EP1311298A2 - In vivo system zur regulierung der expression eines transgens durch konditionelle inhibierung - Google Patents
In vivo system zur regulierung der expression eines transgens durch konditionelle inhibierungInfo
- Publication number
- EP1311298A2 EP1311298A2 EP01965323A EP01965323A EP1311298A2 EP 1311298 A2 EP1311298 A2 EP 1311298A2 EP 01965323 A EP01965323 A EP 01965323A EP 01965323 A EP01965323 A EP 01965323A EP 1311298 A2 EP1311298 A2 EP 1311298A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- transcript
- interest
- transgene
- inhibitory
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/02—Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P21/00—Drugs for disorders of the muscular or neuromuscular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/04—Anorexiants; Antiobesity agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/06—Antihyperlipidemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/12—Antihypertensives
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/635—Externally inducible repressor mediated regulation of gene expression, e.g. tetR inducible by tetracyline
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/15—Nucleic acids forming more than 2 strands, e.g. TFOs
Definitions
- the present invention relates to new compositions as well as a new method intended for controlling the expression in vivo of a transgene of therapeutic or experimental interest, by a conditional inhibition system.
- the present invention is particularly useful for the generation of modified animals and plants as well as in gene therapy applications.
- Gene therapy which consists of correcting a deficiency or an anomaly (mutation, aberrant expression, etc.) or even treating a pathology through the expression of a therapeutic transgene, is generally implemented by the introduction of a exogenous or transgene gene in the affected cell or tissue.
- the transgene is placed under the control of a strong promoter, constitutive or inducible, in order to ensure quantitatively and qualitatively optimal expression in vivo.
- the possibility of exercising effective control, particularly of inhibition, of the transgene of interest may prove to be decisive for the success of certain experiments or of therapy, in particular when the expression of the transgene is accompanied by effects.
- secondary eg cytotoxicity.
- cytokines such as TNF- ⁇ , IL-2, IL-4, 1L-12, IL-18, GM-CSF (Agha-Mohammadi, et al., J. Clin.Invest, 105 (2000) 1173-1176), anticoagulants, antibodies, certain enzymatic activators of active substances (Springer et al., J. Clin.Invest, 105 (2000) 1161-1167), cancerotoxic molecules or hormones.
- LAP Lac Activator Protein
- HSV herpes virus
- LAP is in particular capable of activating, in the absence of isopropyi ⁇ -D-thiogalactoside (IPTG) a minimum early promoter of SV40, comprising, upstream or downstream of the transcription unit, the sequences of the lac operator, then that in the presence of IPTG, the activation of the promoter is inhibited (Labow et al., Mol.Cell.Biol., 10 (1990) 3343-3356).
- Another system uses a tetracycline-controlled transactivating protein, which was constructed by fusion of the E. coli Tet repressor with the VP16 transactivating domain of HSV, so as in particular to activate, in the absence of tetracycline, the transcription of a minimum promoter comprising the sequences of the tet operator of response to tetracycline, this activation being able to be inhibited in the presence of tetracycline of one of its derivatives (Gossen et al, Proc Natl Acad Sci USA, 89, (1992) 5547-5551 ; Gossen et al, Science, 268 (1995) 1766-1769).
- the applicants have finally discovered that the transgene could not only be effectively inhibited by its antisense RNA, but also that it was possible to restore a level of biologically effective expression of the transgene, and thus to control the expression of the latter by l 'through its specific inhibitory antisense transcript.
- the subject of the present invention is a new method of in vivo regulation of the expression of a transgene of interest which consists in:
- nucleic acid comprising the sequence of a transgene of interest coding for a transcript of interest or useful transcript, as well as a nucleic acid comprising the sequence of an inhibiting transgene coding for an inhibitor transcript specific for said transcript of interest, said sequences each being under the control of a transcriptional promoter, and the activity of the inhibitor transcript and / or of the transcript of interest can be regulated by an external agent,
- an external agent known as a repressor is administered to the target tissue or cell, resulting in inhibiting the activity of the inhibitory transcript and thus restoring an activity of the transcript of interest, in proportion to the amount of external repressor used.
- an external agent known as an activator is administered to the target tissue or cell, leading to increasing the activity of the transcript of interest.
- an activity of the transcript of interest can be restored in proportion to the amount of the external activating agent used.
- the subject of the present invention is also a method of in vivo transfer of a transgene of interest, consisting in co-administering and coexpressing in a target tissue or cell, a nucleic acid comprising the sequence of a transgene of interest coding for a transcript of interest or useful transcript, as well as a nucleic acid comprising the sequence of a transgene inhibitor encoding a transcript specific inhibitor of said transcript of interest.
- the expression of the transgene of interest or the activity of the transcript of interest is inhibited constitutively, and can be restored by inhibiting the activity of the inhibiting transcript by the administration of an external repressing agent, and / or by administering an external agent capable of leading to the induction of the activity of the transcript of interest.
- the present invention also relates to a method intended to reduce the residual expression of a transgene of interest in vivo, which consists in coinjecting and coexpressing the sequences coding for the transcript of interest and for its specific inhibitory transcript.
- the present invention further relates to a new combination administered in vivo and capable of being used in the method according to the invention.
- This comprises a nucleic acid comprising the sequence of a transgene of interest coding for a transcript of interest or useful transcript, and a nucleic acid comprising a sequence of an inhibitory transgene coding for a transcript inhibitor specific for the transcript of interest, each of the sequences being under the control of a transcriptional promoter, and the activity of the transcript of interest and / or of the inhibitory transcript can be regulated by an external agent.
- transgene of interest means any exogenous nucleic acid molecule, coding for a biological product, namely either a transcript of interest or useful such as an mRNA, an rRNA, a tRNA, a ribozyme, or an aptazyme. , either a protein, a polypeptide, or a peptide of therapeutic or experimental interest.
- the transgene of interest includes a gDNA, a cDNA, DNAs which are natural or which are obtained totally or partially by chemical synthesis.
- transcript of interest or useful transcript an RNA produced by transcription from the transgene of interest as defined above.
- the transcript of interest may be in the form of a MRNA and be translated into a therapeutic protein or peptide with intracellular or secreted action.
- the transcript of interest or useful transcript may be in the form of an RNA having an intrinsic biological activity such as an aptazyme, a ribozyme, an antisense RNA, or an RNA capable of interacting with the constituents of the cells.
- transfected such as, for example, a ribosomal RNA (rRNA), a transfer RNA (tRNA), or an aptamer.
- inhibitory transgene is understood to mean any exogenous nucleic acid molecule capable of producing by transcription an inhibitory transcript having as target the transcript of interest.
- the inhibitory transgene includes a gDNA, a cDNA, natural DNA or DNA obtained totally or partially by chemical synthesis.
- RNA which may be in the form of an antisense RNA, a ribozyme, an RNA capable of forming a triple helix, and which has a certain complementarity or specificity with the transcript d 'interest.
- the transcript is said to be an inhibitor insofar as it is capable of effectively and constitutively inhibiting the transcript of interest, with which it is coexpressed in the target tissue or cell, either at the translational level, by blocking the translation of the transcript from mRNA type interest, either at the level of its biological activity, by blocking the interaction of the transcript of interest rRNA, tRNA, or aptamer with the cellular constituents, or by blocking the interaction of the transcript of interest type aptazyme, ribozyme , or antisense RNA with a target nucleic sequence, either by decreasing the concentration of the transcript of interest by enzymatic degradation.
- This inhibitory transcript is also said to be repressible, that is to say that it can itself be subject to inhibition by means of an external repressing agent.
- the activity of the transcript of interest is understood to mean either its translation into a protein or a peptide of therapeutic or experimental interest, when the transcript of interest is in the form of an mRNA, or its biological activity when the transcript of the interest is in the form of an aptazyme, a ribozyme, or an antisense RNA, that is to say its interaction with the cellular constituents, when the transcript of interest is in the form of a ribosomal RNA, a transfer RNA, or an aptamer.
- external agent is intended to mean any chemical, and preferably pharmacological, or physical agent such as heat, which can be administered by enteral or parenteral routes, having a low toxicity, and having an activity of inhibition or activation of expression d 'a gene.
- One of the advantageous characteristics of the method of regulation by reversible inhibition according to the present invention lies in its capacity to effectively block constitutively the expression of a transgene of interest in vivo or the activity of the transcript of interest or useful, and to restore this expression when it is desired for clinical or experimental reasons.
- This system is based on the coinjection and coexpression of a transgene of interest and its specific inhibitory transcript in vivo, and the possibility of effectively regulating the transgene of interest, either by inhibition of its specific inhibitory transcript, or by activation of the transcript of interest, or again by activation of the transcript of interest and concomitant inhibition of its specific inhibitory transcript.
- the inhibitory transcript is inhibited by an external repressor, in order to lift the inhibition of the transcript of interest and to indirectly restore the activity of the transcript of interest or a sufficient biological level of the transcript of interest.
- Inhibition of the inhibitory transcript can be obtained by placing the sequence of the inhibitory transgene encoding the inhibitory transcript under the control of a repressible promoter or sensitive to an external repressor.
- a repressible promoter or sensitive to an external repressor.
- This system uses the affinity of the tet repressor (tetR) for the tet operator sequence (tetO), the affinity of tetR for tetracycline, as well as the ubiquitous activity of the herpes virus VP16 transactivator in eukaryotic cells.
- This TrRS regulatory system therefore works thanks to a chimeric transactivator (tTA) which results from the fusion of the C-terminal end of VP 6 with the C-terminal end of the tetR protein.
- the tetR part of the tTA transactivator binds to a regulatory sequence comprising for example repeat sequences (2, 7, or 10 repetitions) of the tetracycline operator, and placed upstream of a transcriptional promoter minimum for example of human Cytomegalovirus (hCMV), and activates the transcription of the inhibitory transgene and the production of the inhibitory transcript, ensuring an effective constitutive inhibition of the transcript of interest.
- a regulatory sequence comprising for example repeat sequences (2, 7, or 10 repetitions) of the tetracycline operator
- tetracycline In the presence of tetracycline, it binds to the tetR part of the chimeric transactivator tTA, causes a change in its conformation as well as a loss of affinity for the repeated sequences of the operator of response to tetracycline (tetO). This then results in an inhibition of the production of the inhibitory transcript from the inhibitory transgene and the reestablishment of a level of expression of the transgene of interest or of the activity of the transcript of interest.
- the regulatory sequences comprising the tetO repeat sequences are advantageously integrated within a tissue-specific enhancer / promoter or can be used to replace certain enhancer sequences (Rose et al., J. Biol. Chem. 272 (1997) 4735 -4739; Agha-Mohammadi et al, Gene Ther, 5 (1998) 76-84).
- This system gives thus not only a temporal targeting of the regulation of the transgene of interest, but also spatial.
- the coding sequence for the tTA transactivator and the TrRS promoter driving the transcription of the inhibitory transcript are carried on a single nucleic acid molecule.
- the latter can comprise, for example, the sequence coding for tTA under the control of a viral or tissue-specific promoter, then the cassette of the promoter repressible by tetracycline (TrRS) operably linked with the sequence coding for the inhibitory transcript (O 'Brien et al., Gene, 184 (1997) 115-120).
- An alternative organization of bicistronic type comprising the TrRS expression cassette operably linked to the sequence coding for an inhibitory transcript, followed by an IRES sequence (Internai Ribosome Entry Site) and a coding sequence for tTA, or vice versa, can also be used.
- Yet another example of organization includes a bidirectional promoter which drives the expression of tTA and the inhibitory transcript. In the absence of tetracycline, tTA is expressed and activates the transcription of the inhibitory transgene into an inhibitory transcript, which in turn inhibits the useful or of interest transcript (Liang et al., Gene Ther., 3 (1996) 350- 356).
- the external repressor used according to this first embodiment can be tetracycline or one of its analogs such as doxycycline, anhydrotetracycline, or oxytetracycline (Agha-Mohammadi et al., Gene Ther, 4 ( 1997) 993-997) likely to lead to an inhibition of the transcription of the inhibiting transgene, and therefore of the activity of the inhibiting transcript.
- tetracycline or one of its analogs makes it possible to lift the inhibition by the inhibitory transcript and thus to restore a biologically effective level of the transcript of interest.
- the level of expression of the transcript of interest can be advantageously correlated with the quantity of tetracycline or of the analog administered, insofar as the properties pharmacokinetics and pharmacodynamics of tetracycline and its analogs are well known to those skilled in the art, and are found, among others, in Vidal, and in the chapter "Antimicrobial Agents: Tetracyclines" in: Goodman and Gilaman's The Pharmacological Basis of Therapeutics , 9 th Ed., Jo ⁇ l G. Hardman, Alfred Goodman Gilamn, Lee E. Limbird Ed.
- tetracycline or an analog thereof can be used at low concentrations and therefore the side effects are minimal.
- the inhibitory transgene sequence is placed under the control of a minimal promoter derived from the promoter of the thymidine kinase (TK) gene or from human CMV upstream of which is a regulatory sequence as described in particular in WO96 / 30512.
- TK thymidine kinase
- the inhibition of the inhibitory transcript can also be obtained by insertion within its sequence or of its 5 ′ or 3 ′ ends, of specific sequences such as the aptamers which are described in European application EP 99402552, and by Werstuck et al. (Science 282 (1998) 296-298) and exhibit an autocatalytic activity preferably in the presence of a ligand.
- the inhibitory transcript acquires an autocatalytic activity, which can be activated in the presence of a specific ligand, when it is desired to restore a transcript activity of interest.
- the aptamer nucleotide sequence which is used to inhibit the inhibitory transcript can be any sequence encoding an RNA having ligand-dependent autocatalytic activity.
- RNAse P any artificially obtained functional derivative sequence
- the size of the aptamer sequence can vary according to its nature and origin, but is preferably between 20 and 200 bp.
- RNA fold The location of the insertion of aptamer sequences is generally determined using bioinformatics software such as "RNA fold" in order to ensure optimal stability and cleavage activity depending on the environment and the conformation.
- the inhibition of the inhibitory transcript can finally be carried out by means of a ribozyme acting in trans which, because of its sequence specificity for part of the inhibitory transcript, is capable of recognizing and of hybridizing with the inhibitory transcript , and thus to degrade it.
- the trans ribozyme is in the form of an allosteric ribozyme, that is to say that it has an Iigand-dependent catalytic activity, which is notably activated in the presence of a ligand.
- allosteric ribozymes are well known to those skilled in the art and are in particular described by Soukup et al. (Structure 7 (1999) 783-791) and in WO94 / 13791.
- the activating ligands used are, for example, nucleic acids, proteins, polysaccharides or sugars, or any organic or inorganic molecule capable of binding to the aptamer sequence of the inhibitory transcript or to a sequence of the allosteric ribozyme by a recognition mechanism. molecular, and thus activate the catalytic activity (Famulok M, Curr Opin Struc Biol 9 (1999) 324-329). These are well known to those skilled in the art and are in particular described, inter alia, by Cowan et al. (Nucleic Acids Res. 28 (15) (2000) 2935-2942) and by Werstuck et al. (Science, 282 (1998), 296- 298).
- antibiotics such as doxycycline, pefloxacin, tobramycin, kanamycin, dyes such as the dyes Hoechst H33258 and H33342, mononucleotides such as FMN (flavin mononucleotide), ATP, cAMP, drugs such as theophylline, adjuvants, and substitutes.
- antibiotics such as doxycycline, pefloxacin, tobramycin, kanamycin
- dyes such as the dyes Hoechst H33258 and H33342
- mononucleotides such as FMN (flavin mononucleotide), ATP, cAMP
- drugs such as theophylline, adjuvants, and substitutes.
- the transgene of interest is placed under the control of a functional constitutive promoter in the target tissue or cells, mammals and preferably humans.
- the constitutive promoter driving the expression of the transcript of interest is preferably tissue-specific.
- the transcript of interest is activated, while the activity of the inhibitory transcript is either kept constant, or inhibited concomitantly with the activation of the transcript of interest, in order to restore a sufficient level of expression or biological activity of the latter.
- Activation of the transcript of interest can be obtained by placing the sequence of the transgene of interest encoding the transcript of interest under the control of an inducible promoter.
- the transcript of interest can also be activated by acting on the stability of the latter.
- the activity of the inhibitory transcript can then be kept constant, and in this case, the inhibitory transgene is placed under the control of a constitutive promoter, and is not subjected to any inhibition via an aptamer or a ribozyme with cis or trans ligand-dependent catalytic activity.
- the activity of the inhibitory transcript is repressed, as previously described, concomitantly with the activation of the transcript of interest.
- the constitutive or inducible promoters used in these embodiments are well known to those skilled in the art. It can thus be any promoter or derived sequence of different origin, heterologous or homologous, tissue-specific or not, strong or weak, functional in the tissue or the target cells and therefore capable of directing the transcription of a sequence functionally linked.
- promoter sequences of eukaryotic or viral genes Mention may in particular be made of the promoter sequences of eukaryotic or viral genes.
- ubiquitous promoters can be used in particular (promoter of the HPRT genes, of phosphoglycerate kinase (PGK), ⁇ -actin, tubulin, of histones), promoters of intermediate filaments (promoter of the GFAP genes, desmin, vimentin, neurofilaments, keratin, etc.), the promoters of therapeutic genes (for example the promoter of the MDR, CFTR, Factor VIII, IX, ApoAl, ApoAII, Albumin, Thymidine kinase, etc.
- tissue-specific promoters promoter of the pyruvate kinase gene, villin, intestinal fatty acid binding protein, smooth muscle ⁇ -actin, specific promoters of endothelial cells such as the promoter of von Willebrand factor, specific promoters of myeloid cell lines , and hematopoietic, such as the IgG promoter, the neuronal specific enolase promoter (Forss-Petter et al., Neuron, 5 (1990) 187); etc), the promoter generating the V1 form of VAChT mRNA (acetylcholine transporter; Cervini et al., J. Biol. Chem.
- the functional promoters in a hyperproliferative cell such as the promoter of the p53 gene, the promoter of the transferrin receptor or else the promoters responding to a stimulus (steroid hormone receptor , retinoic acid receptor, etc.).
- the external agents are specific transcriptional activating factors capable of binding in trans, either directly or through nuclear receptors, on a response element (RE) of the inducible promoter which directs the expression of the transcript of interest.
- the rapamycin regulatory system can also be used (Rivera et al., Nat. Med. 2 (1996) 1028-1032).
- This uses a bipartite transcription factor comprising two chimeric peptides of human origin, namely a first chimeric DNA binding protein ZFHD1-FKBP12 and a second chimeric protein which results from the fusion of the truncated FRAP cellular protein. and of a sequence of 189 amino acids at the C-terminal of the protein NF-kB65.
- the protein ZFHD1-FKBP12 binds to the chimeric protein FRAP-p65 which activates the dependent ZFHD1 promoter.
- inert analogs of rapamycin are used as activating agent, which can be administered, for example, orally or intravenously (Ye et al., Science, 283 ( 1999) 88-91).
- the inducible prorhotrice sequence of the transgene of interest is as described in French application FR 99 07957 or by Frohnert et al. (J. Biol. Chem. 274 (1999) 3970-3977) and includes one or more response elements (PPRE) linked to a minimal transcriptional promoter.
- PPRE response elements
- This system for activating the expression of the transgene of interest works with the PPAR ⁇ or ⁇ nuclear receptors (Peroxisome Proliferator Activated Receptor) as transcriptional regulators.
- the retinoid X receptors such as human RXR ⁇ , which are capable of heterodimerizing with PPARs and thus of synergizing the activation of the transgene of interest, are used as transcriptional co-regulator (Mangelsdorf et al.
- a PPAR ⁇ or ⁇ in its native form, without modification of primary structure or a modified PPAR comprising one or more ligand binding sites or E / F domains, preferably between 2 to 4 (Schoonjans et al., Biochim Biophys Acta 1302 (1996) 93-109).
- the boundaries of the E / F domains vary from one PPAR to another.
- the E / F domain extends from amino acid 284 to amino acid 505.
- PPAR ⁇ 2 ⁇ 2 a transcriptional regulator of the expression in vivo of transgene of interest
- PPAR ⁇ 2 ⁇ 2 a transcriptional regulator of the expression in vivo of transgene of interest
- PPAR ⁇ 2 ⁇ 2 a transcriptional regulator of the expression in vivo of transgene of interest
- PPAR ⁇ 2 ⁇ 2 a transcriptional regulator of the expression in vivo of transgene of interest
- PPAR ⁇ 2 ⁇ 2 that is to say a modified human PPAR ⁇ comprising two repeated domains E and F, the complete protein sequence of which is represented in the sequence SEQ ID NO: 1.
- the PPAR response element which is therefore a nucleic acid region capable of fixing a PPAR, and thus mediating a transcription activation signal of the transgene of interest, can comprise one or more sites. of PPAR.
- sites are described in the prior art, as for example in different human promoters such as the promoter of the human apolipoprotein AH (Apoll) gene (Vu-Dac et al., J Clin Invest, 96 (2), (1995), 741-750).
- the activating ligands of PPAR ⁇ are used, for example fibrates such as fibric acid and its analogs.
- fibrates such as fibric acid and its analogs.
- analogs of fibric acid mention may be made in particular of gemfibrozyl (Atherosclerosis 114 (1) (1995) 61), bezafibrate (Hepatology 21 (1995) 1025), ciprofibrate (BCE & M 9 (4) (1995) 825), clofibrate (Drug Safety 11 (1994) 301), fenofibrate (Fenofibrate Monograph, Oxford Clinical Communications, 1995), clinofibrate (Kidney International.
- the external activating agents can also be chosen from the natural and synthetic ligands of PPAR ⁇ .
- natural ligands there may be mentioned fatty acids and eicosanoids such as, for example, linoleic acid, linolenic acid, 9-HODE, 5-HODE, and as synthetic ligands, thiazolidinediones, such as in particular, may be mentioned.
- rosiglitazone (BRL49653), pioglitazone or troglitazone (see for example Krey G. et al., Mol. Endocrinol., 11 (1997) 779-791 or Kliewer S. and Willson T., Curr. Opin. in Gen. Dev. 8 (1998) 576-581) or the compound RG12525.
- they may be promoter sequences originating from the genome of a virus, such as for example the promoters of the E1A and MLP genes of adenovirus, the early promoter of CMV, or also the promoter of the LTR of RSV or of the MMTV, the promoter of the TK gene of the herpes virus, etc.
- these promoter regions can be modified by addition or deletion of sequences.
- the system according to the present invention ensures faster activation and subsequent inhibition of the exogenous gene and effective. Indeed, the method according to the present invention allows simultaneously the de-induction of the useful transcript, to lift the inhibition of the inhibiting transcript, and thus to reduce, more quickly and to a greatly lowered residual level, the expression d 'a transgene of interest.
- the inhibitory transcript is in the form of an antisense RNA, and is called an inhibitory transcript of the antisense RNA type.
- the latter generally comprises a nucleotide sequence complementary to at least part of the transcript of interest, and hybridizes selectively to the transcripts of interest by conventional Watson-Crick type interactions.
- the antisense RNA-type inhibitory transcript can therefore bind to the transcript of interest and for example block access to the cellular translation machinery at the 5 ′ end of the transcript of interest when the latter is an mRNA, hampering its translation. in protein, and allow the suppression of the expression of the transgene of interest in vivo (Kumar et al., Microbiol. Mol. Biol. Rev, 62 (1993) 1415-1434).
- Such polynucleotides have for example been described in patents EP 92574 and EP 140308.
- the inhibitory transcript When the inhibitory transcript is of the antisense RNA type, it can cover all or part of the coding sequence of the transcript of interest of mRNA type, or all or part of the non-coding sequence in 3 ′ or 5 ′.
- the antisense inhibitory transcript is complementary to the ribosome binding and translation initiation sequence (Coleman J et al., Nature 315 (1990) 601-603).
- the inhibitory transcript is at least 10 ribonucleotides in length.
- the determination of the length and the sequence of the nucleic acid coding for the inhibitory transcript can be carried out by routine experimentation consisting in coinjecting and coexpressing the nucleic acids coding for the inhibitory transcript and for the transcript of interest, and to verify effective inhibition by various detection techniques known to those skilled in the art such as RT-PCR, the various assay techniques for the protein of interest, and detection on Western blot.
- the nucleic acids coding for the transcript of interest and for the antisense inhibitory transcript advantageously comprise the signals allowing the transcription to be stopped as well as signals allowing its stabilization such as for example a 5 'cap and a polyadenylation site. in 3 ', and possibly an intron.
- the antisense RNA-type inhibitory transcripts which are coexpressed with the transgene of interest in a tissue or target cells, are thus capable of effectively blocking the expression of the transgene of interest at the level translational, or the biological activity of the transcript of interest at the level of the target tissue or cells.
- the inhibitory transcript can also be in the form of a catalytic RNA or ribozyme targeting the transcript of interest, and is designated an inhibitory transcript of the ribozyme type.
- the ribozyme may for example be a cis ribozyme, that is to say acting at the intracellular level in cis (Cech TR, Biosci Rep, 10 (3) (1990), 239-261).
- it is a trans ribozyme, that is to say capable of degrading several transcripts of interest into trans (Robertson et al., Nature 344 (1990) 467; Ellington et al.
- the ribozyme inhibitory transcript generally has two distinct regions. A first region which has a certain specificity for the transcript of interest and is therefore capable of binding to the latter, while the second region confers on the ribozyme its catalytic activity of cleavage, ligation and splicing of the transcript of interest.
- ribozymes can be used, such as hammerhead or circular ribozymes, hairpin ribozymes, lasso ribozymes, tetrahymena ribozymes, or RNAse P (Clouet- d'Orval B. et al. , Biochemistry, 34 (1995) 11186-90; Olive JE et al., EMBO J, 14 (1995) 3247-51; Rogers et al. J Mol Biol, 259 (1996), 916-25).
- the ribozyme-type inhibitory transcript is allosteric, that is to say that its catalytic activity is regulated by a ligand (Szostak, TIBS, 10 (1992) 89).
- Some allosteric ribozymes exhibit spontaneous target RNA cleavage activity, while others are activated or inhibited following a change in conformation or following a hybridization reaction.
- Other allosteric ribozymes called aptazymes are endowed with a ligand-dependent autocleavage activity which is preferably activated by the binding of a ligand.
- Such regulatable ribozymes which are described inter alia in international applications WO 94/13791 and WO96 / 21730, and generally have a ribozyme sequence as well as a ligand binding sequence which ensures the control of the cleavage activity.
- the ribozyme-type inhibitory transcript used in the present invention is preferably inactivated by the binding of a ligand, that is to say that it exerts a constitutive catalytic activity against the transcript of interest in the absence of ligand, and can be inactivated by the administration of a ligand, in order to restore a biologically sufficient level of the transcript of interest. (Forter et al., Science, 249 (1990) 783-786).
- the size of the ribozyme inhibitor transcript can vary depending on its nature and / or origin. It is generally between 10 and 500 base pairs, and preferably below 300 base pairs.
- the nucleic acid coding for the inhibitor ribozyme transcript can, in particular, come from RNA sequences of natural origin or be obtained by chemical synthesis, for example using an automatic synthesizer.
- the ligands used for the regulation of allosteric ribozymes are for example nucleic acids, proteins, polysaccharides or sugars, or any organic or inorganic molecules capable of binding to the ribozyme inhibitory transcript and of inhibiting the cleavage reaction of the transcript of interest, or else to bind to the inhibitory transcript aptazyme, and thus to activate the autocleavage reaction.
- the ligand is an external agent such as a non-toxic agent or drug which can be administered in vivo by various external routes, and thus act at the level of the target cell or tissue in order to inhibit the allosteric ribozyme, and to restore sufficient concentration and activity of the transcript of interest. It is preferably an antibiotic such as tetracycline, doxycycline, or pefloxacin, or an adjuvant harmless to the organism to which it is administered.
- the inhibitory ribozyme transcripts which are coexpressed with the transgene of interest in a tissue or target cells, are thus capable of effectively blocking the expression of the transgene of interest at the translational level.
- the concentration of the transcript of interest by enzymatic degradation of the nuclease, transferase, and polymerase type, the biological activity of the transcript of interest at the level of the tissue or of the target cells, or else its interaction with the cellular constituents.
- the inhibitory transcript is in the form of RNA forming triples helices, and capable of associating with the transgene of interest or transcript of interest with which it is coexpressed in vivo.
- RNA is described inter alia, in application WO95 / 18223, by Giovannangeli et al., (J. Am. Chem. Soc, 113 (1991) 7775-7) and by Hélène et al. (CibaFound Symp. 209 (1997), 84-102).
- composite RNAs comprising at least:
- a first region capable of forming a double helix with the target single-stranded nucleic acid at the level of the sequence of the transgene of interest or with a part of it.
- each of the regions can be continuous or interrupted.
- the polynucleotide according to this particular embodiment has a length greater than 10 bases, and, more preferably, greater than 15 bases.
- This length is adapted by a person skilled in the art as a function of the length of the nucleic acid of the targeted single-stranded transgene of interest or of the transcript of interest, so as to ensure the stability, the specificity and the selectivity of the transcribed inhibitor triple helix.
- the method according to the present invention allows the transfer of foreign or exogenous genes and the control of their expression in an efficient and reversible manner.
- This is advantageous when the therapeutic product of the transgene of interest has an optimal action within a certain well defined concentration range and becomes toxic outside this concentration range (Dranoff et al. Proc. Natl.Acad.Sci. (1993) 3539-3543; Schmidt et al., Proc.Natl.Acad.Sci., 92 (1995) 4711-4714; Naffakh et al., Mol. Med. Today, 2 (1996) 343-348).
- certain clinical applications require precise regulation of the expression of the transgene of interest at predefined biological or therapeutic levels, in order to optimize its activity in vivo.
- the reversible negative regulation method according to the present invention is particularly useful when the expression of a transgene of interest or the activity of the transcript of interest must be kept to a minimum, or even even extinguished for long periods. and that rapid induction is required at specific times, whether for therapeutic or experimental needs.
- the method for controlling the expression of an exogenous gene by reversible inhibition makes it possible to control the expression of any transgene having an experimental interest whose function is to be studied in vivo, the implication in molecular mechanisms or in cell signaling such as for example receptors, transcription factors, transporters, etc., or any transgene of interest coding in particular for a product of therapeutic interest, whether it is a peptide, polypeptide , protein, ribonucleic acid, etc.
- the transgene of interest is a DNA sequence (cDNA, gDNA, synthetic DNA, human, animal, plant, etc.) coding for a protein product.
- the transcript of interest can be an antisense sequence, the expression of which in the target cell makes it possible to control the expression of genes or the transcription of cellular mRNAs.
- Such sequences can for example be transcribed, in the target cell, into RNAs complementary to cellular mRNAs and thus block their translation into protein, according to the technique described in patent EP 140 308.
- the transcript of interest can also be an RNA ligand (WO91 / 19813).
- the present invention is particularly suitable for the expression of sequences coding for toxic factors. It may in particular be poisons for cells (diphtheria toxin, pseudomonas toxin, ricin A, etc.) of product inducing sensitivity to an external agent (suicide genes: Thymidine kinase, cytosine deaminase, etc.) or of genes capable of inducing cell death (Grb3 -3) (WO96 / 07981), anti-ras ScFv (W094 / 29446), etc).
- This system is therefore particularly suitable for antitumor therapy strategies for example, for the expression of cytokines, interferons, TNF or TGF for example, the uncontrolled production of which can have very marked side effects.
- This system is also particularly suitable for gene therapy strategies such as angiogenesis using a gene for a growth factor such as for example FGF or VEGF. It is suitable for controlling the expression of hormones such as erythropoietin or anti-cytokines such as the soluble TNF- ⁇ receptor used for the purposes of anti-inflammatory therapies.
- hormones such as erythropoietin or anti-cytokines such as the soluble TNF- ⁇ receptor used for the purposes of anti-inflammatory therapies.
- the combination of the nucleic acid comprising the sequence of the transgene of interest coding for the transcript of interest and the nucleic acid comprising the sequence coding for the inhibitory transcript is transferred simultaneously into the tissue or target cell to allow their coexpression.
- Different physical or mechanical techniques exist for carrying out the transfer of these nucleic acids, such as for example injection, ballistic technique, electroporation, electropermeabilization, electrotransfer, sonoporation, techniques using electric fields, microwave, heat, hydrostatic pressure, or any suitable combination of these techniques (Budker et al., J. Gen. Medicine, 2 (2000) 76-88).
- the association of nucleic acids is introduced by injection and electrotransfer, that is to say by the action of an electric field.
- the electrotransfer technique is described in particular in applications WO99 / 01 57 and WO99 / 01158 and by Aihara et al., Nat. Biotechnol. 16 (9) (1998) 867-870; Mir et al., Proc. Natl. Acad. Sc, 96 (1999), 4262-4267; Rizzuto et al., Proc. Natl. Acad. Sci., 96 (1999) 6417-6422.
- the nucleic acid molecules which it is desired to transfer can be administered, for example, directly into the tissue or topically or systemically, then one or more electrical pulses of an intensity between 1 and 800 volts / cm, of preferably between 20 and 200 Volts / cm are applied.
- the combination of nucleic acids according to the present invention can be injected in the form of naked DNA according to the technique described in application WO 90/11092. It can also be administered in complex form with a chemical or biochemical agent.
- a chemical or biochemical agent mention may, for example, be made of lipofectamine, which associates with DNA by forming vesicles called lipoplexes, as well as other polymers such as DEAE-dextran (Pagano et al., J. Virol.
- the nucleic acids can also be incorporated into lipids in raw form (Felgner et al., PNAS, 84 (1987) 7413) or even be incorporated into a vector such as a liposome (Fraley et al., J. Biol. Chem. 255 (1980) 10431) or a nanoparticle.
- Liposomes are phospholipid vesicles with an internal aqueous phase in which nucleic acids can be encapsulated.
- the synthesis of liposomes and their use for the transfer of nucleic acids is known in the prior art (WO91 / 06309, WO92 / 19752, WO92 / 19730).
- Nanoparticles are small particles, generally less than 500 nm, capable of transporting or vectorizing an active ingredient (such as a nucleic acid) in cells or in the bloodstream.
- the nanoparticles can consist of polymers comprising a majority of degradable units such as polylactic acid, optionally copolymerized with polyethylene glycol.
- Other polymers which can be used in the production of nanoparticles have been described in the prior art (EP 275,796; EP 520,889).
- nucleic acids which comprise a nucleic acid comprising the sequence of a transgene of interest coding for a transcript of interest or useful transcript, as well as a nucleic acid comprising the sequence of a inhibitory transgene encoding a specific inhibitory transcript of the transcript of interest.
- the nucleic acids can be carried by the same vector or by separate vectors. When they are carried on the same vector, they are preferably carried on the same strand.
- the vector used can be of various origins, since it is capable of transforming plant and animal cells, and preferably human cells. It can also be a non-viral vector such as a plasmid, an episome, a cosmid, an artificial chromosome, or a viral vector.
- a viral vector is used, which can be chosen from adenoviruses, retroviruses, adeno-associated viruses (AAV), herpes virus, cytomegalovirus, vaccinia virus, etc. It can also be a phage, an invasive bacteria or a parasite.
- Vectors derived from adenoviruses, retroviruses, or AAVs incorporating heterologous nucleic acid sequences have been described in the literature [Akli et al., Nature Genetics 3 (1993) 224; Stratford-Perricaudet et al., Human Gene Therapy 1 (1990) 241; EP 185,573; Levrero et al., Gene 101 (1991) 195; Le Gai la Salle et al., Science, 259 (1993) 988; Roemer and Friedmann, Eur. J. Biochem, 208 (1992) 211; Dobson et al., Neuron, 5 (1990) 353; Chiocca et al., New Biol. 2 (1990) 739; Miyanohara et al., New Biol. 4 (1992) 238; WO91 / 18088).
- the recombinant virus according to the invention is a defective virus.
- the term "defective virus” refers to a virus incapable of replicating in the target cell.
- the genome of the defective viruses used in the context of the present invention is therefore devoid of at least the sequences necessary for the replication of said virus in the infected cell. These regions can be either eliminated (in whole or in part), or made non-functional, or substituted by other sequences and in particular by the double-stranded nucleic acid sequence of the invention.
- the defective virus nevertheless retains the sequences of its genome which are necessary for the packaging of the viral particles.
- the method according to the present invention uses in particular viral vectors containing the nucleic sequences of a transgene of interest and of the specific inhibitory transgene, without toxicity for the production cells, then then of inducing the expression of these toxic molecules selectively in target cells by dealing with the repressor.
- the invention can be used to regulate the expression of a transgene of interest in different types of cells, tissues, or organs, in vivo.
- it may be a cell, a tissue, or an organ of plant or animal origin, preferably mammalian, and even more preferably of human origin.
- muscle cells or a muscle
- hepatic cells or the liver
- cardiac or heart, arterial or vascular wall
- nerve or brain, marrow, etc.
- tumor or tumor
- the compositions, constructions and method according to the invention are used for the regulated expression of a transgene of interest in a muscle cell or a muscle in vivo.
- the results presented in the examples particularly illustrate the advantages of the invention in vivo in this type of cells.
- tissue of animal or vegetable origin capable of being obtained by the method as described above, and comprising a nucleic acid comprising the sequence of a transgene of interest coding for a transcript of interest, and a nucleic acid comprising the sequence of an inhibitory transgene coding for an inhibitory transcript specific for the transcript of interest.
- the tissues according to the present invention are preferably tissues of animal or vegetable origin which are reconstituted ex vivo, to give, for example, organoids or neorganoids, the cells of which have been modified so as to express the biological product of the transgene of interest according to the control method of the present invention, and which can thus be reimplanted (Vandenburgh et al., Hum. Gen Ther. 9 (17) (1998) 2555-2564; Powell et al. Hum Gen Ther, 10 (4 ), (1999) 565-577; MacColl et al., J. Endochnol, 162 (1) (1999) 1-9).
- compositions which can be administered in vivo comprising the nucleic sequence of a transgene of interest coding for a transcript of interest or useful, the nucleic sequence of an inhibitory transgene coding for a inhibitory transcript specific to the transcript of interest, and an appropriate vehicle.
- the present invention also relates to a composition which can be administered in vivo comprising at least one vector comprising the nucleic sequence of a transgene of interest coding for a transcript of interest or useful transcript, the nucleic acid sequence of an inhibitory transgene coding for an inhibitory transcript specific for said transcript of interest, and an appropriate vehicle, the transcripts of interest and inhibitors being capable of being activated or inhibited by an agent external.
- the present invention also relates to a pharmaceutical composition intended for administration in vivo comprising at least one vector comprising the nucleic sequence of a transgene of interest coding for a transcript of interest or useful transcript, and of a nucleic acid coding for an inhibitory transcript specific for said transcript of interest, and an appropriate vehicle, the transcripts of interest and inhibitors being capable of being activated or inhibited by an external agent.
- the present invention also relates to a medicament comprising at least one vector comprising the nucleic sequence of a transgene of interest coding for a transcript of interest or useful transcript, the nucleic sequence of an inhibitory transgene coding for a specific inhibitory transcript of said transcript of interest, and an appropriate vehicle, the transcripts of interest and inhibitors being capable of being activated or inhibited by an external agent.
- any vehicle suitable for administration for example by the topical, cutaneous, oral, vaginal, parenteral, intranasal, intravenous, intramuscular, subcutaneous, intraocular, transdermal, etc. route, is used.
- a pharmaceutically acceptable vehicle is used for an injectable formulation, in particular for a direct injection into the desired organ, or for any other administration.
- injectable formulations in particular for a direct injection into the desired organ, or for any other administration.
- They may in particular be sterile, isotonic solutions, or dry compositions, in particular lyophilized, which, by addition as appropriate of sterilized water or physiological saline, allow the constitution of injectable solutes.
- Concentrations of nucleic acids, including sequences of the transgene of interest coding for the transcript of interest and of the inhibitory transgene coding for the inhibitory transcript, used for the injection as well as the number of administrations and the volume of the injections can be adapted according to different parameters, and in particular according to the mode of administration used, the pathology concerned, the transgene of interest whose expression is to be regulated, or also according to the duration of the treatment sought.
- transgenes of interest within the meaning of the present invention, there may be mentioned more particularly the genes coding for - enzymes, such as ⁇ -1-antitrypsin, proteinases (metalloproteinases, urokinase, uPA, tPA, and streptokinase), proteases cleaving precursors to release active products (ACE, ICE) or their antagonists (T1MP-1, tissue plasminogen activator inhibitor PAI, TFPI);
- ⁇ -1-antitrypsin proteinases (metalloproteinases, urokinase, uPA, tPA, and streptokinase), proteases cleaving precursors to release active products (ACE, ICE) or their antagonists (T1MP-1, tissue plasminogen activator inhibitor PAI, TFPI);
- - blood derivatives such as the factors involved in coagulation: factors VII, VIII, IX, complement factors, thrombin;
- hormones or the enzymes involved in the pathway for the synthesis of hormones, or the factors involved in controlling the synthesis or excretion or secretion of hormones, such as insulin, factors close to the insulin (IGF), or growth hormone, ACTH, enzymes that synthesize sex hormones;
- - lymphokines and cytokines interleukins, chemokines (CXC and CC), interferons, TNF, TGF, chemotactic factors or activators such as M IF, MAF, PAF, MCP-1, eotaxin, LIF, etc. (French patent FR 2,688,514);
- growth factors for example IGF, EGF, FGF, KGF, NGF, PDGF, PIGF, HGF, proliferin;
- VEGF vascular endothelial growth factor
- FGF vascular endothelial growth factor
- angiopoietin 1 or 2 endothelin
- neurotrophic factors in particular neurotrophic factors for the treatment of neurodegenerative diseases, traumas which have damaged the nervous system, or retinal degenerations, such as members of the neurotrophin family such as NGF, BDNF, NT3, NT4 / 5, NT6 their derivatives and related genes - members of the CNTF family such as CNTF, axokine, LIF and their derivatives - the IL6 and its derivatives - cardiotrophin and its derivatives - GDNF and its derivatives - members of the IGF family, such as IGF-1, PIFGF-2 and their derivatives - members of the FGF family, such as FGF 1, 2, 3, 4, 5, 6, 7, 8, 9 and their derivatives, TGF ⁇ ;
- members of the neurotrophin family such as NGF, BDNF, NT3, NT4 / 5, NT6 their derivatives and related genes - members of the CNTF family such as CNTF, axokine, LIF and their derivatives - the IL6 and its derivatives
- hematopoietic factors such as erythropoietin, GM-CSF, M-CSF, LIF, etc. ;
- - cell architecture proteins such as dystrophin or a minidystrophin (French patent FR 2 681 786), suicide genes (thymidine kinase, cytosine deaminase, cytochrome P450 enzymes), hemoglobin genes or other transporters protein; the genes corresponding to the proteins involved in lipid metabolism, of the apolipoprotein type chosen from the apolipoproteins Al, A-II, A-IV, B, Cl, C-ll, C-III, D, E, F, G, H, J and apo (a), metabolism enzymes such as, for example, lipases, lipoprotein lipase, hepatic lipase, lecithin cholesterol acyltransferase, 7 alpha cholesterol hydroxylase, phosphatidyl acid phosphatase, or also transfer protein lipids such as the cholesterol ester transfer protein and the phospholipid transfer protein, an HDL binding protein or a receptor chosen for example from LDL receptors,
- factors regulating blood pressure such as the enzymes involved in the metabolism of NO, angiotensin, bradykinin, vasopressin, FACE, renin, enzymes coding for the mechanisms of synthesis or release of prostaglandins, thromboxane, or of fadenosine, fadenosine receptors, kallikreins and kallistatins, ANP, ANF, diuretic or antidiuretic factors, the factors involved in the synthesis, metabolism or release of mediators such as histamine, serotonin, cathecholamines, neuropeptides;
- anti-angiogenic factors such as the ligand of Tie-1 and Tie-2, Fangiostatin, factor ATF, plasminogen derivatives, Fendothelin, thrombospondins 1 and 2, PF-4, Finterferon ⁇ or ⁇ , Finterieukine 12 , TNF ⁇ , the Furokinase receptor, fltl, KDR, PAU, PAI2, TIMP1, the prolactin fragment;
- proteins capable of inducing cell death either active in themselves such as caspases, or of the "pro-drug” type requiring activation by other factors, or proteins activating prodrugs as an agent causing cell death , such as thymidine kinase from the herpes virus, deaminases, making it possible in particular to envisage anticancer therapies;
- proteins involved in inter-cellular contacts and adhesion VCAM, PECAM, ELAM, ICAM, integrins, catheni ⁇ es;
- - transcription factors jun, fos, AP1, p53 and the proteins of the signaling cascade of p53;
- - cell structure proteins such as intermediate filaments (vimentin, desmin, keratins), dystrophin, proteins involved in contractility and control of muscle contractility, in particular proteins involved in calcium metabolism and fluxes of calcium in cells (SERCA).
- ligand for example FGF or VEGF
- FGF-R for example FGF or VEGF
- VEGF-R for example FGF or VEGF
- the transgenes of interest coding for proteins or peptides written by the tissue it is important to underline the antibodies, the variable fragments of single chain antibody (ScFv) or any other fragment of antibody having recognition capacities.
- ScFv single chain antibody
- for its use in immunotherapy for example for the treatment of infectious diseases, tumors, autoimmune diseases such as multiple sclerosis (antiidiotype antibody), as well as the ScFv binding to the pro-inflammatory cytokines such as for example IL1 and TNF ⁇ for the treatment of rheumatoid arthritis.
- transgenes of interest used in the medicament according to the invention code, without limitation, for soluble receptors, such as for example the soluble CD4 receptor or the soluble TNF receptor for anti-HIV therapy, the TNF ⁇ receptor or the soluble IL1 receptor for the treatment of rheumatoid arthritis, the soluble acetylcholine receptor for the treatment of myasthenia gravis; peptides substrates or inhibitors of enzymes, or peptides agonists or antagonists of receptors or adhesion proteins such as for example for the treatment of asthma, thrombosis of restenosis, metastases or inflammation; artificial, chimeric or truncated proteins.
- soluble receptors such as for example the soluble CD4 receptor or the soluble TNF receptor for anti-HIV therapy, the TNF ⁇ receptor or the soluble IL1 receptor for the treatment of rheumatoid arthritis, the soluble acetylcholine receptor for the treatment of myasthenia gravis
- insulin in the case of diabetes, growth hormone and calcitonin. Mention may also be made of proteins capable of inducing anti-tumor immunity or stimulating the immune response (IL2, GM-CSF, IL12, etc.). Finally, mention may be made of cytokines which decrease the Tm response such as IL10, IL4 and IL13.
- transgenes of interest can also be used in the compositions and the medicaments according to the present invention have been described in particular by McKusick, VA Mendelian (Inheritance in man, catalogs of autosomal dominant, autosomal recessive, and X-linked phenotypes. edition, John Hopkins University Press (1988)), and in Stanbury, JB et al. (The metabolic basis of inherited disease, Fifth Edition. McGraw-Hill (1983)).
- the transgenes of interest cover the proteins involved in the metabolism of amino acids, lipids and other constituents of the cell.
- carbohydrates such as, for example, fructose-1-phosphate aldolase, fructose-1,6-diphosphat
- lysosomal deficiencies such as lysosomal ⁇ -L-iduronidase, lysosomal iduronate sulfatase, heparan lysosomal N-sulfatase, N-acetayl- ⁇ -D-lysosomal glucosaminidase, acetyl-CoA: ⁇ -glucosamine N-acetyl lysosomal, N-acetyl- ⁇ -D-glucosamine 6-lysosomal sulfatase, galactosamine 6-sulfate lysosomal sulfatase, lysosomal ⁇ -galactosidase, lysosomal arylsulfatase B, ⁇ -glucuronidase lysosomal, N-acetylglososylamidosidylsucosaminylase.
- lysosomal ⁇ -neuraminidase lysosomal aspartylglycosaminidase, lysosomal ⁇ -L-fucosidase, lysosomal acid lipase, lysosomal acid ceramidase, lysosomal sphingomyelinase, lysosomal glucocerebrosidase and galactocerebrosidase lysosomiasis galactosidease.
- lysosomal arylsulfatase A ⁇ -galactosidase A
- ⁇ -galactosidase lysosomal acid ⁇ chain of lysosomal hexosaminidase A.
- the present invention also relates to the use of the combination as described above for the preparation of a medicament intended for the treatment of certain genetic abnormalities or deficiencies, such as for example mitochondrial genetic diseases, hemophilia, and the ⁇ -thalassemia.
- the combination according to the invention for the preparation of a medicament intended for the treatment and / or prevention of certain diseases such as for example ischemia, stenosis, myopathies , neurodegenerative diseases, metabolic diseases such as lysosomal diseases, inflammatory diseases such as rheumatoid arthritis, hormonal disorders such as diabetes, cardiovascular diseases such as hypertension, hyperlipidemias such as obesity.
- certain diseases such as for example ischemia, stenosis, myopathies , neurodegenerative diseases, metabolic diseases such as lysosomal diseases, inflammatory diseases such as rheumatoid arthritis, hormonal disorders such as diabetes, cardiovascular diseases such as hypertension, hyperlipidemias such as obesity.
- Another subject of the present invention is the use of the combination as described above for the preparation of an anticancer drug, or for the preparation of vaccines, for example anti-tumor DNA.
- vaccines for example anti-tumor DNA.
- transgenic animals which express a transgene of interest coding for or transcript of interest as well as an inhibitory transgene coding for a specific inhibitory transcript of the transcript of interest in one or more cell types.
- the methods for generating transgenic animals, particularly transgenic mice, are now well known to those skilled in the art, and are in particular described by Hogan et al. (1986) A Laboratory Manual, Cold Spring Harbor, New York, Cold Spring Harbor Laboratory.
- the nucleic acids previously described are transferred into non-human fertilized oocytes by microinjection, by implanting the oocyte in a carrier female, so that it develops.
- the nucleic acids are integrated into the genome of the cell from which the transgenic animal develops and remain in the genome of the adult animal, so that an expression of the transgene of interest and of the inhibitory transgene in one or more cells or tissues of the transgenic animal can be observed.
- Transgenic animals carrying the nucleic acid sequences of the transgene of interest and the inhibitory transgene can also be crossed with other transgenic animals carrying other transgenes.
- transgenic animals thus produced, there may be mentioned for example a mouse, a goat, a sheep, a pig, a cow or any other domestic animal.
- Such transgenic animals have a phenotype similar to wild animals, however the transgene or transcript of interest is restored when an external agent repressing the inhibitory transcript and / or an activating agent is administered to the animal. of the transcript of interest.
- These transgenic animals are used to simulate the pathophysiology of certain human or animal diseases and therefore constitute experimental models of human or animal diseases.
- the transgene of interest likely to be involved in a pathology can be cointroduced with its specific inhibitory transgene, without causing the appearance of a particular phenotype.
- the expression of the transgene of interest studied can then be modulated by the administration of an external agent repressing the inhibiting transcript, and / or an external agent activating the transcript of interest, in order to determine the relationship which exists between the expression of this gene and the appearance of a pathological phenotype.
- an external agent repressing the inhibiting transcript, and / or an external agent activating the transcript of interest, in order to determine the relationship which exists between the expression of this gene and the appearance of a pathological phenotype.
- a final aspect of the present invention relates to plant cells and transgenic plants comprising in their genome a nucleic acid comprising the sequence of a transgene of interest coding for a transcript of interest and a nucleic acid comprising the sequence of an inhibitory transgene coding for an inhibitory transcript specific for the transcript of interest.
- These plants can be obtained by the usual techniques of plant transgenesis. Plasmids carrying the nucleic acids coding for the transgene or the transcript of interest and for the inhibitory transcript placed under the control of transcription promoters which are naturally functional in plants are introduced for example into a strain of Agrobacterium tumefaciens. Plant transformation can then be performed using standard transformation and regeneration protocols (Deblaere et al., Nucleic Acid Research 13 (1985) 4777-4788; Dinant et al., European Journal of Plant Pathology 104 (1998) 377-382).
- Constitutive promoters can be used, such as, for example, the cauliflower mosaic virus (CaMV) 35S promoter (Odell et al., Nature 313 (1985) 810-812).
- inducible promoters can be used, such as promoters inducible by glucocorticoids which is activated inter alia by dexamethasone (Aoyama et al., Plant J.
- this regulatory system has a high basal level in the non-activated state, when it is used to drive the expression of a transgene of interest in coexpression with an inhibitory transcript thereof, according to the present invention, the basal level of the transgene of interest is greatly lowered.
- a foreign cytotoxic or even lethal gene can be expressed in a punctual manner over a short period of time without inhibiting the regeneration of the transduced plant and by limiting cell death.
- This reversible inhibition system for the expression of the transgene of interest is therefore extremely useful for certain applications. of plant production biotechnology and in the context of basic agricultural research.
- the present invention is particularly useful for the study of genes whose overexpression or even basic expression has deleterious effects for the organism in which they are expressed.
- an uncontrolled production of cytokines in a plant causes, for example, the appearance of abnormal phenotypes during development such as the absence of root, loss of apical dominance, sterility, or cellular toxicity. which blocks in the case of plants the regeneration of plant tissues or even leads to lethality problems.
- the reversible inhibition method according to the present invention of exogenous genes may also prove useful for studying the stability of the product of the transgene of interest (Gil et al., EMBO J., 15 (1996), 1678 -1686), or the evaluation of the turnover of the product of an exogenous gene.
- transgenic plants according to the present invention carrying the constructs of the transgene of interest coding for a transcript of interest and of the inhibitory transgene coding for a specific inhibitory transcript of the transcript of interest, according to the present invention, can also be used for the study. of certain molecular mechanisms and gene interactions. In fact, when the expression of certain genes leads to cell death, the transgenic lines carrying both the sequences of the transgene of lethal interest and of its inhibitory transcript can be used to isolate the mutants which make it possible to study by following the molecular interactions and mechanisms of cell death.
- the system according to the present invention facilitates the functional analysis of certain genes and their intervention in the appearance of a phenotype, as well as their possible implications in certain signal transduction pathways.
- the method according to the invention makes it possible to facilitate the study of plant genes which are capable of affecting the development of the plant in the early stages, but can play a role in later stages of development. Mutations in these genes affect the development of the plant, and therefore prevent the study of possible late functions of these genes. Plants transformed with the sequence carrying the transgene of interest and its inhibitory transcript can follow normal early development, and the administration of an appropriate external agent at a later stage of development advantageously makes it possible to restore the expression of the genes in question. and determine their late functions.
- the plant chimeras according to the invention are therefore capable of providing new information, for example on the signaling mechanisms in plants.
- Figures 1A to 1E Schematic representations of the plasmids pXL3031 (fig. 1A), pXL3010 (fig. 1B), pSeAPantisens (fig. 1C), pXL3296 (fig. 1D), and pLucAntisens (fig. 1E).
- Figures 2A to 2E Schematic representations of the plasmids pTet-Splice (fig. 2A), pTetLucAntisens (fig. 2B), pTetLuc (fig. 2C), pTetSeAPantisens (fig. 2D) and pTet-tTAk (fig. 2E).
- Figures 3A to 3D Schematic representations of the plasmids pGJA1 (fig.3A), pGJA2 (fig. 3B), pGJA3 (fig.3C) and pGJA9 (fig. 3D).
- Figures 4A to 4D Schematic representations of the plasmids pGJA15-2 (fig.4A), pGJA15 (fig.4B), pGJA14 (fig 4C) and pGJA14-2 (fig.4D).
- Figures 5A and 5B Schematic representations of the plasmids pRDA02 (5B) and pSG5-hPPAR ⁇ 2 (5A).
- Figures 6A and 6B Schematic representation of the plasmids pIND (6A), pINDSeAP (6B), and PVgRXR.
- Figure 8 shows a photograph of an electrophoresis gel illustrating the presence of sense and antisense RNA by RT-PCR in vitro.
- Tracks 1 and 9 100 base pair marker (Gibco BRL)
- Lane 2 PCR control using the plasmid pXL3010 as template.
- Lane 3 RT-PCR on the total RNA extracted from the cells transfected with 0.25 ⁇ g of pXL3010 + 0.75 ⁇ g pXL3296.
- Lane 4 RT-PCR on the RNA extracted from cells transfected with 0.25 ⁇ g of pXL3010 + 0.25 ⁇ g pSeAPantisens + 0.50 ⁇ g pXL3296.
- Lane 5 RT-PCR on RNA extracted from cells transfected with
- Tracks 6 to 8 PCR controls (without RT) carried out on the RNAs used in 3, 4 and 5 respectively.
- Figure 9A illustrates the SeAP activities in vitro measured 24 hours after cotransfection of the following sets of plasmids: condition 1: 25% pXL3010 + 75% pXL3296 condition 3: 25% pXL3010 + 25% pSeAPantisens + 50% pXL3296 condition 5: 25% pXL3010 + 25% pLucAntisens + 50% pXL3296
- Figure 9B illustrates the relative luciferase activities, measured 24 h following independent in vitro transfections of the following sets of plasmids: condition 2: 25% pXL3031 + 75% pXL3296 condition 4: 25% pXL3031 + 25% pLucantisens + 50% pXL3296 condition 6: 25% pXL3031 + 25% pSeAPantisens + 50% pXL3296
- Figure 10 illustrates the relative levels of circulating SeAP measured after bilateral intramuscular injections in the cranial tibial skeletal muscle and electrotransfer of plasmids coding for the sense sequence (pXL3010) and the antisense sequence (pSeAPantisens) of the reporter gene for SeAP, ie simultaneously (lot 2) or 22 days apart (lot 1).
- Lot 1 10 mice injected with 30 ⁇ g of plasmid pXL3010 + electrotransfer, then injection of 30 ⁇ g of pSeAPantisens + electrotransfer (2nd injection on day 22); Lot 2: 10 mice coinjected with 30 ⁇ g of a plasmid pXL3010 + 30 ⁇ g of a plasmid pSeAPantisens + electrotransfer (coinjection); Lot 3: 10 mice injected with 30 ⁇ g of a plasmid pSeAPantisens + electrotransfer (control group).
- FIG. 11 A represents a photograph of an electrophoresis gel illustrating the presence of sense and antisense RNA of the reporter gene SeAP by
- Lanes 1 and 13 100 bp DNA marker (Gibco); Tracks 2 and 3: sense and antisense RNA respectively, in muscles of lot 1 mice (pXL3010 then re-injection of pSeAPantisens 22 days later);
- Lanes 4 and 5 sense and antisense RNA, respectively, in muscles of lot 2 mice (coinjection of pXL3010 and pSeAPantisens); Lanes 6 and 7: sense and antisense RNA, respectively, in muscles of lot 3 mice (pSeAPantisens only);
- Lanes 8 to 10 PCR controls without RT of the RNAs used in lanes 2 to
- Lane 11 control: PCR using the plasmid pXL3010 as template; Lane 12: plasmid pXL3010.
- FIG. 11B represents a photograph of an autoradiography film obtained by transfer and hybridization on a nitroceliulose membrane of the agarose gel photographed in FIG. 11A in the presence of probe oligonucleotides labeled with 32 P specific for the sense sequence of the reporter gene SeAP (S) and the antisense sequence (AS).
- S reporter gene
- AS antisense sequence
- Figure 12 Monitoring of the relative activity of circulating SeAP in the plasma of mice after bilateral intramuscular injections in the cranial tibial skeletal muscle and electrotransfer of the following plasmids at the time intervals described below: Lot 1: 10 mice injected with 15 ⁇ g of plasmid pXL3010 + electrotransfer;
- Figure 13 Monitoring of the relative activity of circulating SeAP in the plasma of mice after coinjection and electrotransfer (ET) of the following plasmids: Lot 1: 9 mice injected with 30 ⁇ g of plasmid pXL3010 + ET; Lot 2: 9 mice injected with 30 ⁇ g of plasmid pXL3010 + ET; Lot 3: 9 mice coinjected with 30 ⁇ g of plasmid pXL3010 + 30 ⁇ g of pSeAPantisens + ET;
- Lot 4 9 mice injected with 30 ⁇ g of plasmid pXL3010 + ET; Lot 5: 9 mice injected with 30 ⁇ g of plasmid pXL3010 + ET;
- Figure 14A Relative activities of SeAP in vitro measured after transfection of NIH3T3 cells with the following plasmids with or without subsequent treatment with tetracycline:
- Figure 14B Relative activities of SeAP in vitro measured after transfection of NIH3T3 cells with the following plasmids with or without subsequent treatment with tetracycline:
- FIGURE 15 Relative activities of luciferase 24h after cotransfection of NIH 3T3 cells (80,000 cells per well) with the following plasmids (0.7 or 1.1 ⁇ g of DNA per well) with or without administration of tetracycline:
- FIGURE 16A Relative levels of circulating SeAP in vivo after intramuscular coinjection of 6 week old female SCID mice of the following plasmids with or without administration of tetracycline at variable time intervals: Lot 1: 10 mice injected with 20 ⁇ g of plasmid pXL3010 + 40 ⁇ g pTet- tTAk; Lot 2: 10 mice injected with 20 ⁇ g of plasmid pXL3010 + 20 ⁇ g pTet-tTAk + 20 ⁇ g pSeAPantisens; Lot 3: 10 mice injected with 20 ⁇ g of plasmid pXL3010 +20 ⁇ g pTet- tTAk + 20 ⁇ g pTetSeAPantisens.
- FIGURE 16B Relative levels of circulating SeAP in vivo after intramuscular coinjection of 6-week-old female SCID mice of the following plasmids, with or without administration of tetracycline at variable time intervals:
- Lot 1 10 mice injected with 20 ⁇ g of plasmid pXL3010 + 20 ⁇ g pTet-tTAk + 20 ⁇ g pSeAPantisens;
- Lot 2 10 mice injected with 20 ⁇ g of plasmid pXL3010 +20 ⁇ g pTet-tTAk + 20 ⁇ g pTetSeAPantisens; Lot 3: lot 2 + tetracycline drink (2mg / ml + 2 mg / ml sucrose) for 9 days. Then stop tetracycline at 10 ⁇ eme day. Rebates under tetracycline to 22 th day (IP injection every other day, 500 mg / mouse), and stop at the 30 th day. Doxycycline reach in the 63 th day (400 mg / l in the beverage).
- FIGURE 17 Measurement of the expression of SeAP 48 hours after cotransfection of NIH3T3 cells with the following plasmids: T +: 1 ⁇ g pXL3010 + 1 ⁇ g pXL3296 T-: 1 ⁇ g pXL3010 + 1 ⁇ g pSeAPantisens
- FIGURE 18 Measurement of the expression of SeAP measured 48 hours after cotransfection of NIH3T3 cells with the following plasmids:
- FIG. 19 summary table of the inhibitions of expression of SeAP obtained by the transfection into the NIH3T3 cells of the plasmids pGJA1, pGJA2, pGJA3 and pGJA9, compared with the inhibition produced by the plasmid comprising Fantisens SeAPantisens.
- Figure 20 Monitoring of the relative activity of circulating SeAP in the plasma of mice after bilateral intramuscular injections in the cranial tibial skeletal muscle and electrotransfer of the following plasmids, followed by the administration of doxycycline at the following time intervals: Lot 3: one batch of mice injected with 20 ⁇ g pXL3010 + 20 ⁇ g pTet-tTAk + 20 ⁇ g pTetSeAPantisens, and doxycycline at 400 mg / l added only on day 170;
- Lot 4 a lot of mice injected with 20 ⁇ g pXL3010 + 20 ⁇ g pTet-tTAk + 20 ⁇ g pTetSeAPantisens, and doxycycline at 400 mg / l for durations of 7 days at the periods indicated.
- Figure 21 measurement of the expression of SeAP measured 48 hours after transfection of NIH3T3 cells with the following plasmids, for a number of copies equivalent to 1 ⁇ g pXL3010, qs pXL3296: Column 1: pGJA14; Column 2: pGJA14-2; Column 3: pGJA15; and Column 4: pGJA 15-2.
- Figure 22 measurement of the expression of SeAP 24 hours after cotransfection of NIH3T3 cells with the following plasmids, for a number of copies equivalent to 0.5 ⁇ g pXL3010, qsp pXL3296:
- Figure 24 measurement of the expression of SeAP 5 days after transfection in C2C12 cells with the following plasmids, with and without chemical inducer BRL49653 at 10-7 M final:
- Lot 4 lot 3 + 50 ng pSeAPAS (column 3: without BRL49653; column 4: with BRL49653); Lot 5: lot 3 + 100 ng pSeAPAS (column 5: without BRL49653; column 6: with BRL49653);
- Lot 6 lot 3 + 250 ng pSeAPAS (column 7: without BRL49653; column 8: with BRL49653); Lot 7: lot 3 + 500 ng pSeAPAS
- Figure 25 measurement of the expression of SeAP 48 hours after transfection of NIH3T3 cells with the following plasmids, with and without chemical inducer of the ecdysone system, Ponasterone or Pon ( Figure 26; No et al., PNAS, 1996, pp 3346 -3351).
- Figure 26 Representation of Ponasterone (pon).
- Lot 1 a lot of mice injected with 20 ⁇ g pXL3010 + 20 ⁇ g pcDNA;
- Lot 2 a lot of mice injected with 20 ⁇ g pGJA14 + 20 ⁇ g pTet-tTAk;
- Lot 3 a lot of mice injected with 20 ⁇ g pGJA14 + 20 ⁇ g pTet-tTAk + 400 mg / ml of doxycycline in the drink;
- Lot 4 a lot of mice injected with 20 ⁇ g pGJA15-2 + 20 ⁇ g pTet-tTAk;
- Lot 5 a lot of mice injected with 20 ⁇ g pGJA15-2 + 20 ⁇ g pTet-tTAk + 400mg / ml of doxycycline in the drink.
- the plasmid pXL3031 is also a plasmid pCOR described in pCOR (Soubrier et al., Gen Ther, 6, (1999) 1482-1488) and comprises in particular the luciferase reporter under the control of the CMV promoter.
- pCOR Sudbrier et al., Gen Ther, 6, (1999) 1482-1488
- a schematic representation of this plasmid is presented in Figure 1A.
- the plasmid pXL3010 was ligated in an Mlul / SalI fragment of pGL3-basic (Promega), of an Mlul / SphI fragment of pCDNA3-basic (Invitrogen) containing the early promoter of human cytomegalovirus (hCMV-IE) SeAP gene extracted from pSeAP-basic (Clontech) with Sphl / Clal and a Clal / Sall fragment containing the late polyadenylation signal of the simian virus (polyA SV40) amplified from pGL3-basic by a polymerase chain reaction with the following primers (5'- ATGCATCGATGGCCGCTTCGAGCAGACATG-3 'and 5'-ATGCGTCGACTCTA GCCGATTTTACCACATTTGTAGAGG-3').
- a schematic representation of this plasmid is presented in Figure 1B.
- a DNA fragment containing the SeAP gene is prepared by PCR using the plasmid pXL3010 as template and the oligonucleotides 1 (5 'CGAGCATGCTGCTGCTGCTGCTGCTGCTGGGCC 3') and 2 (5 'GGGTCTA GATTAACCCGGGTGCGCGGCGTCGGT 3'). These oligonucleotides are located respectively at positions 765-797 and 2290-2267 on the plasmid pXL3010.
- This fragment was then digested by the restriction enzymes Xbal and Sphl, purified on 0.8% agarose gel, extracted using the Jetsorb kit, then cloned in antisense orientation relative to the CMV promoter in the plasmid pXL3296, previously digested with Sphl and Xbal, to obtain the plasmid pSeAPantisens.
- a schematic representation of this plasmid is presented in Figure 1C.
- the plasmid pXL3296 is a plasmid pCOR (Soubrier et al., Get7 Ther, 6, (1999) 1482-1488) and comprises the ori ⁇ of R6K, the expression cassette of the suppressor tRNA Phenylalanine (sup Phe), as well as a -522 / + 72 part of the enhancer / early promoter of the CMV virus.
- a schematic representation of this plasmid is presented in Figure 1 D.
- pLucAntisens plasmid (antisense luciferase plasmid in pCOR)
- the plasmid pXL3031 was digested with HindIII and treated with the Klenow fragment in order to make the ends blunt. After precipitation with ethanol, the fragment was digested with Xbal at 37 ° C for 2 hours. After purification on 0.8% agarose gel, the fragment of approximately 1.6 kb containing the luciferase gene was extracted using the Jetsorb kit.
- Plasmid pGJA1 Plasmid 5 ′ end SeAPantisens
- the plasmid pGJA1 was constructed by removing most of the 5 ′ gene SeAPantisens from the plasmid pSeAPantisens (Example 1.3 and FIG. 1 C) by means of the restriction enzymes Dralll and Sphl The ends have summer joined by ligation after treatment with the Klenow enzyme making the ends blunt. The eliminated fragment corresponds to the portion between positions 737 and 2139 of the SeAPantisens gene.
- the remaining portion comprises the first 125 5 ′ bases of the SeAPantisens gene, between positions 612 and 737 (125 nucleotides), therefore the end of the 3 ′ end of the SeAP gene placed under the control of the CMV promoter.
- a schematic representation of this plasmid is given in FIG. 3A.
- Plasmid pGJA2 (5 'end plasmid SeAPantisens) The plasmid pGJA2 was constructed by removing most of the 3' SeAPantisens gene from the plasmid pSeAPantisens using the restriction enzymes Sphl and Nae1. The ends were joined by ligation
- the eliminated fragment corresponds to the portion between positions 647 and 2139 of the SeAPantisens gene.
- the remaining portion therefore includes the
- Plasmid pGJA3 (3 'end plasmid SeAPantisens)
- the plasmid pGJA3 was constructed by removing most of the SeAPantisens gene from the plasmid pSeAPantisens 5 'using the restriction enzymes Xbal and Pvull. The ends were joined by ligation after treatment with the Klenow enzyme making the ends blunt. The eliminated fragment corresponds to the portion between positions 1 and 1936 of the SeAPantisens gene. The remaining portion comprises the last 203 bases in 3 ′ of the SeAPantisens gene, between positions 1936 and 2139 (203 nucleotides), placed under the control of the CMV promoter. A schematic representation of this plasmid is given in FIG. 3C.
- Plasmid pGJA9 Plasmid ends 5 'and 3' SeAPantisens
- Plasmid pGJA9 was constructed by removing the intermediate portion between the 5 'and 3' ends of the SeAPantisens gene from the plasmid pSeAPantisens using the restriction enzymes Dralll and Pvull. The ends were joined by ligation after treatment with the Klenow enzyme making the ends blunt. The eliminated fragment corresponds to the portion between positions 737 and 1936 of the SeAPantisens gene.
- the remaining portion therefore comprises the 5 ′ end and the 3 ′ end of the SeAPantisens gene, respectively between positions 612 and 737 (the first 125 nucleotides in 5 ′ of the antisense SeAP gene) and 1936 and 2139, (the last 203 nucleotides 3 ′ of the antisense SeAP gene), these two portions being placed together under the control of the CMV promoter.
- a schematic representation of this plasmid is given in Figure 3D.
- Example 4 Construction of plasmids allowing the simultaneous production of a transcript and its antisense transcript.
- plasmid (a single SeAP coding sequence surrounded by a constitutive promoter and a conditional promoter in opposite direction in 3 ′)
- the plasmid was constructed by insertion of the tetracycline repressible promoter (Tetp) into the plasmid pXL 3010 at the Eco47 III restriction site, after the polyA sequence.
- Tetp tetracycline repressible promoter
- the Tetp promoter was placed in the opposite direction to that of the CMV promoter which is located upstream of the SeAP gene. In this way, the CMV promoter induces the synthesis of the SeAP transcript in a constitutive manner, and the Tetp promoter placed head to tail induces, in the absence of tetracycline, the production of an antisense transcript. In the absence of tetracycline, SeAP activity is inhibited.
- FIG. 4A A schematic representation of this plasmid is given in FIG. 4A.
- PGJA15 plasmid (a single SeAP coding sequence surrounded by a constitutive promoter and a conditional promoter in the same direction) This plasmid was constructed by inserting the same Tetp promoter in the same location as for the plasmid PGJA 15-2, but in the same direction as the CMV promoter which is located upstream of the SeAP gene. This plasmid serves as a control to verify that the Tetp promoter oriented in this way must not modify the expression of SeAP. A schematic representation of this plasmid is given in FIG. 4B.
- PGJA14 plasmid (constitutive promoter - SeAP and reverse conditional promoter - SeAPantisens, placed in opposite directions) This plasmid was constructed by inserting a set of "Tetp promoter + SeAP antisense gene sequence" in the plasmid pXL3010, in the same place as for the plasmid PGJA 15, in contrast to the whole “CMV promoter + SeAP sequence”.
- the CMV promoter induces the synthesis of the SeAP transcript in a constitutive manner
- the Tetp promoter placed in the opposite direction induces, in the absence of tetracycline, the production of the antisense transcript included in the set "Tetp promoter + antisense SeAP sequence" .
- the SeAP activity is inhibited, in the absence of tetracycline.
- FIG. 4C A schematic representation of this plasmid is given in FIG. 4C.
- This plasmid was constructed by inserting a set "Tetp promoter + sequence of the antisense SeAP gene" into the plasmid pXL3010, in the same location as for the plasmid PGJA 15, and in the same direction as the set "CMV promoter + sequence SEAP ”.
- the CMV promoter induces the synthesis of the SeAP transcript in a constitutive manner
- the Tetp promoter induces, in the absence of tetracycline, the production of the antisense transcript included in the set "Tetp promoter + SeAP antisense sequence”.
- the SeAP activity is inhibited.
- a schematic representation of this plasmid is given in FIG. 4D.
- Plasmid pSG5-hPPARv2 (human transactivating plasmid PPAR ⁇ 2)
- the plasmid pSG5-hPPAR ⁇ 2 comprises the gene for the transactivator of human origin hPPAR ⁇ 2, having the ability to activate a minimal promoter comprising upstream the J region of the human apolipoprotein Ail (ApoAII) promoter repeated 10 times in reverse (JxIOAS), when it is coexpressed with the plasmid pVgRXR (FIG. 6C) coding for the retinoid receptor RXR.
- the transactivator is under the control of the SV40 promoter.
- Plasmid pRDA02 (SeAP plasmid under the control of the inducible promoter JxIOAS)
- the plasmid pRDA02 comprises the reporter gene SeAP placed under the control of a CMV promoter comprising upstream a JxIOAS region inducible by the product of the hPPAR ⁇ 2 gene.
- the SeAP gene is flanked in its 3 ′ part of a termination sequence of the polyA transcription of the SV40 virus. A schematic representation of this plasmid is given in FIG. 5B.
- pINDSeAP plasmid promoter comprising the SeAP gene under the control of the PHSP promoter inducible by ecdysone
- the plasmid pINDSeAP was constructed by inserting the gene coding for SeAP between the EcoRI and Xhol restriction sites in the cloning site multiple of the pIND vector ( Figure 6A; InVitrogen).
- Gene expression coding for SeAP is therefore under the control of the system ecdysone uses a heterodimer of the ecdysone receptor (VgECR) and of the retinoid X receptor (RXR).
- This heterodimer binds on an element of response to ecdysone (E / GRE on the plasmid IND).
- the PHSP promoter is a Drosophila Minimal Heat Shock Promoter (No et al, PNAS 1996, pages 3346-3351). A schematic representation of this plasmid is given in FIG. 6B.
- VgRXR Plasmid pVgRXR (FIG. 6C; InVitrogen)
- the plasmid VgRXR therefore codes on the one hand the RXR receptor, and on the other hand a VP16 / ECR fusion protein.
- a heterodimer containing VP16 can be formed which will activate transcription in the presence of ecdysone or its analogs, such as for example Ponasterone A (Pon; Figure 26) (No et al, PNAS 1996, pages 3346-3351) .
- EXAMPLE 7 Functionality of the plasmids comprising a sequence coding for an inhibitory transcript of antisense type in vitro
- the cells used are murine fibroblasts NIHT3T3 (ATCC: CRL-1658). These cells are seeded 24 h before transfection, in 6 or 24 well plates, at a density of 5.10 4 cells / well in 1 ml of medium, or 2.5 ⁇ 10 5 cells / well in 2 ml.
- the culture medium used is DMEM TM medium (Life Technologies Inc.) supplemented with 10% calf serum.
- the cell cultures are incubated in an oven at 37 ° C. in a humid atmosphere and under partial pressure of CO 2 of 5%.
- the transfections are carried out approximately 24 h after seeding when a confluence of 50 to 80% is obtained.
- C2C12 cells are murine myoblastic cells (ATCC: CRL1772) are cultured on a DMEM TM medium (Life Technologies Inc.) supplemented with 10% fetal calf serum supplemented with L- 2mM final glutamine and antibiotics, 50 final units of penicillin and 50 ⁇ g / ml of streptomycin.
- Example 7.2 Cell Transfection Carried Out Using a Cationic Lipofectant Diluted solutions of DNA and cationic lipid RPR 120535 (Bik G et al., J. Med. Chem 41 (1998) 224-235) are prepared separately with a view to obtaining for the transfection a concentration of approximately 6 nmol of lipid RPR 120535 B / ⁇ g of DNA. Each solution is first diluted in a solution of sodium bicarbonate at 20 mM final in 150 mM NaCl final, and incubated for 10 minutes at room temperature (RT). The cationic lipid solution is then distributed, volume to volume, in the DNA solutions.
- RT room temperature
- a new incubation is carried out for 10 min at RT, and the complexes formed are then diluted 1/10 th in culture medium supplemented with serum. After a final incubation of 10 minutes, the culture medium is eliminated in the plates and 1 or 2 ml / well of these solutions are distributed depending on whether the 24 or 6 well plates are used respectively.
- Example 7.3 Measurement of the luciferase activity The luciferase activity is measured 24 h after the transfection. Luciferase catalyzes the oxidation of luciferin in the presence of ATP, Mg 2+ , and ⁇ 2 , with the concomitant production of a photon. The total light emission, measured by a luminometer, is proportional to the luciferase activity of the sample. The culture medium is removed beforehand, the cells are rinsed twice with PBS, then lysed for 15 min at room temperature, with 200 ⁇ l of Cell Lysis Buffer (Promega Corporation) per well. The Luciférase Assay System TM kit (Promega Corporation) is then used for activity measurements according to the recommended protocol.
- Luciferase activity is measured 24 h after the transfection. Luciferase catalyzes the oxidation of luciferin in the presence of ATP, Mg 2+ , and ⁇ 2 , with the concomitant production of
- the luciferase activity is related to the protein concentration of the cell lysate supernatants. Measuring the protein concentration of cell extracts is performed using the BCA method (Pierce) using bicinchoninic acid (Wiechelman et al., Anal Biochem, 175 (1998) 231-237.)
- Example 7.4 Measurement of the SeAP activity The SeAP activity is measured on the culture supernatants 48 hours after the transfection, using the Phospha-Light TM kit (Tropix, Inc.).
- Example 7.5 Inhibition in vitro of the expression of the reporter genes SeAP (fia. 7A) or of luciferase (FIG. 7B) by the inhibitory transcript of antisense type
- RNAs were prepared by the Trizol method (Gibco BRL) from NIH 3T3 cells.
- RT-PCR products were then deposited on 0.8% o agarose gel, and we can observe the presence of a band with the expected size of 418 bp (lane 2, FIG. 8) which reflects well the transcription of the SeAP sense gene (lane 3, FIG. 8), of the SeAP sense and SeAP antisense in different proportions 1: 1 (lane 4, FIG. 8), and 1: 3 (lane 5, FIG. 8). Lanes 6 to 8 correspond to negative controls of the experiment in which a PCR without prior reverse transcription was carried out.
- Example 8.2 Comparison of the percentage inhibition of the antisense inhibitory transcript when it is coinjected with the reporter gene SeAP or post-injected 22 days after the injection of the SeAP gene The results, gathered in FIG. 10, show that the injection of the plasmid pSeAPantisens does not lead to effective inhibition of the reporter gene for SeAP (pXL3010) injected 22 days previously. Indeed, more than 20 days after the injection of the antisense transcript, the observed expression of SeAP only decreased by 60% (lot 1, Figure 10).
- FIG. 10 clearly shows that a coinjection of the inhibitory transcript of the antisense type and of the sense sequence of the exogenous reporter gene for SeAP confers a very strong inhibition of the expression of SeAP, since it cannot be detected no residual expression of this gene.
- the coexpression of the sense and antisense gene of SeAP makes it possible to abolish the expression of the reporter gene SeAP in vivo (lot 2, FIG. 10).
- the injection of antisense alone as a control does not confer any activity (lot 3, FIG. 10).
- RT-PCR reactions were carried out following the protocol previously described in Example 3.6.
- the reaction products were separated on an agarose gel and visualized with ethydium bromide.
- a photograph of this gel which is presented in FIG. 11 A, shows that both sense and antisense RNA are expressed in the muscles of mice which have undergone a first injection of plasmids pXL3010, and a subsequent injection of plasmid carrying the sequence of the transcript pSeAPantisens antisense inhibitor (tracks 2 and 3).
- the membrane is then exposed on an autoradiography film, and the film is developed three hours later.
- a photograph of this film which is presented in FIG. 11B, confirms the previous results well. Indeed, the presence of a transcript of the SeAP reporter gene is not detected in lane 4 which corresponds to the co-injection of the plasmids comprising the sense sequence of the reporter gene (pXL3010) and the antisense sequence (pSeAPantisens) , while the transcript of the gene SeAP reporter is detected in lane 2 which corresponds to the post-injection experience of these same plasmids.
- Example 8.4 Monitoring of the Relative SeAP Activity Circulating in Vivo After Injection of the Plasmid Comprising the Meaning Sequence of the SeAP Gene (pXL3010), followed by a Post-Injection of the Plasmid Comprising the Sequence of the Antisense-type Inhibitor Transcript of the SeAP Reporter Gen (pSeAPantisens) 50 female SCID mice of 6 weeks, divided into 5 groups of 10 and are treated as previously described in Examples 3.2 and 3.3.
- Example 8.5 Monitoring of the relative circulating SeAP activity in vivo after coinjection of the plasmids pXL3010 and pSeAPantisens
- results, presented in FIG. 14B, show a partial inhibition of the SeAP reporter gene when it is coinjected with the plasmid comprising the sequence of the antisense inhibitor transcript of the SeAP gene under the control of the CMV promoter (pSeAPantisens ) in a 1: 1 proportion (column 2), or under the control of the tetracycline repressible promoter (columns 3 and 6), relative to the level of expression of the reporter gene for SeAP measured after injection of the plasmid comprising the sense sequence SeAP (pXL3010) (columns 1 and 5).
- the administration of tetracycline makes it possible to restore very satisfactory expression of the reporter gene for SeAP (columns 4 and 7).
- results presented in FIG. 15 demonstrate, in the first place, the in vitro functionality of the plasmids comprising the sense and antisense sequences of the reporter gene for luciferase under the control of the promoter repressible by tetracycline (pTetLucAntisens, pTetLuc and pTetSpliceAntisens).
- the antisense inhibitor transcript In the absence of tetracycline, the antisense inhibitor transcript is expressed and leads to an imperfect inhibition of 60-70% (columns 3 and 6), whereas when the antisense inhibitor transcript is placed under the control of the CMV promoter , the inhibition is of the order of 90%, using a sense / antisense ratio of 1: 1 (column 2).
- EXAMPLE 10 Measurement of a strong inhibition in vivo by an inhibitory transcript of the antisense type placed under the control of a repressible promoter
- results presented in FIG. 16B show that the coinjection of the plasmids carrying the sense sequence of the reporter gene for SeAP (pXL3010) and the antisense sequence of the gene under the control of the tetracycline repressible promoter (pTetSeAPantisens) in the presence of an agent external repressor, such as tetracycline, makes it possible to obtain a satisfactory biological level of the reporter gene for SeAP (lot 3, J8). Inhibition of the expression of exogenous reporter gene SeAP can again be observed when one stops the administration of tetracycline on the 10th day (lot 3: J15, J22, J30 and J63). These results also confirm that this inhibition is reversible, since the administration of a similar repressor agent tetracycline, doxycycline, at day 63 ⁇ eme resets a reporter gene expression of SeAP (lot 3: J70).
- a plasmid is constructed, which contains a hammerhead ribozyme sequence, by cloning a sequence comprising at least one GTC site, chosen in positions 958, 1058, 1127, 1205, 1243, 1600, 1620, 1758, 1773, 1880, 1901, 1988, 2007, 2085 and 2201 on the plasmid pXL3010 (reporter gene SeAP), downstream of the promoter repressible by the tetracycline TetRS in the plasmid pTetSplice (Gibco BRL), previously digested, to give the plasmid pTetSeAPribozyme.
- the first group is treated as previously described with the plasmid pXL3010.
- the second group co-injected the plasmids pXL3010, pTet-tTAk, and pTetSeAPribozyme.
- the third group is treated as group 2, and the mice are given a drink containing doxycycline (400 mg / l). The circulating SeAP level is monitored as previously described.
- a plasmid comprising the sense sequence of the reporter gene for SeAP (pXL3010) and a plasmid comprising the sequence of the ribozyme inhibitor transcript specific for SeAP under the control of a promoter repressible by tetracylcine (pTetSeAPribozyme), an effective inhibition of the expression of SeAP, compared to the observed expression of the reporter gene for SeAP in the first group of mice tested, indicating that the inhibitory transcript of the ribozyme type is capable of strongly inhibit in transcription of the exogenous SeAP gene with which it is co-administered.
- Oral administration of a tetracycline analog, doxycycline, as a repressant restores the expression of SeAP.
- EXAMPLE 13 Regulation by an Antisense-type Inhibitor Transcript Including an aptamer Sequence
- the plasmid pSeAPantisens (FIG. 1C) as described in Example 1.3 is modified in order to insert at the 5 ′ end of the sequence of the transcript antisense inhibitor, a ligand-dependent aptamer sequence, of sequence 5 'GGCCUGGGCGAGAAGUUUAGGCC 3' recognized by neomycin B as described by Cowan et al. (Nucleic Acids Res. 28 (15) (2000) 2935-2942), to give the plasmid designated pSeAPaptamereAS.
- mice 30 6 week SCID mice are treated as previously described in Example 4, and are divided into three groups of 10.
- the first group is treated as previously described with the plasmid pXL3010.
- the second group receives in coinjection followed by electrotransfer, the plasmids pXL3010, and pSeAPaptamereAS.
- the third group is treated like group 2, and receives an IP injection of neomycin B at the rate of approximately 500 ⁇ g / mouse.
- the circulating SeAP level is then monitored as previously described. While we detect for the first group, a constant expression of the reporter gene for SeAP, we observe in the second group an effective inhibition of the SeAP gene by the inhibitory transcript ⁇ comprising an aptamer sequence.
- SeAP SeAP
- an effective amount of neomycin B which recognizes the aptamer sequence carried by the plasmid pSeAPaptamereAS.
- a sharp decrease in the circulating SeAP level and therefore an inhibition of the expression of the SeAP reporter gene can again be observed when the administration of neomycin B is stopped.
- a plasmid which contains a hammerhead ribozyme sequence, by cloning a sequence comprising at least one GTC site, chosen in positions 958, 1058, 1127, 1205, 1243, 1600, 1620, 1758, 1773, 1880, 1901 , 1988, 2007, 2085 and 2201 on the plasmid pXL3010, downstream of the CMV promoter in the plasmid pXL3296 (Soubrier et al.) digested to give pSeAPribozyme.
- Three groups of 10 6 week SCID mice are treated: the first group receives by injection followed by electrotransfer the plasmid pXL3010, the second group also receives by coinjection followed by electrotransfer, the plasmids pXL3010, and pSeAPaptazyme, and finally, the third group is treated like group 2, but receives an additional amount of dye H33258 (400mg / l) through drinking water.
- Monitoring the level of circulating SeAP shows an effective in vivo inhibition of the activity of SeAP, which is restored to a significant level in the third group of mice, which receive the ligand or dye H33258, specific for the aptamer sequence present in the plasmid pSeAPaptazyme.
- Example 15.1 Inhibition obtained with the plasmids pGJA pGJA2 and pGJA3 (fragments of transcripts containing respectively, the 125, the first 35 bases in 5 'of the sequence of the SeAPantisens gene, and the last 203 bases in 3' of the sequence of the sequence SeAPantisens gene) Measuring the SeAP activity under the different transfection conditions in vitro makes it possible to compare the inhibitory effect of the sub-fragments of the SeAPantisens transcript with that of the entire SeAPantisens transcript. The results of FIG.
- Example 15.2 Inhibition obtained with the plasmid pGJA9 (fragments of transcripts each containing the two 5 'and 3' ends of the SeAPantisens transcript)
- the inhibition caused by the fusion of the two 3 '(203 nucleotides) and 5' ends (125 nucleotides) of the antisense SeAP transcript is represented in columns 7 and 8 of FIG. 18.
- This transcript is produced from the plasmid pGJA9. It significantly inhibits the SeAP activity measured in the cells, in comparison with the maximum inhibition achieved by the entire SeAPantisens transcript (columns 5 and 6).
- Example 16 In vivo regulation kinetics by the inhibitory transcript of the SeAPantisens type placed under the control of a promoter repressible by doxycycline.
- mice were treated as previously described.
- the induction of the expression of the exogenous reporter gene for SeAP is obtained on two time scales.
- the mice drink water except on day 170 when they drink doxycycline.
- the expression of SeAP is zero in the absence of doxycycline, and a very small increase in this expression is observed after taking a day of doxycycline.
- the mice drink doxycycline for 7 days, then take breaks of 20, 30, or 40 days. Taking doxycycline for a week this time causes considerable increases in the expression of SeAP, which regress significantly during periods of water intake.
- Example 17 Verification of the functionality of the plasmids pGJA14, pGJA14-2, pGJA15 and pGJA15-2 to express the SeAP.
- Example 18 Regulation of the expression of SeAP by the plasmids pGJ14, pGJ15 and pGJA15-2 coinjected with the plasmid pTet-tTAk.
- Example 18.1 Regulation of the expression of SeAP by the plasmids PGJA15 and pGJA15-2 coinjected with the plasmid pTet-tTAk.
- the results presented in FIG. 22 evaluate the inhibition of the expression of SeAP on cells cotransfected with the plasmid pTet-tTAk and, respectively, the plasmids pGJA15 and pGJA15-2.
- the plasmid pGJA 15 in which the orientation of the pTet promoter does not allow the synthesis of the antisense SeAP transcript, no inhibition is observed, as much in the presence as in the absence of tetracycline.
- the plasmid pGJA15-2 in which the inducible promoter pTet is functionally linked to the antisense SeAP gene, produces a significant inhibition of the expression of SeAP in the absence of tetracycline.
- plasmid pGJA15-2 can be used for a strategy of regulation of the expression of an exogenous reporter gene based on the coinjection of two plasmids, where Fantisens and sense are carried by the same plasmid and are produced at from the same sequence on the same plasmid.
- Example 18.2 Regulation of the expression of SeAP by the plasmid pGJA14 coinjected with the plasmid pTet-tTAk
- Example 16.1 The same experiment as that described in Example 16.1 was carried out on cells cotransfected with the plasmids pGJA14 and pTet-tTAk ( Figure 23). The expression of SeAP is inhibited in the absence of tetracycline, in comparison with the constitutive expression of column 5.
- the data presented in FIG. 24 show that the expression of the exogenous reporter gene SeAP (plasmid pRDA02) in the presence of the transactivator hPPAR ⁇ 2 (plasmid pSG5-hPPAR ⁇ 2), but in the absence of the BRL fibrate (RPR131300A at 10 '2 M in water) is not zero (column 1).
- the data in the following columns shows that this base level can be reduced by adding increasing amounts of antisense transcripts obtained by transfecting the plasmid pSeAPAS.
- the presence of the antisense transcript does not prevent a certain inducibility of the expression of SeAP by fibrate (reports in columns 3 and 4; 5 and 6; 7 and 8; respectively).
- the combined system of the three plasmids pRDA02, pSG5-hPPAR ⁇ 2 and pSeAPAS therefore allows control of the expression of the exogenous reporter gene SeAP while minimizing the expressions of residual leakage in the absence of the inducing agent, such as fibrate.
- Figure 25 shows, in columns 1 and 2, the level of expression of the SeAP gene carried by the plasmid pINDSeAP, in the absence and in the presence of an inducer of the ecdysone system, ponasterone ( Figure 26; No et al., PNAS , 1996, pp 3346-3351).
- Figure 26 the level of expression is low, but not zero. This level is reduced to zero when the plasmid pSeAPAS, expressing the antisense transcript of SeAP, is cotransfected with the plasmid pINDSeAP (column 3).
- the combined system from three plasmids pINDSeAP, pVgRXR, and pSeAPAS therefore allows control of the expression of the exogenous reporter gene SeAP while eliminating the expressions of residual leakage observed in the absence of the ecdysone inducer.
- Example 21 In vivo regulation kinetics by the inhibitory transcript of the SeAPantisens type placed under the control of a promoter repressible by doxycycline.
- mice 30 6 week SCID mice are treated as previously described and are divided into 5 lots.
- the first batch of mice (batch 1; Figure 27) is treated with the plasmid pXL3010.
- a residual expression of the SeAP gene is noted when it is placed under the control of the constitutive promoter CMV.
- the second batch of mice (batch 2; Figure 27) receives in coinjection followed by electrotransfer, the plasmids pGJA14 and pTet-tTAk.
- the results presented in FIG. 27 clearly show that a residual expression of the SeAP gene is zero in vivo, in the absence of doxycycline.
- the third batch of mice receives in coinjection followed by electrotransfer the plasmids pGJA14 and pTet-tTAk and doxycycline in the drinking water.
- the expression of the SeAP gene measured on the 8 th day, is then significantly activated in the presence of doxycycline, at a level much higher than the level of expression constituting the SeAP obtained for batch 1.
- the fourth batch of mice receives in coinjection followed by electrotransfer, the plasmids pGJA15-2 and pTet-tTAk. In the absence of doxycycline, the residual expression of SeAP is greatly reduced compared to the constitutive expression observed in lot 1, but not zero.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Public Health (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Diabetes (AREA)
- Hematology (AREA)
- Neurology (AREA)
- Virology (AREA)
- Heart & Thoracic Surgery (AREA)
- Cardiology (AREA)
- Neurosurgery (AREA)
- Rheumatology (AREA)
- Cell Biology (AREA)
- Orthopedic Medicine & Surgery (AREA)
- Physical Education & Sports Medicine (AREA)
- Obesity (AREA)
- Endocrinology (AREA)
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| FR0010730 | 2000-08-18 | ||
| FR0010730A FR2813085A1 (fr) | 2000-08-18 | 2000-08-18 | Systeme de regulation in vivo de l'expression d'un transgene par inhibition conditionnelle |
| US23924600P | 2000-10-11 | 2000-10-11 | |
| US239246P | 2000-10-11 | ||
| PCT/FR2001/002606 WO2002013758A2 (fr) | 2000-08-18 | 2001-08-10 | Systeme de regulation in vivo de l'expression d'un transgene par inhibition conditionnelle |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1311298A2 true EP1311298A2 (de) | 2003-05-21 |
Family
ID=26212583
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP01965323A Withdrawn EP1311298A2 (de) | 2000-08-18 | 2001-08-10 | In vivo system zur regulierung der expression eines transgens durch konditionelle inhibierung |
Country Status (7)
| Country | Link |
|---|---|
| US (2) | US20020166132A1 (de) |
| EP (1) | EP1311298A2 (de) |
| JP (1) | JP2004505647A (de) |
| AU (1) | AU2001285990A1 (de) |
| CA (1) | CA2419790A1 (de) |
| IL (1) | IL154508A0 (de) |
| WO (1) | WO2002013758A2 (de) |
Families Citing this family (17)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1447453A1 (de) * | 2003-02-13 | 2004-08-18 | Max-Planck-Gesellschaft Zur Förderung Der Wissenschaften E.V. | System für induzierbare lokale und reversible Genschaltung unter Verwendung von RNA-Interferenz |
| EP1689784B1 (de) * | 2003-11-14 | 2014-07-16 | Children's Medical Center Corporation | Selbstspaltende ribozyme und anwendungen dafür |
| EP1799825B1 (de) | 2004-10-05 | 2011-06-29 | The California Institute of Technology | Aptamer-regulierte nukleinsäuren und verwendungen davon |
| WO2006073727A2 (en) * | 2004-12-21 | 2006-07-13 | Monsanto Technology, Llc | Recombinant dna constructs and methods for controlling gene expression |
| US20060200878A1 (en) | 2004-12-21 | 2006-09-07 | Linda Lutfiyya | Recombinant DNA constructs and methods for controlling gene expression |
| EP3199646A1 (de) | 2006-10-12 | 2017-08-02 | Monsanto Technology LLC | Pflanzen-mikro-rnas und verfahren zur verwendung davon |
| WO2008058291A2 (en) * | 2006-11-09 | 2008-05-15 | California Institute Of Technology | Modular aptamer-regulated ribozymes |
| US20090082217A1 (en) * | 2007-07-16 | 2009-03-26 | California Institute Of Technology | Selection of nucleic acid-based sensor domains within nucleic acid switch platform |
| US20120165387A1 (en) | 2007-08-28 | 2012-06-28 | Smolke Christina D | General composition framework for ligand-controlled RNA regulatory systems |
| US8367815B2 (en) * | 2007-08-28 | 2013-02-05 | California Institute Of Technology | Modular polynucleotides for ligand-controlled regulatory systems |
| US8865667B2 (en) | 2007-09-12 | 2014-10-21 | California Institute Of Technology | Higher-order cellular information processing devices |
| US9029524B2 (en) * | 2007-12-10 | 2015-05-12 | California Institute Of Technology | Signal activated RNA interference |
| US8329882B2 (en) | 2009-02-18 | 2012-12-11 | California Institute Of Technology | Genetic control of mammalian cells with synthetic RNA regulatory systems |
| US9145555B2 (en) | 2009-04-02 | 2015-09-29 | California Institute Of Technology | Integrated—ligand-responsive microRNAs |
| JP6385644B2 (ja) * | 2013-03-13 | 2018-09-05 | 静岡県公立大学法人 | 目的遺伝子を発現させるための光学スイッチ用コンストラクト |
| EP3455358B1 (de) * | 2016-05-12 | 2020-08-26 | Janssen Vaccines & Prevention B.V. | Potenter und ausbalancierter bidirektionaler promotor |
| WO2018165536A1 (en) * | 2017-03-10 | 2018-09-13 | The Medical College Of Wisconsin, Inc. | Riboswitch modulated gene therapy for retinal diseases |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB8901677D0 (en) * | 1989-01-26 | 1989-03-15 | Ici Plc | Hybrid seed production |
| US6048850A (en) * | 1992-09-22 | 2000-04-11 | Young; Donald A. | Method of inhibiting prostaglandin synthesis in a human host |
| US5866755A (en) * | 1993-06-14 | 1999-02-02 | Basf Aktiengellschaft | Animals transgenic for a tetracycline-regulated transcriptional inhibitor |
| US6204059B1 (en) * | 1994-06-30 | 2001-03-20 | University Of Pittsburgh | AAV capsid vehicles for molecular transfer |
| WO1997044465A1 (en) * | 1996-05-20 | 1997-11-27 | Monsanto Company | Method for controlling seed germination using soybean acyl coa oxidase sequences |
| FR2801319A1 (fr) * | 1999-11-18 | 2001-05-25 | Inst Nat Sante Rech Med | Construction d'acide nucleique porteuse d'un systeme regulant l'expression d'un gene |
-
2001
- 2001-08-10 EP EP01965323A patent/EP1311298A2/de not_active Withdrawn
- 2001-08-10 WO PCT/FR2001/002606 patent/WO2002013758A2/fr not_active Ceased
- 2001-08-10 AU AU2001285990A patent/AU2001285990A1/en not_active Abandoned
- 2001-08-10 CA CA002419790A patent/CA2419790A1/en not_active Abandoned
- 2001-08-10 JP JP2002518906A patent/JP2004505647A/ja not_active Withdrawn
- 2001-08-10 IL IL15450801A patent/IL154508A0/xx unknown
- 2001-08-17 US US09/931,007 patent/US20020166132A1/en not_active Abandoned
-
2005
- 2005-04-15 US US11/106,674 patent/US20050289658A1/en not_active Abandoned
Non-Patent Citations (2)
| Title |
|---|
| None * |
| See also references of WO0213758A3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| IL154508A0 (en) | 2003-09-17 |
| AU2001285990A1 (en) | 2002-02-25 |
| WO2002013758A2 (fr) | 2002-02-21 |
| US20050289658A1 (en) | 2005-12-29 |
| WO2002013758A3 (fr) | 2002-07-18 |
| US20020166132A1 (en) | 2002-11-07 |
| CA2419790A1 (en) | 2002-02-21 |
| JP2004505647A (ja) | 2004-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1311298A2 (de) | In vivo system zur regulierung der expression eines transgens durch konditionelle inhibierung | |
| EP1778297B1 (de) | Adeno-assoziierter viraler vektor zur exon-überspringung in einem für ein protein mit überflüssiger domäne kodierenden gen | |
| EP0701450B1 (de) | Rekombinante viren und ihre verwendung bei der gentherapie | |
| Dean | Nonviral gene transfer to skeletal, smooth, and cardiac muscle in living animals | |
| CN101883777A (zh) | 成纤维细胞生长因子受体4表达的反义调节 | |
| EP4298217A1 (de) | Gewebespezifische verfahren und zusammensetzungen zur modulation eines genoms | |
| WO1996010087A1 (fr) | Methode de traitement des cancers par regulation de l'activite des proteines ras | |
| US20050059620A1 (en) | Promoter driven tissue specific cytotoxic agents and title methods of use | |
| Tomita et al. | Gene therapy with transcription factor decoy oligonucleotides as a potential treatment for cardiovascular diseases | |
| US20060269530A1 (en) | RNA interference compositions and methods | |
| CA2246664A1 (en) | Vascular specific regulatory elements contained in the desmin 5' flanking region | |
| JP2022511227A (ja) | Igf-1異型体を発現させるdnaコンストラクトを用いた神経病症の治療 | |
| Quarck et al. | Gene therapy approaches for cardiovascular diseases | |
| CA2341775A1 (fr) | Systeme d'expression inductible | |
| JP2003500422A (ja) | 石灰化した腫瘍および組織を治療するためのオステオネクチンに基づく毒性遺伝子治療 | |
| FR2813085A1 (fr) | Systeme de regulation in vivo de l'expression d'un transgene par inhibition conditionnelle | |
| US20090048191A1 (en) | Therapeutic molecules for modulating stability of vegf | |
| CA2351015C (fr) | Nouveau systeme de regulation de l'expression d'un transgene | |
| CA2375869A1 (fr) | Systeme de regulation de l'expression utilisant les recepteurs nucleaires ppar | |
| JPH09505984A (ja) | 遺伝子座制御領域の制御下のウイルスdecoyタンパク質の発現およびその使用 | |
| WO1995025804A1 (fr) | Adenovirus recombinants codant pour le facteur neurotrophique derive du cerveau (bdnf) | |
| EP0941243A1 (de) | Polypeptide, welche domänen des proteingax enthalten, die eine rolle bei der repression der transkripten spielen bzw. mit anderen proteinen interagieren, sowie deren nukleinsäuren und verwendung | |
| EP1263978B1 (de) | Durch entzündungsvermittler induzierbare hybridpromotoren, diese enthaltende vektoren und verwendungen davon | |
| WO2002008448A2 (en) | Non-viral linear dna vectors and methods for using the same | |
| Dzau et al. | Gene therapy in cardiovascular disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20030318 |
|
| AK | Designated contracting states |
Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: BIGEY, PASCAL Inventor name: BETTAN, MICHAEL Inventor name: SCHERMAN, DANIEL |
|
| 17Q | First examination report despatched |
Effective date: 20070209 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20070620 |