EP1263934A1 - Genie genetique de la tolerance a la secheresse au moyen d'un genome de plaste - Google Patents

Genie genetique de la tolerance a la secheresse au moyen d'un genome de plaste

Info

Publication number
EP1263934A1
EP1263934A1 EP01913108A EP01913108A EP1263934A1 EP 1263934 A1 EP1263934 A1 EP 1263934A1 EP 01913108 A EP01913108 A EP 01913108A EP 01913108 A EP01913108 A EP 01913108A EP 1263934 A1 EP1263934 A1 EP 1263934A1
Authority
EP
European Patent Office
Prior art keywords
plant
vector
plastid
dna sequence
chloroplast
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01913108A
Other languages
German (de)
English (en)
Other versions
EP1263934A4 (fr
Inventor
Henry Daniell
Seung-Bum Lee
Myung Ok Byun
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Auburn University
University of Central Florida
Original Assignee
Auburn University
University of Central Florida
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Auburn University, University of Central Florida filed Critical Auburn University
Publication of EP1263934A1 publication Critical patent/EP1263934A1/fr
Publication of EP1263934A4 publication Critical patent/EP1263934A4/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8214—Plastid transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis

Definitions

  • FIELD OF INVENTION This application pertains to the field of genetic engineering of plant plastid genomes, particularly chloroplasts and to methods of transforming plants to confer or increase drought tolerance and engineered plants which are drought tolerant.
  • Trehalose is a non-reducing disaccharide of glucose and its synthesis is mediated by the trehalose-6-phosphate (T6P) synthase and trehalose-6-phosphate phosphatase complex in Saccharomyces cerevisiae.
  • T6P trehalose-6-phosphate
  • T6P phosphatase complex in Saccharomyces cerevisiae.
  • this complex consists of at least three subunits performing either T6P synthase (TPSl), T6P phosphatase (TPS2) or regulatory activities (TPS3 or TSLI).
  • T6P trehalose-6-phosphate
  • T6P phosphatase complex in Saccharomyces cerevisiae.
  • T6P T6P synthase
  • TPS3 or TSLI regulatory activities
  • Trehalose Because of its accumulation under various stress conditions such as freezing, heat, salt or drought, there is general consensus that trehalose protects against damages imposed by these stresses. Trehalose is also known to accumulate in anhydrobiotic organisms that survive complete dehydration , the resurrection plant and some desiccation tolerant angiosperms. Trehalose, even when present in low concentrations, stabilizes proteins and membrane structures under stress because ofthe glass transition temperature, greater flexibility and chemical stability / inertness. Prior efforts to engineer plants for trehalose production
  • this invention compartmentalizes trehalose accumulation within chloroplasts .
  • S everal toxic compounds expressed in transgenic plants have been compartmentalized in chloroplasts, even through no targeting sequence was provided indicating that this organelle could be used as a repository like the vacuole.
  • osmoprotectants are known to accumulate inside chloroplasts under stress conditions. Inhibition of trehalase activity is known to enhance trehalose accumulation in plants. Therefore, trehalose accumulation in chloroplast may be protected from trehalase activity in the cytosol, if trehalase was absent in the chloroplast.
  • chloroplast transformation has several other advantages over nuclear transformation.
  • Chloroplast transformation should also overcome some ofthe disadvantages of nuclear transformation that result in lower levels of foreign gene expression, such as gene suppression by positional effect or gene silencing. Chloroplast genetic engineering has been successfully employed to address aforementioned concerns.
  • chloroplast transgenic plants expressed very high level of insect resistance, due to expression of 10,000 copies of foreign genes per cell, thereby overcoming the problem of insect resistance observed in nuclear transgenic plants.
  • chloroplast derived herbicide resistance overcomes out-cross problems of nuclear transgenic plants because of maternal inheritance of plastid genomes. This invention thus presents a solution to the pitfalls of nuclear expression of TPSl in transgenic plants. Non-obvious nature of the invention.
  • Trehalose is a non-reducing disaccharide of glucose and is found in diverse organisms including algae, bacteria, insects, yeast, fungi, animal and plants. Because of its accumulation under various stress conditions such as freezing, heat, salt or drought, there is general consensus that trehalose protects against damages imposed by these stresses. Trehalose is also known to accumulate in anhydrobiotic organisms that survive complete dehydration, the resurrection plant and some desiccation tolerant angiosperms.
  • Osmoprotectants are known to accumulate inside chloroplasts under stress conditions but their mode of action is to provide osmotic protection by accumulation of such compounds (as sugars or amino acids) in large quantities .
  • This invention demonstrates that the protection is offered by accumulation of small quantities of trehalose which was not adequate to provide protection from dehydration but rather stability of biological membranes.
  • Inhibition of trehalase activity is known to enhance trehalose accumulation in the cytosol but there are no reports ofthe presence or absence of trehalase within plastids. Therefore, it was unanticipated that trehalose accumulation within plastids would be protected from trehalase activity.
  • Prior to this invention there were no reports of using plastid transformation as a strategy to confer drought tolerance to transgenic plants.
  • This invention provides a method to transform plants through the plastids, particularly chloroplasts, to confer drought tolerance to plants.
  • the vectors with which to accomplish the chloroplast transformation is provided.
  • the transformed plants and their progeny are provided.
  • the transformed plants and their progeny display drought resistance. More importantly, they display no negative pleiotropic effects such as sterility or stunted growth.
  • the present invention is applicable to all plastids of plants. These include chromoplasts which are present in the fruits, vegetables and flowers; amyloplasts which are present in tubers like the potato; proplastids in roots; leucoplasts and etioplasts, both of which are present in non-green parts of plants.
  • the present invention provides a method to increase water stress tolerance in dicotyledonous or a monocotyledonous plant, comprising introducing an expression cassette into the cells of a plant to yield transformed plant cells .
  • Plant cells include cells of monocotyledenous plants such as cereals, including corn (Zea mays), wheat, oats, rice, barley, millet and cells of dicotyledenous plant such as soybeans and vegetables like peas.
  • the expression cassette comprises a preselected DNA sequence encoding an enzyme which catalyzes the synthesis of an osmoprotectant, operably linked to a promoter functional in the chloroplast plant cell.
  • the enzyme encoded by the DNA sequence is expressed in the transformed plant cells to increase the level of osmoprotection so as to render the transformed cells substantially tolerant or resistant to a reduction in water availability that inhibits the growth of untransformed cells ofthe plant.
  • an "osmoprotectant” is an osmotically active molecule which, when that molecule is present in an effective amount in a cell or plant, confers water stress tolerance or resistance, or salt stress tolerance or resistance, to the cell or plant; when present in lower amounts in a cell or plant, an “osmoprotectant” confers membrane stability.
  • Osmoprotectants include sugars such as monosaccharides, disaccharides, oligosaccharides, polysaccharides, sugar alcohols, and sugar derivatives, as well as proline and glycine-betaine.
  • a preferred embodiment ofthe invention is an osmoprotectant that is a sugar.
  • Useful osmoprotectants include fructose, erythritol, sorbitol, dulcitol, glucoglycerol, sucrose, stachyose, raffmose, ononitol, mannitol, inositol, methyl-inositol, galactol, hepitol, ribitol, xylitol, arabitol, trehalose, and pinitol.
  • Genes which encode an enzyme that catalyzes the synthesis of an osmoprotectant include genes encoding mannitol dehydrogenase (Lee and Saier, J. BacterioL, 153 (1982)) and trehalose-6- phosphate synthase (Kaasen et al., J. BacterioL, 174, 889 (1992)).
  • mannitol dehydrogenase Lee and Saier, J. BacterioL, 153 (1982)
  • trehalose-6- phosphate synthase Kaasen et al., J. BacterioL, 174, 889 (1992)
  • an isolated transformed plant cell and an isolated transformed plant comprising said transformed cells, which cell and plant are substantially tolerant of or resistant to a reduction in water availability.
  • the cells of the transformed monocot plant comprise a recombinant DNA sequence comprising a preselected DNA sequence encoding an enzyme which catalyzes the synthesis of an osmoprotectant.
  • the preselected DNA sequence is present in the cells ofthe transformed plant and the enzyme encoded by the preselected DNA sequence is expressed in those cells to yield an amount of osmoprotectant effective to confer tolerance or resistance to those cells to a reduction in water availability that inhibits the growth ofthe corresponding untransformed plant cells.
  • a preferred embodiment of the invention includes a transformed plant that has an improved osmotic potential when the total water potential ofthe transformed plant approaches zero relative to the osmotic potential of a corresponding untransformed plant.
  • a "preselected" DNA sequence is an exogenous or recombinant DNA sequence that encodes an enzyme which catalyzes the synthesis of an osmoprotectant, such as sugar.
  • the enzyme preferably utilizes a substrate that is abundant in the plant cell.
  • the preselected DNA sequence encode an enzyme that is active without a co-factor, or with a readily available co-factor.
  • the mild gene of E. Coli encodes a mannitol- 1 -phosphate dehydrogenase (Ml PD).
  • Ml PD mannitol- 1 -phosphate dehydrogenase
  • the only co-factor necessary for the enzymatic activity of M 1 PD in plants is NADH and the substrate for M 1 PD in plants is fructose-6-phosphate.
  • substantially increased or “elevated” levels of an osmoprotectant in a transformed plant cell, plant tissue, plant part, or plant are greater than the levels in an untransformed plant cell, plant part, plant tissue, or plant, i.e., one where the chloroplast genome has not been altered by the presence of a preselected DNA sequence.
  • substantially increased or “elevated” levels of an osmoprotectant in a water-stressed transformed plant cell, plant tissue, plant part, or plant are levels that are at least about 1.1 to 50 times, preferably at least about 2 to 30 times, and more preferably about 5-20 times, greater than the levels in a non- water-stressed transformed plant cell, plant tissue, plant part of plant.
  • a plant cell, plant part, plant tissue or plant that is "substantially resistant or tolerant" to a reduction in water availability is a plant cell, plant part, plant tissue, or plant that grows under water-stress conditions, e.g., high salt, low temperatures, or decreased water availability, that normally inhibit the growth of the untransformed plant cell, plant tissue, plant part, or plant, as determined by methodologies known to the art.
  • Methodologies to determine plant growth or response to stress include, but are not limited to, height measurements, weight measurements, leaf area, plant water relations, ability to flower, ability to generate progeny, and yield.
  • a stably transformed plant of the invention has a superior osmotic potential during a water deficit relative to the corresponding.
  • an "exogenous" gene or “recombinant” DNA is a DNA sequence that has been isolated from a cell, purified, and amplified.
  • isolated means either physically isolated from the cell or synthesized in vitro in the basis ofthe sequence of an isolated DNA segment.
  • a “native” gene means a DNA sequence or segment that has not been manipulated in vitro, i.e., has not been isolated, purified, and amplified.
  • the invention also provides, preferably, a plastid vector that is capable of stably transforming and conferring drought resistance to tolerance to different plant species.
  • the invention provides a plastid vector comprising of a DNA construct.
  • the DNA construct includes a 5' part of the plastid DNA sequence inclusive of a spacer sequence; a promoter that is operative in the plastid; heterologous DNA sequences comprising at least one gene of interest encoding a molecule; a gene that confers resistance to a selectable marker; a transcription termination region functional in the target plant cells; and a 3' part ofthe plastid DNA sequence inclusive of a spacer sequence.
  • the molecule can be a peptide of interest.
  • the vector includes a ribosome binding site (rbs) and a 5' untranslated region (5'UTR). A promoter functional in green or non-green plastids is used in conjunction with the 5'UTR.
  • the invention provides a heterologous DNA sequence, which codes for an osmoprotectant, such as the Yeast T6P synthase gene (TSP1 gene), the E. coli otsA gene.
  • TSP1 gene Yeast T6P synthase gene
  • the invention also provides the psbA 3' region, which enhances the translation of foreign genes.
  • the invention provides a promoter is one that is operative in green and non-green plastids such as the 16SrRNA promoter, the psbA promoter, and the accD promoter.
  • the invention provides a gene that confers resistance, such as antibiotic resistance like the aadA gene or an antibiotic-free selectable marker such as BADH or the chlB gene, as a selectable marker. All known methods of transformation can be used to introduce the vectors of this invention into target plant plastids including bombardment, PEG Treatment, Agrobacterium, microinjection, etc.
  • the invention provides transformed crops, like solanaceous plants that are either monocotyledonous or dicotyledonous.
  • the plants are those having economic value which are edible for mammals, including humans.
  • Any plant can be transformed to an osmprotectant-expressing plant in accordance of the inyention which can carry a helogerous DNA sequence which encodes a desired trait.
  • the transformed osmoprotectant-expressing plant need not comprise such a trait other than the DNA sequence which encodes the osmoprotentant.
  • the invention provides plants that have been transformed via the chloroplast which accumulate trehalose at an amount at least 17-fold higher than non-transformed plants which are drought resistant.
  • the invention provides plants that have been transformed via the chloroplast which has at least a seven-fold increase in TPSl activity.
  • the invention provides plants that have been transformed via the chloroplast which, in the T 0 generation, display otherwise normal phenotype other than decreased growth and delayed flowing.
  • the invention further provides that the T,/T 2 generations of the transformed plants display no pleiotropic effects.
  • the invention provides the transformed chloroplasts ofthe target plants which contain high levels of trehalose.
  • the invention provides for chloroplast transformant seedlings which are drought resistant which are resistant to medium containing 3% to 6% PEG.
  • the invention provides a method to confer drought resistance to plants via chloroplast transformation with a universal chloroplast vector which contains a drought-resistant or osmoprotectant gene and the accumulation of high levels of trehalose in the chloroplast.
  • the invention provides a method to transform a target plant for expression ofthe TPS 1 gene leading to accumulations of trehalose in the chloroplast of the plant cells and eliminating adverse pleiotropic effects.
  • the invention provides proof of integration of the heterologous DNA sequence into the chloroplast genome by PCR.
  • the invention provides an environmental friendly method of engineering drought resistance to plants through chloroplast transformation.
  • Yeast trehalose phosphate synthase (TPSl) gene was introduced into the tobacco chloroplast or nuclear genomes to study resultant phenotypes.
  • PCR and Southern blots confirmed stable integration of TPSl into the chloroplast genomes of T ls T 2 and T 3 transgenic plants.
  • Northern blot analysis of transgenic plants showed that the chloroplast transformant expressed 16,966-fold more TPSl transcript than the best surviving nuclear transgenic plant.
  • both the chloroplast and nuclear transgenic plants showed significant TPSl enzyme activity, no significant trehalose accumulation was observed in T 0 /T t nuclear transgenic plants whereas chloroplast transgenic plants showed 15-25 fold higher accumulation of trehalose than the best surviving nuclear transgenic plants.
  • Nuclear transgenic plants (T 0 ) that showed significant amounts of trehalose accumulation showed stunted phenotype, sterility and other pleiotropic effects whereas chloroplast transgenic plants (T,,
  • FIG. 1 PCR analysis of control and chloroplast transformants.
  • A Map of pCt-TPSl, chloroplast transformation vector and primer landing sites. P denotes plus strand and M denotes minus strand. Please note that tRNA genes contain introns.
  • B 1% agarose gel containing PCR products using total plant DNA as template. M: 1 kb ladder; 1.
  • N Nicotiana tabacum Burley, untransformed control; Lanes 1, 3, 5: pCt basic vector transformants. 2, 4, 6: pCt-TPSl transformants.
  • C Map ofthe nuclear expression vector pHGTPS 1.
  • FIG. 1 Southern blot analysis of control, T, and T 3 chloroplast transgenic plants.
  • A Site of integration of foreign genes into the chloroplast genome and expected fragment sizes in Southern blots.
  • PI is the 0.81kb BamHl-Bglll fragment containing chloroplast DNA flanking sequences used for homologous recombination.
  • P2 isthe 1.5kbXbal Fragment containing the TPSl coding sequence.
  • B Southern blot of DNA digested with Bglll and hybridized with probes PI or P2. Lanes: C, untransformed control; 1, T ⁇ generation chloroplast transformant; 2, T 3 generation chloroplast transformant.
  • FIG. 1 Northern and western blot analyses of control, nuclear and chloroplast transgenic plants.
  • A D Western blots detected through chemiluminescence (lOO ⁇ g total protein per lane).
  • B E
  • FIG. 4 Nuclear and chloroplast transgenic plants to illustrate pleiotropic effects. l. N. t xanthi control; 2-5: T 0 nuclear transgenic plants 2, X-113; 3.X-121; 4. X-119; 5. X-224; 6, T, chloroplast transgenic plant; 7, N. t. Burley control.
  • Figure 6 Assay for drought tolerance on PEG. Four week old seedlings on MS medium containing 3% (A, B) or 6% (C, D) polyethylene glycol (MW 8,000). A, C: Control untransformed N. t. Burley. B, D: T, Chloroplast transgenic plants.
  • Figure 7 Dehydration rehydration assay. Three week old seedlings from control and chloroplast transgenic lines germinated on agarose in the absence or presence of spectinomycin (500 ⁇ g/ml) were air-dried at room temperature in 50% relative humidity. After 7 hrs drying, seedlings were rehydrated for 48 hrs by placing roots in MS medium. A, untransformed; B,C, T, and T 3 chloroplast transgenic lines.
  • FIG. 1 Water loss assay. Detached leaves from mature plants at similar developmental stages were dried at room temperature in 25% relative humidity. Leaf weight during drying was recorded and shown as percentage of initial fresh weight.
  • FIG. 9 Dehydration and rehydration of potted plants. Potted plants were not watered for 24 days and rehydrated for 24 hours. Arrows indicate fully dried leaves that either recovered or did not recover from dehydration.
  • This invention discloses a method of conferring drought tolerance to plants by transforming plants via the chloroplast with a vector that contains a DNA sequence encoding a gene of interest that protects against water stress.
  • the vector used is the universal vector as described by Daniell in W099/10513, which is incorporated herein by reference.
  • osmoprotection is the yeast trehalose-6-phosphate synthase (TSP 1).
  • TSP yeast trehalose-6-phosphate synthase
  • yeast trehalose-6-phosphate synthase gene can be expressed in nuclear transgenic plants. Because chloroplasts are prokaryotic in nature, it is desirable to test expression levels ofthe eukaryotic yeast TPS 1 gene in E coli. Because ofthe high similarity in the transcription and translation systems between E. coli and chloroplasts, expression vectors are. routinely tested in E. coli before proceeding with chloroplast transformation of higher plants. Therefore, the TPS 1 gene from yeast was cloned into the E. coli expression vector pQE 30 (see Figure 1 A for details of pQE- TPS1) and expressed in a suitable E. coli strain M15 (pREP4).
  • FIG. IB shows the presence of TPSl protein in crude cell extracts, even with Coomassie Blue stain (lane 1), indicating high levels of expression.
  • Western blot analysis using TPS 1 -antibody confirms the true identity of the expressed protein as shown in Figure IB, lane 41. These results confirm that the codon preference of TPSl is compatible for expression in a prokaryotic compartment. Hyper- expression also facilitated purification as shown in Figure 1 , lanes 2.55 and preparation of polyclonal antibody for characterization of transgenic plants. Chloroplast and nuclear expression vectors.
  • the yeast TPSl gene was inserted into the universal chloroplast expression vector pCt-TPSl as shown in Figure 2B.
  • This vector can be used to transform chloroplast genomes of several plant species because the flanking sequences are highly conserved among higher plants.
  • This vector contains the 16SrRNA promoter (Prrn) driving the aadA (aminoglycoside 3"- adenylyl transferase) and TPSl genes with the psbA 3' region (the terminator from a gene coding for photosystem II reaction center component) from the tobacco chloroplast genome.
  • the 16SrRNA promoter is one of the strong chloroplast promoters and the psbA 3' region stabilized transcripts to avoid hyper-expression of TPS-1 and associated Pleiotropic effects.
  • the yeast ribosme binding site (RBS) was used instead ofthe genome chloroplast RBS (GGAGG). This construct integrates both genes into the spacer region between the chloroplast transfer RNA genes coding for alanine and isoleucine within the inverted repeat (IR) region ofthe chloroplast genome by homologous recombination.
  • the yeast TPSl gene was inserted into the binary vector pHGTPSl ( Figure 2C), in which the TPSl gene is driven by the CaMV 35S promoter and the hph gene is driven by the nopaline synthase promoter.
  • the expression cassette is flanked by both the left and right T-DNA border sequences.
  • the binary vector pHGTPS 1 was mobilized into the Agrobacterium tumafaciens strain LBA
  • Transformed Agrobacterium strain was introduced into Nicotiana tabaccum var xanthi using the leaf disc transformation method.
  • Ninety two independent TPSl nuclear tranformants were obtained on hygromycin selection. Seventeen confirmed nuclear tranformants were analyzed by northern blots. Among tranformants showing various levels of transcripts, five tranformants with strong, moderate, weak, very weak and absence of transcripts were chosen for further characterization.
  • chloroplast transformation green leaves of N. tabacum var. Burley were transformed with the chloroplast integration and expression vector by the biolistic process. Bombarded leaf segments were selected on spectinomycin/streptomycin selection medium.
  • Figure 2A shows the presence of 0.4 kbp PCR product in plants transformed with the universal vector alone (pCt,) or the universal vector containing the TPSl gene (pCt-TPSl), but not in control untransformed plants, confirming that these are transgenic plants and not mutants.
  • the strategy to distinguish between nuclear and chloroplast transgenic plants was to land one primer (3P) on the native chloroplast genome adj acent to the point of integration and the second primer (3 M) on the aadA gene.
  • This primer set generated 1.6 kbp PCR product in chloroplast tranformants obtained with the universal vector (pCt) and the universal vector containing the TPSl gene (pCt-TPSl).
  • T j T 2 T 3 Since there are no significant differences in the level of foreign gene expression among different chloroplast transgenic lines, one line was chosen to generate subsequent generations (T j T 2 T 3 ). Southern blot analysis was performed using total DNA isolated from transgenic and wild type tobacco leaves. Total DNA was digested with a suitable restriction enzyme. Presence of a Bglll at the 3' end ofthe flanking 16S rRNA gene and the trnA intron allowed excision of predicted size fragments in the chloroplast tranformants and untransformed plants. To confirm foreign gene integration and homoplasmy, individual blots were probed with the chloroplast DNA flanking sequence (probe PI, Figure 2A).
  • TPSl integrated plastid tranformants T,T 2
  • the border sequence hybridized with 6.13 and 1.17 kbp fragments while it hybridized with a native 4.47 kbp fragment in the untransformed plants ( Figure 2B).
  • the copy number ofthe integrated TPSl gene was also determined by establishing homoplasmy in transgenic plants. Tobacco chloroplasts contain about 10,000 copies of chloroplast genomes per cell. If only a fraction of the genomes were transformed, the copy number should be less than 10,000. By confirming that the TPSl integrated genome is the only one present in transgenic plants, one could establish that the TPSl gene copy number could be as many as 10,000 per cell.
  • Figure 3 show ethidium bromide stained RNA gels before blotting; this confirms that equal amount of RNA (10 ⁇ g) was loaded in all lanes. It is remarkable that the 16SrRNA promoter is driving both genes very efficiently, eliminating the need for inserting additional promoters for the gene of interest.
  • Trehalose formation is a two step process, involving trehalose-6-phosphate synthase and trehalose 6-phosphate phosphatase.
  • Trehalose-6-phosphate was not detected in all tested chloroplast and nuclear transformers even though the TPS2, trehalose-6-phosphate phosphatase that converts T6P to trehalose, was not introduced (Table 1).
  • Conversion of T6P to trehalose should have been accomplished by endogenous tobacco trehalose phosphatase or by any non-specific endogenous phosphatase.
  • T nuclear transgenic plants accumulated less trehalose than control untransformed plants whereas T [ chloroplast transgenic plants continued to accumulate high levels of trehalose (Table 1). Observation of comparable TPS 1 activity in both nuclear and chloroplast transgenic plants but lack of trehalose accumulation in nuclear transgenic planes indicates that trehalose may be degraded in the cytosol by trehalase but not in the chloroplast compartment. This is consistent with previous studies on inhibition of trehalase activity that resulted in trehalose accumulation in the cytosol. Drought tolerance and pleiotropic effects:
  • TPSl nuclear tranformants showed moderate to severe growth retardation, lancet- shaped leaves and infertility ( Figure 4).
  • the chloroplast tranformants (T 0 ) showed decreased growth rate and delayed flowering but all subsequent generations (Ttre T 2 ) showed similar growth rates and fertility as controls.
  • the nuclear transgenic lines of stunted phenotype showed delayed flowering and produced fewer seeds compared to wild type or did not flower. This result is consistent with prior observations which demonstrated that E. coli otsA (TPSl) and S.
  • TPSl transgenic plants exhibited stunted plant growth and other pleiotropic effects.
  • the nuclear transgenic line showing severe growth retardation did not flower.
  • T nuclear transgenic plants that survived showed no growth retardation and trehalose accumulation. Therefore, these plants could not be used for appropriate comparison with chloroplast transgenic plants.
  • chloroplast transgenic plant crossed between transgenic female and untransformed male
  • wild type seeds were germinated on MS medium containing spectinomycin
  • all chloroplast transgenic progeny were spectinomycin resistant while all wild type seedlings were sensitive to spectinomycin (Figure 5). Because TPSl transgenic lines showed accumulation of trehalose, they were tested for drought tolerance.
  • chloroplast transformant seedlings showed resistance to medium containing 3% and 6% PEG whereas control and nuclear transgenic seedlings exhibited severe dehydration, necrosis and severe growth retardation, ultimately resulting in death.
  • Three-week-old seedlings were chosen to study drought tolerance by dehydration and subsequent rehydration. When seedlings were dried for 7 hours at room temperature in 50% relative humidity, they were all affected by dehydration. However, when dehydrated seedlings were rehydrated for 48 hours in MS medium, all chloroplast transgenic lines recovered while all control seedlings were bleached (Figure 7).
  • EXAMPLE ONE Plant, A. tumefaciens and E. coli culture For transformation experiments, Nicotianatabacum var. xanthi and Burley were grown in MS medium in the Magenta culture box (Sigma, USA). For drought tolerance assays of transgenic tobacco plants, the rooted young plants were transferred to pre- swollen Jiffy-7 peat pellets (Jiffy Products, Norway) inside the greenhouse. Plants used for enzyme assays were grown and kept in Magenta culture boxes. Seven or 8 leaf stage plants were used for enzyme assays. Two to three-week old young transgenic tobacco plants were used for stress analyses. (Agrobacterium tumefaciens strain LBA4404 was grown in the YEP medium at 29°C In a shaking incubator. Other E. coli strains were cultured and maintained as described in Sambrook et al.
  • Plasmid construction and antibody production For hyper-expression ofthe TPSl in E. Coli for antibody production, the yeast TPS 1 gene was cloned into plasmidpQE30 (Qiagen) and subsequently transformed into E. coli strain Ml 5 [pREP4]. The resulting E. coli transformant was grown at 37°C to an A 600 of 0.5-0.8 and induced by 2mM isopropyl- ⁇ -D-thiogalactopyranoside (IPTG) for 1-5 hours. The induced cells were harvested and lysed by sonication. SDS-P AGE analysis showed the presence of TPS 1 protein in crude cell extracts, even with Coomassie Blue stain, indicating high levels of expression.
  • IPTG isopropyl- ⁇ -D-thiogalactopyranoside
  • the yeast 1.537 kbp TPSl gene was inserted into the Xbal site of pCt vector generating pCt-TPSl ( Figure 2B).
  • the yeast TPSl gene was inserted into the pHGTPSl vector in which the TPSl gene is driven by the CaMV 35 S promoter.
  • the resulting vector confers hygromycin resistance because ofthe hygromycin phosphotransferase gene driven by the NOS promoter.
  • Chloroplast and nuclear transformation For chloroplast transformation, particle bombardment was carried out using a helium driven particle gun, Biolistic PDH1000. Briefly, chloroplast vectors, pCt and pCt-TPSl were delivered to tobacco leaves (Burley) using 0.6 ⁇ m gold microcarriers (Bio- Rad) at 1,100 psi with a target distance of 9 cm.
  • pHGTPSl was mobilized into the Acrobacterium tumefaciens strain LBA4404 by electroporation using Gene Pulsar (Bio-Rad. USA). The resulting Agrobacterium strain was used in leaf disc transformation of wild type N. tabacum var. xanthi.
  • Chloroplast DNA isolation and PCR Total DNA was extracted from leaves of wild type and transformed plants using CTAB extraction buffer described. PCR was carried out to confirm spectinomycin resistant chloroplast tranformants using Peltier Thermal Cycler PTC-200 (MJ Research, USA). Three primer sets, 2P(5'-GCGCCTGACCCTG AGATGTGGATCAT-3 ')-2M(5'- TGACTGCCCAACCTGAGAGCGGACA-3 '), 3P(AAAACCCGTCCTCAGTTCGGATTGC)- 3M(CCGCGTTGTTTCATCA AGCCTTACG) and -5P(CTGTAGAAGTCACCATTGTTGTGC), 5M(GTCCAAGAT AAGCCTGTCTAGCTTC) were used for the PCR. PCR reactions were carried out as described elsewhere (Daniell et al., 1998; Guda et al, 2000).
  • RNA isolation and Northern Slot analysis Total RNA was extracted from transgenic tobacco plants using Tri Reagent (MRC, USA) following manufacturer's instruction. For northern blots, RNA samples (10 ⁇ g of total RNA per lane) were electrophoresed on a 1.5% agarose-MOPS gel containing formaldehyde. Uniform loading and integrity of RNAs were confirmed by examining the intensity of ethidium bromide bound ribosomal RNA bands under UV light. RNAs on the gel were transferred onto Hybond-N membrane (Amersham, USA). The membrane was hybridized to radiolabeled TPSl probe and washed at 65°C in a solution of 0.2X SSC and 0. 1 % SDS for 20 min twice.
  • Drought tolerance and biochemical characterization For analyses of drought tolerance, 2-3 week old transgenic tobacco plants were used. Seeds of chloroplast and nuclear tranformants were germinated on MS plates containing 3% or 6% PEG (MW 8,000). TPSl enzyme assay was performed spectrophometrically by the method described by Londesbrough and Vuorio. For quantitative determination of T6P and trehalose, carbohydrates were extracted from aerial parts of transgenic or wild type tobacco plants by treatment in 85% ethanol at 60°C for 1 hour. The amount of T6P and trehalose were measured by high-performance liquid chromatography (HPLC) on a Waters system equipped with a Waters High Performance Carbohydrate Column (4.6x250 mm) and a refractive index detector. The insoluble phase system was 75% acetanitrile-25% H 2 0 with a flow rate of 1.0 ml/min.
  • HPLC high-performance liquid chromatography
  • Protein Folding Deciphering the Second Half of theGenetic Code, Gierasch, L.M., and King, J., eds., American Association For the Advancement of Science (1990).

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Nutrition Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé pour conférer l'osmoprotéction aux végétaux. On transforme des génomes de plaste végétal, notamment le génome du chloroplaste, pour exprimer un osmoprotécteur. Les plantes transgéniques et leur descendance manifestent une résistance à la sécheresse; de plus, ces plantes transgéniques ne manifestent aucun effet pléiotropique négatif tel que la stérilité ou la croissance freinée.
EP01913108A 2000-02-29 2001-02-28 Genie genetique de la tolerance a la secheresse au moyen d'un genome de plaste Withdrawn EP1263934A4 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US18565800P 2000-02-29 2000-02-29
US185658P 2000-02-29
PCT/US2001/006271 WO2001064850A1 (fr) 2000-02-29 2001-02-28 Genie genetique de la tolerance a la secheresse au moyen d'un genome de plaste

Publications (2)

Publication Number Publication Date
EP1263934A1 true EP1263934A1 (fr) 2002-12-11
EP1263934A4 EP1263934A4 (fr) 2004-05-06

Family

ID=22681915

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01913108A Withdrawn EP1263934A4 (fr) 2000-02-29 2001-02-28 Genie genetique de la tolerance a la secheresse au moyen d'un genome de plaste

Country Status (4)

Country Link
EP (1) EP1263934A4 (fr)
AU (1) AU2001241809A1 (fr)
CA (1) CA2401855A1 (fr)
WO (1) WO2001064850A1 (fr)

Families Citing this family (15)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20100251425A9 (en) 1998-05-15 2010-09-30 University Of Central Florida Expression of human interferon in transgenic chloroplasts
KR100440725B1 (ko) 2002-06-20 2004-07-15 주식회사 그린진 바이오텍 비생물성 스트레스에 대한 단자엽 식물의 내성을증가시키는 방법
CA2491639A1 (fr) 2002-07-03 2004-01-15 University Of Central Florida Expression de igf-1 humain dans des plastes transgeniques
ATE405658T1 (de) 2002-07-26 2008-09-15 Basf Plant Science Gmbh Neue selektionsverfahren
WO2004044143A2 (fr) * 2002-11-06 2004-05-27 Cornell Research Foundation, Inc. Genes chimeres et transformants vegetaux de la tps
WO2007053183A2 (fr) 2005-05-27 2007-05-10 University Of Central Florida Chloroplastes genetiquement modifies pour exprimer des proteines pharmaceutiques
US10752909B2 (en) 2007-03-30 2020-08-25 The Trustees Of The University Of Pennsylvania Chloroplasts engineered to express pharmaceutical proteins in edible plants
US8314222B2 (en) * 2007-10-05 2012-11-20 Sapphire Energy, Inc. System for capturing and modifying large pieces of genomic DNA and constructing organisms with chloroplasts
US8242093B2 (en) 2008-02-07 2012-08-14 Ceregene, Inc. Rescue of photoreceptors by intravitreal administration of an expression vector encoding a therapeutic protein
US10689633B2 (en) 2008-02-29 2020-06-23 The Trustees Of The University Of Pennsylvania Expression of β-mannanase in chloroplasts and its utilization in lignocellulosic woody biomass hydrolysis
EP2303296B1 (fr) * 2008-05-27 2019-11-20 The Trustees of the University of Pennsylvania Vaccin contre yersinia pestis pouvant être administré par voie orale
CN101289514B (zh) * 2008-06-13 2011-01-19 北京北方杰士生物科技有限责任公司 一种培育耐逆植物的方法及其专用dna片段
CA2780362C (fr) 2009-11-09 2019-12-24 University Of Central Florida Research Foundation, Inc. Administration par voie orale d'agents de tolerance exprimes chez les plantes
EP2770991B9 (fr) 2011-10-24 2017-01-25 The Trustees Of The University Of Pennsylvania Sous-motif d'exendine 4 de la toxine cholérique b exprimé dans un plastide administré par voie orale pour l'utilisation dans le traitement du diabète de type 2
CN105492458B (zh) * 2013-09-17 2019-04-16 创世纪种业有限公司 一种棉花海藻糖合成酶tps-2及其编码基因与应用

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999010513A1 (fr) * 1997-08-07 1999-03-04 Auburn University Vecteurs universels d'integration et d'expression de chloroplastes, plantes transformees et produits obtenus
WO1999046370A2 (fr) * 1998-03-11 1999-09-16 Novartis Ag Expression de genes biosynthetiques de trehalose dans des plantes

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5693507A (en) * 1988-09-26 1997-12-02 Auburn University Genetic engineering of plant chloroplasts
ATE271131T1 (de) * 1991-05-09 2004-07-15 Univ Arizona Transgene pflanzen mit geändertem polyolgehalt
US5792921A (en) * 1992-02-14 1998-08-11 Londesborough; John Increasing the trehalose content of organisms by transforming them with combinations of the structural genes for trehalose synthase
US5780709A (en) * 1993-08-25 1998-07-14 Dekalb Genetics Corporation Transgenic maize with increased mannitol content

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999010513A1 (fr) * 1997-08-07 1999-03-04 Auburn University Vecteurs universels d'integration et d'expression de chloroplastes, plantes transformees et produits obtenus
WO1999046370A2 (fr) * 1998-03-11 1999-09-16 Novartis Ag Expression de genes biosynthetiques de trehalose dans des plantes

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
LEE SEUNG-BUM ET AL: "Accumulation of trehalose within transgenic chloroplasts confers drought tolerance." MOLECULAR BREEDING, vol. 11, no. 1, January 2003 (2003-01), pages 1-13, XP009027206 ISSN: 1380-3743 *
NUCCIO M L ET AL: "Metabolic engineering of plants for osmotic stress resistance" CURRENT OPINION IN PLANT BIOLOGY, QUADRANT SUBSCRIPTION SERVICES, GB, vol. 2, no. 2, April 1999 (1999-04), pages 128-134, XP002216348 ISSN: 1369-5266 *
RATHINASABAPATHI B ET AL: "METABOLIC ENGINEERING OF GLYCINE BETAINE SYNTHESIS: PLANT BETAINE ALDEHYDE DEHYDROGENASES LACKING TYPICAL TRANSIT PEPTIDES ARE ARGETED TO TOBACCO CHLOROPLASTS WHERE THEY CONFER BETAINE ALDEHYDE RESISTANCE" PLANTA, SPRINGER VERLAG, DE, vol. 193, 1994, pages 155-162, XP002034434 ISSN: 0032-0935 *
See also references of WO0164850A1 *

Also Published As

Publication number Publication date
AU2001241809A1 (en) 2001-09-12
CA2401855A1 (fr) 2001-09-07
WO2001064850A1 (fr) 2001-09-07
EP1263934A4 (fr) 2004-05-06

Similar Documents

Publication Publication Date Title
Lee et al. Accumulation of trehalose within transgenic chloroplasts confers drought tolerance
Cortina et al. Tomato abiotic stress enhanced tolerance by trehalose biosynthesis
Xiao et al. Over-expression of a LEA gene in rice improves drought resistance under the field conditions
Hou et al. Chloroplast transformation in oilseed rape
WO2001064850A1 (fr) Genie genetique de la tolerance a la secheresse au moyen d'un genome de plaste
WO1990002804A1 (fr) Plantes tolerant les agressions
WO1999005902A1 (fr) Plantes transgeniques resistantes aux agressions dues a la salinite
Sugiharto Biotechnology of drought-tolerant sugarcane
US8889949B2 (en) Method for increasing resistance of monocot plants against abiotic stresses, TPSP fusion enzyme gene constructs, and transformants
US10907172B2 (en) Expression of transcription regulators that provide heat tolerance
KR100604191B1 (ko) 고구마 유래 식물체 당 유도성 프로모터 염기서열 및 이를포함하는 식물체 당 유도성 발현 벡터
US20040064846A1 (en) Genetic engineering of drought tolerance via a plastid genome
TW201014909A (en) Plant techonology
Sokhansanj et al. Comparison of bacterial and plant genes participating in proline biosynthesis with osmotin gene, with respect to enhancing salinity tolerance of transgenic tobacco plants
US20120023614A1 (en) Environmental stress-inducible 557 promoter isolated from rice and uses thereof
US20100212050A1 (en) Plants over-expressing pme
CN110294795B (zh) 大豆蛋白质GmDISS2及其编码基因在调控植物耐逆性中的应用
US20040187175A1 (en) TPS plant gene constructs and transformants
US7655837B2 (en) Glutathione-S-transferase gene from Proposis juliflora confers abiotic stress tolerance in plants
Zhang et al. Overexpression of nicotianamine synthase (NAS) gene results in enhanced drought tolerance in perennial ryegrass
Assem et al. Genetic transformation of the Nicotiana protein kinase (NPK1) gene confers osmotic tolerance in Egyptian maize
Stirn et al. Genetically modified plants
EP1321524A1 (fr) Procédé d'augmentation d'une molécule biologique transgène dans un organisme
Kavas Development of salt resistant transgenic plants by using TANHX1 and TASTR genes
CA2901370A1 (fr) Production d'il-37 a partir de plante

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020930

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

A4 Supplementary search report drawn up and despatched

Effective date: 20040319

RIC1 Information provided on ipc code assigned before grant

Ipc: 7C 12N 15/82 A

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060527