CA2148687A1 - Antisense oligonucleotides to inhibit expression of mutated and wild type genes for collagen - Google Patents

Abstract

The invention is an oligonucleotide substantially complementary to a mutant collagen nucleotide sequence and not perfectly complementary to a wild type collagen nucleotide sequence, methods for selecting and preparing such an oligonucleotide, and methods for treating mammals having diseases exhibiting mutant collagen gene expression using such an oligonucleotide to inhibit mutant collagen gene expression.

Description

~ WO 94/11494 2 1 48 6 8 7 P~/US93/10756 A~ISENSE OLIGO~CLEOTIDES TO IN~IIBIT EX~?RESSION OF
MCITATED AND WILD TYPE GENES :Ei'OR COLI~AOEN

BAC~GROVND
Over 100 different mutations in genes for fibrillar collagens have been shown to cause genetic diseases. Byers, P.
H., Trends Genet. 1990, 6, 293-300; Sykes, B., Nature 1990, 348, 18-20; Prockop, D . J., J. Biol . Chem. 1990, 265, 15349-15352; Kuivaniemi, H. et al., FASEB J. 1991, 5, 2052-2060.
Moreo~er, the sequence of c~rtain human collagen genes are 10 known. Myers et al., Proc. Natl . Acad. Sci . USA 1988, 78, 3516, reported structure of a cDN~ for the pro~2 of human type I procollagen and, subsequently, the ~structures of a series of collagen genes have been defined (see Vuorio, E. and de Crombrugghe, B., An. Rev. Biochem. 1990, 58, 837-875; Chu, M.-15 L. and Prockop, D.J., Extracellular Matrix and InheritedDisorders of ~onnective Tissue, Royce and Steinmann, Eds., Alan R. Liss, New York, 1992). Mutations in either of the two genes for type I procollagen (COLlA1 and COLlA2) cause osteogenesis imperfecta and a subset of osteoporo~is; mutations in the gene for type II procollagen ~COL2A1) cause chondrodysplasias~ and some form of osteoarthritis; and mutations in the gene for type III procollagen (COL3A1) cause Ehlers~Danlos syndrome type IV and aneurysms. Most of the mutations of procollagen genes produce disease phenotypes by directing synthesis of structurally abnormal but partially functional proa chains of type I, type II or type III procollagen. The partially functional pro~ chains associate with and become disuifide-linked to normal proa chains. As a result, the mutant chains WO94/11494 - ~- PCT/US93/107~6 ~

2 1 4 8 6 8 7 ! ` . .

can have one of several major effects. Kuivaniemi, H. et al., FASEB J. 1991, 5, 2052-2060. One effect is to prevent folding of the three chains into a collagen triple helix and thereby cause degradation of both the abnormal and normal pro~ chains through a process referred to as procollagen suicide. Th~
second effect is to produce minor changes in the conformation of the collagen triple helix and thereby generate mutated monomers that interfere with self-assembly of normal monomers synthesized by the same cells.
A third effect of mutations in collagen genes is to decrease the amounts of collagen synthesized by fibroblasts and related cells. Mutations that decrease collagen synthesis, ~ however, cause the relatively mild disease known as type I
osteogenesis imperfecta. Deleterious effects of mutant 15 collagen gene expression have been demonstrated in transgenic mice expressing mutated genes for type I procollagen. These transgenic mice developed phenotypes resembling human osteogenesis imperfecta, Stacey, A. et al., Nature 1988, 332, 131-136; Khillan, J. S. et al., J. Biol . Chem. 1991, 266, 20 23373-23379. Further, it has been demonstrated that transgenic mice expressing mutated genes of type4II procollagen developed phenotypes resembling human chondrodysplasia. Vandenberg et al., Proc. Natl. Acad. Sci. 1991, 88, 7640-7644.
Since many heritable diseases of collagen are caused 25 by the protein products from the mutated genes, it is believed that selecti~e inhibition of expression of the mutated genes will be useful a~ a therapy for such diseases. Clinical ~ observations have demonstrated that many patients with severe - diseases caused by m~utations in a collagen gene would bene it 30 from selective inactivation of the mutant allele which directs the synthesis of mutant pro~ chains. The diseases in which ' selective inhibition may be useful include osteogenesis ~ imperfecta, chondrodysplasia, certain forms of osteoporosis, s certain forms of aneurysms, and certain forms of ~ 35 osteoarthritis.
.~i In addition, it has been recognized for many decades , that many pathological conditions are caused by overproduction ~ WO94/11494 2 1 ~ 8 6 8 7 PCT/US~3/10756 of collagen fibers in the form~ of scars and excess fibrous tissues. For example, liver cirrhosis is a two-step process in which normal liver tissue is first destroyed by a virus or by alcohol and other toxins, and then excessive amounts of collagen fibers replace the dama~ed cells before normal liver cell t~egeneration. Idiopathic pulmonary fibrosis is a lethal condition in which, for largely unknown reasons, normal lung tissue is gradually replaced by excessive amounts of collagen fibers. Progressive systemic sclerosis (scleroderma) is a fre~uently lethal disease where, again for unknown reasons, skin and many internal organs become leather-like because of excessive depositions of collagen fibers. In many individuals, ~ wounds or surgical incisions in the skin are followed by excessive depositions of collagen in the form of hypertrophic scars and keloids that present cosmetic problems and sometimes more serious consequences. Also, excessive scarring frequently occurs in normal individuals following trauma and surgical procedures. In these and related conditions, a means of specifically inhibiting collagen synthesis and deposition would 20 be of tremendous benefit. In addition, the same means of specifically inhibiting collagen synt4hesis and deposition would be useful in animal husbandry. For example, most horses de~elop large deposits of collagen fibers resembling human keloids and called "proud flesh" following injury to the legs that can limit the effective life of both d~aft horses and racing thoroughbreds.
It has been demonstrated that modified antisense oligonucleotides that are complementary to specific RNAs can inhibit the expression of a number of cellular and viral genes .
as proteins. See Erickson, R. P., and Izant, J. G. Gene Regul~tion: Biology Of Antisense RNA And DNA, Vol. 1, Raven Press, New York, l992. For example, ~elective inhibition of a p21 gene ~hat differed from a normal gene by a single nucleotide has been reported. Chang, E. H. et al., Biochemistry l99l, 30, 8283-8286. Moreover, mRNA splice junctions were suitable targets for antisense nucleic acids.
Kole, R. et al., Adv. Drug Delivery Rev. l99l, 6, 271-286;

., ~

WO94/11494 PCT/US93/10756 ~
21~8687 Munroe, S. H. ~MBO J. 1~88, 7, 2523-2532. Many hypotheses have been proposed to explain the me~hanisms by which antisense oligonucleotides inhibit.~ène expression, however, the specific mechanism involved may depend on the cell type studied, the RNA
5 targeted, the specific site on the RNA targeted, and the chemical nature of the oligonucleotide. Chiang, M.-Y. et al., J. Biol. Chem. 1991, 266, 18162-18171; Stein, C. A., and Cohen, S ., Cancer Res . 1988 , 48 , 2659-2668.
While there is a long felt need for therapies of 10 disorders of collagen, such need has gone unmet. Methods to selectively decrease expression of either a normal allele or a mutant allele of collagen using antisense oligomlcleotides would be of tremendous benefit to those suffering from diseases of collagen.
:

Mutations in genes encoding procollagen cause osteogenesis imperfecta, chondrodysplasia and related disorders, and Ehlers-Danlos syndrome type IV. They also cause a subset of osteoporosis, a subset of osteoarthritis and a ~0 subset of aneurysms. However, ther~peutic and pharmacologic agents for the treatment of genetic diseases of collagen are few, and none involve the selective inhibition of the expression of the mutant collagen gene causing the disease.
Also, excess synthesis and depo ition of collagen in the form 25 of scars and fibrous tissue causes most of the deleterious effects of diseases such as liver cirrhosis, pulmonary fibrosis, scleroderma, hypertrophic scarring and keloid 7, formation. ~ Also, ~,excessive scarring frequently occurs in normal individuals following trauma and surgical procedures.
30 The present invention provides a means based on antisense strategies to inhibit selectively expression of either a mutated or a normal gene for collagen. Therefore, it provi~es a means for preventing or reversing many of these conditions.
To investigate the selective inhibition of expression 35 of a mutant collagen gene, modified antlsense oligonucleotides complementary to an exogenous mutated COLlAl gene were ,, ~ WO94/11494 2 1 4 8 6 8 7 PCT/US93/10756 .... .

prepared. In the test system, the exogenous gene consisted of a construct of the human COLlAl.gene which was transfected into mouse cells. As a result, the mouse cells synthesized mutated pro~l(I) chains of human type I procollagen. The mouse cells 5 also synthesized normal pro~l(I) chains of mouse type procollagen from the endogenous mouse COLlAl gene. The modified antisense oligonucleotides were designed to contain a base sequence that was complementary to and that, therefore, would bind to a target sequence in RNA transcripts of the ~0 exogenous human COLlAl gene. In the example provided here, the target sequence was 20 nucleotides from exon l and intron l of the normal human COLlAl gene that differed by 9 nucleotides in ~ the same sequence of the normal mouse COLlAl gene. When the modified oligonucleotide was applied to transfected cells 15 expressing both the exogenous human COLlAl gene and the endogenous mouse COLlAl gene, expression of the human COLlAl gene was specifically in~ibited. The inhibition of the human COLlAl gene ranged from 50 to 80%, with less than l0~
inhibition of expression of the endogenous mouse gene for the ~20 same collagen or the endogenous mouse gene for the related q extracellular protein called fibrone~tin.
Missense and sense versions of the same oligonucleotide had essentially no effect on expression of the exogenous gene. The inhibition observed with the most 25 effective oligonucleotide was reduced by introducing a single base change in the oligonucleotide. Selective inhibition of expression of the exogenous collagen gene was consistently observed in all experiments. In the presence of lipofectin that was used as a carrier for the oligonucleotide, the 30 concentration of oligonucleotide required for effective 5~inhibition was as low as 0.l ~M. Therefore, these results indicate that the same oligonucleotide or a modified form of the same oligonucleotide will be useful to rescue the phenotype of fragile bones in transgenic mice expressing the same internally deleted gene or similar deleted genes. Further, it ',is believed that certain other oligonucleotides designed to , .

, W094/11494 PCT/US93/10756 ~
~1~8687 bind other mutant collagen genes may be useful to inhibit mutant collagen gene expression in mammals, including humans.
In addition, oligonucleotjldes designed to target sequences in normal collagen gene~;'may be useful in diseases 5 and related conditions in which deleterious effec~s are produced by excessive synthesis and deposition of collagen in tissues.
Oligonucleotides complementary to specific sequences in either the human COLlAl gene or the mouse COLlAl gene are lO provided.
Methods are also provided for selecting and preparing the oligonucleotides. Further, methods are included in the ~ invention for treating mammals having diseases or related conditions caused by expression of mutated gene for co:Llagen or l5 caused by excessive expression of normal collagen genes in response to ~njury to specific tissues.
The methods of the invention will be particularly useful to treat humans suffering from diseases of collagen by selective inhibition of mutant collagen gene expression using 20 oligonucleotides of the invention. They will also be useful to treat humans and other mammals suff~ering from diseases and related conditions caused by excessive synthesis and deposition of normal collagen in tissues, i.e., condition such as liver cirrhosis, pulmonary fibrosis, scleroderma and scarring 25 following trauma or surgery.

BRIEF DEBCRIPTION OF TXE DRAWINGS
Figure l shows Western blot assays of expression of the endogenous gene (SEQ ID NO: 4) and the exogenous gene (SEQ
ID NO: 3) for proal (I) chains (COLlAl). Lane~ l to 3: Cells ~ 30 treated with missense oligonucleotide MS3 (SEQ ID NO: 6).
i Lanes 4 to 6: Cells trçated with the antisense oligonucleotide ~ AS3 (SEQ ID NO: 5). Lanes 7 to 9: Control cells not treated i with oligonucleotides. Three samples of cells were treated J identically and analyzed separately in the lanes shown.
-~ 35 Figure 2 shows an assay of the steady-state levels of mRNAs frcm the exogenous (SEQ ID NO: 3) and endogenous (SEQ ID
s ,~
, ~ WO94~11494 2 1 ~ 8 6 8 7 PCr/US93/10756 t NO: 4) genes. mRNA from the exogenous COLlAl gene generates a band of 135 bases and mRNA from the endogenous COLlAl gene generates a band of l00 bases under the conditions of the experiment in which the same oligonucleotide primers are used to synthesize cDNAs from the mRNAs and cDMAs are amplified by the polymerase chain reaction followed by cleavage with a restriction endonuclease (BstNl). Lanes 1-3: Treatment with 0.2 ~M AS3 and l0 ~g/ml lipofectin. Lanes 4-6: 0.2 ~M MS3 and l0 ~g/ml lipofectin. Lanes 7 9: l0 ~g/ml lipofectin alone.
l0 Densitometry of the film demonstrated that AS3 decreased the level of the human mRNA to 80~ of the value o~tained with MS3 (SEQ ID NO: 6). There was no effect on the le~el of the mouse - mRNA. Three samples of cells were treated identically and analyzed separately in the lanes shown.
Figure 3 shows a time course for the specific inhibition of expression of the exogenous COLlAl gene (SEQ ID
NO: l). Cells were removed at the times indicated and expression of the genes was assayed by Western blotting (see Figure l). Values are mean + (plus/minus) standard deviation (n = 3).

DETAI~ED DESCRIPTION OF THE INVENTION
It has been established that many of the genetic mutations of fibrillar collagens produce disease phenotypes because they cause synthesis of structurally abnormal but 25 partially functional proa chains of type I, type II or type III
procollagen. It has further been established that mutations in procollagen genes cause osteogenesis imperfecta, chondrodysplasia and Ehlers-Danlos syndrome. Mutations in the same genes also _ause some subsets of osteoporosis, osteoarthritis, and familial aneurysms. However, effective , therapies have been lacking for disorders arising from mutant .~t, collagen production. The present invention concerns oligonucleotides useful for inhibition of mutant collagen gene ~?~ expression, and provides methods using these compounds for treatment of disorders caused by mutant collagen gene expression. It also concerns oligonucleotides useful for :; l ~, i , .
! . . `

WO94/11494 P~T/US93~10756 ~

inhibition of expression of normal collagen genes to prevent excessive deposition of collagen in fibrotic-conditions.
The invention provides an oligonucleotide substantially complementary to a mutant collagen nucleotide 5 sequence or a normal collagen nucleotide sequence. "Nucleotide sequence" refers to a polynucleotide~formed from a series of joined nucleotide units. The term "substantially complementaryl', as used herein, refers to that amount of complementarity between the oligonucleotide and a collagen 10 nucleotide sequence which allows for potentially stable interstrand hybridization and enables the oligonucleotide to inhibit the expression of the collagen gene. Interstrand - hybridization is the interaction between the oligonucleotide and the collagen nucleotide sequence. The potential capability 15 of forming a stable interstrand hybrid can ~e determined by those skilled in the art using methods known in the art, such as, for example, determination of the melting temperature for the hybrid (Tm) by mathematical modelling or empirical analysis, solid support nucleic acid hy~ridizations, or Cot 20 analysis. (Marmur, J. and Doty, P., J. Mol . Biol . 1962 , 5 , 113).
As used herein, the term "collagen nucleotide sequence" refers to any nucleotide sequence derived from the a wild type or mutant collagen or procollagen gene, including, 25 for example, DNA or RNA sequence, DNA sequence of the gene, any transcribed RNA sequence, RNA sequence of the pre-mRNA or mRNA
transcript, and DNA or RNA bound to protein.
Oligonucleotides useful for inhibition of mutant ' collagen gene expression may be selected by comparing a mutant - 30 collagen nucleotide sequence with a wild type collagen nucleotide sequence. A region of the mutant collagen s nucleotide sequence comprising at least one nucleotide difference from the wild type collagen nucleotide sequence may be selected as the target for the oligonucleotide. An ~ 35 oligonucleotide complementary to this region is expected to be `,'~t able to selectively hybridize to the mutant collagen nucleotide ~, sequence but not the wild type nucleotide sequence.
;

.a ~, ~ W094/11494 2 1 4 8 6 ~ 7 PCT/US93~10756 In addition, neutral variations in the base sequence of an allele for a gene can be used as a target site for the oligonucleotide. Therefore, a panel of oligonucleotides to normal alleles can be used to inhibit expression of an allele that contains a neutral variation in sequence and a disease-causing mutation at a second site in the same allele, the use of a panel of oligonucleotides to normally functioning alleles will greatly reduce the number of specific oligonucleotides needed, since it will not be necessary to design a new lO oligonucleotide for each new mutation that is disco~ered in a given gene.
Oligonucleotides targeted to invariant sequences in ~ collagen genes can be used to inhibit collagen synthesis in fibrotic conditions.
The oligonucleotide may be any length of sequence potentially capable of forming a stable hybrid with the mutant or normal collagen nucleotide sequence. The potential capability of forming a stable hybrid can be determined by those skilled in the art using methods known in the art. It is 20 preferred that the length of the oligonucleotide be between 5 and 200 nucleotides. It is mo~re preferred that the oligonucleotide be between lO and 50 nucleotides in length.
It is most preferred that the oliyonucleotide be between 15 and 25 nucleotides in length.
The nucleotides of the oligonucleotides may be those known in the art such as natural and synthetic moieties. The term "oligonucleotide" as used herein refers to a polynu-cleotide formed from joined nucleotides. Moreover, the term "oligonucleotide" includes naturally occurring oligonucleotides or synthetic oligonucleotides formed from naturally occurring qubunits or analogous subunits designed to confer special properties on the oligonucleotide so that it ls more stable in biological systems or binds more tightly to target sequences.
It also includes modifications of the oligonucleotides such as chemically linking them to other compound that ~ill enhance delivery to cells or to the nucleus and other compartments of cells. The term "wild type" as used herein refers to the a WO94/114~4 PCT/US93/10756 ~
2148~87 `` I
, . .,.. ,.. i . 1 o -- ' naru~al, functional form of a collagen or procollagen nu~leotide sequence. This includes, for example, natural, functional genes and transcripts of procollagen types I to XVI
and to still undiscovered collagens that may be found in S tissues of mammals.
Oligonucleotides substantially complementary to regions of the mutant nucleotide sequence that comprise a variation from the wild type nucleotide sequence of at least one point mutation, missense mutation, nonsense mutation, deletion, recombination, insertion or combinations of such mutations are preferred in the invention. Normal in~ariant sequences are preferred to applications involving the inhibition of normal collagen synthesis and deposition.
A preferred embodiment of the invention is an oligonucleotide complementary to mutant or normal wild type nucleotide sequence of ty~e I procollagen (COLlAl and COLlA2), type II procollagen (COL2Al), type III procollagen (CO~3~1) or type IV collagen ( COL4Al, COL4A2, COL4A3, COL4A4 and COL4A5).
It is further preferred that the oligonucleotide be complementary to a nucleotide sequence derived or selected from a mammal, in particular, a human.
The oligonucleotides of the present invention may be ~ oligodeoxyribonucleotides or oligoribonucleotides, including 5. modified oligodeoxynucleotides and oligoribonucleotides.
-~ 25 Moreover, the oligonucleotides of the invention may be ' comprised of combinations of deoxyribonucleotides and - ribonucleotides.
Further, oligonucleotides of the invention may also include modified subunits. For example, the invention may include phosphorothioate oligodeoxyribonucleotides.
It is preferred that the oligonucleotides of the invention be modified to increase stability and prevent '~5 intxacellular and extracellular degradation. It is more preferred that the oligonucleotides of the invention be 35 modified to increase their affinity for target sequences, and their transport to the appropriate cells and cell compartments .
;, , ~i ' J

WO9~J11494 PCT/US93tlO756 when they are delivered into a mammal in a pharmaceutically active form.
Oligonucleotides of the in~ention may be synthesized by any method known in the art. It i5 preferred in the present invention that the oligonucleotides be prepared using synthetic chemical methods, such as, for example, phosphoramidite chemistry by sulfurization with tetraethylthiuram disulfide in aceto~itrile. See, for example, Vu and Hirschbein, Tetrahedron Lett. l99l, 32, 30005-30008. Oligonucleotides of the invention lO may also be synthesized using in vi tro and in vi~o transcription systems, such as transcription by T7 polymerase or expression vectors~ Oligonucleotides synthesized using in vi tro and in vivo transcription systems may be modified via chemical methods known to those skilled in the art. Examples 15 of such modifications include encapsulation in liposomes, or chemical linkage to ster-oids, antibodies, and cell receptors.
It is preferred that an oligonucleotide substantially complementary to a mutant or wild type collagen nucleotide sequence comprises a collagen gene expression control sequence.
20 The term "gene expression control sequence", as used herein, denotes sequences that affect the level of expression a gene.
Gene expression control sequences that affect the level of translation or the rate of RNA processing are preferred, but are the invention is not limited to sequences involved in these 25 processes. Gène expres~ion control sequences useful in the invention include, for example, 5'- and 3'-splice junction sequence, splicing branchpoint sequence, small nuclear ribonucleoprotein binding site sequence (snRNP), polyadenylation region sèquence~, translation initiation region sequence, transcript 5'- and 3'-untranslated region sequence, and sequence affecting RNA turnover. The translation initiation site may include the Koza~ sequence or other sequence embedding the start codon or adjacent to the start codon. The ~'-splice junction sequence may include the Ul ¦ 35 snRNP binding site or the 5~-splice junction octanucleotide consensus sequence. Moreover, the 5'-splice junction sequence may include sequences embedding the splice junction or adjacent W094/11494 PCT/~S93ilO756 ~
2148687 ~

to the splice junction. The 3'-splice junction sequence may include sequences embedding the splice junction or adjacent to the splice junction. The polyadenylation region sequence may include the AAUAAA consensus hexanucleotide, and active 5 ~ariants thereof, and sequences surrounding the cleavage site or adjacent to the cleavage site. The target sequences for the oligonucleotides shall also include seg~nces that code for amino acid sequences in the proteins.
It is preferred that the oligonucleotides of the lO invention be antisense oligonucleotides. It is more preferred that the oligonucleotides of the invention be targeted to a collagen gene splice junction, in particular, a 51-splice junction. Herein, the term "splice junction" may encompass a 5'-splice junction sequence including the Ul snRNP binding site 15 or the 5'-splice junction octanucleotide consensus sequence, or a 5'-splice junction sequence including sequences embedding the splice junction or adjacent to the splice junction. The term "splice junction may also denote a 3'-splice junction sequence including sequences embedding the splice junction or adjacent ~ 20 to the splice junction. The splice junction of the invention s may be, for example, an activated c~yptic splice junction, a splice junction xeconstituted at a deletion junction, or reconstituted by some other mutation, or a dominant splice junction within a mutated sequence milieu. Another preferred ?, 25 method of the inventions is oligonucleotides targeted to coding j sequences of the gene.
The invention further includes an oligonucleotide substantially complementary to a mutant collagen splice junction comprising SEQ ID NO: 18. This consensus sequence is 30 derived from a number of oligonucleotides tested which exhibit ~ certain degrees of inhi~itory activity on mutant collagen gene i expression. See Tables 1 and 2.
To demonstrate the usefulness of the oligonucleotides of the invention, mouse NIH 3T3 cells stably transfected with 35 an internally deleted "mutant" construct of the human COLlAl gene which encodes shortened pro~l~I) chains of type procollagen were contacted with the oligonucleotides. These , J
~.' ~ WO 94/11494 21 4 8 6 8 7 PCI`/US93/l0n6 ~

oligonucleotides were synthesized using a region at the 3' end of exon 1 and the first two nucleotides of intron 1 of the exogenous human gene as a target. See Table 1. The target site was selected because the human gene contained 27 S nucleotides in exon 1 that were not found in the corresponding endogenous mouse gene. Cells contacted with the oligonucleotides showed selective inhibition of the mutant COLlAl gene. See Examples 5 through 8. The target sequence of the most effective oligonucleotide tested was a 20 nuc:leotide 10 stretch. This human collagen target sequence differed from the mouse sequence by nine nucleotides. The observed effects on expression were specific and ranged from 50 to 80% inhibition of the exogenous gene. Less than 10~ inhibition of expression of the endogenous collagen gene or the fibronectin gene was 15 observed. To further demonstrate the specificity of these oligc;nucleotides, missense or sense versions of the same oligonucleotide were tested. These oligonucleotides had essentially no effect on target gene expression. Also, the '~ inhibition observed with the most effective oligonucleotide 20 tested was reduced by introducing a single base change.
It is evident from the forgo,~ng illustration that the oligonucleotides of the invention are useful for research as research reagents. However, the oligonucleotides can also be ; used as diagnostic and therapeutic agents, and in kits.
The invention also includes an oligonucleotide which comprises a sequence selected from the group of SEQ ID NO:5, 3 SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID
NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID~NO:16, SEQ ID NO:19, SEQ ID NC):20, SEQ ID
30 NO:21, SEQ ID NO:22 and SEQ ID NO:23. See Tables 1 and 2.
Certain of these oligonucleotides are complementary to the mutant 5'-splice junction sequence and effectively inhibit expression of the mutant exogenous gene. See Table 2.
Oligonucleotides having SEQ ID NO:5, SEQ ID NO:8, SEQ ID NO:l9, 35 SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 and SEQ ID NO:23 are particularly inhibitory. Oligonucleotides of the foregoing ,~ 1.

`.

W094/1~494 PCTtUS93/10756 ~
21~8687 group are particularly useful as research reagents while not being limited to such u~e.
It is expected that the oligonucleotides of the invention will be useful in pharmaceutical preparations for 5 therapeutic purpo~es when delivered to mammals, particularly humans. Provided are pharmaceutical compositions for inhibiting mutant and normal col~agen gene expression comprising an oligonucleotide of `,~ he invention, and a pharmaceutically acceptable carrier or diluent.
The invention further provides a preferred embodiments of pharmaceutical compositions comprising an oligonucleotide substantially complementary to a mutant or normal collagen gene ~ expression control sequence, such a~ a collagen gene splice junction.
Pharmaceutical compositions comprising an - oligonucleotide having SEQ ID N0: 18 are also included.
The pharmaceutical compositions comprising the oligonucleotides may be administered orally in solid dosage forms, such as capsules, tablets, and powders, or in liquid 20 dosage forms, such as elixirs, syrups, and suspensions. They may also be administered parenterally~in sterile liquid dosage form~ as well as by inhalation or topical administration.
The dosage administered varies depending upon factors such as: pharmacodynamic characteristics; its mode and route of administration; age, health, and weight of the recipient;
nature and extent of symptoms; kind of concurrent treatment;
and frequency of treatment. Effective dosages are those which are able to inhibit collagen protein production in cells at a ~, le~el which eliminates or rçduces the symptons or conditions ~ 30 associated with the collagen portein production.
I The compounds may be formulated with a pharmaceutically acceptable topical carrier and the formulation to produce a creme, lotion or ointment for example.
For parenteral administration, the oligonucleotides 35 of the invention may be mixed with a suitable carrier or diluent such as water, an oil, saline solution, aqueous dextrose, and other sugar solutions, glycols such as propylene :

~ WO94/11494 2 1 4 8 6 8 7 PCT/US93/10756 glycol or polyethylene glycols, and lipids such as in liposomes or cationic lipids capable of binding nucleic acid.
Further, a water soluble salt of an oligonucleotide of the invention may be used for parenteral administration.
Stabilizing agents, antioxidizing agents and preservatives may also be added. Suitable antioxidizing agent~ include sodium bisulfite, ~odium sulfite, and ascorbic acid, citric acid and its salts, and sodium EDTA. Suitable preservatives include benzal~onium chloride, methyl- or propyl-paraben, and chlorbutanol.
Solutions for parenteral administration comprise preferably an oligonucleotide of the invention encapsulated in or bound to a cationic lipid.
As a demonstration of the effectiveness of compositions comprising l-ipid, lipofectin was tested in a cell culture system. Lipoectin optimized inhibition for all of the antisense oligonucleotides tested. See Exa~ple 5, Tables 2 and 3, and Example 8, Table 4. The concentration of oligonucleotide required for effective inhibition were as low as O.l ~M which is a physiologically acceptable concentration for mammalian therapeutic agents. I~ view of this observation i~ is expected that the oligonucleotides of the invention will be useful for treatment of mammals.
The oligonucleotides of the invention may be administered by any method that produces contact of the oligonucleotide with the oligonucleotide's site of action in the body of a mammal including but not limited to oral, intravenous, and intraparenteral.
The oligonucleotides may be administered singly, 30 or in combination with other compounds of the invention, other pharmaceutical compounds, or therapies. The oligonucleotides ' are preferably administered with a pharmaceutically acceptable carrier or diluent selected on the basis of the selected route of administration and standard pharmaceutical practice.
~, ~ 35 The oligonucleotides of the invention are administered s to mammals, preferably humans, in therapeutically effective ' amounts or concentrations which are effective to inhibit mutant ~1 W094~114~4 PCTJUS93tlO7~6 ~
21~868~ ` 16 -~ollagen gene expression, or to treat diseases exhibiting mutant collagen gene expression. The dosage administered in any paxticular instance will depend upon factors such as the pharmacodynamic characteristics of the particular 5 oligonucleotide of the invention, and its mode and route of administration; age, health, and weight ,~ the recipient;
nature and extent of symptoms; kind of c~current treatment, frequency of treatment, and the effect desired.
Inhibition of aberrant collagen gene expression is a lO major focus of this invention. To achieve this end, the invention provides methods of inhibiting mutant collagen gene expression which comprise contacting a cell comprising the mutant collagen gene with a mutant collagen ge~e e~pression inhibitory amount of an oligonucleotide substantially 15 complementary to a mutant collagen nucleotide sequence or a neutral ~ariation in the;sequence of the same collagen allele containing the mutant sequence and not perfectly complementary to a wild type collagen nucleotide sequence or the target sequence in the allele for the wild type collagen allele. The 20 in~ention also includes a method whereby the contacting step ~ comprises lipofectin as a carrier for~the oligonucleotide. In 3 addition, the invention includes similar methods for inhibiting expression of wild type collagen genes.
Moreover, a method of inhibiting mutant or wild type 25 collagen gene expression is provided wherein the collagen nucleotide sequence comprises a collagen gene expression control sequence, such as a collagen gene splice junction, particularly a 5'-splice junction or a normal coding sequence.
` Also incIuded is a method of inhibiting collagen gene 30 expression wherein the oligonucleotide comprises a sequence selected from the group of SEQ ID NO:5, SEQ ID NO:6, SEQ ID
NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:lO, SEQ ID NO:ll, SEQ
ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:l5, SEQ ID
NO:16, SEQ ID NO:l9, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22 35 and SEQ ID NO:23. See Table 2. Methods comprising these oligonucleotides are particularly useful in research while not being limited to such use.

,, ,1 ~ ` ` ~0 94~114g4 2 1 ~ ~ 6 ~ 7 PCT/US93/107~6 A further method of inhibiting mutant and wild type collagen gene expression i9 included wherein the oligonucleotide comprises SEQ ID NO: 18.
As a demonstration of this method for inhibiting collagen gene expression, mouse NIH 3T3 cells stably expressing an internally deleted version of the human COLlAl gene were grown in cell culture. The utility of the system was that it made it possible to assay directly changes in the expression of the exogenous human CO~lA1 relative to the expression of the endogenous mouse COLlA1. Specifically, the exogenous human COLlA1 had an internal deletion of 40 exons (exons 6 to 45) engineered so that the mRNA and the pro~l(I) chai~s synthesized from the gene were less than half the size of the mRNA and pro~l(I) chains synthesized from the mouse endogenous COLlAl 15 gene. Hence, specific inhibition of one gene relative to the other was readily assayed in the same sample of cells or tissues with techniques employed by those familiar in the art.
The cell~ were plated at a concentration adjusted to obtain subconfluent cultures at the end of the experiment.
20 After twenty hours the cells were washed two times with prewarmed medium, and treate~ with lipofectin.
Oligonucleotides dissolved in distilled water were then added and the cells were incubated. Media comprising heat inactivated calf serum and antibiotic were then added. The cells were then incubated for the additional times indicated in the Examples. RNA and protein analyses demonstrated that contacting cells expressing the mutant human collagen gene with certain oligonucleotides of the invention using the above method significantly inhibited the mutant gene expression. See 30 Example 5, Tables 2 and 3, and Example 8, Table 4. Maximal inhibition with AS3 (SEQ ID NO: 5) was observed in about 20 hours. See Figure 3~ The inhibition began after 8 hours and persisted for at least 30 hours.
The mutated human COLlAl gene used in these 35 experiments with cells was modeled after a mutated COLlA1 gene shown to cause a lethal form of osteogenesis imperfecta.
Williams, C.J. and Prockop, D.J., J. Biol. Chem. 1983, 258, ., 4 PCT/US93/10756 ~1 ¦
2148687 `

5915~5921; and Olsen et al., J. Biol. Chem. 1991, 266, 1117-1121. The same m~tated human COLlA1 gene was used to prepare transgenic mice. Lines of tran~genic mice expressing high levels of the gene were shown to develop fractures of bones similar to those seen in children wl~h osteogenesis imperfecta.
Khillan, J.S. et al., J. Biol. Chem. 1991, 266, 23373-23379.
Therefore, oligonucleotides that inhibit the expression of the mutated human COLlAl gene in cell culture offer the potential of inhibiting expression of the same mutated human COLlA1 gene in the transgenic mice and thereby rescuing the phenotype of fragile bsnes in the tran~genic mice. Successful testing of the oligonucleotides in the transgenic mice would offer the prospect of using the same or similar oligonculeotides to treat or prevent fragile bones in children with osteogenesis imperfecta. Since mutations in the CO~lA1 gene are a cause of a subset of post-menopausal osteoporosis, the same or similar oligonucleotides may be useful in treating or preventing osteoporosis. Of special importance is that the same cells and transgenic mice expressing the mutated human COLlA1 gene can be 20 used to develop oligonucleotides to specifically inhibit expression of normal human COLlA1 g~nes by targeting either invariant sequences in the human gene or regions that contain ,neu~ral variations in normal alleles of genes.
¦The oligonucleotides of the invention will be capable - 25 of reaching their intracellular target to affect inhibition of mutant collagen gene expression. The invention therefore provides methods of inhibiting mutant and wild type collagen gene expression which comprise contacting at least one element of gene expression machine;ry~with a collagen gene expression inhibitory amount of an oligonucleotide. For the purposes of the invention, the elements of the gene expression machinery may comprise any nucleotide sequence of a gene, the nucleotide 'sequence of spliced mRNAs transcribed from a gene, unspliced 'RNAs and partially spliced RNAs transcribed from a gene, DNA-i35 RNA hybrids comprising sequence derived from a gene, such as in ,acti~ely transcribing genes, RNA transcribed from a gene bound ~, ,1~

~ WO94/11494 2 1 4 8 6 ~ 7 PC~/US93/1~756 to protein, and any molecule or structure known in the art to be involved in gene expression.
Further, the oligonucleotides of the invention will be capable of inhibiting collagen gene expression in cells in S ~ivo and in vitro, including, for example, individual cells, cells comprising tissues, cells comprising organs, and cells comprising organisms. The inhibitory effect of an oligonucleotide ranges from the lowest statistically significant inhibitory level to about 100~ inhibition. Using the methods of the invention, one skilled in the art will be able to design or select oligonucleotides which are appropriate for the degree of inhibition which is needed for the desired purpose without undue experimentation.
An important aspect of the invention is the use of the oligonucleotides of the invention in the treatment of disease since there are few effective therapies for collagen disorders.
The invention includes a method for treating a disease exhibiting mutant collagen gene expression which comprises administering to a mammal suffering from a disease caused by 20 expression of a mutant collagen gene, an inhib~tory amount of an oligonucleotide substantially co~plementary to a mutant collagen nucleotide sequence and not perfectly complementary to mutant collagen nucleotide sequence. Alternatively, the inhibitory oligonucleotide can be substantially complementary to a neutral sequence variation found in the same collagen allele containing the mutation but not substantially complementary to the same target site in the second allele for the same collagen in the same individual. The methods of the invention also includ!e administering to a mammal suffering from a fihrotic condition, an inhibitory amount of an oligonucleotide substantially complementary to an invariant sequence in the wild type sequence of a neutral variant sequence in the wild type gene to inhibit, specifically, - expression of the gene and, thereby, prevent deleterious deposition of collagen in tissues. The methods of the invention also include the delivery of oligonucleotides to certain regions of the mammal being treated, such as, for ,, ~
I

W094/11494 PCT/US93~107~6 ~
214868~ 20 -example, by specific and targe~ed delivery of the oligonucleotides to certain organs or tissues, including bolus delivery and immunological targeting. Thus, pharmaceutical preparations comprising the oligonucleotides may be injected 5 directly into a desired bodily~sit~. Moreover, antibodies may be bound to the oligonucl~btides or oligonucleotide-lipid complexes to direct the oligonucleotides to cells expressing certain antigens, such as virally infected cells. It is believed that the methods of the invention for treating disease lO are particularly useful in the treatment of human diseases of ; collagen, including, for example, osteogenesis imperfecta, chondrodysplasia and Ehlers-Danlos syndrome type IV. It is also believed they will be useful in treating su~sets of patients with specific types of osteoporosis, osteoarthritis i 15 and aneurysms. It is also believed they will be useful in : treating many patients with fibrotic conditions such as liver ~ cirrhosis, pulmonary fibrosis, scleroderma, hypertrophic scar 3 formation and keloids. It is also believed they will be useful in treating normal individuals to prevent fibrotic scarring 20 following trauma or surgical procedures.
Moreover, the invention proyides a preferred method of treatment wherein the mutant collagen nucleotide sequence ~, comprises a collagen gene expression control sequence, such as a collagen gene splice junction.
2S Another method for treating a disease exhibiting mutant collagen gene expression is included wherein the oligonucleotide comprise~ SEQ ID N0: 18.
;u~ The usefulness of the oligonucleotides of the invention in the ~reatment ~of mammals can be seen from the , . . .
" 30 concentrations of oligonucleotide sufficient to inhibit gene ~ expression. The concentration of oligonucleotide required for ,~ effective inhibition was as low as O.l ~M. See Example 8, - Table 4. In view of this observation, it is expected that the same or similar oligonucleotides in a pharmaceutically 35 acceptable carrier will be useful to rescue the phenot~pe of fragile bones in transgenic mice expressing the same internally ;~ deleted gene. It is also èxpected that ~hese oligonucleotides '"~,.
-~, A

,~ WO94/11494 2148~87 PCT/US93/107~6 .- .

will be useful to inhibit the expression of mutant collagen genes in collagen disorders of humans.
Since the oligonucleotide is specifically targeted to an invariant region of the wild type human COLlA1 gene, it i9 also expected that it will be useful in treating fibrotic conditions in man and other mammals.
The following examples are illustrative of the invention. It is understood that this invention is not limited by these illustrative examples but solely by the claims appended hereto.

EXAMPLES
~ Exa~ple 1 Oligonucleotide Synthesi~
Phosphorothioate oligodeoxynucleotides were synthesized via phosphoramidite chemistry by sulfurization with tetraethylthiuram disulfide in acetonitrile. See Vu and Hirschbein, Tetrahedron Lett. 1991, 32, 3005-3008.

Example 2 Treatment of Cell Cultures NIH 3T3 cells stably expressing an internally deleted version of the human COLlA1 gene, Ols~p, A. S., J. Biol. Chem.
1991, 266, 1117-1121, were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10~ calf serum and 400 ~g/ml of Geneticin (GIBCO BRL, Gaithersberg, MD). The cells were plated in 24-well plates (Falcon, Becton-Dickincon, New Lincoln, New Jersey) at â concentration adjusted to obtain subconfluent cllltures at the end of the experiment. Twenty hours later, the cells were washed two times with prewarmed DMEM, and 0.3 ml of DMEM containing thel indicated concentration in lipofectin (GIBCO BRL, Gaithersberg, MD) WâS added in each well.
Oligonucleotides dissolved in distilled water wère then added as a 20X stock solution and incubated for 4 hours at 37C.
About 0.7 ml of DMEM containing 14% calf serum previously heat inacti~ated at 56C for 1 hour and 400 ~g/ml of Geneticin were added. The cells were then incubated at 37~C for the additional times indicated.

.
:

WfO 94/11494 - PCT/US93/10756 ~

214868~ - 22 -Example 3 Protei~ Analysis At the end of incubation with the oligonucleotides, cells were washed two timeq in DMEM and solubilized in 0.1 ml of lysis buffex consisting of 1% SDS; 1% sodium deoxycholate;
0.1~ Triton X-100; 10 mM EDTA; 0..5-~unlts of aprotinin (Sif3ma, St. Louis, MO) per ml; 3% f~ -me~captoethanol; and phosphate buffered saline (PBS) adjusted to pH 7.4. After 5 minutes incubation at room temperature, the cell lysate was harvested, strongly vortexed and one-fourth volume of sample loadîng 10 buffer was added (0.6 M Tris-HCl buffer, pH 6.8; 50% glycerol;
1% SDS; 0.012% bromphenol blue). The lysate was then heated for 5 minutes at 94C and 10 ~l of the sample was ~ electrophoresed on a 7.0~- SDS polyacrylamide gel. Proteins were electrophoretically transferred to nitrocellulose filters 15 (Schleicher and Schuell, Keene, NH) and reacted with an antibody against a synthetic peptide corresponding to the last f 21 amino acids of human pro~l (I) chain of type I procollagen.
3 The antibody recognized both the human and the mouse COOH-f terminal propeptide of the pro~l (I) chain~ Olsen, A. S., J.
20 Biol. Chem. 1991, 266, 1117-1121.
The pro~fl (I) bands were de~fcted by reaction with a goat anti-rabbit antibody coupled to 12sI (Dupont-NEN, Boston, MA) and subsequent autoradiography. Relative amounts of protein from the endogenous and exogenous COLlA1 genes were 25 then assayed by using a laser densitometer (hKB, Ultroscan XL, f Piscataway, NJ).
i Ex~mpl~ 4 RNA As~ay < For RNA assays, total cellular RNA was isolated from tissues using acidic guanidine thiocyanate-phenol-chloroform J~ 30 extraction. Chomczynski, P., and Sacchi, M., Anat . Biochem.
1987, 162, 156-159. The ratio of mRNA from exogenous and endogenous genes was measured by a quan.itative polymerase chain reaction ~PCR) assay. Primers for reverse transcription i and pGlymerase chain reaction were designed to be complementary 35 to identical sequence in human and m~use pro~1 (I) mRNA.
; Mooslehner, K., and Habers, K., Nucl. Acids ~es. 1988, 16, 773;

, .

~ WO94/11494 2 1 4 8 6 8 7 PCT/US93/10756 Westefflausen, A., Matrix. Col. Rel. Res. 1991, ll, 375-379.
This strategy provided the same efficiency of amplification for both mRNAs. Five micrograms of total cellular KNA were revers~
transcribed in 20 ~l of reaction mixture using 200 pmol of the 5 primer BS33 having the sequence 5'-ACTAAGTTTGA-3'(SEQ ID NO:
17) and a preamplification system for first strand cDNA
synthesis (SuperScript~, GIBCO BRL, Gaithersberg, MD). After RNase H treatment, cDNA was amplified by PCR (GeneAmp~, Perkin-Elmer Cetus, Norwalk, CT) using primer BS31 (5'-l0 TTGGCCCTGTCTGCCT-3') (SEQ ID NO: l) and 32P-labeled primer BS32 (5'-TGAATGCA~AGGAAAAAAAT-3') (SEQ ID NO: 2) at concentrations of 4 pmol ~er l00 ~l of reaction mixture. PCR condition~ were ~ l minute 20 seconds at 94C, l minute at 47C, and 20 seconds at 72C for 15 cycles. Amplified products from human pro~ l(I) 15 mRNA and mouse pro~l (I) mRNA were 176 and 177 bp long, respectively, and were d1stinguishable only after digestion with BstN I. Ten microliters of PCR product were digested by 2 units of BstN I for l h at 60C, denatured and electrophoresed in 15~ PAGE containing 6 M urea. The gel was fixed, dried and exposed to x-ray film.

Example 5 Initial Test~ of Modified Oligonucleotides To develop antisense oligonucleotides, the test system employed mou~e NIH 3T3 cells stably transfected with an internally deleted construct of the human gene for the pro~l(I) chains of type I procollagen (COLlAl). See Prockop, D. J., J.
Biol. Chem. l990, 26S, 15349-15352. A series of modified oligonucleotides were synthesized using a region at the 3' end of exon l and the first two nucleotides of intron l of the ' exogenous gene as a target (Table l).
~ 30 TABLE 1 DESIGN OF MODIFIED OLIGONIJCLE:OTIDES
A. DNl~ SEOIJENCE AT THE EXON l/INTRON 1 ;rUNCTION~

200 210 220 SEQ ID NO:
~35 5' CAAGTCGAGGGCCAAGACGAAGACAgt 3' 3 .~
i ,~

WO94/11494 ~ PCT/US93/1~7~6 ~ ~
2148687 ~
- 2~ -3' GTTCAGCTCCCGGTTCTGCTTCTGTca 5' Exogenou~
I 111111111 1, 5' CTCCTGACGCATGGCCAAGAAGACAgt 3' 4 3' GAGGACTGCGTACCGGTTCTTCTGTca 5' Endogenous ~ ~ o B. PHO5PHOROTKIOATE_OLIGODEOXYNUCLEOTIDES
CODE SEQ~EN OE (5'-3') TARGET SEQ ID NO:
AS3 ACTGTCTTCGTCTTGGCCCT Exo (224-205) 5 10 MS3b ATCCTGCTTCGTTCTGGCTC Missense of AS3 ~
~ S3C AGGGCCAAGACGAAGACAGT Exo (205-224) 7 AS 7d ACTGTATTCGTCTTGGCCCT Exo (224-205) 8 AS8 TGTCTTCGTCTTGGCCCTCG Exo (222-203) 9 AS9 TCTTCGTCTTGGCCCTCGAC Exo (220-201) 10 15 AS10 ACTGTCTTCGTCTTG Exo (224-210) 11 ASll GTCTTGGCCCTCGACTTG Exo (215-198) 12 AS12ACTGTCTTCTTGGCCATGCG Endo (195-176) 13 i AS14eACTGTATTCTTGGCCATGCG Endo (195-176) 14 AS15ACTGTCTACTTGGCCATGCG Endo (195-175) 15 20 AS16 ACTGTCTACGTCTTGGCCCT Exo (224-205) 16 . ACTAAGTTTGA 17 . NMNWCGNCNNG 18 . AS29 ATCTGTGACGAGACCAAGA 23 NOTES:

,;, :
., .

' .~WO 94/11494 2 1 4 8 6 8 7 PCI`/US93/107~;6 e Bases from exon 1 are i~ capital letters and bases frc)m intxon 1 in small letter~.
Verti cal bar~ indi ca te iden ti ty be tween exogenous (human) and endogPnous (mou~e) COL7A1 gene. For both exogenous and endogenous genes, the adenine a t the s tart or transcription was counted as position +1.

b MS3 (SEQ ID NO: 6) con tains the same content in A, C, G and T as AS3 (SEQ I~ NO:
5J, but in a random order.

C S3 (SEQ ID NO: 7) is the sense version of AS3 (SEQ ID NO: 5 ) .

- d Same sequence as AS3 (SEQ ID NO: 5) except for one mismatch (underlined base).

e Same sequence as AS12 (SEQ rD NO: 13), except for one mismatch (underlined ba~e).

None of the oligonucleotides tested were effective in inhibiting expression of either the exogenous or the endogenous gene when the oligonucleotide was administered without any carrier, e~en at concentrations up t~ 25 ~M. However, several of the oligonucleotides designed as antisense inhibitors of the exogenous gene were effective when administered with 10 ~g/ml lipofectin which increases the uptake of nucleic acid, Chiang, M.-Y. et al., J. Biol. Chem. 1991, 266, 18162-18171. The oligonucleotide that which was the most effective of the group tested, AS3 (SEQ ID NO: 5), reduced the relative expression of the exogenous gene to about 43~ of the control. See Figure 1 and Table 2. The missense~oligonucleotide MS3 (SEQ ID NO: 6) reduced expression to about 81~ of the control. The sense oligonucleotide S3 reduced expression to about 74~ of the control. However, the small degrees or inhibition seen with MS3 (SEQ ID NO: 6) and S3 were not consistently observed in all experiments. The relative effectiveness of the oligonucleotides was more apparent when the values were compared to the variable values seen with the missense i oligonucleotide MS3 (SEQ ID NO: 6). On this basis, AS3 (SEQ ID

z ., W094/11494 : PCT/llS93ilO756 ~, !
~ Q 7 l ~V V ~ - 26 -NO: 5) was the most effective oligonucleotide tested andreduced the expression of the exogenous gene to 53% of the control. Also, as indicated in Table 2, altering a single nucleotide at one site in AS3 (SEQ ID NO: 5) had little effect (see AS7 (SEQ ID NO: 8)). However, a single nucleotide change at anot~er site in AS3 (SEQ ID NO 5) significantly decreased the effectiveness of the oligonucleotide ~see AS16 (SEQ ID NO:
16)).
~ I
TAE~LE 2 EFFECTS OF ANTISENSE OLIGONUCLEOTIDES
AGAINST EXPRESSION OF EXOGENOUS GENE ICOL1A1) , _ . _ _ _ . _ _ _ _ _ t:OL1Al EXPRESSION' RATIOS
_ . . . _ _ _ Oligonucleotide EndogenousExogenous Exo/Endo % of % of Controlb MS3 Valueb _ _ _ _ _ _ _ , _ _ .
Control 10.5 i 0.2 4.4 i 0.2 0.42 i 0.03 123 _ , __ _ , _ _ _ AS3 9.~)iO.8 1.7+0.2 0.18+û.01 43d 53d ~SEQ ID NO:5) . _ . . _ _ MS3 10.7 + 1.4 3.6 + 0.2 0.34 i 0.05 81 (SEQ ID NO: 6) _ . _ S3 11.4 i 1.7 3.5 i 0.2 0.31 + 0.06 74 91 (SEQ ID NO: 7) "
I _ __ AS7C 11.3 + 1.3 2.5 iO.2 0.22 +0 04 52d 65 ¦ (SEQ ID NO: 8) _ AS8 8.1 iO.3 1.5iO.1 0.19iO.01 45d 54d (SEQ ID NO: 9) . _ _ __ 2 5 AS9 12.1 i 1.1 3.0 i 0.2 0.25 i 0.06 60~ 74 (SEQ ID NO:
1 10) I _ _ . = _ _ ¦ AS10 14.0 i 2.9 4.2 i 0.7 0.31 i 0.06 74 91 ¦ (SEQ iD NO:

30 1 12) I
¦ AS11 10.3 1 0.9 2.4 i 0.2 0.23 i O.01 55d 68' ¦ (SEQ ID NO:

1 12) l _ .
¦ AS 16C 10.1 + 1.1 3.0 ~ 0.2 0.30 i 0.01 7 l d 88 ¦ (SEQ ID NO:
1 16) ~ _ _ _ VO TES:
~ Expression assayed in arbitrary units by densitometry of Western blots fsee Figure 1J. Values 3 are mean + standard deviation fn = 3J.

?

~ WO 94/1~494 2 1 4 8 6 8 7 P~r/us~3/lo7s~

b To correc~ for variabiJity in cell number among samples, effects were evaluated from the ratio of protein from the exogenous fo the endogenous gene versus untreared control or cells treated wtth missense oligonvcleotJde MS3 ~SEQ ID NO: 6).
c Differ by ane nucleotide from AS3 ~S~Q ID N(:J: 5J (Table 11.
5 d p value < 0.001, p value < 0.01.
In additional control experiments, two antisense oligonucleotides (AS12 (SEQ ID NO: 13) and AS15 ISEQ ID NO 15)) were shown to significantly inhibit the relative expression of the endogenous gene (Table 3)~ In still another control, an antibody to fibronectin was used to assay expressi.on of the fibronectin gene in presence of different oligonucleotides.
Insignificant and variable decreases and increases in fibronectin gene expression, observed by Western blot assays, 15 more similar to the variable decreases and increa~es observed with the same oligonucle~tides on expression of the endogenous COLlA1 gene (Table 2).
. -EFFE~TS OF ANTISENS~ OLIGONUChEOTIDES
AGAINST ~XPRESSION OF END2 IGENOUS GENE
i COLlAl EXPRESSION RATIO
Oligonucleo Endogenous Exogenous Endo/Exo ~ tides Control ,' _ .
. Control 13.5i2.4 6.2il.3 2.18+0.Q7 ~_ ~ 25 AS 2 2.2i0.1 1.5i0.4 1.46+0.27C 6 7d 4 NO: 13) Control 15.2+0.8 4,. 2+0.2 3.60~0. 24 .
3 AS14b 6.7il.5 2.6+0.2 2.48+0.54 69 30 (SEQ ID
NO: 14) _ _ . -Asl5b 6.liO.1 3.0i0.3 2.03i0.16 56c (SEQ ID
NO: 15) 3 5 NOTES:
a Effects evaluated from the ratios as indicated in Ta~l e 2 .
' WOg4/11494 PCT/US93/10756 ~
21~8687 i b Differs by one nucleotide from AS12 (SEQ ID NO:
13) (see Table 1).
c p value ~ o.aol.
g p value ~ O. 01. ..
. ~ r .
S Exa~ple 6 Inhibitio~ of mRNA~ by Antisen~e Oligonucleotides To verify the effects of the oligonucl~otides, the mRNAs from cells were transcribed into single-stranded cDNAs using an oligonucleotide that primed both the mRNA for the human and mouse pro~l(I) chain. The single-stranded cDNA was then amplified by PCR using a single set of primers with one of the primers labeled with 32p, The antisense oligonucleotide AS3 -(SEQ ID NO: 5) selectively decreased the ~teady-state level of mRNA for pro~1 (I) chains from the exogenous gene to about 50~
of the control value (Figure 2). In the same experiments, the relative expression at the protein level was also decreased by about 5~%.

Exampl~ 7 Time Course for the Effects of Antisen~e Oligo~ucleotide After exposure of the cells to the oligonucleotide and lipofectin in serum-free medium for 4 hours, maximal inhibition with AS3 (SEQ ID NO: 5) was observed in about 20 hours (Figure 3). The inhibition began after 8 hours and persisted for at least 30 hours. Re~exposure of the cells after 24 hours to the ~5oligonucleotide and lipofectin in serum-free medium did not j25 increase the degree of inhibition.
,~
i;~xample 8 Effects of Varying the Concentratione .~of Lipo~ectin and Oligo~ucleotideE
Optimal inhibition was obtained with 5 ~g/ml of lipofectin and 0.1 ~M of the oligonucleotide A53 (SEQ ID NO: 5) .~30 (Table 4). With these conditions, expression of the exogenous gene was specifically reduced to 22~ of the value seen using 5'the MS3 oligonucleotide (SEQ ID NO: 6). Less inhibition was ilobserved with S ~g/ml of lipofectin and higher concentrations of oligonucleotide, possibly because saturation of the cationic lipid with oligonucleotide prevented fusion with cell :
,!

WO94/11494 PCT/~S93/10756 membranes. Chiang, M.-Y. et al., ~. Biol. C~em. 266: 18162-L8171,_1991. __ __ ¦ TABL~ 4 EFFE~TS OF ~RYING CONCENTRATIONS OF
LIPOF~CTIN AND OLIGON~C~EOTIDES A~3 (SEQ ID NO: 5~ AND
MS3 (SEQ ID NO- 6) I _ _ , . ____ ¦Lipofectin Oligo- Expression Ratio ~ of MS3 ¦ (~g/ml) nucleotide (Exo/Endo) Value ~ . r ~ ~ _ _ __ ~ _ AS3 (SEQ MS3 ~SEQ
I ID NO: 5) ID NO: 6) .. . = .. _ _ 1~'5 - ~ - 0.45- 0.05 _ 1012.5 _ ~ 0.05 0.31+0.01 0.~8+0.00 76c 2.5 0.1 _ 0.30+0.00 0.41+0.05 64 ~2.5 0.2 _ 0.42+0~00 ~.46+0.05 91 _ 2.5 0.4_~ 0~49+o~06 0.49+0.03 100 - 0'~4 ~0 01 . .
1515 - 0-050.24+0.03 0.47~0.01 51 - 0.1__ 0.11iO.01_ 0.50~0.00 22c_ _ - - 0.2_ 0.19+0.05 _.39+0.02 49 - 0 4_ 0.24+0.05 ~0.44~0.06 54 _ 10_ 00.46 :0.09 _ 20110 0.050.35+0.05 0.44i0.07 79 _ _ 0.10.30+0.01 0.39~0.04 77 ¦10 0.20.14+0.02 0.36+0.Q4 3 9d _ _ 0.4 Ø27+0.02_ 0.62i0.00 44c NOTES:
25 a Effects e~aluated from the ratios as indicated in Table 2'. Alli condi tions were tested in duplicate.
c p value ~ O. 001.
d p value ~ O. 01.
Example 9 Inhibition of hepatic fibrosis in rats produced by carbon tetrachloride and dimethylnitrosamine ~:1 .., WO94/11494 PCT/US93/10756 ~

Cirrhosis of the liver is a potentially lethal condition in which normal liver tissue is gradually replaced by oollagen fibers following injury to liver by viru~es, alcohol or toxic chemicals. The development of hepatic ,fibrosis is frequently studied experimentally in rats by i`-administering carbon tetrachloride or dimethylnitrosamine to the rats.
A typical series of experiments were xeported by L. Ala-Kokko et al., Hepatology 1991, 16, 167-172.
In these experiments, female Sprague-Dawley rats, 8 weeks 10 old, were used for the induction of liver fibrosis~ The initial body weight of the animals was approximately 200 gm.
The animals were maintained on a normal diet with free access ~ to water and a 12-hour light and dark cycle. For induction of hepatic damage with CCl4, the CCl4 was mixed with an equal 15 volume of mineral oil and injected intraperitoneally at doses of C.1 ml/100 gm body weight, twice a week for 42 days. The animals were ki~led at regular intervals over a period of 42 days. Five control animals and seven test animals were inject~d at the same time. For induction of hepatic damage 20 with dimethylnitrosamine (DMN), doses of 1 ~1 (diluted l:lO0 with 0.15 mol/L NaCl) per lO0 gm body weight were administered.
The injections were made on the first 3 days of each week over a period of 28 days. Treated animals were killed on days 7, 14, 21 or 28. Control animals were killed at the same time.
25 Each group killed on a given day consisted of five control and seven treated animals.
Rats were anesthetized with diethylether and the livers were immediately removed and frozen in liquid nitrogen. The livers were stored frozen at -70 until analyzed. Samples of serum were removed at the same time and stored frozen.
Animals were given humane care and all protocols were re~iewed by an institutional review board.
The livers were thawed and homogenized in a teflon and glass homogenizer. A portion of the homogenate was taken for 35 protein measurements. A portion of the homogenate was taken for protein measurements. A portion of the homogenate was used ~ WO94/11494 2 1 4 8 6 8 7 PCT/~S93/~0756 for assays of hydroxyproline alter hydrolysis in 6 mol/L HCl and dansyl modification.
Frozen liver specimens of 30-200 mg were homogenized with a Teflon and glass homogenizer (1500 rpm, 50 strokes) in buffer containing 1% (wt/~ol) sodium dodecyl sulfate (SDS), 5 mmol/L
Na2 EDTA and lO mmol/L Tris-HCl (pH 7.4). Proteinase K (lO0 ~g/ml) was added to the liver homogenates and cell pellets dissolved in the aforementioned buffer. Samples were then incubated at 40C for l hour. After incubation the samples lO were extracted with one vol phenol/chloroform/isoamyl alcohol (25:25:1, vol/vol) followed by 66% (vol/vol) ethanol, 0.2 mol/L
NaCl precipitation at -20C overnight and centrifugation at 8,000 g for l hour at -20C. The sample was dissolved in 6 mol/L guanidine hydrochloride and the sample was centrifuged at 15 about 2,000 g for 30 minutes. The pellet was re-extracted with 6 mol/L guanidine hydrochloride~ The combined supernatants were precipitated by adding a 0~5 vol ethanol~ The RN~ was further purified by washing the samples with 3 mol/L sodium acetate (pH 6) and alter that with 66~ ethanol and O~l mol/L
20 NaCl. The RNA samples were then freezedried, dissolved in a bu~fer containing Tris-HCl and sodiu~ EDTA, frozen in liquid nitrogen and stored at -70C until used. RNA content was assayed alter purification by spectrophotometric absorption at 260 nm. The ratio of absorbencies 260 to 280 nm were about 2:1.
The mRNAs were assayed by slot blot hybridization with complementary DNA (cDNA) probes labeled with 32p by nick translation. Three dilutions of RNA (l-lO ~g) were dotted onto nitrocellul~se; paper withi a vacuum manifold (Minifold II;
30 Schleicher and Schuell, Dassel, Germany). The filters were baked prehybridized and hybridized in the presence of the labeled cDNA probes. The prehybridization and hybridization solutions were 50% formamide, 5 X Denhardt's solution, 5 X
standard saline citrate, 0.1% SDS and 250 ~g/ml salmon sperm 35 DNA. The temperature was 42C. The filters were washed twice in l X standard saline citrate and 0.1% SDS at room temperature for 15 minutes and then twice in O.l X standard saline citrate W094/11494 PCT/US93/10756 ~ ~ ~
21~86~7 32 -and G.l~ SDS at 55C for. ,30 minutes. The cDNA probes were for the human pro~ ~I) chain, the human proal(III) chain, the mouse ~l(IV) chain, the mouse ~2(IV) chain, and the mouse laminin B2 chain.
For histologic evaluation of hepatic fibrosis, thin slices of liver were fixed in lO~ neutral-buffered formalin and embedded in paraffin. Sections were cut at 5 ~m thickness, stained with hematoxylin and eosin and the Masson trichrome stain for collagen, and subjected to silver impregnation for the demonstration of reticulin fibers. Microscopic evaluation o ibrosis, liver cell damage, inflammation and ductular cell proliferation was performed without knowledge of the source of the specimen. The various parameters were graded from 0 to +3 in order of increasing severity.
As indicated in Table 5, treatment of rats with D2~N or CCl4 increased the total content in liver of collagen hydroxyproline. To confirm the fibrotic effects of the two agents, livers from the rats were examined by light microscopy, 1 without knowledge of the source of the specim~n. As indicated 3, 20 in Table 6, the expected fibrotic changes were observed. The degree of hepatic fibrosis increased ~th time in rats treated ~ with both CCl4 and DMN. Histologic evidence of liver cell 3 damage, assessed by cytoplasmic and nuclear pleomorphism, tinctorial properties and hepatic necrosis, tended to increase 25 with time. In further studies, the steady-state levels of mRNAs for type I procollagen, type III procollagen, type IV
collagen and the B2 chain of laminin were assayed. As indicated in Table 5, there were marked increases in the levels of mRNAs for ~l(I), ~l~III~ and al(IV) chains.
~iJ 30 The results of these experiments demonstrate increases 3, in the e~pression of genes for collagen are an integral part of the fibrotic response of liver to injury. Therefore, using i antisense oligonucleotides targeted to one or more of the i collagen genes would provide an effective method of limiting the fibrotic response. Also, the experiments in rats provide a useful system for testing the effectiveness of the oligonucleotides. For example, administering an ., ~i: WO94/11494 2 1 4 8 6 8 7 PCT/US93/10756 oligonucleotide that inhibits expression of the COLlAl gene for type I procollagen should inhibit the increase in mRNA for the ~l(I) chain for type I collagen and increase in collagen liver hydroxyproline seen in Table 5. Therefore, the oligonucleotide 5 should prevent the fibrosis seen in Table 6. Obtaining such results in rats should provide part of the information necessary to test the effectiveness of the same oligonucleotide for preventing liver fibrosis and cirrhosis and other fibrotic conditions in man and other mammals.

10 Example l0 Strategy for d~veloping haplotype-~pecific antiPense oligonucleotides Mutation~ in the two genes for type I procollagen cause osteogenesis imperfecta and a subset of osteoporosis, mutations in the gene for type II procollagen cause chondrodysplasias and 15 some forms of osteoarthritis, and mutations in the gene for type III procollagen cause Ehlers-Danlos syndrome type IV and a subset of aneurysms. Also, mutations in the genes for type IV collagen cause the renal disease and other features of the Alport syndrome. Mutations in type IV collagen may also cause 1 20 glomerulonephrosis and more common re~al diseases. Examination i of the collagen mutations causing these diseases, however, has 1 demonstrated that most unrelated probands and families have a i different mutation in the same collagen gene. Therefore, if an antisense oligonucleotide were designed to target the specific 25 base change that causes a disease in a family, a custom-made ' test would have to be made for each family. However, the ? presence of neutral sequence variations in many collagen genes makes it possible to deisign a relatively small panel of oligonucleotides that can be used for many different mutations 30 in different families. As indicated in Table 7, 25 neutral sequence variations have now been identified in the human gene for type II procollagen. The sequence variations occur both in introns and exons of the gene. Similar neutral sequence variations have been seen in most other genes examined. In the 35 case of the cluster of human ~-globin genes, neutral sequence variations in the large cluster of genes have been used to ,~, WO9~/11494 ~ PCT/US93/10756 ~
2148687 ~ ~

define specific haplotypes of the gene, i.e., patterns of neutral variations in and around the genes that can be used to distinguish the gene cluster of one chromosome from another.
Orkin, S., The Molecular Basis of ~3lood Diseases, G.
Stamatoyannopoulos, A.W. Nieehuis, P. Leder and P.W. Majerus, Eds., W.B. Saunders, Philadelphia, 1987, p 166~ It is very likely that the neutral ~equence variants seen in human type II
procollagen gene define specific neutral haplotypes of the gene. For example, the 25 neutral variations shown in Table 7 l0 probably occur within specific patterns in alleles of the gene so that they define many fewer than 25 different alleles. The presence of such neutral variations provides specific target site~ for oligonucleotides to inhibit expre~sion of specific alleles of type II procollagen gene. Therefore, if a disease in a proband or family is-shown to be caused by the mutation in a specific allele, an oligonucleotide targeted to a neutral sequence variation in the same allele will be effective in inhibiting expression of the allele. Therefore, if the 25 neutral variations shown in Table 7 define five specific alleles of collagen II gene, five specific oligonucleotides will be adequate to specifically inhi~it expre3sion of a large number of different mutations that may occur in the same allele.

EFFECTS OF CCI4 AND D~ ON LIVER CONTENT OF COLLAGEN
HYDROXYPROLINE AND STEADY-STATE LEVEL5 OF mRNAs . . _ . _ I
', Stoadv-state hvels of mRNAs , . Lw~r ~ ,~ :
Dayshydroxyproline all) ol~ olllV) o2llV~ B%
, CCI~
. _ .

7 115 + 24 142 + 75 198 :t 89147 + 46 125 + 24 149 :t 54 ., _ .
14 155 + 45 268 + 94 143 + 77 270 + 72 127 + 52 231 ~ 58 . _ .
21 132 + 37 248 + 91 302 :t 38180 $ 52 145 + 34 138 1 42 28 225 + 139 376 + 200 422 + 225193 + 65 98 * 4 79 :~: 25 I . . .
~, 1 4~ 196+35 288+197 343+123272+7~ 125+24 1 115+8 ) -~- W094/~1494 2 1 4 8 6 8 7 PCT/US93/107~6 jr . . . . . . .
DMN
_ _ _. _ 7 156 + 95 180 + 79 105 + 23 233 + 72 142 + 45 169 + 47 _ _ _ _ 14 165 + 37 tS8 ~ 71 146 + 55 171 + 63 118 + 32 278 l 53 _ _ _ . . . . . . _ 21 237 + 112 436 + 273 315 + 60 214 + 67 399 + 68 373 + 143 . ._ 28 236 + 83 1,438 + 386 460 :t 51 451 + 171 153 + 42 253 + 86 _ . _ Values are mean relative to controls + S.D. Values for liver hydroxyproline were first calculated as milligrams of hydroxyproline per gram wet weight of li~er and then as percent of control values.
Arbitrary absorbance units obtained by densitometric scanning of slot blots. Control values were adjusted to 100%.

HISTOLOGICAL FINDINGS OF LIVhRS OF RATS
Inflammation Liv.~r cell Pres.. nce of _ 1 5 ¦ Days dama~ du~tul.-.s Portal Parenchymal Fibrosis CCI, .,~
i 1 71.1 + 0.36 O 0.3 ~: 0.49 0.3 ~ 0.49 O
l _ 1 142.9 + 0.38 0.9 :t 0.38 1.0 ~: 0.58 1.3 + 0.95 0.3 i: 0.39. _ .
I 212.3 t 0.49 1.1 + 1.1 1.4 + 0.98 1.7 + 1.38 1.2 + 0 39 _ 20 1 281.3 + 0.82 0.8 + 0.70 0.9 + 0.69 0.7 + 0.76 1.0 ~: 0.65 _ 422.7 l 0.49 0.9 + 0.38 0.9 + 0.78 0.7 :t 0.76 2.1 + 0.19 ¦ DMN _ ., , _ 1 7 ~2.1 + 0.69` ! 0,3~+ 0.49 1.3 :~ 0.98 ~0.9 + 0.69 ~0.6 + 0,53 :, . I
bi 1 14 2.4 ~: 0.53 0.6 + 0.53 0.9 + 0.38 . 0.4 + 0.53 ~, i I
25 1 21 2.1 + 0.69 0.6 ~ 0.~3 0.9 + 0.69 0.3 + 0.49 1.0 :t O .
28 3.0 + 0 1.6 + 0~53 1.1 + 0.3~ 2.0 ~ 1.0 1.2 + 0.57 l ~' , . - I
-~ Histological findings graded on scale of 0 to +3, with control being 0. Values refer to the mean and standard deviations of seven rats in each treatment group.

;~
-',A

WOg4/11494 PCI'/US93/lV756 ~' 21486~7 TYPE II PROCOLI~GEN NEUTR~ SEQUENCE VARIANIS
. . . _ _ _ _ _--NUCLEOTIDE' ALLELES OBSERVED
REGION POSITION TYPE MAJOR MINOR FREQUENCY VERIFICATION
I . - , _ _ . _ _. , I
Exon 75 ~Gly.60) base substitution C A 0.25 R.E.
5 5B- .
I- ._ __ . _'_ _ Intron 9 + 15 base substitution G A 0.48 R.E.
. _ _ _ _ -. . ~ _ _ .
Intron 9- +42 base del6tion G 0.16 R.E.
l _ _ . .
Exon 21 (GlY22sl base substitutionT C 0.02 R.E.
I~9" . , ~ .
Exon 3 IGlY3~ basa substitutionT G 0.01 R.E.
24"
1- - - ~ - - .- - -Exon 26 3 ~Gly~,2) bas6 substitutionT C 0.1 PCR-I R.E.
I . ___ _ _ Intron 26 -24 base substitution C A 0.1 R.E.
I _ .. . _ _ . _ Intron -47 base substitution C T 0.4 PCR-I R.E.
15 26~
t l __ _ . _ _ _ Exon 30 ~Gly~93)base substitution C T 0.03 RSS
30~
. _ Intron ~
t ¦ 30^ +7 base substltution A C 0.1 RSS
t~ 2 0 Intron 30~ +37 base substitution G T 0.1 RSS
l __ , _ I
Imron 31~ + 7 base substitution G A 0.03 RSS
" ~
I
-~ 2 5 31 ~+ 56 base substitution C T 0.1 R.E.
. 1 / ~ , I i . I
. Intron ~t 31 + 101 base substitution G T/A nd RSS
l ¦¦ Intron ¦ ~179 ¦ b~se delttion G ¦
nd ¦ RSS

3 0 Intron 31- -55 base substitution T G 0.4 RSS
'~' l ~
_ l Intron 31- -54 base deletion G 0.4 RSS
,,, l ,.
,~

~ -" WO 94/11494 2 1 4 8 6 8 7 P~/US93/10756 `:

Intron -49 base submntion C T 0.4 RSS
_ _ . . .
Exon 32 102 ~Gly~ ) bas~ substi~ution T C 0.35 R.E.
, _ . . .. , . . __.
Intron :~2 -22 base substitution G A 0.4 R.E.
, _, _ 5 Intron 32~ -32 base substitution T C 0.4 R.E.
~ . __ .. _. . _ nd = not determined; RSS = reverse strand sequencing; R.E. = restriction ; enzyme analysis; PCR-I R.E. = PCR-introduced restriction enzyme site analysis ' Position for exon is desiynated without a + sign. Position in intron ~ is designated with ^a"-" sign if-the sequence variant is located 5' to the next exon and with a "+" sign if the sequence variant is located 3' to the preceding exon.

* Sequence variants which ar~ new to this report .~

~, ~ .

:3, ,~
, . .

. .~ -~I , .

WO94/11494 PCI'~IJS93/10756 ~ ~

SEQUENCE LISTING

(1) GENERAL INFORMATIO~
(i) APPLIC~NT: Prockop, Darwin J
Colige, Alain, Bacerga, Renato Nugent, Paul (ii) TITLE OF INVENTION: Antisense Oligonucleotides to I~hibit Expression of Mutated and Wild Type Gene~ for Collagen (iii) NUMBER OF SEQUENCES: 23 (i~) CORRESPONDENCE ~DD~ESS:
(A) ADDRESSEE: Woodcock Washburn Kurtz Mackiewicz & Norris (B) STREET: One Liberty Place - 46th Floor (C) CITY: Philadelphia ~D) STATE: PA
(E) COUNTRY: USA
~ (F) ZIP: 19103 j (v) COMPUTER READABLE FORM:
(A) MEDIUM TYPE: DISKBTTE, 3.5 INCH
' (B) COMPUTER: IBM Compatible (C) OPERATING SYST M: PC-DOS
(D) SOFTWARE: WORDPERFECT 5.1 d~ (Vi) CURRE~T APPLICATION D~TA:
(A) APPLICATION NUMBER:
(B) FILING DATE:
(C) CLASSIFICATION:
(vii) PRIOR APPLICATION DATA:
, I
J (A) APPLICATION NUMBER: 07/973,332 ~: (B) FIhING DATE: 09-NOV-1992 (viii) ATTORNEY/AGENT INFORMATION:
(A) NAME: Mark DeLuca ~ (B) REGISTRA$ION NUMBER: 33,229 '~d (C) REFERENOE/DOCKET NUMBER: TJU-0696 ,~1, (ix) TEL~COMMUNICATION INFORM~TION:
~ (A) TELEP~ONE: (215) 568-3100 -.~` WO94/11494 PCI/IJS93/10756 (B) TELEFAX: (215) 5~8-3439 (2) IN~ORMATION FOR S~Q ID NO~
(i) SEQUENCE CXARACTERISTICS:
tA) LENGTH- 16 (B) TYPE: nucleic (C) STRANDEDNESS: double (D) TOPOLOGY: linear (iv) ANTI-SENSE: no (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:

(2) INYOR~ATION FOR S~Q ID NO: 2:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic (C) STRANDEDNESS- double . (D) TOPOLOGY: linear (i~) ANTI-SENSE: no (xi) SEQ~ENCE DESCRIPTION: SEQ ID NO: 2:
i TGAATGCAAA ~G~AAAAA~T
~2) INFORMATION FOR SBQ ID NO: 3:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: ~7 (B) TYPE: nucleic (C) STRANDEDNESS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE:,yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:

(2) INFOR~TSON FOR SEQ ID NO: 4:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 27 (B) TYPE: nucleic (C) STRANDEDNESS: single (D) TOPOLOGY: linear :~ .

WO 94/11494 PCI`/US93~107~

21~8687 - 40 -(iv) ~NTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
CTCCTGACGC ATGGCCAAGA AGACAGT
(2) INFORNATION FOR ~Q ID NO: 5:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic (C) STR~NDEDNESS: single (D~ TOPOLOGY: linear , (iv) ANTI-SENSE: yes (xi) SEOUENCE DESCRIPTION: SEQ ID NO:
ACTGTCTTCG TCTTGGCCCT
(2) INFoRNa~IoN FOR S~Q ID NO: 6:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic (C) STRANDEDNESS: single (D) TOPOLOGY: linear (i~) ANTI-SENSE: yes (xi) SE~ENCE DESCRIPTION: SEQ ID NO:
ATCCTGCTTC GTTCTGGCTC
(2) INFoRMaTIoN FOR SEQ ID ~O: 7:
(i) SEQUEMCE CHARACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic (C) STRAN~DEDNESS:, single (D) TOPOLOGY: linear ,~ (qv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO:
AGGGCCAAGA CGAA~ACAGT
(2) INFOR~A~ION FOR SEQ ID NO: 8:

(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic ~.

~. WO 94/11494 2 1 4 ~ 6 8 7 PCI'/US93/10756 (C) STRANDEDNESS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

(2) INTORMA~ION FOR S~Q ID NO: 9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic (C) STRANDEDN~SS: single (D) TOPOLOGY: linear ~iv) ANTI-SENSE: yes (xi) SEQUEN OE DESCRIPTION: SEQ ID NO: 9:

(2) INFOR~TIO~ FOR SBQ ID NO: 10:
(i) SEQUENCE CKARACTERISTICS:
(A) LEN~TH: 20 (B) ~YPE: nucleic , (C) STRANDEDNESS: single ', (D) TOPO~OGY: linear (iv) ANTI-SENSE: yes , (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:
, TCTTCGTCTT GGC~CTCGAC 20 3 (2) IN~O~MATION FOR SEQ ID NO: 11:
~ (i) SEQVENCE CHARACTERISTICS:
., (A) LENGTH: 15 (8) TYPE: nucleic (C) STRANDEDNESS: Ringle (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi~ SEQUENCE DESCRIPTION: SEQ ID NO: 11:

(2) INFOR~ATION FOR SEQ ID NO: 12:
(i) SEQUENCE CHARACTERISTICS:

.2 ';,.J;' ; ' ' ' ' ' ' ~

WO94/11494 PCI/US93/1075~ 1 214~687 - 42 - I

(A) LENGTH: 18 (B) TYPE: ~ucleic (C) ST~ANDEDN~SS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:
GTCTTGGCCC TCGACTTG ~ 18 (2) INFOR~ATION FOR S2Q ID NO: 13~
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 (8) TYPE: nucleic (C) STRANDEDNESS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ I~ NO: 13:

(2) INFORMATION FOR SEQ ID NO: 14:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 ~: (B) TYPE: nucleic (C) STRANDEDN~SS: single (D) TOPOLOGY: linear ~iv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:

(2) INFO~MATION FOR SEQ ID NO:j15,:
i (i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic (C) STRANDEDNESS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes .
(xi) SEQUENCE DESCRIPTION~ SEQ ID NO: 15:

.p ,~

WO 94/11494 214 8 6 8 7 PCI/US93/10756 r ~ 43 -(2) INFORMATION FOR S~Q ID MO: 16:
(i) SEQUENCE C~ARACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic (C) STRANDEDNESS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) S~QU~NCE DESC~IPTION: SEQ ID NO: 16:

(2) INFORMATION FOR S~Q ID NO: 17:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTX: 11 (B) TYPE: nucleic (C) STRANDEDNESS- single (D) TOPOLOGY: l~near (iv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 17:

j (2) INFORMATION FOR SEQ ID NO: ~8:
~i) SEQUENOE CHARACTERISTICS:
(A~ LENGTH: 11 (B) TYPE: nucieic (C) STRANDEDNESS: single (D) TOPOLOGY: linear j (iv) ANTI-SENSE: yes i (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 18:
,. . .

(2) INFORMA~ON FOR SEQ ID NO: l9:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 19 (B) TYPE: nucleic (C) STRANDEDNESS: single (D) TOPOLOGY: linear . . .
, ~

W094/~1494 PCI/US93/1~756 ~ I
21~8687 (iv) ANTI-SEMSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 19:

(2) INFORMATION FOR SEQ ID NO: 20:
(i) SEQUENCE CHARACTERISTICS~
(A) LENGTH: 20 (B) TYPE: nucleic (C) STRANDEDNESS: single (D~ TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 20:

(2) INFORMA~ION FOR SEQ ID ~O: 21:
(i) SEQUENCE CHARACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic (C) STRANDEDN~SS: single (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) S~QUENCE DESCRIPTION: SEQ ID NO: 21:

(2) INFORMATION FOR S~Q ID NO: 22:
(i) SEQUENCE CH~RACTERISTICS:
(A) LENGTH: 20 (B) TYPE: nucleic (C) STRANDEDNESS: si~gle (D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) SEQU~NCE DESCRIPTION: SEQ ID NO: 22:

ACAAGAGGC~ TGTCTGGTTC 20 ~, ~ (2) INFORMATION FOR SEQ ID NO: 23:
.;

. . .

-~ r WO 94/11494 2 1 4 ~ 6 ~ 7 PCr/US93/10756 ~ 45 ~
(i) SEQUENCE CHARACTERISTICS:
(A) L~Gl~I: 19 (B) ~PE: nucleic (C) STRANDEDN~3SS: single (D) TOPOLOGY: linear ( iv) ANTI - SENSE: yes (xi) SEQI~ENCE DESCRIPTION: SEQ ID NO: 23:
ATCTGTGACG AG~CCAA~:A 19 .

~
i,~.~, ~,~

Ss~
~ ~ .
. ~
. :r~:

~, j . ~

J~
. ~ .
'" .

~ '

Claims (23)

What is claimed:

1. An oligonucleotide comprising 5 to 200 nucleotides substantially complementary to a mutant collagen nucleotide sequence or a normal wild type collagen nucleotide sequence which is capable of inhibiting expression of collagen gene expression.

2. The oligonucleotide of Claim 1 substantially complementary to a nucleotide sequence of type I procollagen, type II procollagen, type III pro collagen or type IV
collagen.

3. The oligonucleotide of Claim 1 wherein said mutant collagen nucleotide sequence comprises a collagen gene expression or coding sequence.

4. The oligonucleotide of Claim 1 comprising SEQ ID
NO: 18.

5. The oligonucleotide of Claim 1 comprising a sequence selected from the group consisting of SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID
NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID
NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:19, SEQ ID
NO:20, SEQ ID NO:21, SEQ ID NO:22 and SEQ ID NO:23.

6. The oligonucleotide of Claim 1 in a pharmaceutically acceptable carrier or diluent.

7. A method of inhibiting mutant collagen gene expression which comprises contacting a cell containing a mutant collagen gene with a mutant collagen gene expression inhibitory amount of an oligonucleotide substantially complementary to a mutant collagen nucleotide sequence and not perfectly complementary to a wild type collagen nucleotide sequence.

8. The method of Claim 8 wherein said mutant collagen nucleotide sequence comprises a collagen gene expression control sequence or coding sequence.

9. The method of Claim 8 wherein said oligonucleotide comprises SEQ ID NO: 18.

10. The method of Claim 8 wherein said oligonucleotide comprises 5 to 200 nucleotide

11. A method for treating a disease exhibiting mutant collagen gene expression which comprises administering to a mammal suffering from the disease a mutant collagen gene expression inhibitory amount of an oligonucleotide substantially complementary to a mutant collagen nucleotide sequence.

12. The method of Claim 11 wherein said oligonucleotide is substantially complementary to a nucleotide sequence of type I procollagen, type II
procollagen, type III procollagen or type IV collagen.

13. The method of Claim 11 wherein said mutant collagen nucleotide sequence comprises a collagen gene expression control sequence or coding sequence.

14. The method of Claim 11 wherein said oligonucleotide comprises SEQ ID NO: 18.

15. The method of Claim 11 wherein said oligonucleotide comprises 5 to 200 nucleotides;

16. A method of inhibiting normal collagen gene expression which comprises contacting a cell containing a normal collagen gene with a collagen gene expression inhibitory amount of an oligonucleotide substantially complementary to a collagen nucleotide sequence.

17. The method of Claim 16 wherein said oligonucleotide is substantially complementary to a nucleotide sequence of type I procollagen, type II
procollagen, type III procollagen or type IV collagen.

18. The method of Claim 16 wherein said collagen nucleotide. sequence comprises a collagen gene expression control or coding sequence.

19. The method of Claim 16 wherein said oligonucleotide comprises 5 to 200 nucleotides.

20. A method for treating a disease characterized by the overexpression of a collagen gene comprising administering to a mammal suffering from the disease a collagen gene expression inhibitory amount of an oligonucleotide substantially complementary to a collagen gene nucleotide sequence.

21. The method of Claim 20 wherein said oligonucleotide is substantially complementary to a nucleotide sequence of type I procollagen, type II
procollagen, type III procollagen or type IV collagen.

22. The method of Claim 20 wherein said collagen nucleotide sequence comprises a collagen gene expression control sequence or coding sequence.

23. The oligonucleotide of Claim 20 comprising 5 to 200 nucleotides.