EP1228088A2 - Nouvelles proteines de la famille traf - Google Patents

Nouvelles proteines de la famille traf

Info

Publication number
EP1228088A2
EP1228088A2 EP00975594A EP00975594A EP1228088A2 EP 1228088 A2 EP1228088 A2 EP 1228088A2 EP 00975594 A EP00975594 A EP 00975594A EP 00975594 A EP00975594 A EP 00975594A EP 1228088 A2 EP1228088 A2 EP 1228088A2
Authority
EP
European Patent Office
Prior art keywords
tpbd
traf
protein
cell
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00975594A
Other languages
German (de)
English (en)
Inventor
Juan M. Zapata
John C. Reed
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sanford Burnham Prebys Medical Discovery Institute
Original Assignee
Sanford Burnham Prebys Medical Discovery Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sanford Burnham Prebys Medical Discovery Institute filed Critical Sanford Burnham Prebys Medical Discovery Institute
Publication of EP1228088A2 publication Critical patent/EP1228088A2/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4747—Apoptosis related proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/02—Immunomodulators
    • A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00—Drugs for immunological or allergic disorders
    • A61P37/08—Antiallergic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7151—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for tumor necrosis factor [TNF], for lymphotoxin [LT]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide

Definitions

  • This invention relates generally to the fields of molecular biology and molecular medicine and more specifically to proteins involved in the regulation of immunological response and cell death.
  • Tumor Necrosis Factor (TNF) family cytokines play an important role in a wide variety of immunological, allergic, and inflammatory responses.
  • TNF Tumor Necrosis Factor
  • Several members of the TNF family have been identified, including TNF ⁇ , Lymphotoxin- ⁇ , Lymphotoxin- ⁇ , LIGHT, CD27 Ligand (CD27L) , CD30L, CD40L, Fas-L, Trail, and others. These molecules are generally produced as Type-II integral membrane proteins on the surface of cells, undergoing subsequent release into the excellular milieu as a result of proteolytic cleavage.
  • Many of the TNF-family cytokines however remain anchored in the plasma membrane, relying on interactions with receptor-bearing cells through cell-cell contact.
  • TNF-family cytokines The receptors for TNF-family cytokines are equally diverse. All members of the family have a conserved arrangement of cysteines in their extracellular domains, which is one of the criteria for membership in this family.
  • the intraceUular cytosolic domain of TNF-family receptors are diverse in their amino acid sequences, but can be broadly classified into two types: (a) those that contain a protein-interaction module known as a Death-Domain (TNFR1, Fas, DR3, DR4 , DR5) and those that do not (TNFR2, CD27, CD30, CD40, LT ⁇ R, 4B1 and others) .
  • Death Domains are responsible for interactions of a subgroup of the TNF-Receptor (TNFR) family with adapter proteins which bind in turn to caspase-family intraceUular proteases involved in inducing apoptosis (programmed cell death) .
  • the Death Domains can also mediate binding to other types of adaptor molecules which bind kinases or other types of signaling molecules rather than proteases.
  • TRAF-family proteins contain a protein interaction domain known as the TRAF-domain that mediates their binding to the cytosolic domains of TNF-family receptors. The TRAF domain also allows for interactions among TRAF-family members, creating opportunities for homo- and hetero-oligomerization that can have important functional consequences. In humans and mice, six members of the TRAF-family proteins
  • TRAF family have been described, including TRAF1, TRAF2 , TRAF3, TRAF4, TRAF5, and TRAF6.
  • the crystal structure of the TRAF domain of TRAF2 has been solved, revealing a trimeric assembly with 3-fold symmetry and demonstrating the presence of a surface pocket on each monomer that accounts for binding to discrete peptidyl motifs found within the cytosolic domains of many members of the TNF-family receptors.
  • Some TRAF family proteins physically associate with protein kinases and control the activation of these kinases.
  • TRAF2, TRAF5, and TRAF6 for example have been reported to be capable of inducing the activation of kinases involved in activation of: (a) several members of the stress-kinase family, such as the Jun N-terminal kinase (JNK), and (b) phosphorylation of I ⁇ B, an inhibitor of the transcription factor NF- ⁇ B.
  • JNK Jun N-terminal kinase
  • TRAF1, TRAF3, and TRAF4 do not activate these kinase, and in some contexts, may interfere with kinase activation by other TRAFs.
  • All kinase-activating members of the TRAF family contain additional protein domains (besides the TRAF-domain) which are important for their function as kinase-activators, including a RING domain and sometimes zinc-finger domains.
  • TRAF-family proteins Gene knock-out studies in mice have demonstrated critical roles for several of the TRAF-family proteins in signal transduction pathways stimulated by TNF-family receptors. Moreover, mutational analyses of the TRAF-binding sites within the cytosolic domains of TNF-family receptors have also provided evidence that interactions of TRAFs with these receptors are critical for many of the biochemical signal-transduction and cellular biological responses induced via TNF-family receptors.
  • TRAF6 interacts with a Death Domain-containing adapter protein (MyD88) and a Death Domain-containing protein kinase (IRAK) which are critical for NF- ⁇ B induction by IL-1 receptors.
  • MyD88 Death Domain-containing adapter protein
  • IRAK Death Domain-containing protein kinase
  • TRAFs may in some instances participate in signal transduction by other cytokine receptors beside those of the TNFR family.
  • some TRAFs bind to viral proteins, suggesting that such protein interactions may play a role the mechanisms employed by viruses to either evade immune surveillance mechanisms or in virus-mediated malignant transformation.
  • TRAF family proteins or TRAF protein binding domains A need exists, therefore, to identify novel TRAF family proteins or TRAF protein binding domains.
  • the present invention satisfies this need and provides additional advantages as well.
  • novel TRAF-Protein-Binding-Domain polypeptides TPBDs
  • the invention also provides nucleic acid molecules encoding TPBDs, vectors containing these nucleic acid molecules and host cells containing the vectors.
  • the invention also provides antibodies that can specifically bind to invention TPBDs.
  • Such TPBDs and/or anti-TPBD antibodies are useful for discovery of drugs that suppress autoimmunity, inflammation, allergy, allograph rejection, sepsis, and other diseases.
  • the present invention also provides a screening assay useful for identifying agents that can effectively alter the association of an invention TPBD with itself or with other proteins.
  • an effective agent may increase or decrease the activation of kinases, or modulate cellular pathways that effect apoptosis, cell proliferation, cell adhesion, cell stress responses, B cell immunoglobulin class switching, and the like.
  • the invention also provides methods of altering the activity of TPBD in a cell, wherein such increased or decreased activity of TPBD can modulate the level of kinase activity or cellular pathways that effect apoptosis, cell proliferation, cell adhesion, cell stress responses, B cell immunoglobulin class switching, and the like.
  • the activity of TPBD in a cell can be increased by introducing into the cell and expressing a nucleic acid sequence encoding this polypeptide or proteins comprising such TPBD.
  • the activity of TPBD or TPBD-comprising proteins in a cell can be decreased by introducing into the cell and expressing an antisense nucleotide sequence that is complementary to a portion of a nucleic acid molecule encoding the TPBD or TPBD-comprising proteins.
  • the invention also provides methods for using an agent that can specifically bind TPBD or a nucleotide sequence that can bind to a nucleic acid molecule encoding TPBD to diagnose a pathology that is characterized by an altered level of apoptosis, cell proliferation, cell adhesion, cell stress responses and B cell immunoglobulin class switching due to an increased or decreased level of TPBD in a cell.
  • FIG. 1 shows a schematic representation of the structure of newly identified TRAF proteins referred to as HAUSP (SEQ ID NO:8) (also known as USP7), SPOP (SEQ ID NO:10) and TRAF 7 (SEQ ID NO: 12); and additionally, TRAF 1 and TRAF 2, showing in shaded boxes the relative positions of the indicated protein domains: TRAF domain, protease domain, ring finger, Z-b box, zinc finger, poly- acidic domain, coiled coil, and nuclear localization signal .
  • HAUSP SEQ ID NO:8
  • SPOP SEQ ID NO:10
  • TRAF 7 SEQ ID NO: 12
  • TRAF 1 and TRAF 2 showing in shaded boxes the relative positions of the indicated protein domains: TRAF domain, protease domain, ring finger, Z-b box, zinc finger, poly- acidic domain, coiled coil, and nuclear localization signal .
  • FIG. 2 shows amino acid sequences of the TRAF domains of TRAF 7 (SEQ ID NO:25) (also known as KIAA) , HAUSP (SEQ ID NO:23) (also known as USP7), and SPOP (SEQ ID NO: 24) in alignment with TRAF domains of six other known human TRAF proteins (hTltd through hT ⁇ td, SEQ ID NOS:26-31). Dark boxes indicate identical residues between family members. Light boxes indicate structurally related residues.
  • Figure 3 shows the predicted amino acid sequence of TRAF7 (SEQ ID NO: 32, corresponding to amino acids 16-979 of SEQ ID NO: 6).
  • the different protein domains and regions of the protein are indicated: ring finger domain (amino acids 15-55); ZF-B Box domain (amino acids 90-132); coiled coil (amino acids 132-177); coiled coil (amino acids 195-231); two leucine zipper domains. (amino acids 197-218 and 222-245); TRAF domain (amino acids 277-403); coiled coil (amino acids 427-446); and two poly-acidic regions (amino acids) (amino acids 868- 964) .
  • Figure 4 shows Northern blot analysis of the mRNA levels of TRAF7, USP7 and SPOP in human tissues.
  • TRAF-protein-binding-domains TPBDs
  • TRAF domains of TRAF7 or TRAF2 were expressed in 293 cells. Bound TRAF proteins were detected by SDS-PAGE and fluorography .
  • Figure 6 shows an analysis of the binding of human TRAF proteins 1-6 and I-TRAF (Rothe et al . , Proc. Natl. Acad. Sci. USA 93:8241-8246 (1996)) to TRAF-7,
  • HAUSP and SPOP HAUSP and SPOP.
  • GST-TRAF7 (282-435), GST HAUSP (1-213) and SPOP (1-180) proteins immobilized on glutathione- Sepharose were incubated with in vitro translated 35 S-TRAF proteins and I-TRAF, as indicated. Bound TRAF proteins were detected by SDS-PAGE and fluorography .
  • FIG. 7 shows that TPBDs of HAUSP, SPOP and TRAF7 can specifically inhibit the NF- ⁇ B activity induced by TRAF containing proteins.
  • FIG. 7 shows that TPBDs of HAUSP, SPOP and TRAF7 can specifically inhibit the NF- ⁇ B activity induced by TRAF containing proteins.
  • FIG. 7 shows that TPBDs of HAUSP, SPOP and TRAF7 can specifically inhibit the NF- ⁇ B activity induced by TRAF containing proteins.
  • FIG. 7 shows that TPBDs of HAUSP, SPOP and TRAF7 can specifically inhibit the NF- ⁇ B activity induced by TRAF containing proteins.
  • FIG. 7 shows that TPBDs of HAUSP, SPOP and TRAF7 can specifically inhibit the NF- ⁇ B activity induced by TRAF containing proteins.
  • FIG. 7 shows that TPBDs of HAUSP, SPOP and TRAF7 can specifically inhibit the NF- ⁇ B activity induced by TRAF containing proteins.
  • FIG. 7 shows that TPBD
  • Figure 8 shows the effect of TRAF7 and USP7 in regulating NFKB activity induced by TRAF2 and TRAF6 in a mammalian cell line.
  • Figure 9 shows the effect of the TRAF domains of TRAF7, USP7 and SPOP in regulating the NFKB activity induced by TNF ⁇ or CD40 overexpression.
  • Figure 10 shows regulation of NIK induced NFKB activation by TRAF7 and USP7.
  • FIG. 11 shows the subcellular localization of different TRAF7 deletion mutants.
  • Figure 12 shows the subcellular localization of different domains of USP7.
  • TPBDs novel TRAF-jorotein-binding-domains of newly identified TRAF proteins, and fragments thereof.
  • an invention TPBD refers to a peptide region that binds to one or more TRAF proteins.
  • TPBDs share sequence homology with the C-TRAF domain of TRAF proteins, and have been found herein to have binding properties similar to those of other known TRAF proteins.
  • This domain corresponds to the portion of the TRAF domain commonly referred to as the C-TRAF or TRAF-C domain (Arch et al . , supra . ; and Wajant et al . , Cytokine Growth Factor Rev. 10:15-26 (1999), each of which is incorporated herein by reference) .
  • Previously characterized human TRAF domain proteins have also been found to have N-TRAF domains immediately amino-terminal of the C-TRAF domain.
  • TRAF proteins were initially identified as a family of proteins that are associated with members of the TNF-receptors family. TRAF proteins are known to influence a variety of cellular processes such as class switching in B cells, apoptosis, cell proliferation, and stress response (Arch et al . , Genes Dev. 12:2821-2830
  • TRAF proteins thus represent an important class of intraceUular proteins that mediate the signal transduction of cell surface receptors such as TNFR-family members that ultimately influence a variety of cellular processes.
  • TRAF domain proteins In addition to binding TNF-family receptors, TRAF domain proteins also interact with other TRAF domain proteins. For example, TRAF 1, TRAF 2 and TRAF 3 all have been shown to homo-oligomerize . TRAF 2 has further been demonstrated capable of hetero-oligomerization with TRAF 1 and TRAF 5. As shown herein, TRAF domains of the present invention have all been demonstrated as capable of interacting with other TRAF-domain proteins.
  • invention TPBDs have been found to associate with other proteins, including proteins comprising TRAF domains.
  • Exemplary TRAF proteins to which invention TPBDs bind are human TRAF1, TRAF2, TRAF3, TRAF4, TRAF5 or TRAF6.
  • bind or "binding" refers to the association of an invention TPBD with another protein relatively specifically and, therefore, can form a bound complex.
  • the binding of a TPBD to a TRAF protein is sufficiently specific such that the bound complex can form in vivo in a cell or in vi tro under suitable condition.
  • HAUSP TPBD (SEQ ID NOS : 8 or 23) binds TRAF1, TRAF2, TRAF3, TRAF , TRAF5 and TRAF6, and can inhibit the NF-KB activation activity of TRAF2, TRAF5 and TRAF6.
  • SPOP TPBD domain (SEQ ID NOS: 10 or 24) binds TRAF1 and TRAF6, and can inhibit the NF- ⁇ B activation activity of TRAF6.
  • TRAF-7 TPBD (SEQ ID NOS: 12 or 25) binds TRAF1, TRAF2, TRAF3, TRAF4, TRAF5 and TRAF6, and can inhibit the NF- ⁇ B activation activity of TRAF2 and TRAF6, and can increase the NF- ⁇ B activation activity of TRAF5. Furthermore, it has been found that the TRAF domain of TRAF7 and USP7 can inhibit the NF- ⁇ B activation induced by TNF ⁇ and CD40 overexpression, whereas the TRAF domain of SPOP showed no inhibitory activity.
  • TRAF7 TRAF7
  • TRAF domain of TRAF7 TRAF7
  • TRAF domain of USP7 HUSP7
  • the invention provides TPBDs that can be used to inhibit NIK-induced NFKB activation.
  • invention TPBDs also bind to TNF receptor family proteins.
  • the SPOP TPBD of SEQ ID NO: 10 binds TNF-R2
  • the TRAF-7 TPBD (SEQ ID NOS: 12 or 25) binds to TNF-R2, CD40, lymphotoxin- ⁇ R, NGFRp75 and DR
  • the TRAF domain of TRAF7 also binds with itself.
  • TRAF proteins generally, are known to bind to a wide variety of cell- surface receptors, and in particular, with cytokine receptors of the TNF receptor family.
  • TRAF proteins are known to bind are: TNFR1, TNFR2, CD27, CD30, CD40, 4-1BB, Ox40, LT- ⁇ R, Fas, DR3, DR4, DR5, HVEM, LMP-1 and IL-lR.
  • TRAF proteins have been observed to bind to all members of the TNF receptor family that do not comprise a death domain.
  • invention TPBDs also bind one or more receptors selected from TNFR1, TNFR2, CD27, CD30, CD40, 4-1BB, Ox40, LT- ⁇ R, Fas, DR3, DR4, DR5, HVEM, LMP-1, IL-lR, and members of the TNF receptor family that do not comprise a death domain.
  • invention TPBDs have been found to bind to TRAF- associated proteins.
  • TRAF-7 TPBD SEQ ID NOS: 12 or 25
  • TRAF proteins generally are known to interact with numerous TRAF- associated proteins, such as TRADD, FADD, I-TRAF, TRIP, A20, c-IAPl, C-IAP2, Casper, RIP, RIP2, NIK, Peg3, GCK, NIK, ASKl and IRAK.
  • TPBDs also bind one or more TRAF-associated proteins selected from TRADD, FADD, I-TRAF, TRIP, A20, c-IAPl, c- IAP2, Casper, RIP, RIP2, NIK, Peg3, GCK, NIK, ASKl and IRAK.
  • an invention TPBD is characterized as having the sequence: E(X) 17 _ 21 LX (X) 3 VXP(X) 15 . 16 L(X) 24 _ 28 K(X) 15 . 16 (SEQ ID NO: 19), where X is any amino acid.
  • an invention TRAF domain is characterized as having the sequence:
  • an invention TRAF domain has the sequence: E (X) 10 _ 13 S (X) 6 _ 7 LXW (X) 3 VXP (x) 10 _ n S(X) 4 L(X) 24 _ 28 K(X) 9 _ 10 F(X) 5 WG(X) 3 F(X) 16 D(X) 5 _ 7 V (SEQ ID NO:21), where X is any amino acid.
  • an invention TRAF domain has the following sequence: E (X) 4 (X A ) (X) 5 _ 8 SX(X B ) (X) 4 _ 5 LXWX(X A )XVXP(X) 10 _ n S(X A ) (X) 3 L(X) 16 _ 18 (X A ) (X) 4 _ 6 (X C ) (X) 2 K(X) 9 _ 10 F(X) 5 G(X D ) (X) 2 F(X) 5 (X A )X(X C ) (X) 7 (X C ) DX(X A ) (X) 2 .
  • TRAF domain comprises the sequence SEQ ID NOS : 8 , 10, 12, 23, 24 or 25.
  • TRAF domain proteins generally, are well known in the art to modulate the activity of NF- ⁇ B and JNK.
  • invention TPBDs, HAUSP (preferably SEQ ID NOS : 8 or 23), SPOP (SEQ ID NOS: 10 or 24), and TRAF-7 (SEQ ID NOS: 12 or 25) have been found to modulate the activity NF- ⁇ B or cJun N-terminal kinase (JNK) .
  • TPBDs modulate a variety of cellular pathways .
  • TRAF domain proteins generally, are well known in the art as modulating the cellular pathways that effect apoptosis, cell proliferation, cell adhesion, cell stress responses and B cell immunoglobulin class switching, and NF-kB and JNK are further known to modulate these pathways.
  • TPBDs modulate one or more cellular pathways that effect apoptosis, cell proliferation, cell adhesion, cell stress responses and B cell immunoglobulin class switching.
  • TRAF domains of the invention include amino acid sequences that comprise substantially the same protein sequence set forth in SEQ ID NOS:8, 10, 12, 23, 24 and 25, as well as biologically active, modified forms thereof.
  • invention TPBDs include proteins comprising TPBD fragments having the sequence SEQ ID NO:19 or SEQ ID NO:20, which retain at least one native biological TPBD activity, such as immunogenicity, the ability to bind to a TNF family receptor, the ability to bind a TRAF domain protein, the ability to bind a TRAF-associated protein, the ability to modulate NF- ⁇ B activity or JNK activity, the ability to modulate apoptosis, cell proliferation, cell adhesion, cell stress responses or B cell immunoglobulin class switching, provided the TRAF protein is no longer than 213 amino acids .
  • native biological TPBD activity such as immunogenicity, the ability to bind to a TNF family receptor, the ability to bind a TRAF domain protein, the ability to bind a TRAF-associated protein, the ability to modulate NF- ⁇ B activity or JNK activity, the ability to modulate apoptosis, cell proliferation, cell adhesion, cell stress responses or B cell immunoglobulin class switching, provided the
  • DNA, RNA, polypeptides or proteins are useful in ways described herein that the DNAs, RNAs, polypeptides or proteins as they naturally occur are not.
  • eukaryotic refers to the variety of species from which an invention TPBD is derived, e.g., yeast, slime mold, plant, insect, nematode, mammal, and the like.
  • a preferred TPBD herein, is mammalian TRAF.
  • TPBD telomere kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase kinase, a preferred invention TPBD is derived, e.g., human, rat, mouse, rabbit, monkey, baboon, bovine, porcine, ovine, canine, feline, and the like.
  • a more preferred TPBD herein, is human TRAF.
  • TPBD biologically active or “functional”, when used herein as a modifier of invention TPBD(s), or polypeptide fragment thereof, refers to a polypeptide that exhibits functional characteristics similar to a TPBD.
  • one biological activity of a TPBD is the ability to bind, preferably in vivo, to a TRAF protein. Such TRAF binding activity can be assayed, for example, using the methods described in the Examples described herein.
  • TRAF Another biological activity of TRAF is the ability to act as an immunogen for the production of polyclonal and monoclonal antibodies that bind specifically to an invention TPBD.
  • an invention TPBD will encode a polypeptide specifically recognized by an antibody that also specifically recognizes the TPBD having the amino acid sequence SEQ ID NO: 19 or SEQ ID NO:20, preferably including an amino acid set forth in SEQ ID NOS:8, 10, 12, 23, 24 or 25.
  • Such immunologic activity may be assayed by any method known to those of skill in the art.
  • a test-TPBD polypeptide can be used to produce antibodies, which are then assayed for their ability to bind to an invention TPBD comprising SEQ ID NO: 19 or SEQ ID NO:20, preferably including a sequence set forth in SEQ ID NOs:8, 10, 12, 23, 24 or 25. If the antibody binds to the test-polypeptide and a protein including the sequence SEQ ID NO: 19 or SEQ ID NO: 20, and preferably also a protein including SEQ ID NOS:8, 10, 12, 23, 24 or 25 with substantially the same affinity, then the polypeptide possesses the requisite immunologic biological activity.
  • the TPBD containing protein set forth in SEQ ID NO: 2 was initially identified as a herpes-associated ubiquitin-specific protease (HAUSP) associated with the nuclear domain of the PML protein and with Herpes simplex virus type 1 protein VmwllO (Everett et al . , EMBO J. 16:566-577 (1997)).
  • HUSP herpes-associated ubiquitin-specific protease
  • VmwllO Herpes simplex virus type 1 protein
  • the TPBD containing protein set forth in SEQ ID NO: 4 was initially identified in serum from a scleroderma patient as having a speckled pattern in nuclei, and was termed a speckle-type POZ jorotein, or SPOP (Nagai et al . , FEBS Lett. 418:23-26 (1997)).
  • the POZ domain of SPOP has an undetermined function, but the protein was found to be widely expressed.
  • the TPBD containing protein set forth in SEQ ID NO: 6 was identified as having a leucine-zipper region, a zinc finger region and a leucine zipper-like K-box region (Nagase et al . , DNA Res. 5:355-364 (1998)). Initially named KIAA0898, this protein is also referred to herein as TRAF7.
  • TRAF7 was also found to have a number of previously unrecognized domains (see Figure 3) .
  • the existence of a RING finger domain (amino acids 15-55) close to the N-terminus of TRAF7 was previously known.
  • TRAF7 is KIAA0898, which was described in the database as a RING finger protein of unknown function. Besides this domain, several other new protein domains were identified in this molecule.
  • the RING finger domain is followed by a ZF-BBox domain (amino acids 90-132) and a coiled coil (amino acids 132-177). These three protein domains form what is denominated the tripartite motif.
  • the tripartite motif has been found in a very restricted list of proteins, including transcription factors, ribonucleoproteins, and oncoproteins and appears to be involved in protein- protein interaction (Borden, Biochem. Cell. Biol. 76:351- 358 (1998)). After the tripartite motif, a second coiled coil (amino acids 195-231) is found. Two putative leucine zipper domains are also found in this region of the protein (amino acids 197-218 and 222-245) . The TRAF domain (amino acids 277-403) is located after the leucine zippers.
  • TRAF domain is followed by another coiled coil (amino acids 427-446) and by two regions rich in acidic residues (amino acids 452-577 and 868-964). Therefore, in addition to TRAF domains, including the TRAF domain of TRAF7 (SEQ ID NOS:12 or 25), the invention also provides additional functional domains of TRAF7 , including a ZF-BBox domain (amino acids 90-132 of SEQ ID NO:32); coiled coil domains (amino acids 132-177, 195-231 and 427-446 of SEQ ID NO:32); leucine zipper domains (amino acids 197-218 and 222-245 of SEQ ID NO:32); and poly-acidic domains (amino acids 452-577 and 868-964 of SEQ ID NO:32) .
  • ZF-BBox domain amino acids 90-132 of SEQ ID NO:32
  • coiled coil domains amino acids 132-177, 195-231 and 427-446 of SEQ ID NO:32
  • the invention TPBD (SEQ ID NOS: 8 or 23) can bind all known human TRAF proteins (i.e., TRAF proteins 1 through 6), although the TRAF domain of HAUSP (SEQ ID NOS : 8 or 23) binds TRAF 3 somewhat weakly, and binds TRAF 6 quite strongly.
  • the invention TPBD of HAUSP (SEQ ID NOS : 8 or 23) has also been found to inhibit NF- ⁇ B activation mediated by any of TRAF2, TRAF5 or TRAF6.
  • the TPBD of TRAF7 (SEQ ID NOS: 12 or 25) also was found to inhibit NFKB activation mediated by TRAF2 or TRAF6 (see Examples) .
  • the invention TPBD of SPOP shows selectivity in TRAF protein interaction, binding human TRAF 1 and TRAF 6, but not human TRAF proteins 2, 3, 4 or 5.
  • the invention TPBD of SPOP (SEQ ID NOS: 10 or 24) has also been found to be specific in TNF-receptor interaction, binding TNF-receptor 2, but not FAS, CD40, lymphotoxin- ⁇ receptor, NGF receptor and DR4.
  • the invention TPBD of SPOP (SEQ ID NOS: 10 or 24) has also found to inhibit NF- ⁇ B activation mediated by TRAF6.
  • the invention TPBD of TRAF7 (SEQ ID NOS: 12 or 25) binds all known human TRAF proteins, but binds TRAF 2 somewhat weakly, and binds TRAF 6 quite strongly.
  • the invention TPBD of SPOP (SEQ ID NOS: 10 or 24) also binds numerous members of the TNF-receptor family, including TNF- receptor 2, CD40 (albeit weakly), lymphotoxin- ⁇ receptor, NGF receptor and DR4, but not to FAS.
  • the invention TPBD of SPOP (SEQ ID NOS:10 or 24) has also been demonstrated to inhibit NF- ⁇ B activation by either TRAF2 or TRAF6.
  • the term "substantially the same amino acid sequence” refers to amino acid sequences having at least about 70% identity with respect to the reference amino acid sequence, and retaining comparable functional and biological activity characteristic of the protein defined by the reference amino acid sequence.
  • proteins having "substantially the same amino acid sequence” will have at least about 80%, more preferably 90% amino acid identity with respect to the reference amino acid sequence; with greater than about 95% amino acid sequence identity being especially preferred. It is recognized, however, that polypeptides (or nucleic acids referred to hereinbefore) containing less than the described levels of sequence identity arising as splice variants or that are modified by conservative amino acid substitutions, or by substitution of degenerate codons are also encompassed within the scope of the present invention.
  • TPBDs can be isolated by a variety of methods well-known in the art, e.g., recombinant expression systems described herein, precipitation, gel filtration, ion-exchange, reverse- phase and affinity chromatography, and the like. Other well-known methods are described in Deutscher et al . , Guide to Protein Purification: Methods in Enzymoloqy Vol. 182, (Academic Press, (1990)), which is incorporated herein by reference. Alternatively, the isolated polypeptides of the present invention can be obtained using well-known recombinant methods as described, for example, in Sambrook et al . , supra . , 1989) .
  • An example of the means for preparing the invention TPBD(s) is to express nucleic acids encoding the TPBD in a suitable host cell, such as a bacterial cell, a yeast cell, an amphibian cell (i.e., oocyte) , or a mammalian cell, using methods well known in the art, and recovering the expressed polypeptide, again using well-known methods.
  • a suitable host cell such as a bacterial cell, a yeast cell, an amphibian cell (i.e., oocyte) , or a mammalian cell
  • invention polypeptides can be isolated directly from cells that have been transformed with expression vectors as described below herein.
  • the invention polypeptide, biologically functional fragments, and functional equivalents thereof can also be produced by chemical synthesis.
  • synthetic polypeptides can be produced using Applied Biosystems, Inc. Model 430A or 431A automatic peptide synthesizer (Foster City, CA) employing the chemistry provided by the manufacturer .
  • TPBD functional fragments or polypeptide analogs thereof.
  • the term "functional fragment” refers to a peptide fragment that is a portion of a full length TPBD, provided that the portion has a biological activity, as defined above, that is characteristic of the corresponding full length protein.
  • a functional fragment of an invention TPBD can have an activity such as the ability, for example, to bind a TNF-family receptor, to bind another TRAF protein, to bind a TRAF-associated protein, or to modulate NF- ⁇ B activity or JNK activity, or to modulate the level of cell proliferation, apoptosis, cell adhesion, cell stress responses , class switching, and the like.
  • the characteristic of a functional fragment of invention TPBDs to elicit an immune response is useful for obtaining an anti-TPBD antibodies.
  • the invention also provides functional fragments of invention TPBDs, which can be identified using the binding and routine methods, such as bioassays described herein.
  • polypeptide analog includes any polypeptide having an amino acid residue sequence substantially the same as a sequence specifically shown herein in which one or more residues have been conservatively substituted with a functionally similar- residue and which displays the ability to functionally mimic a TPBD as described herein.
  • conservative substitutions include the substitution of one non-polar (hydrophobic) residue such as isoleucine, valine, leucine or methionine for another, the substitution of one polar (hydrophilic) residue for another such as between arginine and lysine, between glutamine and asparagine, between glycine and serine, the substitution of one basic residue such as lysine, arginine or histidine for another, or the substitution of one acidic residue, such as aspartic acid or glutamic acid for another.
  • the amino acid length of functional fragments or polypeptide analogs of the present invention can range from about 5 amino acids up to one residue less than a full-length protein sequence of an invention TPBD.
  • the amino acid lengths include, for example, at least about 10 amino acids, at least about 20, at least about 30, at least about 40, at least about 50, at least about 75, at least about 100, at least about 150, at least about 200, at least 213, at least about 250, at least about 300, at least about 350 or more amino acids in length up to one residue less than a full-length TPBD-containing protein sequence, provided as sequence SEQ ID NO:2, 4 or 6.
  • a fragment comprises a sequence selected from SEQ ID NO: 19, 21 or 22.
  • Such a fragment can also include at least about 10 residues at its amino- terminus, carboxy-terminus, or both; at least about 20 residues at its amino-terminus, carboxy-terminus, or both; at least about 30 residues at its amino-terminus, carboxy-terminus, or both; at least about 40 residues at its amino-terminus, carboxy-terminus, or both; at least about 50 residues at its amino-terminus, carboxy- terminus, or both; at least about 60 residues at its amino-terminus, carboxy-terminus, or both.
  • a fragment comprises a sequence selected from SEQ ID NO: 19, 21 or 22, further comprising one or more domains selected from N-TRAF, Ring Finger, Zinc finger, coiled-coil, POZ, and USP.
  • a fragment has at least one fewer domains than the domains in proteins from SEQ ID NO: 2, 4 or 6, wherein the domains are selected from N-TRAF, Ring Finger, Zinc finger, coiled-coil, POZ, and USP.
  • domains are known in the art, as exemplified in Arch et al., supra . ; and ajant et al., supra .
  • the phrase "conservative substitution” also includes the use of a chemically derivatized residue in place of a non-derivatized residue, provided that such polypeptide displays the required binding activity.
  • chemical derivative refers to a subject polypeptide having one or more residues chemically derivatized by reaction of a functional side group.
  • derivatized molecules include, for example, those molecules in which free amino groups have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl groups, chloroacetyl groups or formyl groups.
  • Free carboxyl groups may be derivatized to form salts, methyl and ethyl esters or other types of esters or hydrazides. Free hydroxyl groups may be derivatized to form O-acyl or O-alkyl derivatives. The imidazole nitrogen of histidine may be derivatized to form N-im-benzylhistidine . Also included as chemical derivatives are those peptides which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids.
  • Polypeptides of the present invention also include any polypeptide having one or more additions and/or deletions of residues, relative to the sequence of a polypeptide whose sequence is shown herein, so long as the required activity is maintained.
  • invention TPBD-containing TRAF proteins refer to a protein comprising an invention TPBD including SEQ ID NO: 19 or including SEQ ID NO:20, or a recombinantly produced invention TPBD-containing TRAF protein, including naturally occurring allelic variants thereof encoded by mRNA generated by alternative splicing of a primary transcript, provided the TPBD-containing TRAF protein are not the sequence SEQ ID NO : 2 , 4 or 6.
  • a TPBD-containing TRAF protein comprises an invention TPBD with a sequence substantially the same as SEQ ID NO: 8, 10, 12, 23, 24, or 25. More preferably, a TPBD- containing TRAF protein comprises an invention TPBD with the sequence of SEQ ID NO:8, 10, 12, 23, 24, or 25.
  • a TPBD-containing TRAF protein comprising an invention TPBD domain is further characterized as binding one or more members of the TNF-family of receptors, or binding to one or more TRAF domain proteins, or binding to one or more TRAF associated proteins; or modulating NF-kB activity, or modulating cJun N-terminal kinase (JNK) activity; or modulating apoptosis, cell proliferation, cell adhesion, cell stress responses or B cell immunoglobulin class switching; or any combination thereof .
  • JNK cJun N-terminal kinase
  • TPBD-containing chimeric proteins comprising an invention TPBD, or fragments thereof, having the sequence of SEQ ID NO: 19 or SEQ ID NO:20, and further comprising one or more sequences from a heterologous protein.
  • invention TPBD-containing chimeric proteins include, for example, polypeptides having the sequence SEQ ID NO: 8, 10, 12, 23, 24 or 25. Sequences from heterologous proteins with which the TPBD or functional fragment thereof are fused will include, for example, glutathione-S-transferase, an antibody, or other proteins or functional fragments thereof which facilitate recovery of the chimera.
  • proteins with which the TPBD or functional fragment thereof are fused will include, for example, luciferase, green fluorescent protein, an antibody, or other proteins or functional fragments thereof which facilitate identification of the chimera. Still further proteins with which the TPBD or functional fragment thereof are fused will include, for example, the LexA DNA binding domain, ricin, ⁇ -sarcin, an antibody, or other proteins which have therapeutic properties or other biological activity.
  • chimeric proteins include sequences from two different proteins, the resultant amino acid sequence of the chimeric protein will typically be a non- naturally occurring sequence.
  • chimeric proteins comprising an invention TPBD, or fragments thereof, having the sequence of SEQ ID NO: 19 or SEQ ID NO:20, provided the sequence of the chimeric protein is not naturally occurring.
  • chimeric proteins contemplated herein are chimeric proteins wherein an invention TPBD is combined with one or more domains selected from a Ring-Finger domain, a Zinc-finger domain and an N-TRAF domain from a heterologous protein.
  • the TPBD of SEQ ID NO:8, 10, 12, 23, 24, or 25 can be fused with the Ring-Finger domain of TRAF proteins such as human TRAF 2, 3, 4, 5 or 6, and the like.
  • Another example of such a chimera is a protein wherein the TPBD of SEQ ID NO : 8 , 10, 12, 23, 24, or 25 is fused with the N-TRAF domain from a TRAF protein such as human TRAF 1, 2, 3, 4, 5 or 6, and the like.
  • TPBD TPBD
  • a "moiety" can be a physical, chemical or biological entity which contributes functionality to TPBD or a functional fragment thereof. Functionalities contributed by a moiety include therapeutic or other biological activity, or the ability to facilitate identification or recovery of TPBD. Therefore, a moiety will include molecules known in the art to be useful for detection of the conjugate by, for example, by fluorescence, magnetic imaging, detection of radioactive emission, and the like. A moiety may also be useful for recovery of the conjugate, for example a His tag or other known tags used for protein isolation/purification, or a physical substance such as a bead. A moiety can be a therapeutic compound, for example, a cytotoxic drug which can be useful to effect a biological change in cells to which the conjugate localizes.
  • oligomers comprising invention TPBDs and fragments thereof, invention TPBD- containing proteins, TPBD-containing chimeric proteins, or combinations thereof. It has been found that a TPBD such as the TPBD of TRAF 7 (SEQ ID NOS: 12 or 25) can bind at least one other, equivalent TPBD in forming a homo- oligomer.
  • the invention comprises homo-oligomers of invention TPBDs and fragments thereof, invention TPBD-containing proteins, TPBD- containing chimeric proteins, or combinations thereof.
  • hetero-oligomers comprising invention TPBDs and fragments thereof, invention TPBD-containing proteins, TPBD-containing chimeric proteins, or combinations thereof. It was found that invention HAUSP- TPBD (SEQ ID NOS : 8 or 23), SPOP-TPBD (SEQ ID NOS:10 or 24) and TRAF7-TPBD (SEQ ID NOS:12 or 25) all bind, for example, multiple TRAF proteins.
  • hetero-oligomers comprising invention TPBDs and fragments thereof, invention TPBD-containing proteins, TPBD-containing chimeric proteins, or combinations thereof, and further comprising TRAF proteins such as human TRAFl, TRAF2,
  • the HAUSP-TPBD (SEQ ID NOS : 8 or 23) can form a hetero-oligomer with human TRAFl, TRAF2, TRAF3, TRAF4, TRAF5, TRAF6, or combinations thereof.
  • the SPOP-TPBD (SEQ ID NOS: 10 or 24) can form a hetero-oligomer with human TRAFl, TRAF6, or combinations thereof.
  • the TRAF7-TPBD (SEQ ID NOS: 12 or 25) can form a hetero-oligomer with human TRAFl, TRAF2, TRAF3, TRAF4 , TRAF5, TRAF6, or combinations thereof.
  • nucleic acids which encode a novel TPBD, and fragments thereof, TPBD- containing TRAF proteins and TPBD-containing chimeric proteins.
  • Nucleic acids that encode a TPBD are those that encode a protein with the ability to bind, preferably in vivo, to one or more members of the Tumor Necrosis Factor Receptor-family (TNFR-family) , or to one or more members of the TRAF family, or to one or more TRAF-associated proteins, or any combination thereof, or have the ability to modulate NF- ⁇ B activity, JNK activity, apoptosis, cell proliferation, cell adhesion, cell stress responses or B cell immunoglobulin class switching.
  • TNFR-family Tumor Necrosis Factor Receptor-family
  • An invention nucleic acid encodes a TPBD having the sequence: E (X) 17 _ 21 L (X) 2 (X) 3 VXP (X) 15 _ 16 L (X) 24 _ 28 K(X) 15 _ 16 W (SEQ ID NO: 19), where X is any amino acid.
  • an invention nucleic acid encodes a TPBD having the sequence: LX X(X')XVXP (SEQ ID NO: 20) where X is any amino acid and X' is selected from L and I.
  • an invention nucleic acid encodes a TPBD having the sequence: E (X) 10 .
  • an invention nucleic acid encodes a TPBD having the sequence: E (X) 4 (X A ) (X) 5 .
  • nucleic acid encodes a TPBD comprising the sequence SEQ ID NO:8, 10, 12, 23, 24 or 25.
  • nucleic acid molecules described herein are useful for producing invention proteins, when such nucleic acids are incorporated into a variety of protein expression systems known to those of skill in the art.
  • nucleic acid molecules or fragments thereof can be labeled with a readily detectable substituent and used as hybridization probes for assaying for the presence and/or amount of an invention TPBD gene or mRNA transcript in a given sample.
  • the nucleic acid molecules described herein, and fragments thereof are also useful as primers and/or templates in a Polymerase Chain Reacion (PCR) for amplifying genes encoding invention proteins described herein.
  • PCR Polymerase Chain Reacion
  • nucleic acid encompasses ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), probes, oligonucleotides, and primers.
  • DNA can be either complementary DNA (cDNA) or genomic DNA, e.g. a gene encoding a TPBD.
  • cDNA complementary DNA
  • genomic DNA e.g. a gene encoding a TPBD.
  • One means of isolating a nucleic acid encoding a TPBD is to probe a mammalian genomic library with a natural or artificially designed DNA probe using methods well known in the art. DNA probes derived from the TPBD gene are particularly useful for this purpose.
  • DNA and cDNA molecules that encode TPBDs can be used to obtain complementary genomic DNA, cDNA or RNA from eukaryotic (e.g., human, primate, mammal, plant, nematode, insect, yeast, and the like) , or mammalian sources, or to isolate related cDNA or genomic clones by the screening of cDNA or genomic libraries, by methods described in more detail below.
  • eukaryotic e.g., human, primate, mammal, plant, nematode, insect, yeast, and the like
  • nucleic acids are RNA, cDNA, or isolated genomic DNA encoding a TPBD, provided the nucleic acids do not comprise the nucleotide sequence set forth in SEQ ID NOs:l, 3, or 5.
  • Such nucleic acids may include, but are not limited to, nucleic acids comprising substantially the same nucleotide sequence as set forth in SEQ ID NOs:7, 9, and 11.
  • cDNAs encoding the invention TPBD disclosed herein comprise substantially the same nucleotide sequence as set forth in SEQ ID NOs:19 or 20, provided they do not comprise the sequence set forth in SEQ ID NO: 1, 3 or 5.
  • cDNAs encoding the invention TPBDs disclosed herein comprise substantially the same nucleotide sequence as set forth in any of SEQ ID NOs:7, 9, and 11, provided they do not comprise the sequence set forth in SEQ ID NO: 1, 3 or 5.
  • Preferred cDNA molecules encoding the invention proteins comprise the same nucleotide sequence as set forth in SEQ ID No: 7, 9 and 11.
  • cDNAs encoding the invention TPBDs disclosed herein comprise substantially the same nucleotide sequence as set forth in SEQ ID NOs:19 or 20, provided they are no longer than 639 bases in length.
  • cDNAs encoding the invention TPBDs disclosed herein comprise substantially the same nucleotide sequence as set forth in any of SEQ ID NOs : 7 , 9, and 11, provided they are not longer than 639 bases in length.
  • Preferred cDNA molecules encoding the invention proteins comprise the same nucleotide sequence as set forth in SEQ ID No: 7, 9 and 11.
  • TRAF domains respectively represent the same nucleotide sequence as nucleotides 1-639 set forth in SEQ ID No : 1 ; nucleotides 1-540 set forth in SEQ ID NO: 3; and nucleotides 847-1305 set forth in SEQ ID NO: 5.
  • the term “substantially the same nucleotide sequence” refers to DNA having sufficient identity to the reference polynucleotide, such that it will hybridize to the reference nucleotide under moderately stringent hybridization conditions.
  • DNA having substantially the same nucleotide sequence as the reference nucleotide sequence encodes substantially the same amino acid sequence as that set forth in any of SEQ ID Nos:8, 10, 12, 23, 24 and 25, provided the DNA does not encode the sequence set forth in SEQ ID NO: 2, 4 or 6.
  • DNA having "substantially the same nucleotide sequence" as the reference nucleotide sequence has at least 60% identity with respect to the reference nucleotide sequence.
  • DNA having at least 70%, more preferably at least 90%, yet more preferably at least 95%, identity to the reference nucleotide sequence is preferred.
  • Identity of any two nucleic acid sequences can be determined by those skilled in the art based, for example, on a BLAST 2.0 computer alignment, using default parameters. BLAST 2.0 searching is available at http://www.ncbi.nlm.nih.gov/gorf/bl2.html., as described by Tatiana et al., FEMS Microbiol Lett. 174:247-250 (1999) .
  • nucleic acids which differ from the nucleic acids shown in SEQ ID NOs: 7, 9, and 11, but which have the same phenotype. Phenotypically similar nucleic acids are also referred to as “functionally equivalent nucleic acids”. As used herein, the phrase "functionally equivalent nucleic acids” encompasses nucleic acids characterized by slight and non-consequential sequence variations that will function in substantially the same manner to produce the same protein product (s) as the nucleic acids disclosed herein. In particular, functionally equivalent nucleic acids encode polypeptides that are the same as those encoded by the nucleic acids disclosed herein or that have conservative amino acid variations. For example, conservative variations include substitution of a non- polar residue with another non-polar residue, or substitution of a charged residue with a similarly charged residue. These variations include those recognized by skilled artisans as those that do not substantially alter the tertiary structure of the protein .
  • nucleic acids encoding TPBDs that, by virtue of the degeneracy of the genetic code, do not necessarily hybridize to the invention nucleic acids under specified hybridization conditions.
  • Preferred nucleic acids encoding the invention TPBDs are comprised of nucleotides that encode substantially the same amino acid sequence as set forth in SEQ ID NOs: 8, 10, and 12, provided they do not encode the sequence set forth in SEQ ID NO: 2, 4 or 6.
  • an exemplary nucleic acid encoding an invention TPBD may be selected from:
  • Another exemplary nucleic acid encoding an invention TPBD may be selected from:
  • DNA encodes biologically active TPBD, wherein the nucleic acid sequence does not encode the amino acid sequence set forth in SEQ ID Nos: 2, 4 or 6.
  • Hybridization refers to the binding of complementary strands of nucleic acid (i.e., sense : antisense strands or probe : target-DNA) to each other through hydrogen bonds, similar to the bonds that naturally occur in chromosomal DNA. Stringency levels used to hybridize a given probe with target-DNA can be readily varied by those of skill in the art.
  • stringent hybridization is used herein to refer to conditions under which polynucleic acid hybrids are stable. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (T m ) of the hybrids. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Reference to hybridization stringency relates to such washing conditions.
  • moderately stringent hybridization refers to conditions that permit target-DNA to bind a complementary nucleic acid that has about 60% identity, preferably about 75% identity, more preferably about 85% identity to the target DNA; with greater than about 90% identity to target-DNA being especially preferred.
  • moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5X Denhart ' s solution, 5X SSPE, 0.2% SDS at 42°C, followed by washing in 0.2X SSPE, 0.2% SDS, at 42°C.
  • high stringency hybridization refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at 65°C (i.e., if a hybrid is not stable in 0.018M NaCl at 65°C, it will not be stable under high stringency conditions, as contemplated herein) .
  • High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5X Denhart ' s solution, 5X SSPE, 0.2% SDS at 42°C, followed by washing in 0. IX SSPE, and 0.1% SDS at 65°C.
  • low stringency hybridization refers to conditions equivalent to hybridization in 10% formamide, 5X Denhart 's solution, 6X SSPE, 0.2% SDS at 42°C, followed by washing in IX SSPE, 0.2% SDS, at 50°C.
  • Denhart ' s solution and SSPE are well known to those of skill in the art as are other suitable hybridization buffers .
  • the term “degenerate” refers to codons that differ in at least one nucleotide from a reference nucleic acid, e.g., SEQ ID NOs:7, 9, and 11, but encode the same amino acids as the reference nucleic acid.
  • a reference nucleic acid e.g., SEQ ID NOs:7, 9, and 11
  • codons specified by the triplets "UCU”, “UCC”, “UCA”, and “UCG” are degenerate with respect to each other since all four of these codons encode the amino acid serine.
  • Preferred nucleic acids encoding the invention polypeptide hybridize under moderately stringent, preferably high stringency, conditions to substantially the entire sequence, or substantial portions (i.e., typically at least 15-30 nucleotides) of the nucleic acid sequence set forth in SEQ ID NOs: 7, 9, and 11, provided they do not comprise the sequence set forth in SEQ ID NO: 1, 3 or 5.
  • nucleic acids can be produced by a variety of methods well-known in the art, e.g., the methods described herein, employing PCR amplification using oligonucleotide primers from various regions of SEQ ID NOs:7, 9, and 11, and the like.
  • TRAF-encoding cDNAs can be employed to probe library (ies) (e.g., cDNA, genomic, and the like) for additional nucleic acid sequences encoding novel eukaryotic TPBDs.
  • libraries e.g., cDNA, genomic, and the like
  • Construction of suitable eukaryotic cDNA libraries is well-known in the art. Screening of such a cDNA library is initially carried out under low- stringency conditions, which comprise a temperature of less than about 42°C, a formamide concentration of less than about 50%, and a moderate to low salt concentration.
  • Presently preferred pr Jobe-based screening conditions comprise a temperature of about 37°C, a formamide concentration of about 20%, and a salt concentration of about 5X standard saline citrate (SSC; 20X SSC contains 3M sodium chloride, 0.3M sodium citrate, pH 7.0).
  • SSC standard saline citrate
  • Such conditions will allow the identification of sequences which have a substantial degree of similarity with the probe sequence, without requiring perfect homology.
  • the phrase "substantial similarity" refers to sequences which share at least 50% homology.
  • hybridization conditions will be selected which allow the identification of sequences having at least 70% homology with the probe, while discriminating against sequences which have a lower degree of homology with the probe.
  • nucleic acids having substantially the same nucleotide sequence as SEQ ID NOs:l, 3, and 5, are obtained.
  • a nucleic acid "probe” is single-stranded DNA or RNA, or analogs thereof, that has a sequence of nucleotides that includes at least 14, at least 20, at least 50, at least 100, at least 200, at least 300, at least 400, or at least 500 contiguous bases that are the same as (or the complement of) any contiguous bases set forth in any of SEQ ID NOs : 7 , 9, and 11.
  • Preferred regions from which to construct probes include 5' and/or 3' coding regions of SEQ ID NOs : 7 , 9, and 11.
  • the entire cDNA encoding region of an invention TRAF or the entire sequence corresponding to SEQ ID NOs: 7, 9, and 11, may be used as a probe. Probes may be labeled by methods well-known in the art, as described hereinafter, and used in various diagnostic kits .
  • indicating means in their various grammatical forms refer to single atoms and molecules that are either directly or indirectly involved in the production of a detectable signal. Any label or indicating means can be linked to invention nucleic acid probes, expressed proteins, polypeptide fragments, or antibody molecules. These atoms or molecules can be used alone or in conjunction with additional reagents. Such labels are themselves well-known in clinical diagnostic chemistry.
  • the labeling means can be a fluorescent labeling agent that chemically binds to antibodies or antigens without denaturation to form a fluorochrome (dye) that is a useful immunofluorescent tracer.
  • a fluorochrome a fluorochrome that is a useful immunofluorescent tracer.
  • a description of immunofluorescent analytic techniques is found in DeLuca, "Immunofluorescence Analysis", in Antibody As a Tool, Marchalonis et al . , eds., John Wiley & Sons, Ltd., pp. 189-231 (1982), which is incorporated herein by reference.
  • the indicating group is an enzyme, such as horseradish peroxidase (HRP) , glucose oxidase, and the like.
  • HRP horseradish peroxidase
  • radioactive elements are employed labeling agents.
  • the linking of a label to a substrate, i.e., labeling of nucleic acid probes, antibodies, polypeptides, and proteins, is well known in the art.
  • an invention antibody can be labeled by metabolic incorporation of radiolabeled amino acids provided in the culture medium. See, for example, Galfre et al . , Meth. Enzymol . , 73:3-46 (1981) .
  • Conventional means of protein conjugation or coupling by activated functional groups are particularly applicable.
  • nucleic acids are provided encoding chimeric proteins comprising an invention TPBD, or fragment thereof, having the sequence of SEQ ID NO: 19 or SEQ ID NO:20, and further comprising one or more sequences from a heterologous protein.
  • Functional fragments of TPBD include, for example, polypeptides having the sequence SEQ ID NO: 8, 10, 12, 23, 24 or 25.
  • Nucleic acids encoding proteins with which the TPBD or functional fragment thereof are fused will also encode, for example, glutathione-S-transferase, an antibody, or other proteins or functional fragments thereof which facilitate recovery of the chimera.
  • Nucleic acids of the invention can also encode proteins with which the TPBD or functional fragment thereof are fused, for example, luciferase, green fluorescent protein, an antibody, or other proteins or functional fragments thereof which facilitate identification of the chimera. Still further nucleic acids of the invention encode proteins with which the TPBD or functional fragment thereof are fused including, for example, the LexA DNA binding domain, ricin, ⁇ -sarcin, an antibody, or other proteins which have therapeutic properties or other biological activity.
  • acceptable carrier encompasses any of the standard pharmaceutical carriers, such as phosphate buffered saline solution, water and emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents.
  • TPBD compositions described herein can be used, for example, in methods for modulating the activity of members of the TNFR family.
  • TNF family receptor binding is well known in the art as mediating the signal transduction activity of the receptor, and it is demonstrated herein that invention TPBDs can bind TNF receptors.
  • a protein comprising the sequence SEQ ID NO: 19 or 20, or a nucleic acid encoding a protein comprising the sequence SEQ ID NO: 19 or 20 modulates the activity of one or more TNF family receptors.
  • modulation of a member of the TNFR family will comprise the step of contacting a member of the TNFR family with a protein comprising the sequence SEQ ID NO: 19 or 20.
  • the method comprises contacting a cell with a protein comprising the sequence of SEQ ID NO:8, 10, 12, 23, 24 or 25.
  • modulation of a member of the TNFR family will comprise the step of contacting a member of the TNFR family with a nucleic acid encoding a protein comprising the sequence SEQ ID NO: 19 or 20.
  • the method comprises contacting a cell with a nucleic acid encoding a protein comprising the sequence of SEQ ID NO:8, 10, 12, 23, 24 or 25.
  • the TPBD compositions described herein can be used, for example, in methods for modulating the activity of TRAF domain containing proteins.
  • a protein comprising the sequence SEQ ID NO: 19 or 20, or a nucleic acid encoding a protein comprising the sequence SEQ ID NO: 19 or 20, modulates the activity of one or more TRAF domain containing proteins.
  • modulation of a TRAF domain containing protein will comprise the step of contacting a TRAF domain containing protein with a protein comprising the sequence SEQ ID NO: 19 or 20.
  • the method comprises contacting a cell with a protein comprising the sequence of SEQ ID NO:8, 10, 12, 23, 24 or 25.
  • modulation of a TRAF domain containing protein will comprise the step of contacting a TRAF domain containing protein with a nucleic acid encoding a protein comprising the sequence SEQ ID NO: 19 or 20.
  • the method comprises contacting a cell with a nucleic acid encoding a protein comprising the sequence of SEQ ID N0:8, 10, 12, 23, 24 or 25.
  • a TPBD comprising the sequence SEQ ID NO: 19 or 20, or a nucleic acid encoding a protein comprising the sequence SEQ ID NO: 19 or 20, modulates the activity of one or more TRAF-associated proteins. While some TRAF-associated proteins are known to modulate NF- ⁇ B activity, others are known to modulate cJun N-terminal kinase (JNK) activity, and still others are known to modulate the activity of other proteins .
  • JNK cJun N-terminal kinase
  • TRAF domain protein can modulate the activity of TRAF-associated proteins any protein with which TRAF-associated proteins are known to interact .
  • modulation of a TRAF- associated protein will comprise the step of contacting a TRAF-associated protein with a protein comprising the sequence SEQ ID NO: 19 or 20.
  • the method comprises contacting a cell with a protein comprising the sequence of SEQ ID NO:8, 10, 12, 23, 24 or 25.
  • modulation of a TRAF- associated protein will comprise the step of contacting a TRAF-associated protein with a nucleic acid encoding a protein comprising the sequence SEQ ID NO: 19 or 20.
  • the method comprises contacting a cell with a nucleic acid encoding a protein comprising the sequence of SEQ ID NO:8, 10, 12, 23, 24 or 25.
  • TPBD compositions can also be used, for example, in methods for modulating the activity of NF- ⁇ B and cJun N-terminal kinase (JNK).
  • JNK cJun N-terminal kinase
  • Proteins homologous to invention TPBDs for example, human TRAF domain proteins, are well known in the art as modulating the activity of NF-KB and JNK, and it is further shown herein that SEQ ID NOS:8, 10, 12, 23, 24 and 25 can modulate NF- ⁇ B activity.
  • a protein comprising the sequence SEQ ID NO: 19 or 20, or a nucleic acid encoding a protein comprising the sequence SEQ ID NO: 19 or 20, modulates the activity of NF-KB or JNK.
  • modulation of NF- ⁇ B or JNK activity will comprise the step of contacting a cell containing NF- ⁇ B or JNK activity with a protein comprising the sequence SEQ ID NO: 19 or 20.
  • the method comprises contacting a cell with a protein comprising the sequence of SEQ ID NO: 8, 10, 12, 23, 24 or 25.
  • modulation of NF- ⁇ B or JNK activity will comprise the step of contacting a cell containing NF- ⁇ B or JNK activity with a nucleic acid encoding a protein comprising the sequence SEQ ID NO: 19 or 20.
  • the method comprises contacting a cell with a nucleic acid encoding a protein comprising the sequence of SEQ ID NO : 8 , 10, 12, 23, 24 or 25.
  • the functions of the invention TPBDs support the role of TRAFs in modulating cellular pathways that effect apoptosis, cell proliferation, cell adhesion, cell stress responses and B cell immunoglobulin class switching.
  • a protein comprising the sequence SEQ ID NO: 19 or 20, or a nucleic acid encoding a protein comprising the sequence SEQ ID NO: 19 or 20, modulates apoptosis, cell proliferation, cell adhesion, cell stress responses or B cell immunoglobulin class switching.
  • modulation of apoptosis, cell proliferation, cell adhesion, cell stress responses or B cell immunoglobulin class switching will comprise the step of contacting a cell with a protein comprising the sequence SEQ ID NO: 19 or 20, whereby apoptosis, cell proliferation, cell adhesion, cell stress responses or B cell immunoglobulin class switching is modulated.
  • the method comprises contacting a cell with a protein comprising the sequence of SEQ ID NO: 8, 10, 12, 23, 24 or 25.
  • modulation of apoptosis, cell proliferation, cell adhesion, cell stress responses or B cell immunoglobulin class switching will comprise the step of contacting a cell with a nucleic acid encoding a protein comprising the sequence SEQ ID NO: 19 or 20, whereby apoptosis, cell proliferation, cell adhesion, cell stress responses or B cell immunoglobulin class switching is modulated.
  • the method comprises contacting a cell with a nucleic acid encoding a protein comprising the sequence of SEQ ID NO: 8, 10, 12, 23, 24 or 25.
  • antisense-nucleic acids having a sequence capable of binding specifically with full-length or any portion of an mRNA that encodes TPBD polypeptides so as to prevent translation of the mRNA.
  • the antisense-nucleic acid may have a sequence capable of binding specifically with any portion of the sequence of the cDNA encoding TPBD polypeptides.
  • binding specifically encompasses the ability of a nucleic acid sequence to recognize a complementary nucleic acid sequence and to form double-helical segments therewith via the formation of hydrogen bonds between the complementary base pairs.
  • An example of an antisense- nucleic acid is an antisense-nucleic acid comprising chemical analogs of nucleotides.
  • compositions comprising an amount of the antisense-nucleic acid, described above, effective to reduce expression of TPBD polypeptides by passing through a cell membrane and binding specifically with mRNA encoding TPBD polypeptides so as to prevent translation and an acceptable hydrophobic carrier capable of passing through a cell membrane are also provided herein.
  • Suitable hydrophobic carriers are described, for example, in U.S. Patent Nos. 5,334,761; 4,889,953; 4,897,355, and the like.
  • the acceptable hydrophobic carrier capable of passing through cell membranes may also comprise a structure which binds to a receptor specific for a selected cell type and is thereby taken up by cells of the selected cell type.
  • the structure may be part of a protein known to bind to a cell-type specific receptor.
  • Antisense-nucleic acid compositions are useful to inhibit translation of mRNA encoding invention polypeptides.
  • Synthetic oligonucleotides, or other antisense chemical structures are designed to bind to mRNA encoding TPBD polypeptides and inhibit translation of mRNA and are useful as compositions to inhibit expression of TPBD associated genes in a tissue sample or in a subject.
  • kits for detecting mutations, duplications, deletions, rearrangements and aneuploidies in TPBD genes comprising at least one invention probe or antisense nucleotide .
  • the present invention provides means to modulate levels of expression of TPBD polypeptides by employing synthetic antisense-nucleic acid compositions (hereinafter SANC) which inhibit translation of mRNA encoding these polypeptides.
  • SANC synthetic antisense-nucleic acid compositions
  • Synthetic oligonucleotides, or other antisense-nucleic acid chemical structures designed to recognize and selectively bind to mRNA are constructed to be complementary to full-length or portions of a TPBD coding strand, including nucleotide sequences set forth in SEQ ID NOs: 7, 9, and 11.
  • the SANC is designed to be stable in the blood stream for administration to a subject by injection, or in laboratory cell culture conditions.
  • the SANC is designed to be capable of passing through the cell membrane in order to enter the cytoplasm of the cell by virtue of physical and chemical properties of the SANC which render it capable of passing through cell membranes, for example, by designing small, hydrophobic SANC chemical structures, or by virtue of specific transport systems in the cell which recognize and transport the SANC into the cell.
  • the SANC can be designed for administration only to certain selected cell populations by targeting the SANC to be recognized by specific cellular uptake mechanisms which bind and take up the SANC only within select cell populations.
  • the SANC is an antisense oligonucleotide .
  • the SANC may be designed to bind to a receptor found only in a certain cell type, as discussed supra .
  • the SANC is also designed to recognize and selectively bind to target mRNA sequence, which may correspond to a sequence contained within the sequences shown in SEQ ID NOs: 7, 9, and 11.
  • the SANC is designed to inactivate target mRNA sequence by either binding thereto and inducing degradation of the mRNA by, for example, RNase I digestion, or inhibiting translation of mRNA target sequence by interfering with the binding of translation-regulating factors or ribosomes, or inclusion of other chemical structures, such as ribozyme sequences or reactive chemical groups which either degrade or chemically modify the target mRNA.
  • a method for the recombinant production of invention TPBDs by expressing the above-described nucleic acid sequences in suitable host cells.
  • Recombinant DNA expression systems that are suitable to produce TPBDs described herein are well-known in the art.
  • the above-described nucleotide sequences can be incorporated into vectors for further manipulation.
  • vector or plasmid refers to discrete elements that are used to introduce heterologous DNA into cells for either expression or replication thereof.
  • Suitable expression vectors are well-known in the art, and include vectors capable of expressing DNA operatively linked to a regulatory sequence, such as a promoter region that is capable of regulating expression of such DNA.
  • an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the inserted DNA.
  • Appropriate expression vectors are well known to those of skill in the art and include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome.
  • a promoter region refers to a segment of DNA that controls transcription of DNA to which it is operatively linked.
  • the promoter region includes specific sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation.
  • the promoter region includes sequences that modulate this recognition, binding and transcription initiation activity of RNA polymerase. These sequences may be cis acting or may be responsive to trans acting factors. Promoters, depending upon the nature of the regulation, may be constitutive or regulated.
  • Exemplary promoters contemplated for use in the practice of the present invention include the SV40 early promoter, the cytomegalovirus (CMV) promoter, the mouse mammary tumor virus (MMTV) steroid-inducible promoter, Moloney murine leukemia virus (MMLV) promoter, and the like.
  • CMV cytomegalovirus
  • MMTV mouse mammary tumor virus
  • MMLV Moloney murine leukemia virus
  • operatively linked refers to the functional relationship of DNA with regulatory and effector nucleotide sequences, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences.
  • operative linkage of DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA.
  • expression refers to the process by which polynucleic acids are transcribed into mRNA and translated into peptides, polypeptides, or proteins. If the polynucleic acid is derived from genomic DNA, expression may, if an appropriate eukaryotic host cell or organism is selected, include splicing of the mRNA.
  • Prokaryotic transformation vectors are well-known in the art and include pBlueskript and phage Lambda ZAP vectors (Stratagene, La Jolla, CA) , and the like. Other suitable vectors and promoters are disclosed in detail in U.S. Patent No. 4,798,885, issued January 17, 1989, the disclosure of which is incorporated herein by reference in its entirety.
  • E . coli cells include the pET expression vectors (Novagen, see U.S patent 4,952,496), e.g., pETlla, which contains the T7 promoter, T7 terminator, the inducible E . col i lac operator, and the lac repressor gene; and pET 12a-c, which contain the T7 promoter, T7 terminator, and the E . coli ompT secretion signal.
  • Another suitable vector is the pIN-IIIompA2 (see Duffaud et al . , Meth. in Enzymoloqy, 153:492-507, 1987), which contains the lpp promoter, the lacUV5 promoter operator, the ompA secretion signal, and the lac repressor gene.
  • Exemplary, eukaryotic transformation vectors include the cloned bovine papilloma virus genome, the cloned genomes of the murine retroviruses, and eukaryotic cassettes, such as the pSV-2 gpt system (described by Mulligan and Berg, Nature Vol. 277:108-114 (1979)) the Okayama-Berg cloning system (Mol. Cell Biol. 2:161-170 (1982)), and the expression cloning vector described by Genetics Institute (Wong et al . , Science 228:810-815 (1985)), are available which provide substantial assurance of at least some expression of the protein of interest in the transformed eukaryotic cell line.
  • pSV-2 gpt system described by Mulligan and Berg, Nature Vol. 277:108-114 (1979)
  • the Okayama-Berg cloning system Mol. Cell Biol. 2:161-170 (1982)
  • TPBD-encoding DNAs for transfection of mammalian cells are cytomegalovirus (CMV) promoter-based vectors such as pcDNAl (Invitrogen, San Diego, CA) , MMTV promoter-based vectors such as pMAMNeo (Clontech, Palo Alto, CA) and pMSG (Pharmacia, Piscataway, NJ) , and SV40 promoter-based vectors such as pSV ⁇ (Clontech, Palo Alto, CA) .
  • CMV cytomegalovirus
  • pcDNAl Invitrogen, San Diego, CA
  • MMTV promoter-based vectors such as pMAMNeo (Clontech, Palo Alto, CA) and pMSG (Pharmacia, Piscataway, NJ)
  • SV40 promoter-based vectors such as pSV ⁇ (Clontech, Palo Alto, CA) .
  • nucleic acid molecules i.e., DNA or mRNA
  • suitable host cells preferably bacterial cells, and more preferably E . col i cells, as well as methods applicable for culturing said cells containing a gene encoding a heterologous protein, are generally known in the art. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (2 ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA (1989) .
  • Exemplary methods of transformation include, e.g., transformation employing plasmids, viral, or bacterial phage vectors, transfection, electroporation, lipofection, and the like.
  • the heterologous DNA can optionally include sequences which allow for its extrachromosomal maintenance, or said heterologous DNA can be caused to integrate into the genome of the host (as an alternative means to ensure stable maintenance in the host) .
  • Host organisms contemplated for use in the practice of the present invention include those organisms in which recombinant production of heterologous proteins has been carried out.
  • Examples of such host organisms include bacteria (e.g., E. coli ) , yeast (e.g., Saccharomyces cerevisiae, Candida tropicalis, Hansenula polymorpha and P. pastoris; see, e.g., U.S. Patent Nos. 4,882,279, 4,837,148, 4,929,555 and 4,855,231), mammalian cells (e.g., HEK293, CHO and Ltk " cells), insect cells, and the like.
  • Presently preferred host organisms are bacteria. The most preferred bacteria is E . coli .
  • nucleic acids encoding the invention TPBDs can be delivered into mammalian cells, either in vivo or in vi tro using suitable viral vectors well-known in the art.
  • suitable viral vectors well-known in the art.
  • Suitable retroviral vectors designed specifically for "gene therapy" methods, are described, for example, in WIPO publications WO 9205266 and WO 9214829, which provide a description of methods for efficiently introducing nucleic acids into human cells.
  • the introduction of the antisense strand of the invention nucleic acid is contemplated.
  • Viral based systems provide the advantage of being able to introduce relatively high levels of the heterologous nucleic acid into a variety of cells .
  • viral vectors for introducing invention nucleic acid encoding an TPBD into mammalian cells (e.g., vascular tissue segments) are well known in the art.
  • These viral vectors include, for example, Herpes simplex virus vectors (e.g., Geller et al . , Science, 241:1667- 1669 (1988)), Vaccinia virus vectors (e.g., Piccini et al., Meth. in Enzvmolo ⁇ v, 153:545-563 (1987);
  • Cytomegalovirus vectors (Mocarski et al . , in Viral Vectors, Y. Gluzman and S.H. Hughes, Eds., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1988, pp. 78-84), Moloney murine leukemia virus vectors (Danos et al., PNAS, USA, 85:6469 (1980)), adenovirus vectors (e.g., Logan et al . , PNAS, USA, 81:3655-3659 (1984); Jones et al . , Cell, 17:683-689 (1979); Berkner, Biotechnigues, 6:616-626 (1988); Cotten et al .
  • adeno-associated virus vectors examples include adeno-associated virus vectors, retrovirus vectors (see, e.g., U.S. Patent 4,405,712 and 4,650,764), and the like.
  • retrovirus vectors see, e.g., U.S. Patent 4,405,712 and 4,650,764
  • Especially preferred viral vectors are the adenovirus and retroviral vectors.
  • adenovirus-transferrin/polylysine-DNA for example, in one embodiment of the present invention, adenovirus-transferrin/polylysine-DNA
  • TfAdpl-DNA vector complexes (Wagner et al., PNAS, USA, 89:6099-6103 (1992); Curiel et al . , Hum. Gene Ther. , 3:147-154 (1992); Gao et al . , Hum. Gene Ther. , 4:14-24 (1993) ) are employed to transduce mammalian cells with heterologous TPBD nucleic acid. Any of the plasmid expression vectors described herein may be employed in a TfAdpl-DNA complex.
  • retroviral vector refers to the well-known gene transfer plasmids that have an expression cassette encoding an heterologous gene residing between two retroviral LTRs .
  • Retroviral vectors typically contain appropriate packaging signals that enable the retroviral vector, or RNA transcribed using the retroviral vector as a template, to be packaged into a viral virion in an appropriate packaging cell line (see, e.g., U.S. Patent 4,650,764).
  • retroviral vectors for use herein are described, for example, in U.S. Patent 5,252,479, and in WIPO publications WO 92/07573, WO 90/06997, WO 89/05345, WO 92/05266 and WO 92/14829, incorporated herein by reference, which provide a description of methods for efficiently introducing nucleic acids into human cells using such retroviral vectors.
  • retroviral vectors include, for example, the mouse mammary tumor virus vectors (e.g., Shackleford et al . , PNAS, USA, 85:9655-9659 (1988)), and the like.
  • anti-TPBD antibodies having specific reactivity with one or more TPBD polypeptides of the present invention. Active fragments of antibodies are encompassed within the definition of "antibody”.
  • invention antibodies can be produced by methods known in the art using invention polypeptides, proteins or portions thereof as antigens.
  • polyclonal and monoclonal antibodies can be produced by methods well known in the art, as described, for example, in Harlow and Lane, Antibodies: A
  • invention polypeptides can be used as immunogens in generating such antibodies.
  • synthetic peptides can be prepared (using commercially available synthesizers) and used as immunogens.
  • Amino acid sequences can be analyzed by methods well known in the art to determine whether they encode hydrophobic or hydrophilic domains of the corresponding polypeptide.
  • Altered antibodies such as chimeric, humanized, CDR-grafted or bifunctional antibodies can also be produced by methods well known in the art. Such antibodies can also be produced by hybridoma, chemical synthesis or recombinant methods described, for example, in Sambrook et al . , supra .
  • Antibody so produced can be used, inter alia, in diagnostic methods and systems to detect the level of TPBD present in a mammalian, preferably human, body sample, such as tissue or vascular fluid. Such antibodies can also be used for the immunoaffinity or affinity chromatography purification of the invention TRAF.
  • methods are contemplated herein for detecting the presence of an invention TPBD either within a cell, or on the surface of a cell, comprising contacting the cell with an antibody that specifically binds to TPBD polypeptides, under conditions permitting binding of the antibody to the TPBD polypeptides, detecting the presence of the antibody bound to the TPBD polypeptide, and thereby detecting the presence of invention polypeptides on the surface of the cell. With respect to the detection of such polypeptides, the antibodies can be used for in vi tro diagnostic or in vivo imaging methods .
  • Immunological procedures useful for in vi tro detection of target TPBD polypeptides in a sample include immunoassays that employ a detectable antibody.
  • immunoassays include, for example, ELISA, Pandex microfluorimetric assay, agglutination assays, flow cytometry, serum diagnostic assays and immunohistochemical staining procedures which are well known in the art.
  • An antibody can be made detectable by various means well known in the art.
  • a detectable marker can be directly or indirectly attached to the antibody.
  • Useful markers include, for example, radionucleotides, enzymes, fluorogens, chromogens and chemiluminescent labels.
  • Invention anti-TPBD antibodies are contemplated for use herein to modulate the activity of the TPBD polypeptide in living animals, in humans, or in biological tissues or fluids isolated therefrom.
  • modulate refers to a compound' s ability to increase (e.g., via an agonist), decrease (e.g., via an antagonist), or otherwise modify (e.g., increasing a first TPBD activity while decreasing a second TPBD activity) the biological activity of an invention TPBD protein, such as TNFR family-binding, TRAF protein binding activity, TRAF-associated protein binding activity, NF- ⁇ B modulating activity, JNK modulating activity, apoptosis modulating activity, cell proliferation modulating activity, cell adhesion, cell stress responses modulating activity, or B cell immunoglobulin class switching modulating activity, and the like.
  • compositions comprising a carrier and an amount of an antibody having specificity for TPBD polypeptides effective to block naturally occurring ligands or other TPBD-associated proteins, and the like, from binding to invention TPBD polypeptides are contemplated herein.
  • an antibody having specificity for TPBD polypeptides effective to block naturally occurring ligands or other TPBD-associated proteins, and the like, from binding to invention TPBD polypeptides are contemplated herein.
  • a monoclonal antibody directed to an epitope of an invention TPBD polypeptide including an amino acid sequence set forth in SEQ ID NOs:8, 10, 12, 23, 24 and 25 can be useful for this purpose .
  • the present invention further provides transgenic non-human mammals that are capable of expressing exogenous nucleic acids encoding TPBDs.
  • exogenous nucleic acid refers to nucleic acid sequence which is not native to the host, or which is present in the host in other than its native environment (e.g., as part of a genetically engineered DNA construct) .
  • invention TPBDs can either be overexpressed or underexpressed (such as in the well-known knock-out transgenics) in transgenic mammals .
  • transgenic non-human mammals capable of expressing nucleic acids encoding TPBD polypeptides so mutated as to be incapable of normal activity, i.e., do not express native TPBD.
  • the present invention also provides transgenic non-human mammals having a genome comprising antisense nucleic acids complementary to nucleic acids encoding TPBD polypeptides, placed so as to be transcribed into antisense mRNA complementary to mRNA encoding TPBD polypeptides, which hybridizes to the mRNA and, thereby, reduces the translation thereof.
  • the nucleic acid may additionally comprise an inducible promoter and/or tissue specific regulatory elements, so that expression can be induced, or restricted to specific cell types.
  • nucleic acids are DNA or cDNA having a coding sequence substantially the same as the coding sequence shown in SEQ ID NOs:l, 3, and 5.
  • An example of a non-human transgenic mammal is a transgenic mouse.
  • tissue specificity-determining elements are the metallothionein promoter and the L7 promoter.
  • TPBD polypeptides Animal model systems which elucidate the physiological and behavioral roles of TPBD polypeptides are also provided, and are produced by creating transgenic animals in which the expression of the TPBD polypeptide is altered using a variety of techniques. Examples of such techniques include the insertion of normal or mutant versions of nucleic acids encoding an TRAF polypeptide by microinj ection, retroviral infection or other means well known to those skilled in the art, into appropriate fertilized embryos to produce a transgenic animal. (See, for example, Hogan et al . , Manipulating the Mouse Embryo: A Laboratory Manual (Cold Spring Harbor Laboratory, (1986)).
  • TPBD neuropeptide deficiency virus
  • homologous recombination techniques are well known in the art.
  • Homologous recombination replaces the native (endogenous) gene with a recombinant or mutated gene to produce an animal that cannot express native (endogenous) protein but can express, for example, a mutated protein which results in altered expression of TPBD polypeptides.
  • microinj ection adds genes to the host genome, without removing host genes.
  • Microinjection can produce a transgenic animal that is capable of expressing both endogenous and exogenous TPBDs.
  • Inducible promoters can be linked to the coding region of nucleic acids to provide a means to regulate expression of the transgene .
  • Tissue specific regulatory elements can be linked to the coding region to permit tissue-specific expression of the transgene.
  • Transgenic animal model systems are useful for in vivo screening of compounds for identification of specific ligands, i.e., agonists and antagonists, which activate or inhibit protein responses.
  • invention nucleic acids, oligonucleotides (including antisense) , vectors containing same, transformed host cells, polypeptides and combinations thereof, as well as antibodies of the present invention can be used to screen compounds in vitro to determine whether a compound functions as a potential agonist or antagonist to invention TPBDs.
  • vi tro screening assays provide information regarding the function and activity of invention TPBDs, which can lead to the identification and design of compounds that are capable of specific interaction with one or more types of polypeptides, peptides or proteins.
  • An invention TPBD contains the sequence E (X) 17 . 21 L (X) 2 W (X) 3 VXP (X) 15 . 16 L (X) 24 . 28 K (X) 15 _ 16 W (SEQ ID NO: 19), where X is any amino acid.
  • an invention TPBD is characterized as having the sequence: LXWX(X')XVXP (SEQ ID NO:20) where X is any amino acid and X' is selected from L and I.
  • an invention TPBD has the sequence: E (X) 10 _ 13 S (X) 6 _ 7 LXW (X) 3 VXP (x) 10 _ 11 S(X) 4 L(X) 24 .
  • an invention TPBD has the following sequence: E(X) 4 (X A ) (X) 5 _ 8 SX(X B ) (X) 4 . 5 LXWX(X A )XVXP(X) 10 . n S(X A ) (X) 3 L(X) 16 _ 18 (X A ) (X) 4 _ 6 (X C ) (X) 2 K(X) 9 .
  • an invention TPBD comprises the sequence SEQ ID NO:8, 10, 12, 23, 24 or 25.
  • invention TPBDs By the known homology of invention TPBDs to known TRAF domains, it is within the scope of the invention that invention TPBD also have a role in celluar pathways that effect apoptosis, cell proliferation, cell adhesion, cell stress responses and B cell immunoglobulin class switching. Thus, invention TPBDs also provide drug discovery targets for a broad variety of pathologies including autoimmunity, inflammation, allergy, allograph-rejection and sepsis, and for a broad variety of cancer pathologies, such as, gliomas, carcinomas, sarcomas, melanomas, hamartomas and the like.
  • invention TRAF proteins, agonist or antagonists thereto are used to treat autoimmunity, inflammation, allergy, allograph- rejection, sepsis, keratinocyte hyperplasia, neoplasia, keloid, benign prostatic hypertrophy, inflammatory hyperplasia, fibrosis, smooth muscle cell proliferation in arteries following balloon angioplasty (restenosis) , and the like.
  • Exemplary cancer pathologies contemplated herein for treatment include, gliomas, carcinomas, adenocarcinomas, sarcomas, melanomas, hamartomas, leukemias, lymphomas, and the like.
  • compositions are typically administered in a physiologically compatible composition.
  • Methods of treating pathologies of abnormal cell proliferation will include methods of modulating the activity of one or more oncogenic proteins, wherein the oncogenic proteins specifically interact with a TPBD. Methods of modulating the activity of such oncogenic proteins will include contacting the oncogenic protein with a substantially pure TPBD or an active fragment
  • oncogenic protein-binding fragment thereof.
  • This contacting will modulate the activity of the oncogenic protein, thereby providing a method of treating a pathology caused by the oncogenic protein.
  • Further methods of modulating the activity of oncogenic proteins will include contacting the oncogenic protein with an agent, wherein the agent modulates the interactions between the TPBD and the oncogenic protein.
  • Methods of treating immune-based pathologies such as autoimmunity, inflammation, allergy, allograph- rejection, and sepsis will include modulating the activity of one or more proteins that modulate immune response, wherein the protein that modulates immune response specifically interact with a TPBD.
  • Methods of modulating the activity of such protein that modulates immune response will include contacting the protein that modulates immune response with a substantially pure TPBD or an active fragment (i.e., protein-binding fragment) thereof. This contacting will modulate the activity of the protein that modulates immune response, thereby providing a method of treating a pathology caused by the protein that modulates immune response.
  • Further methods of modulating the activity of a protein that modulates immune response will include contacting the protein that modulates immune response with an agent, wherein the agent modulates the interactions between the TPBD and the protein that modulates immune response.
  • invention pharmaceutical compositions for the treatment of pathological disorders in which there is too little cell division, such as, for example, bone marrow aplasias, immunodeficiencies due to a decreased number of lymphocytes, and the like.
  • Methods of treating a variety of inflammatory diseases with invention therapeutic compositions are also contemplated herein, such as treatment of sepsis, fibrosis (e.g., scarring), arthritis, graft versus host disease, and the like.
  • compositions of the present invention such as pharmaceutical compositions, contain a physiologically compatible carrier together with an invention TPBD (or functional fragment thereof) , a TPBD modulating agent, such as a compound (agonist or antagonist) identified by the methods described herein, or an anti-TPBD antibody, as described herein, dissolved or dispersed therein as an active ingredient.
  • TPBD TPBD modulating agent
  • the therapeutic composition is not immunogenic when administered to a mammal or human patient for therapeutic purposes .
  • compositions, carriers, diluents and reagents are used interchangeably and represent that the materials are capable of administration to a mammal without the production of undesirable physiological effects such as nausea, dizziness, gastric upset, and the like.
  • compositions that contains active ingredients dissolved or dispersed therein are well known in the art.
  • compositions are prepared as injectables either as liquid solutions or suspensions; however, solid forms suitable for solution, or suspension, in liquid prior to use can also be prepared.
  • the preparation can also be emulsified.
  • the active ingredient can be mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient in amounts suitable for use in the therapeutic methods described herein.
  • Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like, as well as combinations of any two or more thereof.
  • the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and the like, which enhance the effectiveness of the active ingredient.
  • the therapeutic composition of the present invention can include pharmaceutically acceptable salts of the components therein.
  • Pharmaceutically acceptable nontoxic salts include the acid addition salts (formed with the free amino groups of the polypeptide) that are formed with inorganic acids such as, for example, hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, phosphoric acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, fumaric acid, anthranilic acid, cinnamic acid, naphthalene sulfonic acid, sulfanilic acid, and the like.
  • Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium hydroxide, ammonium hydroxide, potassium hydroxide, and the like; and organic bases such as mono-, di-, and tri-alkyl and -aryl amines (e.g., triethylamine, diisopropyl amine, methyl amine, dimethyl amine, and the like) and optionally substituted ethanolamines (e.g., ethanolamine, diethanolamine, and the like) .
  • inorganic bases such as, for example, sodium hydroxide, ammonium hydroxide, potassium hydroxide, and the like
  • organic bases such as mono-, di-, and tri-alkyl and -aryl amines (e.g., triethylamine, diisopropyl amine, methyl amine, dimethyl amine, and the like) and optionally substituted ethanolamines (e.g., ethanolamine, diethanolamine,
  • Physiologically tolerable carriers are well known in the art.
  • Exemplary liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH, physiological saline or both, such as phosphate-buffered saline.
  • aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes.
  • Liquid compositions can also contain liquid phases in addition to and to the exclusion of water.
  • exemplary additional liquid phases include glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions .
  • an "effective amount” is a predetermined amount calculated to achieve the desired therapeutic effect, e.g., to modulate activity of an invention TPBD.
  • the required dosage will vary with the particular treatment and with the duration of desired treatment; however, it is anticipated that dosages between about 10 micrograms and about 1 milligram per kilogram of body weight per day will be used for therapeutic treatment. It may be particularly advantageous to administer such compounds in depot or long-lasting form as discussed hereinafter.
  • a therapeutically effective amount is typically an amount of an TPBD-modulating agent or compound identified herein that, when administered in a physiologically acceptable composition, is sufficient to achieve a plasma concentration of from about 0.1 ⁇ g/ml to about 100 ⁇ g/ml, preferably from about 1.0 ⁇ g/ml to about 50 ⁇ g/ml, more preferably at least about 2 ⁇ g/ml and usually 5 to 10 ⁇ g/ml.
  • Therapeutic invention anti-TPBD antibodies can be administered in proportionately appropriate amounts in accordance with known practices in this art.
  • invention proteins may be employed in a competitive binding assay.
  • Such an assay can accommodate the rapid screening of a large number of compounds to determine which compounds, if any, are capable of binding to TPBDs. Subsequently, more detailed assays can be carried out with those compounds found to bind, to further determine whether such compounds act as modulators, agonists or antagonists of invention TPBDs.
  • Compounds that bind to and/or modulate invention TPBDs can be used to treat a variety of pathologies mediated by invention TPBDs.
  • invention TPBD polypeptides are known to influence the activities of, for example, NF- ⁇ B.
  • homologous TRAF polypeptides are known to influence the activities of, for example, NF- ⁇ B and cJun N-terminal kinase (JNK) .
  • JNK cJun N-terminal kinase
  • invention TPBD polypeptides are contacted with an "unknown” or test substance, the activity of the invention TPBD polypeptide is monitored subsequent to the contact with the "unknown” or test substance, and those substances which effect a resultant modulation of, for example, NF- ⁇ B activity or JNK activity are identified as functional ligands for TPBD polypeptides.
  • bioassays for identifying compounds which modulate the activity of invention TPBD polypeptides can be used which routinely are used to test for protein :protein interactions.
  • Such bioassays include yeast two-hybrid assays, glutathione-S-transferase fusion protein binding assays, co-immmunoprecipitation assays, and the like.
  • assays are well known in the art and can be found in standard reference texts such as Sambrook et al . , supra . , and Current Protocols in Molecular Biology, supra .
  • transformed host cells that recombinantly express invention polypeptides can be contacted with a test compound, and the modulating effect (s) thereof can then be evaluated by comparing the TPBD-mediated response (e.g., via reporter gene expression) in the presence and absence of test compound, or by comparing the response of test cells or control cells (i.e., cells that do not express TPBD polypeptides), to the presence of the compound.
  • TPBD-mediated response e.g., via reporter gene expression
  • test cells or control cells i.e., cells that do not express TPBD polypeptides
  • a compound or a signal that "modulates the activity" of invention TPBD polypeptides refers to a compound or a signal that alters the activity of TRAF polypeptides so that the activity of the invention polypeptide is different in the presence of the compound or signal than in the absence of the compound or signal.
  • such compounds or signals include agonists and antagonists.
  • An agonist encompasses a compound or a signal that activates TPBD protein expression.
  • an antagonist includes a compound or signal that interferes with TPBD expression.
  • the effect of an antagonist is observed as a blocking of agonist-induced protein activation.
  • Antagonists include competitive and non-competitive antagonists.
  • a competitive antagonist (or competitive blocker) interacts with or near the site specific for agonist binding.
  • a non-competitive antagonist or blocker inactivates the function of the polypeptide by interacting with a site other than the agonist interaction site.
  • control is a cell or culture that is treated substantially the same as the test cell or test culture exposed to the compound, with the distinction that the "control" cell or culture is not exposed to the compound.
  • control cell or culture may be a cell or culture that is identical to the transfeeted cells, with the exception that the "control" cell or culture do not express native proteins. Accordingly, the response of the transfeeted cell to compound is compared to the response (or lack thereof) of the "control" cell or culture to the same compound under the same reaction conditions .
  • the activation of TPBD polypeptides can be modulated by contacting the polypeptides with an effective amount of at least one compound identified by the above-described bioassays.
  • methods for diagnosing cancer comprising: detecting, in said subject, a defective sequence or mutant of SEQ ID NOs : 7 , 9, and 11.
  • diagnostic systems preferably in kit form, comprising at least one invention nucleic acid in a suitable packaging material.
  • the diagnostic nucleic acids are derived from the TPBD- encoding nucleic acids described herein. In one embodiment, for example, the diagnostic nucleic acids are derived from any of SEQ ID NOs: 7, 9, and 11.
  • Invention diagnostic systems are useful for assaying for the presence or absence of nucleic acid encoding TPBD in either genomic DNA or in transcribed nucleic acid (such as mRNA or cDNA) encoding TRAF.
  • a suitable diagnostic system includes at least one invention nucleic acid, preferably two or more invention nucleic acids, as a separately packaged chemical reagent (s) in an amount sufficient for at least one assay. Instructions for use of the packaged reagent are also typically included. Those of skill in the art can readily incorporate invention nucleic probes and/or primers into kit form in combination with appropriate buffers and solutions for the practice of the invention methods as described herein.
  • packaging material refers to one or more physical structures used to house the contents of the kit, such as invention nucleic acid probes or primers, and the like.
  • the packaging material is constructed by well known methods, preferably to provide a sterile, contaminant-free environment.
  • the packaging material has a label which indicates that the invention nucleic acids can be used for detecting a particular sequence encoding TPBD including the nucleotide sequences set forth in SEQ ID NOs: 7, 9, and 11 or mutations or deletions therein, thereby diagnosing the presence of, or a predisposition for, cancer.
  • the packaging material contains instructions indicating how the materials within the kit are employed both to detect a particular sequence and diagnose the presence of, or a predisposition for, cancer .
  • packaging materials employed herein in relation to diagnostic systems are those customarily utilized in nucleic acid-based diagnostic systems.
  • the term "package” refers to a solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding within fixed limits an isolated nucleic acid, oligonucleotide, or primer of the present invention.
  • a package can be a glass vial used to contain milligram quantities of a contemplated nucleic acid, oligonucleotide or primer, or it can be a microtiter plate well to which microgram quantities of a contemplated nucleic acid probe have been operatively affixed.
  • Instructions for use typically include a tangible expression describing the reagent concentration or at least one assay method parameter, such as the relative amounts of reagent and sample to be admixed, maintenance time periods for reagent/sample admixtures, temperature, buffer conditions, and the like.
  • TRAF protein binding domain fragments TPBDs
  • HAUSP residues 1-213 of SEQ ID N0:2
  • SPOP residues 1-180 of SEQ ID NO:4
  • the PCR was performed for 1 cycle of 94 °C for 2 min followed by 35 cycles of 94°C for 15 s, 60°C for 20 s and 72°C for 100 s, followed by a final cycle of 72°C for 5 min, using the following primers HAUSP: 5' GCGAATTCCAGGCCGCG 3' (SEQ ID NO: 13) and 5' TTCCTCGAGCCGACTTAGCCTGTGTGC 3' (SEQ ID NO:14); SPOP: 5' CTTCGAATTCGCGATGTCAAGGGTTCC 3' (SEQ ID NO: 15) and 5' CCATGCTCGAGGTATTCTAGCCAGAAATG 3' (SEQ ID NO: 16);
  • TRAF 7 5' CCAGAATTCACCAGTGAATTAGTGCC 3' (SEQ ID NO: 17) and 5' CCACTCGAGTAATGTACCAATGCTAGTCC 3' (SEQ ID NO: 18).
  • the amplified fragments were purified, digested with EcoRl and Xho 1 restriction enzymes and subcloned into pCDNA-3-myc tag and into pGEX4T (Pharmacia) .
  • TRAF7 mRNA was most highly expressed in brain, heart, skeletal muscle, kidney, liver and placenta. TRAF7 was expressed at a lower level in thymus, small intestine, lung, spleen, PBL and colon. USP7, also known as HAUSP, was expressed as a doublet of about 7 and 5.5 kb . USP7 was most highly expressed in heart, skeletal muscle, and kidney, with lower expression in brain, thymus, liver, placenta and PBLs, and lowest expression, barely detectable, in colon, spleen, small intestine and lung.
  • SPOP was expressed as mRNA of about 2.6 kb . SPOP was most highly expressed in heart and skeletal muscle, with lower expression in kidney and liver, and even lower expression in brain, skeletal muscle, colon, thymus, small intestine, placenta, lung, and PBLs.
  • GST-TRAF2 (263-501), (GST- HAUSP (SEQ ID NO: 8), GST-SPOP (SEQ ID NO: 10) and GST- TRAF7 (SEQ ID NO: 12) proteins were purified from bacterial lysates by affinity chromatography using glutathione-Sepharose (Amersham Pharmacia Biotech) . The resins were then washed with PBS containing ImM dithiothreitol until the OD 2 ⁇ 0mn reached ⁇ 0.01.
  • Plasmids pGEX-TRAF2 (263-501) , pGEX-CD40 (ct) , pGEX-Fas (ct) , pGEX-LT ⁇ R (ct ) , pGEX-DR4 (ct) and pGEX- NGFR(ct) have been previously described (Leo et al . , 1999, JBC 274, 22414; Sato et al . , 1995, FEBS lett.358
  • Plasmid pGEX-TNF- R2(ct) was kindly provided by Dr. C. Ware (La Jolla Institute for Alergy and Immunology) .
  • Equal amounts of each labeled protein (2-6 ⁇ l lysate) were then diluted with 250 ⁇ l of binding buffer (142 mM KC1, 5 mM MgC12, 10 mM Hepes pH 7.4, 0.2% Nonidet-P40, 0.5 mM dithiothreitol, ImM EGTA, 0.5 mM phenyl-methyl- sulphonyl-fluoride and a mixture of other protease inhibitors (Boehringer 1697498) and incubated with the GST-protein resins (0.25 ⁇ g protein) at 4°C for 2h.
  • binding buffer 142 mM KC1, 5 mM MgC12, 10 mM Hepes pH 7.4, 0.2%
  • Nonidet-P40 0.5 mM dithiothreitol
  • ImM EGTA 0.5 mM phenyl-methyl- sulphonyl-fluoride
  • a mixture of other protease inhibitors Boehringer
  • the resins were then extensively washed with binding buffer and the GST-protein binding complexes were eluted with buffer containing 50 mM Tris-HCI pH 8 , 1 mM dithiothreitol and 100 mM glutathione and analyzed by SDS-PAGE and fluorography .
  • vi tro protein binding assays were performed by in vi tro translating TRAF2 or the TRAF domain of TRAF7 in the presence of 35 S-L-methionine in reticulocyte lysates, as described above, or following in vivo overexpression of TRAF2 or the TRAF domain of TRAF7 by transfection of 293T cells.
  • Equal volumes of the in vi tro translation mixtures (10 ⁇ l) were incubated with GST-fusion proteins containing the cytosolic domains of different members of the TNF-R family (1 ⁇ g) (FAS, TNF-R2, CD40, LT ⁇ R, NGFRp75, and DR4) immobilized on glutathione- Sepharose.
  • TRAF domain protein expression in vivo 293T lysates (50 ⁇ l) were incubated with GST-fusion proteins (1 ⁇ g) containing the cytosolic domains of the TNF-R family members DR4 , HVEM, TNF-R2, LT ⁇ R, NGFRp75, CD40, and TRAF7 and then immobilized on glutathione- Sepharose.
  • Control GST and other GST control proteins were included in all assays After washing, bound proteins were analyzed by SDS-PAGE followed by fluorography for binding assays using in vi tro translated proteins.
  • samples were immunoblotted using anti-TRFA2 or anti-Myc antibodies to detect TRAF2 or TRAF7 TD binding, respectively. Bound proteins were then detected by standard chemiluminescence assay (ECL; Amersham; Piscataway NJ) .
  • TNF-R2 three TNF family receptors interacted with the GST-fused TRAF domain of TRAF2: TNF-R2, CD40 and LT ⁇ R.
  • TNF-R2 three TNF family receptors interacted with the GST-fused TRAF domain of TRAF2: TNF-R2, CD40 and LT ⁇ R.
  • FAS, NGFRp75 and DR4 did not appreciably interact with the TRAF domain of TRAF2.
  • the GST-SPOP fusion protein showed significant interaction with only one of these six receptors, TNF-R2; and GST-HAUSP did not significantly interact with any of the six receptors.
  • GST-TRAF7 binds TNF-R2, CD40 (albeit weakly), LT ⁇ R, NRFRp75 and DR4.
  • TRAF7 In cell lysates of 293 cells transfeeted with TRAF2 or the TRAF domain of TRAF7, binding was observed with several TNF-R family members.
  • TRAF2 interacted with HVEM, TNF-R2, LT ⁇ R, CD40 and TRAF7, with low binding activity also observed with NGFRp75.
  • the TRAF domain of TRAF7 interacted with DR4, LT ⁇ R, and NGFRp75, with strongest binding observed with TRAF7.
  • a faint band of TRAF7 was also observed to interact with TNF-R2 under these conditions, but no binding of TRAF7 to CD40 or HVEM was detected. Therefore, TRAF7 has strong binding activity with itself.
  • Plasmids containing cDNAs encompasing the complete open reading frames of hTRAF 1 (pSG5-TRAF 1), hTRAF 2 (pcDNA3-HA-TRAF2) , hTRAF3 (pbluscriptKS-TRAF3b) , hTRAF4 (pcDNA3-HA-TRAF4 ) , hTRAF5 (pcDNA3-Flag-TRAF5 ) and hTRAF ⁇ (pcDNA3-myc-TRAF6) have been previously described (Sato et al., 1995, FEBS lett.358, 113; Nakano et al., 1996, JBC 271, 14661; Mosialos et al . , 1995, Cell 80, 389; Krajewska et al., 1998, Am.J.Pathol. 152, 1549; Leo et al., 1999, JBC 274, 22414; Song and Donner.1995,
  • TRAF2, TRAF3, TRAF4, TRAF5, TRAF6, full-length I-TRAF (Rothe et al . , Proc. Natl. Acad. Sci. USA 93:8241-8246 (1996)), HAUSP (1-213, SEQ ID NO:8), SPOP (1-180, SEQ ID NO:10) and TRAF7 (282- 435, SEQ ID NO: 12) were incubated with the GST-protein resins using the previously described method.
  • the resultant images showed that the GST-fused TPBD of TRAF7 (SEQ ID NO: 12) interacted with all previously identified TRAF proteins, TRAFSl-6, and with I-TRAF (see Figure 6) . Additionally, the TPBD of TRAF7 showed an ability to self-associate .
  • the GST-fused TPBD of HAUSP (SEQ ID NO: 8) also was able to interact with all previously known TRAF proteins, although somewhat weakly with TRAF3, and weakly with I-TRAF. However,
  • HAUSP did not demonstrate an ability to self-associate.
  • the GST-fused TPBD of SPOP demonstrated a higher selectivity, having significant interactions with only TRAFl and TRAF6, and no ability to self-associate.
  • no heterologous interaction between invention TPBDs i.e., HAUSP:SPOP, HAUSP :TRAF7 and SPOP:TRAF7 were observed.
  • 293T cells were obtained from ATCC (Rockville, MA) and cultured in Dulbecco modified Eagle ' s-high glucose medium (Life technology, Inc) supplemented with 10% FCS (Hyclone, UT) , ImM glutamine and antibiotics.
  • the promoter-containing reporter gene plasmids pUC13- 4xNFkB-luc (containing 4 tandem HIV-NFkB response elements and the minimal fos promoter) and pCMV- ⁇ - galactosidase has been previously described (Miyashita and Reed, 1995, Cell 80, 293 ; Lin and Stavnezer, 1996, MCB 16, 4591) .
  • 293T cells were calcium phosphate-transfected with 12 ⁇ g DNA, including 3.5 ⁇ g of either pcDNA3-myc-hTRAF2 , pcDNA3-myc-hTRAF5 or pcDNA3-myc-hTRAF6, in combination with either 3.5 or 7 ⁇ g of control plasmid, pcDNA3-myc-HAUSP (1-213, SEQ ID NO: 8), pcDNA3-myc-SPOP (1-180, SEQ ID NO: 10) or pcDNA3-myc- TRAF7 (282-435, SEQ ID NO: 12) at 60% confluency in 6- well plates in duplicate, except in the case of TRAF5 in which only 7 ⁇ g of pcDNA3-myc-HAUSP or pcDNA3-myc-TRAF7 were transfeeted.
  • Immunobloting was performed as described (Krajewski et al . , 1996, Anal. Biochem. 236, 221). Briefly, 5 ⁇ l of each cell lysate was analyzed by immunoblotting using anti-TRAF6 or anti-myc antibodies and standard chemiluminiscence methods (Amersham) for detection .
  • TRAF 7 can inhibit NF- ⁇ B activon induced by TRAF6 (see Figure 7) .
  • the TPBD of HAUSP is capable of canceling nearly all of the TRAF6-induced increase in NF-KB activon.
  • the TPBD of HAUSP also strongly inhibits NF- ⁇ B activation induced by TRAF 2 and TRAF 5.
  • the TPBD of TRAF 7 also demonstrates the ability to inhibit TRAF 2-mediated NF- ⁇ B activation, but actually increases TRAF 5 mediated NF- ⁇ B activation.
  • TRAF7 and USP7 were further characterized with respect to regulating NFKB activity.
  • the effect of TRAF7 and USP7 in regulating the NFKB activity induced by TRAF2 and TRAF6 in a mammalian cell line was tested. Briefly, 293T cells were transfeeted in 6 well plates with approximately 10 ⁇ g of pcDNA3 control plasmid, 3.5 ⁇ g of either pcDNA3-myc-hTRAF6 or pcDNA3-hTRAF2, and 7 ⁇ g of any of several TRAF7 or USP7 plasmid constructs containing various domains (see Figure 8, bottom) .
  • the transfections also included 0.5 ⁇ g pUC13-4xNF ⁇ B-luc plasmid and 1 ⁇ g pCMV- ⁇ -galactosidase plasmid.
  • Relative NFKB activity was assessed by luciferase assays using 10 ⁇ l of each of the cell lysates prepared 36 h after transfection, with normalization for ⁇ -galactosidase activity. At least three to eight independent experiments were performed. The results are presented as fold of activation, with one representative experiment shown ( Figure 8) .
  • full length USP7 and a USP7 construct lacking the TRAF domain had a slight inhibitory effect on NFKB activity induced by TRAF2 or TRAF6.
  • the USP7 TRAF domain alone strongly inhibited the TRAF2 and TRAF6-induced increase in NFKB activation.
  • full length TRAF7 as well as the TRAF domain of TRAF7 alone, had inhibitory activity for TRAF2 and TRAF6-induced increase in NFKB activation.
  • a TRAF7 mutant construct lacking the TRAF domain did not show any effect on inhibiting the NFKB activation mediated by TRAF2 or TRAF6.
  • TRAF domains of TRAF7 , USP7 and SPOP were transfeeted in 6 well plates with approximately 10 ⁇ g of pcDNA3 control plasmid, 7 ⁇ g of either TRAF7 TD, USP7 TD or SPOP TD plasmids, and either no plasmid (TNF ⁇ in Figure 9) or 3.5 ⁇ g of pcDNA3-myc-CD40 (CD40 in Figure 9), together with 0.5 ⁇ g pUC13-4xNFkB-luc plasmid and 1 ⁇ g pCMV- ⁇ -galactosidase plasmid.
  • TNF ⁇ treatment was performed by adding 100 ng/ml of TNF ⁇ to the cells 12 h before harvesting.
  • Relative NFKB activity was assessed by luciferase assays using 10 ⁇ l of each of the cell lysates prepared 36 h after transfection, with normalization for ⁇ -galactosidase activity. At least three independent experiments were performed. The results of a representative experiment are presented as fold of activation.
  • the TRAF domain of TRAF7 had some inhibitory activity for activation of NFKB induced by both TNF ⁇ and CD40 overexpression.
  • the TRAF domain of USP7 had even stronger inhibitory activity than the TRAF domain of TRAF7.
  • the TRAF domain of SPOP showed essentially no inhibitory activity of NFKB activation by either TNF ⁇ or CD40 overexpression.
  • TRAF7 and USP7 of NFKB activation induced by the TRAF-associated protein NIK were transfeeted in 6 well plates with approximately 10 ⁇ g of pcDNA3 control plasmid, 7 ⁇ g of either empty pcDNA3, or pcDNA3-myc-containing TRAF7 , TRAF7 TD, USP7 TD or SPOP TD plasmids, and 3.5 ⁇ g of pcDNA3-Flag-NIK, together with 0.5 ⁇ g pUC13-4xNF ⁇ B-luc plasmid and 1 ⁇ g pCMV- ⁇ -galactosidase plasmid.
  • Relative NFKB activity was assessed by luciferase assays using 10 ⁇ l of each of the cell lysates prepared 36 h after transfection, with normalization for ⁇ -galactosidase activity. At least three independent experiments were performed. The results of a representative experiment are presented as fold of activation ( Figure 10) .
  • NIK induced NFKB activation can be partially regulated by TRAF7 and USP7. Both TRAF7 and the TRAF domain of TRAF7 partially inhibited NIK-induced NFKB activation. USP7 TRAF domain also partially inhibited NIK induced NFKB activation, although the full length USP7 did not inhibit NIK-induced NFKB activation ( Figure 10)
  • TRAF7 and USP7 deletion mutants were constructed.
  • Cos7 cells were transfeeted with Lipofectamin plus (Life Technologies; Rockville MD) and a total of 3 ⁇ g of plasmid.
  • the TRAF7 deletion mutants (shown in Figure 11) were constructed as Myc fusion proteins. 24 hours after transfection, cells were plated onto poly-lysinated cover-glasses and allowed to settle for 24h more. Cells were fixed with methanol-acetone (50% each) .
  • FIG 11 shows the subcellular localization of TRAF7 and different deletion mutants of the molecule.
  • a scheme of the different TRAF7 mutants analyzed is also shown.
  • TRAF7 localizes in cytosolic corpuscles, which can appear as individual dots (panel A) or as large aggregates (A, small panel) .
  • Deletion mutants of TRAF7 lacking the RING finger domain (B) containing only the tripartite domain (C) , lacking the poly-acidic region (D), or lacking the TRAF domain (E) have a similar subcellular localization as the full length TRAF7.
  • the TRAF domain alone (F) or the TRAF domain containing also the leucine zippers (G) did not show this particular subcellular localization, having a diffuse cytosolic localization.
  • the C-terminal region of the molecule containing the TRAF domain and the poly-acidic region (H) or the poly-acidic region alone (I) have a similar diffuse cytosolic localization, although in this case they appear to be also located in the nucleus .
  • Cos7 cells were transfeeted with
  • USP7 full length and deletion mutants were constructed as Myc fusion proteins.
  • the USP7 deletion mutants tested were a mutant lacking the TRAF domain and a mutant containing USP7 TRAF domain.
  • 24 hours after transfection cells were plated onto poly-lysinated cover-glasses and allowed to settle for 24h more. Cells were fixed with methanol-acetone (50% each) . After blocking, cells were stained with anti-myc mAb (Santa Cruz Biothech.) and a secondary FITC-labelled rabbit anti-mouse Ig (Dako) . Analysis was performed using a Bio-Rad confocal microscope.
  • Figure 12 shows the subcellular localization of USP7 full length (A and B) , a deletion mutant of USP7 lacking the TRAF domain (C and D) and USP7 TRAF domain (E and F) .
  • USP7 is mainly located in the nucleus, although some cytosolic staining can also be observed in some cells.
  • the deletion mutant lacking the TRAF domain is completely excluded from the nucleus, even when it still contains the nuclear localization signal.
  • the TRAF domain of USP7 appears to have a diffuse localization, with a larger concentration in the perinuclear region.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Immunology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Pain & Pain Management (AREA)
  • Urology & Nephrology (AREA)
  • Pulmonology (AREA)
  • Transplantation (AREA)
  • Cardiology (AREA)
  • Vascular Medicine (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Rheumatology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne des polypeptides de domaine de liaison de protéines TRAF (TPBD). Cette invention concerne aussi des molécules d'acide nucléique codant pour ces TPBD, des vecteurs contenant ces molécules d'acide nucléique et des cellules hôtes contenant ces vecteurs. Cette invention concerne encore des anticorps qui peuvent spécifiquement se lier à ces TPBD. Ces TPBD et/ou ces anticorps anti-TPBD sont utiles pour la découverte de médicaments qui suppriment l'auto-immunité, les inflammations, les allergies, le rejet de greffe allogénique, les sepsies et d'autres maladies.
EP00975594A 1999-11-05 2000-11-03 Nouvelles proteines de la famille traf Withdrawn EP1228088A2 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US43478499A 1999-11-05 1999-11-05
US434784 1999-11-05
PCT/US2000/030533 WO2001032696A2 (fr) 1999-11-05 2000-11-03 Nouvelles proteines de la famille traf

Publications (1)

Publication Number Publication Date
EP1228088A2 true EP1228088A2 (fr) 2002-08-07

Family

ID=23725690

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00975594A Withdrawn EP1228088A2 (fr) 1999-11-05 2000-11-03 Nouvelles proteines de la famille traf

Country Status (4)

Country Link
EP (1) EP1228088A2 (fr)
JP (1) JP2003512857A (fr)
AU (1) AU1362101A (fr)
WO (1) WO2001032696A2 (fr)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7425538B2 (en) 2002-03-30 2008-09-16 The Trustess Of Columbia University In The City Of New York HAUSP-p53 interaction and uses thereof
US7498134B2 (en) 2002-03-30 2009-03-03 The Trustees Of Columbia University In The City Of New York HAUSP-Mdm2 interaction and uses thereof
AU2003251363A1 (en) * 2002-07-31 2004-02-16 The Babraham Institute Method of enzymatic deubiquitination
WO2008086502A2 (fr) * 2007-01-10 2008-07-17 University Of Chicago Marqueur moléculaire pour carcinome du rein à cellules claires
TWI502199B (zh) * 2013-05-23 2015-10-01 Univ Nat Central 腫瘤壞死因子受體相關因子７作爲紅斑性狼瘡的生物標記物之用途、偵測人體患有紅斑性狼瘡的方法以及偵測人體患有紅斑性狼瘡的套組
JP6320752B2 (ja) * 2013-12-28 2018-05-09 国立大学法人愛媛大学 新規ユビキチンリガーゼ及びその利用方法

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH10512443A (ja) * 1994-12-30 1998-12-02 ブリガム アンド ウイメンズ ホスピタル Ｔｒａｆ−媒介シグナルの制御

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0132696A2 *

Also Published As

Publication number Publication date
WO2001032696A3 (fr) 2002-01-17
AU1362101A (en) 2001-05-14
JP2003512857A (ja) 2003-04-08
WO2001032696A2 (fr) 2001-05-10

Similar Documents

Publication Publication Date Title
US5942490A (en) Cell death regulators
US7666607B1 (en) TRAF family proteins
US7982002B2 (en) Nucleic acid encoding proteins involved in protein degradation, products and methods related thereto
US20050192427A1 (en) Novel death domain proteins
US20080109917A1 (en) Card-domain containing polypeptides, encoding nucleic acids, and methods of use
US7994282B2 (en) Card proteins involved in cell death regulation
US7927832B2 (en) Nucleic acid encoding proteins involved in protein degradation, products and methods related thereto
WO1998031701A1 (fr) Proteine du domaine pas endothelial
US7196182B2 (en) Card domain containing polypeptides, encoding nucleic acids, and methods of use
US6207422B1 (en) Protein that enhances expression of potassium channels on cell surfaces and nucleic acids that encode the same
EP0944722B1 (fr) Genes transformants de la tumeur de l'hypophyse et produits derives
US6617430B2 (en) Ataxin-2 binding proteins
EP1228088A2 (fr) Nouvelles proteines de la famille traf
US6638734B1 (en) Nucleic acid encoding proteins involved in protein degradation, products and methods related thereto
WO2000077207A2 (fr) Acides nucleiques codant pour les proteines participant a la decomposition de proteines et produits et procedes qui y sont lies
WO1996036711A2 (fr) Homeoproteine specifique des ilots pancreatiques et regulatrice de la transcription de l'expression du gene de l'insuline
WO2001059065A2 (fr) Nouvelles molecules de la famille des proteines apparentees a card et leurs utilisations
US7041783B2 (en) Survivin-binding proteins, encoding nucleic acids, and methods of use
US20040170997A1 (en) Traf3-binding b-cell-specific receptor

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020528

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050601