Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
  • C12Q1/42—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase involving phosphatase
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
  • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
  • C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
  • C12Q1/18—Testing for antimicrobial activity of a material

Definitions

• the present invention relates to the use of an enzyme found in fungi, bacteria, insects, nematodes, worms, protozoa, mites and other organisms expressing that enzyme as a target in a screening assay by means of which agents capable of inhibiting the function of that enzyme may be identified.
• the screening assay may include complete cell or purii ⁇ ed-enzyme assays adaptable for automation.
• the present invention relates to a screening assay for inhibitors or suppressors of sugar phosphatases or sugar alcohol phosphatases as well as preparations, in particular, pharmaceutical preparations, which include the inhibitor or suppressor obtained from the screening assay.
• trehalose-6-phosphate synthase TPS, expressed by the TPS1 gene
• TPS trehalose-6-phosphate synthase
• TPP trehalose-6-phosphate phosphatase
• Candida albicans is a common microorganism, found in the digestive tract and cavities of 10 to 50% of normal humans, upon a decreased resistance to infection in the host or upon administration of antibiotics for a long term or upon a surgical invasion, these microorganisms proliferate abnormally, damage tissues, and can enter the blood. Treatment is often hampered by the fact that many agents which are active against fungi also are toxic to mammalian cells, leading to a low therapeutic index and undesirable side effects in the patient. A selection of drugs is available to combat fungal infections: Amphotericin B,
• Ketoconazole suffers from similar problems as Ketoconazole. Fluconazole and Itraconazole are more specific, less toxic and more efficacious than Ketoconazole and Miconazole. However Fluconazole is active against fewer fungi. Itraconazole is highly lipophilic and as a result reaches only low levels in most body fluids. As a result there is a requirement for novel antifungals with broader spectrum, higher efficacy and less side- effects. The azole class of antifungals is also widely used in agriculture to combat plant pathogenic fungi (Adams D.J., 1997, In: Molecular genetics of drug resistance, eds. Hayes J. H., Wolf C. R., Harwood Academic Publishers , The Netherlands).
• Some antifungal drug discovery efforts have been directed at components of the fungal cell or its metabolic pathways which are unique to fungi, and hence might be used as targets of new therapeutic agents. Ideally, these should act on the fungal pathogen without undue toxicity to host cells. Because no single approach is effective against all fungal pathogens and because of the possibility of developed resistance to previously effective antifungal compounds, there remains a need for new antifungal agents with novel mechanisms of action. An essential aspect of meeting this need is the selection of an appropriate component of fungal structure or metabolism as a therapeutic target.
• a preferred method continues to be the mass screening of compound libraries for active agents by exposing cultures of pathogens to the test compounds and assaying for inhibition of growth.
• a compound which is found to inhibit fungal growth in culture may be acting not on the desired target but on a different, less unique fungal component, with the result that the compound may act against host cells as well and thereby produce unacceptable side effects. Consequently, there is a need for assay or screening methods which more specifically identify those agents that are active against a certain intracellular target. Additionally, there is a need for assay methods having greater throughput, i.e., which reduce the time and materials needed to test each compound of interest.
• biocides, antiparasite drugs or coagents for new and conventional antiparasite drugs or biocides having at least one of the following properties: enhancement of efficiency, lowering of concentration required for effective treatment and reduction of side effects of conventional drugs.
• the present invention includes a novel target for antiparasitic, especially antifungal agents, such as antifungal drugs or fungicides, that is not required for growth of the parasite under standard conditions in vitro but that is specifically required for survival of the parasite under all conditions of reduced growth or absence of growth and all other conditions which in some way deviate from optimal growth conditions and/or apply stress to the parasite.
• antifungal agents such as antifungal drugs or fungicides
• the word 'parasite refers to an organism having a biosynthetic pathway in which sugar-, glycerol- and sugar alcohol phosphates are converted to the corresponding unphosphorylated compounds and which is capable of infesting or causing a disease or discomfort in a host.
• Examples of such parasites are fungi, bacteria, insects, nematodes, worms, mites, protozoa.
• trehalose-6-phosphate phosphatase and similar phosphatases converting sugar-, glycerol- and sugar alcohol phosphates to the corresponding unphosphorylated compounds as well as the genes expressing these enzymes are targets for antiparasite agents, especially antifungal agents, such as antiparasitic drugs such as antifungal drugs or fungicides, either alone or in combination with other agents, e.g. drugs inhibiting growth of, or compounds inducing stress in the cells of the pathogen. Inhibition of the enzyme in parasitic pathogens, either directly or by blocking its expression from the corresponding gene, leads to accumulation of trehalose-6-phosphate rather than trehalose. As a result, they show intracellular acidification.
• the sequestration of free phosphate into trehalose-6-phosphate reduces glycolitic flux since phosphate is required at the level of glycoaldehyde-3-phosphate dehydrogenase and since trehalose-6-phosphate inhibits hexokinase.
• the reduced glycolitic flux and the phosphate sequestration results in reduced ATP levels which will lower the activity of the plasma membrane H + -ATPase, further lower the intracellular pH, the activity of the multidrug - ATPase, enhancing sensitivity to antifungal drugs and many other processes depending on efficient cellular ATP production.
• the cells will therefore experience even more stress, will induce the stress response even more vigorously, and will enter into a vicious circle of stress and enhanced synthesis to even hyperaccumulation of trehalose-6-phosphate as a reaction against the stress, and they will rapidly die or cease to grow.
• Inhibition of other parallel pathways to produce trehalose is also included within the scope of the invention so that the targeted cell has high trehalose phosphate levels and low trehalose levels thus doubly weakening the cell against attack by antiparasitic agents such as antifungal drugs or fungicides or by the immune system of the host.
• the present invention includes, in one aspect, inhibitors of trehalose-6-phosphate phosphatase. Inhibition of this enzyme can lead to much faster elimination of a parasitic pathogen. This effect might be obtained by such inhibitors alone or in combination with commonly known antiparasitic agents, e.g. antifungal drugs or fungicides or other compounds or factors inducing the fungal stress response.
• the present invention is also applicable to organisms that synthesize large quantities of trehalose, using this sequence of enzyme reactions, or at least the dephosphorylation reaction of trehalose-6-phospahte, such as bacteria, insects, nematodes, worms, mites, protozoa etc.
• the present invention includes all cellular parasites of mammals which depend on trehalose synthesis for survival in the host organism, and which make use of trehalose-6-phosphate phosphatase as part of the trehalose biosynthesis pathway. Further examples include Mycobacterium tuberculosum, Synechochystis sp., Streptomyces coelicolor, Salmonella typhimurium, Encephalitozoon cuniculi.
• the present invention also includes the addition of a stress raising factor to enhance the inhibitor in combating the pathogen.
• the stress factor may be temperature, osmotic pressure, an immunological reaction of the infected host or a compound having an equivalent stress-raising effect.
• Non-optimal growth conditions generally prevail during growth of parasitic, e.g.
• Trehalose-6-phosphate phosphatase the second enzyme in the biosynthesis pathway of trehalose, converts trehalose-6-phosphate into trehalose. All fungi contain trehalose, which serves as a storage carbohydrate and as a stress protectant. Because of these functions trehalose is accumulated under unfavorable growth conditions and in survival forms where it can reach very high concentrations. Trehalose-6-phosphate on the other hand is normally only found in very low concentrations and its accumulation at high levels is toxic to the cells.
• trehalose-6-phosphate synthase which is encoded by the TPS1 gene.
• Inactivation of the TPS2 gene, which encodes trehalose-6-phosphate phosphatase renders fungal cells hypersensitive to stress conditions, for example, commonly used antifungals specifically under non-optimal growth conditions. As an example this is demonstrated for the fungus Saccharomyces cerevisiae.
• the genes of trehalose metabolism, including the TPS2 gene are also present in Candida albicans, an important human pathogen. Equivalent genes to, or names for TPS2 are HOG2, PFK3, D4416, YD8554.07, YDR074W.
• trehalose biosynthesis uses the same enzymes, trehalose-6-phosphate synthase and phosphatase, in all fungi, including fungal pathogens of humans, mammals and other animals, and plants.
• fungal cells including those of pathogens such as Candida albicans, accumulate large quantities of trehalose and often also other sugars or polyols.
• Inhibitors of trehalose-6-phosphate phosphatase cause accumulation of trehalose-6-phosphate.
• Mutants deficient in the trehalose-6-phosphate phosphatase enzyme or cells treated with the novel inhibitors in accordance with the present invention accumulate large quantities of trehalose-6- phosphate under these conditions, which is highly toxic to the cells because it is a strong acid. It acts as a pleiotropic agent impairing a wide range of essential cellular components and cellular defense systems. Because the accumulation of trehalose-6- phosphate itself is a stress condition to the cell and because the trehalose-6-phosphate is synthesized as a reaction to the stress condition, the cells enter into a vicious circle after which they finally die.
• the present invention also includes all similar metabolic situations, such as the conversion of glycerol-3 -phosphate to glycerol, mannitol-1- phosphate to mannitol, sorbitol-6-phosphate to sorbitol, arabitol-5 -phosphate to arabitol, erythritol-4-phosphate to erythritol.
• Glycerol is generally accumulated in fungi under osmotic stress. Depending on the species sugar alcohols are accumulated together with trehalose. This is probably the case for instance in Aspergillus fumigatus. It should be emphasized that a purpose of the antiparasitic, e.g.
• antifungal agents in accordance with the present invention is not only to block the growth of the parasite but preferably to eradicate the parasite or to assist in its eradication. Hence, although it is useful to have an antifungal that blocks the growth of the fungus, it is much better to have an antifungal that kills the fungus. Especially in immunocompromised hosts the difference between mere inhibition of growth of the fungus and actual killing of the fungus is important since these patients will have a reduced capacity to eliminate the fungus themselves when its growth is merely inhibited.
• trehalose-6-phosphate synthase The synthesis of trehalose is induced in fungi under a variety of stress conditions.
• yeast it is part of the general stress response mechanism, which is mediated by STRE- elements in the promoter of genes involved in stress protection (e.g. heat shock proteins, catalase, TPS1 encoding trehalose-6-phosphate synthase, etc.).
• stress protection e.g. heat shock proteins, catalase, TPS1 encoding trehalose-6-phosphate synthase, etc.
• inhibitors that act on the trehalose-6-phosphate phosphatase lock the fungus into a vicious circle. Because it is stressed it reacts with the stress response mechanism of which stimulation of trehalose synthesis forms part.
• trehalose-6-phosphate will be accumulated instead of trehalose and it will become even more stressed, inducing an even stronger stress response resulting in more toxic trehalose-6-phosphate, and so on. Since the sensitivity of fungi to antifungal drugs is in part determined by the multidrug ATPase or multidrug efflux pump, severe disturbance of ATP generation will enhance the sensitivity to antifungal drugs.
• the tps2 mutant in Saccharomyces cerevisiae is not only temperature sensitive but also osmosensitive. It has been isolated as an osmosensitive mutant and the gene called HOG2. In tissues of organisms, water availability is usually restricted and the fungal pathogens are therefore generally osmostressed. Since inhibition of trehalose-6- phosphate phosphatase renders the cells osmosensitive, the fungus will also be unable to survive because of this reason.
• the present invention includes all antiparasitic agents, e.g. antifungal drugs or fungicides, that inhibit enzymes converting with a low or high degree of specificity, sugar phosphates into sugars or sugar alcohol phosphates into sugar alcohols that are accumulated in large quantities for instance, but not exclusively, under conditions deviating from the optimal growth condition or as a reaction to stress conditions.
• antiparasitic agents e.g. antifungal drugs or fungicides, that inhibit enzymes converting with a low or high degree of specificity, sugar phosphates into sugars or sugar alcohol phosphates into sugar alcohols that are accumulated in large quantities for instance, but not exclusively, under conditions deviating from the optimal growth condition or as a reaction to stress conditions.
• the present invention also includes all biocides acting on insects, nematodes, bacteria, worms, mites, protozoa and other organisms accumulating large quantities of trehalose and/or similar stress-protective sugars or sugar alcohols and inhibiting enzymes converting with a low or high degree of specificity sugar phosphates into sugars or sugar alcohol phosphates into sugar alcohols that are accumulated in large quantities for instance, but not exclusively, under conditions deviating from the optimal growth condition or as a reaction to stress conditions.
• the present invention includes a screening assay for identifying inhibitors which inhibit a first cell enzyme converting with a low or high degree of specificity a sugar phosphate into a sugar or a sugar alcohol phosphate into a sugar alcohol that are accumulated in large quantities by cells for instance, but not exclusively, under conditions deviating from the optimal growth condition or as a reaction to stress conditions, the inhibition being either directly of the enzyme or indirectly, e.g. by suppressing the expression of the corresponding gene; the method comprising the steps of:
• Step 1 contacting a candidate inhibitor with a biological medium comprising the sugar phosphate or sugar alcohol phosphate and the first enzyme;
• Step 2 measuring activity which depends upon the activity of the first enzyme; Step 3: repeating steps one and two with further candidate inhibitors; and Step 4: selecting those candidate inhibitors which reduce activity of the enzyme compared with the same medium without the inhibitor under the same conditions.
• the inhibitor may act on the enzyme or the gene expressing the enzyme or on any other factor required for successful enzymatic conversion.
• the first enzyme is preferably a phosphatase which synthesizes a sugar or a sugar alcohol as a reaction to stress.
• the reduction in activity is preferably at least 25%, more preferably at least 50%, more preferably at least 75%, more preferably at least 85% and most preferably at least 95%.
• the activity of the second enzyme which is involved in the synthesis of the corresponding sugar phosphate or sugar alcohol phosphate is assessed and the selecting step preferentially involves selection of inhibitors which reduce the activity of the first enzyme while maintaining a viable activity of the second enzyme.
• Viable activities are considered to be at least 25%, more preferably at least 50% and most preferably at least 75% of the activity of the second enzyme in the same medium under the same conditions but without the inhibitor.
• the activity of the inhibitor is preferably better than NEM and/or DTNB, especially when the inhibitor is contacted with the pathogenic cells rather than in vitro.
• the biological medium may include a pure enzyme or pure enzymes, sub-cellular organelles or sub-cellular non-organelle components ⁇ in vitro screening), a cell culture, or animal tissue, plant tissue or a plant or an animal (in vivo screening).
• the sub-cellular organelles or sub-cellular non-organelle components or the cell culture may be obtained from the target organism, e.g. cells from insects, worms, mites or nematodes or cells of fungi, bacteria or protozoa or any other organism with a trehalose pathway.
• Further examples include Mycobacterium tuberculosum, Synechochystis sp., Streptomyces coelicolor, Salmonella typhimurium, Encephalitozoon cuniculi.
• the first enzyme may be one or more of trehalose-6-phosphatase, glycerol-3- phosphatase, mannitol-1 -phosphatase, sorbitol-6-phosphatase, arabitol-5-phosphatase, or erythritol-4-phosphatase or any similar enzyme controlling a metabolic pathway which has an intermediary compound which is normally produced as a reaction to stress conditions and/or is toxic to the cell in high concentrations.
• the present invention may provide a screening assay for an inhibitor of the first enzyme in fungi. Yeast cells are extracted by vortexing in the presence of glass beads. After clearing of the extract by low-speed centrifugation, it is desalted on a gel filtration column, i.
• the final cell extract is used to measure the activity of the first enzyme.
• different concentrations of candidate compounds are added and the residual activity of the first enzyme is measured.
• the substrate trehalose-6-phosphate
• Inhibitors are selected based on their ability to inhibit TPP. Ideally, inhibitors are selected which inhibit TPP but not TPS.
• Filamentous fungi may be extracted after freezing in liquid nitrogen. The frozen mycelia are extracted by grinding in a mortar. After addition of the buffer, the cell extracts are cleared by low-speed centrifugation and desalted over a Sephadex column.
• inhibitors To screen for inhibitors, different concentrations of these compounds are added and the residual activity of the first enzyme is measured.
• the first enzyme is TPP
• trehalose-6-phosphate is added to the cell extracts and either the phosphate or the trehalose that is generated is measured.
• Inhibitors are selected based on their ability to inhibit TPP. Ideally, inhibitors are selected which inhibit TPP but not TPS.
• the present invention may provide a screening assay for an inhibitor of the first enzyme in worms, e.g. nematodes.
• worms e.g. nematodes.
• Nematodes, or worms in general are extracted after freezing in liquid nitrogen.
• the frozen nematodes or worms are extracted by grinding in a mortar.
• the cells are cleared by low-speed centrifugation and desalted over a Sephadex column.
• different concentrations of candidate compounds are added and the residual activity of the first enzyme is measured.
• the first enzyme is TPP
• trehalose-6-phosphate is added to the cell extract and either the phosphate or the trehalose that is generated is measured.
• Inhibitors are selected based on their ability to inhibit TPP.
• inhibitors are selected which inhibit TPP but not TPS.
• the present invention may provide a screening assay for an inhibitor of the first enzyme in insects or mites (Acari). Insects or mites, or parts of the insects or mites are extracted after freezing in liquid nitrogen. The frozen insects or mites are extracted by grinding in a mortar. After addition of the buffer, the cell extracts are cleared by low- speed centrifugation and desalted over a Sephadex column. To screen for inhibitors, different concentrations of candidate compounds are added to the cell extract and the residual activity of the first enzyme is measured. When the first enzyme is TPP, trehalose-6-phosphate is added to the cell extract and either the phosphate or the trehalose that is generated is measured.
• Inhibitors are selected based on their ability to inhibit TPP. Ideally, inhibitors are selected which inhibit TPP but not TPS.
• the present invention may provide a screening assay for an inhibitor of a first enzyme in bacteria or protozoa. Bacterial or protozoal cells are extracted by vortexing in the presence of glass beads. After clearing of the extract by low-speed centrifugation, it is desalted on a gel filtration column, i. e. Sephadex G25. The final cell extract is used to measure the TPP activity. To screen the inhibitors, different concentrations of candidate compounds are added and the residual activity of the first enzyme is measured.
• the substrate When the first enzyme is TPP the substrate, trehalose-6-phosphate, is added to the cell extract and either the formation of trehalose or free phosphate is then measured.
• Inhibitors are selected based on their ability to inhibit TPP. Ideally, inhibitors are selected which inhibit TPP but not TPS. According to the method for the identification of enzyme inhibitors of the present invention, assays may be carried out both in whole-cell preparations or in ex vivo cell- free systems.
• the assay target is an enzyme converting with a low or high degree of specificity a sugar phosphate into a sugar or a sugar alcohol phosphate into a sugar alcohol that are accumulated in large quantities by cells for instance, but not exclusively, under conditions deviating from the optimal growth condition or as a reaction to stress conditions, the inhibition of which enzyme significantly attenuates cell growth or is lethal.
• Test compounds which are found to inhibit a target enzyme in an assay of the present invention are thus identified as potential pharmaceutically or biologically active agents. It is expected that the assay methods of the present invention will be suitable for both small- and large-scale screening of test compounds, as well as in quantitative assays such as serial dilution studies wherein the target enzyme is exposed to a range of test compound concentrations.
• the target enzyme is an intracellular enzyme and the entire, living cells are exposed to the test compound under culture conditions in which the target enzyme is produced, e.g. during non-optimal growth, stress situations.
• Such conditions including essential nutrients, optimal temperatures and other parameters, depend upon the particular fungal, bacterial, insect, nematode, worm, mite or protozoal strain being targeted.
• the step of determining inhibition of the enzyme may be carried out by observing the cell culture's growth or lack thereof; such observation may be made visually, by optical densitometric or other light absorption/scattering means, or by other suitable means, whether manual or automated.
• the method may be performed as a paired-cell assay in which each test compound is separately tested against two different sets of cells, the first having a lower enzyme activity than that of the second and thereby being more susceptible to inhibition of the enzyme.
• differential susceptibility is by using a first cell which has diminished enzyme activity relative to that of a wild-type cell, as for example a mutant strain.
• differential susceptibility to target enzyme inhibitors may be obtained by using a second fungal cell which has increased enzyme activity relative to that of a wild-type cell, as for example one which has been genetically manipulated to cause overexpression of the enzyme.
• overexpression can be achieved by placing into a wild-type cell a plasmid carrying the gene for the target enzyme.
• Preferred is a method in which the differentiated target enzyme activity is produced by subjecting one set of cells to a stress or non-optimal growth situation which favors enzyme activity and a second control set without the stress or non-optimal growth promoter.
• the present invention also includes any inhibitor found by any of the above screening assays.
• the present invention includes any inhibitor found by any of the above screening assays used in a pharmaceutical preparation either alone or in combination with an antifungal drug.
• the present invention also includes any inhibitor found by any of the above screening assays used in a biocide acting on insects, nematodes, worms, mites, bacteria, protozoa or other organisms accumulating large quantities of a sugar alcohol or a sugar in response to stress.
• the present invention also includes a screening assay for identifying inhibitors which inhibit a first cell enzyme converting with a low or high degree of specificity a sugar phosphate into a sugar or a sugar alcohol phosphate into a sugar alcohol that are accumulated in large quantities by cells for instance, but not exclusively, under conditions deviating from the optimal growth condition or as a reaction to stress conditions, the inhibition being either directly of the enzyme or indirectly, e.g. by suppressing the expression of the corresponding gene; the method comprising the steps of:
• Step 1 contacting a candidate inhibitor with a biological medium comprising the sugar phosphate or sugar alcohol phosphate and the first enzyme;
• Step 2 measuring activity which depends upon the activity of the first enzyme;
• Step 3 repeating steps one and two with further candidate inhibitors;
• Step 4 selecting those candidate inhibitors which reduce activity of the enzyme compared with the same medium without the inhibitor under the same conditions.
• Step: 5 contacting the selected candidate inhibitors with a biological medium comprising whole cells having the first enzyme as an intracellular enzyme; and Step 6: selecting those candidate inhibitors which reduce the growth of the cells.
• intracellular inhibitor refers to inhibitors which are able to penetrate target cells, or which are taken up by target cells, and which exhibit inhibitory activity inside the target cell.
• the inability to penetrate the cell (non- permeability), rapid degradation of a compound or a conversion to inactive forms once inside the cell are possible reasons for a compound to be non-active in vivo.
• target cell refers to yeast, fungals, bacterial, protozoal, nematodal, worm, mite or insect cells, or cells of any other organism exhibiting enzymatic TPP activity or, more in general, the sugar alcohol phopshatases or sugar phosphatases of the present invention.
• host or "host organism”, as used herein, refers to a human, an animal or a plant infected by the target cells.
• Figure 1 gives a representation of the trehalose biosynthesis in Saccharomyces cerevisiae as a two step process.
• Figures 2A and B show the growth curves of prototrophic S. cerevisiae wild- type and tps2A strains in the presence of different concentrations of Itraconazole at 37°C, respectively.
• Figure 3 shows the growth curves of prototrophic S. cerevisiae tps2A and wild- type strains in the presence of 10 "7 M of Itraconazole at 33°C. Closed symbols: wild-type (WT); open symbols: tps2 ⁇ ( ⁇ ): DMSO; (•): 10 '7 M Itraconazole (itra).
• FIG. 4 shows the growth curves of prototrophic S. cerevisiae tps2A (PVD23) and wild-type (PVD32) strains in the presence of 10 "6 M of Ketoconazole at 33°C. Closed symbols: wild-type (WT); open symbols: tps2A ( ⁇ ): DMSO; (•): 10 "6 M Ketoconazole (keto).
• Figures 5A and B show the growth curves of diploid prototrophic wild-type S. cerevisiae (PVD190) and diploid heterozygous S. cerevisiae tps2A (PVD191) strains in the presence of different concentrations of Itraconazole at 33°C.
• Figure 6 shows the effect of Itraconazole on the growth of wild-type S. cerevisiae (PVD32) and S. cerevisiae tps2 ⁇ (PVD23) strains on YPD plates.
• Figure 7 shows the effect of osmotic and heat stress on the growth of wild-type S. cerevisiae (PVD32) and S. cerevisiae tps2 ⁇ (PVD23) strains on YPD plates.
• Figure 8 shows the alignment for maximal amino acid similarities of trehalose phosphate phosphatase derived from S. cerevisiae (GENBank accession number 577801) with a homologous sequence from C. albicans (C. albicans database, http://www- sequence.stanford.edu/group/candidal with indication of the 2 putative phosphatase boxes (bold italic and underlined). Identical residues are indicated by an asterisk (*). Gaps in the amino acid sequence are represented by dots (--). A colon (:) stands for strong similarity, a dot (.) stands for weak similarity. The CLUSTAL W (1.8) multiple sequence alignment software was used.
• Figure 9 shows the genomic organisation of the C. albicans TPS2 gene, CaTPS2, and its flanking regions (5598 bp in total) with indication of the oligonucleotide primers used to isolate and amplify the gene (FOR2 and REV2), primers used to check for deletions in the strains (e.g. 3' diag and 5' diag) and with the relevant restriction sites.
• Figure 10 shows the complete cloning strategy used to obtain the C. albicans pUC ⁇ 9/Catps2A: :HisGURA3HisG disruption construct.
• Figure 11 shows a Southern blot analysis for 14 heterozygous TPS2ltps2A CAI4 fransformants as obtainable by using the TPS2 disruption cassette. The presence of two bands, one of 3224 and one of 2874 bp confirm the heterozygous character. 10 ⁇ g of DNA was digested with EcoRI and fragments electrophoresed. Hybridization was performed with the P 32 -labelled 579 bp SnaBl- Hind ⁇ l fragment corresponding to the 3' flanking site of CaTPS2 gene. Left: molecular weight marker VII from Boehringer; Lanes 1-14: putative heterozygous TPS2/tps2 ⁇ C. albicans mutants.
• Figure 12 A shows the results of a PCR analysis with a set of three primers: Diag3, Diag5 and DiagHIS4. Left: Smart ladder molecular weight marker (Eurogentec) Lanes 1-4: putative C. albicans double deletion fransformants. 10 ⁇ l of a standard PCR reaction mixture was loaded on a 1% agarose gel. Lane 2 corresponds with a putative double deletion mutant.
• Figure 12 B shows the results of a Southern blot analysis used for the identification and verification of putative double strain mutants. 10 ⁇ g of DNA was digested with EcoRI and fragments elecfrophoresed.
• Hybridization was performed with the P 32 -labelled 579 bp SnaBl- Hind ⁇ ll fragment corresponding to the 3' flanking site of CaTPS2 gene Left: molecular weight marker VII from Boehringer; Lanes 1-5, 7- 10: putative C. albicans double deletion mutants.
• Figures 13 A and B show the growth curves at 41°C (closed symbols) and 43 °C (open symbols) of the three different C. albicans strains, TPS2ITPS2 (wild-type, SC5314), TPS2ltps2 ⁇ (heterozygous deletion mutant, CC5) and tps2 ⁇ ltps2 ⁇ (homozygous deletion mutant, CC17) respectively, grown on YPgalactose (A) and YPglucose (B) medium respectively.
• TPS2ITPS2 wild-type, SC5314
• TPS2ltps2 ⁇ heterozygous deletion mutant, CC5
• tps2 ⁇ ltps2 ⁇ homozygous deletion mutant, CC17
• Figures 14 and 15 show the inhibition of trehalose-6-phosphate activity in S. cerevisiae strain PVD45 by N ⁇ M and DTNB.
• Figure 16 shows the screening assay in accordance with the present invention for the determination of TPP activity and inhibition thereof in cell extracts using the Biomek robotic system and screening the DIVERSetTM (Chembridge, San Diego) compound library.
• Figure 17 shows the structure of 7 potential TPP inhibitors identified in accordance with the present invention from the DIVERSetTM (Chembridge, San Diego) compound library.
• the identified compounds perform equal to or better than DTNB at 10 "5 M under the circumstances as given.
• Numbers refer to the number given to the compound in the DIVERSetTM compound library.
• Figure 18 shows the in vitro inhibitory activity on S. cerevisiae trehalose phosphate phosphatase of 6 different DiverSetTM compounds, tested in 7 different concentrations. Bars, from left to right respectively stand for: 0M, 3xl0 "5 M, lxl0 "5 M, 3xl0 “6 M, Ixl0- 6 M, 3xl0 "7 M, lxlO "7 M. Compounds are: (1) 136794; (2) 109146; (3) 143067; (4) 116321; (5): 145704; (6) DTNB.
• Figures 19 A and B show the growth curves at 37°C of the wild-type S. cerevisiae (W303.1A) strain in the presence of different concenfrations (0, 10 "5 , 10 "6 , 10 "7 , and 10 “8 M respectively) of inhibitory compounds 136794 (A) and 143067 (B).
• ⁇ ) compound at 10 "7 M;
• Figures 20 A and B show the growth curves at 43°C of a wild-type C. albicans strain (SC5314) in the presence of inhibitory compounds 133207 (oc), 133805 ( ⁇ -), 113610 ( ⁇ ), DTNB ( ⁇ ), NEM (•) or DMSO (”)• Test compounds were added at two different concentrations: 10 "5 M (A) and 10 "7 M (B).
• Figures 21 A and B show the growth curves at 39°C of a C. albicans tps2 ⁇ ltps2 ⁇ strain (CC17) in the presence of inhibitory compounds 133207 (oc), 133805 ( ⁇ -), 113610 ( ⁇ ), DTNB ( ⁇ ), NEM (•) or DMSO ("). Test compounds were added at two different concentrations: 10 "5 M (A) and 10 "7 M (B).
• Figure 22 shows the growth curves at 43 °C of a wild-type C. albicans strain (SC5314) in the presence of inhibitory compounds 100764 ( ⁇ ), 136794 (•), 143067 ( ⁇ ), 113610 ( ⁇ ) or DMSO (")• Test compounds were added at 10 '7 M in DMSO.
• Figure 23 shows percentage survival of Balb/C mice after intravenous injection of 10 6 (A) and 10 7 (B) cells of the wild type, tps2 /tps2 and TPS2/tps2 strains of Candida.
• Figure 24 shows growth of cells of the wild type (first row), tps2 /tps2 (second row) and TPS2/tps2 (third row) strains after incubation for different periods of time at 44 °C. The cells were spotted in serial dilutions on YPD plates.
• Figure 25 shows trehalose levels after a temperature upshift in wild type Candida albicans (•), heterozygous TPS2/tps2 ( ⁇ ) a nd homozygous tps2 /tps2 (A) cells.
• Figure 26 shows trehalose-6-phosphate levels in wild type (circles), heterozygous (squares) and homozygous (triangles) TPS2 deletion sfrains. Samples were taken at different time points after the shift to 37 °C (filled symbols) or 43 °C (open symbols).
• Figure 27 shows growth curves at 37 °C. Wild type (circles), heterozygous (squares) and homozygous (triangles) TPS2 deletion strains are grown in YPD containing DMSO (filled symbols), 10 " M miconazole (open symbols, left panel) or 10 M miconazole (open symbols, right panel).
• Figure 28 shows growth curves at 40 °C. Wild type (circles), heterozygous
• TPS2 deletion strains are grown in YPD containing DMSO (filled symbols), 10 "7 M miconazole (open symbols, left panel) or 10 "8 M miconazole (open symbols, right panel).
• Figure 29 shows growth curves at 43 °C. Wild type (circles), heterozygous (squares) and homozygous (triangles) TPS2 deletion strains are grown in YPD containing DMSO (filled symbols), 10 "7 M miconazole (open symbols, left panel) or 10 "8 M miconazole (open symbols, right panel).
• Fig. 1 is a schematic representation of the metabolic pathway within yeasts, other fungi, bacteria, protozoa, nematodes, worms, mites (Acari), insects and other organisms producing trehalose.
• Trehalose is synthesized from glucose-6-phosphate and UDP- glucose, catalyzed by trehalose-6-phosphate synthase (TPS), which is encoded by the gene TPSl in yeast, to form trehalose-6-phosphate which is further processed to trehalose by trehalose-6-phosphatase (TPP) which is encoded by the gene TPS2 in yeasts.
• TPS trehalose-6-phosphate synthase
• TPP trehalose-6-phosphatase
• additional genes TPS3 and Tsll are believed to encode proteins which only play a regulatory role.
• the promoters of the TPSl and TPS2 genes are highly stress dependent and TPS is very active under bad growth conditions such as during growth on non-fermentable carbon sources, during nutrient limitation, e.g. during the stationary phase and during growth at high temperatures.
• the present inventors have been the first to determine that specific inhibition of the TPP enzyme while maintaining the activity of the TPS enzyme makes the cell more prone to attack by antifungal agents. That is, the amount of antifungal agent required to stop growth or to kill the cell is reduced. This is particularly advantageous as the commonly used antifungal agents have serious side effects and any method of reducing the concentrations having a significant therapeutic effect is valuable.
• the trehalose metabolic pathway is irrelevant in humans and other mammals, so that a specific inhibitor to TPP, offers the possibility of reduced, few or no side effects.
• inventions of the present invention relate to a screening assay for detecting specific inhibitors of TPP.
• specific is meant that the inhibitor (preferably) interferes with TPP only and not with phosphatases or any essential metabolic pathway of the host, e.g. a human, animal or plant in need of treatment.
• Methods for the measurement of trehalose-6-phosphatase activity may comprise methods for the measurement of the trehalose that is released from trehalose-6-phosphate and/or the measurement of the phosphate that is released from the trehalose-6-phosphate.
• the extraction can be performed on a vortex apparatus in glass tubes (always used for large scale preparations); h) extracts are centrifuged at 4°C for 20 min at 14000 rpm; i) 20 ⁇ l of the supernatant is loaded on a small Sephadex G25 column, made in a blue tip containing a siliconized glass bead. The tip is filled completely with pre- equilibrated G25 Sephadex (50 mM Tricine (Sigma T-0377 (RT)) buffer (pH7). The tips are centrifuged once before application of the extract for 1 min at 800 rpm.
• the extract is centrifuged for 1 min at 1000 rpm; j) 200 ⁇ l of the eluate is added to 140 ⁇ l Assay I solution consisting of 40 ⁇ l of 200 mM Tricine buffer (pH7), 20 ⁇ l of 0.1 M MgCl 2 , 20 ⁇ l of 25 mM trehalose- 6-phosphate (Sigma) and 60 ⁇ l H 2 O.
• Assay I control mixture 20 ⁇ l trehalose-6-phosphate is omitted and replaced by 20 ⁇ l H 2 O.
• k) the assay mixture and the control mixture are incubated for 30 min at 30°C;
• step i loading on small Sephadex G25 columns (step i) is replaced by loading on a superdex200 column (Amersham Pharmacia biotech). Briefly, about 500 ⁇ l of extract (protein concentration about 15 mg/ml) in extraction buffer (see step (d) above) is loaded on a superdex200 column equilibrated with this same extraction buffer. For each run, 500 ⁇ l of sample was loaded on the column, which was then eluted at 0.5 ml/min with a total buffer volume of 35.5 ml. 750 ⁇ l fractions were collected and the FPLC fractions containing TPP activity (fractions 11-13) pooled.
• One method of calculating the amount of trehalose released from trehalose-6- phosphate is by performing two steps: the hydrolysis of trehalose by frehalase and the measurement of the resulting glucose by either the glucose-oxidase/peroxidase reaction, or the use of the Trinder reagent.
• the trehalase is obtained from the fungus Humicola grisea var. thermoidea.
• the organism is grown at 40°C on a solid medium containing 4% oat and 1.8% agar.
• the isolation and purification of the trehalase from this fungus is performed according to Neves et al. (FEBS Lett. 283, 19-22, 1991).
• a trehalose standard curve of 0,1,2,4,8 and 10 mM is also analyzed.
• Solution A containing 3.75 mg glucose-oxidase (100 U/mg), 8 mg peroxidase (100 U/mg) and 2.25 ml Tris/Cl (1M pH8) adjusted to 100 ml with water.
• Solution B containing 10 mg/ml ortho-dianisidine-diHCl. The glucose-oxidase solution is prepared just before use by mixing 1 ml of solution B with 100 ml solution A.
• the method involves the transfer of 60 ⁇ l of the product of the trehalase reaction to a glass tube, adding 1 ml of the glucose-oxidase solution, incubating for 60 min at 30 °C. The reaction is terminated by adding 0.5 ml H 2 SO4 (56%) to the reaction mixture. The OD of the reaction mixture is measured at 546 nm. A glucose standard curve with 0, 1, 2, 3 and 4 mM is analyzed at the same time.
• the glucose produced from the hydrolysis of trehalose by frehalase can also be measured using the Trinder reagent (SIGMA), which is based on the same principle as the glucose oxidase reaction.
• SIGMA Trinder reagent
• the method involves the transfer of 20 ⁇ l of the end products of the trehalase reaction in a microtiter plate well, the addition of 200 ⁇ l Trinder reagent and mixing by shaking and incubating for 15 min at 30°C.
• the OD of the sample is determined at 505 nm in the microtiter plate reader (Spectramax).
• a glucose standard curve with 0, 1, 2, 3 and 4 mM is analyzed at the same time.
• the TPP activity can be calculated by dividing the OD of a sample by the time of the reaction and by the protein content (expressed as nKat/g protein).
• the trehalose that is formed by the action of the trehalose-6- phosphate enzyme can be measured by the HPLC analysis on a CarboPac PA- 100 anion- exchange column as described by De Virgilio et al. (Eur. J. Biochem.212, 315-2-323, 1993).
• the phosphate can also be measured that is released by the action of the trehalose-6-phosphate phosphatase enzyme.
• the protein concentration is determined by the method of Lowry (Lowry et al., J. Biol. Chem. 193, 265-275, 1951) d) The measurement of free phosphate using glyceraldehyde-3-phosphate dehydrogenase and phosphoglycerate kinase in a linked enzyme assay according to Trentham et al. (Biochem. J. 126, 635-644, 1972).
• TPP activity can be measured by direct measurement of radioactive phosphate using radioactive trehalose-6-phosphate in the extracts as has been described by Vuorio et al. (Eur. J. Biochem.216, 849-861,1993).
• the method comprises the following steps: a) cultures are grown to the desired density and are cooled quickly on ice; b) preferably, at least 400 mg of cells are harvested by centrifugation for 3 min at 3000 rpm; c) cells are washed twice with ice-cold distilled water; d) cells are resuspended in 990 ⁇ l exfraction buffer consisting of 968 ⁇ l of 50 mM Imidazole (Merck), 2 ⁇ l of 0.5 M EDTA (Tritriplex III Merck), 20 ⁇ l of 0.1 M MgCl 2 (UCB), e) cells are transferred to screw capped tubes and an equivalent of 0.5 ml glass beads with 0.5 mm diameter are added; f) just before extraction 10 ⁇ l of a 100 mM PMSFsolution (Sigma) in methanol; is added to the cell mixture ; g) the exfraction is performed in a Fastprep apparatus (BIO101) for 20 seconds at level 4, and is repeated three times with a cooling
• the extraction can be performed on a vortex apparatus in glass tubes; h) extracts are centrifuged at 4°C for 20 min at 14000 rpm; i) 200 ⁇ l of the supernatant is loaded on a small Sephadex G25 column, made in a blue tip containing a siliconized glass bead. The tip is filled completely with pre- equilibrated G25 Sephadex (50 mM Tricine (Sigma) buffer pH7). The tips are centrifuged once before application of the extract for 1 min at 800 rpm. The extract is centrifuged for 1 min at 1000 rpm; j) 5 ⁇ l of the eluate is added to 45 ⁇ l assay solution consisting of 27.5 mM Tris-Cl
• W303.1A was first transformed (LiAc method according to Gietz et al (1992), Nucleic Acids Research 20: 1425 - Gietz et al (1995), Yeast 11: 355-60) with a plasmid containing the HIS3 marker. Unless otherwise stated, all yeast fransformation steps were performed in accordance with this method.
• the plasmid pJJ215 was linearized with Nhel, which cuts in the marker. The complete plasmid will integrate at the location of the his3 marker and as a result one wild-type HIS3 marker is present in the genome.
• the resulting strain is PVD1: W303-1A HIS3. Subsequently PVD1 was transformed with a plasmid containing the URA3 marker.
• the plasmid YIplac 211 was linearized with EcoRV, which cuts the marker.
• the complete plasmid will integrate at the location of the URA3 marker and as a result one wild-type URA3 marker is present in the genome.
• the resulting strain is PVD2: W303- 1 A HIS3 URA3.
• PVD2 was transformed with a plasmid containing the LEU2 marker.
• the plasmid YIplac 128 was linearized with EcoRV, which cuts in the marker.
• the complete plasmid will integrate at the location of the leu2 marker and as a result one wild-type LEU2 marker is present in the genome.
• the resulting strain is PVD16: W303- 1 A HIS3 URA3 LEU2.
• PVD6 was transformed with a plasmid containing the ADE2 marker.
• the plasmid pASZIO was linearized with EcoRV, which cuts in the marker.
• the complete plasmid will integrate at the location of the ade2 marker and as a result one wild-type ADE2 marker is present in the genome.
• the resulting strain is PVD29: W303- 1 A HIS3 URA3 LEU2 ADE2.
• PVD29 was transformed with a plasmid containing the TRP1 marker.
• the plasmid YIplac204 was linearized with EcoRV, which cuts in the marker.
• the complete plasmid will integrate at the location of the trpl marker and as a result one wild-type TRP1 marker is present in the genome.
• the resulting strain is PVD32: W203-1 A HIS3 URA3 LEU2 ADE2 TRP
• PVD23 YSH448 was first transformed with a plasmid containing the HIS3 marker.
• the plasmid pJJ215 was linearized with Nhel, which cuts in the marker.
• the complete plasmid will integrate at the location of the his3 marker, and as a result one wild-type HIS3 marker is present in the genome.
• the resulting strain is PVD11 : tps2 ⁇ ::LEU2 HIS3.
• PVD11 was subsequently transformed with a plasmid containing the URA3 marker.
• the plasmid YIplac211 was linearized with EcoRV, which cuts in the marker.
• the complete plasmid will integrate at the location of the URA3 marker and as a result one wild-type URA3 marker is present in the genome.
• the resulting strain is PVD7: tps2 ⁇ LEU2 HIS3 URA3.
• PVD7 was transformed with a plasmid containing the TRP1 marker.
• the plasmid YIplac204 was linearized with EcoRV, which cuts in the marker.
• the complete plasmid will integrate at the location of the trpl marker and as a result one wild-type TRP1 marker is present in the genome.
• PVD18 tps2 ⁇ ::LEU2 HIS3 URA3 TRPL
• PVD18 was transformed with a plasmid containing the ADE2 marker.
• the plasmid pASZIO was linearized with EcoRV, which cuts in the marker.
• the complete plasmid will integrate at the location of the ade2 marker and as a result one wild-type ADE2 marker is present in the genome.
• the resulting strain is PVD23: tps2 ⁇ LEU2 HIS3 URA3 TRP1 ADE2.
• Strain PVD190 is a diploid S. cerevisiae strain made by a cross between the W303 prototrophic strain (PVD32) and the W303 haploid auxofrophic strain (YSH339).
• Strain PVD191 is a diploid strain made by a cross between the tps2 ⁇ prototrophic strain (PVD32) and the W303 haploid auxofrophic sfrain (YSH339).
• Candida albicans TPS2 sequence homologous to the Saccharomyces cerevisiae TPS2 gene was found in the Candida albicans database (l ttp://www- sequence.stanford.edu/group/candidal. This sequence, located in contig 4-3098, is further referred to as the Candida albicans TPS2 gene, or CaTPS2. Both sequences were aligned for maximal amino acid similarities by making use of the CLUSTAL W (1.8) multiple sequence alignment software. conserveed regions of the amino acid sequences were aligned to give the best fit. Identical residues are indicated by an asterisk (*).
• Gaps in the amino acid sequence are represented by dots (--).
• a colon (:) stands for strong similarity
• a dot (.) stands for weak similarity.
• the two putative phosphatase boxes are indicated in bold italic and are underlined.
• the CaTPS2 gene and its flanking sites were then isolated from a Candida albicans wild-type strain SC5314, using the following 30 and 31 bp oligonucleotide primers (Pharmacia) for PCR (Polymerase Chain Reaction) amplification:
• CaTPS2FOR2 5' GAGTCGACCTCACCTGAGGCATCCACATAC 3'
• CaTPS2REV2 5' GAGGTACqGTGTAATCCGGACATTAACTCCG 3' whereby the forward primer (FOR2) contains the recognition site for the restriction enzyme Sail and the reverse primer (REV2) that o Kpnl (see boxes).
• PCR amplifications (30 cycles) and analysis were performed according to standard protocols (for references see above). PCR amplification with the designed primers (Pharmacia) yielded a fragment of 3171 bp long, which contains apart from the TPS2 reading frame an additional 523 bp upstream and 639 bp downstream sequences.
• the DNA of one of the positive colonies was then digested with the restriction enzymes SnaBl and Nsil, cutting just in the beginning and at the end of the CaTPS2 open reading frame, leaving only 8 and 10 amino acids at the C- and N- terminus respectively.
• the large fragment (3885 bp) thus contains the vector plus the flanking sites of the CaTPS2 gene.
• the HisG-URA3-HisG cassette was cloned.
• the URA3 blaster cassette located on a fragment of 3948 bp, was isolated from plasmid pMB7-A (Fonzi W.A. and Irwin M.Y.
• Competent CAI4 cells were prepared using a modified LiAc (Lithium acetate) method (Sanglard et al (1996), Antimicrobiol. Agents Chemother. 40: 2300-2305) . Briefly, yeast cells are grown, harvested and pelleted as recommended. Cells are then resuspended in buffered lithium solution, freshly prepared. Next, 50 ⁇ l of this yeast cell suspension was added to 300 ⁇ l of PEG solution (PEG4000 of Merck), together with 50 ⁇ g of carrier DNA (sperm carrier DNA from Clontech, Yeastmaker carrier DNA Cat No. K1606-A) and 30 ⁇ g of the DNA fragment. After mixing, the cells were incubated at 30 °C for 1 hour in an incubator with shaker.
• carrier DNA sperm carrier DNA from Clontech, Yeastmaker carrier DNA Cat No. K1606-A
• a Diag3 3' diag
• 19 bp oligonucleotide primer annealing to the flanking sites of the CaTPS2 gene outside of the fragment that has been used for the disruption
• DiagHIS4 a 18 bp oligonucleotide primer (Pharmacia) annealing to a nucleotide sequence in the HisG sequence was used to verify the deletion of one of the TPS2 alleles.
• Diag3 5 ' CCTTC ATCGCCTGACTGAT 3 '
• DiagHIS4 5' GCGTAAGCGGGTGTTGTC 3'
• Genomic DNA was prepared from all 14 fransformants and after digestion with EcoRI, separated on a 1% agarose gel and blotted onto nylon membranes (Amersham Pharmacia biotech). The membrane was hybridised with a P 32 -labelled 579 bp probe containing the 3' flanking site of CaTPS2, prepared by digesting ⁇ UC ⁇ 9ICaTPS2 with Hindlll and SnaBl.
• Biotin and digoxigenin are the nonisotopic labels that are used most frequently (Ausubel et al (1999) in "Short Protocols in Molecular Biology, 4 th ed. John Wiley & Sons, New York", and units 2.9 A, 2.10, 3.18- 19 in particular).
• the heterozygous TPS2/tps2 URA3 + strain is first plated on 5-fluoroacetic acid (5-FOA) medium (FOA medium, Ausubel et al (1999) in "Short Protocols in Molecular Biology, 4 th ed. John Wiley & Sons, New York", and units 13.1 and 13.10 in particular) to generate a URA3 ' strain.
• 5-FOA 5-fluoroacetic acid
• URA3 + sfrains cannot survive on media containing the pyrimidine analog 5-FOA (5-FOA selection, modified method of Boeke et al (1984), Mol. Gen. Genet.
• Diag5 5 ' ACCGTCGTGCTGATCCTG 3 ' .
• the 18 bp oligonucleotide Diag5 primer is located in the open reading frame of the TPS2 gene.
• a mixture of the three following primers: Diag3, DiagHIS4 and Diag5 was used in the analysis.
• the molecular weight marker was the Smart ladder of Eurogentec (Cat No.: MW- 1700- 10).
• the presence of only a 1100 bp fragment indicated that in the corresponding transformant the two TPS2 alleles were deleted. This was confirmed by Southern analysis, using the same P -labelled probe and marker, cutting the DNA with the same restriction enzymes as before. Once more, all steps involved with Southern hybridization and visualization of the results were performed according to standard protocols (for references see above).
• the upper bands in the blot are probably due to incomplete digestion of the DNA. Further evidence for a double knock out was provided by repeating the Southern blot but using a P 32 -labelled TPS2 specific probe.
• the probe consisted of a P 32 -labelled 548 bp Ndel-BamHl fragment of the CaTPS2 coding region. Labelling and hybridization were performed under the same conditions as defined above. The TPS2 specific probe did not hybridise to any DNA fragment from the double deletion mutant.
• Sensitivity towards the antifungals ifraconazole and ketoconazole was tested in microtiter wells using a bioscreen C apparatus (Life sciences, Labsystems) and on solid culture media.
• S. cerevisiae cells were pre-grown in YPglucose medium till stationary phase.
• the cells were diluted to a initial optical density of 0.05 OD and 300 ⁇ l of cell suspension was added to each well of a microtiter plate.
• the microtiter plates were placed in the bioscreen C apparatus and were incubated at 33°C or 37°C, with medium intensity shaking (30 seconds shaking per minute). The optical density at 600 nm was measured every 30 min.
• the S. cerevisiae TPS2 deletion strain is sensitive to osmotic and heat stress.
• the growth characteristics of wild-type (PVD32) and tps2 ⁇ (PVD23) S. cerevisiae sfrains were tested in the presence of either 1.5 M sorbitol or 5% NaCl.
• the sfrains were pre-grown on YPD plates to stationary phase.
• the cells were diluted to an OD of 0.5. This corresponds to approximately 10 7 cells/ml
• 10-fold serial dilutions were made and from each dilution 10 ⁇ l suspension was spotted on YPD plates containing either 1.5 M sorbitol or 5% NaCl. Plates of the different media were inoculated with 5 ⁇ l of 10-fold serial dilutions and incubated at 30 °C.
• Figure 7 shows the effect of the osmotic and heat stress on the growth of the tested strains. The results clearly show that a tps2 ⁇ strain is more sensitive to osmotic or salt stress in comparison with a wild-type sfrain.
• Candida albicans sequence homologous to the Saccharomyces cerevisiae TPS2 gene (Candida albicans database, http://www-sequence.stanford.edu/group/candida1 ( Figure 8) was isolated from a Candida albicans wild-type sfrain SC5314. PCR amplification with the designed primers (REV2 and FOR2) yielded a fragment of 3171 bp long, which contains apart from the TPS2 reading frame an additional 523 bp upsfream and 639 bp downstream sequences.
• Figure 9 shows the genomic organisation of the CaTPS2gene and its flanking sites with indication of the relevant restriction sites and with indication of the two primers used to amplify the gene (REV2 and FOR2).
• the diag primers (3' diag and 5' diag) are diagnostic primers used to check for deletions in the strain.
• Candida albicans TPP activity (as measured via the method of Bencini, see above) as low as 6.9 nKat/g protein for the tps2 ⁇ ltps2 ⁇ compared to values of 231.3 for the wild- type (TPS2/TPS2) and 147.3 for the heterozygous knock out strain (TPS2I tps2 ⁇ ), provided a third proof for the double knock out in tps2 ⁇ ltps2 ⁇ .
• Trehalose-6-phosphate is a strong acid and will therefore cause intracellular acidification, which will negatively influence cellular metabolism or growth or even inhibit growth of double deletion yeast strains. Hyperaccumulation of trehalose-6-phosphate also sequestrates free orthophosphate (Pi) and in this way will negatively influence glycolytic flux and energy (ATP) generation. As such, total cellular energy metabolism can be severally disturbed.
• Candida albicans cells grown in microtiter plates in YPglucose (A) and YPgalactose (B) medium. Plates were incubated in a bioscreen C apparatus (Life sciences, Labsystems) at temperatures of 41°C, resulting in the accumulation of trehalose in yeasts at least in wild-type cells.
• the C. albicans strains tested in accordance with the particular embodiment were the TPS2ITPS2 SC5314 wild- type sfrain, the heterozygous TPS2/tps2A sfrain (CC5) and the homozygous tps2 ⁇ /tps2 ⁇ sfrain (CC17).
• the growth curves at 41°C already showed that there is a clear extension of the lag phase and a clear inhibitory effect on the growth rate when respectively one or two of the alleles of the TPS2 gene are deleted and especially when the two TPS2 alleles are deleted.
• Such growth curves provide proof of principle for the fact that as a result of TPS2 knock out, accumulation of trehalose-6-phosphate in cells, cytotoxic to at least yeast cells in higher concentrations, can hamper or even inhibit cell growth.
• the effect was even more pronounced.
• Saccharomyces cerevisiae strain PVD45 (PVD45: a leu2-3/112ura3-l trpl-1 his3-ll/15 ade2-l canl-lOOGAL SUC2 tpsl ⁇ r.
• the screening assay comprises the following steps:
• Dithiodinitrobenzoate (DTNB) are prepared in water and ethanol respectively. From these stock solutions, serial dilutions of 0.1 mM, ImM and 10 mM, are made. For the experiments 56 ⁇ l of each dilution of the compound is added to the Assay I solution consisting of 40 ⁇ l of 200 mM Tricine buffer (pH7), 20 ⁇ l of 0.1 M MgCl 2 , 20 ⁇ l trehalose-6-phosphate (Sigma) and 68 ⁇ l H 2 O (mixl, see above).
• the assay mixtures and the control mixtures are incubated for 30 min at 30°C; subsequently boiled for 5 min to stop the reaction and cooled down to room temperature.
• the micro-centrifuge tubes were centrifuged for 5 min at 14000 rpm.
• Measurement of the trehalose-6-phosphate activity is performed according to the methods described previously.
• the chemical test based on the method of Bencini (1983), might be preferred over the enzymatic test (EnzChek TM) since it is linear over a broad range of concentrations and is less prone to interference and the generation of false positives compared to the enzymatic test.
• EndChek TM enzymatic test
• An assay in accordance with the present invention further involves screening test inhibitory compounds from large libraries of synthetic or natural compounds.
• Synthetic compound libraries are commercially available from, for example, Maybridge Chemical Co. (Trevillet, Cornwall, UK), Comgenex (Princeton, NJ), Brandon Associates (Merrimack, NH), and Microsource (New Milford, CT), Chembridge Corporation (San Diego, CA).
• a rare chemical library is available from Aldrich Chemical Company, Inc. (Milwaukee, WI).
• libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available from, for example, New Chemical Entities, Pan Laboratories, Bothell, WA or MycoSearch (NC), Chiron, or are readily producible. Plant extracts may also be obtained from the University of Ghent, Belgium. Additionally, natural and synthetically produced libraries and compounds are readily modified through conventional chemical, physical, and biochemical means. Performing the screening assays in microtiter plates, for instance 96-well microtiter plates, allows screening by an automated robotic system and as such the testing of large numbers of test samples within a reasonable short time frame. The above list of commercial libraries is non-exhaustive.
• the TPP inhibitors will not interfere with any essential metabolic process or pathway of the human, animal or plant in need of treatment.
• DIVERSetTM a 5,000 compounds-collection (DIVERSetTM) from Chembridge Corporation (San Diego, CA) was screened for identifying novel TPP- specific intracellular inhibitors in accordance with the present invention.
• DIVERSetTM is a unique set of drug-like, hand-synthesized small molecules, rationally preselected to form a "universal" library that covers the maximum pharmacophore diversity with the minimum number of compounds.
• other libraries such as those previously mentioned in the non-exhaustive list above, may be screened. Such screening may yield inhibitors, other than the ones explicitly disclosed in the present invention but falling within the scope of the present invention, inclusive further screening with structure analogs.
• DIVERSetTM compounds are delivered in 96-well microtiter plates each containing 80 compounds, with each compound representing about 0.1 mg of lyophilized material.
• the compounds were dissolved in 33 ⁇ l of DMSO resulting in a mean concentration of 10 "2 M. From these stock plates ( Figure 17), 10 "3 M working plates were then prepared via a 10-fold dilution in DMSO (total volume per well is 50 ⁇ l) (Working plates). Next, 2 ⁇ l of each well of the working plates was transferred to the corresponding well of a fresh microtiter plate, to which 148 ⁇ l of mixl (see above) was added.
• test compound at 10 "3 M were replaced by 2 ⁇ l pure DMSO (negative control) or 2 ⁇ l of a 10 '3 M DTNB solution in DMSO (positive control) respectively.
• DMSO negative control
• 10 ⁇ l of a yeast extract with final protein concentration of about 10 mg/ml was then added, whereafter the plates were incubated for 30 minutes at 30°C in a standard incubator in the dark.
• TPP inhibitors were in a second round of screening retested at 4 differential concentrations of 10 "5 , 10 "6 , 10 '7 and 10 "8 M in DMSO respectively.
• the strain that was used to prepare the extracts for the large-scale screening assay in accordance with this particular embodiment of the present invention is a
• Saccharomyces cerevisiae wild-type strain (W303.1 A) in which the yeast TPS2 gene is overexpressed.
• FPLC fractions 750 ⁇ l fractions of a superdex200 column (Amersham Pharmacia biotech)) containing TPP activity (fractions 11-13) were pooled, concentrated on VIVASPIN columns (VIVAscience) by a 30 min centrifugation step at 3500 rpm and used for screening in the assay. The final protein concentration of the extract used for screening was about 10 mg/ml.
• the screening assay for determination of inhibitors of TPP activity in microtiter plates is adaptable for automation and as such allows high throughput screening.
• the Biomek robotic system was applied. It will be understood by a person known in the art that equivalent automated screening methods could be used as well.
• the first round of screening resulted in 86 compounds with TPP inhibitory actions similar to or better than that of 10 "5 M DTNB ("good” TPP inhibition). These compounds with their respective numbers/positions in the DIVERSetTM compound library are shown in Table 1 (for their structures, see Figure 17). Subsequently, these 86 compounds were tested again, but this time at concenfrations of 10 "5 , 10 "6 , 10 “7 and 10 “8 M respectively in DMSO. As such, 5 compounds with good TPP inhibition activity could be identified. These compounds (113596, 113610, 133207, 136794 and 143067) are indicated in bold italic and marked with an asterisk in Table 1.
• Table 1 Indication of number and position (plate number - position in the plate) of ccoommppoouunnddss iiddeennttiified in the DIVERSetTM library as being compounds with good TPP' inhibition activity
• DIVERSetTM compounds 136794 and 143067 were applied in 7 different concentrations (0, lxlO '7 , 3xl0 "7 , lxlO "6 , 3xl0 “6 , lxlO “5 and 3xl0 “5 M in DMSO respectively) to S. cerevisiae and from their inhibitory activity the IC 50 calculated.
• Three DIVERSetTM compounds without any TPP inhibitory activity 109146, 116321 and 145704) and DNTB were included as respectively negative and positive controls ( Figure 18).
• DIVERSetTM compound 136794 comparable in its TPP inhibiting action to DNTB at 10 "5 M, is less active at lower concentrations.
• the calculated IC50 for this compound is 1.5xl0 '5 M.
• DIVERSetTM compound 143067 has a calculated IC 50 of 3.1xl0 "7 M under the given test conditions and in accordance with this particular embodiment of the present invention.
• Compound 143067 has the strongest TPP inhibitory potential at 10 "7 M. The drop in activity at higher concenfrations is most probably due to a bad solubility of this compound at high concenfrations .
• the 3 aforementioned compounds proved to be specific inhibitors of TPP as the compounds do not or only slightly affect the growth of the double deletion mutant.
• DIVERSetTM compounds nr 133207 and 113610 have a strong effect on the growth rate of the wild-type Candida albicans strain, whereas compound 133805 is less effective for growth inhibition with wild-type Candida albicans.
• the cells grow a little slower in the beginning but after some hours cells stop growing completely. Since there was no effect at all of this compound in the tps2A/tps2A background, this might indicate that it also acts on Tps2 (TPP).
• DIVERSetTM compounds 136794 and 143067 were also tested on Candida albicans.
• the compounds were tested at 10 "7 M only, since at 10 "5 M compound 143067 was less inhibitory in Saccharomyces cerevisiae (see above). Also in Candida albicans this compound caused significant growth inhibition at 10 "7 M in DMSO.
• the inhibition is as strong as with DIVERSetTM compound 113610 (positive control).
• Another compound, with comparable activity was identified, namely compound nr 100764 (for structure, see Figure 17).
• Figure 22 shows the compound's behavior compared to compounds nr 136794, 143067 and 113610 (positive confrols) and DMSO (negative control). Growth curves were established for a wild-type C. albicans strain (SC5314), grown at 43°C on YPD medium in the presence of 10 "7 M of the test compounds.
• mice were injected with 10 7 cells of wild type C. albicans When mice were injected with 10 7 cells of wild type C. albicans, the mean survival time was about two days. After three days all mice were dead. After injection with the tps2 /tps2 strain the mean survival time was about 4 days. After 5 days all mice were dead.
• the heterozygous deletion strain behaved in an intermediate way. When the mice were injected with 10° cells, those injected with wild type C. albicans were all dead after 13 days. The mice that were injected with the heterozygous mutant survived for 40 % this treatment (up to 40 days). Those injected with the homozygous mutant ⁇ (10 6 tps2 /tps2 Candida albicans) survived for 60% this treatment.
• mice that survived the experiment were killed and the kidneys were investigated. No Candida albicans cells could be detected in these kidneys. This means that mice can completely recover from injection with 10 6 tps2 /tps2 Candida albicans cells, but not from 10 6 wild type Candida albicans cells.
• the mice injected with 10 6 tps2 /tps2 Candida albicans cells which died were examined.
• the kidneys of the dead mice contained a virulent Candida strain not used in these tests, indicating that the cause of death was not caused by the injected cells.
• an inhibitor of the tps2 gene or of the TPP enzyme in accordance with the present invention which achieves the same inhibition as the heterozygous mutation (about 50%o) may render Candida albicans non-lethal even in high injected doses.
• Candida albicans tps2 mutants were incubated under the strong stress condition of high temperature to investigate whether accumulation of trehalose-6-P only arrests cell proliferation or whether it causes cell death.
• Cells of the wild type, TPS2/tps2 and tps2 /tps2 str a ins were incubated for different periods of time at 44 °C and aliquots were spotted in serial dilutions on YPD plates. Growth was scored after three days.
• Wild type (SC5314), TPS2/tps2 (CC5) and tps2 /tps2 (CC 17) strains were grown overnight in YPD at 30 °C. In the morning the cells were washed and resuspended in 400 ml YPD. After three hours, the cultures were divided and 100 ml of each culture was further incubated at either 30 °C, 37 °C, 40°C or 43 °C in the case of trehalose and 37 °C or 43 °C in the case of trehalose-6-P. At time zero and at various time points after the shift, samples were taken for trehalose or frehalose-6-P determination.
• frehalase buffer 300 mM NaAc, 30 mM CaCl 2 , pH 5.5
• frehalase purified from Humicola grisea var. thermoidea
• the samples are incubated at 40 °C for 45 min.
• the glucose that is formed during this incubation is determined by the glucose oxidase/peroxidase reaction using Trinder reagent (Sigma).
• the amount of trehalose in the samples is determined based on the standard curve and the dilution. The results are shown in Fig. 25.
• the wild type and the heterozygous deletion strain show a rapid increase in trehalose levels after the shift from 30°C to 40°C or 43 °C. There is also more trehalose (up to three times more) in the tps2 /tps2 strain. This indicates that there may be other probably aspecific phosphatases that are able to dephosphorylate to some extent the trehalose-6-P.
• Trehalose-6-P (Tre6P)
• Tre ⁇ P trehalose-6-P
• Tre ⁇ P levels in the heterozygous TPS2/tps2 strain there is a two-fold increase in Tre ⁇ P levels in the heterozygous TPS2/tps2 strain compared to the wild type (at 43 °C).
• the tps2 /tps2 strain there is a more than 30 fold increase in the Tre ⁇ P level.
• the same fold induction is seen at 37 °C.
• the tps2 /tps2 strain can not survive a heat treatment at 44 °C. Under these conditions there is a very large increase in Tre ⁇ P. This indicates that the high levels of Tre ⁇ P accumulated (hyperaccumulation) under the strong stress condition at high temperature cause the tps2 /tps2 cells to die at this temperature.
• Candida albicans cells results in a drop in growth rate. At lower concenfrations and without stress, the compounds do not have any effect on the wild type strain. In the double knock-out tps2 /tps2 strain, however, there is still a dramatic effect on growth rate at 10 " M and this inhibition is still visible at 10 " M. Under stress conditions, the effect of antifungals (e.g. Micanozole) on the growth of the tps2 /tps2 strain is even more pronounced. This indicates the usefulness of TPP inhibition for combined antifungal therapy with inhibitors of TPP together with known antifungal drugs and/or other compounds that induce or enhance the stress response of the cells.
• antifungals e.g. Micanozole
• the present invention further includes a method for treating a parasitic infection such as a fungal infection in a patient in need of such treatment, comprising administering to said patient an antiparasitic agent comprising an inhibitor as identified above, or determined according to one of above assay methods or a pharmaceutically acceptable salt, ester or pro-drug thereof.
• a stress raising factor for the parasite may be co-administered.
• the invention includes a method for treating a fungal, a bacterial or a protozoal infection, or a nematode, an insect, worm or mite infestation, in a human, animal or a plant in need of such treatment which comprises administering a specific inhibitor which inhibits the proper functioning of a cell enzyme of the parasite which converts with a low or high degree of specificity a sugar phosphate into a sugar or a sugar alcohol phosphate into a sugar alcohol that are accumulated in large quantities by cells for instance, but not exclusively, under conditions deviating from the optimal growth condition or as a reaction to stress conditions, the inhibition being either directly of the enzyme or indirectly, e.g. by suppressing the expression of the corresponding gene.
• the inhibitor may be determined by the assays described above.
• compositions in accordance with the present invention include a biologically or therapeutically effective amount of an inhibitory agent (either biocide or pharmaceutical) determined in accordance with a screening assay in accordance with the present invention.
• Therapeutically or biologically effective amounts are those quantities of the active agent of the present invention that afford prophylactic protection against the relevant infections or infestations in humans, animals or plants, and which result in amelioration or cure of an existing infection or infestation in humans, animals or plants.
• the biologically or therapeutically active agents or compositions can be formed into dosage unit forms, such as for example, creams, ointments, lotions, powders, liquids, tablets, capsules, suppositories, sprays, or the like.
• the dosage unit form may contain an antifungal effective amount of active agent.
• the active agents and compositions of the present invention are useful for preventing or treating parasitic, especially fungal infections in humans, animals or plants.
• Parasitic infection prevention methods in accordance with the present invention incorporate a prophylactically effective amount of an antiparasitic agent or composition.
• a prophylactically effective amount is an amount effective to prevent parasitic infection and will depend upon the parasite, e.g. fungus, the agent and the host. These amounts can be determined experimentally by methods known in the art.
• Parasite infection treatment methods incorporate a therapeutically effective amount of an antiparasitic agent or composition.
• a therapeutically effective amount is an amount sufficient to stabilize or to ameliorate a parasitic infection.
• the prophylactically and/or therapeutically effective amounts can be administered in one administration or over repeated administrations.
• Therapeutic administration can be followed by prophylactic administration, once the initial parasitic infection has been resolved.
• the parasitic, e.g. fungal agents and compositions can be applied to plants topically or non-topically, i.e., systemically. Topical application is preferably by spraying onto the plant.
• Systemic administration is preferably by application to the soil and subsequent absorption by the roots of the plant.
• antiparasitic agents in accordance with the present invention e.g. antifungal agents and compositions

Priority Applications (1)

Applications Claiming Priority (6)

Publications (1)

Family

ID=26074264

Family Applications (1)

Country Status (3)

Families Citing this family (28)

Family Cites Families (4)

• 2000
  • 2000-08-29 AU AU75118/00A patent/AU7511800A/en not_active Abandoned
  • 2000-08-29 EP EP00964054A patent/EP1206568A2/de not_active Withdrawn
  • 2000-08-29 WO PCT/EP2000/008410 patent/WO2001016357A2/en not_active Application Discontinuation

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events