Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
  • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
  • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
  • A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
  • A61K31/7076—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
  • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
  • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
  • A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
  • A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
  • A61K31/7072—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid having two oxo groups directly attached to the pyrimidine ring, e.g. uridine, uridylic acid, thymidine, zidovudine
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
  • A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
  • A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
  • A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
  • A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K31/00—Medicinal preparations containing organic active ingredients
  • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
  • A61K31/7084—Compounds having two nucleosides or nucleotides, e.g. nicotinamide-adenine dinucleotide, flavine-adenine dinucleotide
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
  • A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
  • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
  • A61P1/10—Laxatives
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
  • A61P1/12—Antidiarrhoeals
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
  • A61P31/10—Antimycotics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00

Definitions

• This invention relates to a method of regulating mucus secretions and fluid transport in the gastrointestinal system of a patient by administering purinergic receptor agonists such as certain uridine, adenine, or cytidine 5'-di- and triphosphates, dinucleoside polyphosphates and their analogs thereof.
• purinergic receptor agonists such as certain uridine, adenine, or cytidine 5'-di- and triphosphates, dinucleoside polyphosphates and their analogs thereof.
• the gastrointestinal system operates principally to extract energy and metabolic building blocks from the nutrient materials presented to it.
• the digestive tract includes the buccal cavity (primary salivary glands), esophagus, stomach, small intestine, large intestine, rectum, and ancillary organs (pancreas, liver and gall bladder).
• the mucosal barrier When the mucosal barrier is impaired in the digestive tract, it results in diseases such as dry mouth, gastro-esophageal reflux disease, peptic ulcer, inflammatory bowel disease, etc.
• Abnormal fluid and electrolytic transport in the lower gastrointestinal tract results in disorders such as constipation and diarrhea.
• Mucus is a viscous material that coats many epithelial surfaces and is secreted into fluids such as saliva. It is composed chiefly of mucins and inorganic salts suspended in water. Mucus adheres to many epithelial surfaces, where it serves as a diffusion barrier against contact with noxious substances (e.g. gastric acid, digestive enzymes and bacteria) and as a lubricant to minimize shear stresses. Such mucous coatings are particularly prominent on the epithelia of the gastrointestinal, respiratory and genital tracts. Mucous is also an abundant and important component of saliva, giving it virtually unparalleled lubricating properties. Mucus-secreting cells such as goblet cells are abundant in the epithelium of the gastrointestinal tracts.
• mucins are a family of large, heavily glycosylated proteins.
• the dense "sugar coating" of mucins gives them considerable water-holding capacity and makes them resistant to proteolysis, which may be important in maintaining mucosal barriers.
• Bicarbonate secretion plays an important role in the maintenance of mucosal health in the gastrointestinal tract.
• the production of bicarbonate and mucus by the esophagus in response to local acidification provides an inherent mechanism for resisting acid-induced damage.
• the secretion of salivary protective factors, including bicarbonate, as well as bicarbonate secreted from esophageal submucosal glands, are important in preventing esophageal mucosal injury associated with gastrointestinal reflux disease.
• Mucosal bicarbonate also provides an important mechanism for protection against acid damage in the proximal duodenum, in which adherent mucus provides a stable protective layer supporting surface neutralization of acid by mucosal bicarbonate.
• Constipation is associated with a delay in the transit of fecal matter through the large intestine.
• the increased resident time of feces in the large intestine leads to increased fluid absorption by the colonic epithelium, and results in dehydration of feces and the subsequent production of dry, hard feces in the descending colon.
• diarrhea results from rapid movement of fecal matter through the large intestine, resulting from either increased fluid secretion in the small intestine or by reduced fluid absorption in the colon.
• Xerostomia results from the underproduction of saliva. Dry mouth is caused by radiation treatment or diseases that damage salivary glands and decrease salivary flow. Gastroesophageal reflux disease is the condition where the degree of exposure of esophageal mucosa to gastric contents is greater than normal. The most common manifestation is heartburn.
• Pharmacological treatment involves the use of H2 antagonists (e.g., Tagamet ® , Zantac ® , Pepcid ® , Axid ® ) and proton pump inhibitors such as Prilosec ® or Prevacid ® , for treatment of acute disease.
• H2 antagonists e.g., Tagamet ® , Zantac ® , Pepcid ® , Axid ®
• proton pump inhibitors such as Prilosec ® or Prevacid ®
• Ulceration results from a complex interplay of acid and chronic inflammation induced by Helicobacter pylori infection.
• Patients with duodenal ulcers have high acid secretion. Increased acid secretion causes changes in the wall of the duodenum, setting the stage for invasion by H. pylori.
• Drugs for treating peptic ulcer diseases include Histamine-2 (H2) blockers (Tagamet ® , Zantac ® , Axid ® , Pepcid ® , etc.), sucralfate, proton pump inhibitors, and antacids.
• Inflammatory bowel disease is classified into two types: ulcerative colitis and Crohn's disease.
• Ulcerative colitis affects the colon/rectum and involves the mucosa or the innermost lining of the colon wall.
• Crohn's disease is a transmural disease involving all layers of the bowel and may involve any part of the gut, from mouth to anus.
• Medical treatment of inflammatory bowel disease includes aminosalicylates and corticosteroids. Corticosteroids have substantial long-term toxicity.
• medical researchers have sought to develop new treatments for gastrointestinal diseases.
• the following references disclose the role of mucus integrity and mucin secretion in some diseases of the gastrointestinal tract.
• Uridine 5'-triphosphate has been shown to increase both the rate and total amount of mucin secretion by Goblet cells in vitro (Lethem et al, Am. J. Respir. Cell Mol. Biol, 9:315-322 (1993)).
• USPN 5,900,407 discloses a method for the stimulation of tear secretion in a subject in need of treatment.
• the method comprises administering to the ocular surfaces of the subject a purinergic receptor agonist such as uridine 5'-triphosphate, cytidine 5'-triphosphate, adenosine 5'-triphosphate, or their analogs and derivatives, in an amount effective to stimulate tear fluid secretion.
• a purinergic receptor agonist such as uridine 5'-triphosphate, cytidine 5'-triphosphate, adenosine 5'-triphosphate, or their analogs and derivatives
• the compounds are useful in the treatment of chronic obstructive pulmonary diseases, bronchitis, certain pneumonias, cystic fibrosis, sinusitis, and otitis media.
• USPN 5,763,447 discloses a method of promoting drainage of mucous secretions in the congested airway of an immobilized patient.
• the method comprises administering to the airway of the patient a uridine phosphate such as uridine 5'- triphosphate (UTP), or P,'P 4 -di(uridine-5')tetraphosphate, in an amount effective to promote drainage of fluid in the congested airway, including sinuses, by hydrating mucous secretions or by stimulating ciliary beat frequency in the airway.
• a uridine phosphate such as uridine 5'- triphosphate (UTP), or P,'P 4 -di(uridine-5')tetraphosphate
• USPN 5,789,391, 5,981,506, 5,972,904 and 5,958,897 are directed to a method of promoting drainage of congested mucous secretions in the sinuses of a subject in need.
• the method comprises administering to the sinuses of the subject a uridine phosphate such as uridine 5'-triphosphate (UTP) or P 1 , P 4 -di(uridine-5') tetraphosphate, an analog of UTP, or any other analog, in an amount effective to promote drainage of congested fluid in the sinuses by hydrating mucous secretions or by stimulating ciliary beat frequency in the sinuses.
• UTP uridine 5'-triphosphate
• P 1 , P 4 -di(uridine-5') tetraphosphate an analog of UTP, or any other analog
• USPN 5,968,913 is directed to a pharmaceutical compositions of UTP for use in promoting increased mucociliary clearance of retained mucous secretions of the human airways, middle/inner ears or sinuses.
• USPN 5,763,447 is directed to a method of preventing or treating pneumonia, including ventilator-associated pneumonia, in a bedridden or immobilized subject in need of such treatment. The method comprises administering to the airways of the patient a uridine phosphate such as uridine 5'- triphosphate (UTP), P 1 , P 4 -di(uridine-5')tetraphosphate, or their analogs, in an amount effective to promote drainage of fluid in the congested airways.
• uridine phosphate such as uridine 5'- triphosphate (UTP), P 1 , P 4 -di(uridine-5')tetraphosphate, or their analogs
• WO 99/09998 discloses a method of using uridine 5'-diphosphate and analogs thereof to treat lung disease.
• the compounds described in the above references ('391, '506, '904, '897, '913 and '447 Patent and WO 99/09998), which have purinergic receptor activity, are incorporated herein by reference.
• USPN 5,733,916 (Neely) discloses a method of preventing or treating ischemia-reperfusion injury or endotoxin-related lung injury by administration of a composition containing a selective A, adenosine receptor antagonist and/or a P 2 X purinoceptor antagonist. Somers et al.
• T Thymidine m 2 . 2 . 7 _ 2,2,7-Trimethylguanosine
• TAD Tiazofurin
• C-NAD C-nicotinamide riboside
• P2Y purinergic receptors are purine and pyrimidine nucleotide receptors that couple to G proteins; they are 308 to 377 amino acid proteins with molecular weights of 41 to 53 kDa after glycosylation.
• P2Y receptors such as P2Y,, P2Y 2 and P2Y 6 receptors are present in the gastrointestinal tract (Ralevic et al, Pharm. Rev. 50:415-492 (1998)).
• P2Y receptors including P2Y 4 and P2Y ⁇ are present in gastrointestinal tissues.
• Applicants also discover that mucus and mucin secretion, bicarbonate secretion and fluid transport in these tissues can be regulated via P2Y purinergic receptor-mediated mechanisms.
• P2Y purinergic receptor ligands administered orally or systemically, provide a novel method of treating gastrointestinal disorders.
• the invention provides a method of regulating mucus/mucin secretions, and fluid transport in the gastrointestinal tract.
• the invention provides a method for treating gastrointestinal disease in which the mucosal barrier of the gastrointestinal system is impaired.
• the invention additionally provides a method for correcting disorders of fluid secretion or absorption in the gastrointestinal tract resulting in either diarrhea or constipation.
• the method comprises administering to a patient a pharmaceutical composition comprising a purinergic P2Y receptor ligand, in an amount effective to regulate mucus/mucin and bicarbonate secretions and fluid transport in the gastrointestinal tract.
• Methods of administering include oral and systemic administration.
• the diseases treated include diseases and disorders of the buccal cavity, esophagus, stomach, small intestine, large intestine, rectum, and ancillary organs such as pancreas, liver and gall bladder.
• the pharmaceutical composition used in this invention comprises a P2Y purinergic receptor agonist.
• P2Y agonists increase secretion of water, bicarbonate and mucin in the mucosal epithelia of the gastrointestinal tract.
• P2Y agonists include uridine 5'- di-and triphosphate (UDP, UTP) and their analogs (Formulae la and lb), adenosine 5'- monophosphate (AMP) and its analogs, adenosine 5'- di-and triphosphate (ADP, ATP) and their analogs (Formulae Ila and lib), cytidine 5'- di-and triphosphate (CDP, CTP) and their analogs. (Formulae Ilia and Illb), and dinucleotide polyphosphate compounds (general Formula IV).
• Figure 1 shows the P2Y 2 receptor in situ hybridization results of stomach tissues (gastric epithelia) with (a) control sense probe and (b) antisense probe.
• Figure 2 shows the P2Y 2 receptor in situ hybridization results of esophagus epithelia with (a) control sense probe and (b) antisense probe.
• Figure 3 shows the P2Y 2 receptor in situ hybridization results of the large intestine (colon) epithelia with (a) sense probe and (b) antisense probe.
• Figure 4 shows the P2Y 2 receptor in situ hybridization results of the small intestine (jejunum) epithelia with (a) sense probe and (b) antisense probe.
• Figure 5 shows calcium mobilization induced by P2Y receptor agonists in human colonic epithial cells.
• the invention provides a method of regulating mucous secretions, bicarbonate secretion, and fluid transport in the gastrointestinal tract.
• the invention also provides a method of treating gastrointestinal disease in which the mucosal barrier of the organ is impaired, or in which an imbalance of fluid absorption rf secretion occurs in the small and large intestine.
• the method comprises administering to a mammal a pharmaceutical composition comprising a purinergic P2Y receptor ligand, in an amount effective to regulate mucus or mucin secretions, bicarbonate secretion, or fluid transport in the gastrointestinal tract.
• the method enhances the mucin release, pH and hydration, or regulates the fluid transport in the gastrointestinal tract.
• Gastrointestinal diseases suitable for treatment by this invention include diseases or disorders affecting the buccal cavity (primary salivary), esophagus, stomach, small intestine, large intestine, rectum and ancillary organs such as pancreas, liver and gall bladder.
• diseases or disorders affecting the buccal cavity primary salivary
• esophagus esophagus
• stomach small intestine
• large intestine rectum
• ancillary organs such as pancreas, liver and gall bladder.
• ancillary organs such as pancreas, liver and gall bladder.
• dry mouth, mouth ulcer, gum disease, esophageal reflux disease, peptic ulcer, inflammatory bowel disease (ulcerative colitis and Crohn's disease), mycositis, diarrhea and constipation can be treated by the present method.
• gastrointestinal problems associated with cystic fibrosis diseases such as dry mucin and decreased absorption of nutrient by epithelial cells in the gastrointestinal tract can
• Mucin has been shown to be important in protecting mucosal surfaces from environmental exposure; it acts as an acid barrier and has been found to bind to pathogens. Mucin is thus a part of the natural mucosal defense system in the body, and stimulation of its secretion may lead to protection of the mucosal surface epithelium.
• the method of the present invention is to increase the mucous secretions in gastrointestinal tracts, such as stomach and esophagus, thus strengthening the natural defense system.
• the epithelial lining of the human esophagus consists of squamous epithelium and submucosal glands that serve as a natural barrier between the lumen and blood and act as protective lining against the physical perturbations of the injested food and against the acidic gastric juices from the stomach.
• the esophageal submucosal glands contain mucous, serous, and myoepithelial cell types.
• Submucosal glands in the airways and conjunctiva contain P2Y 2 receptors in mucosal epithelia of the esophagus. Activation of P2 Y 2 receptors by natural and synthetic agonists increases mucus secretion into and hydration of the mucosal layer of the esophagus.
• GERD gastroesophageal reflux disease
• the symptoms of GERD include mild to severe heartburn, esophageal inflammation (esophagitis), regurgitation, dysfunctional swallowing, and chest pain.
• GERD is caused by a variety of factors, including abnormal function of the lower esophageal sphincter (which allows reflux of gastric juices into the lower esophagus), delayed stomach emptying, reduced rates of esophageal clearance, and diminished salivation.
• the esophagus is exposed to high acid content during gastric reflux, it results in a breakdown of the protective mucus layer.
• the present invention discloses that in an animal model of esophagitis, P2Y 2 receptor agonists can restore the integrity of the disrupted esophageal mucosal layer by naturally stimulating mucin, bicarbonate, and fluid production by squamous epithelia and/or submucosal glands. Gastric ulcers and gastric reflux are conditions characterized in part by a breakdown in the mucosal defense barrier of the upper gastrointestinal epithelium.
• Gastric ulcer is associated with, but not limited to stress, diet, H. pylori infection, chemotherapy or radiotherapy, other autoimmune diseases such as Sjogren's syndrome, etc., surgery, psychosomatic disorders, stress, anxiety, and pharmacological drug-related side effects.
• the crypts of Lieberkuhn along the small intestine play a principal role in mediating fluid secretion into the lumen of the small intestine. Chloride efflux across apical membrane chloride channels at the apical membrane of epithelial cells along these crypts provide the driving force for osmotically obliged fluid secretion in the small intestine. Constipation and diarrhea result from abnormal fluid transport (absorption verses secretion) across the small and large intestines.
• the present invention discloses a method to correct for imbalance of fluid transport leading to either constipation or diarrhea by targeting activation of P2Y receptors along the small and large intestines.
• the colonic epithelia of the large intestine normally absorb fluid and function to remove excessive fluid from the entering chyme from the small intestine and convert it into feces. Diarrhea results from excessive fluid in the entering chyme, or malabsorption of fluid across the colon. Fluid absorption along the colonic epithelia is mediated by sodium absorption via apical membrane sodium channels and basolateral membrane sodium potassium transporters. The fluid absorption properties of this epithelium can be modulated electrogenically by calcium-activated potassium channels at the basolateral membrane. Increase in basolateral membrane potassium conductance hyperpolarizes the apical and basolateral membranes and thus increases the electrogenic driving force for sodium influx across the apical membrane.
• the present invention discloses that activation of P2Y purinoceptors by agonists increases basolateral membrane potassium conductance and facilitates fluid removal from feces. Therefore direct administration of P2Y receptor agonists can be used therapeutically to treat diarrhea.
• the present method comprises administering to a patient a pharmaceutical composition that regulates mucus/mucin secretion, hydration and fluid transport in the gastrointestinal tract.
• the present method has advantages over other commonly used treatments.
• the method regulates a patient's own production and secretion of mucus as well as the levels of mucosal hydration.
• the present invention maintains the natural protective and lubricant characteristics of mucosa of gastro-intestinal system and directly addresses the problem resulting from mucus impairment.
• the present invention is concerned primarily with the treatment of human subjects, but may also be employed for the treatment of other mammalian subjects, such as dogs and cats, for veterinary purposes.
• P2Y receptors P2Y,, P2Y 2 , P2Y 4 , P2Y 6 , and P2Y ⁇
• gastrointestinal tissues such as salivary glands, esophagus, stomach, small intestine, colon, duodenum, and rectum
• a potent purinergic receptor agonist increases the secretion of mucin, and regulates fluid transport in the mucosal epithelia of the gastrointestinal tract.
• P2Y agonists include nucleotide mono-, di-, and triphosphates and dinucleotide polyphosphates.
• Nucleotide monophosphates useful in this invention include adenosine 5'-monophosphate (AMP) and its derivatives such as 2-thioether-substituted AMP, e.g., 2-hexylthio AMP (Br. J. Pharmacol. 118:1959 (1996)).
• Nucleotide di-and triphosphates useful in this application include uridine 5'-di- and triphosphate (UDP and UTP) and their analogs of general formulae la and lb; adenosine 5'-di- and triphosphate (ADP and ATP) and their analogs of general formulae Ila and lib; and cytosine 5'-di- and triphosphate (CDP and CTP) and their analogs of general formulae Ilia and Mb.
• UDP and its analogs are depicted by general formula la:
• Y is H or OH
• R is selected from the group consisting of O, imido, methylene, and dihalomethylene (e.g., dichloromethylene, difluoromethylene);
• R 2 is selected from the group consisting of H, halo, alkyl, substituted alkyl, alkoxyl, nitro and azido;
• R 4 is selected from the group consisting of -OR', -SR', NR', and NR'R", wherein R' and R" are independently selected from the group consisting of H, alkyl, substituted alkyl, aryl, substituted aryl, arylalkyl, alkoxyl, and aryloxyl, and with the proviso that R' is absent when R 4 is double bonded from an oxygen or sulfur atom to the carbon at the 4- position of the pyrimidine ring.
• alkyl refers to C,.
• I0 inclusive linear, branched, or cyclic, saturated or unsaturated (i.e., alkenyl and alkynyl) hydrocarbon chains, including for example, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, pentyl, hexyl, octyl, ethenyl, propenyl, butenyl, pentenyl, hexenyl, octenyl, butadienyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, allenyl and optionally substituted arylalkenyl and arylalkyny groups.
• acyl refers to an organic acid group wherein the -OH of the carboxyl group has been replaced with another substituent (i.e., as represented by RCO-, wherein R is an alkyl or an aryl group).
• RCO- substituent
• acyl specifically includes arylacyl groups.
• Specific examples of acyl groups include acetyl and benzoyl.
• aryl refers to 5 and 6-membered hydrocarbon and heterocyclic aromatic rings.
• aryl groups include but are not limited to cyclopentadienyl, phenyl, furan, thiophene, pyrrole, pyran, pyridine, imidazole, isothiazole, isoxazole, pyrazole, pyrazine, pyrimidine, and the like.
• alkoxyl refers to C,. ]0 inclusive, linear, branched, or cyclic, saturated or unsaturated oxo-hydrocarbon chains, including for example methoxy, ethoxy, propoxy, isopropoxy, butoxy, t-butoxy, and pentoxy.
• aryloxyl refers to aryloxy such as phenyloxyl, and alkyl, halo, or alkoxyl substituted aryloxyl.
• substituted alkyl and “substituted aryl” include alkyl and aryl groups, as defined herein, in which one or more atoms or functional groups of the aryl or alkyl group are replaced with another atom or functional group, including for example, halogen, aryl, alkyl, alkoxy, hydroxy, nitro, amino, alkylamino, dialkylamino, sulfate, and mercapto.
• halo and halogen
• halogen refer to fluoro, chloro, bromo, and iodo groups.
• Formula la compounds include: uridine 5'-diphosphate (UDP); uridine 5'-O-(2- thiodiphosphate)(UDPBS); 5-bromouridine 5'-diphosphate (5-BrUDP); 5-(l- phenylethynyl)-uridine 5'-diphosphate (5-(l-phenylethynyl)UDP); 5-methyluridine 5'- diphosphate (5-methylUDP); 4-hexylthiouridine 5'-diphosphate (4-hexylthioUDP); 4- mercaptouridine 5 '-diphosphate (4-mercaptoUDP); 4-methoxyuridine 5 '-diphosphate ( 4- methoxyUDP); 4-(N-morpholino)uridine 5'-diphosphate ( 4-(N-morpholino)uridine 5'-diphosphate ( 4-(N-morpholino)uridine 5'-diphosphate ( 4-(N-morpholino)uridine 5
• Preferred compounds of Formula la include UDP and UDP ⁇ S and 4-thio UDP.
• Certain compounds of Formula la e.g., UDP, dUDP, UDP ⁇ S, and 4-mercaptoUDP
• UDP, dUDP, UDP ⁇ S, and 4-mercaptoUDP are known and may be made in accordance with known procedures or variations thereof, which will be apparent to those skilled in the art.
• the identification and preparation of certain thiophosphate analogues of nucleoside diphosphates are set forth in U.S. Patent No. 3,846,402 (Eckstein et al.), and in R.S. Goody and F. Eckstein, J. Am. Chem. Soc. 93: 6252-6257 (1971).
• UDP, and other analogs thereof are also commercially available from vendors such as Sigma (St. Louis, MO) and Pharmacia (Uppsala, Sweden).
• UTP and its analogs are depicted by general formula lb;
• Y is H or OH
• R j , R 2 , R 3 and R 4 are defined as in Formula la.
• X 2 and X 3 are O " , R, is oxygen or imido, and R 2 is H.
• Particularly preferred compounds of Formula lb include uridine 5 '-triphosphate (UTP) and uridine 5'-O-(3-thiotriphosphate) (UTP ⁇ S).
• UDP and its analogs are depicted by general Formula Ha:
• Z is H, Cl, or SR, wherein R is alkyl (C,-C 20 , saturated or unsaturated);
• R 3 and R 4 are H while R 2 is nothing and there is a double bond between N-1 and C-6 (adenine), or
• R 3 and R 4 are H while R 2 is nothing and Z is SR, or
• R 3 and R 4 are H while R 2 is O and there is a double bond between N-1 and C-6 (adenine 1 -oxide), or
• Particularly preferred compounds of Formula Ila include 5'-adenosine diphosphate (ADP) and 2-methyl-SADP.
• R,, X,, X 2 , X 3 and Y are defined as in Formula lb, and R 2 , R 3 , R 4 and Z are defined as in Formula Ha.
• Preferred compounds of Formula lib include 5'-adenosine triphosphate (ATP).
• CDP and its analogs are depicted by general Formula Ilia:
• R 5 and R 6 are H while R 7 is nothing and there is a double bond between N-3 and C-4 (cytosine), or
• R,, X,, X 2 , X 3 and Y are defined as in Formula lb, and R 5 , Rs and R 7 are defined as in Formula Ilia.
• Preferred compounds of Formula Mb include cytidine 5 '-triphosphate (CTP) and 4-nitrophenyl ethenocytidine 5 '-triphosphate.
• Formulas I, II, and III, herein illustrate the active compounds in the naturally occurring D-configuration, but the present invention also encompasses compounds in the L-configuration, and mixtures of compounds in the D- and L-configurations, unless otherwise specified.
• the naturally occurring D-configuration is preferred.
• P2Y agonists also include dinucleotide phosphates of general Formula (IV):
• Y H or OH
• Y' H or OH
• the sugar moieties are as depicted in the D-configuration, but may be L-, or D- and L-.
• the D-configuration is preferred.
• the nucleoside residue can be in the alpha- or beta- and D- or L-configurations, but most preferably the beta-D-configuration.
• R is hydrogen, chlorine, amino, monosubstituted amino, disubstiruted amino, alkylthio, arylthio, or aralkylthio, wherein the substituent on sulfur contains up to a maximum of 20 carbon atoms, with or without unsaturation;
• R 2 is hydroxy, amino, mercapto, alkylthio, arylthio, aralkylthio, acylthio, alkyloxy, aryloxy, aralkyloxy, acyloxy, monosubstituted alkylamino, heterocyclic, monosubstituted cycloalkylamino, monosubstituted aralkylamino, monosubstituted arylamino, diaralkylamino, diarylamino, dialkylamino (wherein alkyl groups are optionally linked to N 7 to form a substitute ring), acylamino, diacylamino, or NHR Y ;
• R x is O (adenine 1 -oxide derivatives), or is absent (adenine derivatives); provided that when R 2 is NHR Y , R ⁇ and R x may be taken together form a 5- membered fused imidazole ring (1, N 6 -ethenoadenine derivatives), optionally substituted on the 4- or 5-positions of the etheno moiety with alkyl, aryl or aralkyl moieties as defined below;
• R 3 is hydrogen, azido, alkoxy, aryloxy, aralkyloxy, alkylthio, arylthio, or aralkylthio as defined below; or ⁇ -A(C ] . 6 alkyl)OCONH (C,. 6 alkyl)B- wherein A and B are independently amino, mercapto, hydroxy or carboxyl; or pharmaceutically acceptable esters, amides or salts thereof; or absent.
• the substituted derivatives of adenine include adenine 1 -oxide; l,N 6 -(4- or 5-substituted etheno) adenine; 6-substituted adenine; or 8-substituted aminoadenine, where R' of the 6- or 8-HNR' groups are chosen from among: arylalkyl (C,. 6 ) groups with the aryl moiety optionally functionalized as described below; alkyl; and alkyl groups with functional groups therein, such as: ([6-aminohexyl]carbamoylmethyl)-, and ⁇ - acylated- amino(hydroxy, thiol and carboxy)alkyl(C 2 .
• R' of the 6- or 8-HNR' groups are chosen from among: arylalkyl (C,. 6 ) groups with the aryl moiety optionally functionalized as described below; alkyl; and alkyl groups with functional groups therein, such as
• acyl group is chosen from among, but not limited to, acetyl, trifluoroacetyl, benzoyl, substituted-benzoyl, etc., or the carboxylic moiety is present as its ester or amide derivative, for example, the ethyl or methyl ester or its methyl, ethyl or benzamido derivative.
• the ⁇ -amino(hydroxy, thiol) moiety may be alkylated with a C M alkyl group.
• J is carbon or nitrogen, with the provision that when J is nitrogen, R 3 is not present; wherein the alkyls are straight-chain, branched or cyclic; wherein the aryl groups are optionally substituted with lower alkyl, amino, alkylamino, NO 2 N 3 , carboxylic, amido, sulfonamido, or halo groups; and
• R 4 is hydrogen, hydroxy, oxo, mercapto, amino, cyano, C 7 . 12 arylalkoxy, C,. 6 alkylthio, C,_ 6 alkoxy, C,. 6 alkylamino, or diC, ⁇ alkylamino, wherein the alkyl groups are optionally linked to form a heterocycle;
• R 5 is hydrogen, oxo, acetyl, benzoyl, C,_ 6 alkyl, C,. 5 alkanoyl, or aroyl;
• R ⁇ is hydroxy, oxo, mercapto, C alkoxy, C 7 . 12 arylalkoxy, C,. 6 alkylthio, amino, S- phenyl, C,. 5 disubstituted amino, triazolyl, C,. 6 alkylamino, or di-C alkylamino, wherein said dialkyl groups are optionally linked to form a heterocycle or linked to N J to form a substituted ring; or
• R 7 is selected from the group consisting of: hydrogen, hydroxy, cyano, nitro, and C 2 . 8 alkenyl; wherein said alkenyl moiety is optionally linked through an oxygen to form a ring, wherein at least one hydrogen of said alkenyl moiety on the carbon adjacent to said oxygen is optionally substituted with a substituent selected from the group consisting of: C,_ 6 alkyl or phenyl; substituted C 2 . 8 alkynyl, halogen, substituted C M alkyl, CF 3 , C 2 . 3 alkenyl, C 2 . 3 alkynyl, allylamino, bromovinyl, ethyl propenoate, or propenoic acid; or
• R 6 and R 7 together form a 5 or 6-membered saturated or unsaturated ring bonded through N or O or S at ⁇ , such ring optionally contains substituents that themselves contain functionalities; provided that when R 8 is amino or substituted amino, R 7 is hydrogen; and
• R g is selected from the group consisting of: hydrogen, amino or di-C,. 4alkylamino, C M alkoxy, C 7 ., 2 arylalkoxy, C alkylthio, C 7 . 12 arylalkylthio, carboxamidomethyl, carboxymethyl, methoxy, methylthio, phenoxy, and phenylthio.
• the dotted lines in the 2- to 6- positions are intended to indicate the presence of single or double bonds in these positions; the relative positions of the double or single bonds being determined by whether the R 4 , R 5 and R 6 substituents are capable of keto-enol tautomerism.
• the acyl groups comprise alkanoyl or aroyl groups.
• the alkyl groups contain 1 to 8 carbon atoms, particularly 1 to 4 carbon atoms optionally substituted by one or more appropriate substituents, as described below.
• the aryl groups including the aryl moieties of such groups as aryloxy are preferably phenyl groups optionally substituted by one or more appropriate substituents, as described below.
• the above-mentioned alkenyl and alkynyl groups contain 2 to 8 carbon atoms, particularly 2 to 6 carbon atoms, e.g., ethenyl or ethynyl, optionally substituted by one or more appropriate substituents as described below.
• alkyl, alkenyl, alkynyl, and aryl groups are selected from halogen, hydroxy, C,_ 4 alkoxy, C,_ 4 alkyl, C 6 . 12 aryl, C 6.12 arylalkoxy, carboxy, cyano, nitro, sulfonamido, sulfonate, phosphate, sulfonic, amino and substituted amino wherein the amino is singly or doubly substituted by a C M alkyl, and when doubly substituted, the alkyl groups optionally being linked to form a heterocycle.
• novel pharmaceutical compositions comprising compounds of general Formula IV, which newly feature: (1) a novel dinucleotide with a sugar moiety selected from the group consisting of: arabinofuranosyl, 3'- deoxyribofuranosyl, xylofuranosyl, and lyxofuranosyl; (2) a novel dinucleotide with an azapurine base; and (3) a novel dinucleotide with a 6-substituted purine.
• a novel dinucleotide with a sugar moiety selected from the group consisting of: arabinofuranosyl, 3'- deoxyribofuranosyl, xylofuranosyl, and lyxofuranosyl
• a novel dinucleotide with an azapurine base when the sugar moiety is 3 '-deoxyribofuranosyl, Z and T are H.
• J is nitrogen and R 3 is absent.
• the 6-substituted amino purine base is excluded
• Some compounds of Formula I, II and III can be made by methods known those skilled in the art; some compounds are commercially available, for example, from Sigma Chemical Co. (St. Louis, MO 63178).
• Compounds of Formulae la UDP and its analogs
• Compounds of Formulae lb, lib and Mb UDP, ATP, CTP and their analogs
• Compounds of Formula IV can be made in accordance with known procedures described by Zamecnik, et al, Proc. Natl. Acad. Sci. USA 89, 838-42 (1981); and Ng and Orgel,
• the compounds of the present invention also encompass their non-toxic pharmaceutically acceptable salts, such as, but not limited to, an alkali metal salt such as sodium or potassium; an alkaline earth metal salt such as manganese, magnesium or calcium; or an ammonium or tetraalkyl ammonium salt, i.e., NX 4 + (wherein X is C M ).
• Pharmaceutically acceptable salts are salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects.
• the present invention also encompasses the acylated prodrugs of the compounds disclosed herein. Those skilled in the art will recognize various synthetic methodologies which may be employed to prepare non-toxic pharmaceutically acceptable salts and acylated prodrugs of the compounds.
• P2Y agonist compounds of this invention are indicated by the inositol phosphate assay for P2Y activity.
• This widely used assay as described in E. Lazarowski, et al., Brit. J. Pharm. 116, 1619-27 (1995), relies on the measurement of inositol phosphate formation as a measurement of activity of compounds activating receptors linked via G-proteins to phospholipase C
• P2Y agonist compounds of this invention are indicated by the intracellular calcium mobilization assay for P2Y activity.
• cultured cells are stimulated with the increasing concentrations of P2Y receptor agonists.
• Intracellular calcium levels are monitored by measuring the changes in fluorescence intensity of a calcium-sensitive dye using the FLIPR (Molecular Devices Corp., Sunnyvale, CA) or equivalent instrumentation.
• FLIPR Molecular Devices Corp., Sunnyvale, CA
• P2Y agonist compounds increase mucus production in in vitro preparations of esophageal, gastric mucosal, jujenum, proximal and distal colon epithelia.
• Mucus secretion can be assayed by a variety of techniques, including impression cytology, enzyme-linked immunosorbent assay (ELISA), and dot blots using mucin-specific antibodies.
• impression cytology enzyme-linked immunosorbent assay (ELISA)
• ELISA enzyme-linked immunosorbent assay
• dot blots using mucin-specific antibodies See Danjo et al, Invest. Ophthalmol Vis. Sci., 39: 2602-2609 (1988); Jumblatt et. al., Invest. Ophthalmol Vis. Sci. 40:43-49 (1999); and Jumblatt et. al, Invest.
• Isc short circuit currents
• the effectiveness of P2Y agonists for amelioration of symptoms associated with gastrointestinal disease can be shown in an animal model.
• Helicobacter pylori infection by acetic acid administration to the antral mucosa of cynomolgus monkeys is a model for chronic gastritis; the model shows histological and clinical phenotype similar to those of human gastric ulcers.
• Oral administration of P2Y receptor agonists to monkeys with gastritis shows significant recovery of staining of periodic acid- Schiff-positive substances and increases anti-mucin immunoreactivity, both of which reflect an increase in mucin secretion. Reduced histological incidents of gastric ulcerations are also an indication of the effectiveness of the P2Y receptor agonists.
• the desired compounds of the present invention may be administered orally, systemtically, intra-operatively, or rectally, in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and vehicles.
• systemic includes subcutaneous injections, intravenous, intramuscular, intrasternal injection or infusion techniques.
• the pharmaceutical formulation in this invention comprises a ligand compound and a pharmaceutically acceptable carrier.
• One or more ligand compounds may be present in association with one or more non-toxic pharmaceutically acceptable carriers or diluents or adjuvants and, if desired, other active ingredients.
• One such carrier would be sugars, where the compounds may be intimately incorporated in the matrix through glassification or simply admixed with the carrier (e.g., lactose, sucrose, trehalose, mannitol) or other acceptable excipients for oral or systemic delivery.
• the carrier e.g., lactose, sucrose, trehalose, mannitol
• the pharmaceutical composition is in a suitable form such as tablets, lozenges, aqueous or oily suspensions, viscous gels, chewable gums, dispersible powders or granules, emulsion, hard or soft capsules, syrups or elixirs.
• Compositions intended for oral use are prepared according to any method known to the art for the manufacture of pharmaceutical compositions.
• Such compositions may contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations.
• Tablets usually contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients suitable for the manufacture of tablets.
• excipients include, for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example, starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc.
• the tablets may be uncoated or they may be coated by known techniques to provide a sustained action over a longer period. For example, a time delay material such as glyceryl monosterate or glyceryl distearate may be employed.
• hard gelatin capsules are prepared by mixing the active ingredient with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin.
• Soft gelatin capsules are prepared by mixing the active ingredient with water or an oil medium, for example, peanut oil, liquid paraffin or olive oil.
• chewable gums are prepared by embedding the active ingredient in gums; the active ingredient is slowly released upon chewing. This form is suitable for treating mouth ulcers.
• an aqueous suspension is prepared by addition of water to dispersible powders and granules with a dispersing or wetting agent, suspending agent and one or more preservatives.
• Suspending agents include, for example, sodium carboxymethylcellulose, methylcellulose and sodium alginate.
• Dispersing or wetting agents include naturally-occurring phosphatides, condensation products of an allylene oxide with fatty acids, condensation products of ethylene oxide with long chain aliphatic alcohols, condensation products of ethylene oxide with partial esters from fatty acids and a hexitol, and condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anydrides.
• Preservatives include, for example, ethyl, and n-propyl p-hydroxybenzoate.
• An aqueous suspension may also contain one or more coloring agents, one or more flavoring agents, and one or more sweetening agents, such as sucrose or saccharin.
• sweetening agents such as sucrose or saccharin.
• the pharmaceutical formulation is prepared in a sterile medium.
• the active ingredient depending on the vehicle and concentration used, can either be suspended or dissolved in the vehicle.
• Adjuvants such as local anaesthetics, preservatives and buffering agents can also be dissolved in the vehicle.
• the sterile injectable preparation may be a sterile injectable solution or suspension in a non-toxic acceptable diluent or solvent.
• acceptable vehicles and solvents that may be employed are sterile water, saline solution, or Ringer's solution.
• the pharmaceutical application may also be administered in the form of suppositories for rectal administration.
• These compositions can be prepared by mixing the active ingredient with a suitable non-irritating excipient which is solid at ordinary temperatures but liquid at the rectal temperature and will therefore melt in the rectum to release the compound.
• excipients include cocoa butter and polyethylene glycols.
• Dosage levels of the order of from about 10-2000 mg of active ingredients are useful in the treatment of the above-indicated conditions. Preferred doses are about 50- 1000 mg, and more preferred doses are about 75-850 mg of active ingredients. These doses can be given several times a day as needed.
• the amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration.
• the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, and rate of excretion, drug combination and the severity of the particular disease undergoing therapy.
• P2Y, P2Y 2 , P2Y 4 , P2Y 6 and P2Y ⁇ purinergic receptors in gastrointestinal tissues was determined in vitro using RT-PCR techniques of human RNA purchased from a commercial sources.
• Human normal stomach poly A + mRNA was purchased from Clontech (Palo Alto, CA).
• First strand cDNA was synthesized (Advantage RT-for PCR kit; Clontech, Palo Alto, C A) from 1 OOng of stomach polyA + mRNA using an oligo (dT)18 primer and MMLV reverse transcriptase (60 min, 42°C).
• Invitrogen Carlsbad, CA.
• First strand cDNAs for normal human colon, liver, and small intestine were from Clontech's multiple tissue cD A panels.
• RT-PCR was performed with stomach tissues and PCR was performed with other tissues.
• P2Y 2 (accession number S74902) forward 5' AGGAGATGTGTTGGGCAGCAGTGAGGAC 3'; reverse 5' ACCAGGGTTTTCTGGCCAACCTGTGACT 3'; P2Y 4 (accession number X91852) forward 5' ATGCAACGGCCACCTACATGTTCC 3'; reverse 5' GTACTCGGCAGTCAGCTTCCAACA 3'; P2Y 6 (accession number U52464) forward 5 ' ATGGCATGGCTCTCACTGTC ATCG 3 ' ; reverse 5' TTGGTGAGCTTCTGGGTCCTGTGAG 3'; P2Y U (accession number AF030335) forward 5' ATACTGGTGGTTGAGTTCCTGG 3'; reverse 5' ACCAGGCTATACGCTCTGTAGG 3'.
• H&E-stained tissue sections were prepared to evaluate the quality and orientation of study tissues. Examination of H&E slides indicated that all tissues were suitable for ISH.
• a PCR product containing nucleotides 253-651 from a human P2Y 2 -R cDNA was obtained from a sponsor.
• P2Y,-R nucleotides 272-627 were reamplified with P2Y 2 primers (forward primer sequence:
• the resulting PCR products were used to synthesize digoxigenin-labeled riboprobes by in vitro transcription (IVT).
• IVT in vitro transcription
• Antisense and sense riboprobes were synthesized using T7 and T3 RNA polymerases, respectively, in the presence of digoxigenin-11-UTP (Roche Molecular) using a MEGAscript IVT kit (Ambion) according to the manufacturer. Following IVT, template DNA was degraded with DNase-1, and unincorporated digoxigenin was removed by ultrafiltration.
• Hybridization was visualized by immunohistochemistry using alkaline phosphatase- conjugated anti-digoxigenin Fab and nitroblue tetrazolium chloride-bromochloroindolyl phosphate (Roche Molecular) according to the manufacturer. Tissue sections were counter stained with nuclear fast red. Negative controls included stomach and esophagus tissues stained with the sense P2Y 2 -R probe.
• P2Y 2 receptor gene expression in gastrointestinal epithelium including both secretory and absorptive cell types, supports a role for P2 Y 2 receptors in gastrointestinal mucosal physiology, and as a target for the treatment of gatrointestinal diseases in which enhanced mucus secretion and/or fluid secretion are therapeutic.
• Example 3 Measurement of intracellular calcium mobilization in cultured epithelial cells from the gastrointestinal tract.
• a conventional technique is used to detect intracellular calcium mobilization induced by P2Y receptor agonists.
• the technique is familiar to those well versed in the art.
• Cells are seeded in 96-well plates and used for calcium mobilization assays.
• the growth medium is aspirated and replaced with a solution of Fluo-3 AM (2.5 ⁇ M final concentration) in an assay buffer consisting of (mM): KCl (10.0), NaCl (118), CaCl 2 (2.5), MgCl 2 (1.0), HEPES (20), glucose (10), pH 7.4.
• Probenecid Sigma Chemical Co.
• T84 cells a human colonic epithelial cell line
• P2Y receptor agonists ATP and UTP are stimulate calcium mobilization in these cells, consistent with activation of the P2Y 2 receptors ( Figure 5).
• 2-methylthioADP a P2Y, receptor-selective agonist
• human colonic HT-29 cells exhibit a robust P2Y response to ATP and UTP, consistent with P2Y 2 receptor activation ( Figure 6).
• Example 4 Measurement of gastrointestinal epithelial mucus production, bicarbonate secretion, and short circuit current in epithelial cultures and explants.
• Bicarbonate secretion is measured by monitoring pH using a pH-stat system. Changes in these parameters that are consistent with chloride ion secretion, bicarbonate secretion, or alteration of the transmembrane flux of other ions indicate that P2 Y receptor agonists modify secretion, absorption, and/or mucosal hydration in the gastrointestinal tract.
• Mucus production by goblet cells residing in epithelial glands is assayed by a variety of techniques familiar to those well versed in the art.
• Native explant and cultured monolayers of esophageal and gastric mucosal epithelia are assayed for mucin production by impression cytology, which consists of exposing fixed surface area of epithelium with polyvinylidene difluoreide (PVDF) membrane and staining PVDF membrane with periodic-acid and SchifF s (PAS) reagent.
• PVDF polyvinylidene difluoreide
• PAS periodic-acid and SchifF s
• agonists of P2Y 2 and P2Y 4 perinoceptors are shown to decrease PAS staining, which is consistent with an increase mucus secretion.
• P2Y purinoceptor-induced increases in mucus secretion are verified by enzyme-linked immunosorbent assay (ELISA), and immunoblots using mucin-specific antibodies. Positive results indicate robust, prolonged, and significant increases in mucus production when purinoceptor agonists following administered to luminal surface of epithelial preparation. Mucin production can be repeatedly increased by repetitive stimulation with purinoceptor agonists.
• Example 5 Purinoceptor agonists for amelioration of symptoms associated with ulcerative colitis.
• Helicobacter pylori infection by acetic acid administration to the antral mucosa of cynomolgus monkeys is a model for chronic gastritis, and shows histological and clinical phenotype similar to those of human gastric ulcers.
• Oral administration of P2Y receptor agonists to monkeys with gastritis shows significant recovery of staining of periodic acid- Schiff-positive substances and increases in anti-mucin immunoreactivity, both of which reflect an increase in mucin secretion. Reduced histological incidents of gastric ulcerations are also an indication of the effectiveness of the P2Y receptor agonists.
• a human subject, suffering from ulcerative colitis or chronic gastritis, is treated by a method in the present invention.
• the patient is given an endoscopy, followed with a biopsy of the gastric mucosa. Ulcerative colitis is diagnosed following confirmation of mucosal inflammation and erosion of the gastric mucosal layer.
• the present invention treats the patient by an oral administration of a suitable formulation of the P2Y-receptor agonist, which coats the esophageal and gastric mucosal layer and stimulates mucous production under the gastric mucosa.
• the composition is administered as a slow-release oral form, preferable in the form of chewing gum or lozenges, and is administered multiple times during the day as needed.
• Disease activity is monitored on the basis of the Clinical Activity Index, Endoscopic Index, Histological Index, and Global Efficacy Assessments by the clinical investigator. Improvements in one or more of these parameters indicate that P2Y agonists ameliorate the symptoms of ulcerative colitis.
• Example 6 Purinoceptor agonists for altering fluid absorption by the small intestine and distal colon and for amelioration of symptoms associated with diarrhea or constipation.
• a human subject, suffering from either constipation of diarrhea is treated by methods in the present invention as follows.
• the patient presenting either diarrhea or constipatory symptoms is given an oral formulation of compound, said compound formulated as tablet that can discharge the active compound in an amount therapeutically and specifically into the small intestine (for constipation) or large intestine (for diarrhea).
• the activate compound specifically agonizes P2Y receptors in respective tissue and promotes fluid secretion in small intestine and fluid absorption in large intestine.
• 48 hour stool output, measured in grams, and the duration of diarrhea or constipation, as assessed by patient questionnaire and/or clinical observation, are determined following treatment. Positive results indicate that P2Y agonists are effective in the treatment of diarrhea and/or constipation.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Pharmacology & Pharmacy (AREA)
• Veterinary Medicine (AREA)
• Chemical & Material Sciences (AREA)
• Public Health (AREA)
• General Health & Medical Sciences (AREA)
• Medicinal Chemistry (AREA)
• Animal Behavior & Ethology (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Organic Chemistry (AREA)
• Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Epidemiology (AREA)
• Molecular Biology (AREA)
• Oncology (AREA)
• Communicable Diseases (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicinal Preparation (AREA)
• Saccharide Compounds (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=22624842

Family Applications (1)

Country Status (9)

Families Citing this family (14)

Family Cites Families (4)

• 2000
  • 2000-12-22 KR KR1020027007963A patent/KR20020069218A/ko not_active Application Discontinuation
  • 2000-12-22 CN CN00817607A patent/CN1413113A/zh active Pending
  • 2000-12-22 AU AU26031/01A patent/AU2603101A/en not_active Abandoned
  • 2000-12-22 MX MXPA02005161A patent/MXPA02005161A/es unknown
  • 2000-12-22 EP EP00989533A patent/EP1261323A2/en not_active Withdrawn
  • 2000-12-22 CA CA002395108A patent/CA2395108A1/en not_active Abandoned
  • 2000-12-22 WO PCT/US2000/035439 patent/WO2001045691A2/en not_active Application Discontinuation
  • 2000-12-22 JP JP2001546630A patent/JP2003524636A/ja active Pending
  • 2000-12-22 BR BR0016021-0A patent/BR0016021A/pt not_active Application Discontinuation

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events