EP1317556A1 - Fusionsprotein aus antikörper-zytokin-zytokin inhibitor (selektokin) als zielspezifisches prodrug - Google Patents

Fusionsprotein aus antikörper-zytokin-zytokin inhibitor (selektokin) als zielspezifisches prodrug

Info

Publication number
EP1317556A1
EP1317556A1 EP01974261A EP01974261A EP1317556A1 EP 1317556 A1 EP1317556 A1 EP 1317556A1 EP 01974261 A EP01974261 A EP 01974261A EP 01974261 A EP01974261 A EP 01974261A EP 1317556 A1 EP1317556 A1 EP 1317556A1
Authority
EP
European Patent Office
Prior art keywords
region
polypeptide according
tnf
seq
polypeptide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01974261A
Other languages
English (en)
French (fr)
Inventor
Klaus Pfizenmaier
Thomas Wüst
Dieter Moosmayer
Matthias Grell
Peter Scheurich
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Universitaet Stuttgart
Original Assignee
Universitaet Stuttgart
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universitaet Stuttgart filed Critical Universitaet Stuttgart
Publication of EP1317556A1 publication Critical patent/EP1317556A1/de
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6849—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site the antibody targeting a receptor, a cell surface antigen or a cell surface determinant
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/525—Tumour necrosis factor [TNF]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7151—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for tumor necrosis factor [TNF], for lymphotoxin [LT]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • the present invention relates to a polypeptide with preferably antitumor and / or immunomodulating cytokine properties, which can be activated by processing in vivo, comprising a central region with specific biological activity, at the C-terminal end of which there is a region with a processing unit and an inhibitor domain, while there is a region at the N-terminal end of the central region which selectively recognizes a macromolecule on a cell surface or a component of the extracellular matrix.
  • tumor necrosis factor and other active substances for the treatment of, for example, tumor diseases has hitherto only been possible under very limited treatment protocols (for example by means of "isolated limb perfusion") because of the strong systemic side effects which are to be regarded as therapy-limiting Indications (melanoma / sarcoma metastases of the extremities) can be carried out successfully. From these clinical data it can be estimated that a 10 to 100 times higher TNF dose than the MTD (“Maximum Tolerated Dose”) would be required for the anti-tumor efficacy than the massive systemic side effects would allow.
  • the present invention is therefore based on the object of avoiding or reducing the undesirable consequences of treatment with therapeutically active polypeptide active substances, such as TNF-containing substances, while at the same time maintaining the therapeutically active, for example antitumor, properties of the active substance, such as TNF or even be reinforced.
  • therapeutically active polypeptide active substances such as TNF-containing substances
  • therapeutically active for example antitumor, properties of the active substance, such as TNF or even be reinforced.
  • polypeptide with an amino acid sequence comprising from N- to C-terminal
  • the polypeptide according to the invention is a modular active substance, according to a particularly preferred embodiment a preferably homotrimeric fusion protein with a cytokine, preferably TNF or a biologically active derivative or a biologically active mutant thereof, as an antitumor substance or region (3), which releases its biological effect in a targeted manner in the diseased tissue, for example a tumor area, by linking with four further functional modules.
  • a cytokine preferably TNF or a biologically active derivative or a biologically active mutant thereof
  • the N-terminal linkage of the therapeutically active substance for example the TNF molecule
  • a targeting module (1) specific for the target tissue for example tumor-specific antibodies or derivatives thereof, such as scFv antibodies
  • an inhibitor (5) against the therapeutically active substance in particular a peptide inhibitor, which is selectively inactivated in the target tissue, such as the tumor area, by processing the domain (4), preferably removed from the fusion protein by targeted proteolytic cleavage, and so on bioactive agent bound to the selective targeting module, for example TNF, is formed.
  • a peptide linker domain (2) is located between the targeting module (eg the scFv antibody fragment) and the module with therapeutic function (eg TNF) Trimerization domain, which ensures the formation of covalent disulfide bridges and thus a regular and stable homotrimerization of the fusion protein
  • the construct according to the invention it is possible to locally high active concentrations of the therapeutically active substance, e.g. of the TNF, without resulting in systemically elevated therapeutic levels (e.g. TNF in the serum) and thus therapy-limiting side effects.
  • the targeting module e.g. antibody
  • the targeting module mediated presentation of the locally activated TNF achieves an effect which corresponds to that of the natural membrane TNF, i.e. both types of TNF receptors are co-activated, thus potentiating the anti-tumor properties of TNF.
  • the polypeptide (selectokine) provides a novel prodrug technology and is a construct which, according to a preferred embodiment, comprises a recombinant, homotrimeric fusion protein which in principle comprises a defined sequence of the following structural elements (in the monomer) (N-terminal to C-terminal): (1) a murine, humanized or human single chain antibody question ent (scFv) of defined antigen specificity consisting of VH linker VL; (2) a peptide linker with intrinsic trimerization properties; (3) a TNF molecule which corresponds, for example, to the wild-type TNF or the extracellular domain of TNF (mature 17 kDa form, AA 1-157, Swissprot # P01375) or biologically active variants derived therefrom; (4) a variable linker peptide with specific protease cleavage sites, (5) a specific TNF-binding protein or peptide.
  • structural elements in the monomer
  • scFv human single chain antibody question
  • the targeting module (1) is preferably specific for a cell surface molecule which is expressed in tumor lesions and / or proliferating endothelial cells which are associated with the process of angiogenesis. According to another preferred embodiment, the targeting module (1) is specific for a component of the extracellular matrix that is present in tumor lesions and / or angiogenic areas of pathological lesions. According to a further preferred embodiment, the targeting module (1) is specific for a component of the malignant tumor cell itself.
  • the region or the module (1) preferably comprises an antibody (for example murine, humanized or human) or a fragment thereof, for example a Fab fragment or a typical single-chain antibody fragment (scFv) murine produced according to the prior art, by CDR- Grafting of humanized or completely human origin with specificity for an antigen which is preferably selectively or dominantly expressed in the tumor tissue, for example, which can in principle be expressed on the malignant cells themselves, but preferably in the non-malignant portion of the tumor, the stromal cells or the tumor endothelium becomes.
  • an antibody for example murine, humanized or human
  • a fragment thereof for example a Fab fragment or a typical single-chain antibody fragment (scFv) murine produced according to the prior art, by CDR- Grafting of humanized or completely human origin with specificity for an antigen which is preferably selectively or dominantly expressed in the tumor tissue, for example, which can in principle be expressed on the malignant cells themselves, but preferably in the non-malignant portion of the tumor,
  • Such antigens of non-malignant tissue parts of a solid tumor are on the one hand genetically invariant, on the other hand they occur in a wide variety of tumor entities and are therefore universal tumor markers.
  • the VEGFR or VEGFR VEGF complex as an example for receptor-ligand complexes
  • the Integ ⁇ n avß3 the endosialin and the fibronectin isoform bFn as selective target structures of the tumor endothelium
  • FAP fibroblast activation protein
  • Other examples of suitable targeting modules are peptides, artificial antibodies and Spiegelmers.
  • the peptide linker region (2) is preferably a trimerization module and connects the targeting region (1) with the therapeutically active region (3).
  • the trimerization module comprises a naturally occurring or synthetic peptide with intrinsic trimerization properties.
  • a particularly suitable example of such a peptide is a domain of the tenascin molecule (AA 110-139, Swissprot # P10039, (Chicken) or Swissprot # P24821 (human)). It establishes the connection between the targeting module (1) (eg scFv) and the therapeutic agent (3) (eg TNF) and at the same time ensures the covalent, homotrimeric linkage of the fusion protein during biogenesis.
  • the therapeutically active module (3) preferably contains an amino acid sequence of a cytokine or a therapeutically active fragment thereof.
  • Region (3) preferably contains the amino acid sequence of TNF, more preferably a TNF precursor protein and most preferably of a protein identical to the processed, mature wild-type TNF molecule (AA 1-157, Swissprot # P01375), or derivatives derived therefrom or mutants with selective receptor binding properties or mutants or derivatives which have been optimized with regard to their specific bioactivity or other properties (stability, protease resistance).
  • the processing module (4) is, for example, protease-sensitive (ie the processing site corresponds to the recognition sequence of a protease) and is preferably of an amino acid composition and overall length such that it allows the fusion protein to be homotrimerized by the trimerization module and TNF itself, but at the same time also has a high affinity, stable binding of the TNF inhibitor located in the C-terminal molecule (eg the extracellular TNF receptor domain) to the TNF portion is permitted, thereby preventing the binding of the TNF module to cell-expressed TNF receptors.
  • the linker is preferably such that it contains at least one, preferably several, selective cleavage sites for such extracellular or cell-associated proteases, which are preferably detected selectively in the tumor tissue.
  • Suitable cleavage sites are those for urokinase-type plasminogen activator (uPA), tissue plasminogen activator (tPA), the activated coagulation factor VIIa, matrix metalloproteases, such as MMP-2 and MMP-9, and for the highly selective expression of the membrane in the stroma of tumors FAP protease.
  • uPA urokinase-type plasminogen activator
  • tPA tissue plasminogen activator
  • matrix metalloproteases such as MMP-2 and MMP-9
  • MMP-9 matrix metalloproteases
  • the structure of the linker is chosen such that the protease recognition sequence is freely accessible, ie effective processing by specific proteases is possible, and after cleavage of the fusion protein, amino acids of the linker that may remain on the TNF molecule do not negatively influence the bioactivity of the therapeutically active region ,
  • the inhibitor module (5) is a receptor for a cytokine or a fragment thereof. Furthermore, the inhibitor module preferably has at least one binding site for the therapeutically active region (3). Preferably, in the case of using TNF in region (3), the inhibitor module comprises the complete or partial extracellular domain of a human TNF receptor, e.g. of the hu TNFR1 (synomym p55 / 60TNFR; Swissprot # P19438, AA 1-190; or fragments of this molecule, for example AA 1-157 or AA 60-120).
  • hu TNFR1 e.g. of the hu TNFR1 (synomym p55 / 60TNFR; Swissprot # P19438, AA 1-190; or fragments of this molecule, for example AA 1-157 or AA 60-120).
  • TNF TNF binding proteins
  • huTNFR2 extracellular domain of huTNFR2
  • proteins of viral origin such as e.g. the T2 protein, as well as synthetic peptides derived therefrom, which have TNF binding properties and interfere with TNF binding to TNF receptors which are located in the cell membrane
  • the fusion protein according to the invention is biologically inactive in this state, i.e. it is in the Proform (Prodrug).
  • the polypeptide according to the invention can comprise further domains.
  • suitable labeling sequences can be added to simplify the purification of the recombinantly produced protein and the in vitro analysis.
  • a myc-hise tag derived from the vector POPE can be added to the region (5), preferably the TNFR fragment, at the C-terminal. Further labeling sequences are known to a person skilled in the art.
  • the TNF selectokine preferred according to the invention is a covalently linked, homotrimeric molecule, consisting of the fusion of three functional domains explained in detail above, the tumor-specific antibody module, TNF and the blocking TNF binding protein (extracellular receptor domain or peptide derived therefrom) and functional linkers in between Trimerization properties or specific protease cleavage sites, which is inactive in this complete state with regard to the TNF effect.
  • the selectokin is initially specifically enriched by the antibody portion in the tumor area and processed there by the proteases formed by the tumor itself or the reactive tumor stroma / tumor vascular system (eg FAP, uPA, tPA, MMP2, factor VIIa), ie the inhibitory one Peptide (5) is split off.
  • the TNFR fragment / inhibitor peptide dissociates from the trimeric TNF molecule, the latter thus becoming bioactive (ie the biological activity of the region is released by processing the processing site in Reion (4)).
  • the TNF processed in this way now binds preferentially to cellular TNF receptors, since these, as homomultimeric molecules, have a substantially higher affinity than the monomeric, soluble receptor fragments.
  • the selectivity of the TNF effect is thus achieved with the selectokin according to the invention by two measures: on the one hand via the scFv-mediated selective enrichment of the inactive prodrug in the tumor and its retention even after proteolytic activation, and on the other hand via the site-specific conversion of the prodrug by proteases, which exclusively or preferably can be detected in the tumor area in significant activity.
  • scFv-mediated fixation of the TNF shifts the dissociation equilibrium at the TNFR2 towards a more stable binding, thereby achieving its activation. It is known that the simultaneous activation of both TNFRs leads to a cooperative signaling mechanism and the resulting increased cellular reactions, in particular the activation of endothelial cells and the induction of apoptosis in tumor cells are resistant to conventionally used (soluble) TNF.
  • polypeptide according to the invention have the amino acid sequences shown in FIGS. 1 (SEQ ID NO 1) and 5 (SEQ ID NO 3).
  • the present invention further relates to a nucleic acid comprising a nucleotide sequence which codes for the polypeptide according to the invention.
  • nucleic acid means a native, semi-synthetic, synthetic or modified nucleic acid molecule made from deoxyribonucleotides and / or ribonucleotides and / or modified nucleotides.
  • Preferred embodiments of the nucleic acid according to the invention contain the nucleotide sequence shown in FIG. 1 (SEQ ID NO 2) and FIG. 5 (SEQ ID NO 4).
  • a vector containing the nucleic acid defined above is provided.
  • the vector is preferably capable of expression and / or amplification in a prokaryotic and / or eukaryotic cell.
  • the vector preferably contains suitable regulatory elements, such as promoters, enhancers, termination sequences, etc.
  • the vector can also be used for the stable integration of the nucleic acid according to the invention into the genetic material of a host cell.
  • Another object of the invention relates to a host cell containing the above nucleic acid and / or the above vector.
  • Suitable host cells are, for example, all mammalian cells, such as COS or CHO cells.
  • the present invention also provides a method for producing the polypeptide of the invention comprising the steps
  • the polypeptide according to the invention is preferably produced by expression with the aid of suitable expression systems, preferably stable, selectable transfectants of the Zeil line CHO DG44, or after transient expression in COS7 cells.
  • suitable expression systems preferably stable, selectable transfectants of the Zeil line CHO DG44, or after transient expression in COS7 cells.
  • Other state-of-the-art eukaryotic expression systems for example Pichia pastoris, insect or mammalian cells, with the expression vectors suitable for the respective cell system for secretion, for example as in Brooks et al. (Immunotechnology 3: 173-184, 1997) for mammals and insect cells.
  • pPICZalpha vectors for expression and secretion in the yeast Pichia pastoris are also suitable.
  • polypeptide according to the invention, the nucleic acid and / or the vector can advantageously be used for the production of pharmaceutical compositions for the treatment of pathological disorders.
  • a further embodiment of the present invention therefore relates to a pharmaceutical composition containing, in pharmaceutically effective amount, the polypeptide according to the invention and / or the nucleic acid according to the invention and / or the vector according to the invention, optionally in conjunction with one or more pharmaceutically acceptable auxiliaries, diluents and / or carriers.
  • the pharmaceutical composition is preferably used for the therapeutic treatment of cancer and / or infectious diseases and / or metabolic diseases. Particularly preferred areas of application for the pharmaceutical composition are the treatment of solid tumors and angiogenesis in pathological lesions.
  • the pharmaceutical composition of the invention may take any form known to be suitable in the art. It is preferably solid, liquid or aerosol-like.
  • the present invention thus also includes a treatment method which includes the administration of a therapeutically sufficient amount of the pharmaceutical composition according to the invention to a patient in need of treatment.
  • Suitable routes of administration of pharmaceutical Zeutician composition are known to a person skilled in the art and include, for example, oral, intravenous, intraarterial, intramuscular, nasal, rectal and topical application.
  • Intravenous administration can be carried out, for example, in the form of a bolus injection with subsequent injection intervals and / or in the form of an infusion. Both the human and animal patients can be treated with the pharmaceutical composition of the present invention.
  • the treatment method is preferably used in patients with the diseases mentioned above.
  • SEQ ID NO 1 shows the amino acid sequence (SEQ ID NO 1, top) and the corresponding cDNA nucleotide sequence (SEQ ID NO 2, bottom) of the selectokine Prodrug W24 according to the invention.
  • FIG. 2 shows photographic representations of an SDS-PAGE gel stained with Coomassie and the corresponding Western blot after incubation with anti-c-myc-mAb 9E10.
  • the Prodrug W24 was expressed in CH0-DG44 cells and purified using IMAC. The purified protein was applied under reducing (red.) As well as non-reducing conditions.
  • Figure 3 is a photographic representation of a Western BIot analysis of a 12% SDS gel after detection with anti-c-myc-mAb 9E10. Lane 1: purified prodrug W24 after incubation with PBS. Lane 2: purified prodrug W24 after incubation with PBS plus tPA.
  • 5 shows the amino acid sequence (SEQ ID NO 3, top) and the corresponding cDNA nucleotide sequence (SEQ ID NO 4, bottom) of the selectokine Prodrug W33 according to the invention.
  • FIG. 6 shows photographic representations of a SDS-PAGE gel stained with Coomassie and the corresponding Western blot after incubation with anti-c-myc-mAb 9E10.
  • the prodrug W32 was expressed in CHO-DG44 cells and purified using IMAC. The purified protein was applied under both reducing and non-reducing conditions.
  • (B) is a graphical representation of the results for the determination of K D, apP . of the prodrug W32 with respect to the FAP binding by means of FACS analysis.
  • FAP-positive HT1080 # 33 cells (O) and FAP-negative HT1080 control cells (•) were incubated with serial dilutions of prodrug W32 and the cell-bound portion was detected using indirect immunofluorescence intensity.
  • the prodrug concentration used is shown against the mean fluorescence intensity (mfi).
  • Figure 7 (A) is a graphical representation of the results of an apoptosis induction test on Kym-1 cells with non-activated prodrug W32 ( ⁇ ), trypsin-activated prodrug W32 (D) or wild-type TNF (•). A representative of three experiments is shown. Inserted is the photographic representation of a SDS-PAGE gel stained with Coomassie under reducing conditions of IMAC-cleaned prodrug W32 (left lane) and IMAC-cleaned prodrug W32 after trypsin activation (right lane). The arrow corresponds to the expected MW of the activated prodrug W32.
  • (B) is a graphical representation of the results of an apoptosis induction test of Kym-1 cells in coculture with prodrug-presenting, FAP-positive cells (HT1080 # 33) and with FAP-negative control cells (HT1080).
  • HT1080 + non-activated prodrug W32 ( ⁇ ) HT1080 + trypsin-activated prodrug W32 (D)
  • (C) is a graphical representation of an experiment corresponding to that shown in (B), but the trypsin activation only occurred after binding to the HT cells and subsequent fixation.
  • Example 1 Examples of the sequence of TNF selectokines
  • potential endogenous interfaces in the huTNF molecule are removed by amino acid exchange (TNFmut I83F, R131Q) while maintaining the scFV, linker and receptor sequence as exemplified above.
  • the co-coil domain of Tenascin-C (AS 110-139), which is highly conserved in various species, is used as the trimerization domain:
  • a processing sequence according to the invention is, for example, a linker with the protease cleavage sites for thrombin, tPA, factor VIIa and uPA (amino acid sequence below, SEQ ID NO 7; cDNA nucleotide sequence above, SEQ ID NO 8):
  • Example 3 Expression, purification and functional characterization of the TNF selectokine Prodrug W24
  • the TNF selectokin prodrug W24 consists of the following components (from N- to C-terminal, amino acid residues (AA) are related to SEQ ID NO 1):
  • AA 322-486 mutated form of the natural, human TNF precursor protein
  • AA 513-639 human TNFR1 fragment containing the extracellular
  • the amino acid sequence (SEQ ID NO 1) and the corresponding coding DNA sequence (SEQ ID NO 2) are shown in FIG. 1.
  • the calculated MW of the protein portion is 70.3 kDa.
  • the Prodrug W24 was purified from CHO supernatant using IMAC according to the manufacturer's instructions (Pharmacia). In the SDS-PAGE gel stained with Coomassie, 400 ng (20 ⁇ l) of it was applied under reducing and non-reducing conditions; in the Western blot with an anti-c-myc mAb 9E10, 2 ⁇ l were used; see. Fig. 2. The expression of the monomeric, dimeric and trimeric construct is detected.
  • Prodrug W24 is cleaved by tPA
  • the purified W24 prodrug 600 ng was incubated in PBS (50 ⁇ l) or in PBS + tPA (5 ⁇ g tPA in 50 ⁇ l PBS) at 37 ° C. for 16 h. After 12% SDS-PAGE (reducing) and Western blot, detection was carried out with anti-c-myc mAb 9E10, followed by alkaline phosphatase-conjugated goat anti-mouse IgG serum. The appearance of a band below 33 kDa in the amount of the expected size of the cleaved TNFR fragment (approx. 17 kDa), which carries a myc tag at the C-terminal, in the approach with tPA shows the partial digestion of prodrug W24; see. Fig. 3. The activated TNF selectokine cannot be represented with this detection method.
  • the determination of the LD 50 results in an approximately 4000-fold increase in activity through the processing.
  • Prodrug W33 has the same functional properties as the Prodrug W24 from Example 3, but differs from it by an extended protease-sensitive linker (AA 487-520) and a shortened TNFR fragment (AA 521-582; Swissprot # P19438, AA 54-115 of human TNFR1; see Himmler et al. (1990) DNA and Cell Biology 9, 705-715).
  • Amino Acid (SEQ ID NO 3) and coding cDNA sequence (SEQ ID NO 4) of prodrug W33 are shown in FIG. 5.
  • Example 5 Expression, purification and functional characterization of the TNF selectokine Prodrug W32
  • Prodrug W32 Another construct (Prodrug W32) was produced, which corresponds functionally to the Prodrug W24 from Example 3, but contains as targeting module (1) another antibody fragment (scFv M036), which was isolated independently from a murine Ig gene library and for cross-reactivity human / murine FAP was selected.
  • targeting module (1) another antibody fragment (scFv M036), which was isolated independently from a murine Ig gene library and for cross-reactivity human / murine FAP was selected.
  • the targeting specificity of the prodrug W24 of Example 3 is based on scFv OS4, which only recognizes human FAP.
  • Prodrug W32 was expressed like construct W24 (Example 3), purified by IMAC and analyzed by SDS-PAGE Western Blot; see. Figure 6A.
  • the KD, app. Of the prodrug W32 for FAP binding was determined by means of FACS analysis; see. Figure 6B.
  • the Ko, a pp. was calculated from the concentration at which the half-maximum signal was obtained. The result was a value of 2.4 x 10 "10 M.
  • the activated prodrug W32 has an effect comparable to that of the naturally occurring TNF in the Kym-1 apoptosis test (for the implementation, see Example 3), while the unprocessed construct only develops an apoptotic effect at much higher concentrations; see. Figure 7A. Furthermore, a juxtatropic apoptosis induction of the activated prodrug W32 was investigated in co-culture with prodrug-presenting cells.
  • FAP-negative HT1080 control cells or FAP-positive HT1080 # 33 cells were incubated with serial dilutions of the prodrug or of the trypsin-activated prodrug, washed, fixed, co-cultivated with Kym-1 and the vitality of the cells was determined after 16 h; see. Figure 7B.
  • the trypsin activation of the prodrug was carried out only after the binding to the cells and subsequent fixation of the cells; see. Figure 7C. In both cases there was a significant juxtatropic apoptosis induction due to the activated prodrug.
  • the fusion proteins are produced as follows:
  • the single chain antibody fragment (scFv) OS4 (hereinafter referred to as OS4) is the CDR grafting humanized version of the FAP-specific mAb F19 (Rettig et al. 1988) and in Rippmann J.F. (Dissertation Uni Stuttgart, Verlag Grauer, Stuttgart, 1999) and Rippmann et al (Appl EnvMicrobiol 64: 4862-4869, 1998).
  • trimerization domain for example AA 110-139 of chicken tenascin
  • primers 1 SEQ ID NO 10
  • 2 SEQ ID NO 11
  • the human TNF fragment was primed 3 (SEQ ID NO 12) and 4 (SEQ ID NO 13) from a non-cleavable, membrane-bound TNF mutant (membrane TNF, TNFdelta1-12, Grell et al, Cell 83: 793-802, 1995), whereby the Kpn1 interface at the 5 'end and the Acc3 and BamH1 interfaces at the 3' end and between the sequence segments coding for the tenascin and TNF domains, a sequence coding for the peptide linker TyrGlyGlyGlySer (SEQ ID NO 9) were introduced. The two fragments were inserted into the Not1 / BamH1 digested cloning intermediate using the Not1, Kpn1 and BamH1 interfaces.
  • the protease-sensitive linker and the human TNF receptor 1 fragment were cloned via several intermediates.
  • the TNF receptor 1 fragment (cysteine-rich domains 1-3; AS 12-138; SwissProt # 10039) with the primers 5 (SEQ ID NO 14) and 6 (SEQ ID NO 15) from the plasmid pADBTNF-R (Himmler et al. DNA Cell Biol 9: 705-715, 1990) PCR amplified, with the primers 7 (SEQ ID NO 16) and 6 (SEQ ID NO 15) reamplified, whereby the interfaces Acc3, BamH1 and a linker 5 'from the TNFR Fragment was introduced which encodes the protease interfaces. This fragment was cloned into the intermediate described in 3 via the Acc3 / BamH1 interfaces.
  • a TNF receptor with the primers 9 and 10 PCR is amplified, resulting in one for AA 54-115 of the human TNFR1 coding sequence with 5 'lying linker. This fragment is inserted into pW24 via the Sah and BamH1 interfaces and replaces the linker TNFR1 fragment contained therein.
  • the resulting expression plasmid pW33 allows expression of the TNF selectokine prodrug W33.
  • TNF selectokine prodrug (W24 and W33)
  • CHO-DG44 cells were transfected with the constructs described under 5 and 6 according to the manufacturer's instructions with lipofectamine (Gibco-BRL) and then free using hypoxanthine and thymidine ( HT ⁇ ) CHO-S-SFM Medium (Life Technologies) selected for stable integration of the constructs into the genome.
  • An increase in expression was obtained by gradually increasing the selection reagent methotrexate (0.1; 1; 10 ⁇ M).
  • Both W24 and W33 were analyzed using Immobilized Metal Affinity Chromatography (IMAC) as described in Rippmann et al. (Appl EnvMicrobiol 64: 4862- 4869, 1998) described under sterile conditions, purified from the culture supernatants and stored at 4 ° C. until further use.
  • IMAC Immobilized Metal Affinity Chromatography

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

Die vorliegende Erfindung betrifft ein Polypeptid mit vorzugsweise antitumoralen und/oder immunmodulierenden Zytokineigenschaften, welches durch Prozessierung in vivo aktivierbar ist, umfassend eine zentrale Region mit spezifischer biologischer Aktivität, an dessen C-terminalem Ende sich eine Region mit einer Prozessierungseinheit und einer Inhibitordomäne befindet, während sich am N-terminalen Ende eine Region befindet, die ein Makromolekül auf einer Zelloberfläche oder eine Komponente der extrazellulären Matrix selektiv erkennt.

Description

FUSIONSPROTEIN AUS AN^KÖRPER-ZYTOKIN-ZYTOKIN INHIBITOR ( SE EKTO IN) ALS ZIELSPEZIFISCHES PRODÜG
Beschreibung
Die vorliegende Erfindung betrifft ein Polypeptid mit vorzugsweise antitumoralen und/oder immunmodulierenden Zytokineigenschaften, welches durch Prozessierung in vivo aktivierbar ist, umfassend eine zentrale Region mit spezifischer biologischer Aktivität, an dessen C-terminaiem Ende sich eine Region mit einer Prozessierungseinheit und einer Inhibitordomäne befindet, während sich am N- terminalen Ende der zentralen Region eine Region befindet, die ein Makromolekül auf einer Zelloberfläche oder eine Komponente der extrazellulären Matrix selektiv erkennt.
Der Einsatz von rekombinantem Tumornekrosefaktor (TNF) und anderer Wirkstoffe zur Behandlung von beispielsweise Tumorerkrankungen ist bisher aufgrund von starken systemischen Nebenwirkungen, die als therapiebegrenzend anzusehen sind, nur unter speziellen, aufwendigen Behandlungsprotokollen (z.B. mittels sog. "Isolated Limb Perfusion") bei sehr begrenzten Indikationen (Melanom/Sarkom- Metastasen der Extremitäten) mit Erfolg durchführbar. Aus diesen klinischen Daten kann man abschätzen, daß etwa eine 10- bis 100-fach höhere TNF-Dosis als die MTD (engl. "Maximum Tolerated Dose") zur anti-tumoralen Wirksamkeit erforderlich wäre, als es die massiven systemischen Nebenwirkungen zulassen würden.
Der vorliegenden Erfindung liegt daher die Aufgabe zugrunde, die unerwünschten Folgen einer Behandlung mit therapeutisch wirksamen Polypeptid Wirkstoffen, wie TNF-haltigen Substanzen, zu vermeiden oder zu vermindern, während gleichzeitig die therapeutisch wirksamen, z.B. antitumoralen, Eigenschaften der aktiven Substanz, wie TNF, beibehalten oder sogar verstärkt werden. Diese Aufgabe wird durch die in den Ansprüchen gekennzeichneten Ausführungsformen der vorliegenden Erfindung gelöst.
Insbesondere wird erfindungsgemäß ein Polypeptid mit einer Aminosäuresequenz bereitgestellt, umfassend von N- nach C-terminal
(1) eine Region, die ein spezifisches Makromolekül auf einer Zelloberfläche und/oder eine Komponente der extrazellulären Matrix selektiv erkennt,
(2) eine Region, welche einen Peptidlinker umfasst,
(3) eine Region mit einer biologischen Aktivität für ein spezifisches Zielmolekül,
(4) eine Region, die mindestens eine Prozessierungsstelle aufweist, und
(5) eine Region, welche die biologische Aktivität der Region (3) durch intramolekulare Bindung und/oder Wechselwirkung hemmt, wobei die biogische Aktivität der Region (3) durch Prozessierung in vivo der mindestens einen Prozessierungsstelle in Region (4) freisetzbar ist.
Das erfindungsgemäße Polypeptid, nachstehend auch als "Selektokin" bezeichnet, ist ein modular aufgebauter Wirkstoff, gemäß einer besonders bevorzugten Ausführungsform ein vorzugsweise homotrimeres Fusionsprotein mit einem Zytokin, vorzugsweise TNF bzw. ein biologisch wirksames Derivat oder eine biologisch wirksame Mutante davon, als antitumoral wirksamer Substanz bzw. Region (3), welches seine biologische Wirkung durch Verknüpfung mit vier weiteren Funktionsmodulen gezielt im erkrankten Gewebe, z.B. einem Tumorareal, freisetzt. Dies wird durch die N-terminale Verknüpfung der therapeutisch wirksamen Substanz, z.B. des TNF-Moleküls, mit einem für das Zielgewebe spezifischen Targeting-Modul (1), z.B. tumorspezifische Antikörper oder Derivate davon, wie scFv-Antikörper, und der C-terminalen Verknüpfung mit einem Inhibitor (5) gegen die therapeutisch wirksame Substanz, insbesondere einem Peptid-Inhibitor erreicht, welcher selektiv im Zielgewebe, wie dem Tumorareal, durch Prozessierung der Domäne (4) inaktiviert, vorzugsweise durch gezielte proteolytische Abspaltung aus dem Fusionsprotein entfernt wird und so ein am selektiven Targeting-Modul gebundener, bioaktiver Wirkstoff, z.B. TNF, entsteht. Zwischen dem Targeting-Modul (z.B. dem scFv-Antikörperfragment) und dem Modul mit therapeutischer Funktion (z.B. TNF) befindet sich eine Peptidlinker-Domäne (2), vorzugsweise eine Trimerisierungsdomäne, welche die Ausbildung von kovalenten Disulfidbrücken und damit eine regelmäßige und stabile Homotrimerisierung des Fusionsproteins gewährleiste
Mit dem erfindungsgemäßen Konstrukt wird es ermöglicht, lokal hohe Wirkkonzentrationen der therapeutisch wirksamen Substanz, z.B. des TNF, zu erreichen, ohne dass es zu systemisch erhöhten Therapeutikum-Spiegeln (z.B. TNF im Serum) und damit therapielimitierenden Nebenwirkungen kommt. Gleichzeitig wird beispielsweise im Fall von TNF als therapeutisch wirksamer Domäne durch die Targeting-Modul- (z.B. Antikörper-) vermittelte Präsentation des vor Ort aktivierten TNF eine Wirkung erzielt, die der des natürlichen Membran-TNF entspricht, d.h. es kommt zur Koaktivierung beider TNF-Rezeptor-Typen und damit zur Potenzierung der antitumoralen Eigenschaften von TNF. Durch Auswahl der Spezifität des Targeting-Moduls kann ein auf die jeweilige Tumorentität spezifisch abgestimmtes/optimiertes Therapeutikum hergestellt werden.
Die (Aminosäuresequenz-)Regionen bzw. Module des erfindungsgemäßen Polypeptids werden nachstehend in Bezug auf bevorzugte Ausführungsformen im einzelnen beschrieben.
Das erfindungsgemäße Polypeptid (Selektokin) stellt eine neuartige Prodrugtechnologie bereit und ist ein Konstrukt, das gemäß einer bevorzugten Ausführungsform ein rekombinantes, homotrimeres Fusionsprotein, welches prinzipiell eine definierte Abfolge der folgenden Strukturelemente (im Monomer) umfasst (N-terminal nach C-terminal): (1) ein murines, humanisiertes oder humanes Einzelkettenantikörperfrag ent (scFv) definierter Antigenspezifität bestehend aus VH-Linker-VL; (2) ein Peptidlinker mit intrinsischen Trimerisierungseigenschaften; (3) ein TNF-Molekül, welches beispielsweise dem Wildtyp-TNF oder der extrazellulären Domäne des TNF (mature 17 kDa Form, AA 1-157, Swissprot #P01375) oder davon abgeleitete biologisch aktive Varianten entspricht; (4) ein variables Linkerpeptid mit spezifischen Protease-Spaltstellen, (5) ein spezifisch TNF-bindendes Protein bzw. Peptid. Das Targeting Modul (1 ) ist vorzugsweise für ein Zeiloberflächenmolekül spezfisch, das in Tumorläsionen und/oder proliferierenden Endothelzellen, die mit dem Prozess der Angiogenese assoziiert sind, exprimiert wird. Gemäß einer anderen bevorzugten Ausführungsform ist das Targeting-Modul (1 ) für eine Komponente der extrazellulären Matrix spezifisch, die in Tumorläsionen, und/oder Angiogenesebereichen pathologischer Läsionen vorhanden ist. Gemäß einer weiteren bevorzugten Ausführungsform ist das Targeting-Modul (1) für eine Komponente der malignen Tumorzelle selbst spezifisch. Vorzugsweise umfaßt die Region bzw. das Modul (1) einen Antikörper (z.B. murin, humanisiert oder human) oder ein Fragment davon, z.B. ein Fab-Fragment oder ein typisches, nach dem Stand der Technik hergestelltes Einzelkettenantikörperfragment (scFv) murinen, durch CDR-Grafting humanisierten oder vollständig humanen Ursprungs mit Spezifität für ein z.B. im Tumorgewebe vorzugsweise selektiv bzw. dominant exprimiertes Antigen, wobei dies prinzipiell auf den malignen Zellen selbst exprimiert sein kann, vorzugsweise aber im nicht-malignen Anteil des Tumors, den Stromazellen oder dem Tumorendothel, exprimiert wird. Derartige Antigene nichtmaligner Gewebeanteile eines soliden Tumors (Karzinoms) sind einerseits genetisch invariant, andererseits bei unterschiedlichsten Tumorentitäten vorkommend und damit universelle Tumormarker. Beispielsweise seien hier der VEGFR- bzw. der VEGFR VEGF-Komplex (als Beispiel für Rezeptor-Liganden-Komplexe) sowie das Integήn avß3, das Endosialin und die Fibronektin-Isoform bFn als selektive Zielstrukturen des Tumorendothels, und das sog. Fibroblast Activation Protein (FAP) als selektiver Marker für eine Komponente der extrazellulären Matrix, welche im Tumorstroma vorhanden ist, genannt, die beispielsweise mit spezifischen, hochaffinen scFv wirksam erfasst werden können. Weitere Beispiele für geeignete Targeting-Module sind Peptide, artifizielle Antikörper und Spiegelmere.
Die Peptidlinker-Region (2) ist vorzugswise ein Trimerisierungsmodul und verbindet die Targeting-Region (1) mit der therapeutisch wirksamen Region (3). Gemäß einer besonders bevorzugten Ausführungsform umfasst das Trimerisierungsmodul ein natürlich vorkommendes oder synthetisches Peptid mit intrinsischen Trimerisierungseigenschaften. Ein besonders geeignetes Beispiel eines derartigen Peptids ist eine Domäne des Tenascin-Moleküls (AA 110-139, Swissprot #P10039, (Huhn) oder Swissprot #P24821 (Mensch)). Es stellt die Verbindung zwischen dem Targeting-Modul (1) (z.B. scFv) und dem Therapeutikum (3) (z.B. TNF) her und gewährleistet gleichzeitig die kovalente, homotrimere Verknüpfung des Fusionsproteins während der Biogenese.
Wie vorstehend ausgeführt, enthält das therapeutisch wirksame Modul (3) vorzugsweise eine Aminosäuresequenz eines Zytokins oder einem therapeutisch wirksamen Fragment davon. Vorzugsweise enthält die Region (3) die Aminosäuresequenz von TNF, mehr bevorzugt eines TNF-Vorläuferproteins und am meisten bevorzugt von einem dem prozessierten, reifen Wildtyp-TNF-Molekül (AA 1- 157, Swissprot #P01375) identischen Protein, oder davon abgeleiteten Derivaten oder Mutanten mit selektiven Rezeptorbindungseigenschaften oder Mutanten bzw. Derivaten, die hinsichtlich ihrer spezifischen Bioaktivität oder anderer Eigenschaften (Stabilität, Proteaseresistenz) optimiert wurden.
Das Prozessierungsmodul (4) ist beispielsweise Protease-sensitiv (d.h. die Prozessierungsstelle entspricht der Erkennungssequenz einer Protease) und vorzugsweise in Aminosäurezusammensetzung und Gesamtlänge derart beschaffen, dass es die durch das Trimerisierungsmodul und TNF selbst bewirkte Homotrimerisierung des Fusionsproteins zulässt, gleichzeitig aber auch eine hochaffine, stabile Bindung des im Molekül C-terminal befindlichen TNF-Inhibitors (z.B. die extrazelluläre TNF-Rezeptordomäne) an den TNF-Anteil erlaubt, so dass hierdurch die Bindung des TNF-Moduls an zellexprimierte TNF-Rezeptoren verhindert wird. Der Linker ist weiterhin vorzugsweise derart beschaffen, dass er mindestens eine, vorzugsweise mehrere selektive Spaltstellen für solche extrazellulären oder zellassozierten Proteasen enthält, die vorzugsweise selektiv im Tumorgewebe nachgewiesen werden. Beispiele für geeignete Spaltstellen sind diejenige für Urokinase-Typ Plasminogenaktivator (uPA), Gewebsplasminogen- aktivator (tPA), den aktivierten Gerinnungsfaktor Vlla, Matrix-Metalloproteasen, wie MMP-2 und MMP-9, und für die hochselektiv im Stroma von Tumoren membranständig exprimierte FAP-Protease. Besonders bevorzugte Protease- sensitive Spaltstellen sind diejenigen von mit dem Vorgang der Metastasierung und der Angiogenese in Verbindung stehenden Matrix-Metalloproteasen (z.B. MMP-9- Erkennungssequenz Gly-Pro-Leu-Gly-Val-Arg-Gly-Lys; SEQ ID NO 18), von Heparanase, von Enzymen, die bevorzugt in nekrotischen Läsionen auftreten sowie von Enzymen, die mit Prostatakrebs assoziiert sind (z.B. PSMA, PSA, spaltbares Prozessierungsmodul Glutaryl-(4-hydroxypropyl)-Ala-Ser-cyclohexaglycyl-Gln-Ser- Leu-COOH). Die Struktur des Linkers wird derart gewählt, dass die Protease- Erkennungssequenz frei zugänglich, d.h. eine effektive Prozessierung durch spezifische Proteasen möglich ist, und nach Spaltung des Fusionsproteins ggf. am TNF-Molekül verbleibende Aminosäuren des Linkers die Bioaktivität der therapeutisch wirksamen Region nicht negativ beeinflussen.
Das Inhibitor-Modul (5) ist gemäß einer bevorzugten Ausführungsform des erfindungsgemäßen Polypeptids ein Rezeptor für ein Zytokin oder ein Fragment davon. Des weiteren weist das Inhibitor-Modul bevorzugt mindestens eine Bindungsstelle für die therapeutisch wirksame Region (3) auf. Vorzugsweise umfasst das Inhibitor-Modul im Falle der Verwendung von TNF in Region (3) die vollständige oder partielle extrazellulären Domäne eines humanen TNF-Rezeptors, z.B. des hu TNFR1 (synomym p55/60TNFR; Swissprot #P19438, AA 1-190; bzw. Fragmente dieses Moleküls, beispielsweise AA 1-157 bzw. AA 60-120). Andere, spezifisch TNF bindende Proteine, etwa die extrazelluläre Domäne des huTNFR2 (EMBL- Datenbank #M32315) oder Proteine viralen Ursprungs wie z.B. das T2 Protein, sowie jeweils davon abgeleitete synthetische Peptide, die TNF-Bindungseigenschaft besitzen und mit der TNF-Bindung an Zellmembran-ständige TNF-Rezeptoren interferieren, sind ebenfalls geeignet. Aufgrund der Bindung bzw. Wechselwirkung des Inhibitors mit dem therapeutisch wirksamen Modul ist das erfindungsgemäße Fusionsprotein in diesem Zustand biologisch inaktiv, d.h. es befindet sich in der Proform (Prodrug).
Das erfindungsgemäße Polypeptid kann weitere Domänen umfassen. Beispielsweise können zur vereinfachten Reinigung des rekombinant hergestellten Proteins und der in vitro Analytik geeignete Markierungssequenzen angefügt werden. So kann z.B. C- terminal an der Region (5), vorzugsweise dem TNFR-Fragment, ein vom Vektor POPE abgeleiteter myc-Hise-Tag angefügt werden. Weitere Markierungssequenzen sind einem Fachmann bekannt. Das erfindungsgemäß bevorzugte TNF-Selektokin ist ein kovalent verknüpftes, homotrimeres Molekül, bestehend aus der oben im Detail erläuterten Fusion von drei Funktionsdomänen, dem tumorspezifischem Antikörpermodul, TNF und dem blockierendem TNF-Bindeprotein (extrazelluläre Rezeptordomäne oder davon abgeleitetes Peptid) sowie dazwischenliegenden funktioneilen Linkern mit Trimerisierungseigenschaften bzw. spezifischen Protease-Spaltstellen, welches in diesem kompletten Zustand in Bezug auf die TNF-Wirkung inaktiv ist. Das Selektokin wird nach in vivo Verabreichung durch den Antikörper-Anteil zunächst spezifisch im Tumorareal angereichert und dort durch die vom Tumor selbst oder das reaktive Tumorstroma/Tumorgefäßsystem gebildete Proteasen (z.B. FAP, uPA, tPA, MMP2, Faktor Vlla) prozessiert, d.h. das inhibierende Peptid (5) wird abgespalten. Nach selektiver proteolytischer Spaltung dissoziiert das TNFR-Fragment/Inhibitorpeptid vom trimeren TNF-Molekül, letzteres wird somit bioaktiv (d.h. die biologische Aktivität der Region wird durch Prozessierung der Prozessierungsstelle in Reion (4) freigesetzt). Das derart prozessierte TNF bindet nun bevorzugt an zellständige TNF- Rezeptoren, da diese, als homomultimere Moleküle, eine wesentlich höhere Affinität besitzen als die monomeren, löslichen Rezeptor-Fragmente. Die Selektivität der TNF-Wirkung wird mit dem erfindungsgemäßen Selektokin also durch zwei Maßnahmen erreicht: Einerseits über die scFv-vermittelte selektive Anreicherung des inaktiven Prodrugs im Tumor und dessen Retention auch nach proteolytischer Aktivierung, andererseits über die ortsspezifische Umwandlung des Prodrugs durch Proteasen, welche ausschließlich oder bevorzugt im Tumorareal in signifikanter Aktivität nachweisbar sind. Durch die scFv-vermittelte Bindung des TNF an membranständige Antigene wird darüberhinaus eine weitere bevorzugte Wirkung des Selektokins erreicht, nämlich eine gegenüber dem herkömmlich verwendeten (löslichen) TNF-Molekül verbesserte biologische Wirkung, die der des natürlichen Membran-TNF Moleküls ähnlich ist: Durch die scFv-vermittelte Fixierung des TNF wird das Dissoziationsgleichgewicht am TNFR2 hin zu einer stabileren Bindung verschoben und damit dessen Aktivierung erreicht. Es ist bekannt, dass die simultane Aktivierung beider TNFR zu einem kooperativen Signalmechanismus und daraus resultierend verstärkten zellulären Reaktionen, insbesondere die Aktivierung von Endothelzellen und die Induktion von Apoptose in Tumorzellen, die diesbezüglich resistent gegenüber herkömmlich verwendetem (löslichen) TNF sind, führen kann.
Besonders bevorzugte Ausführungsformen des erfindungsgemäßen Polypeptids weisen die in der Fig. 1 (SEQ ID NO 1) und 5 (SEQ ID NO 3) gezeigten Aminosäuresequenzen auf.
Ein weiterer Gegenstand der vorliegenden Erfindung betrifft eine Nukleinsäure, umfassend eine Nukleotidsequenz, welche für das erfindungsgemäße Polypeptid kodiert. Der Begriff "Nukleinsäure" bedeutet ein natives, halbsynthetisches, synthetisches oder modifiziertes Nukleinsäuremolekül aus Desoxyribonukleotiden, und/oder Ribonukleotiden und/oder modifizierten Nukleotiden. Bevorzugte Ausführungsformen der erfindungsgemäßen Nukleinsäure enthalten die in der Fig. 1 (SEQ ID NO 2) und der Fig. 5 (SEQ ID NO 4) gezeigte Nukleotidsequenz.
Des weiteren wird erfindungsgemäß ein Vektor, enthaltend die vorstehend definierte Nukleinsäure, bereitgestellt. Der Vektor ist vorzugsweise zur Expression und/oder Amplifikation in einer prokaryontischen und/oder eukaryontischen Zelle befähigt. Dazu enthält der Vektor vorzugsweise geeignete regulatorische Elemente, wie Promotoren, Enhancer, Terminationssequenzen usw. Der Vektor kann auch zur stabilen Integration der erfindungsgemäßen Nukleinsäure in das genetische Material einer Wirtszelle verwendet werden.
Ein weiterer Gegenstand betrifft erfindungsgemäß eine Wirtszelle, enthaltend die obige Nukleinsäure und/oder den obigen Vektor. Geeignete Wirtszellen sind beispielsweise alle Säugerzellen, wie COS- oder CHO-Zellen.
Die vorliegende Erfindung stellt ebenfalls ein Verfahren zur Herstellung des erfindungsgemäßen Polypeptids bereit, umfassend die Schritte
(a) Züchten der vorstehenden Wirtszelle in einem Kulturmedium unter geeigneten Bedingungen und
(b) Isolieren des erfindungsgemäßen Polypeptids aus den Wirtszellen und/oder dem Kulturmedium. Das erfindungsgemäße Polypeptid wird vorzugsweise durch Expression mit Hilfe von geeigneten - Expressionssystemen, vorzugsweise als sezerniertes Produkt selektionierbarer, stabiler Transfektanden der Zeil Linie CHO DG44 oder nach transienter Expression in COS7 Zellen, hergestellt. Andere, dem Stand der Technik entsprechende eukaryontische Expressionssysteme, z.B. Pichia pastoris, Insektenoder Säugerzellen, mit den für das jeweilige Zellsystem für Sekretion geeigneten Expressionsvektoren, z.B. wie in Brooks et al. (Immunotechnology 3:173-184,1997) für Säuger und Insektenzellen beschrieben. pPICZalpha-Vektoren (INVITROGEN) zur Expression und Sekretion in der Hefe Pichia pastoris, sind ebenfalls geeignet.
Das erfindungsgemäße Polypeptid, die Nukleinsäure und/oder der Vektor kann (können) vorteilhafterweise zur Herstellung von pharmazeutischen Zusammensetzungen zur Behandlung krankhafter Störungen verwendet werden.
Eine weitere Ausgestaltung der vorliegenden Erfindung betrifft daher eine pharmazeutische Zusammensetzung, enthaltend in pharmazeutisch wirksamer Menge das erfindungsgemäße Polypeptid und/oder die erfindungsgemäße Nukleinsäure und/oder den erfindungsgemäßen Vektor, gegebenenfalls in Verbindung mit einem oder mehreren pharmazeutisch verträglichen Hilfsstoffen, Verdünnungsmitteln und/oder Trägern. Die pharmazeutische Zusammensetzung dient vorzugsweise zur therapeutischen Behandlung von Krebserkrankungen und/oder Infektionskrankheiten und/oder metabolischen Erkrankungen. Besonders bevorzugte Einsatzgebiete der pharmazeutischen Zusammensetzung sind die Behandlung solider Tumoren sowie die Angiogenese in pathologischen Läsionen. Die erfindungsgemäße pharmazeutische Zusammensetzung kann jegliche im vorliegenden Fachgebiet als geeignet bekannte Form annehmen. Vorzugsweise ist sie fest, flüssig oder aerosolartig.
Die vorliegende Erfindung umfasst somit ebenfalls ein Behandlungsverfahren, welches die Verabreichung einer therapeutisch ausreichenden Menge der erfindungsgemäßen pharmazeutischen Zusammensetzung an einen die Behandlung benötigenden Patienten einschließt. Geeignete Verabreichungswege der pharma- zeutischen Zusammensetzung sind einem Fachmann bekannt und umfassen beispielsweise die orale, intravenöse, intraarterielle, intramuskuläre, nasale, rektale und topische Applikation. Eine intravenöse Verabreichung kann z.B. in Form einer Bolusinjektion mit nachfolgenden injektionsintervallen und/oder in Form einer Infusion durchgeführt werden. Mit der pharmeutischen Zusammensetzung der vorliegenden Erfindung können sowohl menschliche als auch tierische Patienten behandelt werden. Das Behandlungsverfahren wird bevorzugt bei Patienten mit den vorstehend genannten Erkrankungen angewendet.
Die Figuren zeigen:
Fig. 1 zeigt die Aminosäuresequenz (SEQ ID NO 1 , oben) und die entsprechende cDNA-Nukleotidsequenz (SEQ ID NO 2, unten) des erfindungsgemäßen Selektokins Prodrug W24.
Fig. 2 zeigt photographische Darstellungen eines mit Coomassie gefärbten SDS- PAGE-Gels und des entsprechenden Western Blots nach Inkubation mit anti-c-myc-mAK 9E10. Das Prodrug W24 wurde in CH0-DG44-Zelien exprimiert und mittels IMAC gereinigt. Das gereinigte Protein wurde unter reduzierenden (red.) als auch nicht-reduzierenden Bedingungen aufgetragen.
Fig. 3 ist eine photographische Darstellung einer Western BIot-Analyse eines 12 % SDS-Gels nach Detektion mit anti-c-myc-mAK 9E10. Spur 1 : gereinigtes Prodrug W24 nach Inkubation mit PBS. Spur 2: gereinigtes Prodrug W24 nach Inkubation mit PBS plus tPA.
Fig. 4 ist eine graphische Darstellung der Ergebnisse eines Apoptose- Induktionstests an Kym1 -Zellen mit tryptisch aktiviertem Prodrug W24 (■)
bzw. nicht-aktiviertem Prodrug W24 (▼ ). Fig. 5 zeigt die Aminosäuresequenz (SEQ ID NO 3, oben) und die entsprechende cDNA-Nukleotidsequenz (SEQ ID NO 4, unten) des erfindungsgemäßen Selektokins Prodrug W33.
Fig. 6 (A) zeigt photographische Darstellungen eines mit Coomassie gefärbten SDS-PAGE-Gels und des entsprechenden Western Blots nach Inkubation mit anti-c-myc-mAK 9E10. Das Prodrug W32 wurde in CHO-DG44-Zellen exprimiert und mittels IMAC gereinigt. Das gereinigte Protein wurde unter reduzierenden als auch nicht-reduzierenden Bedingungen aufgetragen. (B) ist eine graphische Darstellung der Ergebnisse zur Bestimmung der KD, apP. des Prodrugs W32 bzgl. der FAP-Bindung mittels FACS-Analyse. FAP- positive HT1080#33-Zellen (O) und FAP-negative HT1080-Kontrollzellen (•) wurden mit seriellen Verdünnungen des Prodrugs W32 inkubiert und der Zeil-gebundene Anteil mittels indirekter Immunfluoreszenzintensität detektiert. Es ist die eingesetzte Prodrug-Konzentration gegen die mittlere Fluoreszenzintensität (m.f.i.) dargestellt.
Fig. 7 (A) ist eine graphische Darstellung der Ergebnisse eines Apoptose- Induktionstests bei Kym-1 -Zellen mit nicht-aktiviertem Prodrug W32 (■), Trypsin-aktiviertem Prodrug W32 (D) oder Wildtyp-TNF (•). Es ist ein representatives von drei Experimenten gezeigt. Eingefügt ist die photographische Darstellung eines mit Coomassie gefärbten SDS-PAGE- Gels unter reduzierenden Bedingungen von IMAC-gereinigtem Prodrug W32 (linke Spur) und des IMAC-gereinigten Prodrugs W32 nach Trypsin- Aktivierung (rechte Spur). Der Pfeil entspricht dem erwarteten MW des aktivierten Prodrugs W32. (B) ist eine graphische Darstellung der Ergebnisse eines Apoptose-Induktionstests von Kym-1-Zellen bei Kokultur mit Prodrug- präsentierenden, FAP-positiven Zellen (HT1080#33) sowie mit FAP- negativen Kontrollzellen (HT1080). HT1080 + nicht-aktiviertes Prodrug W32 (Δ), HT1080 + Trypsin-aktiviertes Prodrug W32 (D), HT1080#33 + nicht- aktiviertes Prodrug W32 (A), HT1080#33 + Trypsin-aktiviertes Prodrug W32 (■). (C) ist eine graphische Darstellung eines dem in (B) gezeigten entsprechenden Experiments, jedoch erfolgte die Trypsin-Aktivierung erst nach der Bindung an die HT-Zellen und anschließender Fixierung. HT1080 + nicht-aktiviertes Prodrug W32 (O), HT1080 + Trypsin-aktiviertes Prodrug W32 (D), HT1080#33 + nicht-aktiviertes Prodrug W32 (•), HT1080#33 + Trypsin-aktiviertes Prodrug W32 (■). In den graphischen Darstellungen von (B) und (C) ist jeweils ein repräsentatives von drei Experimenten gezeigt.
Die vorliegende Erfindung wird anhand der folgenden nicht-einschränkenden Beispiele näher erläutert.
BEISPIELE
Beipiel 1 : Beispiele für die Sequenz von TNF-Selektokinen
Beispiele der Sequenz eines TNF-Selektokins mit multiplen Schnittstellen im Linker und verschiedenen Rezeptorfragmenten:
1. scFv - TDrenascin - hu TNF (AS1-157)- Linker- huTNFRl (AS1-190).
2. scFv - TDrenascin - hu TNF (AS1-157)- Linker - huTNFRl (AS 60-120).
Bei einer weiteren Variante werden potentielle, endogene Schnittstellen im huTNF- Molekül durch Aminosäureaustausch entfernt (TNFmut I83F, R131Q) unter Beibehaltung der scFV, Linker- und Rezeptorsequenz wie oben exemplarisch dargestellt.
Als Trimerisierungsdomäne wird die bei verschiedenen Spezies hochkonservierte Coiled-Coil-Domäne von Tenascin-C (AS 110-139) verwendet: Beispiel der AS- Sequenz :
Huhn: ACGCΆAAPIVKDLLSRLEE EGLVSS REQ (Swissprot #P10039, SEQ ID NO
5)* Mensch: ACGCAAAPDVKELLSRLEELENLVSSLREQ (Swissprot #P24821 , SEQ ID NO
6)# * Nies, D.E., Hemesath.T.J., Kim.J.H., GuIcher.J.R. and Stefansson.K. The complete cDNA sequence of human hexabrachion (Tenascin). A multidomain protein containing unique epidermal growth factor repeats. J. Biol. Chem. 266 (5), 2818- 2823 (1991)
# Spring,J., Beck.K. and Chiquet-Ehrismann.R. Two contrary functions of tenascin: dissection of the active sites by recombinant tenascin fragments. Cell 59 (2), 325- 334 (1989)
Beispiel 2: Linker-Sequenz
Eine erfindungsgemäße Prozessierungssequenz ist beispielsweise ein Linker mit den Proteasespaltstellen für Thrombin, tPA, Faktor Vlla und uPA (Aminosäuresequenz unten, SEQ ID NO 7; cDNA-Nukleotidsequenz oben, SEQ ID NO 8):
TCCGGAATGTACCCCAGAGGATCGATCGGCGCCCCCTTCGGCCGCGGCGCCCCCTTCGTACGCATC S G M Y P R G S I G A P F G R G A P F V R I
I Thrombin I I tPA I I FactorVIIal
GAGGGTCGGGTC
E G R V
| uPA |
Beispiel 3: Expression, Reinigung und funktioneile Charakterisierung des TNF-Selektokins Prodrug W24
Prodrug W24
Das TNF-Selektokin Prodrug W24 besteht aus folgenden Komponenten (von N- nach C-terminal, Aminosäurereste (AA) sind auf SEQ ID NO 1 bezogen):
1. AA 1-19: Leitpeptidsequenz
2. AA 20-285: scFv OS4 (Spezifität: humanes FAP; vgl. Mersmann (2000)
Dissertation Universität Stuttgart, Verlag Grauer, Stuttgart, ISBN 3-86186-335-9; Rippmann 1999, Dissertation Universität Stuttgart, ISBN 3-86186-281-6)
3. AA 286-315 Trimerisierungsdomäne des Tenascins (Huhn, s.o) AA 316-321 Linker
4. AA 322-486: mutierte Form des natürlichen, humanen TNF-Vorläuferproteins
(26 kDa Membranform, Swissprot #P01375, 233 AA) mit Deletionen der N-terminalen 56 AA und von AA 78-89 (TNFΔ1_ 56, 78-89)> d.h. Deletion der cytoplasmatischen Domäne, der Transmembrandomäne und der TACE-Spaltstelle des TNF- Vorläuferpolypeptids
5. AA 487-512: Linker mit Proteaseschnittstellen (vgl. Beispiel 2)
6. AA 513-639: humanes TNFR1 -Fragment enthaltend die extrazellulären
Domänen 1-3 (Swissprot #P 19438, AA 12-138; vgl. Himmler et al. (1990) DNA and Cell Biology 9, 705-715),
7. AA 640-652: myc-tag
8. AA 653-658: His-tag
Die Amiosäuresequenz (SEQ ID NO 1) und die entsprechende kodierende DNA- Sequenz (SEQ ID NO 2) sind in der Fig. 1 gezeigt. Das berechnete MW des Proteinanteils beträgt 70,3 kDa.
Expression und Reinigung
Das Prodrug W24 wurde aus CHO-Überstand mittels IMAC nach der Vorschrift des Herstellers (Pharmacia) gereinigt. Im mit Coomassie gefärbten SDS-PAGE-Gel wurden 400 ng (20 μl) davon unter reduzierenden und nicht-reduzierenden Bedingungen aufgetragen, im Western-Blot mit einem anti-c-myc-mAk 9E10 wurden 2 μl verwendet; vgl. Fig. 2. Es wird die Expression des monomeren, dimeren und trimeren Konstrukts nachgewiesen.
Spaltung von Prodrug W24 durch tPA Das gereinigte Prodrug W24 (600 ng) wurde in PBS (50 μl) bzw. in PBS + tPA (5 μg tPA in 50 μl PBS) bei 37°C für 16 h inkubiert. Nach 12% SDS-PAGE (reduzierend) und Westem-Blot erfolgte die Detektion mit anti-c-myc-mAk 9E10, gefolgt von alkalische Phosphatase-konjugiertem Ziege-anti-Maus IgG-Serum. Das Erscheinen einer Bande unterhalb von 33 kDa in Höhe der erwarteten Größe des abgespaltenen TNFR-Fragments (ca.17 kDa), welches C-terminal einen myc-tag trägt, im Ansatz mit tPA zeigt den partiellen Verdau des Prodrugs W24; vgl. Fig. 3. Das aktivierte TNF- Selektokin ist mit dieser Nachweismethode nicht darstellbar.
Proteolytische Aktivierung von Prodrug W24 durch Trypsin
20000 Kym1 -Zellen in 50 μl Standard-Kulturmedium (10% FCS) wurden am Vortag in Platten mit 96 Vertiefungen ausgesät (4-fach Werte), und am folgenden Tag wurden 50 μl , Prodrug W24-Verdünnung zugegeben. Die Trypsin-Aktivierung von IMAC-gereinigtem Prodrug W24 (2μg) erfolgte in einem Totalvolumen von 50 μl PBS mit einer Endkonzentration von 100 μg/ml Trypsin. Die Reaktion wurde nach 5 min Inkubation bei RT mit 200 μl RPMI/10 % FCS abgestoppt. Die nicht-aktivierte Probe wurde identisch behandelt, jedoch ohne Trypsin. Die Bestimmung der Vitalität erfolgte nach 16 h durch MTT-Färbung. Die Ergebnisse zeigen (Fig. 4), dass das nicht-prozessierte TNF-Selektokin bis zu einer Konzentration von ca. 2-3 μg/ml keinerlei Bioaktivität (Apoptoseinduktion) aufweist, während das tryptisch aktivierte Selektokin eine dem Wildtyp-TNF vergleichbare, hohe spezifische Bioaktivität aufweist (LD50 = 0,5 ng/ml). Die Bestimmung der LD50 ergibt eine etwa 4000-fache Steigerung der Aktivität durch die Prozessierung.
Beispiel 4: Prodrug W33
Das Konstrukt Prodrug W33 weist die gleichen funktioneilen Eigenschaften wie das Prodrug W24 von Beispiel 3 auf, unterscheidet sich von diesem jedoch durch einen verlängerten Protease-sensitiven Linker (AA 487-520) und ein verkürztes TNFR- Fragment (AA 521-582; Swissprot #P19438, AA 54-115 des humanen TNFR1 ; vgl. Himmler et al. (1990) DNA and Cell Biology 9, 705-715). Aminosäure- (SEQ ID NO 3) und kodierende cDNA-Sequenz (SEQ ID NO 4) des Prodrug W33 sind in der Fig. 5 gezeigt.
Beispiel 5: Expression, Reinigung und funktioneile Charakterisierung des TNF-Selektokins Prodrug W32
Prodrug W32
Es wurde ein weiteres Konstrukt (Prodrug W32) hergestellt, welches funktioneil dem Prodrug W24 von Beispiel 3 entspricht, jedoch als Targeting-Modul (1) ein anderes Antikörperfragment enthält (scFv M036), welches unabhängig aus einer murinen Ig Genbibliothek isoliert wurde und auf Kreuzreaktivität humane/murine FAP selektioniert wurde. Im Gegensatz dazu basiert die Targeting-Spezifität des Prodrugs W24 des Beispiels 3 auf scFv OS4, welches ausschließlich humanes FAP erkennt.
Biochemische Charakterisierung und Antigen-Bindungsaktivität des TNF-Selektokins Prodrug W32
Prodrug W32 wurde wie das Konstrukt W24 (Beispiel 3) exprimiert, mittels IMAC aufgereinigt und durch SDS-PAGE Western Blot analysiert; vgl. Fig. 6A.
Des weiteren wurde eine Bestimmung der KD, app. des Prodrugs W32 für die FAP- Bindung mittels FACS-Analyse vorgenommen; vgl. Fig. 6B. Die Ko, app. wurde aus der Konzentration, bei welcher das halbmaximale Signal erhalten wurde, berechnet. Es ergab sich ein Wert von 2,4 x 10"10 M.
TNF-Aktivität des Prodrugs W32
Das aktivierte Prodrug W32 weist im Kym-1-Apoptosetest (hinsichtlich der Durchführung vgl. Beispiel 3) eine dem natürlich vorkommenden TNF vergleichbare Wirkung auf, während das nicht-prozessierte Kontrukt erst bei sehr viel höheren Konzentrationen eine apoptotische Wirkung entfaltet; vgl. Fig. 7A. Des weiteren wurde eine juxtatrope Apoptose-Induktion des aktivierten Prodrugs W32 bei Kokultur mit Prodrug-präsentierenden Zellen untersucht. Dazu wurden FAP- negative HT1080-Kontrollzellen oder FAP-positive HT1080#33 Zellen mit seriellen Verdünnungen des Prodrugs oder des Trypsin-aktivierten Prodrugs inkubiert, gewaschen, fixiert, mit Kym-1 cokultiviert und die Vitalität der Zellen nach 16 h bestimmt; vgl. Fig. 7B. In einem weiteren Experiment erfolgte bei sonst gleichen Ansätzen die Trypsin-Aktivierung des Prodrugs erst nach der Bindung an die Zellen und anschliessender Fixierung der Zellen; vgl. Fig. 7C. In beiden Fällen ergibt sich eine signifikante juxtatrope Apoptose-Induktion durch das aktivierte Prodrug.
Beispiel 6: Konstruktion der erfindungsgemäßen Polypeptide Selektokin W24 und W33
Die Fusionsproteine werden wie folgt hergestellt:
1. Das Single chain Antikörper Fragment (scFv) OS4 (im weiteren als OS4 bezeichnet) ist die durch 'CDR grafting' humanisierte Version des FAP spezifischen mAb F19 (Rettig et al. 1988) und in Rippmann J.F. (Dissertation Uni Stuttgart, Verlag Grauer, Stuttgart, 1999) sowie Rippmann et al (Appl EnvMicrobiol 64:4862-4869,1998) beschrieben.
2. Im eukaryotischen Expressionsvektor pG1 D105 (beschrieben in EP 0 953 639) mit der Expressionskassette für die schwere Immunglobulin-Kette des mAb F19 wurde diese mittels BstE2 und Nae1 gegen die Minibody OS4 Kassette bestehend aus scFv OS4; hinge-CH3 Region eines hulgGI ; myc/his- Tag des Plasmides pW7 (beschrieben in Wüest, T., Dissertation Uni Stuttgart, 2001 ) ausgetauscht. Durch einen Not1/BamH1 Verdau wird selektiv das Fc Fragment (Hinge- und CH3- Region des hu lgG1) entfernt.
3. Die cDNA Sequenz der Trimerisierungsdomäne (bspw. AA 110-139 des Tenascins vom Huhn) wurde durch proof-reading PCR mittels der Primer 1 (SEQ ID NO 10) und 2 (SEQ ID NO 11) amplifiziert, wodurch die Schnittstellen Not1 und Kpn1 eingeführt wurden. Das humane TNF Fragment wurde mittels der Primer 3 (SEQ ID NO 12) und 4 (SEQ ID NO 13) aus einer nichtspaltbaren, membranständigen TNF Mutante (Membran-TNF, TNFdelta1-12, Grell et al, Cell 83:793-802,1995) amplifiziert, wodurch am 5'-Ende die Schnittstelle Kpn1 und am 3'-Ende die Schnittstellen Acc3 und BamH1 sowie zwischen den für die Tenascin- und die TNF-Domäne kodierenden Sequenzabschnitte eine Sequenz kodierend für den Peptid-Linker TyrGlyGlyGlySer (SEQ ID NO 9) eingeführt wurden. Die beiden Fragmente wurden unter Verwendung der Not1-, Kpn1- und BamH1 -Schnittstellen in das unter 2. beschriebenen Not1/BamH1 verdaute Klonierungsintermediat eingefügt.
4. Die Klonierung des Protease-sensitiven Linkers und des humanen TNF- Rezeptor 1 Fragmentes erfolgte über mehrere Intermediate. Dazu wurde das TNF-Rezeptor 1 Fragment (cysteinreiche Domänen 1-3; AS 12-138; SwissProt #10039) mit den Primern 5 (SEQ ID NO 14) und 6 (SEQ ID NO 15) aus dem Plasmid pADBTNF-R (Himmler et al. DNA Cell Biol 9:705-715,1990) PCR amplifiziert, mit den Primern 7 (SEQ ID NO 16) und 6 (SEQ ID NO 15) reamplifiziert, wodurch die Schnittstellen Acc3, BamH1 und ein Linker 5' vom TNFR Fragment eingeführt wurde, der die Proteaseschnittstellen kodiert. Dieses Fragment wurde über die Schnittstellen Acc3/BamH1 in das in 3. beschriebene Intermediat kloniert.
5. Über PCR Amplifikation mit den Primern 8 (SEQ ID NO 17) und 6 (SEQ ID NO 15) wurde eine Modifikation des Protease-sensitiven Linkers im Linker- TNFR1 -Fragment eingeführt. Das so erhaltene Fragment wurde über die Schnittstellen Cla1 und BamH1 in das unter 4. beschriebenen Intermediat eingefügt, das zuvor enthaltene Linker-TNFR Fragment ersetzend. Das so hergestellte eukaryotische Expressionsplasmid pW24 erlaubt die Expression der TNF-Selektokin-Prodrug W24.
6. In einer weiteren Ausführungsform des TNF-Selektokin-Prodrugs wird ein TNF-Rezeptor mit den Primern 9 und 10 PCR amplifiziert, resultierend in einer für AA 54-115 des humanen TNFR1 kodierenden Sequenz mit 5' liegendem Linker. Dieses Fragment wird über die Sah- und BamH1 -Schnittstellen in pW24 eingefügt und ersetzt das dort enthaltene Linker-TNFR1 Fragment. Das resultierend Expressionsplasmid pW33 erlaubt die Expression der TNF- Selektokin-Prodrug W33.
7. Zur Gewinnung von TNF-Selektokine-Prodrug (W24 und W33) wurden CHO- DG44 Zellen mit den unter 5. und 6. beschriebenen Konstrukten nach Angaben des Herstellers mit Lipofektamin (Gibco-BRL) transfiziert und anschliesend mittels Hypoxanthin und Thymidin freiem (HT~~) CHO-S-SFM Medium (Life Technologies) auf stabile Integration der Konstrukte ins Genom hin selektioniert. Eine Expressionssteigerung wurde durch eine schrittweise Erhöhung des Selektionsreagenzes Methotrexat (0,1 ; 1 ; 10 μM) erhalten. Sowohl W24 als auch W33 wurden mittels Immobilized Metal Affinity Chromatography (IMAC) wie in Rippmann et al. (Appl EnvMicrobiol 64:4862- 4869,1998) beschrieben unter sterilen Bedingungen aus den Kulturüberständen gereinigt und bei 4°C bis zur weiteren Verwendung gelagert.
Alle Klonierungs- und PCR-Amplifikationsschritte erfolgten nach üblichen Standardprozeduren mit den nachfolgenden Primern. Alle Konstrukte wurden zur Verifikation der cDNA-Sequenz sequenziert. Die relevanten Schnittstellen sind fett gedruckt.
Primer 1 (SEQ ID NO 10)
Not1 5' TAA ATA GGG GCC CAC AGC CAG GCG GCC GCC TGT GGC TGT GCG GCT GC 3'
Primer 2 (SEQ ID 11)
Kpn1 5' ATA AAT GGT ACC CTG CTC CCG GAG GGA GGA 3' Primer 3 (SEQ ID NO 12)
Kpn1 5' GAG AGG GTA CCG GAG GTG GGT CTG GCC CCC AGA GGG AAG AG 3'
Primer 4 (SEQ ID N0 13)
BamH1 Acc3
5' TTG TTC GGA TCC ACG ACC CTC GAT TCC GGA CAG GGC AAT GAT CCC AAAG 3'
Primer 5 (SEQ ID NO 14)
BamH1 5' CTC GGG ATC CGG CGG TGG CAG ATC TGG CGG GGG TGG GGT CGA CAG TGT GTG TCC CCA AGG 3'
Primer 6 (SEQ ID NO 15)
BamH1 5' CCT GCG GAT CCG GTG CAC ACG GTG TTC TG 3'
Primer 7 (SEQ ID N0 16)
Acc3 Cla1
5' GCC TTC CGG AAT GTA, CCC CAG AGG ATC GAT TGG TGG CAG ATC TGG CGG 3'
Primer 8 (SEQ ID NO 17)
Cla1 5' AGT GGA TCG ATC GGC GCC CCC TTC GGC CGC GGC GCC CCC TTC GTA CGC ATC GAG GGT CGG GTC GAC AGT GTG TGT C 3'

Claims

Ansprüche
1. Polypeptid mit einer Aminosäuresequenz, umfassend von N- nach C- terminal
(1 ) eine Region, die ein spezifisches Makromolekül auf einer Zelloberfläche und/oder eine Komponente der extrazellulären Matrix selektiv erkennt,
(2) eine Region, welche einen Peptidlinker umfasst,
(3) eine Region mit einer biologischen Aktivität für ein spezifisches Zielmolekül,
(4) eine Region, die mindestens eine Prozessierungsstelle aufweist, und
(5) eine Region, welche die biologische Aktivität der Region (3) durch intramolekulare Bindung und/oder Wechselwirkung hemmt, wobei die biologische Aktivität der Region (3) durch Prozessierung in vivo der mindestens einen Prozessierungsstelle in Region (4) freisetzbar ist.
2. Polypeptid nach Anspruch 1, wobei die Region (3) eine Aminosäuresequenz eines Zytokins oder ein Fragment davon enthält.
3. Polypeptid nach Anspruch 2, wobei das Zytokin ein Tumor-Nekrose-Faktor (TNF), ein biologisch wirksames Derivat oder eine biologisch wirksame Mutante davon ist.
4. Polypeptid nach einem der Ansprüche 1 bis 3, wobei das spezifische Zielmolekül der Region (3) ein Zellmembran-gebundener Zytokinrezeptor ist.
5. Polypeptid nach Anspruch 3 oder 4, wobei die Region (3) die Aminosäurereste 322 bis 486 von SEQ ID NO 1 umfasst.
6. Polypeptid nach einem der Ansprüche 1 bis 5, wobei die mindestens eine Prozessierungsstelle in Region (4) eine Spaltstelle für eine Protease ist.
7. Polypeptid nach Anspruch 5, wobei die Protease eine Urokinase-Typ- Plasminogenaktivator (uPA), Gewebsplasminogen-Aktivator (tPA), aktivierter Gerinnungsfaktor Vlla, eine Matrix-Metalloprotease oder eine FAP-Protease ist.
8. Polypeptid nach Anspruch 6 oder 7, wobei die Region (4) die Aminosäurereste 487 bis 512 von SEQ ID NO 1 oder die Aminosäurereste 487 bis 520 von SEQ ID NO 3 umfasst.
9. Polypeptid nach einem der Ansprüche 1 bis 8, wobei die Region (5) mindestens eine Bindungsstelle für die Region (3) aufweist.
10. Polypeptid nach Anspruch 9, wobei die Region (5) ein Rezeptor für ein Zytokin oder ein Fragment davon ist.
11. Polypeptid nach Anspruch 10, wobei der Rezeptor die vollständige oder partielle extrazelluläre Domäne eines humanen TNF-Rezeptors und/oder ein TNF-bindendes Virus-Protein oder eine Mutante dieser oder eine synthetische TNF-bindende Verbindung umfasst.
12. Polypeptid nach Anspruch 11 , wobei die Region (5) die Aminosäurereste 513 bis 639 von SEQ ID NO 1 oder die Aminosäurereste 521 bis 582 von SEQ ID NO 3 umfasst.
13. Polypeptid nach einem der Ansprüche 1 bis 12, wobei der Peptidlinker in Region (2) ein Trimerisierungsmodul ist und die Region (1) mit der Region (3) verbindet.
14. Polypeptid nach Anspruch 13, wobei das Trimerisierungsmodul ein natürlich vorkommendes oder synthetisches Peptid mit intrinsischen Trimerisierungseigenschaften umfasst.
15. Polypeptid nach Anspruch 14, wobei die Region (2) Aminosäuresequenz von SEQ ID NO 5 oder SEQ ID NO 6 umfasst.
16. Polypeptid nach einem der Ansprüche 1 bis 15, wobei die Region (1 ) für ein Zelloberflächenmolekül spezifisch ist, welches in Tumorläsionen und/oder proliferierenden Endothelzellen, die mit dem Prozess der Angiogenese assoziiert sind, exprimiert wird.
17. Polypeptid nach einem der Ansprüche 1 bis 15, wobei die Region (1 ) für eine Komponente der extrazellulären Matrix spezifisch ist, die in Tumorläsionen, und/oder Angiogenesebereichen pathologischer Läsionen vorhanden ist.
18. Polypeptid nach einem der Ansprüche 1 bis 15, wobei die Region (1 ) für eine Komponente der malignen Tumorzelle selbst spezifisch ist.
19. Polypeptid nach einem der Ansprüche 1 bis 18, wobei die Region (1 ) ein muriner, humanisierter oder humaner Antikörper oder ein Fragment davon mit definierter Antigenspezifität ist.
20. Polypeptid nach Anspruch 19, wobei das Antikörperfragment ein scFv- oder Fab-Fragment ist
21. Polypeptid nach Anspruch 20, wobei die Region (1) die Aminosäurereste 20 bis 285 von SEQ ID NO 1 umfasst.
22. Nukleinsäure, die eine Nukleotidsequenz umfasst, welche für das Polypeptid nach einem der Ansprüche 1 bis 21 kodiert.
23. Vektor, enthaltend die Nukleinsäure nach Anspruch 22.
24. Vektor nach Anspruch 23, der zur Expression und/oder Amplifikation in einer prokaryontischen und/oder eukaryontischen Zelle befähigt ist.
25. Wirtszelle, enthaltend die Nukleinsäure nach Anspruch 22 und/oder den Vektor nach Anspruch 23 oder 24.
26. Verfahren zur Herstellung des Polypeptids nach einem der Ansprüche 1 bis 21 , umfassend die Schritte
(a) Züchten der Wirtszelle nach Anspruch 25 in einem Kulturmedium unter geeigneten Bedingungen und
(b) Isolieren des Polypeptids nach einem der Ansprüche 1 bis 21 aus den Wirtszellen und/oder dem Kulturmedium.
27. Pharmazeutische Zusammensetzung, enthaltend in pharmazeutisch wirksamer Menge das Polypeptid nach einem der Ansprüche 1 bis 21 und/oder die Nukleinsäure nach Anspruch 22 und/oder den Vektor nach Anspruch 23 oder 24, gegebenenfalls in Verbindung mit einem oder mehreren pharmazeutisch verträglichen Hilfsstoffen, Verdünnungsmitteln und/oder Trägern.
28. Pharmazeutische Zusammensetzung nach Anspruch 27 zur therapeutischen Behandlung solider Tumoren und/oder der Angiogenese in pathologischen Läsionen.
29. Pharmazeutische Zusammensetzung nach Anspruch 27 oder 28, die fest, flüssig oder aerosolartig ist.
EP01974261A 2000-09-15 2001-09-17 Fusionsprotein aus antikörper-zytokin-zytokin inhibitor (selektokin) als zielspezifisches prodrug Withdrawn EP1317556A1 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
DE10045592 2000-09-15
DE10045592A DE10045592A1 (de) 2000-09-15 2000-09-15 Ein Antikörper-TNF-TNF Inhibitor Fusionsprotein (TNF-Selektokin) als zielspezifisches Prozytokin zur Tumortherapie
PCT/EP2001/010730 WO2002022833A1 (de) 2000-09-15 2001-09-17 Fusionsprotein aus antikörper-zytokin-zytokin inhibitor (selektokin) als zielspezifisches prodrug

Publications (1)

Publication Number Publication Date
EP1317556A1 true EP1317556A1 (de) 2003-06-11

Family

ID=7656260

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01974261A Withdrawn EP1317556A1 (de) 2000-09-15 2001-09-17 Fusionsprotein aus antikörper-zytokin-zytokin inhibitor (selektokin) als zielspezifisches prodrug

Country Status (22)

Country Link
US (1) US20040053829A1 (de)
EP (1) EP1317556A1 (de)
JP (1) JP2004508828A (de)
KR (1) KR20030048041A (de)
CN (1) CN1214115C (de)
AU (1) AU2001293819A1 (de)
BG (1) BG107613A (de)
BR (1) BR0113928A (de)
CA (1) CA2422759A1 (de)
DE (1) DE10045592A1 (de)
EE (1) EE200300100A (de)
HR (1) HRP20030192A2 (de)
HU (1) HUP0301693A3 (de)
IL (1) IL154185A0 (de)
MX (1) MXPA03002229A (de)
NO (1) NO20031185L (de)
PL (1) PL360540A1 (de)
RU (1) RU2003106429A (de)
SK (1) SK2812003A3 (de)
WO (1) WO2002022833A1 (de)
YU (1) YU18903A (de)
ZA (1) ZA200302008B (de)

Families Citing this family (28)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002043773A2 (en) * 2000-12-01 2002-06-06 The Johns Hopkins University Tissue specific prodrugs
PE20021080A1 (es) * 2001-04-12 2003-02-12 Boehringer Ingelheim Int Un anticuerpo especifico fapo bibh1 en el tratamiento del cancer
DE10144252A1 (de) 2001-08-31 2003-03-27 Fraunhofer Ges Forschung Nanopartikel mit daran immobilisiertem biologisch aktivem TNF
US7057026B2 (en) 2001-12-04 2006-06-06 Solexa Limited Labelled nucleotides
DE10247755B4 (de) * 2002-10-14 2006-01-19 Pfizenmaier, Klaus, Prof. Dr. Selektive, lokale Aktivierung von Mitgliedern der TNF-Rezeptorfamilie durch systemisch inaktive nicht-Antikörper-TNF-Liganden-Fusionsproteine
US20060235201A1 (en) * 2003-02-06 2006-10-19 Roman Kischel Enduring T cell response
US7374898B2 (en) * 2004-10-12 2008-05-20 The Research Foundation Of State University Of New York Peptide inhibitors against seprase
US20090041783A1 (en) 2005-04-28 2009-02-12 Mochida Pharmaceutical Co., Ltd. Anti-platelet membrane glycoprotein vi monoclonal antibody
EP1736482A1 (de) * 2005-06-20 2006-12-27 INSERM (Institut National de la Santé et de la Recherche Medicale) Rekombinanter trimerer 4-1BB Ligand
DE102005036542A1 (de) * 2005-08-03 2007-02-08 Universität Stuttgart CTL-Prodrug
EP1972350A1 (de) * 2007-03-20 2008-09-24 Rijksuniversiteit Groningen Duales Targeting-System
EP2009022A1 (de) * 2007-06-26 2008-12-31 Apogenix GmbH Trimere Todesliganden mit erhöhter Aktivität (Tenascin)
US20090304719A1 (en) 2007-08-22 2009-12-10 Patrick Daugherty Activatable binding polypeptides and methods of identification and use thereof
US8895702B2 (en) 2008-12-08 2014-11-25 City Of Hope Development of masked therapeutic antibodies to limit off-target effects; application to anti-EGFR antibodies
RU2636046C2 (ru) 2009-01-12 2017-11-17 Сайтомкс Терапьютикс, Инк Композиции модифицированных антител, способы их получения и применения
AU2010215761B2 (en) 2009-02-23 2017-04-06 Cytomx Therapeutics, Inc Proproteins and methods of use thereof
EP3762406A2 (de) * 2018-03-09 2021-01-13 Askgene Pharma, Inc. Zytokin-prodrugs
AU2019271148B9 (en) 2018-05-14 2025-05-29 Werewolf Therapeutics, Inc. Activatable interleukin-2 polypeptides and methods of use thereof
WO2019222296A1 (en) 2018-05-14 2019-11-21 Werewolf Therapeutics, Inc. Activatable interleukin 12 polypeptides and methods of use thereof
WO2020023702A1 (en) 2018-07-25 2020-01-30 AskGene Pharma, Inc. Novel il-21 prodrugs and methods of use thereof
US20220002370A1 (en) * 2018-09-27 2022-01-06 Xilio Development, Inc. Masked cytokine polypeptides
EP3969035A4 (de) 2019-05-14 2023-06-21 Werewolf Therapeutics, Inc. Trennungseinheiten und verfahren und ihre verwendung
CA3141626A1 (en) * 2019-06-12 2020-12-17 AskGene Pharma, Inc. Novel il-15 prodrugs and methods of use thereof
US20220289822A1 (en) * 2019-08-21 2022-09-15 AskGene Pharma, Inc. Novel il-21 prodrugs and methods of use thereof
AU2020353235A1 (en) * 2019-09-28 2022-03-31 AskGene Pharma, Inc. Cytokine prodrugs and dual-prodrugs
MX2022005666A (es) 2019-11-14 2022-10-07 Werewolf Therapeutics Inc Polipeptidos de citocina activables y metodos de uso de los mismos.
CA3165927A1 (en) 2020-01-11 2021-07-15 AskGene Pharma, Inc. Novel masked cytokines and methods of use thereof
WO2022115865A2 (en) 2020-11-25 2022-06-02 Xilio Development, Inc. Tumor-specific cleavable linkers

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1981001145A1 (en) * 1979-10-18 1981-04-30 Univ Illinois Hydrolytic enzyme-activatible pro-drugs
US5502037A (en) * 1993-07-09 1996-03-26 Neuromed Technologies, Inc. Pro-cytotoxic drug conjugates for anticancer therapy
US5763733A (en) * 1994-10-13 1998-06-09 Enzon, Inc. Antigen-binding fusion proteins
US5614191A (en) * 1995-03-15 1997-03-25 The United States Of America As Represented By The Department Of Health And Human Services IL-13 receptor specific chimeric proteins and uses thereof
DE19900709A1 (de) * 1999-01-11 2000-07-13 Falkenberg Frank W Eine neue Applikationsform für biologisch wirksame Substanzen zur Anwendung bei Menschen und Tieren

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0222833A1 *

Also Published As

Publication number Publication date
CN1458977A (zh) 2003-11-26
BG107613A (bg) 2003-12-31
BR0113928A (pt) 2003-07-22
CN1214115C (zh) 2005-08-10
JP2004508828A (ja) 2004-03-25
NO20031185L (no) 2003-05-05
SK2812003A3 (en) 2003-11-04
YU18903A (sh) 2006-05-25
MXPA03002229A (es) 2005-06-20
EE200300100A (et) 2005-02-15
RU2003106429A (ru) 2004-08-27
IL154185A0 (en) 2003-07-31
KR20030048041A (ko) 2003-06-18
PL360540A1 (en) 2004-09-06
DE10045592A1 (de) 2002-03-28
NO20031185D0 (no) 2003-03-14
HUP0301693A3 (en) 2005-11-28
HRP20030192A2 (en) 2005-10-31
AU2001293819A1 (en) 2002-03-26
ZA200302008B (en) 2004-06-25
WO2002022833A1 (de) 2002-03-21
CA2422759A1 (en) 2003-03-17
HUP0301693A2 (hu) 2003-08-28
US20040053829A1 (en) 2004-03-18

Similar Documents

Publication Publication Date Title
EP1317556A1 (de) Fusionsprotein aus antikörper-zytokin-zytokin inhibitor (selektokin) als zielspezifisches prodrug
Peppel et al. A tumor necrosis factor (TNF) receptor-IgG heavy chain chimeric protein as a bivalent antagonist of TNF activity.
DE69133036T2 (de) Cytokine immunokonjugate
EP1317488B1 (de) ORTSSPEZIFISCHE, ANTIKÖRPERVERMITTELTE AKTIVIERUNG PROAPOPTOTISCHER ZYTOKINE: AMAIZe (ANTIBODY-MEDIATED APOPTOSIS INDUCING ZYTOKINE)
DE69132925T2 (de) An stabile proteinkernstruktur gebundene proteinpolyliganden
US5650150A (en) Recombinant antibody cytokine fusion proteins
RU2157701C2 (ru) Иммуноконъюгаты, способ получения, фармацевтическая композиция
DE60203996T2 (de) Concatamere immunadhäsion
DE69931908T2 (de) Steigerung der antikörper-zytokin-fusionsproteinmediierten immunantwort durch mitverabreichung mit einem angiogeneseinhibitor
DE69428764T2 (de) Immunokonjugate
DE69528894T2 (de) Bifunktionelles protein, herstellung und verwendung
DE10235248B4 (de) Fusionsprotein mit verstärkter in vivo-Aktivität von Erythropoietin
DE102005036542A1 (de) CTL-Prodrug
DE69420251T2 (de) Löslicher Interferon-Rezeptor, seine Herstellung und Anwendung
EP1551977A1 (de) Selektive, lokale aktivierung von mitgliedern der tnf-liganden familie von systemisch inaktiven nicht-antikörper-tnf-liganden-fusionsproteinen
US20250388695A1 (en) Epcam-cd3 epsilon bispecific antibodies
McGrath et al. Bifunctional fusion between nerve growth factor and a transferrin receptor antibody
CN114456274A (zh) 抗Her-2抗体-趋化因子融合蛋白及其制法和应用
KR100418329B1 (ko) 직렬 연쇄체를 갖는 면역접합체
US20260103522A1 (en) FCeRI BINDING PROTEIN
JPH06169776A (ja) 可溶性ヒトＦｃεＲＩα鎖の製造方法

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030130

AK Designated contracting states

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RIN1 Information on inventor provided before grant (corrected)

Inventor name: SCHEURICH, PETER

Inventor name: GRELL, MATTHIAS

Inventor name: MOOSMAYER, DIETER

Inventor name: WUEST, THOMAS

Inventor name: PFIZENMAIER, KLAUS

17Q First examination report despatched

Effective date: 20060816

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20081202