EP1294936A2 - Hoch-durchsatz-screening verfahren zur haplotypisierung - Google Patents

Hoch-durchsatz-screening verfahren zur haplotypisierung

Info

Publication number
EP1294936A2
EP1294936A2 EP01922863A EP01922863A EP1294936A2 EP 1294936 A2 EP1294936 A2 EP 1294936A2 EP 01922863 A EP01922863 A EP 01922863A EP 01922863 A EP01922863 A EP 01922863A EP 1294936 A2 EP1294936 A2 EP 1294936A2
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
snp
allele
acid sample
hybridization
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01922863A
Other languages
English (en)
French (fr)
Inventor
John E. Landers
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
PolyGenyx Inc
Original Assignee
PolyGenyx Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by PolyGenyx Inc filed Critical PolyGenyx Inc
Publication of EP1294936A2 publication Critical patent/EP1294936A2/de
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/6818Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer

Definitions

  • the invention relates to high throughput methods for single nucleotide polymorphism (SNP) haplotyping.
  • the methods involve analysis of polymorphic loci of a nucleic acid using techniques involving hybridization, primer extension, MALDI TOF, HPLC, and/or fluorescence detection.
  • Mapping of complex traits or diseases requires that the entire genome be scanned in order to identify all genomic regions that potentially contribute to the development of that trait or disease.
  • genome wide scans are performed using polymorphic DNA markers to determine which markers segregate with a complex trait of interest. The loci which are identified as contributing to a disease can then be mapped to specific genomic regions based on the known chromosomal locations of the markers segregating with or "linked" to that trait.
  • DNA polymorphisms or markers occur in the human genome and can be used in genome wide scans. These include restriction fragment length polymorphisms (RFLPs), microsatellites or simple sequence length polymorphisms (SSLPs), and single nucleotide polymorphisms (SNPs).
  • RFLPs restriction fragment length polymorphisms
  • SSLPs simple sequence length polymorphisms
  • SNPs single nucleotide polymorphisms
  • RFLPs are single nucleotide changes (point changes or insertion/deletion changes) which alter a restriction site and thus the digestion pattern of a given segment of DNA.
  • RFLPs were the first type of polymorphism identified and were used as a tool to construct early genetic linkage maps in humans.
  • RFLPs are unsuitable for a large scale analysis of populations, however, because they are unreliable and not amenable to automation.
  • RFLPs are unreliable when used to analyze genetically-related individuals, because RFLPs have only two alleles, one with the restriction site and one without and related individuals generally have the same allele on both chromosomes. Additionally, RFLPs are not amenable to automation because RFLP detection requires tl e use of Southern Blot techniques which are not easily automated.
  • Micr satellite markers or SSLPs are sequences that are repeated in tandem, with the number of repeats resulting in multiple alleles of different lengths.
  • Microsatellite markers are useful for identifying genes involved in traits which follow simple Mendelian, monogenic patterns of inheritance. Microsatellites, however, have proven to be unsuitable for studies involving traits which follow non-Mendelian complex patterns of inheritance because microsatellites are not optimally abundant, occurring only once every few kilobases. Microsatellites also have a high mutation and recombination rate which makes them genetically unstable. Microsatellite markers are not amenable to high throughput analysis because they can only be analyzed using PCR and gel-based assays, which require a substantial investment in labor and time as well as cost.
  • SNPs are single base pair positions in the genome at which different sequence alternatives (alleles) exist in the population at frequencies of greater than 1%. SNPs are extremely stable and dense within the genome, but are not optimally informative because they only identify a single loci, and thus have low statistical power.
  • the invention relates to a high throughput method for SNP -based haplotyping, which is capable of assessing multiple alleles in large numbers of genomic samples.
  • SNP haplotype analysis is much more informative than single SNP loci analysis because it enables the analysis of complex traits.
  • Each haplotype segregates as a contiguous set of alleles within families and consideration of multiple closely-linked marker loci can provide a larger number of alleles, each of low frequency. If a chromosomal region has multiple polymorphic loci, none of which are individually very informative, then haplotypes of these loci can be used to define a new locus with a heterozygosity and informativeness significantly beyond that of any single marker contained therein.
  • the high throughput method of SNP-haplotyping described and claimed herein provides improved methods for SNP-haplotyping that can dramatically increase the rate of haplotype analysis and enable large scale haplotyping studies.
  • the invention is a method for haplotyping.
  • the method involves analyzing a first polymorphic locus of a nucleic acid within a sample by specifically capturing the nucleic acid on a surface wherein the step of capturing the nucleic acid on the surface identifies a first allele of a first SNP of the polymorphic locus, repeating the analysis of the first polymorphic locus of the nucleic acid to identify a second allele of the first SNP of the polymorphic locus, separately analyzing a second SNP of a polymorphic locus of the nucleic acid sample to identify both alleles of the second SNP, and determining the haplotype based on the identification of each allele of each SNP.
  • the term "separately" refers to analysis in discreet physical locations.
  • first and second SNPs are analyzed separately, they may be analyzed simultaneously.
  • the different SNP alleles may also be analyzed on the same surface (i.e. surface of a slide) as long as they are analyzed on different spots or discreet locations of the slide from one another.
  • the second SNP is analyzed using a method selected from the group consisting of hybridization, primer extension, MALDI TOF, and HPLC.
  • the second SNP is analyzed by hybridization of the nucleic acid sample with an ASO complementary to a first allele of the second SNP and an ASO complementary to a second allele of the second SNP.
  • the nucleic acid is captured by hybridization with an ASO, and wherein the ASO is fixed to a surface.
  • ASO is fixed to a surface.
  • a first ASO complementary to a first allele of the first SNP and a second ASO complementary to a second allele of the first SNP are hybridized to the surface and are used to capture the nucleic acid.
  • each ASO corresponding to an allele of the first SNP further includes a spacer sequence.
  • the spacer sequence is selected from the group consisting of a poly-T, poly- A, poly-C, and poly-G.
  • each of the ASOs corresponding to an allele of the second SNP may be hybridized independently to the nucleic acid sample.
  • the alleles of the second SNP are analyzed simultaneously with one another.
  • At least one of the ASOs complementary to an allele of the first SNP and at least one of the ASOs complementary to an allele of the second SNP contains a fluorescent label or quencher, the fluorescent label or quencher of the two ASOs, being distinct from one another.
  • the surface may be any type of solid support, such as, for instance, a multiwell dish, a chip, a slide or a bead.
  • the nucleic acid sample may be prepared by any method known in the art.
  • the nucleic acid may be prepared by PCR amplification of a polymorphic locus from a genomic DNA sample.
  • the nucleic acid sample may be a reduced complexity genome.
  • the nucleic acid sample is labeled with a first label.
  • the presence of one set of alleles at the polymorphic locus is associated with a disease and the haplotyping method is performed to identify predisposition to the disease.
  • the methods for haplotyping may also involve analysis of more than two SNPs.
  • a third SNP of a polymorphic locus of the nucleic acid sample is analyzed to identify both alleles of the third SNP, and the haplotype is determine based on the identification of each allele of each SNP.
  • a fourth SNP of a polymorphic locus of the nucleic acid sample is analyzed to identify both alleles of the fourth SNP, and the haplotype is determine based on the identification of each allele of each SNP.
  • Many genes are known to have multiple SNPs, for example the APOE gene has a reported 23 variable sites. Therefore the haplotyping technology of the invention involves the analysis of haplotypes containing multiple (i.e. >2) SNPs, e.g., using a microarray-based haplotyping method that can determine the haplotype for any number of SNPs with just two hybridizations.
  • the invention in other aspects relates to a method for haplotyping by analyzing a genotype of a first SNP of a polymorphic locus of a nucleic acid within a sample in solution by detecting the presence or absence of a first labeled probe which specifically identifies a first putative allele of the SNP and detecting the presence or absence of a second labeled probe which specifically identifies a second putative allele of the SNP, separating the nucleic acid sample based on the genotype of the first SNP, and analyzing a second SNP of the polymorphic locus of the separated nucleic acid samples to identify the haplotype of the nucleic acid.
  • the analysis of the first SNP is performed using fluorescence detection and the nucleic acid sample is separated using flow cytometry.
  • the second SNP is analyzed using a method selected from the group consisting of hybridization, primer extension, MALDI TOF, and HPLC.
  • a method for haplotyping involves labeling first and second SNPs of a polymorphic locus of a nucleic acid within a sample in solution with a first, second, third, and fourth labeled probe which specifically identifies a first and second putative allele of the first SNP and a first and second putative allele of the second SNP respectively, separating the labeled nucleic acid sample into single nucleic acid molecules, detecting the presence or absence of the first, second, third, and fourth labeled probes on the single nucleic acid molecules to identify the haplotype of the nucleic acid.
  • the probes are labeled with fluorescence molecules and optionally each of the fluorescent molecules of the labeled probes is spectrally distinct.
  • the invention in another aspect is a method for haplotyping by performing four hybridization reactions on a nucleic acid sample, each of the four hybridization reactions involving one labeled probe specific for one allele of one of two SNPs, each of the labeled probes labeled with a spectrally distinct label and wherein each label on the probe specific for a first of the two SNPs is a spectral pair with the label on each probe specific for the second of the two SNPs, bringing each of the labeled probes in each hybridization reaction within energy transfer distance from one another, exciting one of the labeled probes in each hybridization reaction, and detecting electromagnetic radiation released from the other labeled probe as a signal, wherein the presence or absence of a signal for each hybridization reaction is an indicator of the haplotype of the nucleic acid sample.
  • the method can be performed in solution or on
  • each hybridization reaction is performed in a separate vessel.
  • the labeled probes are brought within energy transfer proximity of one another using binding partners, such as avidin and biotin.
  • the labeled probes are labeled ASOs.
  • a kit is provided according to other aspects of the invention.
  • the kit includes one or more containers housing: a first set of ASOs, wherein the first set of ASOs represents two ASOs, each containing one of the two alleles of a first SNP in a polymorphic locus, a second set of ASOs, wherein the second set of ASOs represents two ASOs, each containing one of the two alleles of a second SNP in the polymorphic locus, and instructions for performing a hybridization reaction to determine a haplotype from a genomic DNA sample using the first and second sets of ASOs.
  • the kit may include a set of PCR primers for amplifying the polymorphic locus of the genomic DNA sample.
  • the first set of ASOs are fixed to a surface and the second set of ASOs are labeled.
  • the ASOs include a spacer and the spacer sequence is selected from the group consisting of a poly-T, poly-A, poly-C, and poly-G.
  • Figure 1 is a flow chart and diagram depicting an exemplary method for performing high throughput SNP haplotyping analysis.
  • Figure 2 is a diagram depicting an exemplary arrangement for performing hybridization reactions to determine haplotype.
  • Figure 3 is a diagram depicting each potential result resulting from a double hybridization method for a single chromosome at a polymorphic locus. There are four possible haplotypes, each individually depicted in one of the four rows. Columns A-D refer to the hybridization surfaces schematically pictured in Figure 2.
  • Figure 4 is a diagram depicting examples of nucleic acid samples labeled with different fluorescent labels, to exemplify the single molecule detection methods.
  • Figure 5 is a graph depicting data generated from the haplotyping of 4 individuals (column sets 1-4). Haplotypes for each individual are as follows: #l-homozygote A-G, #2-homozygote A-G, #3- heterozygote G-G, A-G, #4-homozygote A-A.
  • Figure 6 is a diagram depicting four graphs that generated from the haplotyping of 4 individuals (graphs 1-4). Haplotypes for each individual are as follows: #1- homozygote G-C, #2- heterozygote G-T, G-C, #3- heterozygote G-C, C-C, #4- heterozygote G-T, C-C.
  • SEQ ID NO. 1 is a PCR primer for M13 w - CCTCAGTGACATCCTTGCCT.
  • SEQ ID NO. 2 is a PCR primer for Ml 3 (Rev) CATGCCCATTCTTCTCTGGT.
  • SEQ ID NO. 3 is a SNP1-(G detecting) oligo: NH 2 -(T) 15 AGTCTCCC(C)TTTCCCT.
  • SEQ ID NO. 4 is SNP1-(T detecting) oligo: NH 2 -(T) 15 AGTCTCCC(A)CTTTCCCT.
  • SEQ ID NO. 5 is SNP2-(C detecting) oligo: AGGGTGGT(G)CCAGAGGT.
  • SEQ ID NO. 6 is SNP2-(T-detecting) oligo: AGGGTGGT(A)CCAGAGGT.
  • SEQ ID NO:7 is a PCR forward primer: [PO4]-ACTTGACAGCGAGTGTGCTG.
  • SEQ ID NO:8 is a PCR reverse primer: GTCCCTTTGCTGCGTGAC.
  • SEQ ID NO:9 is a BAR-G oligo: NH 2 -(T) 23 CACCCAATGGAAGCCAT.
  • SEQ ID NO:10 is a BAR-A oligo: NH 2 -(T) 23 CACCCAATAGAAGCCAT.
  • SEQ ID NO.T 1 is a BARPIIGcc oligo: AGGAAATCGGCAGCTGT.
  • SEQ ID NO: 12 is a BARPIIAcc oligo: AGGAAATCAGCAGCTGT.
  • SEQ ID NO:13 is a biotinylated BAR-PIIG oligo: [Bio]-AGGAAATCGGCAGCTGT.
  • SEQ ID NO: 14 is a biotinylated BAR-PIIA oligo: [Bio]-AGGAAATCAGCAGCTGT.
  • SEQ ID NO: 15 is a PCR forward primer: GAACAGCAATGCACATTACCATGG.
  • SEQ ID NO: 16 is a PCR reverse primer: CTGTCAAGTATTTCTCCGCAGCATA.
  • SEQ ID NO: 17 is an amine-labeled 4035AmC oligo:
  • SEQ ID NO: 18 is an amine-labeled 4035AmC oligo: NH 2 (T) 23 GCCACAATCAATGACAT.
  • SEQ ID NO: 19 is a 4035ColdCompG oligo: ATGTCATTGATTGTGGC.
  • SEQ ID NO.20 is a 4035ColdCompC oligo: ATGTCATTCATTGTGGC.
  • SEQ ID NO:21 is a biotinylated 4035-CB oligo: Biotin-TGTATAATCAGAATTAT.
  • SEQ ID NO:22 is a biotinylated 4035-TB oligo: Biotin-TGTATAATTAGAATTAT.
  • SEQ ID NO:23 is a cold competitive 4035-C oligo: TGTATAATCAGAATTAT.
  • SEQ ID NO:24 is a cold competitive 4035-T oligo: TGTATAATTAGAATTAT.
  • SNPs occur in the epsilon allele of the apolipoprotein E locus (APOE).
  • APOE apolipoprotein E locus
  • the precise haplotype an individual inherits can also predict the age of onset of disease from younger than 70 years for the e4/e4 haplotype to greater than 90 years for the e2/e3 haplotype, a more than 20 year shift in susceptibility.
  • the invention involves the identification of high throughput methods for screening DNA to identify polymorphic haplotypes and to enable identification of haplotypes associated with predisposition to these and other diseases as well as other genetically associated traits.
  • the high throughput method is based on the analysis of SNPs.
  • the invention involves the use of a capture step to analyze the SNPs. Two types of SNP haplotyping methods have been described in the prior art, the 3' mismatch PCR-SSP and SMD methods.
  • PCR-SSP 3' mismatch PCR-sequence-specific primers
  • ASA allele-specific amplification
  • Single molecule dilution is a method which involves serial dilution of genomic DNA until an average of one molecule or haploid equivalent of DNA per 5-10 aliquots is reached. After dilution, a multi-step PCR reaction known as a booster PCR is performed with each of the 5-10 aliquots. The PCR reactions are analyzed by gel electrophoresis and then with dot blot hybridization or direct sequencing to determine haplotypes. There are many disadvantages associated with this technique, including the many laborious steps which prevent high throughput screening, the increased likelihood of shearing due to the dilution steps, and sensitivity of the reaction to any DNA contamination.
  • the marker In order for a marker to be effective in genetically dissecting complex traits in genome wide scans, the marker should be abundant, stable, informative, amenable to high throughput analysis, have high scoring power, and be useful in linkage disequilibrium analysis.
  • the ability for a marker to be amenable to high throughput analysis is very important. Due to the genetic complexity with which most phenotypic traits and diseases arise, genome wide scan analysis requires the genotyping of thousands of individuals in order to achieve adequate statistical power.
  • the polymorphic markers used thus, must be amenable to a high throughput and cost efficient method of analysis in order to analyze the extremely large numbers of samples required.
  • the SNP -based methods of the invention are high throughput, whereas the 3' mismatch PCR-SSP and SMD methods are not.
  • Scoring power is also important. Scoring power refers to the degree of ease, accuracy and reliability with which a marker's presence or absence can be determined in the genome that is being analyzed. In order to genotype thousands of test genomes in a time and cost efficient manner, the polymorphic marker must be easily scored as either present or absent and this scoring must be accurate and reliable without the need for secondary rounds of testing. Neither RFLP marker analysis nor microsatellite marker analysis for complex traits are amenable to high throughput analysis or scoring power. The scoring power of microsatellite markers is low, since the determination of whether a marker is present or absent requires highly skilled labor for reading gels because of the difficulty associated with distinguishing alleles at each locus on gels. The SNP haplotyping methods of the invention have high scoring power.
  • Linkage disequilibrium analysis is the preferential association within populations of one allele of one locus with another allele of another locus, at a frequency greater than that expected by chance. (Brookes, A.J., Gene, 234:177-186 (1999)). If a new polymorphic allele develops within a grouping of other polymorphic alleles at other contiguous loci and is so closely linked with these other alleles that recombination within that region is very unlikely, then, as the disease allele becomes replicated over time, all the alleles would be replicated together. Thus, linkage disequilibrium would have been established between the disease allele and the alleles within that grouping.
  • Linkage disequilibrium is a powerful tool that is useful in locating genes involved in the development of a complex trait. This tool can only be used, however, if the polymorphic markers are extremely stable and not prone to recombination events which would disrupt the DNA sequence of the polymorphic marker and very dense such that a sufficient number of markers will be found in a non- recombinatorial distance to the complex trait alleles, thereby assuring their association. SNPs are extremely stable and dense within the genome and thus have high statistical power as polymorphic markers for linkage disequilibrium studies.
  • the high throughput SNP haplotyping method of the invention overcomes many of the problems with the prior art methods of haplotyping.
  • the methods of the invention which involve either capture of specific SNPs and/or solution phase detection are amenable to high throughput and allow the simultaneous discrimination and haplotyping of multiple SNP loci for both chromosomes of an individual. Methods can be performed on many nucleic acid samples at a time, thus, providing massive quantities of haplotype information, which is useful in characterizing complex traits and diseases. Additionally, the methods provide fewer false readings than some prior art methods.
  • the invention is a method for haplotyping, which involves the specific capture of a nucleic acid on the surface.
  • the method involves analyzing a first polymorphic locus of a nucleic acid within a sample by specifically capturing the nucleic acid on a surface wherein the ' step of capturing the nucleic acid on the surface identifies a first allele of a first SNP of the polymorphic locus, repeating the analysis of the first polymorphic locus of the nucleic acid to identify a second allele of the first SNP of the polymo ⁇ hic locus, analyzing a second SNP of a polymorphic locus of the nucleic acid sample to identify both alleles of the second SNP, and determining the haplotype based on the identification of each allele of each SNP.
  • Haplotyping is a process of genetic analysis which involves identifying genetic markers within a linked genetic region.
  • haplotype is derived from the phrase "haploid genotype" and refers to the allelic constitution of a single chromosome or chromosomal region at two or more loci. The term has developed two variant uses in the field of human genetics. The first use of haplotype refers to the arrangement of alleles along a given section of a chromosome and is frequently used in association with disease mappings and studies to identify which closely linked polymorphic markers in a number of affected individuals are held in common by descent from a common ancestor who possessed the founder chromosome.
  • haplotype refers to a small genetic region within which recombination is very rare, such that specific allelic combinations of polymorphic markers are seldom, if ever, disrupted by meiotic recombination. As a result, linkage disequilibrium exists and certain allelic recombinations will occur in the population much more frequently than would be expected by chance while other combinations will occur much less frequently.
  • haplotype analysis described herein is consistent with the second use of the term haplotype.
  • haplotype refers to an ordered combination of alleles in a defined genetic region that co-segregate. Such alleles are said to be “linked.”
  • the alleles of the haplotype may be within a gene, between genes, or in adjacent genes or chromosomal regions that co-segregate with high fidelity.
  • linkage refers to the degree to which regions of a nucleic acid are inherited together. DNA on different chromosomes are inherited together 50% of the time and do not exhibit linkage.
  • linkage disequilibrium refers to the co-segregation of two alleles at a linked loci such that the frequency of the co-segregation of the alleles is greater than would be expected from separate frequencies of occurrence of each allele.
  • at least one of the two polymorphic loci is analyzed using a capture step.
  • a nucleic acid within a sample is specifically captured on a surface in order to identify the first allele of a first SNP of the polymorphic locus.
  • the nucleic acid can be captured by any method known in the art for sequence-specific nucleic acid capture.
  • an allele-specific oligonucleotide (ASO) which is complementary to a sequence spanning the first SNP of the polymorphic locus of the nucleic acid may be attached to the surface then caused to interact with the nucleic acid by a hybridization reaction.
  • any binding molecule which is specific for the first SNP of the polymorphic locus of the nucleic acid, may be used to bind and interact with the nucleic acid to capture it on the surface.
  • a binding molecule such as an ASO, which is linked to a first binding partner, such as streptavidin, may be allowed to hybridize or interact with the first SNP region of the nucleic acid within the sample to form a complex.
  • This complex may then be interacted with a surface containing a second binding partner, such as biotin, attached thereto.
  • a second binding partner such as biotin
  • Other methods for capturing a nucleic acid in a sequence-specific manner will be apparent to those of ordinary skill in the art. For instance primer extension, oligonucleotide ligation assay (OLA) or a combination of binding partner- ASO hybridization can be used.
  • Binding partner-ASO hybridization is a method which involves a tag attached to an ASO which can specifically hybridize to a nucleic acid.
  • the tag is a binding partner which can specifically bind to another molecule and thus capture the ASO or ASO/nucleic acid complex.
  • Binding partners include for instance biotin, avidin, flourescein, anti- flourescein antibodies, other antigens and antibodies, haptens, chemical groups which are capable of specifically interacting with specific compounds, nucleic acids that can specifically hybridize with nucleic acids attached to a surface.
  • the capture step is carried-out for each of the two alleles of the first SNP of the polymorphic locus of the nucleic acid in the sample.
  • the capture steps performed on the first and second allele may be the same (i.e., both may involve allele-specific hybridization of the nucleic acid sample to an ASO attached to a surface) or different (i.e., analysis of the first allele may involve allele-specific hybridization and capture of the second allele may involve use of binding partners). It is important to identify using a capture step both the first and second alleles of the first SNP. Thus, it is important to determine the identity of both alleles of the first SNP within the nucleic acid sample. Once the first two alleles of the first SNP are identified, both alleles of the second SNP are identified to determine the haplotype.
  • the alleles of the second SNP may be dete ⁇ nined using any methods known in the art for identifying SNPs. These methods include, but are not limited to, hybridization, primer extension, MALDI-TOF, HPLC, solution phase detection, and fluorescence detection.
  • Methods for identifying alleles of a SNP using hybridization include the methods described above. For instance, an ASO/nucleic acid sample complex, which is hybridized to a surface as described above, may be subjected to a second hybridization reaction to detect the identity of the second SNP in the nucleic acid sample.
  • probes such as ASOs, which are complementary to both potential alleles of the second SNP, can be separately hybridized to the ASO/nucleic acid sample complex attached to the surface to identify the presence of the second SNP. If the probe or ASOs are labeled, the presence of the bound label can be detected to determine the presence or absence of the hybridization reaction.
  • Primer extension can also be used to identify the alleles of the second SNP.
  • Primer extension is performed by hybridizing primers which flank but do not span the second SNP, performing a primer extension reaction to produce a PCR product.
  • the primers may hybridize directly to the nucleic acid adjacent to the polymorphic site or they may hybridize to a site which is some distance away. It is possible to determine which allele is present in the nucleic acid sample in one of several ways. For instance, if one possible allele is a G at the polymorphic site then a labeled G can be added to the primer extension mixture instead of an unlabeled G. In some cases the labeled nucleotide is a dideoxynucleotide which will stop the production of the strand being created.
  • the label may be any type of detectable label, e.g., a fluorescent label or a binding partner, e.g., biotin.
  • MALDI-TOF matrix-assisted laser desorption ionization time of flight mass spectrometry provides for the" spectrometric determination of the mass of poorly ionizing or easily-fragmented analytes of low volatility by embedding them in a matrix of light- absorbing material and measuring the weight of the molecule as it is ionized and caused to fly by volatilization. Combinations of electric and magnetic fields are applied on the sample to cause the ionized material to move depending on the individual mass and charge of the molecule.
  • U.S. Patent No. 6,043,031 issued to Koster et al., describes an exemplary method for identifying single-base mutations within DNA using MALDI- TOF and other methods of mass spectrometry.
  • HPLC high performance liquid chromatography
  • HPLC can be used to separate nucleic acid sequences based on size and/or charge.
  • a nucleic acid sequence having one base pair difference from another nucleic acid can be separated using HPLC.
  • nucleic acid samples, which are identical except for a single allele may be differentially separated using HPLC, to identify the presence or absence of a particular allele.
  • the HPLC is dHPLC (denatured HPLC).
  • dHPLC involves the denaturation of the nucleic acid sample, followed be a reannealing step where the nucleic acid can assume a secondary structure, which will differ somewhat in nucleic acid samples having different alleles.
  • the ASO or other probes or binding molecules is fixed to a surface.
  • a surface refers to any type of solid support material to which a molecular component such as an ASO is capable of being fixed. Surfaces include, for instance, single or multi-well dishes, chips, slides, membranes, beads, agarose or other types of solid support mediums.
  • the nucleic acid sample being analyzed is any type of nucleic acid in which potential SNP-haplotypes exist.
  • the nucleic acid sample may be an isolated genome or a portion of an isolated genome.
  • An isolated genome consists of all of the DNA material from a particular organism, i.e., the entire genome.
  • a portion of an isolated genome which is referred to herein as a reduced complexity genome (RCG) is a plurality of DNA fragments within an isolated genome but which does not include the entire genome.
  • Genomic DNA comprises the entire genetic component of a species excluding, applicable, mitochondrial and chloroplast DNA.
  • the methods of the invention can also be used to analyze mitochondrial, chloroplast, etc., DNA as well.
  • the genomic DNA can vary in complexity.
  • species which are relatively low on the evolutionary scale can have genomic DNA, which is significantly less complex than species higher on the evolutionary scale.
  • Bacteria such as E coli have approximately 2.4 x 10 grams/mol of haploid genome, and bacterial genomes having a size of less than about 5 million base pairs (5 megabases) are known.
  • Genomes of intermediate complexity such as those of plants, for instance, rice, have a genome size of approximately 700-1000 megabases.
  • Genomes of highest complexity, such as maize or humans have a genome size of approximately 10 9 -10 ⁇ .
  • Humans have approximately 7.4 x 10 12 grams/mol of haploid genome.
  • a subject refers to any type of DNA-containing organism, and includes, for example, bacteria, virus, fungi, animals, including vertebrates, and invertebrates, and plants.
  • a "RCG” as used herein is a reproducible fraction of an isolated genome which is composed of a plurality of DNA fragments.
  • the RCG can be composed of random or non-random segments or arbitrary or non-arbitrary segments.
  • the term "reproducible fraction” refers to a portion of the genome which encompasses less than the entire native genome. If a reproducible fraction is produced twice or more using the same experimental conditions the fractions produced in each repetition include at least 50% of the same sequences. In some embodiments the fractions include at least 70%, 80%, 90%, 95%, 97%, or 99% of the same sequences, depending on how the fractions are produced.
  • a RCG is produced by PCR another RCG can be generated under identical experimental conditions having at a minimum greater than 90% of the sequences in the first RCG.
  • Other methods for preparing a RCG such as size selection are still considered to be reproducible but often produce less than 99% of the same sequences.
  • a “plurality” of elements, as used throughout the application refers to 2 or more of the element.
  • a “DNA fragment” is a polynucleotide sequence obtained from a genome at any point along the genome and encompassing any sequence of nucleotides.
  • the DNA fragments of the invention can be generated according to any one of two types mechanisms, and thus there are two types of RCGs, PCR-generated RCGs and native RCGs.
  • the nucleic acid sample may be prepared using conventional PCR amplification of a polymorphic locus from a genomic DNA sample using known primers. Alternatively PCR-generated RCGs are randomly primed.
  • each of the polynucleotide fragments in the PCR-generated RCG all have common sequences at or near the 5' and 3' end of the fragment (When a tag is used in the primer, all of the 5' and 3' ends are identical. When a tag is not used the 5' and 3' ends have a series of N's followed by the TARGET sequence (reading in a 5' to 3' direction).
  • the TARGET sequence is identical in each primer, with the exception of multiple-primed DOP-PCR) but the remaining nucleotides within the fragments do not have any sequence relation to one another.
  • each polynucleotide fragment in a RCG includes a common 5' and 3' sequence which is determined by tl e constant region of the primer used to generate the RCG.
  • each polynucleotide fragment would have near the 5' or 3' end nucleotides that are determined by the "TARGET nucleotide sequence".
  • the TARGET nucleotide sequence is a sequence which is selected arbitrarily but which is constant within a set or subset (e.g. multiple primed DOP-PCR) of primers.
  • each polynucleotide fragment can have the same nucleotide sequence near the 5' and 3' end arising from the same TARGET nucleotide sequence.
  • more than one primer can be used to generate the RCG.
  • each member of the RCG would have a 5' and 3' end in common with at least one other member of the RCG and, more preferably, each member of the RCG would have a 5' and 3' end in common with at least 5% of the other members of the RCG.
  • a RCG is prepared using DOP-PCR with 2 different primers having different TARGET nucleotide sequences, a population containing of four sets of PCR products having common ends could be generated.
  • One set of PCR products could be generated having the TARGET nucleotide sequence of the first primer at or near both the 5' and 3' ends and another set could be generated having the TARGET nucleotide sequence of the second primer at or near both the 5' and 3' ends.
  • Another set of PCR products could be generated having the TARGET nucleotide sequence of the second primer at or near the 5' end and the TARGET nucleotide sequence of the first primer at or near the 3' end.
  • a fourth set of PCR products could be generated having the TARGET nucleotide sequence of the second primer at or near the 3' end and the TARGET nucleotide sequence of the first primer at or near the 5' end.
  • the PCR generated genomes are composed of synthetic DNA fragments.
  • the DNA fragments of the native RCGs have arbitrary sequences. That is, each of the polynucleotide fragments in the native RCG do not have necessarily any sequence relation to another fragment of the same RCG. These sequences are selected based on other properties, such as size or, secondary characteristics. These sequences are referred to as native RCGs because they are prepared from native nucleic acid preparations rather than being synthesized. Thus they are native-non-synthetic DNA fragments.
  • the fragments of the native RCG may share some sequence relation to one another (e.g. if produced by restriction enzymes). In some embodiments they do not share any sequence relation to one another.
  • the RCG includes a plurality of DNA fragments ranging in size from approximately 200 to 2,000 nucleotide residues.
  • a RCG includes from 95 to 0.05% of the intact native genome.
  • the fraction of the isolated genome which is present in the RCG of the invention represents at most 90%) of the isolated genome, and in preferred embodiments, contains less than 50%, 40%, 30%, 20%, 10%, 5%, or 1% of the genome.
  • a RCG preferably includes between 0.05 and 1% of the intact native genome.
  • the RCG encompasses 10% or less of an intact native genome of a complex organism.
  • PCR-generated RCG including IRS- PCR, AP-PCR, DOP-PCR, multiple primed PCR, adaptor-PCR and multiple-primed- DOP-PCR.
  • Hybridization conditions for particular PCR methods are selected in the context of the primer type and primer length to produce to yield a set of DNA fragments which is a percentage of the genome, as defined above.
  • PCR methods have been described in many references, see e.g., US Patent Nos. 5,104,792; 5,106,727; 5,043,272; 5,487,985; 5,597,694; 5,731,171; 5,599,674; and 5,789,168.
  • Basic PCR methods have been described in e.g., Saiki et al, Science, 230: 1350 (1985) and U.S. Pat. Nos.
  • RCGs Another method for generating RCGs is based on the development of native RCGs.
  • Several methods can be used to generate native RCGs, including DNA fragment size selection, isolating a fraction of DNA from a sample which has been denatured and reannealed, pH-separation, separation based on secondary structure, etc.
  • Size selection can be used to generate a RCG by separating polynucleotides in a genome into different fractions wherein each fraction contains polynucleotides of an approximately equal size.
  • One or more fractions can be selected and used as the RCG. The number of fractions selected will depend on the method used to fragment the genome and to fractionate the pieces of the genome, as well as the total number of fractions.
  • One method of generating a RCG involves fragmenting a genome into arbitrarily size pieces and separating the pieces on a gel (or by HPLC or another size fractionation method). A portion of the gel is excised, and DNA fragments contained in the portion are isolated. Typically, restriction enzymes can be used to produce DNA fragments in a reproducible manner.
  • Different nucleic acid 1 sources may be used to generate RCGs.
  • mitochondrial DNA can be isolated and used as the source of the RCG.
  • Separation based on secondary structure can be accomplished in a manner similar to size selection. Different fractions of a genome having secondary structure can be separated on a gel. One or more fractions are excised from the gel, and DNA fragments are isolated therefrom.
  • Another method for creating a native RCG involves isolating a fraction of DNA from a sample which has been denatured and reannealed.
  • a genomic DNA sample is denatured, and denatured nucleic acid molecules are allowed to reanneal under selected conditions. Some conditions allow more of the DNA to be reannealed than other conditions. These conditions are well known to those of ordinary skill in the art. Either the reannealed or the remaining denatured fractions can be isolated. It is desirable to select the smaller of these two fractions in order to generate RCG.
  • the reannealing conditions used in the particular reaction determine which fraction is the smaller fraction. Variations of this method can also be used to generate RCGs.
  • the double stranded DNA may be removed (e.g., using column chromatography), the remaining DNA can then be allowed to partially reanneal, and the reannealed fraction can be isolated and used.
  • This variation is particularly useful for removing repetitive elements of the DNA, which rapidly reanneal.
  • the amount of isolated genome used in the method of preparing RCGs will vary, depending on the complexity of the initial isolated genome. Genomes of low complexity, such as bacterial genomes having a size of less than about 5 million base pairs (5 megabases), usually are used in an amount from approximately 10 picograms to about 250 nanograms.
  • a more preferred range is from 30 picograms to about 7.5 nanograms, and even more preferably, about 1 nanogram.
  • Genomes of intermediate complexity such as plants (for instance, rice, having a genome size of approximately 700-1,000 megabases) can be used in a range of from approximately 0.5 nanograms to 250 nanograms. More preferably, the amount is between 1 nanogram and 50 nanograms.
  • Genomes of highest complexity such as maize or humans, having a genome size of approximately 3,000 megabases
  • the nucleic acid sample can be an entire or a portion of an RNA genome.
  • RNA genomes differ from DNA genomes in that they are generated from RNA rather than from DNA.
  • An RNA genome can be, for instance, a cDNA preparation made by reverse transcription of RNA obtained from cells of a subject (e.g. human ovarian carcinoma cells).
  • a cDNA preparation made by reverse transcription of RNA obtained from cells of a subject (e.g. human ovarian carcinoma cells).
  • an RNA genome can be composed of DNA sequences, as long as the DNA is derived from RNA.
  • RNA samples can also be used directly.
  • the methods of the invention involve analysis of at least two SNPs to identify the haplotype.
  • the two SNPs are referred to as SNP1 or the first SNP and SNP2 or the second SNP.
  • the reference to a first or second SNP does not provide an indication of the order of the SNPs on the nucleic acid.
  • a "single nucleotide polymorphism" or "SNP” as used herein is a single base pair (i.e., a pair of complementary nucleotide residues on opposite genomic strands) within a DNA region wherein the identities of the paired nucleotide residues vary from individual to individual.
  • a "polymorphic region” is a region or segment of DNA the nucleotide sequence of which varies from individual to individual.
  • the two DNA strands which are complementary to one another except at the variable positions are referred to as alleles.
  • a polymorphism is allelic because some members of a species have one allele and other members have a variant allele and some have both. When only one variant sequence exists, a polymorphism is referred to as a diallelic polymorphism. There are three possible genotypes in a diallelic polymorphic DNA in a diploid organism.
  • a diploid individual's DNA may be homozygous for one allele, homozygous for the other allele, or heterozygous (i.e. having one copy of each allele).
  • other mutations it is possible to have triallelic or higher order polymorphisms.
  • polymorphic locus refers to a region of a nucleic acid that includes more than one single nucleotide polymorphism.
  • the method for haplotyping involves a bi-phasic allele- specific oligonucleotide hybridization technology. Briefly, the method is carried out as shown in Figure 1 for a haplotype consisting of two SNP loci.
  • a SNPl allele-specific oligonucleotide (ASO) is synthesized and attached to a surface.
  • a nucleic acid sample is then prepared using a method such as amplification of a genome to produce a nucleic acid sample containing the polymorphic locus.
  • the nucleic acid sample can be labeled.
  • the sample is then allowed to hybridize to the SNPl ASO coated on the surface to produce a SNPl /nucleic acid sample complex. Excess is removed.
  • a SNP2 ASO which is labeled is synthesized and allowed to hybridize to the SNPl ASO/nucleic acid sample complex.
  • the entire surface is then scanned and the haplotype can be scored.
  • the SNPl ASO is actually a set of ASO which includes two allele-specific oligonucleotides corresponding to an anti- sense version of each allele of two SNPs of a polymorphic locus.
  • the second set of ASOs corresponds to the second SNP (SNP2) of the polymorphic locus.
  • the nucleic acid sample will only hybridize to the ASO of the first set of ASOs, which is anti-sense to the allele of the first SNP in the genomic sample. Likewise, only the ASO of the second set of ASOs, which is anti-sense to the allele of the second SNP present in the nucleic acid sample, will hybridize.
  • haplotyping methods for identifying 2 SNPs generally involve the analysis of 4 wells. If a subject is homozygous, analysis of their DNA will result in a signal in one well. If a subject is heterozygous, analysis of their DNA will result in a signal in two wells.
  • the high throughput SNP haplotyping methods of the invention are useful in linkage disequilibrium studies for the analysis of complex traits to localized genes involved in diseases such as diabetes, multiple sclerosis, and asthma; diagnostic analysis to determine the presence or absence of a predisposing disease haplotype or other trait; pharmacogenomic analysis to identify haplotypes that correlate with either positive or negative responses to drugs and development; genome-wide scan studies for complex trait analysis using SNP haplotypes, instead of single SNPs, to increase the statistical power; etc.
  • Deletions, multiplications, or substitutions in genes can result in genetic disease. Most of these deletions, multiplications, or substitutions, causing multiple alleles, produce indistinguishable or distinguishable "normal" phenotypes. For instance, multiple alleles produce variable characteristics like eye color. Some genetic alterations, however, are associated with' clinical disease like sickle cell anemia.
  • the haplotyping methods of the invention are useful for identifying both normal phenotypes and disease phenotypes. Thus, the methods for the invention are useful for identifying traits such as eye color as well as for diagnostics to determine presence or absence of predisposing disease haplotype in a subject.
  • Some diseases which are known to have a genetic element include colon cancer, breast cancer, cystic fibrosis, neurofibromatosis type 2, LiFraumeni disease, VonHippel-Lindau disease, thalassemia, ornithine, transcarbamylase deficiency, hypoxanthine-guanine-phosphoribosyl-transferase deficiency, phenylketonuria, etc.
  • Another recently identified phenomenon is that the inheritance of varying haplotypes within the same gene can alter a disease phenotype altogether. This is exemplified by polymorphic mutations in the prion gene, PrP. (Goldfarb, L.G. and Petersen, R.B., Science, 258:806-808 (1992)). Individuals that inherit a SNP polymorphism at codon 178 of the PRP gene, will develop a Creutzfeldt- Jakob disease. If the individual also inherits a concomitant SNP polymorphism at codon 129 of the PRP gene, then that individual will develop a fatal familial insomnia instead.
  • haplotypes associated with phenotypic traits is useful for many purposes in addition to identifying predisposition to disease. For example, identification of a correlation between susceptibility to a particular drug or a therapeutic treatment and specific genetic alterations is particularly useful for tailoring therapeutic treatments to a specific individual. The methods are also useful in prenatal screening to identify whether a fetus is afflicted with or is predisposed to develop a serious disease. Additionally, this type of information is useful for screening animals or plants bred for the purposes of enhancing or exhibiting desired characteristics.
  • the invention is a method for haplotyping by analyzing a genotype of a first SNP of a polymorphic locus of a nucleic acid within a sample in solution by detecting the presence or absence of a first labeled probe which specifically identifies a first putative allele of the SNP and detecting the presence or absence of a second labeled probe which specifically identifies a second putative allele of the SNP, separating the nucleic acid sample based on the genotype of the first SNP, and analyzing a second SNP of the polymorphic locus of the separated nucleic acid samples to identify tlie haplotype of the nucleic acid.
  • the first and second allele of the first SNP of the polymorphic locus are detected in solution using labeled probes.
  • the labeled probes are any type of molecule which specifically binds to one allele of the SNP and not the other and which include a detectable label.
  • the molecule which specifically interacts with one of the two alleles can be any type of molecule, for instance, it may be a DNA-specific binding protein or an ASO complementary to the allele containing DNA.
  • a label may be a light-emissive label, radioactive label, etc. Light-emissive labels can be added to the molecule or may be naturally-occurring within the molecule.
  • some bases of a nucleotide are natui-ally-occurring light-emissive labels.
  • an extrinsic label does not need to be added to the molecule.
  • Light-emissive labels, which can be added to molecules include fluorophors and quenchers, light-scattering particles (such as gold particles which scatter light), etc.
  • Radioactive labels include, but are not limited to, 3 H, 32 P, and 35 S. The use of each of these types of labels is well-known to those of ordinary skill in the art.
  • the nucleic acid sample is separated such that the DNA molecules containing the first allele are in a separate container from the DNA samples containing the second allele.
  • One method for accomplishing this separation is through the use of flow cytometry e.g., using a fluorescence-activated cell sorter (FACS).
  • FACS fluorescence-activated cell sorter
  • Flow cytometry analysis involves the separation of single molecules based on the presence of a particular fluorescence marker.
  • a nucleic acid molecule which includes a labeled probe that emits in the red light wavelength will be separated from the nucleic acid molecules hybridized to a labeled probe which emits light in the green wavelength.
  • each can be separately analyzed to identify the presence or absence of an allele at the second SNP.
  • Other methods for separating the nucleic acid samples based on the allele present in the sample include but are not limited to (1) the use of an ASO attached to different size beads which can be separated by size, affinity, or weight, and (2) the use of tags such as binding partners which can be separated based on their specific binding interactions.
  • the invention involves solution phase analysis that utilizes four labeled probes, each specific for an allele of the two SNPS.
  • the labeled probes are allowed to interact with the nucleic acid sample to form complexes.
  • the labeled complexes are then separated such that each nucleic acid complex is separate from one another.
  • this analysis is based on single molecule detection strategies. Each individual nucleic acid is separated from other nucleic acid molecules. The separate nucleic acid molecules are then detected for the presence or absence of each of the four labeled probes.
  • each single nucleic acid sample which has been separated, includes two of the four labeled probes, one specific for a first allele of the first SNP and the other specific for an allele of the second SNP.
  • the first labeled probe includes a label which is stimulated in the red wavelength of light to produce a signal detected in the green wavelength.
  • the second labeled probe is capable of detecting light in the orange wavelength and emitting light in the yellow wavelength.
  • the single molecule when subjected to light within the red wavelength spectrum, will emit green light that can be detected.
  • the sample when exposed to light within the orange wavelength, will emit yellow light.
  • the sample when exposed to red and orange light, emits green and yellow, this is indicative that the first and third labeled probes, specifically identifying the first allele of the first SNP and the first allele of the second SNP are present.
  • this when light of red and orange wavelengths are used to stimulate the sample and blue and red light wavelengths are emitted, this is indicative that the second and fourth labeled probes have bound to the nucleic acid sample, thus identifying the presence of the second allele of the first SNP and the second allele of the second SNP.
  • Other combinations would be indicative of other haplotypes which are possible in this two SNP system.
  • Other combinations of labels can be used.
  • each of the 4 labeled probes can be labeled with a molecule that is stimulated in one wavelength of light, e.g., red, as long as each labeled probe emits in a different spectrum (or one may quench).
  • each of the 4 labeled probes can be labeled with a molecule that is stimulated by distinct wavelengths of light, but all can emit in the same or different spectrums.
  • fluorescence detection of single molecules is used to identify the components of the polymorphic locus.
  • a fluorescent label or fluorophore is a substance which is capable of exhibiting fluorescence within a detectable range.
  • Fluorophores include, but are not limited to, fluorescein, isothiocyanate, fluorescein amine, eosin, rhodamine, dansyl, umbelliferone, 5- l carboxyfluorescein (FAM), 2'7'-dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE), rhodamine, 6 carboxyrhodamine (R6G), N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 4-(4'-dimethylaminophenylazo) benzoic acid (DABCYL), 5-(2'-aminoethyl) aminonaphthalene-1-sulfonic acid (EDANS), 4- acetamido-4'-isothiocyanatostilbene-2, 2'disulfonic acid, acridine
  • RTM Brilliant Red 3B-A
  • lissamine rhodamine B sulfonyl chloride rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101, sulfonyl chloride derivative of sulforhodamine 101, (Texas Red), tetramethyl rhodamine, tetramethyl rhodamine isothiocyanate (TRITC), riboflavin, rosolic acid, and terbium chelate derivatives.
  • TRITC tetramethyl rhodamine isothiocyanate
  • Fluorescence is measured using a fluorometer.
  • the optical emission from the fluorescence molecule can be detected by the fluorometer and processed as a signal.
  • the surface can be moved using a multi-access translation stage in order to position the different areas of the surface, such that the signal can be collected.
  • Many types of flourometers have been developed. For instance, a new sensitive instrument for measuring FRET is described in U.S. Patent No. 5,911,952.
  • the invention is a method for haplotyping which is accomplished by performing four hybridization reactions on a nucleic acid sample, each of the four hybridization reactions involving one ASO specific for one allele of one of two SNPs, each of the ASOs labeled with a spectrally distinct label and wherein each label on the ASO specific for a first of the two SNPs is a spectral pair with the label on each ASO specific for the second of the two SNPs, bringing each of the labeled ASOs in each hybridization reaction within energy transfer distance from one another, exciting one of the labeled ASOs in each hybridization reaction, and detecting light released from the other labeled ASO as a signal, wherein the presence or absence of a signal for each hybridization reaction is an indicator of the haplotype of the nucleic acid sample.
  • a process referred to as a molecular beacon for nucleic acid detection has previously been described.
  • the method involves the use of a probe which is in the form of a stem loop structure, such that the 3' and 5' ends of the nucleic acid probe are adjacent one another in the stem section.
  • the 5' and 3' ends are labeled with a donor fluorophore and a quencher.
  • this probe encounters a complementary nucleic acid within the sample, the secondary structure stem loop is destabilized and the 5' and 3' ends are moved away from one another. This causes the fluorescent group to emit light which is no longer quenched and thus an increase in fluorescence emission occurs. (Discussed in U.S. Patent No. 5,989,823).
  • binding partners are two molecules which specifically interact with one another when brought into proximity with one another. Many types of binding partners are known in the art. Some well known examples of a binding partners are biotin and avidin or streptavidin, as well as antibody and antigen:' These binding partners are used to bring the regions of the nucleic acid housing the two SNPs within proximity of one another.
  • the first SNP may be labeled with an ASO which is conjugated to biotin.
  • the second SNP may be hybridized with an ASO which is conjugates to avidin.
  • Either the biotin or the avidin may contain fluorophores, which when brought within proximity of one another, will produce a signal or the ASO may contain the fluorophore label which would be brought in proximity with the other fluorophore label when the biotin and avidin interact.
  • Streptavidin and biotin labeled with various fluorophores are commercially available from several sources including Molecule Probes (Eugene, Oregon), Intergen (Purchase, NY) and NEN (Boston, MA).
  • Fluorescence resonance energy transfer is the transfer of electronic excitation energy by the Forster mechanism. FRET is useful for measuring the distance between a pair of fluorophores (donor and acceptor) which are in a range of 10-80 angstroms from one another. FRET has previously been used to study the hybridization of complementary oligodeoxynucleotides (Cardullo et al, PNAS, USA, 85:8790-8794 (1988)), and various other binding assays.
  • FRET arises from certain fluorophores which when excited by exposure to a particular wavelength of light will emit light at a different wavelength.
  • a donor fluorophore absorbs a photon of energy and transfers this energy non-radiatively to the acceptor fluorophore.
  • the excitation and emission spectra of two fluorophores which are brought within close proximity of one another overlap the excitation of one fluorophore will cause it to emit light at a wavelength that is absorbed and that can stimulate the second fluorophore causing it to fiuoresce.
  • the fluorescence of the donor molecule is quenched and fluorescence intensity of the acceptor molecule is enhanced.
  • the donor is in proximity with a fluorophore which is a non-acceptor (referred to as a quencher)
  • the fluorescence of the donor is still quenched but there is no subsequent emission of fluorescence by the second fluorophore, or quencher. Thus, there is no emission of light.
  • U.S. Patent No. 4,996,143 describes some of the parameters that should be considered when designing fluorescent probes, such as the spacing of the fluorescent moieties and the length of the portion of the molecule which connects the fluorescent moiety to the base unit of the' nucleic acid.
  • the donor and acceptor molecules should be within 100 angstroms of one another.
  • the donor and acceptor fluorophores are within 1 to 20 base pairs of one another for FRET analysis. Additionally, when performing FRET analysis flourophores which are spectral pairs should be used.
  • Two fluorophores are spectral pairs when one of the two fluorophores emits light at a wavelength which either causes the other fluorophore to emit light of a different wavelength or to quench the light emitted by the first fluorophore without producing additional light.
  • FAM is excited by light with a wave-length of approximately 488 nm and emits light with a spectrum of 500-650 nm.
  • FAM is a suitable donor fluorophore for use with JOE, TAMRA and ROX, all of which have an excitation maximum of 514 nm and a spectral pair is formed when FAM is matched with either JOE, TAMRA or ROX.
  • Appropriate spectral pairs among the known flourophores are well known to those of ordinary skill in the art.
  • Example 1 Haplotype analysis of multiple individuals using a double hybridization method.
  • SNPl is a T to G transversion at nucleotide 3208 and SNP2 is a C to T transition at nucleotide 3420 (Sarkar, G., et al, Genomics, 11:8-14 (1991)).
  • haplotypes at the D 2 receptor locus are determined for multiple individuals, using standard sequence analysis.
  • the haplotypes determined by sequence analysis are used for comparison to the haplotypes determined by the SNP-Haplotyping Method of the invention.
  • the sequencing step is performed as follows:
  • Primer 1 (Ml 3 (For) ⁇ CCTCAGTGACATCCTTGCCT) (SEQ ID NO: 1) and Primer 2 (M13 (pev) CATGCCCATTCTTCTCTGGT) (SEQ ID NO:2) flank the region containing SNP1/SNP2 of the D 2 receptor polymorphic locus.
  • Primer 1 contains an Ml 3 forward sequence at the 5' end and Primer 2 contains an Ml 3 reverse sequences at the 5' end to facilitate sequencing of the PCR products.
  • the expected size of tlie PCR product is 350 base pairs.
  • DNA from unrelated individuals is obtained from the National Human Genome Research Institute (NHGRI) which is a database containing a standardized collection of DNA from 450 unrelated individuals.
  • Primers 1 and 2 are used to PCR amplify the polymorphic locus from the D 2 receptor gene from all of the individuals using a proof-reading thermostable DNA polymerase such as Pfu polymerase, as previously described (Sarkar, G., et al, Genomics, 11:8-14, (1991)).
  • Each of the PCR reactions is separated by agarose gel electrophoresis and the PCR products cut from the gel, and purified. These purified PCR products represent the D 2 receptor polymorphic locus from the individuals.
  • genotype of the polymorphic locus for each individual is determined by sequencing an aliquot of each purified PCR product using dye-labeled Ml 3 forward and reverse primers.
  • the haplotype of the polymorphic locus for each individual is determined as follows: a) An aliquot of each purified PCR product is subcloned into a plasmid vector such as TA vector (Invitrogen), and transformed into the appropriate strain of E. coli. This results in multiple transformations, one for each individual. b) Six colonies are picked from each transformation and plasmid DNA is isolated from all colonies. Picking 6 colonies/transformation results in a >96% chance that the loci from both chromosomes (alleles) of each individual is represented and therefore analyzed. c) The plasmid inserts, representing the D 2 receptor polymorphic locus for each individual, are sequenced using vector-specific primers. The sequences are analyzed to determine the haplotype of the SNP1/SNP2 locus for each of the individuals.
  • Haplotype I Haplotype II
  • Haplotype III Haplotype III
  • Haplotype II G— T
  • Haplotype IN T— T
  • Each chromosome will have its own haplotype for the two SNP loci, therefore, each individual is expected to possess two haplotypes. Since the maternal and paternal chromosomes cannot be distinguished, ten possible haplotype combinations between the two chromosomes are possible and each individual is scored as possessing one of the ' ⁇ following haplotype combinations:
  • the SNP-Haplotyping Method of the invention depends, in some aspects, on the ability to discriminate between polymorphic loci using differential ASO hybridizations.
  • the technique of ASO hybridization has been established in the literature (Wang, D., et al, Science, 280:1077-1082 (1998); Guo, S, et al, Nucleic Acids Res., 22:5456-5465 (1994); Sapolsky, R., et al, Genet. Anal. Biomed, Engin. 14:187-192 (1999)).
  • Phase I of this method involves the accurate genotyping of multiple individuals, for the SNPl locus, using ASO hybridization techniques.
  • the following protocol is outlined in Figure 1, which outlines Phase I Hybridization Protocol and Expected Results.
  • Step 1 Synthesis of anti-sense SNPl allele-specific oligonucleotides
  • Step 2 Attachment of anti-sense SNPl allele-specific oligos to wells
  • Step 3 Amplification of the SNP1/SNP2 polymorphic Locus from individuals using a Cy3 -labeled PCR reaction
  • Step 4 Hybridization of Cy 3 -labeled PCR products from each individual to duplicate SNPl -(G) allele wells and duplicate SNPl-(T) allele wells
  • Step 1 involves Synthesis of Oligonucleotides Representing the Antisense Strand of the Two SNPl Alleles.
  • Two oligonucleotides are synthesized, each representing one allele of the SNPl (G/T) locus of the D 2 receptor.
  • the oligonucleotides represent the antisense (complementary) strand for each allele as follows: SNP1-(G detecting) oligo: NH 2 -(T) 15 AGTCTCCC(C)TTTCCCT (SEQ ID NO:3) SNP1-(T detecting) oligo: NH 2 -(T) 15 AGTCTCCC(A)CTTTCCCT (SEQ ID NO:4)
  • the amino group is added to facilitate binding to the surface of the wells.
  • the addition of 15 Ts on the 5' end of the oligonucleotide functions as a "spacer" sequence. Spacer sequences have been shown to greatly enhance the hybridization signal, presumably by lifting the hybridization sequence off the support surface thereby decreasing the steric interference produced by that surface (Guo, S., et al, Nucleic Acids Res., 22:5456-5465 (1994)) , but are not essential.
  • Step 2 involves Binding of Oligonucleotides to Solid Surface.
  • Each oligonucleotide is covalently attached to one 96-well Xenobind Black plate (Xenopore, Corp., Hawthorne, NJ) as follows: a) 200 pmol of each oligonucleotide is resuspended in 0.05 M phosphate buffer, pH 7.0 and placed into the wells of a Xenobind plate. One plate contains SNPl-(G-detecting) oligos and the second plate contains SNP1-(T detecting) oligos. b) Plates are incubated at 37° C for 2 hours.
  • Step 3 involves Amplification of the Polymorphic Locus from the Test Subjects.
  • the polymorphic locus (SNPl and SNP2) from the receptor gene is PCR-amplified from each of the individual test subjects.
  • the primers used are the primers outlined above (SEQ ID NO:l and 3), except that the M13 sequences are omitted.
  • the PCR is carried out in the presence of Cy3-dCTP, to fluorescently label the products, and the PCR products are purified using a PCR purification column system (QIAGEN).
  • Step 4 involves Hybridization of the Polymorphic Locus PCR Products from the
  • TMAC TMAC/0.6% SDS/10 mM sodium phosphate pH 6.5/5X Denhardt's solution/40 ug/ml yeast tRNA).
  • TMAC Sigma, Inc.
  • Hybridizations are incubated overnight at 52° C with gentle agitation.
  • Control wells are set up to monitor background produced by non-specific binding to unattached sites of the wells, insufficient blocking, random DNA/DNA interactions etc.
  • a random segment of human DNA is amplified from genomic DNA. This random segment is of equal length (350 base pairs) and of approximately equal G/C and A/T content to the locus specific PCR products from the test individuals. These control DNA segments are hybridized to wells bound with each of the SNPl allele-specific oligos as outlined above.
  • tlie Cy3 -labeled PCR product from an individual binds to the oligonucleotides attached to the wells, then a fluorescent signal is detected in that well. If the PCR product does not bind to the oligonucleotide attached to the well, then no fluorescent signal is detected.
  • genotypes are possible: a) G/T heterozygote b) G/G homozygote c) TT homozygote
  • the hybridization pattern for each genotype is describe herein as the possible hybridization patterns expected for the SNPl (G/T) locus of the D2 receptor gene. G/T heterozygote, G/G homozygote, T/T homozygote.
  • G/T Heterozygote If an individual is a G/T heterozygote then the hybridization of the Cy3 -labeled PCR product occurs in wells containing both the SNP-1(G detecting) oligo and the SNP1-(T detecting) oligo. As a result a fluorescent signal is detected for wells bound with oligonucleotides representing both SNPl alleles.
  • G/G Homozygote If an individual is a G/G homozygote then the hybridization of the Cy3 -labeled PCR product occurs only in the wells containing the SNP1-(G detecting) oligo. As a result, a fluorescent signals are detected only in wells bound with oligonucleotides representing the SNP1-G allele.
  • T/T Homozygote If an individual is a T/T homozygote then the hybridization of the Cy3-labeled PCR product occurs only to the wells containing the SNP1-(T detecting) oligo. As a result, a fluorescent signal is detected only in wells bound with oligonucleotides representing the SNP 1 -allele.
  • Control Wells Negligible fluorescent signals are obtained with wells hybridized with control PCR products. Any background signal is subtracted from the fluorescent signals obtained with the test wells and these values are used as the adjusted results.
  • Phase I of the Method of Haplotyping involves hybridizing CN3-labeled PCR products from the S ⁇ P1/S ⁇ P2 loci of each individual to SNPl allele- specific oligonucleotides.
  • Phase II involves an additional hybridization with SNP2 allele-specific oligonucleotides which simultaneously determines: 1) the genotype of the SNP2 locus for each individual and 2) the phase of the SNP2 genotype with the SNPl genotype, in other words, the haplotype.
  • SNPl Antisense Allele-specific Oligonucleotides are bound to the Wells of a
  • SNPl-(G)-detecting and SNPl-(T)-detecting antisense allele-specific oligonucleotides are synthesized. Each SNPl oligo is bound to two 96 well Xenobind Black plates (4 plates total) as outlined above.
  • the SNP1/SNP2 locus is PCR amplified from the test subjects in the presence of Cy3-dCTP and hybridized to two wells each of the 4 plates containing immobilized SNPl (G) or (T) allele-specific oligos. However, after the last wash at 54° C, the plates are not read on a fluorometer. They are, instead, subjected to the next Step in the SNP-Haplotyping Protocol.
  • Oligonucleotides are synthesized, each representing one allele of the SNP2 (C/T) locus in the presence of Cy5-dCTP.
  • the oligonucleotides represent the antisense sequence for each SNP2 allele as follows:
  • SNP2-(C detecting) oligo AGGGTGGT(G)CCAGAGGT (SEQ ID NO:5)
  • SNP2-(T-detecting) oligo AGGGTGGT(A)CCAGAGGT (SEQ ID NO:6)
  • the SNP2-(C)-oligo and SNP2-(T)-oligo are each hybridized to one Xenobind plate bound with the SNPl (G) oligo individual PCR products complex (Fig. 2, plates 2 & 4).
  • Each SNP2 allele-specific oligonucleotide is diluted to 0.5 pmol/ml in TMAC hybridization solution + 50 X cold competitor.
  • the hybridization protocol is identical to the protocol described in above (Step 4). Plates are read on a fluorescent microplate reader which can differentiate Cy3 and Cy5 signals. Cy5 signals are read to determine haplotype.
  • Phase II Hybridization Setup is shown in Figure 2.
  • Phase II hybridization setup is represented in Plates A-D.
  • Plate A SNPl (G) allele-specific oligo is bound to the plate and Phase I-hybridized with 48 test genomes, each in duplicate wells.
  • Plate A is then Phase Il-hybridized with SNP2 (C) allele-specific oligo.
  • Plate B SNPl (T) allele- specific oligo is bound to the plate and Phase I-hybridized with 48 test genomes, each in duplicate wells.
  • Plate B is then Phase Il-hybridized with SNP2 (C) allele-specific oligo.
  • SNPl (G) allele-specific oligo is bound to the plate and Phase I-hybridized with 48 test genomes, each in duplicate wells. Plate C is then Phase II;-hybridized with SNP2 (T) allele-specific oligo.
  • Plate D) SNPl (T) allele-specific oligo is bound to the plate and Phase I-hybridized with 48 test genomes, each in duplicate wells. Plate D is then Phase Il-hybridized with SNP2 (T) allele-specific oligo.
  • Haplotype II Haplotype II
  • T— C Haplotype III
  • T— T Haplotype IN
  • FIG. 3 the expected Phase II hybridization patterns are shown for the four possible haplotypes (rows 1-4) of the S ⁇ P1 (G/T) locus and the S ⁇ P2 (C/T) locus.
  • Columns A-D refer to Plates A-D as outlined in Figure 2.
  • the (G-C) haplotype gives a positive signal on Plate A (well 1A).
  • the (G-T) haplotype gives a positive signal on Plate B (well 2B).
  • the (T-C> haplotype gives a signal on Plate C (well 3 C).
  • the (T/T) haplotype gives a signal on Plate D (well 4D).
  • SNPl Genotype If an individual possesses a G allele at the SNPl locus, then that individual's PCR product will hybridize only to those wells containing the SNP1- (G)-detecting-oligo ( Figure 3, wells 1A, IB, 2 A and 2B). If this individual however, possesses a T allele at the SNPl locus then hybridization will occur to those wells containing the SNPl-(T)-detecting-oligo ( Figure 3, wells 3C, 3D, 4C and 4D). Since the PCR products are Cy3 labeled, the genotype at SNPl can be determined by detecting which wells have a Cy3 signal.
  • Haplotyping for One Chromosome The haplotype for a particular chromosome is determined by hybridizing with either the SNP2-(C) or the SNP2-(T) allele-specific oligo. If an individual has a SNP1-SNP2 haplotype of G-C on one chromosome, then a Cy5 signal results when the SNP2 (C) specific oligo binds to a (G-C) PCR product/SNPl (G) specific oligo complex bound to a well ( Figure 3, well 1A).
  • Haplotype for Both Chromosomes By examining the hybridization patterns, (i.e. which plates have wells with a Cy5 signal), the haplotype can be determined for both chromosomes. As outlined in Figure 2: Plate A will detect SNPl (G)/SNP2 (C); Plate B will detect SNPl (G)/SNP2 (T); Plate C will detect SNPl (T)/SNP2 (C) and Plate D will detect SNPl (T)/SNP2 (T). Therefore, haplotypes can be scored for hybridization signals seen on each plate. They are as follows:
  • the ten possible haplotype combinations for both chromosomes are indicated in the left column of the chart.
  • the plate (A-D) where the signal is expected to be detected for each haplotype combination, is indicated in the right column of the chart. It is expected that the haplotypes generated for the shuffled test samples will match the known haplotypes generated by sequencing.
  • the protocol used to detect genetic haplotypes consisting of two Single Nucleotide Polymorphisms (SNPs) in the human Beta-Adrenergic Receptor (BAR) gene.
  • SNPs Single Nucleotide Polymorphisms
  • BAR Beta-Adrenergic Receptor
  • the assay was conducted in 96 well plate format, in which a set of four wells was used to detect each sample's haplotype.
  • an amine labeled oligo was bound to the surface of the wells.
  • One pair of wells contain an oligo, BAR-G, complimentary to a 17 base pair region including one allele of the SNP, while the remaining two wells contained an oligo, BAR- A, complimentary to a 17 base pair region including the other allele of the first SNP.
  • Beta-Adrenergic Receptor gene probe binds preferentially to one set of wells over the other if only one allele of that SNP is present. If both alleles are present in the samples genome, the probe, produced using the Polymerase Chain Reaction (PCR), will bind to both sets of wells with proportionately equal success.
  • PCR Polymerase Chain Reaction
  • the wells of the assay plate are washed to remove unbound oligo.
  • the plate is then treated with blocking agents to prevent nonspecific binding of the subsequent hybridization and detection components to the wells. Further washing removes the blocking agent and prepares the assay plate for hybridization.
  • the sample of interest's BAR PCR product probe is introduced into each of the four wells used in the haplotype detection.
  • a pair of biotin-labeled oligos, BAR-PUG and BAR-PIIA complimentary to the 17 base pair region including the two SNP alleles of the second SNP, are added as follows:
  • the cold competitor oligo DNA sequence is identical to the biotin- labeled oligo except does not contain a biotin label.
  • the cold competitor oligo is added to the opposite wells as above and in some cases helps to enhance SNP discrimination. The addition of the cold competitor oligos is shown below.
  • Hybridization occurs by incubating the components together in the assay plate wells overnight. Probe that is non-complimentary to the amine oligo is washed from the wells, consequently removing any biotin oligo from the wells as well. Biotin oligo is also removed from wells in which the probe binds the amine oligo at the first SNP location but does not contain the allele of the second SNP that is complimentary to the SNP present in the biotin oligo sequence. Thus, biotin-labeled oligo remains after post- hybridization washing only in wells in which the probe is complimentary to the SNPs contained in the amine-labeled oligo and the biotin labeled oligo added to that well. This well will produce a positive signal for the haplotype it detects. Wells that do not meet this criterion will produce no signal, a "negative" signal.
  • haplotypes present are detected by addition of a streptavidin-horseradish peroxidase conjugate to the assay plate. Biotin- streptavidin binding ensures that the peroxidase remains in the wells containing the positive haplotypes. Detection takes advantage of this with the addition of peroxidase substrates that form a chemiluminescent product in the positive wells and relatively none in the negative wells.
  • the PCR reactions were prepared as follows:
  • PCR reaction was conducted in PTC-225 DNA Engine Tetrad MJ Research (Waltharn, MA.)using the following PCR profile:
  • the final product of this PCR reaction was an 1140 base pair fragment of the
  • Beta-Adrenergic Receptor (BAR) gene sequence is a gene sequence.
  • Lambda Exonuclease Digestion was preformed to produce single-stranded DNA.
  • Gibco Lambda exonuclease, 6U/ul, (Life Technologies, Rockville, MD, cat. #28023-018) was added to 2X Lambda exonuclease buffer (lOmg/ml Glycine, 5mM MgCl 2 pH 9.4) at a rate of 1 :50.
  • 50 ⁇ l of the enzyme/buffer mix per well was dispensed from above to a Skirted Thermo-Fast 96 96 well PCR plate (Marsh cat. # AB-0800).
  • the Millipore Multiscreen-PCR Plate purified PCR products were eluted and transferred to the PCR plate containing the 2X lambda exonuclease enzyme/buffer mixture.
  • the PCR products were then digested for thirty minutes at 37°C in PTC-225 DNA Engine Tetrad (MJ Research) and the reaction was heated 10 min. at 75°C to stop the reaction.
  • BIND plate (Corning, Inc. cat. #2498) in oligo binding buffer (lOO ⁇ l of Disodium phosphate, 50 mM, and EDTA, 1 mM, pH 8.5).
  • Oligo binding buffer was removed by inverting the assay plate and dumping the contents of the wells into the sink. The plate was then gently shaken to remove any residual droplets of binding buffer. Any amine oligo was removed by washing the wells of the assay plate three times with 200 ⁇ l of IX PBS wash buffer. Washes were added via a 12-channel pipettor and removed by the technique described above. One wash consisted of addition of the 200 ⁇ l wash buffer to the dry assay plate and its removal. All subsequent washes were carried out in an identical manner.
  • the wells of the assay plate were blocked with 200 ⁇ l blocking buffer (Disodium phosphate, 50 mM, and EDTA, 1 mM, pH 8.5, 3% Bovine Serum Albumin, 0.05% Tween 20). The plate was allowed to block by incubation for 1 hour at 37°C while shaking at 98 rpm.
  • blocking buffer Disodium phosphate, 50 mM, and EDTA, 1 mM, pH 8.5, 3% Bovine Serum Albumin, 0.05% Tween 20.
  • the plate was washed three times with IX PBS, 200ul per wash, as described above. Then the plate was washed once with 200 ⁇ l of TMAC-B solution (3M Tetramethyl-ammonium Chloride (Sigma-Aldrich Inc. St. Louis, MO, product # T 3411), 50mM Tris pH 8.0, 0.1 % SDS, ImM EDTA) and the wash was allowed to incubate for 7 minutes at room temperature. '
  • Hybridization solution was prepared in 96 well PCR plate using the following procedure.
  • the final volume was brought up to lOO ⁇ l such that hybridization occurs in TMAC- B solution as described above.
  • the Hybridization Solution was heated for 7 minutes at 95°C in a PTC- 100
  • the plate was washed three times with TMAC-B solution at room temperature with incubation in the third wash for 5 minutes at room temperature with shaking at 98 rpm. The plate was then washed once with TMAC-B solution at 52°C, with the wash incubated for five minutes at 52°C, with shaking at 98 rpm. The plate was then washed twice with 2X SSC followed by one wash with oligo binding buffer.
  • the assay plate was washed three times with IX PBS + 0.05% Tween 20 wash buffer followed by washing twice with IX PBS wash buffer.
  • the graph in Figure 5 represents data generated from the haplotyping of 4 individuals.
  • the signal generated from a negative control well (no PCR product added) was subtracted from the signal generated for each of the four wells analyzed for each individual.
  • the background-subtracted signal was plotted for each well. From this analysis, the determined haplotypes for each individual are as follows: #1 -homozygote A-G, #2-homozygote A-G, #3- heterozygote G-G, A-G, #4-homozygote A-A. Sequence analysis of several subcloned BAR products for each individual have confirmed these haplotypes.
  • the hybridization described in Example 2 can also be performed in two steps.
  • the PCR product and an appropriate cold competitor are added to wells containing bound amine- labeled oligo. These components are allowed to hybridize, then washed thoroughly to remove nonspecific binding.
  • the second set of hybridization components are then added to the wells and allowed to hybridize.
  • detection was carried out using a Streptavidi -alkaline phosphatase conjugate. Fluorescent products were then formed upon the addition of alkaline phosphatase substrates.
  • An alternate method of preparing the PCR product probe utilizes a method known as asymmetric PCR.
  • the strand of interest is produced at a much higher frequency than its compliment during the PCR reaction. This is accomplished by increasing the concentration of the primer that initiates replication of the desired strand relative to the concentration of the primer producing the strand's compliment. This results in a large number of copies of the strand of interest being produced that have no compliment with which to bind.
  • These single-stranded DNA fragments are readily available to take place in the hybridization that follows. Therefore, digestion of the opposite strand via exonuclease is not necessary when the PCR product is produced with asymmetric primer concentrations.
  • the locus of interest in this procedure can be found using accession # G54849 to search the Website of the National Center for Biotechnology Information's (NCBI) Genbank Database.
  • Phase I Components (An equal amount of an asymmetric PC each well in this hybridization)
  • PCR reaction was conducted in PTC-225 DNA Engine Tetrad (M J Research) using the following PCR profile:
  • the final product of this PCR reaction was a 289 base pair fragment of the human genome described above. This fragment contains SNPS at base pairs 35 (G/C) and 234
  • BLND assay plate (Corning, Inc. cat. #2498) in oligo binding buffer (lOO ⁇ l of Disodium phosphate, 50 mM, and EDTA, 1 mM, pH 8.5).
  • Wells of the assay plate used for negative "no oligo" controls receive lOO ⁇ l binding buffer without amine-labeled oligo added. The oligo was allowed to bind by incubating overnight at 4°C.
  • Oligo binding buffer was removed with a 12 channel vacuum apparatus. The remaining amine oligo was removed by washing the wells of the assay plate three times with 200 ⁇ l of IX PBS wash buffer. Washes were added via a 12-channel pipettor and removed by the technique described above. One wash consists of addition of the 200 ⁇ l wash buffer to the dry assay plate and its removal. All subsequent washes are carried out in an identical manner.
  • TMAC-B solution M Tetramethyl- ammonium Chloride (Sigma-Aldrich Inc. product # T 3411), 50mM Tris pH 8.0, 0.1% SDS, ImM EDTA). The final wash was allowed to incubate for 7 minutes at room temperature while treating the hybridization solution.
  • Hybridization solution was prepared in 96 well PCR plate using the following procedure:
  • Hybridization Solution was heated for 7 minutes at 95°C. Then lOO ⁇ l of hybridization solution was transferred to COSTAR DNA-BIND plate and allowed to hybridize overnight at 52°C with shaking at 98 rpm.
  • the final volume is then brought up to 100 ⁇ l such that hybridization occurs in TMAC-B solution as described above.
  • the plate was washed three times with TMAC-B solution at room temperature and then incubated 5 minutes at room temperature with shaking at 98 rpm. The plate was then washed once with TMAC-B solution at 52C and incubate five minutes at 52°C with shaking at 98rpm. Then the plate was wash twice with 2X SSC, with the washes carried out as described above. Then the plaste was washed once with oligo binding buffer.
  • ELF 97 phosphatase substrate working solution ELF 97 mRNA In Situ Hybridization Kit, Component D 1:10, Component E 1:500, Component F 1 : 500, in Component C
  • ELF 97 mRNA In Situ Hybridization Kit Component D 1:10, Component E 1:500, Component F 1 : 500, in Component C
  • the assay plate was washed once with 4C IX Elf Wash, and the wash was left in the plate. Then the assay plate fluorescence was read again as above.
  • the four graphs in Figure 6 represent data generated from the haplotyping of 4 individuals.
  • the signal generated from a negative control well (no PCR product added) was subtracted from the signal generated for each of the four wells analyzed for each individual.
  • the background-subtracted signal was plotted for each well. From this analysis, the determined haplotypes for each individual are as follows: #1 -homozygote G-C, #2- heterozygote G-T, G-C, #3- heterozygote G-C, C-C, #4- heterozygote G-T, C-C. Sequence analysis of several subcloned products for each individual have confirmed these haplotypes. :

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
EP01922863A 2000-04-04 2001-03-30 Hoch-durchsatz-screening verfahren zur haplotypisierung Withdrawn EP1294936A2 (de)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US19442500P 2000-04-04 2000-04-04
US194425P 2000-04-04
PCT/US2001/010173 WO2001075163A2 (en) 2000-04-04 2001-03-30 High throughput methods for haplotyping

Publications (1)

Publication Number Publication Date
EP1294936A2 true EP1294936A2 (de) 2003-03-26

Family

ID=22717553

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01922863A Withdrawn EP1294936A2 (de) 2000-04-04 2001-03-30 Hoch-durchsatz-screening verfahren zur haplotypisierung

Country Status (3)

Country Link
EP (1) EP1294936A2 (de)
AU (1) AU2001249617A1 (de)
WO (1) WO2001075163A2 (de)

Families Citing this family (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6958225B2 (en) 1999-10-27 2005-10-25 Affymetrix, Inc. Complexity management of genomic DNA
US6632611B2 (en) 2001-07-20 2003-10-14 Affymetrix, Inc. Method of target enrichment and amplification
US7297778B2 (en) 2001-07-25 2007-11-20 Affymetrix, Inc. Complexity management of genomic DNA
US6872529B2 (en) 2001-07-25 2005-03-29 Affymetrix, Inc. Complexity management of genomic DNA
US20030124539A1 (en) * 2001-12-21 2003-07-03 Affymetrix, Inc. A Corporation Organized Under The Laws Of The State Of Delaware High throughput resequencing and variation detection using high density microarrays
US20040224331A1 (en) 2003-01-17 2004-11-11 The Trustees Of Boston University Haplotype analysis
WO2005023091A2 (en) * 2003-09-05 2005-03-17 The Trustees Of Boston University Method for non-invasive prenatal diagnosis
US20050142585A1 (en) * 2003-10-02 2005-06-30 University Of South Florida Determination of phenotype of cancer and of precancerous tissue
US9388457B2 (en) 2007-09-14 2016-07-12 Affymetrix, Inc. Locus specific amplification using array probes
US9074244B2 (en) 2008-03-11 2015-07-07 Affymetrix, Inc. Array-based translocation and rearrangement assays

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU8776898A (en) * 1997-08-04 1999-02-22 Oncormed, Inc. Determining common functional alleles in a population and uses therefor
JP2002517242A (ja) * 1998-06-05 2002-06-18 ジェンセット 前立腺癌腫瘍抗原−1(pcta−1)の多型マーカー
US6306643B1 (en) * 1998-08-24 2001-10-23 Affymetrix, Inc. Methods of using an array of pooled probes in genetic analysis

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0175163A2 *

Also Published As

Publication number Publication date
AU2001249617A1 (en) 2001-10-15
WO2001075163A3 (en) 2003-01-09
WO2001075163A2 (en) 2001-10-11

Similar Documents

Publication Publication Date Title
US6844154B2 (en) High throughput methods for haplotyping
Jehan et al. Single nucleotide polymorphism (SNP)–methods and applications in plant genetics: a review
Cai et al. Flow cytometry-based minisequencing: a new platform for high-throughput single-nucleotide polymorphism scoring
US7348141B2 (en) Hybridization beacon and method of rapid sequence detection and discrimination
US8809238B2 (en) Probe based nucleic acid detection
US5800994A (en) Hybridization-ligation assays for the detection of specific nucleic acid sequences
US7998673B2 (en) Hybridisation beacon and method of rapid sequence detection and discrimination
JP4938824B2 (ja) イネの品種鑑別法
US20070065816A1 (en) Methods for genotyping
US20030207306A1 (en) Detectably and removably tagged nucleic acids
JP2011239790A (ja) 全ゲノム増幅および遺伝型決定のための方法および組成物
JP2007525963A (ja) 全ゲノム増幅および遺伝型決定のための方法および組成物
KR20150028063A (ko) 리포터 및 소광자가 결합된 프로브를 이용한 액상형 어레이 및 이를 이용한 표적핵산 또는 돌연변이 검출방법
Chagné et al. Single nucleotide polymorphism genotyping in plants
JP2004521634A (ja) MutSおよびRecAを使用する変異検出
US20030124544A1 (en) Method for testing nucleic acid sequence
US9587278B2 (en) Combined CGH and allele specific hybridisation method
US20040019005A1 (en) Methods for parallel measurement of genetic variations
EP1294936A2 (de) Hoch-durchsatz-screening verfahren zur haplotypisierung
JP4228041B2 (ja) 塩基多型の検出方法
US6083701A (en) Method for determining tandem repeat sequence length
WO2002020844A1 (en) Methods and products related to high throughput genotype analysis
JP2005518819A (ja) 酵素的連結に基づく核酸配列の同定
Peter Single-nucleotide polymorphism genotyping for disease association studies
WO2018166463A1 (en) Methods for haplotype and diplotype determination

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20021101

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20051001