Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
  • C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
  • C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
  • C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
  • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/11—Antisense
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/31—Chemical structure of the backbone
  • C12N2310/315—Phosphorothioates
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2320/00—Applications; Uses
  • C12N2320/10—Applications; Uses in screening processes
  • C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids

Definitions

• the present invention relates generally to the field of antisense gene therapy and methods for identifying therapeutic oligonucleotides for selected regulation of pathogenic processes associated with specific genetic disorders.
• the invention further relates to methods for identifying and creating oligonucleotides for the general control of gene expression, whether or not the gene is involved in a known genetic disorder.
• the field of gene therapy involves techniques that attempt to treat a variety of disorders that are associated with genetic deficiencies or defects.
• Several treatments have been proposed that attempt to remedy a disease by introducing a replacement gene in the hope that the gene will be incorporated into the genome of the patient and become self-replicating.
• Another type of gene therapy treatment takes the form of treating the patient with a regulatory molecule, such as an antisense DNA oligonucleotide (ODN) molecule that binds to messenger RNA (mRNA) with the subsequent inhibition or control of translation and, hence, control of the production of a protein product.
• ODN antisense DNA oligonucleotide
• mRNA messenger RNA
• PKC protein kinase C
• the protein kinase C (PKC) family of proteins plays an important role in controlling proliferation, transformation, gene expression, and differentiation of a wide range of cell types. PKC proteins are central in mediating the signal transduction response to hormones and growth factors.
• Activation of PKC is also known to induce angiogenesis, migration, and proliferation of endothelial cells (EC), but can also prevent growth factor-induced EC proliferation.
• the protein kinase C family transduces a number of signals from lipid metabolism. Signals that stimulate members of the large families of protein- coupled receptors, tyrosine kinase receptors, or non-receptor tyrosine kinases can cause diacylglycerol (DAG) production to regulate PKC, either rapidly by activation of specific phospholipase C enzymes or more slowly by activation of phospholipase D to yield phosphatidic acid and then diacylglycerol.
• DAG diacylglycerol
• PKC fatty acid generation by phospholipase A2 activation modulates PKC activity.
• multiple receptor pathways feed multiple lipid pathways that have the common end result of activating protein kinase C.
• PtdSer phosphatidylserine
• Ca ⁇ Ca ⁇ for optimal activity.
• PKC Upon activation, PKC translocates to different subcellular sites where it phosphorylates numerous proteins, most of which are unidentified [3-12]. Different PKC isoforms are listed in Table 1.
• Carbonic Anhvdrase Carbonic anhydrases in general are enzymes important to the management of CO 2 . About 11% of the blood's CO 2 is transported by hemoglobin. Most of the CO 2 enters the erythrocytes (red blood cells) and dissolves in the cytoplasm (cellular fluid). It then combines with water molecules to form carbonic acid, which immediately disassociates into hydrogen ions and bicarbonate. This reaction is sped up by carbonic anhydrase, which is located in the erythrocytes. Most of the CO 2 is converted into bicarbonate as soon as it enters a red blood cell, thus keeping the red blood cell CO 2 level lower than that of the interstitial fluid. This is important since the concentration gradient between the interstitial fluid and the surrounding tissue increases the diffusion efficiency of CO 2 , thereby allowing it to be removed quickly from tissues.
• the total effect is to maintain a CO 2 gradient steep enough to quickly drive the gas into the alveolar air space of the lungs for exhalation from the body [13-16].
• Raf which is a member of the Raf-Mos ser/thr kinase subfamily of the Src super family, plays a role in gene regulation.
• Two other members of Raf family are A-Raf (RafAl) and B-Raf (RafBl).
• C-Raf is expressed in most human tissue.
• A-Raf is expressed predominantly in urogenital tissues and B-Raf is expressed primarily in cerebrum and testes.
• Raf is activated by Ras and activated Raf is translocated to the perinuclear region and the nucleus.
• Raf activates MAP kinase kinase (MAPKK), which in turn stimulates the MAP kinases Erkl and Erk2, resulting in activation of Fos and Jun to control transcription of DNA genes.
• MAPKK MAP kinase kinase
• These biochemical pathways associated with C-Raf expression have been associated with stomach cancer, laryngeal, lung and other carcinomas and sarcomas. Mechanisms to control the expression of C-Raf may provide a viable treatment method for these and other pathologies [17-20].
• Mvc The Myc oncoprotein also is involved in gene regulation. Myc is a member of the helix-loop-helix/leucine zipper superfamily.
• the c-Myc protein contains two regions that are characteristic of transcription factors: an amino- terminal transactivation domain, and a carboxy-terminal basic helix-loop-helix leucine zipper motif (bHLHLZ) known to mediate dimerization and sequence- specific DNA binding.
• the most widely studied of the Myc proteins, c-Myc was first discovered through its homology with the transforming gene (v-Myc) of the avian myelocytomatosis virus MC29.
• v-Myc transforming gene
• N-Myc and L- Myc Two other Myc proteins, were discovered later through their homology with v-Myc in the amplified sequences of neuroblastoma cells, and a small cell lung tumor, respectively. Deregulation of Myc expression correlates with the occurrence of many types of human tumors, particularly small cell lung carcinoma, breast and cervical carcinomas [21-26].
• Cyclin D 1 Another factor affecting gene expression is Cyclin D 1 , a member of the Gl cyclins. Cyclin Dl regulates the progression of mammalian cells through the Gl phase of the cell cycle. In the Gl (resting) phase of the cell cycle, cyclin Dl together with its cyclin dependent kinase (cdk) partner, is responsible for transition to the S phase (DNA synthesis phase) of the cell cycle by phosphorylating a tumor suppressor gene product (pRb), that results in the release of transcription factors important in the initiation of DNA replication. Amplification of the cyclin Dl gene or overexpression of the cyclin Dl protein releases a cell from its normal controls, and causes transformation of a cell into a malignant phenotype. Analysis of these changes provides important diagnostic information in mantle cell (and related) lymphomas and allows an early detection of many cancers [27-32].
• cdk cyclin dependent kinase
• IGF-I and IGF-II are mediated by their activation of the IGF-IR, a transmembrane tyrosine kinase linked to the ras-raf-MAPKK cascade. Functional IGF-IRs are required for the cell to progress through the cell cycle. Most importantly, cells lacking this receptor cannot be transformed by any of a number of dominant oncogenes, a finding that proves that the presence of the IGF- IR is important for the development of a malignant phenotype. Consistent with this role, the IGF-IR displays a potent anti-apoptotic effect, both in vitro and in vivo.
• IGF-IR is a very attractive therapeutic target, since targeting of the IGF-IR can both decrease the growth rate of transplantable tumors and cause massive apoptosis, and, in some cases, can result in complete inhibition of tumorigenesis [33, 34].
• Myjb The transcription factor c-Myb is involved in the regulation of many different genes.
• the c-myb gene is the cellular homologue of the v-myb oncogenes carried by the avian leukemia viruses AMV and E26. As does each of the viral oncogenes products, the c-Myb transcription factor recognizes the core DNA sequence C/T-A-A-C-G/T-G via a repeated helix-turn-helix-like motif.
• C-Myb is expressed in immature haemopoietic cells, as well as in immature cells of the gastro-intestinal epithelium, and is down regulated during differentiation. Enforced expression of activated or even normal forms of Myb can transform haemopoietic cells, most often of the myeloid lineage, in vitro and in vivo. Although many genes have been identified which are likely to be regulated by c-Myb, the critical target genes involved in its transforming activity are not known. Amplification of Myb gene has been detected in acute myeloblastic leukemia, chronic myelogenous leukemia, acute lymphoblastic leukemia, T cell leukemia, colon carcinomas) and melanomas [35 -39].
• Bcl-2 Gene regulation also involves the Bcl-2 protein, discovered in association with follicular lymphoma.
• Bcl-2 plays a prominent role in inhibiting apoptosis and enhancing cell survival in response to diverse apoptotic stimuli.
• Apoptosis normally eliminates cells with damaged DNA or an aberrant cell cycle, which are the cells most likely to become a neoplastic clone.
• Bcl-2 is tumorigenic.
• genetic and biochemical evidence suggests that Bcl-2 may function by inhibiting the activation of proteases that eventually lead to cell death.
• Activation of the Bcl-2 gene by chromosomal translocation is a common abnormality in human lymphoid neoplasms [40-45].
• the Brome Mosaic Virus is a multiparticle plant RNA Virus that has a well-characterized, segmented mRNA genome useful in the research of antisense regulation of translation.
• the segmented genome of BMV is composed of four single positive strand RNA chains called RNAl, RNA2, RNA3, and RNA4. All four RNAs are active in vitro messengers that stimulate synthesis of the polypeptides designated as 1 (1 10 kDa),. 2 (105 kDa), 3 (35 kDa), and 4 (20 kDa).
• Polypeptide 4 (the coat protein) is encoded on both RNA3 and RNA4.
• RNAs 1 and 2 are separately encapsulated in viral particles, while RNA3 is encapsulated with a single copy of its subgenomic mRNA, RNA4.
• the sequences of BMV RNAl, RNA2, and RNA3 share little or no homology except for 200 nucleotides in the 3 ' non-coding region common to each molecule and short homologues at the 5' ends.
• the smallest BMV genomic RNA, RNA3, contains coding regions for the coat protein gene and another gene (3 a) that encodes a host specificity protein, separated by a 250-base intercistronic coding region.
• BMV mRNAs are well characterized and useful for the study of antisense inhibition of translation in vitro [46-50].
• the present invention provides a method whereby subsequences of mRNA molecules that are optimal targets for hybridization with antisense molecules can be identified by analysis of nearest- neighbor compositions of all possible subsequence targets and by consideration of the secondary structures of the subsequence targets and antisense molecules.
• the invention provides a method for providing a library of specific mRNA subtargets capable of functioning as effective targets for antisense ODNs.
• the method comprises a series of steps of identifying optimal subsequences of an mRNA target and constructing complementary oligonucleotides therefrom.
• This library of mRNA subtargets and complementary ODNs may be designated as an Optimal AntiSense Identified Sequence library, or OASIS library. The following steps would be followed to create same: ⁇ 1 ⁇ collecting mRNA sequences from genes expressed by human cells; ⁇ 2 ⁇ determining the nearest-neighbor nucleotide compositions of subsequence targets within each target mRNA sequence; ⁇ 3 ⁇ determining the hybridization efficiency for each of the mRNA subtarget sequences; and ⁇ 4 ⁇ ranking t he subsequence targets according to hybridization efficiency.
• This ranking may occur by, for example, determining the free energies of interaction with antisense molecules or by the melting temperatures of hybrids formed with antisense molecules. This procedure may be accomplished, by way of example, through the use of a computer program such as the NNTSA computer program as described in United States Patent No. 5,856,103.
• the method may include a step ⁇ 5 ⁇ of eliminating antisense molecule sequences that have competing structures. One method of doing same may be through eliminating antisense sequences that have more than four (4) contiguous G bases.
• Oligo Toolkit ® can be used to analyze the self-hybridization of selected antisense molecules so as to eliminate oligonucleotide sequences having a high percentage of complementary bases.
• An additional step ⁇ 6 ⁇ that may be included in some embodiments of the invention is deleting subsequence target sequences that have competing structures, selecting 10-20 subsequence targets that are highest in hybridization potential, and testing the selected 10-20 subsequence targets for inhibition or other control of mRNA expression of each mRNA sequence. There may be more than one subsequence target that is equally efficient for control of a given mRNA sequence.
• a collection of optimal subsequence targets within mRNA sequences chosen by steps ⁇ 1-6 ⁇ and called the Optimal AntiSense Identified Sequences or OASIS library may also be compiled from cDNA ("copy DNA") sequences obtained from the GenBank database. These sequences are given as sense strand sequences, which are the same as mRNA sequences (with T substituted for U).
• Genetic control can be exercised at the level of mRNA transcripts by antisense reagents or at the level of the duplex DNA gene by antigene reagents. Regulation can be by transient inhibition of mRNA translation into protein, by inhibition of mRNA splicing, and by inhibition of DNA transcription into RNA. More permanent means may also be used involving long-term gene therapy employing homologous recombination. In the case of control at the level of the DNA gene, antigen reagents are used.
• Steps of the procedure for identification of each optimal subsequence target within DNA genomic sequences and constructing the second desired library, called Optimal Antigen Identified Sequence library, or OAGIS library include: ⁇ 1 ⁇ collecting sequences for genes from the public Embank sequence database (where each gene sequence corresponds to an expressed human gene sequence plus its control sequences), ⁇ 2 ⁇ determining the nearest-neighbor base pair compositions of all possible subsequence targets within each target genomic DNA sequence including its control sequences, ⁇ 3 ⁇ calculating the hybridization efficiencies for the subsequence targets, and ⁇ 4 ⁇ ranking the subsequence targets according to hybridization efficiency, such as by free energies of interaction with antigene molecules or melting temperatures of triple-stranded nucleic acids formed with antigene molecules.
• a computer program such as the NNTSA computer program as described in United States Patent No. 5,856,103 may be used to accomplish such ranking.
• the method may include a step ⁇ 5 ⁇ of eliminating antigene molecule sequences that have competing structures.
• One method of doing same may be through eliminating antigene sequences that have more than four (4) contiguous G bases.
• Oligo Toolkit ® can be used to analyze the self-hybridization of selected antigene molecules so as to eliminate oligonucleotide sequences having a high percentage of complementary bases.
• An additional step ⁇ 6 ⁇ that may be included in some embodiments of the invention is deleting subsequence target sequences that have competing structures, selecting 10-20 subsequence targets that are highest in hybridization potential, and testing the selected 10-20 subsequence targets for inhibition or other control of DNA expression of each genomic DNA sequence.
• Optimal AntiGene Identified Sequences may also be compiled from gene sequences obtained from the GenBank database where each sequence is subjected to the specified steps for subsequence target selection.
• the OASIS and OAGIS libraries identify optimum sites for regulation of genes that may be involved in specific disease processes such as oncogene involvement in cancer. Regulation of one or more of such genes could serve as a therapeutic treatment of the respective disease.
• Additional commercial utility as a result of regulation of genes at the OASIS and OAGIS libraries of sites could a Pply to, but is not limited to, agriculture, chemical, and veterinary fields.
• the above steps can be applied to all gene sequences, whether of human or other origin.
• cDNA sequences specified in the present invention were obtained from the public sequence database GenBank. These sequences are given as sense strand sequences, which are the same as mRNA sequences (with T substituted for
• subtarget sequences each 20 nucleotides long
• Tm melting temperature
• - G° large negative free energy
• Ten to twenty subtarget mRNA sequences (each 20 nucleotides long) in each human gene mRNA target sequence were selected as having the greatest hybridization potential for antisense DNAs. For tests of PKCo.
• the secondary structures of subtarget sequences in the context of 100 or more neighboring nucleotides in the most stable mRNA were typically analyzed with the mfold ® RNA structure program (version 2.52), as noted in table footnotes. All mRNA subtargets that were analyzed were devoid of secondary structures containing more than ten consecutive base pairs without being interrupted by at least one bulge, loop, or unpaired nucleotide region.
• the invention provides for a method for selecting optimal subsequence antisense targets capable of inhibiting mRNA expression of a target mRNA sequence.
• the invention in yet another embodiment provides for preparing a set of antisense molecular reagents that will bind these targets and thus inhibit mRNA expression.
• Another aspect of the invention provides for a method of selecting optimal subsequence antigene targets for inhibition or other control of DNA expression of genomic DNA sequences.
• this method comprises the step of collecting DNA sequences of genes of interest expressed by a cell, where each gene sequence corresponds to an expressed gene sequence plus its control sequences, determining the nearet-neighbor nucleotide compositions of subsequence targets within each target mRNA sequence, determining the hybridization efficiency for each DNA subsequence with a triplex-forming antigene molecule according to its TM (°C) or G ° (kcal/mol at 37° C) value; selecting a set of subsequences that are optimal target sequences; preparing a set of antigene sequences specific for said target sequences; and selecting from said set of antigene sequences having mRNA, protein, or cell growth inhibition efficiencies of about 50% or more as the optimal subsequence antigene targets.
• antigene sequences containing containing repeating G sequences or a G cluster should be eliminated. Further, antigene molecules having a percentage of self-complementary bases greater than 40 percent should be eliminated.
• mRNA subsequence targets of a human gene molecule by way of example, the c-Myc, c-Myb, Bcl-2, c-Raf, Cyclin Dl, IGF-IR, PKCo; and CA 12 gene.
• the invention in yet another aspect provides for a library of antisense reagents having specific binding affinity for the subsequence antisense targets identified herein as another aspect of the invention.
• the invention may provide for an effective antisense reagent capable of inhibiting any individually identified human genomic DNA sequence of a human gene.
• Fig. 1 Plot of - G° versus PKC ⁇ mRNA subtarget position. Numbers show the location of the first base in a 20-mer selected subtarget.
• Fig. 2 Dose response curve of cell growth inhibition for PKC ⁇ ODN
• FIG. 3 Western blot of antisense inhibition of PKC ⁇ protein synthesis.
• Fig. 4 Western blot of antisense inhibition of PKC ⁇ protein synthesis that include selected antisense oligos.
• Fig. 6 Correlation between PKC ⁇ protein inhibition and cell growth inhibition.
• Fig. 7 Correlation of calculated Tm and inhibition of C-Raf protein synthesis.
• Fig. 8 Autoradiograph of 12.5% SDS-polyacrylamide gel of proteins synthesized in vitro from BMV mRNA. F Fiigg.. 9 9 -- Dose response curve of S-ODN #89.
• Fig. 10 Dose response curve of S-ODN #140.
• Fig. 11 Dose response curve of S-ODN #241.
• Fig. 12 Plot of Tm versus percentage inhibition of BNW mRNA #3.
• the present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via inhibition of protein kinase C ⁇ expression, to control unwanted hormone and growth-factor- induced cell growth as might occur in cancers.
• An analysis was carried out on the PKC ⁇ mRNA sequence, to obtain the hybridization stabilities of antisense molecules of 20 nucleotides each, starting at each sequence position from 1 through 2225 of the mRNA.
• Figure 1 shows the relative variation in G° (kcal/mol at 37°C) for each hybridization position in the mRNA.
• Target sites marked No. 89, No. 288, and No. 898 were among those of highest affinity for antisense oligomers according to the NNTSA program. Such sites revealed by the method of this invention are typically clustered as shown in Figure 1.
• Table 2 lists 11 optimal target sequences selected by the steps of the invention.
• Table 2 Selected 11 subtarget antisense sites for PKC ⁇ from NNTSA analysis, ranked by Tm
• RNA targets were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.
• Antisense oligodeoxynucleotides 20 nucleotides long containing phosphorothioate-modified backbones were purchased from two commercial companies (Midland Certified Reagent Company or Oligos Etc., Inc). These modified DNA oligomers can have either of two phosphate bonding positions occupied by sulfur at each of 19 backbone positions linking the 20 base- sugar nucleosides in a 20-mer. Such oligomers are therefore of mixed backbone chirality.
• S-ODNs were used because they have a well-known nuclease resistance while maintaining the ability to pair with mRNA and activate the RNaseH needed to cleave the target mRNA and thus disrupt translation and protein expression.
• S-ODN sequences were used to inhibit cell growth rate and translation of the PKC ⁇ protein in A549 human lung carcinoma cells. Specifically, 20-mer antisense oligomers that were complementary to the high affinity sites 89, 288, and 899 were tested. S-ODNs starting at positions 21, 22, 25, 2044, 2100, and 2192 were used as additional test sequences. These included sequences 21, 22, 2044, and 2192 that had been recognized as effective PKC ⁇ inhibitors in published work [3, 51-53].
• A549 cells were grown to 70-80% confluence and treated with S-ODN at a concentration of 1 ⁇ M in the presence of cationic lipid (Lipofectin). After 4 hr of treatment and 20 hr of recovery, cells were lysed by sonication and the amount of proteins in cell lysates was determined with a protein colorimetric assay. Equal amounts (30 ⁇ g) of total cell lysates were electrophoresesed on 8% sodium dodecyl sulfate (SDS) polyacrylamide gels.
• SDS sodium dodecyl sulfate
• Proteins were transferred to membranes by electroblottmg, the membranes were blocked and treated overnight with specific primary antibodies, one to C-Raf and, generally, one to actin as an internal control to correct for loading of different amounts in different gel lanes. Following this, the membrances were incubated with secondary antibodies conjugated to alkaline phosphatases. Antibody-specific protein bands could then be detected by an enhanced chemifluorescence detection reagent, visualized by a STORM ® phosphorimager scanner, and quantified by NIH ImageQuant 1.61.
• Tm (°C) or G°(37) (kcal/mol at 36 °C)
• Table 3 The sequence position, percentage inhibition, and predicted rank of inhibitory efficiency as Tm (°C) or G°(37) (kcal/mol at 36 °C) are shown in Table 3.
• Examples of the Western blots that were digitized to obtain these data are shown in Figures 3 and 4.
• the first three selected oligomers in Table 3 were predicted to have, and experimentally were shown to have, the highest or among the highest, percent inhibition of PKC ⁇ protein expression by Western blotting.
• Figure 5 shows the correlation between the Tm values and protein inhibition.
• United States Patent No. 5,703,054 [51] concerns antisense ODNs targeted to positions 22, 2044, and 2192 (SEQ ID Nos. 2, 3, and 5, which are identical to SEQ ID Nos. 18, 20, and 24 of the present application).
• United States Patent No. 5,885,970 [52] is for antisense ODNs targeted to specific sequences in each of the protein kinase isoforms; 20 sequences (SEQ ID Nos. 1 to 20 of Patent No. 5,885,970) are targeted to the PKC ⁇ isoform and are largely restricted to the 5' region (and AUG start codon), to the 3' region (and UGA stop codon), and to the beginning of the coding region.
• the present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via control of c-Raf protein expression, in treating stomach cancer, laryngeal cancer, lung cancer, and other carcinomas and sarcomas.
• Ten optimal sites on the C-Raf mRNA for hybridization of antisense ODNs are shown in Table 4.
• RNA targets except position 1395 were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.
• S-ODNs oligonucleotides with phosphorothioate backbone linkages to make them resistant to nucleases
• S-ODNs Three of the selected sequences from Table 4 (targeted to positions 2098, 1474 and 85) were tested along with seven additional sequences that were not predicted to have a high antisense inhibitory rank.
• the sequence targeted to position 2484 was chosen because it had previously been chosen as the most effective sequence in published work [18, 19]. All ten sequences are listed in Table 5 along with their rank according to both Tm (°C) and - G° (kcal/mol at 37°C) values.
• A549 cells were grown until 50 to 60% confluent and treated with the S- ODNs at a concentration of l ⁇ M in the presence of cationic lipid (Lipofectin). After 36 hr of treatment, cells were lysed in 1% sodium dodecyl sulfate (SDS) lysis buffer, and the arnbunt of proteins in cell lysates was determined with a protein colorimetric assay. Equal amounts (40 ⁇ g) of total cell lysates were electrophoresesed on 5-15% gradient SDS polyacrylamide gels.
• SDS sodium dodecyl sulfate
• Proteins were transferred to membranes by electroblottmg, the membranes were blocked and treated overnight with specific primary antibodies, one to C-Raf and one to actin as an internal control to correct for loading of different amounts in different gel lanes. Following this, the membranes were incubated with secondary antibodies conjugated to alkaline phosphatases. Antibody-specific protein bands could then be detected by an enhanced chernifluorescence detection reagent, visualized by a STORM ® phosphorimager scanner, and quantified by NIH ImageQuant 1.61.
• S-ODN#2482 is identical to the SEQ ID No: 1 of United States Patent No. 5,656,612 [54].
• the present invention also differs from the inventions of United States Patent Nos. 5,744,362 and 5,654,284, which relate to specific types of ODN modifications in which the phosphorothioate linkages are of one chirality or in which the sugar contains a methoxyethoxy modification [55, 56].
• All of the S- ODNs used in the present examples 1, 2, and 3 are from commercial sources (Midland Certified Reagent Company or Oligos Etc., Inc) and contain backbone sulfur substitutions of mixed chirality.
• the present invention relates to the selection of subtarget sequences of high inhibition potential for S-ODNs of mixed chirality.
• the subtarget sequences chosen by this invention may also have utility for other types of ODN modifications.
• the in vitro translation mixture included rabbit reticulocyte lysate, 2.25, nM BMV mRNA, and 0.5 unit RNaseH. To this mixture was added 35 S- methionine and antisense oligomer (0-1500nM). The RNaseH cleaves the RNA of any hybrids formed between the mRNA target site and the added antisense phosphorothioate DNA oligonucleotide (S-ODN), which stops the production of protein from that target mRNA. The mixture was incubated at 30 °C for 30 minutes.
• S-ODN antisense phosphorothioate DNA oligonucleotide
• the antisense inhibition of BMV RNA involved nine antisense phosphorothioate-modified S-ODNs, which were targeted to the 35 kDa protein coding sequence on BMV mRNA3.
• Six of the S-ODNs were 20-mers and are listed in the first six rows of Table 6.
• Three additional oligomers were shorter versions of S-ODN#89 and are listed together with S-ODN#89 in the last four rows of Table 6.
• the percentage specific in vitro translation inhibition data of the 35 kDa protein encoded on BMV mRNA #3 is shown in Table 6 for all nine oligomers. They inhibited the 35 kDa protein in a specific manner, with no effect on the 20 kDa protein from RNA3, as shown for S-ODN#89 in the example in Figure 8.
• Dose response curves for inhibition of the 35 kDa protein by S-ODNs #89, #140, and #241 are shown in Figures 9, 10, and 11, respectively.
• the % inhibition for the six 20-mer S-ODNs at 500 nM concentration ranged from 17.8 to 99.4% (Table 6). These 20-mer phosphorothioate oligomers demonstrated a general correlation between % inhibition and predicted ranking by our selection procedure. The correlation between Tm and percentage inhibition of BMV mRNA #3 at 500nM S-ODN concentration is shown in Figure
• the method of this application for selecting the best subtarget sequences for antisense inhibition provides for selecting effective sequences for in vitro translation inhibition.
• the S-ODN#89 subtarget sequence included the starting AUG codon.
• a further set of S-ODNs of varying length which were targeted to the AUG containing region were studied. They demonstrated a good correlation between % inhibition and Tm calculated for different oligomer length according to the length-dependent option of the NNTSA program. These results are in the last four rows of Table 6.
• the method of this application for selecting antisense sequences is not restricted to oligomers that are 20 nucleotides in length.
• Table 6 BMV mRNA#3 sequence position and inhibition by phosphorothioate antisense DNA sequences in an in vitro translation system
• % inhibition is of the protein band at 500nM, oligomer concentration, relative to the inhibition of the 20 kDa protein band.
• the present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful in testing for an overexpression of this isozyme in lung cancers.
• Ten optimal sites for ODN hybridization on the carbonic anhydrase isozyme CA12 mRNA are shown in Table 7.
• RNA targets were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.
• Example 5 Selection of Optimal Sites for Inhibition of c-Myc Oncoprotein Gene mRNA
• the present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via deregulation of c-Myc protein expression, in treating many types of human tumors, particularly small cell lung carcinoma, breast, and cervical carcinomas. Twelve optimal sites for ODN hybridization on the Myc-mRNA are shown in Table 8.
• Table 8 Selected 12 subtarget antisense sites for c-Myc from NNTSA analysis, ranked by Tm
• RNA targets except positions 965 and 1048 were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.
• the present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via regulation of
• Cyclin Dl gene expression in the diagnosis of mantle cell lymphoma and related cancers.
• Ten optimal sites for ODN hybridization on the Cyclin D 1-mRNA are shown in Table 9.
• Table 9 Selected 10 subtarget antisense sites for Cyclin Dl from NNTSA analysis, ranked by Tm
• RNA targets 755 70.66 50.55 ggcagcggggagcgtggtgg (SEQ ID NO: 104) *Secondary structures of RNA targets were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.
• IGF-IR IGF-IR Receptor
• the present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via regulation of IGF- IR activation, in providing a therapeutic target for various cancer treatments.
• the key element in the attractiveness of IGF-IR as a therapeutic target is that the anti- apopotic effect of IGF-IR, which can result in a malignant phenotype, could be contradicted by antisense ODNs to these targets and cause apoptosis or complete inhibition of tumorigenesis.
• Ten optimal sites for ODN hybridization on the IGF- IR-mRNA are shown in Table 10.
• Table 10 Selected 10 subtarget antisense sites for IGF-IR from NNTSA analysis, ranked.by Tm
• RNA targets were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.
• the present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via regulation of the expression of the transcription factor c-Myb, in treating myoblastic leukemia, chronic myelogenous leukemia, acute lymphoblastic leukemia, T cell leukemia, colon carcinomas, and melanomas.
• Ten optimal sites for ODN hybridization on the c-Myb-mRNA are shown in Table 11.
• Table 11 Selected 10 subtarget antisense sites for c-Myb from NNTSA analysis, ranked by Tm
• RNA targets except position 341 were all studied and were interrupted by at least one bulge, loop, or unpaired nucleotide region.
• Example 9 Selection of Optimal Sites for Inhibition of Bcl-2 Gene mRNA
• the present example is provided to demonstrate the use of the present invention for the selection of nucleic acid sequences useful, via controlling expression of the Bcl-2 protein, in the diagnosis of human lymphoid neoplasms. Twenty optimal sites for ODN hybridization on the Bcl-2 mRNA are shown in Table 12.
• Table 12 Selected 20 subtarget antisense sites for Bcl-2 from NNTSA analysis, ranked by Tm
• Kornmann M, Arber N, Korc M (1998) Inhibition of basal and mitogen- stimulated pancreatic cancer growth by cyclin Dl antisense is associated with loss of tumorigenicity andpotentiation of cytotoxicity to cisplatinum.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Genetics & Genomics (AREA)
• Biomedical Technology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Wood Science & Technology (AREA)
• Organic Chemistry (AREA)
• Chemical & Material Sciences (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• Zoology (AREA)
• Molecular Biology (AREA)
• Microbiology (AREA)
• Plant Pathology (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Physics & Mathematics (AREA)
• Virology (AREA)
• Oncology (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Saccharide Compounds (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=24007191

Family Applications (1)

Country Status (4)

Families Citing this family (10)

Family Cites Families (3)

• 2001
  • 2001-02-14 WO PCT/US2001/004732 patent/WO2001061030A2/en not_active Application Discontinuation
  • 2001-02-14 AU AU2001235019A patent/AU2001235019A1/en not_active Abandoned
  • 2001-02-14 EP EP01907219A patent/EP1257665A2/de not_active Withdrawn
  • 2001-02-14 CA CA002400028A patent/CA2400028A1/en not_active Abandoned

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events