Classifications

• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
  • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
• • A—HUMAN NECESSITIES
  • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
  • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
  • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
  • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
  • A23L33/17—Amino acids, peptides or proteins
  • A23L33/18—Peptides; Protein hydrolysates
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K8/00—Cosmetics or similar toiletry preparations
  • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
  • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
  • A61K8/60—Sugars; Derivatives thereof
  • A61K8/606—Nucleosides; Nucleotides; Nucleic acids
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K8/00—Cosmetics or similar toiletry preparations
  • A61K8/18—Cosmetics or similar toiletry preparations characterised by the composition
  • A61K8/30—Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
  • A61K8/64—Proteins; Peptides; Derivatives or degradation products thereof
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P3/00—Drugs for disorders of the metabolism
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P3/00—Drugs for disorders of the metabolism
  • A61P3/04—Anorexiants; Antiobesity agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P3/00—Drugs for disorders of the metabolism
  • A61P3/06—Antihyperlipidemics
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P35/00—Antineoplastic agents
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
  • A61Q13/00—Formulations or additives for perfume preparations
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61Q—SPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
  • A61Q15/00—Anti-perspirants or body deodorants
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
  • A61K2800/40—Chemical, physico-chemical or functional or structural properties of particular ingredients
  • A61K2800/57—Compounds covalently linked to a(n inert) carrier molecule, e.g. conjugates, pro-fragrances
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K2800/00—Properties of cosmetic compositions or active ingredients thereof or formulation aids used therein and process related aspects
  • A61K2800/80—Process related aspects concerning the preparation of the cosmetic composition or the storage or application thereof
  • A61K2800/86—Products or compounds obtained by genetic engineering
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K2319/00—Fusion polypeptide

Definitions

• the present invention relates to the discovery of new human proteins fixing odors, hereinafter called "OBP" (Odorant Binding Proteins) as well as their applications, both therapeutically and non-therapeutically.
• OBP Oletin binding Proteins
• the present invention is based on the identification of a family of lipocalin genes composed of three genes and two pseudogenes on the human chromosome 9q34; the three genes correspond to the LCN 1 gene already described and to two new genes which are the subject of the present invention and called hOBPIIa and hOBPIIb.
• the invention is based on the attribution of new functions to human lipocalins already known by the discovery of new territories of expression.
• the OBPs according to the present invention are human OBPs which have a very large number of advantages, as will emerge from the rest of the text, compared to murine proteins.
• OBP proteins of the lipocalin family have, for some of them, been mentioned indirectly in patent WO 99 07740, but their function of OBP has never been described until now; this also applies to the proteins LCN1, retinol-binding-protein (RBP) and Apolipoprotein D (ApoD), as will be explained more fully below.
• RBP retinol-binding-protein
• ApoD Apolipoprotein D
• the lipocalin family has been enriched to now incorporate a large number of proteins, more than a hundred, in both eukaryotes and prokaryotes (Flower and al, 1995, 1996).
• This family consists of small proteins (160-190 amino acids) containing a hydrophobic pocket and which are generally secreted (Bocskei et al, 1992; Senoo et al, 1990, Zeng et al, 1996; Miller, 1998), although in some cases are proteins that remain associated with the membrane (Nagata et al, 1991).
• the sequence identities between the different lipocalins are around 20%, however, the sequence identities are more important for orthologous proteins, as well as for the recent paralogous genes described (Igarashi et al, 1992; Dewald and al, 1992).
• the present invention relates to isolated OBPII polypeptides encoded by the two new isolated human OBPIIa and OBPIIb genes located at locus 9q34; the invention also relates to the corresponding polynucleotide sequences, the corresponding mRNAs, as well as the promoter regulatory sequences which determine the expression profile in the various tissues and in particular in the secretory tissues. These two genes code for at least seven different polypeptides given the existence of alternative splicing of the transcripts.
• the OBPIIa gene codes for at least 4 different polypeptides called OBPIIa ⁇ , OBPIIa ⁇ , OBPIIa ⁇ , OBPIIas and the OBPIIb gene codes for three polypeptides different called OBPIIb ⁇ , OBPIIb ⁇ , OBPIIb ⁇ . Even if a gene is mainly expressed, all forms of messengers are found in the nasal structure.
• the subject of the present invention is therefore an isolated polypeptide comprising an amino acid sequence having at least 90% identity with the amino acid sequences SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2, SEQ ID No 2
• the invention relates to polypeptides obtained by purification from natural sources or else obtained by recombinant techniques, as will be described in what follows; the invention also relates to the polypeptides obtained by chemical synthesis which can then comprise unnatural amino acids.
• polypeptide will be used to also denote a protein or a peptide.
• percentage of identity between the sequences is meant the percentage of identical amino acids between the sequences obtained with the best possible alignment of sequences. This percentage being purely statistical and the differences between the polypeptides being distributed randomly and over the entire length.
• the present invention also relates to an isolated polypeptide characterized in that it comprises a polypeptide chosen from: a) a polypeptide of sequence SEQ ID No. 2, SEQ ID No. 4,
• variant polypeptide will be understood to mean all of the mutated polypeptides which may exist naturally, in particular in humans, and which correspond in particular to truncations, substitutions, deletions and / or additions of amino acid residues.
• the variant polypeptides according to the invention conserve at least one domain for binding to a hydrophobic ligand.
• homologous polypeptide is intended to denote the polypeptides having, with respect to the polypeptides of sequence SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No.
• SEQ ID N ° 12 and SEQ ID N ° 14 certain modifications such as in particular a deletion, addition or substitution of at least one amino acid, a truncation, an elongation and / or a chimeric fusion.
• homologous polypeptides those whose amino acid sequence has at least 90% identity, preferably 95%, preferably 97%, and even more preferably 99% identity with the sequences, are preferred.
• amino acids of the polypeptides according to the invention In the case of a substitution, one or more consecutive or non-consecutive amino acids are replaced by "equivalent amino acids".
• equivalent amino acid is intended here to denote any amino acid capable of being substituted for one of the amino acids of the basic structure without, however, modifying the essential functional characteristics or properties of the corresponding polypeptides, their biological activities, such as, for example, the induction in vivo of antibodies capable of recognizing the polypeptide whose amino acid sequence is included in the sequence of amino acids SEQ ID N ° 2, SEQ ID N ° 4, SEQ ID N ° 6, SEQ ID N ° 8, SEQ ID N ° 10, SEQ ID N ° 12 or SEQ ID N ° 14, or one of its fragments.
• biologically active fragment is intended to denote in particular a fragment of the amino acid sequence of a polypeptide according to the invention having at least one of the characteristics or functional properties of the polypeptides according to the invention, in particular in that: (i) it is capable of being recognized by an antibody specific for a polypeptide according to the invention or by antibodies produced by patients during an immune reaction; (ii) it presents at least one of the domains or regions as defined below; (iii) it is capable of binding a hydrophobic ligand and in particular odorous molecules, preferably pheromones; (iv) it is able to specifically bind a receptor.
• polypeptide fragment is intended to denote a polypeptide comprising at least 15 amino acids, preferably 18 amino acids, more preferably 25 and more preferably 50 amino acids.
• the polypeptide fragments according to the invention obtained by cleavage of said polypeptide by a proteolytic enzyme, by a chemical reagent, or alternatively by placing said polypeptide in a very acidic environment are also part of the invention.
• the present invention relates to an isolated polypeptide selected from a polypeptide corresponding to the sequence SEQ ID No. 2 and called OBPIIa ⁇ , at the sequence SEQ ID N ° 4 and called OBPIIa ⁇ , to the sequence SEQ ID N ° 6 and called OBPII a ⁇ , to the sequence SEQ ID N ° 10 and called OBPIIb ⁇ , to the sequence SEQ ID N ° 12 and called OBPII b p.
• polypeptides according to the invention are characterized in that they preferably comprise the Gly-Thr-Trp-Tyr domain.
• the invention also relates to the isolated polynucleotide characterized in that it codes for a polypeptide as described above.
• the polynucleotide according to the invention is chosen from the polynucleotide of sequence SEQ ID N ° 1, SEQ ID N ° 3, SEQ ID N ° 5, SEQ ID N ° 7, SEQ ID N ° 9, SEQ ID N ° 11 or SEQ ID No. 13.
• the invention also relates to an isolated polynucleotide characterized in that it comprises a polynucleotide chosen from: a) a polynucleotide of sequence SEQ ID No 1, SEQ ID No 3, SEQ ID No 5, SEQ ID No 7 , SEQ ID N ° 9, SEQ ID N ° 1 1 or SEQ ID N ° 13 or whose sequence is that of the RNA corresponding to the sequence SEQ ID N ° 1, SEQ ID N ° 3, SEQ ID N ° 5 , SEQ ID No.7, SEQ ID No.9, SEQ ID No.11 or SEQ ID No.13; b) a polynucleotide whose sequence is complementary to the sequence of a polynucleotide defined in a), c) a polynucleotide whose sequence comprises at least
• polynucleotide, oligonucleotide, polynucleotide sequence, nucleotide sequence or nucleic acid is intended to denote a DNA fragment, both a double-stranded DNA, a single-stranded DNA and transcription products of said DNAs, and / or an RNA fragment, said isolated natural or synthetic fragments, comprising or not non-natural nucleotides, designating a precise sequence of nucleotides, modified or not, making it possible to define a fragment or a region of a nucleic acid.
• polynucleotide of complementary sequence is intended to denote any DNA whose nucleotides are complementary to those of SEQ ID No.1, SEQ ID No.3, SEQ ID No.5, SEQ ID No.7, SEQ ID No.9, SEQ ID N ° ll, SEQ ID N ° 13 or part of SEQ ID N ° 1, SEQ ID N ° 3, SEQ ID N ° 5, SEQ ID N ° 7, SEQ ID N ° 9, SEQ ID N ° 11, SEQ ID N ° 13 and whose orientation is reversed.
• percentage identity within the meaning of the present invention means a percentage of identical bases between the polynucleotides obtained after the best alignment, this percentage being purely statistical and the differences between the two polynucleotides being distributed randomly and over their entire length.
• hybridization under conditions of high stringency means that the conditions of temperature and ionic strength are chosen in such a way that they allow hybridization to be maintained between two complementary DNA fragments.
• high stringency conditions of the hybridization step for the purpose of defining the polynucleotide fragments described above are advantageously as follows: DNA-DNA or DNA-RNA hybridization is carried out in two stages: (1) prehybridization at 42 ° C for 3 hours in phosphate buffer (20 mM, pH 7.5) containing 5 x SSC (1 x SSC corresponds to a 0.15 M NaCl + 0.015 M sodium citrate solution), 50% formamide, 7% sodium dodecyl sulfate (SDS), 10 x Denhard's, 5% dextran sulfate and 100 ⁇ g / ml of salmon sperm DNA ; (2) actual hybridization for 20 hours at a temperature depending on the size of the probe (ie: 42 ° C, for a probe of size>
• the last washing is carried out in 0.1 x SSC + 0.1% SDS for 30 minutes at 60 ° C. for a probe of size> 100 nucleotides.
• the high stringency hybridization conditions described above for a polynucleotide of defined size will be adapted by those skilled in the art for oligonucleotides of larger or smaller size, according to the teaching of Sambrook and ⁇ . (1989) .
• a nucleotide fragment corresponding to the preceding definition will have at least 15 consecutive nucleotides, preferably at least 21 nucleotides, and even more preferably at least 30 consecutive nucleotides of the sequence from which it is derived.
• the polynucleotide according to the invention is characterized in that it is labeled directly or indirectly with a radioactive compound or a non-radioactive compound.
• the polynucleotide according to the invention is used as a primer for the amplification or polymerization of nucleic sequences; the invention also relates to the use of a polynucleotide according to the invention as a probe for the detection of nucleic acid sequences.
• the fragments of polynucleotides which can be used as probe or as primer in methods of detection, identification, assay or amplification of nucleic sequence will have a minimum size of 9 bases, preferably 18 bases , and more preferably 36 bases.
• the invention relates to the use of a polynucleotide according to the invention as a sense or antisense oligonucleotide to control the expression of the corresponding protein product in this case a polypeptide according to the invention.
• the unlabeled polynucleotide sequences according to the invention can be used directly as a probe, primer or oligonucleotide; however, the sequences used are generally marked to obtain sequences which can be used for numerous applications.
• the labeling of primers, probes, oligonucleotides according to the invention is carried out by radioactive elements or by non-radioactive molecules; among the radioactive isotopes used, mention may be made of 3 P, 33 P, 35 S, 3 H or 125 I.
• Non-radioactive entities are selected from ligands such as biotin, avidin, streptavidin, dioxygenin, haptens, dyes, luminescent agents such as radioluminescent, chemiluminescent, bioluminescent, fluorescent, phosphorescent agents.
• ligands such as biotin, avidin, streptavidin, dioxygenin, haptens, dyes, luminescent agents such as radioluminescent, chemiluminescent, bioluminescent, fluorescent, phosphorescent agents.
• the invention also includes a method of detecting and / or assaying nucleic acid according to the invention, in a biological sample, characterized in that it comprises the following steps: (i) isolation of the DNA to starting from the biological sample to be analyzed, or obtaining a cDNA from the RNA of the biological sample; (ii) specific DNA amplification coding for the polypeptide according to the invention using primers; (iii) analysis of the amplification products.
• the invention furthermore comprises a kit for the detection and / or the assay of a nucleic acid according to the invention, in a biological sample, characterized in that it comprises the following elements: (i) a pair of primers nucleic acids according to the invention, (ii) the reagents necessary to carry out a DNA amplification reaction, and optionally (iii) a component making it possible to verify the sequence of the amplified fragment, more particularly a probe according to the invention.
• the invention also includes a method for detecting and / or assaying nucleic acid according to the invention, in a biological sample, characterized in that it comprises the following steps: (i) bringing a probe into contact according to the invention with a biological sample; (ii) detecting and / or assaying the hybrid formed between said probe and the DNA of the biological sample.
• the invention also includes a kit for the detection and / or the assay of nucleic acid according to the invention, in a biological sample, characterized in that it comprises the following elements: (i) a probe according to the invention, (ii) the reagents necessary for carrying out a hybridization reaction, and if appropriate, (iii) a pair of primers according to the invention, as well as the reagents necessary for an amplification reaction of the DNA.
• the invention relates particularly to the methods according to the invention and described above, for the detection and diagnosis of cells of cancerous origin and mainly cancers of the breast, uterus, ovary, prostate and lung.
• the polynucleotides according to the invention can thus be used as a primer and / or probe in methods using works in particular the PCR (polymerase chain reaction) technique (Erlich, 1989; Innis et al, 1990, and Rolfs et al, 1991).
• This technique requires the choice of pairs of oligonucleotide primers framing the fragment which must be amplified.
• the amplified fragments can be identified, for example after an electrophoresis in agarose or polyacrylamide gel, or after a chromatographic technique such as gel filtration or ion exchange chromatography.
• the specificity of the amplification can be controlled by molecular hybridization using as probe the nucleotide sequences of polynucleotides of the invention, plasmids containing these sequences or their amplification products.
• the amplified nucleotide fragments can be used as reagents in hybridization reactions in order to demonstrate the presence, in a biological sample, of a target nucleic acid of sequence complementary to that of said amplified nucleotide fragments.
• the invention also relates to the nucleotide fragments capable of being obtained by amplification using primers according to the invention.
• PCR-like will be understood to mean all the methods implementing direct or indirect reproductions of the nucleic acid sequences, or else in which the labeling systems have been amplified, these techniques are of course known, in general these are of amplification of DNA by a polymerase; when the original sample is an RNA, a reverse transcription should be carried out beforehand.
• the target polynucleotide to be detected is an RNA, for example an mRNA
• an enzyme of reverse transcriptase type in order to obtain a cDNA from the RNA contained in the biological sample.
• the cDNA obtained will then serve as a target for the primers or probes used in the amplification or detection method according to the invention.
• nucleotide probes according to the invention specifically hybridize with a DNA or RNA molecule of polynucleotide according to the invention, more particularly with the sequences SEQ ID N ° 1, SEQ ID N ° 3, SEQ ID N ° 5, SEQ ID No 7, SEQ ID No 9, SEQ ID No 11 and SEQ ID No 13, under high stringency hybridization conditions as given in the form of an example above.
• the hybridization technique can be carried out in various ways (Matthews et al, 1988).
• the most general method consists in immobilizing the nucleic acid extracted from cells of different tissues or cells in culture on a support (such as nitrocellulose, nylon, polystyrene) and incubating, under well defined conditions, the target nucleic acid immobilized with the probe. After hybridization, the excess probe is eliminated and the hybrid molecules formed are detected by the appropriate method (measurement of radioactivity, fluorescence or enzymatic activity linked to the probe).
• the latter can be used as a capture probe.
• a probe called a “capture probe”
• a probe is immobilized on a support and is used to capture by specific hybridization the target nucleic acid obtained from the biological sample to be tested and the target nucleic acid is then detected.
• a second probe called a “detection probe”, marked by an easily detectable element.
• the invention comprises the use of a sense or antisense oligonucleotide to control the expression of the corresponding protein product.
• a sense or antisense oligonucleotide to control the expression of the corresponding protein product.
• the antisense oligonucleotides that is to say the structure of which ensures, by hybridization with the target sequence, an inhibition of the expression of the corresponding product.
• sense oligonucleotides which, by interaction with proteins involved in the regulation of the expression of the corresponding product, will induce either an inhibition or an activation of this expression.
• the oligonucleotides according to the invention have a minimum size of 9 bases, preferably 18 bases, and more preferably 36 bases.
• the invention relates to a recombinant vector for cloning a polynucleotide according to the invention and / or for expressing a polypeptide according to the invention, characterized in that it contains a polynucleotide according to the invention as previously described.
• the vector according to the invention is characterized in that it comprises the elements allowing the expression of said sequences in a host cell and optionally the secretion of said sequences out of the host cell.
• expression vector is meant both expression vectors with autonomous replication of the plasmid type and systems intended to ensure integration into cells, but these expression vectors may also be expression vectors. of the viral type or even, when it is desired to carry out, for example, gene therapy, naked DNA.
• viral vectors those derived from adenovirus, from virus associated with adenovirus (AAV), from retroviruses, from lentiviruses, and preferably derivatives from HIV, poxviruses, from herpesvirus are preferred. in eukaryotic system.
• naked polynucleotides such as naked DNA or naked RNA are preferred according to the technique developed by the company VICAL, artificial yeast chromosomes (YAC, yeast artificial chromosome) for expression in yeast, mouse artificial chromosomes (MAC, mou se artificial chromosome) for expression in murine cells and preferably human artificial chromosomes (HAC, human artificial chromosome) for l expression in human cells.
• the vector according to the invention comprises elements for controlling the expression of the polypeptides; these control elements are preferably chosen from (i) the promoter sequence of the hOBPIIa gene according to the invention which corresponds to the sequence SEQ ID No. 15 and / or from the promoter sequence of the hOBPIIb gene according to the invention which corresponds to the sequence SEQ ID No. 16; (ii) a polynucleotide whose sequence is complementary to the sequence SEQ ID No. 15 and SEQ ID No.
• the invention furthermore comprises the host cells, in particular the eukaryotic and prokaryotic cells, characterized in that they are transformed by the vectors according to the invention.
• the host cells are transformed under conditions allowing the expression of a recombinant polypeptide according to the invention.
• the cell host can be chosen from bacterial cells but also from yeast cells, as well as from plant and animal cells; preferably, the cell host is a mammalian cell (Edwards and Aruffo, 1993), but also an insect cell in which methods using baculoviruses can be used, for example (Luckow, 1993).
• These cells can be obtained by introducing into host cells a nucleotide sequence inserted into a vector as defined above, then culturing said cells under conditions allowing replication and / or expression of the transfected nucleotide sequence.
• the invention also relates to an animal or a transgenic plant which comprises host cells according to the invention.
• the invention also relates to a method for preparing a polypeptide characterized in that it implements a vector according to the invention. More particularly, the invention relates to a method for preparing a recombinant polypeptide characterized in that cells transformed according to the invention are cultivated under conditions allowing the expression of said recombinant polypeptide and that said recombinant polypeptide is recovered.
• the polypeptide according to the invention is capable of being obtained according to a method of the invention and according to the techniques for producing recombinant polypeptides known to those skilled in the art.
• the present invention therefore relates to the recombinant polypeptide capable of being obtained by the method presented above.
• the nucleic acid sequence used is placed under the control of signals allowing its expression in a cellular host.
• An efficient system for producing a recombinant polypeptide requires a vector, for example of plasmid or viral origin, and a compatible host cell.
• the vector must include a promoter, translation initiation and termination signals, as well as appropriate regions for transcription regulation.
• nucleic acid sequences according to the invention can be inserted into vectors with autonomous replication within the chosen host, or vectors integrative of the chosen host.
• vectors will be prepared according to the methods commonly used by those skilled in the art, and the resulting clones can be introduced into an appropriate host by standard methods such as, for example, calcium phosphate precipitation transfection, lipofection, electroporation, thermal shock.
• the recombinant polypeptides obtained as indicated above can either be in glycosylated form or non-glycosylated and may or may not have the natural tertiary structure.
• the polypeptides obtained by chemical synthesis and which may contain unnatural amino acids corresponding to said recombinant polypeptides, are also included in the invention.
• the peptides according to the invention can also be prepared by conventional techniques, in the field of peptide synthesis. This synthesis can be carried out in homogeneous solution or in solid phase.
• the recombinant polypeptide purification methods used are known to those skilled in the art.
• the recombinant polypeptide can be purified from cell lysates and extracts, from the culture medium supernatant, by methods used individually or in combination, such as fractionation, chromatography methods, immunoaffinity techniques using specific mono- or polyclonal antibodies, etc.
• a preferred variant consists in producing a recombinant polypeptide fused to a “carrier” protein (chimeric protein).
• carrier chimeric protein
• the present invention relates to the use of a polypeptide chosen from a hOBPIIa and hOBPIIb polypeptide according to the invention or one of their fragment and from LCN1, “retinol binding protein” (RBP) and apolipoprotein D (ApoD) as binding protein to a hydrophobic ligand, preferably a molecule fragrant.
• RBP retinol binding protein
• ApoD apolipoprotein D
• the present invention also relates to the use of a polypeptide according to the invention or one of its fragments, LCN1, RBP and apolipoprotein D as a competitive inhibitor, as an agonist or antagonist of cellular lipocalin receptors.
• the use of inhibitor of binding of lipocalins to their receptor can be used in an anti-cancer strategy; in fact, a certain number of tumors are hormone-dependent: thus breast tumors are sensitive to steroids; these steroids being transported by lipocalins, it is within the scope of the invention to provide inhibitors of binding to the polypeptides according to the invention and LCN1, OBP or APO-D to avoid the binding of steroid hormones to the receptors of the tumor cells.
• the invention also relates to a monoclonal or polyclonal antibody and its fragments, characterized in that they specifically bind a polypeptide according to the invention.
• Chimeric antibodies, humanized antibodies and simple antibodies chain are also part of the invention.
• the antibody fragments according to the invention are preferably Fab or F fragments (ab12.
• the polypeptides according to the invention make it possible to prepare monoclonal or polyclonal antibodies.
• the monoclonal antibodies can advantageously be prepared from Tibridomas according to the technique described by Kohler and Milstein in 1975.
• the polyclonal antibodies can be prepared, for example by immunization of an animal, in particular a mouse, with a polypeptide according to the associated invention to an adjuvant of the immune response, then purification of the specific antibodies contained in the serum of the immunized animals on an affinity column on which has been previously fixed the polypeptide having served as antigen.
• the polyclonal antibodies according to the invention can also be prepared by purification on an affinity column, on which a polypeptide according to the invention has previously been immobilized.
• the invention also relates to a monoclonal antibody specific for a polypeptide according to the invention and capable of inhibiting the interaction between said polypeptide and the cellular receptor to which said polypeptide specifically binds.
• the monoclonal antibody according to the invention is capable of inhibiting the interaction between said polypeptide and its hydrophobic ligands, preferably the odorous molecules and preferably the pheromones with which said polypeptide binds.
• the antibodies of the invention may also be labeled in the same manner as described above for the nucleic probes of the invention and preferably with labeling of the enzymatic, fluorescent or radioactive type.
• labeled antibodies can be used for the detection of these polypeptides in a biological sample.
• the biological sample consists of a fluid, for example serum, blood or human biopsies. They thus constitute a means of analysis of the expression of the polypeptide according to the invention, for example by immunofluorescence, gold labeling, enzyme immunoconjugates.
• the antibodies of the invention can be advantageously used in any situation where the expression of a polypeptide according to the invention must be observed, and more particularly in immunocytochemistry, in immunohistochemistry or in “western blotting” experiments. In ELISA and RIA techniques. It is thus within the scope of the invention to provide a method of detecting and / or assaying a polypeptide according to the invention, in a biological sample, characterized in that it comprises the following stages of contacting of the biological sample with antibodies according to the invention and then of detection of the antigen-antibody complex formed.
• kits for the detection and / or the assay of a polypeptide according to the invention in a biological sample characterized in that it comprises the following elements: (i) a monoclonal antibody or polyclonal as described above; (ii) where appropriate, the reagents for constituting the medium suitable for the immunological reaction; (iii) reagents for the detection of antigen-antibody complexes produced by the immunological reaction.
• This kit is particularly useful for carrying out Western Blotting experiments and for immunoprecipitation experiments.
• the hOBPII according to the present invention can be used in numerous applications.
• the first applications of OBP are in odor control; these applications mainly concern personal hygiene (perfumery, cosmetology, pharmacy) or collective hygiene.
• Such a method can be used in a process to control the volatilization of an odor; such a method is characterized in that it comprises a step of binding said odor with a polypeptide according to the invention or with the proteins LCN1, RBP or apolipoprotein D.
• the OBPIIs according to the present invention will be more particularly usable in the perfumery and cosmetic industry where the OBPIIs will be used in the form of a liquid mixture intended to control the volatilization of odors after the composition has been spread. on human skin. This makes it possible to prolong the "hold” of perfumes or to enter into the composition of body deodorants in particular.
• the term “perfume” generally encompasses the mixtures known in perfumery, based on alcohol or in aqueous form, and containing in particular essential oils.
• the polypeptide according to the invention can also be used in the composition of retinol-based creams as an agent for transporting and protecting said retinol for cosmetological applications and in particular for preventing, erasing and treating wrinkles, fine lines of the skin. , fight against sagging skin and / or subcutaneous.
• the method according to the invention can be used in a device aimed at deodorizing premises such as, for example, pet stores, stables.
• a device can also be envisaged for deodorizing the air flow entering a conditioned air device; such a device would be very useful in polluted geographic areas.
• the invention also relates to a method for screening a molecule, preferably an odor or flavor, which comprises passing the molecule onto a substrate which comprises a polypeptide according to the invention or, LCN1, RBP and the apolipoprotein D linked to said substrate, said polypeptide binding said odor or flavor and recovering said odor or flavor from the polypeptide if necessary.
• the OBPs according to the invention could thus allow the isolation of odors or perfumes by fixing them on a support as described above but which, in this case, could for example be a chromatography column, by passing over it. this is the product on which we wish to capture odors. It is of course possible, always in this same type of application, to carry out an analysis of a complex perfume by using the differences in retention of the different products by OBP.
• the isolation process described above can also be used to separate particular "smells", especially human pheromones.
• the hOBPII according to the present invention can be used for food or industrial applications.
• the OBPs according to the present invention by virtue of their characteristics can make it possible to dissolve certain lipophilic molecules by associating them with said OBPs.
• the polypeptides according to the invention can be used in combination with edible fatty acids as a food additive.
• the present invention relates to a method for solubilizing lipophilic molecules characterized in that it comprises the binding of said lipophilic molecule to a polypeptide according to the invention, to LCN1, RBP or to apoD.
• OBPII, as well as LCN1, RBP and ApoD are likely to be involved in the transport of fatty acids and in the biological mechanisms allowing the detection of the fatty acid load of the food ration, particularly at the oral level.
• the invention therefore also relates to the use of the above polypeptides in combination with fatty acids to reduce the consumption of fatty acids, in particular in hyperlipidemia or obesity.
• the above polypeptides can therefore be used for the treatment of hyperlipidaemia and obesity.
• these proteins participate in the detection of the fatty acid content in food intake (Gilbertson, 1998), an excess of these proteins must lead to deceive the physiological system detecting the fat load of a food ration.
• a food portion low in fat but supplemented with OBP or ApoD or RBP or LCN1 beforehand loaded with fatty acid will be falsely identified as high in fat.
• Another application is to supplement non-breast milk with one or more of the polypeptides described above.
• the OBPs according to the present invention can be used in preventive and curative therapy.
• the absence of detection of this type of protein in a biological sample using an antibody, a primer, a probe according to the invention could be an element in the diagnosis of anosmias.
• the invention therefore relates to a method for detecting antibodies directed against human OBPII (hOBPII) in the human serum of an allergic and / or asthmatic patient using a hOBPII polypeptide according to the invention.
• the invention relates to a method for detecting antibodies directed against human OBPII (hOBPII) in a biological fluid of a patient suffering from cancer, and in particular prostate cancer and / or cancer breast and / or uterine and / or ovarian and / or lung cancer.
• hOBPII human OBPII
• the proteins according to the invention are over-expressed in tumors and in particular in prostate cancer (US 5804368, WO 97 10503, CS 84 02898, CS 83 02012, CS 82 08506, CS 82 08215), breast cancer (Stoecz and Gould, 1995; Simard et al, 1992), uterine cancer, ovarian cancer , lung cancer.
• OBPs according to the present invention can also be used in pharmaceutical compositions, this in particular in order to vectorize certain drugs.
• lipocalins are used by mammals to transport hydrophobic molecules within biological fluids. It even seems to be the natural transporters of xenobiotics in vivo.
• an experimental overload of xenobiotics creates tumors in the male proximal convoluted tube (TCP) in the male rat (Borghoff et al., 1990).
• TCP male proximal convoluted tube
• the MUP proteins only produced in the male rat, are reabsorbed by the TCP cells; after lysosomal degradation, the MUP proteins release the xenobiotics which they transported. These accumulate in these cells and lead them to a tumor pathway by mutagenesis.
• Lipocalins therefore seem to be the ideal structure for trapping a molecule used as a medicament in their calyx, thus avoiding a general distribution thereof.
• G. Beste and ⁇ /. (1999) and application WO 99 16873 describe a mutagenesis and screening strategy making it possible to identify variants of a lipocalin having an optimal affinity for a given ligand. It is therefore possible to create a highly specific "medicine cage”.
• the present invention therefore relates to a polypeptide according to the invention as a targeting agent for a pharmaceutical compound.
• targeting agent is meant the polypeptides of the invention capable of ensuring the transport and release of the ligand to which they are linked at the level of certain target tissues or cells which have receptors for said polypeptides on their surface.
• the invention relates to the transport of medicament within the cage of a polypeptide according to the invention and the targeting of cells thanks to the ability of OBPII to bind to a specific receptor.
• the present invention therefore relates to a polypeptide characterized in that said polypeptide is expressed in the form of a fusion protein with a protein allowing specific cell addressing.
• proteins allowing specific cell addressing mention should be made of interleukins, cytokines, lymphokines, chemokines, growth factors, hormones, mono- or polyclonal antibodies.
• the interleukins, cytokines and lymphokines are chosen from a group preferably composed of interleukins II-1 to 11-20, interferons ⁇ -IFN, ⁇ -IFN and ⁇ -IFN.
• the growth factors are preferably colony stimulating factors G-CSF, GM-CSF, M-CSF and erythropoietin.
• the hormones are preferably chosen from steroid hormones.
• the polypeptide according to the invention as a targeting agent for a pharmaceutical compound is associated with a molecule allowing specific cell addressing.
• a molecule allowing specific cell addressing.
• the molecules allowing specific cell addressing mention should be made of the group of steroids, interleukins, cytokines, lymphokines, interferons, growth factors, hormones, antibodies.
• the molecule is a steroid.
• the association between the polypeptide according to the invention and said molecule is carried out either by a non-covalent bond using for example the avidin-biotin system or by a covalent bond by using for example bridging chemical agents.
• Anti-cancer agents are selected from the group of antiproliferative, antineoplastic or cytotoxic agents and are used to stop the development of cancers and to induce regression and / or elimination of the tumor mass. These anticancer agents are preferably radioisotopes, and more preferably gamma ray radioisotopes such as Iodine 131 , Yttrium 90 , Gold 199 , Palladium 100 , Copper 67 , Bismuth 217 and l 'Antimony 211 . Beta and alpha emitters can also be used for therapy.
• the non-isotopic anticancer agents linked to the polypeptide according to the invention are multiple and varied; we can cite: (i) antimetabolites such as anti-folate agents, methotrexate, (ii) analogs of purines and pyrimidines (mercaptopurine, fluorouracil, 5-azacytidine), (iii) antibiotics, (iv) lectins (ricin, abrin) and (iv) bacterial toxins (diphtheria toxin); the toxins are preferably chosen from exotoxin A from Pseudomonas, diphtheria toxin, cholera toxin, anthrox toxin from Bacillus, pertussis toxin, Shiga toxin from Shigella, toxin related to Shiga toxin, toxins from Escherichia coli, colicin A, d-endotoxin, Haemophilus A hemagglutinin
• the invention also relates
• the invention relates to a pharmaceutical composition as defined above for the treatment of cancer, and in particular prostate cancer, breast cancer, uterine cancer, ovarian cancer, liver cancer and lung epithelial cell carcinoma. Since the OBP called hOBPIIb, apolipoprotein D, RBP and ⁇ -1-glycoprotein acid are expressed in the prostate, the pharmaceutical composition according to the invention is intended for the treatment of prostate cancer.
• the pharmaceutical composition according to The invention is intended for the treatment of breast cancer.
• the invention also relates to a polypeptide according to the invention as a carrier for a pharmaceutical compound.
• transporter is intended to denote polypeptides according to the invention capable of transporting a pharmaceutical compound into the body without said compound being released in a privileged place in the body.
• Such a polypeptide constitutes a means of delivering said pharmaceutical compound into the body.
• the present invention also relates to a pharmaceutical composition according to the invention characterized in that said polypeptide constitutes a delayed form of delivery of said pharmaceutical compound in the body.
• said pharmaceutical compound of interest linked to the OBPII polypeptide according to the invention gradually diffuses into the body as said transporter polypeptide is catabolized in the body.
• the use of recombinant DNA techniques allows those skilled in the art to modify the half-life of the OBPII polypeptide in the body by introducing modifications into said polypeptide.
• the invention relates to a compound characterized in that it is chosen from an antibody, a polypeptide, a ligand, a polynucleotide, an oligonucleotide or a vector according to the invention as a medicament and in particular as active drug ingredients; these compounds will preferably be in soluble form, associated with a pharmaceutically acceptable vehicle.
• pharmaceutically acceptable vehicle means any type of vehicle usually used in the preparation of injectable compositions, that is to say a diluent, a suspending agent such as an isotonic or buffered saline solution.
• these compounds will be administered by the systemic route, in particular by the intravenous route, by the intramuscular, intradermal route or by the oral route.
• Their optimal modes of administration, dosages and dosage forms can be determined according to the criteria generally taken into account in the establishment of a treatment adapted to a patient such as for example the age or the body weight of the patient, the seriousness of his general condition, the tolerance to the treatment and the observed side effects, etc.
• the invention also relates to a pharmaceutical composition comprising an expression vector according to the invention and a pharmaceutically acceptable vehicle.
• the present invention presents various therapeutic applications intended to treat pathologies of gestation in women.
• one of the objects of the present invention is to use the polypeptide according to the invention for the preparation of a medicament intended for the transport of compounds across the placental barrier.
• These compounds are preferably lipophilic molecules.
• the polypeptide according to the invention can be used to carry out the transport of compounds from the pregnant mother to the fetus; the compounds which can be chosen from molecules of therapeutic interest, preferably lipophilic, essential fatty acids, hormones, vitamins, and more generally, small lipophilic molecules.
• the cells of the placental villi massively secrete polypeptides according to the invention in particular OBPII.
• these polypeptides then spread through the fetal blood and into the general bloodstream of the fetus.
• the polypeptide according to the invention can be used to transport the compound from the fetus to the pregnant mother.
• the fetus secretes at the level of the villi of the nasal structures of the polypeptides according to the invention which participate in the exchange of molecules between the fetus and the mother at the level of the amniotic membrane.
• the polypeptide according to the invention can be used as a pregnancy marker.
• the polypeptide according to the invention is present in different biological fluids of the mother such as urine, blood; measuring its concentration and / or presence is an indicator of pregnancy.
• this marker can be used, with, or in place of, or in addition to the pregnancy marker that is human choriogonadotropin hCG; the polypeptide according to the invention and hCG are indeed molecules which are secreted by the placental trophoblastic cells.
• the polypeptide can be used as a marker for feto-placental pathologies. It can be a marker for the rupture of the water pocket membrane.
• FIGURE 1 Genomic organization of the LCNl / hOBPII locus
• the top line represents the region of chromosome 9q34.
• the double arrow indicates the interval between the location of the polymorphic markers D9S1811 and D9S67; the relative position of the markers D9S67 and D9S1826 is uncertain.
• the level of the medium indicates the partial organization of the cosmids at 3 different loci: LCN lc, LCNlb-hOBP ⁇ b, LCNl-hOBPiia.
• the cosmids (approximately 40 kb) are represented by horizontal lines with their name and the arms of the vectors T3 or T7 noted below the line.
• the arrows represent the different genes or pseudogenes with their respective orientation.
• the vertical dotted lines represent the EcoRI sites.
• the symbol ® indicates an uncertain orientation of the locus.
• the lower level shows the intron / exon structures of the LCN 1 and hOPBII genes: the black boxes represent the exons; the arrows represent the site of initiation of transcription; oll to ol5 represent the oligonucleotide probes used to screen the cosmids; Alu represents the presence of repeated sequences.
• FIGURE 2 Dot Plot analysis of:
• FIGURE 3 Nucleotide sequence of hOBPII genes.
• the upper lines represent the sequence hOBPIIa and the lower lines the sequence hOBPIIb for which only the different nucleotides are represented; a dash indicates the absence of corresponding sequences.
• the shaded capitals are the exonic sequences and the lower case letters are the intronic sequences.
• the sizes indicated on the left are indicated in pb.
• the TATA box is in bold type and the polyadenylation signal is underlined.
• the boxes indicate the splice acceptor sites for exons 5, 5b, 5c.
• FIGURE 4 Schematic representation of the two hOBPII genes and their corresponding mRNA.
• the horizontal lines represent the exon / intron organization with sizes indicated in bp.
• the shaded boxes numbered from 1 to 7 are the coding exonic sequences of the main transcripts; the letters b and c refer to supernumerary exons.
• the different transcripts are represented using assembled boxes: the first, hOBPIIa ⁇ and hOBPIIb ⁇ correspond to the main transcripts, the others correspond to the forms resulting from an alternative splicing, j indicates a shift in the reading frame resulting from the insertion or of the deletion of an exon and * represents a stop codon.
• the letter "a” represents a ⁇ and “b” helix of ⁇ sheets predicted by DSC software. Letters in italics are predictions obtained with the "Predator" software.
• OBP2aaHOMS OBP2aaHOMS
• hOBPIIb ⁇ OPB2baHOMSA
• hOBPIIb ⁇ OPB2bbHOMSA
• the residues in the dark gray boxes are identical and those in the light gray boxes are similar.
• the secondary structural elements predicted with the DSC program are underlined and the amino acid residues are in italics.
• the ⁇ sheets and the ⁇ propellers are numbered for hOPBIIa and b.
• the expected signal peptide cleavage site is indicated by an arrow (AAA -LS) at position 15.
• Unaligned sequences of widely divergent forms of spliced genes, hOPBa ⁇ (OPB2adHOMSA) and hOBPb ⁇ (OBP2bgHOMSA) have been added at the bottom of the alignment after analysis.
• FIGURE 6 RT-PCR analysis
• FIGURE 7 Tissue localization of hOBP mRNAs
• Sections of the middle meatus (A, B), cornets (C, D), prostate (E, F), vas deferens (G, H), mammary glands (I, J) were hybridized to digoxigenin-1 1-UTP labeled hOBP riboprobes.
• Hybridization with a sense hOBP riboprobe revealed no signal (B, D, F, H, J).
• a specific hybridization signal is obtained with an antisense riboprobe (A, C, E, G, I).
• the arrows indicate different structures: AC: acinar cells, EC: epithelial cells, GC: glandular cells, SD: secretory canal and L: lumen (X200).
• FIGURE 8 Phylogenetic distance tree of vertebrate lipocalins.
• FIGURE 9 Diagram of the evolution of the LCN1 -OBPII gene subfamily during evolution.
• the boxes indicate the exons arranged on a line representing genomic DNA.
• the “//” between the lines indicate that the loci are not consecutive, without it being possible to determine the order.
• the large cross under the symbol “?” "Illustrates a partial duplication or complete duplication event with a subsequent genomic deletion for the LCN lc locus (choice indicated by the symbol” * ").
• the smaller cross indicates the elimination of the seventh exon which appears to be specific to humans due to the many Alu repeat sequences present in this genomic region and because the rat has two VEGP genes.
• the symbol “**” marks the exon recruitment stage based on the present data and that of the literature; this step could appear at any time after the duplication of the loci and could be sequential.
• FIGURE 10 Analysis by RT-PCR in the oral and genital spheres of the expression of other known human lipocalins.
• RBP retinol-binding-protein
• ApoD apoliporotein D
• FIGURE 11 Study of the polyclonal antibody directed against the hOBPII proteins.
• the fusion protein is deposited in wells 1 and 3.
• a sample of human nasal mucus is deposited in wells 2 and 4.
• the proteins contained in wells 1 and 2 were revealed by staining with Coomassie blue.
• the hybrid antibody on the membrane obtained by Western blotting specifically reveals the GST-hOBPIIb protein between 30 and 42 kDa (well 3) and the 18 kDa hOBPIIa and hOBPIIb (well 4) in human nasal mucus.
• FIGURE 12 Immunohistochemistry on the tissues of the olfactory apparatus.
• FIGURE 13 immunohistochemistry on tissues of the oral sphere These two tissues, lacrimal glands (A, B) and Von glands
• Ebner (E, F) show a strong immunoreactivity in comparison with the results obtained thanks to the pre-immune serum (C for the lacrimal glands and D for the Von Ebner glands).
• C for the lacrimal glands
• D for the Von Ebner glands.
• FIGURE 14 Immunohistochemistry on the mammary glands and lung
• a strong immunoreactivity is visible on the sections of mammary glands (A and B) compared to the negative control (C) produced using the pre-immune serum.
• a strong immunoreactivity is also observed on the lung sections (E and F) compared always to the negative control (D). each observation is made at X 100 magnification for A and C and at X 200 magnification for B, D, E and F.
• Figure 15 Demonstration of hOBPII proteins in different nasal structures: Cornet (A: 200x, B: 400x), Septum (C: 300x, D 600x), Medium meatus (E: 400x, F: 600x): Detection of proteins hOBPII with a polyclonal rabbit serum revealed by a peroxidasic activity detected by DAB. AC: acinar secretory cell, P: precipitate of DAB (hOBPII detection)
• Figure 16 Demonstration of the LCN1 protein in different nasal structures: Cornet (A: 200x, B: 500x), Septum (C: 100x, D 500x), Medium meatus (E: 200x, F: 600x):
• FIG. 17 Demonstration of the ApoD protein in different nasal structures: Cornet (A: 500x, B: 700x), Septum (C: 300x), Medium meatus (D: 400x):
• Figure 18 Demonstration of the hOBPII protein in different structures of the oral sphere: Lacrimal gland (A: 200x, B: 600x), Von Ebner glands (C: 100x, D: 400), Lung (E: 200x, 800x): Detection of the hOBPII protein with a polyclonal rabbit serum revealed by a peroxidasic activity detected by DAB.
• AC acinar secretory cell
• P precipitate of DAB (hOBPII detection).
• Figure 19 Demonstration of hOBPII proteins in different placental structures: chorionic villi (A: 300x, B: 800x), Amniotic membrane (C: 800x), Cord (D: 600x):
• hOBPII proteins Detection of hOBPII proteins with a polyclonal rabbit serum revealed by peroxidase activity detected by DAB.
• L gap (contains maternal blood)
• C fetal capillary
• Am amniotic membrane
• E epithelial cells derived from extraembryonic ectoblast
• MB basement membrane
• M mesenchymal layer
• P DAB precipitate (hOBPII detection)
• Figure 20 Demonstration of the LCN1 protein in different placental structures: chorionic villi (A: 200x, B: 800x), Amniotic membrane (C: 600x), Cord (D: 500x): Detection of the LCNl protein with a serum polyclonal rabbit revealed by peroxidasic activity detected by DAB.
• L gap (contains maternal blood), C: fetal capillary, Am: amniotic membrane, E: epithelial cells derived from extraembryonic ectoblast, MB: basement membrane, M: mesenchymal layer, P: precipitate of DAB (LCN detection l)
• Figure 21 Demonstration of the ApoD protein in different placental structures: chorionic villi (A: 100x, B: 500x), Amniotic membrane (C: 400x), Cord (D: 400x):
• a Lambda gtl l library of human testis cDNA (Clontech) (10 7 pfu) was amplified by 30 cycles of chain polymerization (PCR) (94 ° C 45 sec, 54 ° C 45 sec, 72 ° C lmin 30 sec) with the primer oliEST58 CCTGCAGGTACATGAGCTTCC and 5 'or 3' amplimers for screening inserts located on the arms of the Lambda gt 1 1 vectors.
• a nested PCR was then carried out with oliEST26 CGCTGTATTTGCCAGGCTCC and specific oligonucleotides of the vector arm .
• the PCR products were subcloned into the vector pGEM-T (r), which made it possible to obtain the 5 ′ end of the cDNAs of the hOBPII gene.
• RNA samples were collected from Caucasian individuals between the ages of 45 and 55 in accordance with current French regulations.
• Total RNA is extracted using a one-step method using the NOW ® RNA reagent according to the manufacturer's instructions (Biogentex). 5 ⁇ g of total RNA were back transcribed into a final volume of 20 ⁇ l using 0.5 ng of oligonucleotide
• the primers G3PDH 1: CTCTGCCCCCTCTGCTGATG and G3PDH2: CCTGCTTCACCACCTTCTTG of the G3PDH gene were used; the G3PDH gene is considered to be constitutively expressed in all cell types.
• 32 PCR cycles (94 ° C 45 sec, 54 ° C 45 sec, 72 ° C 2 min. 30 sec.) Were carried out and the amplification products were separated on 1% agarose gel. The DNA is transferred to a Hybond N + @ membrane.
• oligonucleotides specific for the respective genes have been synthesized: - olLCNl: GACTCAGACTCCGGAGATGA,
• - ol4 CCGGGACGGACGACTACG specific for the hOBPIIa gene
• - G3PDH3 CTCATGACCACAGTCCATGC
• the oligonucleotides are labeled with ⁇ 32 P-ATP using T4 kinase (Applied Biosystem); the hybridizations of the labeled oligonucleotides are carried out at 42 ° C. The final washing is carried out in a solution of 0.1 X SSC, 0.1% SDS at 48 ° C for 20 min. The specificity of the oligonucleotide hybridization reactions is checked using digested cosmid DNA samples (p233G2 for LCN1 and hOBPIIa, P19E7 for LCN lb and hOBPIIb, P181A9 for LCN lc) and loaded onto the gel with RT- products. PCR.
• Genotyping is carried out by PCR reactions using 100 ng of genomic DNA from 8 CEPH reference families and using oli9 oligonucleotides TGTTCGGGAACGCAGCTT and olilObis
• the parameters of the thermal cycler consist of an initial cycle at 94 ° C for 10 min followed by 30 cycles at 94 ° C for 30 s, 55 ° C for 30 s and 70 ° C for 45 s and then a final elongation step of 10 min at 70 ° G.
• the PCR products are then analyzed on a 3% agarose gel.
• Information on the markers of chromosome 9 can be obtained at the following Internet address (hTTP://galton.ucl.ac.uk); the analyzes were carried out using the link study tools previously described in Lacazette et al. ( 1997).
• the haplotypes are reconstructed manually according to the recombination events previously described in the 1362 family (Attwood et al., 1994).
• the lipocalin proteins whose sequences are known in their entirety were aligned three times consecutively using the Clustalx software (ftp://ftp.inforbiogen.fr). Distances in the phylogenetic tree were calculated with Clustalx and drawn with Njplot.
• RNA probes are obtained according to standard techniques using T7 or SP6 polymerase from a matrix obtained by digestion with Ncol or PstI restriction enzymes from the cDNA clone of phOBPIIaP2 and using DIG-1 1-UTP (Boehringer Mannheim) (the length of the probe is approximately 150 nucleotides ).
• RNA polymerase SP6 The matrices digested by PstI and transcribed by T7 RNA polymerase correspond to the antisense probe and the matrices digested by Ncol transcribed by RNA polymerase SP6 correspond to the sense probe.
• Tissue sections are fixed in 4% paraformaldehyde for 15 min and then rinsed for 5 min in 2X PBS. After acetylation (2 x 5 min in a triethanolamine buffer (TEA) pH 8, containing 0.25% v / v acetic anhydride), the tissue sections are prehybridized at 60 ° C for 15 min in 50% formamide / IX SSC.
• TAA triethanolamine buffer
• the labeled probes are applied to each of the sections in 50 ⁇ l of hybridization buffer (50% formamide, IX Denhardt's, 500 ⁇ g / ml total of tRNA, 10% of Dextran sulfate, 10 mM of dithiotreitol).
• hybridization buffer 50% formamide, IX Denhardt's, 500 ⁇ g / ml total of tRNA, 10% of Dextran sulfate, 10 mM of dithiotreitol.
• the sections are covered and then incubated in humid rooms at 50 ° C. overnight. After hybridization, the slides are immersed at 55 ° C in a washing buffer (50% formamide, IX SSC) for 2 hours.
• Each slide is then rinsed 2 times 5 min in 2X SSC at room temperature, then treated for 30 min with 10 mg / ml of RNase at 37 ° C, and finally immersed for 2 hours at 55 ° C in a washing solution (50 % formamide, 2X SSC).
• the slides are then placed for 15 min at 55 ° C. in 0.1 X SSC.
• Immunological detection is carried out using an anti-DIG antibody conjugated to alkaline phosphatase (Fab fragments) according to the protocol of Boehringer Mannheim.
• the sections are examined at different magnifications using an Axiophot microscope (Zeiss).
• fusion proteins Two hundred and fifty ⁇ l of fusion proteins were supplied to the company Agro-Bio for the production of antibodies. Rabbits (New Zealand White SPF) are injected on days 0, 14, 28 and 42. The sera are taken on days 0, 35, 49 and 63. In order to test the antibody, the fusion protein is deposited in the tracks 1 and 3 ( Figure 11), while human nasal mucus is deposited in tracks 2 and 4. Lanes 1 and 2 as well as the track corresponding to the molecular weight scale, correspond to a revelation by Coomassie blue . Lanes 3 and 4 correspond to a detection of proteins recognized by the antibody using the Western blot technique.
• Lanes 1 and 3 show the presence of a series of truncated recombinant proteins between 30 and 42 kDa resulting from an ineffective synthesis due to the presence of many rare codons in the bacteria within the hOBPIIb sequence. However this production of recombinant protein was sufficient to produce a good quality polyclonal antibody as indicated by the revelation in lane 4 corresponding to the nasal mucus, of an 18 kDa band specific for hOBPn proteins.
• a DAPI solution (100 ng / ⁇ l in PBSxl) is applied for 10 min (against staining of the cell nuclei in blue).
• the slides are mounted in glycerol water (50/50). The analysis is carried out in the presence of DAPI and FITC filters using a CDD camera using an integration time between 4 and 32 ms.
• the tissues are frozen at -80 ° C. in the presence of OCT. Serial sections of 7 micrometers are made using a microtome. The tissues are then fixed with 4% Para-formaldehyde in PBS. The slides are incubated for 10 min in a methanol solution in the presence of 4.5% of H 2 O 2, then rinsed three times in PBS for 5 min After an incubation for 30 min in a solution of 3% of bovine serum albumin , the first antibody (diluted 1/350) is incubated overnight at room temperature (Rabbit polyclonal antibodies for hOBPII and LCN1, and mouse monoclonal for ApoD).
• the second antibody (diluted to 1/300) (anti-rabbit for hOBPII and LCN 1, and anti-mouse for ApoD) is incubated for 3 h at room temperature.
• a revelation with peroxidase by DAB is carried out for 2 to 10 min, using the “Vector” kit.
• the slides are then rinsed with water, and counter-stained with Mayer's serum for 2 min.
• the slides are dehydrated by successive drenching in ethanol solutions 70 °, 95 °, 100 °, 100 °, and finally two baths of toluene.
• the slides are then mounted in Canada balsam, and observed using a Zeiss microscope.
• EXAMPLE 2 IDENTIFICATION OF A GENE APPROVED WITH LCN1 LOCALIZED ON HUMAN CHROMOSOME 9
• a library of cosmids specific for human chromosome 9 (LL09NP01) was screened with the human LCN1 cDNA probe; 26 cosmids have been identified; these were digested with EcoRI or PvuII, then hybridized successively with the DNA of
• the cosmids are divided into 3 groups.
• the first group (clones P32H3, P41B5, P63B6, P92H20, P109C6, P145H6, P195B4, P233G2, P233F2, P265D4, and P276H8) correspond to cosmids containing a sequence of the LCNl gene previously isolated (accession number: L 14927) formed by 7 exons (Holzfeind and Redl, 1994).
• the second group corresponds to the homologous sequence LCNlb LCNl (clone P19E4) (accession number: Y-10826) from the promoter to the 6 th exon and then diverging.
• a third group of cosmids contains an LCNlc region, established from the partial sequencing of clone P181A9 (accession number Y 10827), which is highly homogeneous to LCNl only from the promoter to exon 2.
• the LCN is the only gene that has the 7 th and last exon.
• the TATA boxes are degenerate in the promoters of the LCN lb and LCNlc genes
• LCN revealed that the sequence LCNlc corresponded to the clone having the accession number AC002106, LCNlb with number AC002098 and LCNl with number AC000396; however, there is an insertion of 60 base pairs at position 12360 of the clone having the accession number AC000396 relative to that having the number L14927. Further analyzes revealed that these sequences are homologous over a much wider region than the LCN 1 genes.
• P203H 12 may correspond to a 4 th duplicated region
• the area has been tested by PCR on genomic DNA of 150 unrelated individuals using specific primers for AC000396 and L14927.
• a single band corresponding to the length of the sequence AC000396 was detected (data not shown) thus proving that P203H 12 contains the LCN1 gene previously described.
• the LCN lb locus has not been positioned precisely in the region as it is demonstrated by the fact that the ends AC002098 as well as the ends of the cosmids containing LCNlb do not detect any homologous sequence in the databases.
• the comparison of AC002098 to the database revealed similarities between this sequence and the lipocalin genes.
• the region around the position of 2150 contains sequences having similarities with the sequences coding for the binding proteins to rat odor type II, lipocalins of tears as well than for EST AA460385.
• the comparison of the sequence AC000396 to the database revealed, in addition to the region 1 1 100 to 17 100 containing the LCN 1 gene, similarities for the same group of sequences in the region 36 600 to 37 800.
• EST AA460385 expressed in human testes corresponds to 4 exons of the new lipocalin gene present in the clone P161A1 (AC002098).
• a putative 50 base pair exon similar to the EST sequence is also present at the end of clone P203H12 (AC000396).
• the inventors therefore concluded that a new lipocalin gene exists at a position distal to LCN lb.
• the inventors have hypothesized that, following genomic duplication, a second gene orthologous to the gene coding for EST is present in the 3 'region of LCN1.
• hOBPIIa corresponding to the gene located downstream from LCNl and hOBPIIb located downstream from LCNlb ( Figures 3 and 4), are 97.5% and 63% identical to those corresponding to the LCN1 gene.
• the intron / exon organizations of these two genes are consistent with the lipocalin family.
• the prediction of the secondary structures of the hOBPIIa and hOBPIIb proteins with the DSC software by performing multiple alignments with the lipocalin sequences of known structures indicates the presence of 8 strands of antiparallel ⁇ sheets which can allow the formation of a calyx followed by an ⁇ helix. and a final ⁇ sheet in accordance with the known data of the structures of lipocalins (FIG. 5).
• the hOBPIIa and hOBPIIb genes are expressed, which confirms their previous detection in cDNA libraries.
• the two proteins hOBPIIa and hOBPIIb are very similar over their entire sequence including in the 1.5 kb promoter region, their expression profile are different ( Figure 6B).
• the hOBPIIa protein is strongly expressed in the nasal septum, the middle meatus, the nasal horn, the testes and the placenta and more weakly in the mammary glands, the lacrimal glands, the sweat glands, the von Ebner glands and the lung.
• the hOBPIIb protein is expressed predominantly in the prostate, testes and mammary glands and more weakly in the submandibular glands, the nasal septum and the middle meatus.
• RT-PCR analyzes revealed the existence of an alternative splicing of the gene transcript hOBPIIa and the hOBPIIb gene which generates four and three mRNAs respectively ( Figures 3, 4, 5 and 6).
• Transcription of the hOBPIIa gene generates at least four mRNAs which code for four different proteins; the first mRNA codes for the hOBPIIa ⁇ protein which corresponds to the hOBPIIa protein described above.
• the first mRNA codes for the hOBPIIa ⁇ protein which corresponds to the hOBPIIa protein described above.
• three different splice acceptor sites have been identified for exon 5 (FIGS. 3 and 4), thus forming two other splice variants.
• a first splicing variant presents an acceptor site for exon 5 located 49 bp before the previous one (exon 5b); this generates an mRNA of 725 nucleotides which codes for the hOBPIIa ⁇ protein of 146 amino acids.
• This protein is identical to the 8 th putative ⁇ sheet and then different with only 16 additional amino acids.
• a second splicing variant has an acceptor site for exon 5 located 65 bp before the previous one (exon 5c); this generates an mRNA of 741 nucleotides which codes for a hOBPIIa ⁇ protein of 228 amino acids.
• This protein has the first eight putative ⁇ sheets identical to those of hOBPIIa ⁇ then is different in the C-terminal region ( Figure 5) because of a reading frame shift generated by this alternative splicing event; the structure of this C-terminal region predicted by Predator software is a long bent region containing a 9 th ⁇ sheet.
• hOBPIIb In the case of the hOBPIIb gene, in addition to the hOBPIIb ⁇ mRNA previously described, a supernumerary exon of 106 bp (exon 3b) between the previous exons 3 and 4 has been identified (FIG. 3). This longer mRNA (782 nucleotides) codes for a hOBPIIb ⁇ protein of 165 amino acids. From the viewpoint of the protein structure, hOBPIIb ⁇ is identical to hOBPIIb ⁇ to the 5th sheet putative ⁇ and then differs due to a shift in the reading frame. Computer software predictions indicate that the ALWEALAIDTRLK pattern is an ⁇ helix which is just behind the fifth ⁇ sheet. Two additional ⁇ sheets may be present in the long C-terminal part.
• MRNAs coding for hOBPIIa ⁇ and hOBPIIb ⁇ which lack the coding sequence for exon 2 and which have exon 5b and exon 5 respectively encode putative secreted proteins of 147 and 85 amino acids respectively ( Figures 4 and 5); these proteins diverge from the previous proteins from the 24 th amino acid.
• the inventors hybridized sense and antisense ribonucleic probes labeled with digoxygenin on tissue sections (FIG. 7).
• HOBPII mRNAs are detected in the acinar cells of the middle meatus and the nasal horns as well as the epithelial cells of the horns; this supports the idea that hOBPII proteins are involved in olfactory function.
• mRNAs encoding hOBPII have been detected in the genital sphere, in particular in the glandular cells of the prostate, in the secretory epithelial cells. of the vas deferens. No signal was detected in the male gonads, which suggests that the expression of the hOBPII genes demonstrated in the RT-PCR experiments corresponded to the presence of additional channels in the tissue preparation (rete testis and efferent channels). .
• hOBPIIa ⁇ , hOBPIIa ⁇ , hOBPIIa ⁇ , hOBPIIb ⁇ , hOBPIIb ⁇ five hOBPII proteins
• hOBPIIa ⁇ , hOBPIIa ⁇ , hOBPIIa ⁇ , hOBPIIb ⁇ , hOBPIIb ⁇ five hOBPII proteins
• hOBPIIb ⁇ and hOBPIIb ⁇ are secreted by the epithelio-glandular cells of the prostate and mammary glands.
• the inventors have identified nine main groups of lipocalins derived from a common precursor: the family of apolipoprotein and of retinol binding protein (RBP) (group 1); the prostaglandin D-synthase group and the lipocalin precursor associated with the gelatinase of neutrophils (group 1);
• alpha-1-microglobulin / bikunin (HC protein) subfamily group 3
• the orosomucoid subfamily A1AG, Al AH, Al AI
• group 4 the oral sphere subfamily 1 (OBPII-type-
• LCN1 / VEGP, VNSP I and II, LALP, CanFl) group 5
• the lactoglobulin subfamily group 6
• - the subfamily of proteins secreted by the lizard epididymis group 7
• the subfamily oral sphere 2 major urinary protein (MUP) of mice
• group 8 the oral sphere 3 subfamily (OBP1, mouse OBPII, Aphrodisine, Probasine, BD20) (group 9).
• the present invention relates more particularly to groups 5, 8 and 9.
• Group 5 contains the hOBPII proteins which are evolutionarily closely linked to rat OBPII. Taken together, the present results indicate that the human hOBPII genes are orthologous to the rat OBPII gene. This group also contains LCN 1-VEGP proteins of different species.
• the tree data illustrate the duplication event (arrow) which gives rise to the ancestral hOBPII and LCN l genes from their common lipocalin precursor ( Figure 9) . More recently, the original duplications of the 50 kb region containing hOBPII-LCNl (arrow) have generated in humans the two genes hOBPII and the gene LCN 1 and its pseudogen LCNlb.
• the additional duplication which gave rise to the pseudogen LCN lc is partial in the human genome and does not produce a functional protein and is therefore absent from the present tree.
• the two rat VEG proteins are more closely linked to each other in the phylogenetic tree than with the human protein LCN 1.
• the situation is identical for the two human OBPII proteins compared to the rat OBPII protein.
• Group 9 corresponds to the oral sphere family 3 and contains OBPs which have already been described.
• the Aphrodisine protein has already been described as a pheromone transporter (Henzel et al, 1988) and appears to be orthologous to the rat and mouse OBP1 protein, with two paralogous OBP1 genes.
• the olfactory lipocalins produced by the Bowman glands of rana pipens (OLFA RANPI) which are considered to be potential odor transporters in the frog's mucus, are not linked to any group of putative OBPs (groups 5, 8 and 9) thus suggesting the existence of other categories of OBP.
• the present invention has revealed the existence of a genomic duplication at locus q34 of human chromosome 9 which harbors a family of genes of the LCN1 type; this family comprises, in addition to the LCN 1 gene, described above, two pseudogenes as well as two hOBPII genes which are paralogs to LCN1.
• the inventors have revealed that the hOBPII-LCN1 family results from consecutive events of genomic duplications.
• the sequences as well as the genomic organization revealed that the LCN 1 and hOBPII genes derive from a common ancestor and were generated by means of tandem duplication.
• the inventors have shown that the hOBPII and LCN 1 genes code for proteins involved in different functions, as shown by the expression of these genes both in the oral sphere and in the genital sphere.
• the inventors have shown by phylogenetic analysis (Example 6) that several different proteins can participate in the same function of odorant-binding protein; thus three subfamilies of lipocalins (groups 5, 8 and 9) corresponding to several proteins are found expressed in the oral sphere and in particular in the nasal and buccal glands.
• the inventors therefore propose to include the proteins ApoD and RBP in the family of human OBP and include them in the set of claims relating to these human OBP.
• the inventors have demonstrated that the transcription of the two hOBPII genes generates numerous alternative transcripts which code for distinct proteins whose structure is compatible with that of a hydrophobic ligand transporter.
• the inventors have demonstrated the expression of the two hOBPII genes in the oral sphere (nasal glands, von Ebner glands, submaxillary glands, lacrimal glands, lung).
• the inventors have also demonstrated that the hOBPII proteins according to the invention are produced by cells of the genital sphere; the hOBPII gene is mainly expressed in the prostate, vas deferens and mammary glands while the expression of the hOBPIIa gene is restricted to the vas deferens.
• the BamH I and Xho I enzyme restriction sites located at the ends of the two oligonucleotides were used for a directional cloning in a plasmid vector of expression pGEX-6Pl, followed by a transformation by electroporation (1800V, 200 ⁇ , 25 ⁇ F) in a bacterial strain BL21.
• the synthesis of the recombinant protein is obtained by adding dTPTG at a rate of 5 mM final for 3 h in 250 ml of culture of the strain in LB medium containing 100 ⁇ g / ml of ampicillin previously incubated at 37 ° C for 2 h. The centrifuged cultures are taken up in 25 ml of TENGN buffer.
• the lysate is sonicated and centrifuged again.
• the fusion protein is then purified using 4 ml of beads covalently fixing insoluble glutathione (Sigma) per 25 ml of supernatant. After 4 h of incubation, they are washed with 3 volumes of 1M NaCl and then with 10 volumes of PBS IX. The elution is obtained by bringing the beads into contact for 10 min with a glutathione solution (reduced glutathione 10 mM, Tris-HCl pH 8.0 50 mM).
• the amount of recombinant protein produced is estimated by migration into polyacrylamide gel and staining with Coomassie blue ( Figure 11).
• the specificity of the induction of a recombinant protein is tested by Western blot using an anti-goat GST antibody ( Figure 11), revealed with an anti-goat IgG antibody coupled to peroxidase using an ECL + plus kit (Amersham).
• the separation of the fusion protein into two proteins is obtained by proteolysis of 100 ⁇ g of recombinant protein previously dialyzed using 2U of preScission TM protease (Pharmacia Biotech) in 10 ⁇ l final containing buffer of enzyme IX, for 4 h at 5 ° C.
• EXAMPLE 9 DETECTION OF hOBPII, LCNl AND ApoD, WITHIN NASAL STRUCTURES BY RT-PCR, AND BY IMMUNOHISTOCHEMISTRY.
• RT-PCRs performed using primer sets for hOBPII and for LCN 1 reveal the presence of the corresponding mRNAs in at least one of the nasal structures.
• Immunohistochemical detection techniques both by fluorescence detection and by revelation using peroxidase and DAB, reveal the presence of the proteins hOBPII (FIG. 15) and LCNl (FIG. 16) in the epithelial cells of the acini of the nasal glands, as well than in the lumens of the secretory canals. It can also be detected on mucus stuck on tissue.
• RT-PCRs performed using primer sets for ApolipoproteinD reveal the presence of the corresponding mRNAs in at least one of the nasal structures.
• Revelation-based immunohistochemical detection techniques using peroxidase and DAB reveal the presence of the protein ApoD (Figure 17) in the epithelial cells of the nasal gland acini, as well as in the lumen of the secretory ducts, although the expression seems weaker and in less acini than for hOBPII.
• RT-PCR performed using primer sets for hOBPII and for LCN1 reveal the presence of the corresponding mRNAs in the placenta.
• the expression of the mRNAs detected by RT-PCR at the level of the placental villi indicates that these hOBPII proteins are produced by the placenta to transfer lipophilic molecules (hormones, fatty acids, vitamins, etc.) to the fetus through the circulation. fetal blood.
• the proteins detected in the amniotic membrane could correspond to the absorption of these proteins from the amniotic fluid, knowing that the nasal structures of the fetus are bathed by this amniotic fluid.
• the proteins hOBPII and LCNl would thus participate in the transport of small lipophilic substances from the mother to the fetus at the level of the chorionic villi via the fetal blood, and from the fetus to the mother via the amniotic fluid.
• RT-PCRs performed using primers for the ApoD protein reveal the presence of the corresponding mRNAs in the placenta.
• Immunohistochemical detection techniques by revelation using peroxidase and DAB reveal the presence of the ApoD protein very strongly in the vacancies of the placental villi ( Figure 21).
• the ApoD protein is not detected in the cells of the amniotic membrane and in the underlying cells, both for the amniotic membrane and for the cord.
• the expression of mRNAs detected by RT-PCR at the placental level indicates that the ApoD protein is produced by the placenta to transfer lipophilic molecules (hormones, fatty acids, vitamins ...) to the fetus through the fetal blood circulation .
• the ApoD protein can also be produced by the liver of the fetus.
• the ApoD protein would thus participate in the transport of small lipophilic substances from the mother to the fetus at the level of the chorionic villi via the fetal blood.
• lipocalins by the placenta, such as Alpha 1 -acid Glycoprotein (A1AG), prostaglandin D-synthase (PGDS), PP14 and RBP as revealed by RT-PCR techniques indicates that these proteins with the transporter properties of hydrophobic molecules are massively recruited for mother-child relationships, for the transport of these molecules as can be steroid hormones, fatty acids, vitamins or xenobiotics and more generally detoxification products from metabolism.
• A1AG Alpha 1 -acid Glycoprotein
• PGDS prostaglandin D-synthase

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Chemical & Material Sciences (AREA)
• Veterinary Medicine (AREA)
• Public Health (AREA)
• Animal Behavior & Ethology (AREA)
• Organic Chemistry (AREA)
• Medicinal Chemistry (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Engineering & Computer Science (AREA)
• General Chemical & Material Sciences (AREA)
• Pharmacology & Pharmacy (AREA)
• Chemical Kinetics & Catalysis (AREA)
• Diabetes (AREA)
• Hematology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Obesity (AREA)
• Molecular Biology (AREA)
• Biochemistry (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Epidemiology (AREA)
• Birds (AREA)
• Child & Adolescent Psychology (AREA)
• Polymers & Plastics (AREA)
• Toxicology (AREA)
• Zoology (AREA)
• Gastroenterology & Hepatology (AREA)
• Food Science & Technology (AREA)
• Biophysics (AREA)
• Genetics & Genomics (AREA)
• Nutrition Science (AREA)
• Mycology (AREA)
• Peptides Or Proteins (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Preparation Of Compounds By Using Micro-Organisms (AREA)
• Coloring Foods And Improving Nutritive Qualities (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Applications Claiming Priority (3)

Publications (1)

Family

ID=9549103

Family Applications (1)

Country Status (5)

Families Citing this family (8)

Family Cites Families (4)

• 1999
  • 1999-08-12 FR FR9910439A patent/FR2797447B1/fr not_active Expired - Fee Related
• 2000
  • 2000-08-11 CA CA002381712A patent/CA2381712A1/fr not_active Abandoned
  • 2000-08-11 WO PCT/FR2000/002319 patent/WO2001012806A2/fr not_active Application Discontinuation
  • 2000-08-11 EP EP00958685A patent/EP1206544A2/de not_active Withdrawn
  • 2000-08-11 AU AU70130/00A patent/AU7013000A/en not_active Abandoned

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events