- Synthase X84740
DNA-"Mismatch"-Repair-Protein MSH2 U04045; L47583 DNA-"Mismatch"-Repair-Protein MSH6; mutS-alpha- 160kDa-Untereinheit; G/T "Mismatch"-bindendes Protein (GTMBP; GTBP) U54777
RecQ Protein-artig (DNA-Helicase Ql-artig) D37984 DNA Polymerase-beta-Untereinheit (DPOB) D29013 DNA-"Mismatch"-Reparatur-Protein PMS1 (PMS1 - Protein-Homolog 1) U13695
DNA-"Mismatch"-Reparatur-Protein PMS2 (PMS1- Protein-Homolog 2) U13696
ATP-abhängige DNA-Ligase I (LIG1) ; Polydeoxy- ribonukleotid-Synthase M36067 Xeroderma-Pigmentosum-Gruppe-A-komplemen- tierendes Protein (XPA) D14533
Schädigungs-spezifische DNA-bindende Protein- p48-Untereinheit (DDBB P48); in Zusamenhang mit Xeroderma Pigmentosum Gruppe E (DDB2) U18300 DNA-Reparatur-Protein XRCC4 U40622 G/T-"Mismatch"-spezifische Thymin-DNA- Glycosylase (TDG) U51166 DNA-Reparatur-Protein XRCC9 U70310 Endonuklease-III-Homolog 1; HNTH1; OCTS3 U79718 DNA-Reparatur-Protein komplementierende XP-C- Zellen; Xeroderma Pigmentosum Gruppe C komplementierendes Protein (pl25) D21089 Uracil-DNA-Glycosylase-Präkursor (UNG1) X15653 DNA- (apurinische oder apyrimidinische Stelle) Lyase; AP-Endonuklease 1 (APEl) ; apurinische / apyrimidinische Endonuklease (APEX) ; APEX Nuklease (APEN) ; REF1 X59764; X66133 DNA-Reparatur-Protein-RAD54-Homolog X97795 recA-artiges Protein HsRadδl; DNA-Reparatur- Protein RAD51-Homolog D13804 V(D)J Rekombinations-aktivierendes Protein 2
(RAG2) M94633 V(D)J Rekombinations-aktivierendes Protein 1
(RAGl) M29474 Muskel-spezifischer DNase-I-artiger Präkursor
(DNaselLl; DNL1L) ; DNase X X90392; L40817;
U06846
Deoxyribonuklease I (DNase I) M55983 dual-Spezifitäts-Protein-Phosphatase 9; Mitogen-aktivierte Protein-Kinase-Phospha- tase 4 (MAP-Kinase-Phosphatase 4 (MKP4) Y08302 Gl/S-spezifisches Cyclin D3 (CCND3) M92287 Gl/S-spezifisches Cyclin Dl (CCND1) ; Cyclin- Parathyreoid-Adenomatose 1 (PRAD1) ; bcl-1 Onkogen X59798
Gl/S-spefisches Cyclin D2 (CCND2) + KIAK0002 M90813 + D1363< G2/Mitose-spezifisches Cyclin Bl (CCNB1) M25753 Gl/S-spezifisches Cyclin E (CCNE) M73812 G2/Mitose-spezifisches Cyclin Gl (CCNGl; CYCGl) U47413 Gl/S-spezifisches Cyclin C M74091
Cyclin K AF060515
Protein-Serin/Threonin-Kinase STK1; Zellteilungs-Protein-Kinase 7 (CDK7); CDK-aktivierende Kinase (CAK) ; 39kDa-Protein- Kinase L20320
Cyclin-abhängige Protein-Kinase 2 (CDK2) ; p33-Protein-Kinase M68520 extrazelluläre Signal-gesteuerte Kinase 2
(ERK2) ; Mitogen-aktivierte Protein-Kinase 2
(MAP Kinase 2; MAPK 2); p42-MAPK M84489
Mitogen-aktivierte Protein-Kinase 3 (MAPK3;
PRKM3) ; MAPKl; extrazelluläre Signal-gesteuerte
Kinase 1 (ERK1) ; Microtubulus-assoziierte
Protein-2-Kinase; Insulin-stimulierte MAP2
Kinase X60188 extrazelluläre Signal-gesteuerte Kinase 3
(ERK3); MAP-Kinase 3 (MAPK3; p97-MAPK) ;
PRKM5 X80692
CDC-artige Kinase 3 (CLK3) L29220
Zellteilungs-Protein-Kinase 4; Cyclin- abhängige Kinase 4 (CDK4) ; PSK-J3 M14505 extrazelluläre Signal-gesteuerte Kinase 5
(ERK5); BMKl-Kinase U25278
Zellteilungs-Kontroll-Protein-2-Homolog (CDC2) ; p34-Protein-Kinase; Cyclin-abhängige Kinase 1
(CDKl) X05360 extrazelluläre Signal-gesteuerte Kinase 4
(ERK4); MAP-Kinase 4 (MAPK4; p63-MAPK) ; PRKM4 X59727 Zellteilungs-Protein-Kinase 5 (CDK5) ; tau- Protein-Kinase II katalytische Untereinheit
(TPKII katalytische Untereinheit) ; Serin/ Threonin-Protein-Kinase PSSALRE X66364 extrazellulär Signal-gesteuerte Kinase 6 (ERK6) ; Stress-aktivierte Protein Kinase-3; Mitogen- aktivierte Protein-Kinase p38 gamma; (MAP- Kinase p38 gamma) X79483 Serin/Threonin-Protein-Kinase PLK1 (STPK13) U01038 "Checkpoint"-Kinase 1 (CHK1) AF016582 Aurora- & IPLl-artige "Midbody"-assoziierte Protein-Kinase 1 (AIM1) ; ARK2 AF008552 Cyclin-G-assoziierte Kinase (GAK) D88435 besonders AT-reiche Sequenz bindendes Protein 1 (SATB1) ; MAR/SAR-DNA-bindendes Protein M97287
Cyclin-abhängiger Kinase-Inhibitor 1A (CDKNIA) ; Melanom-Differenzierungs-assoziiertes Protein 6 (MDA6) ; CDK-wechselwirkendes Protein 1 (CIP1) ; WAF1; SDI1 U09579; L25610 weelHu-CDK-Tyrosin-15-Kinase; wee-1-artige Protein-Kinase U10564
Cyclin-abhängiger Kinase-4-Inhibitor 2B (CDKN2B) ; pl4-INK4B; Polytumor-Suppressor 2 (MTS2) U17075; L36844
Helix-Loop-Helix-Protein HLH 1R21; DNA-bindender Protein-Inhibitor Id-3; HEIR-1 X69111 DNA-bindender Protein-Inhibitor ID-1; Id-IH D13889 Prothymosin alpha (PROT-alpha; PTMA) M26708 40S ribosomales Protein S19 (RPS19) M81757 p55CDC U05340
Zellteilungszyklus-Protein 25A (CDC25A) ; M-Phasen-Induktor-Phosphatase 1 M81933 CDC25B; CDC25HU2; M-Phasen-Induktor- Phosphatase 2 M81934; S78187
CDC25C; M-Phasen-Induktor-Phosphatase 3 M34065 Wachstumsinhibitor-Faktor (GIF) ; Metallothio- nein-III (MT-III; MT3) D13365; M93311 CDC37 Homolog U63131
Zellzyklus-Protein-P38-2G4-Homolog; HG4-1 U59435 btg-Protein-Präkursor; NGF-induzierbares anti- proliferatives Protein PC3 U72649
RCL Wachstums-verwandtes c-myc-Responsiv-Gen AF040105 40kDa-Hitzeschock-Protein 1 (HSP40) ; DNAJ- Protein-Homolog 1 (HDJ1; DNAJ1) D49547 60kDa-Hitzeschock-Protein (HSP60) ; HSPD1; 60kDa-Chaperonin; mitochondrialer Matrix- Protein-Pl-Präkursor; p60 Lymphozyt-Protein; HUCHA60; GROEL M34664 90kDa-Hitzeschock-Protein A (HSP90A) ; HSP86; HSPCA X07270
27kDa-Hitzeschock-Protein (HSP27); Stress- responsives Protein 27 (SRP27) ; Estrogen- gesteuertes 2 Da-Protein; HSPB1 X54079 70kDa-Hitzeschock-Protein 1 (HSP70.1; HSPAl) M11717 Hitzeschock-70kDa-Protein 6 (Hitzeschock- 70kDa-Protein B) X51757; M11236
Hitzeschock-Cognat-71kDa-Protein; Hitzeschock- 70kDa-Protein 8 (HSPA8; HSC70) ; HSP73 Y00371 Hitzeschock-verwandtes 70kDa-Protein 2 L26336 Haupt-Gewölbe-Protein (MVP) ; Lungen Resistenzverwandtes Protein (LRP) X79882 Thiosulfat-Sulfurtransferase; Rhodanese D87292 lösliche Epoxid-Hydrolase (SEH) ; Epoxid- Hydratase; zytosolische Epoxid-Hydrolase
(CEH) ; EPHX2 L05779
Serum-Paraoxonase/Arylesterase 1 (PON1) ; Serum-Aryldiakylphosphatase 1; aromatische Esterase 1 (A-Esterase 1) M63012 polymorphe Arylamin-N-Acetyltransferase
(PNAT) + monomorphe (MNAT) X14672; X17059
Chinon-Oxidoreduktase; NADPHrChinon-Reduktase; Zeta-Crystallin (CRYZ) L13278; S58039 zytosolische Superoxid-Dismutase 1 (SOD1) K00065; X02317 Cytochrom P450 IB1 (CYP1B1) U03688
Cytochrom P450 IIA6 (CYP2A6) + CYP2A7 + CYP2A13 + CYP2A7PT + CYP2A7PC M33318; M33316 + Ü22029 + U22030 + U22044 Cytochrom P450 IIB6
(CYP2B6) + CYP2B3 M29874; J02864
Cytochrom P450 IIIA3 (CYP3A3) + CYP3A4 + CYP3A5 + CYP3A7 M13785 + M18907 + J04813 + D00408 Cytochrom P450 IVA11 (CYP4A11) L04751 Cytochrom P450 VIIA1 (CYP7A1) X56088 D-Aminosäure-Oxidase (DAMOX; DAO; DAAO) X13227 S-Mephenytoin-4-Hydroxylase; Cytochrom P450 IIC9 (CYP2C9) + CYP2C10 + CYP2C17 + CYP2C18 + CYP2C19 M21940 + M15331; M21939 + M61858 + M61854
Cytochrom P450 HEI (CYP2E1) J02625
Cytochrom P450 IIF1 (CYP2F1) J02906
Cytochrom P450 IVB1 (EC 1.14.14.1) (P450-HP) J02871
Cytochrom P450 IA2 (P450-P3) (P450-4) Z00036
Plasma-Glutathion-Peroxidase-Präkursor (GPXP;
GPX3) D00632; X58295 natürliche Killerzellen verstärkender Faktor (NKEFB) + Thiol-spezifisches Antioxidans-Protein (TSA) ; Thioredoxin-Peroxidase 1 (TDPX1) ; Thiore- doxin abhängige Peroxid-Reduktase 1 L19185 + Z22548; X82321
Thioredoxin-Peroxidase 2 (TDPX2) ; Thioredoxin- abhängige Peroxid-Reduktase 2; Proliferation- assoziiertes Gen (PAG) ; natürliche Killerzellen verstärkender Faktor A (NKEFA) X67951 Glutathion-Reduktase (GRase; GSR; GR) X15722 microsomale Glutathion-S-Transferase 12
(GST12; MGST1) J03746; B28083
Glutathion-S-Transferase pi (GSTP1; GST3) X08058; M24485 Glutathion-Peroxidase (GSHPX1; GPX1) Y00483; M21304 Glutathion-S-Transferase theta 1 (GSTT1) X79389 Methallothionein IH (MT1H) ; MetallothineinO
(MT0) + MT1I; MT2 + MT1L + MT1R X64177 + X97260 + X76717 + X97261
Glutathion-Peroxidase-Gastrointestinal (GSHPX-GI) ;
Glutathion-Peroxidase-verwandtes Protein 2 (GPRP)
X53463
Häm-Oxygenase 1 (HOl) ; HSOXYGR X06985
Häm-Oxygenase 2 (H02) D21243; S34389
Dimethylanilin-Monooxygenase (N-Oxide bildend) 1
(EC 1.14.13.8); fetal hepatische Flavin- enthaltende Monooxygenase 1 (FMO 1) ; Dimethyl- anilin-Oxidase 1 M64082
Glutathion-S-Transferase mul (GSTM1; GST1) ;
HB-Untereinheit 4; GTH4 X68676; S01719 Glutathion-S-Transferase AI (GTH1; GSTA1) ; HA-Untereinheit 1; GST-epsilon M25627
Glutathion-S-Transferase (GST) -Homolog U90313
Glutathion-Synthetase (GSH-Synthetase; GSH-S) ; Glutathion-Synthase U34683
NAD(P)H-Dehydrogenase; Chinon-Reduktase; DT- Diaphorase; Azoreductase; Phyllochinon- Reduktase; Menadion-Reduktase J03934
Wachstumsstillstand- & DNA-Schädigung-induzierbares Protein (GADD45) ; DNA-Schädigung-induzierbares
Transkript 1 (DDIT1) M60974
Tumor-Nekrose-Faktor-alpha-Präkursor (TNF-alpha; TNFA) ; Cachectin X01394
Lymphotoxin-alpha-Präkursor (LT-alpha) ; Tumor- Nekrose-Faktor-beta (TNF-beta; TNFB) D12614 fas-Antigen-Ligand (FASL) ; Apoptosis-Antigen- Ligand (APTL; APT1LG1); TNFSF6 D38122; U08137
Tumor-Nekrose-Faktor-Rezeptor (TNFR) + Tumor- Nekrose-Faktor Rezeptor 2 (TNFR2) ;Tumor- Nekrose-Faktor-bindendes Protein 2 (TBP2) M32315 + M55994 Tumor-Nekrose-Faktor-Rezeptor 1 (TNFRl) ; Tumor- Nekrose-Faktor-bindendes Protein 1 (TBPl) ; CD120A-Antigen M33294 fasL-Rezeptor; Apoptosis-unterstützendes Oberflächen-Antigen fas; APO-1-Antigen; CD95-Antigen M67454 Retinsäure-Rezeptor beta (RXR-beta; RXRB) M84820; X63522;
S54072
Tumor-Nekrose-Faktor-Rezeptor-1-assoziier es
"Death"-Domain-Protein (TNFRl-assoziiertes
"Death"-Domain-Protein; TRADD) L41690
CD27BP (Siva) U82938
Tumor-Nekrose-Faktor Typ-1-Rezeptor-assozi- iertes Protein (TRAPl) U12595
Caspase-2-Präkursor (CASP2) ; ICH-IL-Protease +
ICH-lS-Protease U13021 + U13022
Interleukin-1-beta-Convertase-Präkursor (IL-IBC)
IL-1-beta-umwandelndes-Enzym (ICE); p45; Caspase-1 (CASP1 ) U13699; M87507; X65019
Caspase-6-Präkursor (CASP6) ; Cysteine-Protease MCH2-Isoformen alpha + beta U20536 + U20537 Caspase-4-Präkursor (CASP4); ICH-2-Protease; TX-Protease; ICE(REL)-II + Caspase-5-Präkursor (CASP5); ICH-3-Protease; TY-Protease; ICE(REL)-III U28014 + U28015
Caspase-7-Präkursor (CASP7) ; ICE-artige apoptotische Protease 3 (ICE-LAP3) ; apoptotische
Protease MCH-3; CMH-1 U37448 TNF-verwandter Apoptosis-induzierender Ligand (TRAIL) ; APO-2-Ligand (AP02L) U57059 Caspase-8-Präkursor (CASP8) ; ICE-artige apoptotische Protease 5 (ICE-LAP5) ; MORTl- assoziiertes CED-3-Homolog (MACH) ; FADD-Homolog ICE/CED-3-artige Protease (FADD-artige ICE; FLICE); apoptotische Cysteine-Protease MCH-5 U60520; U58143;
X98172; AF00962
Apoptosis-Regulator bax L22474 Apoptosis-Regulator bcl-x Z23115; L20121;
L20122
Apoptosis-Regulator bcl-2 M14745
NIP3 (NIP3) U15174 bcl2 homologer Antagonist/Killer (BAK) U23765; U16811;
X84213 induziertes myeloid Leukämiezellen-Differentiations-Protein MCL-1 L08246 BAD-Protein; bcl-2-bindende Komponente 6
(BBC6) ; bcl-2L8 U66879
BCL-2-bindendes Athanogen-1 (BAG-1) ; Glucocorticoid-Rezeptor-assoziiertes Protein RAP46 S83171; Z35491
Interferon-induzierbare RNA-abhängige Protein- Kinase (P68 Kinase) M35663; U50648 induzierbare Stickstoffmonoxid-Synthase
(INOS); Typ II NOS; Hepatozyt NOS (HEP-NOS) L09210 Verteidiger gegen Zelltod 1 (DAD1) D15057 Clusterin-Präkursor (CLU) ; Komplement-assozi- iertes Protein SP-40; Komplement-Lysis-Inhibitor
(CLI) ; Apolipoprotein J (APOJ) ; Testosterone- reprimiertes Prostata-"Message" 2 (TRPM2) ; sulfatiertes Glyco-protein 2 (SGP2) M74816 Wachstummsstilstand- & DNA-Schädigung-induzierbares Protein 153 (GADD153) ; DNA-Schädigungs- induzierbares Transkript 3 (DDIT3) ; C/EBP homologes Protein (CHOP) S40706; S62138 Inhibitor des Apoptosis-Protein 1 (HIAPl; APIl)
+ lAP-Homolog C; TNFR2-TRAF Signalstoff- Komplex-Protein 1; MIHC U45878 + U37546
Zytoplasmische Dynein "light chain" 1 (HDLC1) ; Protein-Iinihibitor neuronaler Stickstoffmon- oxid-Synthase (PIN) U32944 Apoptosis-Inhibitor "survivin" U75285 Sentrin; Ubiquitin-artiges Protein SMT3C; Ubiquitin-Homologie-Region-Protein PIC1; UBL1; SUMO-1; GAP modifizierendes Protein 1; GMPl U83117 IEX-1L Anti-"Death"-Protein; PRG-1; DIF-2 AF039067; AF071596
Poly(ADP-Ribose) Polymerase (PARP; PPOL ); ADPRT; NAD+ ADP-Ribosyltransferase; Poly(ADP- Ribose) Synthetase M18112; J03473 Avian Myelocytomatose virales Onkogene-Homolog
(MYC) V00568 p53-assoziiertes mdm2-Protein Z12020; M92424 aus Blutplättchen gewonnener Wachstumsfaktor B Untereinheit-Präkursor (PDGFB; PDGF2) ; Bacaplermin; c-sis X02811; X02744; M12783; M16288 p53 zelluläres Tumor-Antigen M14694; M14695
MYB-verwandes Protein B (B-MYB) ; Avian Myeloblastose virales Onkogen-Ho olog-artige 2 (MYBL2) X13293
Triiodothyronin-Rezeptor; Thyroid-Hormon- Rezeptor (THRA1) ; v-erbA-verwandtes Protein Protein ear-1 M24898 "jun" Proto-Onkogen; Avian-Sarkoma-Virus-17- Onkogen-Homolog; Transkriptionsfaktor AP-1 J04111 Insulin-artigen Wachstumsfaktor bindendes Protein 2 (IGFBP2) M35410 c-myc Purin-bindender Transkriptionsfaktor puf; Nukleosid-Diphosphat-Kinase B (NDP- Kinase B; NDKB) + nm23-H2S L16785 + M36981 Abelson-Murine-Leukämie virales Onkogen- Homolog 1 (ABL1) M14752
Retinoblasto -assoziiertes Protein (RB1) ; PP110; P105-RB M15400 L-myc Proto-Onkogene (MYCL1) M19720 Brustkrebs-Typ-2-Suszeptibilitäts-Protein (BRCA2) Ü43746 fos-verwandtes Antigen (FRA1) ; fosLl X16707 Nukleus-Phosphoprotein B23; Nukleophosmin (NPM) ; Numatrin M23613 c-myc-bindendes Protein MM-1 D89667 c-fos-Proto-Onkogen; G0S7 Protein K00650 met-Proto-Onkogen; Hepatozyt-Wachstumsfaktor- Rezeptor-Präkursor (HGF-SF Rezeptor) J02958 Nukleosid-Diphosphate-Kinase A (NDKA) ; NDP- Kinase A; Tumor-metastatischem Prozess-assozi- iertes Protein; Metastase-Inhibiions-Faktor NM23 (NM23-H1) X17620
Matrix-Metalloproteinase 11 (MMP11) ; Stromelysin 3 X57766
Box-abhängiges myc-wechselwirkendes Protein 1 U68485 H-ras-Proto-Onkogen; transformierendes G-Protein V00574
Protein-Tyrosin-Phosphatase PTEN; mutiert in verschiedenen fortgeschrittenen Krebsen 1 (MMAC1) ; TEP1 U92436
Prostaglandin-G/H-Synthase-2-Präkursor (PGH-Synthase-2; PGHS2; PTGS2) ; Cyclooxy- genase 2 (COX2) ; Prostaglandin-Endoperoxid- Synthase 2 M90100
78-kDa Glucose-regulierter Protein-Präkursor (GRP 78); Immunoglobulin-"heavy chain"- bindendes Protein (BIP) M19645 Komplement 3 (C3) K02765
Interleukin-10-Präkursor (IL-10) ; Cytokin- Synthese-Hemmfaktor (CSIF) M57627 Thioredoxin (TRDX; TXN) ; ATL-abgeleiteter Faktor (ADF) ; Oberflächen-assoziiertes Sulphy- drylprotein (SASP) J04026
Enolase 1 alpha (ENOl) ; nicht-neurale Enolase (NNE) ; Phosphopyruvat-Hydratase (PPH) M14328 Biliverdin-Reduktase-A-Präkursor (BLVRA; BVR) U34877 Tyrosin-Aminotransferase (TAT); I-Tyrosin:2- Oxoglutarateaminotransferase X52520 Mskel-spezifische Kohlensäure-Anhydrase III (CA3) ; Carbonat- Dehydratase III M29458 Spermidine/Spermine-Nl-Acetyltransferase (SSAT) ; Diamine-Acetyltransferase; Putrescin- Acetyl-transferase M55580
L-Lactate-Dehydrogenase-H-Untereinheit (LDHB) Y00711 Phosphoglycerid-Kinase 1 (PGK1; PGKA) ; Primer- Erkenungs-Protein 2 (PRP2) V00572 Glucose-6-Phosphat-Dehydrogenase (G6PD) X03674 mitochondriale Phosphoenolpyruvat-Carboxy- kinase-2-Präkursor (PEPCK-M; PCK2) ; Phosphoenol- pyruvat-Carboxylase X92720
Galactosid 2-1-Fucosyltransferase 2; GDP-l-Fucose:beta-D-Galactosid 2-alpha-l- Fucosyl-transferase 2; Fucosyltransferase 2 (FUT2) ; Sekretor Blutgruppe alpha-2-Fucosyl- transferase; Sekretor Faktor 2 (SE2) D87942 Galactosyltransferase-assoziierte Protein- Kinase p58 (GTA) ; Zellteilungszyklus-2-artige 1 (CDC2L1; CLK1) M37712 Adrenodoxin M34788
Alkohol-Dehydrogenase-alpha-Untereinheit + Alkohol-Dehydrogenase 2 + Alkohol-Dehydro- genase 3 M12271 + D00137
+ X04299
Alkohol-Dehydrogenase-5-chi-Polypeptid M30471 Alkohol-Dehydrogenase-Klasse-II-pi-Untereinheit M15943 Creatin-Kinase B-Kette L47647 Fettsäure- S80437 hepatische Triglycerid-Lipase (HTGL) X07228 Gallensalz-aktivierte Lipase M85201; M37044 mitochondriale Enoyl-CoA-Hydratase kurze Untereinheit 1 D13900 peroxisomales bifunktionales Enzym L07077 peroxisomale Acyl-CoA-Oxidase-verzweigte- Unterein-heit (BRCOX) X95190
Acyl-CoA-Dehydrogenase-"long-chain-spezifischer Präkursor (LCAD; ACADL) M74096 Al ohol-Sulfotransferase L20000 Estradiol-17-beta-Dehydrogenase 1 M36263 Cytochrom P450 XVIIAI (CYP17A1) M14564 peroxisomaler 3-Ketoacyl-CoA-Thiolase-Präkursor (PTHIO) ; peroxisomale 3-Oxoacyl-CoA-Thiolase; beta-Ketothiolase; Acetyl-CoA-Acyltransferase (ACAA) X14813
3-Hydroxy-3-Methylglutaryl-CoEnzym-A-Reduktase (HMG-CoA Reduktase; HMGCR) M11058 Lipoprotein-Lipase-Präkursor (LPL) M15856 Lunge Gruppe IB Phospholipase-A2-Präkursor (PLA2) ; Phosphatidylcholin-2-Acylhydrolase M21054 mitochondrialer Cytochrom-P450-XIAI-Präkursor; P450 (SCC) ; Cholesterol-Seiten-Kette-Spaltungs- Enzy ; Cholesterol-Desmolase CYP11A1 M14565 Dihydrofolat-Reduktase (DHFR) V00507 Thymidylat-Synthase (TYMS; TS) X02308 zytosolische Thymidin-Kinase (TK1) K02581 Ribonucleosid-Diphosphat-Reduktase-Ml-Unter- einheit; Ribonukleotid-Reduktase X59543 microsomale UDP-Glucuronosyltransferase-2B15- Präkursor (UDPGT); UDPGTH-3; UGT2B15 + microso- maler 2B10-Präkursor (UDPGT); UGT2B10 + 2microsomal B8 Präkursor U08854; X63359; U06641; J05428; Y00317
GLCLC, GLCL (Glutamat-Cystein-Ligase katalytische Untereinheit, gamma-Glutamylcystein- Synthetase) M90656 gamma-Glutamyl-Hydrolase-Präkursor (GGH; GH) ; Folyl-polygammaglutamyl-Hydrolase; gamma-glu-X Carboxy-peptidase; Conjugase U55206
3 ' -Phosphoadenosin-5 ' -Phosphosulfat-Synthase 1 (PAPS-Synthase 1; PAPSS1) ;
PAPS-Synthetase 1; Sulfurylase-Kinase 1 (SKI) Y10387 lösliche Glutamat-Oxalacetat-Transaminase 1 (GOT1) ; zytoplasmische Aspartat-Aminotrans- ferase 1; Transaminase A M37400
Alkohol-Dehydrogenase-6 + Aldehyd-Dehydroge- nase 1 (ALDH1) K03000 peroxisomale Acyl-CoEnzym-A-Oxidase S69189 "very-long-chain"-spezifischer Acyl-CoA- Dehydrogenase-Präkursor (VLCAD) D43682 Glutamat-Cystein-Ligase regulatorische Untereinheit (GLCLR) ; gamma-Glutamylcystein- Synthetase P48507
LOX (Protein-Lysin-6-Oxidase, Lysyl-Oxidase) M94054 Ornithin-Decarboxylase X16277
Corticosteroid-11-beta-Dehydrogenase-Isozym 2 U14631 Cytochrom P450 VA1 (CYP5A1) M80647 mitochondrialer Aldehyd-Dehydrogenase-Präkursor (Klasse 2); ALDHI; ALDH2 Y00109
5, 6-Dihydroxyindol-2-carbonsäure-Oxidase- Präkursor (DHICA-Oxidase) ; Tyrosinase-verwandtes Protein 1 (TRP-1) ; Catalase B; Glycoprotein-75 (GP75) X51420
Tenascin-Präkursor (TN) ; Hexabrachion (HXB) ; Cytotactin; Neuronectin; GMEM; miotendinöses Antigen; Gliom-assoziiertes extrazelluläres Matrix-Antigen X78565; M55618
Osteopontin-Präkursor (Knochen-Sialoprotein 1) X13694 ATP-bindender-Cassette-Transporter (ABCR) U88667 Gewebe-Inhibitor des Metalloproteinase-2- Präkursors (TIMP2) J05593
Matrix-Metalloproteinase 15 (MMP15) Z48482 Matrix-Metalloproteinase 14 (MMP14) D26512 Matrix-Metalloproteinase 1 (MMP1) X54925 Vinculin M33308 Vimentin (VIM) X56134; M1414
Serum-Amyloid- Al-Präkursor (SAA1) M23698
Seneszenz-Marker-Protein 30 (SMP30) ; Regucalcin
(RGN; RC) D31815
Ubiquitin-"cross-reactive"-Protein-Präkursor
(UCRP) ; alpha-induzierbares Interferon; Inter- feron-induziertes-17kDa-Protein; G1P2; ISG15 M13755 Laminin-gamma-2-Untereinheit-Präkursor (LAMC2) Z15009 Peroxisom-Assembly-Faktor 1 (PAF1) ; Peroxisomales Membran-Protein 3 (PXMP3; PMP3) ; 35kDa peroxisomales Membran-Protein (PMP35) ; Peroxin 2 (PEX2) M86852 peroxisomales Membran-Protein 69 (PMP69) AF009746 Peroxisom-Biogenese-Störungs-Protein 1 (PEX1) AF026086 mitochondriale Glutamat-Oxaloacetat-Trans- aminase 2 (GOT2); Aspartat-Aminotransferase 2; Transaminase A M22632 nck~, ash- & Phoshpholipase-C-gamma-bindendes Protein (NAP4) AB005216
N-Oxid-bildende Dimethylanilin-Monooxygenase 4; hepatische Flavin-enthaltende Monooxygenase 4
(FM04) Z11737
Xeroderma Pigmentosum Gruppe F komplementierendes Protein (XPF) ; DNA Exzisions-Reparatur- Protein ERCC4; ERCC11 L77890
Replikations-Protein-A-30kDa-Untereinheit; Replikations-Faktor-A-Protein 4 (RPA4; RFA) U24186 mutY-Homolog (hMYH) U63329 beta Crystallin A4 (CRYBA4) U59057 T-Komplex-Protein-1-epsilon-Untereinheit
(TCPl-Epsilon) ; CCT-epsilon (CCTE; CCT5) D43950 beta Crystallin Bl (CRYBB1) U35340 beta Crystallin B2 (CRYBB2) ; BP L10035 beta Crystallin B3 (CRYBB3; CRYB3) U71216 mitochondriales lOkDa Hitzeschock-Protein
(HSP10); lOkDa-Chaperonin (CPN10) ; HSPE1 U07550 Hitzeschock-Protein beta-3 (HSPB3) ; Hitze- schock-17kDa-Protein; HSPL27 U15590 wahrscheinlicher Protein Disulfid-Isomerase- P5-Präkursor D49489
90kDa-Hitzeschock-Proteinbeta (HSP90) ; 84kDa- Hitzeschock-Protein beta (HSP84); HSPCB M16660 mikrosomaler UDP-Glucuronosyltransferase-1-6- Präkursor (UDPGT; UGT1.6; UGT1F; GNTl) J04093
Glutathion-S-Transferase mu 3 (GSTM3) ; GST5 J05459 Cytochrom P450 1A1 (CYP1A1) ; P450-P1; P450 Form 6; P450-C K03191
Peroxisom Proliferator-aktivierter Rezeptor alpha (PPAR-alpha; PPARA) L02932
Protein-Disulfid-Isomerase-verwandter Protein- Präkursor (PDIR) D49490 Leber-Carboxylesterase-Präkursor; Acyl- coEnzym A: Cholesterol-Acyltransferase (ACAT) ; Monozyt/Makrophage-Serin-Esterase (hMSE) ; CES2 L07765 Serum-Paraoxonase/Arylesterase 3 (PON3) ; Serum- Aryldiakylphosphatase 3; aromatische Esterase 3 (A-Esterase 3) L48516 Cytochrom P450 XXIB (CYP21B) ; Steroid-21-Hydroxy- lase; CYP21A2 M12792; M23280
Cytochrom P450 IID6 (CYP2D6) ; P450-DB1; Debrisoquine-4-Hydroxylase M20403 mikrosomaler UDP-Glucuronosyltransferase-1-1- Präkursor (UDPGT; ÜGT1.1; UGT1A; GNTl); Bili- rubin-spezifisches Isozym 1 (hUG-BRl) M57899 mikrosomaler UDP-Glucuronosyltransferase-1-4- Präkursor (UDPGT; UGT1.4; UGTID; GNTl); Bili- rubinspezifisches Isozym 2 (hUG-BR2) M57951 Flavin-enthaltende Amin-Oxidase B (MAOB) ; Monoamin-Oxidase M69177 eukaryotische Peptid-Ketten-Release-Faktor- üntereinheit 1 (ERF1) ; TB3-1; CH Protein M75715 mikrosomaler UDP-Glucuronosyltransferase-1-3- Präkursor (UDPGT; UGT1.3; UGT1C; GNTl) M84127 Struktur-spezifisches Erkennungs-Protein 1 (SSRPl) ; Rekombinations-Signal-Sequenz- Erkennungs-Protein; T160 M86737 mikkrosomaler UDP-Glucuronosyltransferase-1-2- Präkursor (UDPGT; UGT1.2; UGTIB; GNTl); HLUGP4 S55985 Thiopurin-S-Methyltransferase (TPMT) S62904 meiotisches Rekombinations-Protein-DMC1/LIM15-
Homolog D63882
"short"/branched-chain"-spezifischer Acyl-CoA-
Dehydrogenase-Präkursor (SBCAD; ACADSB) ;
2-Methyl-"branched chain"-Acyl-CoA-Dehydrogenase
(2-MEBCAD) U12778
Cytochrom-P450-XIB1-Präkursor (CYPllBl) ;
Steroid-11-beta-Hydroxylase (SllBH) X55764
Cytochrom P450 IVA11 (CYP4A11) X71480
NADH-Cytochrom-B5-Reductase (B5R) ; DIA1 Y09501
Coproporphyrinogen-IH-Oxidase-Präkursor (CPO) ;
Coproporphyrinogenase; Coprogen-Oxidase (COX) Z28409
HOkDa-Hitzeschock-Protein (HSP110 ) ; 105kDa-
Hitzeschock-Protein (HSP105 ) ;
KIAA0201 D86956
Gamma Crystallin C (CRYGC; CRYG3;
Gamma Crystallin 2 + Gamma Crystallin B (CRYGB;
CRYG2); Gamma Crystallin 1-2 U66582 + M11971; M11970
Hitzeschock-Transkriptionsfaktor 4 (HHSF4) D87673 extrazellulärer Superoxid-Dismutase-Präkursor (EC-SOD; SOD3) J02947
DNAJ-Protein-Homolog 2 (DNAJ2; hDJ2; HSJ2) D13388 DNA "mismatch repair" Protein MSH3; divergentes Upstream-Protein (DUP) ; "Mismatch Repair"- Protein 1 (MRPl) J04810
Protein-Disulfid-Isomerase-verwandter Protein- ERP?2-Präkursor J05016
Replikations-Protein-A-32kDa-Untereinheit (RPA32); Replikations-Faktor A Protein 2 (REPA2; RPA2; RFA) J05249
Mehrfachresistenz-assoziiertes Protein 1 (MRPl) L05628 Calnexin-Präkursor (CANX) ;
Haupthistocompatibilitäts-Komplex Klasse I Antigen-bindendes Protein p88; IP90 L10284; L18887; M94859; M98452
Cyclophilin-40 (CYP40; CYPD); 40-kDa Peptidyl- Prolyl-cis-trans-Isomerase (PPIASE) ; Rotamase; Cyclophilin-verwandtes Protein L11667
Hitzeschock-70kDa-Protein 4 (HSPA4); HSP70RY; Hitzeschock-70-verwandtes Protein APG-2 L12723 T-Komplex-Protein-1-theta-Untereinheit (TCP1- theta); CCT-theta (CCTQ; CCT8); KIAA0002 D13627 mitochondrialer Stress-70-Protein-Präkursor; 75kDa Glucose-gesteuertes Protein (GRP75) ; Peptid-bindendes Protein 74 (PBP74); Mortalin (MOT) ; HSPA9B L15189 p23; 23-kDa Progesteron-Rezeptor-assoziiertes
Protein L24804; L24805
FLAP Endonuklease 1 (FENl) ; Maturations-Faktor 1 (MF1) L37374
FK506-bindendes Protein 12 (FKBP12) ; Peptidyl- Prolyl-cis-trans-Isomerase (PPIase); Rotamase M34539; M80199;
M92423; X55741; X52220 Hitzeschock-Faktor Protein 2 (HSF2) ; Hitzeschock-Transkriptionsfaktor 2 (HSTF2) M65217 3-Methyladenin DNA-Glycosylase (ADPG) ;
3-Alkyladenin DNA Glycosylase; N-Methylpurin-
DNA Glycosirase (MPG) M74905
Calreticulin-Präkursor (CRP55) ; Calregulin;
HACBP; ERP60; 52-kDa Ribonukleoprotein-Auto- antigen RO/SS-A M84739
Transformations-sensitives Protein IEF SSP 3521 M86752 alpha-Crystallin-B-Untereinheit (alpha (B) - Crystallin; CRYAB; CRYA2) ; Rosenthal-Faser- Komponente S45630 Hitzeschock-Protein beta 2 (HSPB2) ; DMPK- bindendes Protein; MKBP S67070 alpha Crystallin A-Kette (CRYAA; CRYA1) U05569
Nicotinamid N-Methyltransferase (NNMT) U08021
Phenol-sulfatierende Phenol-Sulfotransferase 1 (PPST1); thermostabile Phenol-Sulfotransferase
(TS-PST) ; HAST1/HAST2; ST1A3; STP1 + PPST2; ST1A2; STP2 + Monoamin-sulfatierende Phenol-
Sulfo-transferase U09031 + U28170
+ L19956 NADP+ Dihydropyrimidin-Dehydrogenase-Präkursor (DPD) ; Dihydrouracil-Dehydrogenase; Dihydro- thymin-Dehydrogenase (DPYD) U09178 transkriptioneller Regulator atrX; "X-Linked"- Helicase II (XH2) ; "X-linked"-Kern-Protein (XNP) ; RAD54L U09820
26S-Proteasom-Regulierungs-Untereinheit S2 (PSMD2) ; Tumor-Nekrose-Faktor-Typ-1-Rezeptor- assoziiertes Protein (TRAP2) ; 55.11 Protein U12596 Schädigungs-spezifisches DNA-bindendes Protein pl27 Untereinheit (DDBApl27); DDB1 U18299 T-Komplex-Protein-1-delta-Untereinheit (TCP1- delta) ; CCT-delta (CCTD; CCT4); Stimulator von RNA-bindendendem tar (SRB) U38846
7 , 8-Dihydro-8-Oxoguanin-Triphosphatase ( 8-Oxo- dGTPase); mutT-Homolog 1 (MTH1) D16581 150-kDa Sauerstoff-gesteuertes Protein ORP150 U65785 48-kDa FKBP-assoziiertes Protein (FAP48) U73704 T-Komplex-Protein-1-eta-Untereinheit (TCPl-eta) ; CCT-eta (CCTH; CCT7); HIV-1 NEF wechselwirkendes Protein U83843 Catalase (CAT) X04076
Porphobilinogen-Deaminase (PBGD) ; Hydroxymethyl- bilan-Synthase (HMBS) ; pre-Uroporphyrinogen- Synthase X04808
Mn+ Superoxid-Dismutase-2-Präkursor (SOD2) X07834; X59445 94kDa-Glukose-gesteuertes Protein (GRP94); Endoplasmin-Präkursor; GP96-Homolog; Tumor- Rejektions-Antigen 1 (TRA1) X15187; M33716 Uracil-DNA-Glycosylase 2 (UNG2) X52486 T-Komplex-Protein-1-alpha-Untereinheit (TCP1- alpha); CCT-alpha (CCTA; CCT1) X52882 4OS ribosomales Protein S3 (RPS3) X55715 47kDa-Hitzeschock-Protein-Präkursor; Collagenbindendes Protein 1 (CBP1) ; Colligin 1 + Collagen-bindendes Protein 2 (CBP2) X61598 + D83174 T-Koruplex-Protein-1-gamma-Untereinheit (TCPl-gamma) ; CCT-gamma (CCTG; CCT3) ; TRIC5 X74801; U17104 Transkriptionsfaktor HH (TFIIH) ; 52-kDa- "basic"-Transkriptionsfaktor-2-Untereinheit (BTF2p52) Y07595
"x-ray repair cross-complementing Protein 2" (XRCC2) Y08837 8-Oxyguanin-DNA-Glycosylase 1 (OGG1) ; mutM-
Homolog (MMH) Y11838
"34-kDa Basic"-Transkriptionsfaktor-2-Unter- einheit (BTF2p34) Z30093
N-Oxide-bildende Dimethylanilin-Monooxy- genäse 5; hepatische Flavin-enthaltende Monooxygenase 5 (FM05); Dimethylanilin Oxidase 5 L37080 Ubiquitin-artiges Protein NEDD8 D23662
Mehrfachresistenz-Protein 3 (MDR3) ; P-Glyco- protein 3 (PGY3) M23234 Ubiqitin-konjugierendes Enzym E2-17-kDa (UBE2B) ; Ubiquitin-Protein-Ligase; Ubiquitin-Träger- Protein; HR6B M74525 p59-Protein; HSP-bindendes Immunophilin (HBI) ; wahrscheinliche Peptidyl-Prolyl-cis-trans- Isomerase (PPIase); Rotamase; 52kDa-FK506- bindendes Protein (FKBP52) ; FKBP59; HSP56; FKBP4 M88279
Hitzeschock-Protein-40-Homolog (HSP40 homolog) ; DNAJW U40992 51kDa-FK506-bindendes Protein (FKBP51) ; Peptidyl- Prolyl-cis-trans-Isomerase (PPIase) ; Rotamase; 54kDa-Progesteron-Rezeptor-assoziiertes Immunophilin; FKBP54; FFl-Antigen; HSP90-bindendes Immunophilin U42031 hämatopoietische Progenitor-Kinase (HPK1) U66464 SPSl/Ste20-Homolog KHS1 U77129
Leber-Glyceraldehyde-3-Phosphat-Dehydrogenase (GAPDH; G3PDH) X01677
Gehirn-spezifische Tubulin-alpha-1-Untereinheit (TUBA1) K00558
HLA Klasse I Histokompatibilitäts-Antigen-C-4- alpha-Untereinheit (HLAC) M11886
Cytoplasmisches beta-Aktin (ACTB) X00351
"23kDa highly basic"-Protein; 60S ribosomales Protein L13A (RPL13A) X56932
40S ribosomales Protein S9 U14971
Ubiquitin M26880
Phospholipase A2 M86400 Hypoxanthin-Guanin-Phosphoribosyltransferase
(HPRT) V00530
3. Ein Verfahren zur toxikologischen Diagnostik nach Anspruch 1, dadurch gekennzeichnet, dass der Methylie- rungszustand oder das Methylierungsmuster von im wesentlichen allen der im Anspruch 2 aufgeführten Genen untersucht wird.
4. Verfahren nach Anspruch 1 dadurch gekennzeichnet, dass ein Satz von Genen auf Methylierung untersucht wird, in dem bis zu 25% der in Anspruch 2 aufgeführten Gene nicht enthalten sind.
5. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass mindestens 95% der in Anspruch 2 aufgeführten
Gene zusammen mit einer begrenzten Anzahl zusätzlicher nicht aufgeführter Gene auf ihren Methylierungszustand oder ihr Methylierungsmuster untersucht werden.
Verfahren nach Anspruch 1, dadurch gekennzeichent, dass bis zu 25 % der aufgeführten Gene durch einen kompletten Satz anderer nicht aufgeführter Gene ersetzt sind.
7. Verfahren nach Anspruch 1 für einen Satz von Genen gemäß einem oder mehrerer der Ansprüche 1-6, in welcher die chemisch vorbehandelte DNA Sequenz der nachzuweisenden Gene mindestens zu 95% mit der entspre- chend vorbehandelten DNA Sequenz der Gene aus obiger Liste übereinstimmt.
8. Das Verfahren zur toxikologoschen Diagnostik nach einem der Ansprüche 1-7, dadurch gekennzeichnet, dass man folgende Schritte durchführt: a) einem Lebewesen oder einer Zellkultur wird eine Probe entnommen, die die DNA besagten Lebewesens oder besagter Zellkultur enthält; b) in einer Probe, die genomische DNA enthält, wandelt man durch chemische Behandlung an der 5-Position un- methylierte Cytosinbasen in Uracil oder Thymidin um, wobei an der 5-Position methylierte Cytosinbasen unverändert bleiben; c) aus dieser chemisch vorbehandelten genomischen DNA amplifiziert man Fragmente; d) die amplifizierten Fragmente werden an (Sonden-) Oli- gonukleotide oder PNA Oligomere hybridisiert; e) der Methylierungszustand oder das Methylierungsmuster wird aus dem Hybridisierungsverhalten der amplifizierten Fragmente abgeleitet; f) durch Abgleich mit Daten aus Methylierungszustanden anderer Proben wird auf die Einwirkung einer Substanz auf das Lebewesen oder die Zellkultur geschlossen und/oder die Einwirkung dieser Substanz auf das Lebewesen oder die Zellkultur im Vergleich zu anderen Substanzen in toxikologischer Hinsicht verglichen.
9. Verfahren nach Anspruch 8, dadurch gekennzeichnet, dass die chemische Behandlung mit der Lösung eines Bisulfits (=Disulfit, Hydrogensulfit) erfolgt.
10. Verfahren nach Anspruch 8, dadurch gekennzeichnet, dass die A plifizierung mittels der Polymeraseketten- reaktion (PCR) durchgeführt wird.
11. Verfahren nach Anspruch 10, dadurch gekennzeichnet, dass Sätze von Primeroligonukleotiden umfassend min- destens zwei Oligonukleotide zur Amplifizieurng verwendet werden, deren Sequenzen jeweils mindestens 18 Basenpaare lange Abschnitte der nach chemischer Modifikation erhaltenen Nukleinsäure Sequenzen der in An- spruch 2 aufgeführten Gene entsprechen oder zu ihnen komplementär sind.
12. Verfahren nach Anspruch 10 oder 11, dadurch gekennzeichnet, dass Sätze von Primeroligonukleotiden ver- wendet werden, die identifizierbare Markierungen enthalten.
13. Verfahren nach Anspruch 12, dadurch gekennzeichnet, dass die Markierungen der Primeroligonukleotide Fluo- reszenzmarkierungen sind.
14. Verfahren nach Anspruch 12, dadurch gekennzeichnet, dass die Markierungen der Primeroligonukleotide Radionuklide sind.
15. Verfahren nach Anspruch 12, dadurch gekennzeichnet, dass die Markierungen der Primeroligonukleotide ablösbare" Molekülfragmente mit typischer Masse sind, die in einem Massenspektrometer nachgewiesen werden können.
16. Verfahren nach Anspruch 8 adurch gekennzeichnet, dass die hybridisierten Amplifikate, Fragmente der Amplifikate oder zu den Amplifikaten komplementäre Sonden im Massenspektrometer nachgewiesen werden.
17. Verfahren nach Anspruch 15 oder 16 dadurch gekennzeichnet, dass zur besseren Detektierbarkeit im Massenspektrometer die erzeugten Fragmente eine einzelne positive oder negative Nettoladung aufweisen.
18. Verfahren nach einem der Ansprüche 8-17, dadurch gekennzeichnet, dass die (Sonden-) Oligonukleotide oder PNA Oligomere nach Anspruch 8 d) mehrheitlich
- identisch oder komplementär zu einem mindestens 9 Nukleotide langen Sequenzabschnitt mindestens eines der Gene nach Anspruch 2 sind, wie er nach der chemischen Modifizierung gemäss Anspruch 8 voliegt und- mindestens ein CG oder TG Dinukleotid enthalten.
19. Verfahren nach Anspruch 18 dadurch gekennzeichnet, dass Oligonukleotide verwendet werden, bei denen das Cytosin des CpG Dinukleotids oder das Thymin des TpG Dinukleotids das 5. - 9. Nukleotid vom 5-Ende des 13 mers ist.
20. Verfahren nach Anspruch 18 dadurch gekennzeichnet, dass PNA Oligomere verwendet werden, bei denen das Cytosin des CpG Dinukleotids oder das Thymin des TpG Dinukleotids das 4. - 6. Nukleotid vom 5-Ende des 9 mers ist.
21. Verfahren nach Anspruch 8, dadurch gekennzeichnet, dass mehr als zehn unterschiedliche Fragmente ampli- fiziert werden und mit dem gleichen Satz von Sondeno- ligonukleotiden nach einem der Ansprüche 18 bis 20 untersucht werden.
22. Verfahren nach Anspruch 8, dadurch gekennzeichnet, dass die Sondenoligonukleotide oder PNA-Oligomere an definierten Stellen an eine Festphase gebunden sind.
23. Verfahren nach Anspruch 22, dadurch gekennzeichnet, dass unterschiedliche Detektionsoligonukleotide und/oder PNA-Oligomersequenzen auf einer ebenen Fest- phase in Form eines rechtwinkligen oder hexagonalen Gitters angeordnet sind.
24. Verfahren nach Anspruch 22 oder 23 dadurch gekenn- zeichnet, dass die an den Amplifikaten angebrachten Markierungen an jeder Position der Festphase, an der sich ein Oligonukleotid befindet, identifizierbar sind.
25. Verfahren nach einem der Ansprüche 22-24 dadurch gekennzeichnet, dass die Festphasenoberfläche aus Silizium, Glas, Polystyrol, Aluminium, Stahl, Eisen, Kupfer, Nickel, Silber oder Gold besteht.
26. Verfahren nach einem der voranstehenden Ansprüche, wobei die genomische DNA aus einer DNA enthaltenden Probe gewonnen wird, wobei Quellen für DNA z.B. Zelllinien, Biopsien, Blut, Sputum, Stuhl, Urin, Gehirn- Rückenmarks-Flüssigkeit, in Paraffin eingebettetes Gewebe, beispielsweise Gewebe von Augen, Darm, Niere, Hirn, Herz, Prostata, Lunge, Brust oder Leber, histo- logische Objektträger und alle möglichen Kombinationen hiervon umfasst.
27. Verfahren nach einem der voranstehenden Ansprüche zur Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individuen, wobei diese nachteiligen Ereignisse im Zusammenhang mit mit der Diagnose toxikologisch bedeutender Parameter stehen.
28. Verwendung eines Verfahrens nach einem der voranstehenden Ansprüche zur Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individu- en, wobei diese nachteiligen Ereignisse im Zusammen- hang mit der Diagnose toxikologisch bedeutender Parameter stehen.
29. Kit enthaltend a) eine chemische Substanz zur Modifizierung von Cytosinbasen; b) Primeroligonukleotide zur Amplifizierung der modifizierten Nukleinsäuren; c) Sondenoligonukleotide oder PNA Oligomere; und optional d) eine Anleitung zur Durchführung eines Verfahrens gemäß einem der voranstehenden Ansprüche; e) eine Kontroll-Nukleinsäure mit bekanntem Methylierungszustand oder Methylierungsmuster.
EP01996625A 2000-11-14 2001-11-08 Verfahren zur detektion von methylierungszuständen zur toxikologischen diagnostik Withdrawn EP1337668A2 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE10056802A DE10056802B4 (de) 2000-11-14 2000-11-14 Verfahren zur Detektion von Methylierungszuständen zur toxikologischen Diagnostik
DE10056802 2000-11-14
PCT/EP2001/012951 WO2002040710A2 (de) 2000-11-14 2001-11-08 Verfahren zur detektion von methylierungszuständen zur toxikologischen diagnostik

Publications (1)

Publication Number Publication Date
EP1337668A2 true EP1337668A2 (de) 2003-08-27

Family

ID=7663517

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01996625A Withdrawn EP1337668A2 (de) 2000-11-14 2001-11-08 Verfahren zur detektion von methylierungszuständen zur toxikologischen diagnostik

Country Status (6)

Country Link
US (1) US20040048279A1 (de)
EP (1) EP1337668A2 (de)
JP (1) JP2004513650A (de)
AU (1) AU2002223672A1 (de)
DE (1) DE10056802B4 (de)
WO (1) WO2002040710A2 (de)

Families Citing this family (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10128508A1 (de) * 2001-06-14 2003-02-06 Epigenomics Ag Verfahren und Nukleinsäuren für die Differenzierung von Prostata-Tumoren
GB0215509D0 (en) * 2002-07-04 2002-08-14 Novartis Ag Marker genes
EP1428889A1 (de) * 2002-12-10 2004-06-16 Epigenomics AG Methode der Überwachung des Übergangs einer Zelle von einem Zustand in einen Anderen
US8415100B2 (en) 2003-08-14 2013-04-09 Case Western Reserve University Methods and compositions for detecting gastrointestinal and other cancers
EP1660683B1 (de) * 2003-08-14 2017-04-19 Case Western Reserve University Verfahren und zusammensetzungen zum nachweis von kolonkarzinomen
US20090264302A1 (en) * 2006-11-01 2009-10-22 Achim Plum Methods, systems and computer program products for determining treatment response biomarkers
JP5211790B2 (ja) * 2007-03-26 2013-06-12 住友化学株式会社 Dnaメチル化測定方法
WO2010037001A2 (en) 2008-09-26 2010-04-01 Immune Disease Institute, Inc. Selective oxidation of 5-methylcytosine by tet-family proteins
DE102010031354B3 (de) 2010-07-14 2012-02-02 Technische Universität Dresden Mittel und Verfahren zur Diagnostik, Prognose und Therapiekontrolle von Tumorerkrankungen
ES2669214T3 (es) 2011-12-13 2018-05-24 Oslo Universitetssykehus Hf Procedimientos y kits para la detección de estado de metilación
ES2786984T3 (es) 2012-11-30 2020-10-14 Cambridge Epigenetix Ltd Agente oxidante para nucleótidos modificados
KR101302173B1 (ko) 2012-12-07 2013-08-30 이화여자대학교 산학협력단 Hmox1 유전자의 메틸화 변화를 이용한 알츠하이머 질환의 진단용 조성물 및 이를 이용한 알츠하이머 질환의 진단방법
US9169509B2 (en) 2013-01-15 2015-10-27 Board Of Regents, The University Of Texas System Topoisomerase 2b as a predictor of susceptibility to anthracycline-induced cardiotoxicity
US20160039877A1 (en) 2013-03-15 2016-02-11 Shenzhen Hightide Biopharmaceutical, Ltd. Compositions and methods of using islet neogenesis peptides and analogs thereof
JP2016523125A (ja) 2013-05-30 2016-08-08 グラハム エイチ. クリーシー 局所神経性刺激
US11229789B2 (en) 2013-05-30 2022-01-25 Neurostim Oab, Inc. Neuro activator with controller
US20160281128A1 (en) * 2013-11-08 2016-09-29 Veterinary Diagnostics Institute, Inc. Method and apparatus for detecting vector-borne diseases in mammals
US11077301B2 (en) 2015-02-21 2021-08-03 NeurostimOAB, Inc. Topical nerve stimulator and sensor for bladder control
WO2017059245A2 (en) 2015-09-30 2017-04-06 Trustees Of Boston University Deadman and passcode microbial kill switches
CN107177679A (zh) * 2017-06-07 2017-09-19 北京呈诺医学科技有限公司 一种检测食管鳞癌相关基因tfpi2和hspb2启动子甲基化程度的试剂盒
US10953225B2 (en) 2017-11-07 2021-03-23 Neurostim Oab, Inc. Non-invasive nerve activator with adaptive circuit
WO2020264214A1 (en) 2019-06-26 2020-12-30 Neurostim Technologies Llc Non-invasive nerve activator with adaptive circuit
WO2021055670A1 (en) 2019-09-20 2021-03-25 Avx Corporation Somatic cell-based electrical biosensor
WO2021126921A1 (en) 2019-12-16 2021-06-24 Neurostim Solutions, Llc Non-invasive nerve activator with boosted charge delivery
CA3187549A1 (en) 2020-07-30 2022-02-03 Cambridge Epigenetix Limited Compositions and methods for nucleic acid analysis
CN114878840A (zh) * 2022-07-12 2022-08-09 昆明思安生物科技有限公司 磁微粒化学发光测定三碘甲状腺原氨酸试剂盒及检测方法
CN118685521A (zh) * 2024-08-26 2024-09-24 湖南宏雅基因技术有限公司 一种用于前列腺癌检测的引物探针组合物及其应用

Family Cites Families (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4532204A (en) * 1982-07-19 1985-07-30 Massachusetts Institute Of Technology Mutation assays involving blood cells that metabolize toxic substances
US6020139A (en) * 1995-04-25 2000-02-01 Oridigm Corporation S-adenosyl methionine regulation of metabolic pathways and its use in diagnosis and therapy
US6017704A (en) * 1996-06-03 2000-01-25 The Johns Hopkins University School Of Medicine Method of detection of methylated nucleic acid using agents which modify unmethylated cytosine and distinguishing modified methylated and non-methylated nucleic acids
DE19754482A1 (de) * 1997-11-27 1999-07-01 Epigenomics Gmbh Verfahren zur Herstellung komplexer DNA-Methylierungs-Fingerabdrücke
US6074831A (en) * 1998-07-09 2000-06-13 Agilent Technologies, Inc. Partitioning of polymorphic DNAs
US6143504A (en) * 1998-10-27 2000-11-07 Arch Development Corporation Methods and compositions for the diagnosis of fragile X syndrome
DE19905082C1 (de) * 1999-01-29 2000-05-18 Epigenomics Gmbh Verfahren zur Identifikation von Cytosin-Methylierungsmustern in genomischen DNA-Proben
US6331393B1 (en) * 1999-05-14 2001-12-18 University Of Southern California Process for high-throughput DNA methylation analysis
DE19935772C2 (de) * 1999-07-26 2002-11-07 Epigenomics Ag Verfahren zur relativen Quantifizierung der Methylierung von Cytosin Basen in DNA-Proben
WO2001073060A2 (en) * 2000-03-24 2001-10-04 Millennium Pharmaceuticals, Inc. 18221, dual specificity phosphatase and uses thereof
US6451588B1 (en) * 2000-06-30 2002-09-17 Pe Corporation (Ny) Multipartite high-affinity nucleic acid probes
JP2004512050A (ja) * 2000-10-23 2004-04-22 キャンサー・リサーチ・テクノロジー・リミテッド 核酸の増幅およびプロファイリングに関連する物質および方法

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0240710A2 *

Also Published As

Publication number Publication date
AU2002223672A1 (en) 2002-05-27
DE10056802B4 (de) 2005-06-16
JP2004513650A (ja) 2004-05-13
WO2002040710A2 (de) 2002-05-23
DE10056802A1 (de) 2002-05-29
US20040048279A1 (en) 2004-03-11
WO2002040710A3 (de) 2003-05-30

Similar Documents

Publication Publication Date Title
WO2002040710A2 (de) Verfahren zur detektion von methylierungszuständen zur toxikologischen diagnostik
EP2504451B1 (de) Verfahren zur vorhersage des klinischen verlaufs von krebs
Ohmine et al. Characterization of stage progression in chronic myeloid leukemia by DNA microarray with purified hematopoietic stem cells
Wan et al. Large-scale cDNA transfection screening for genes related to cancer development and progression
EP3654993A1 (de) Zellatlas des gesunden menschlichen dickdarms und menschlichen dickdarms mit colitis ulcerosa
EP1278892A1 (de) Detektion von variationen des dna-methylierungsprofils
EP2767595A1 (de) Nachweisverfahren
EP3770274A1 (de) Systeme und verfahren zur diagnose von idiopathischer pulmonaler fibrose auf transbronchialen biopsien mit maschinellem lernen und hochdimensionalen transkriptionsdaten
WO2004108899A2 (en) Pni microarray and uses
US20220081721A1 (en) Characterization of bone marrow using cell-free messenger-rna
KR20120079295A (ko) 초기유방암의 예후 예측용 유전자 및 이를 이용한 초기유방암의 예후예측 방법
EP4514995A1 (de) Transkriptomanalyse zur behandlung von entzündungen
US20100298160A1 (en) Method and tools for prognosis of cancer in er-patients
Pathak et al. Repetitive DNA: A tool to explore animal genomes/transcriptomes
US20020009730A1 (en) Human stress array
EP2710147A1 (de) Molekulare analyse von akuter myeloischer leukämie
Zufferey et al. Epigenetics and methylation in the rheumatic diseases
EP1683862A1 (de) Mikroarray zur beurteilung der neuroblastomprognose und verfahren zur beurteilung der neuroblastomprognose
US20220044764A1 (en) Treatment of cancer by risk stratification of patients based on comordidities
US20240401149A1 (en) Treatment of cancer by risk stratification of patients based on comorbidities
EP4662332A2 (de) Verfahren zur identifizierung von nierenallotransplantatabstossungsgenen im urin und verwendung für diese messungen
Mathiyazhagan et al. Indonesian Journal of Biotechnology
CN116334178A (zh) 一种用于提高扩增子文库均一性的文库构建方法
EP4634398A1 (de) Verfahren zur genauen quantifizierung von nichtcodierenden rnas in geringen mengen
Pereira Assessement of Postmortem Intervals Using DNA Methylation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030428

AK Designated contracting states

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

17Q First examination report despatched

Effective date: 20031219

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: EPIGENOMICS AG

17Q First examination report despatched

Effective date: 20031219

APBK Appeal reference recorded

Free format text: ORIGINAL CODE: EPIDOSNREFNE

APBN Date of receipt of notice of appeal recorded

Free format text: ORIGINAL CODE: EPIDOSNNOA2E

APBR Date of receipt of statement of grounds of appeal recorded

Free format text: ORIGINAL CODE: EPIDOSNNOA3E

APAV Appeal reference deleted

Free format text: ORIGINAL CODE: EPIDOSDREFNE

APAF Appeal reference modified

Free format text: ORIGINAL CODE: EPIDOSCREFNE

APBT Appeal procedure closed

Free format text: ORIGINAL CODE: EPIDOSNNOA9E

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20110224