EP1198578A2

EP1198578A2 - PLANT S-ADENOSYLMETHIONIN:Mg-PROTOPORPHYRIN-IX-O-METHYLTRANSFERASE, PLANTS WITH VARIABLE CHLOROPHYLL CONTENTS AND/OR HERBICIDE TOLERANCE, AND METHOD FOR THE PRODUCTION THEREOF

Info

Publication number: EP1198578A2
Application number: EP00958357A
Authority: EP
Inventors: Andreas Reindl; Ralf Reski; Jens Lerchl; Bernhard Grimm; Ali Al-Awadi
Original assignee: BASF SE
Current assignee: BASF SE
Priority date: 1999-08-03
Filing date: 2000-08-02
Publication date: 2002-04-24
Also published as: WO2001009355A2; WO2001009355A3; AU6990800A

Abstract

The invention relates to a nucleotide sequence coding for an S-adenosylmethionin:Mg-protoporphyrin-IX-O-methyltransferase and to a method for producing genetically modified plants with a capacity to control in various ways the chlorophyll biosynthesis mode and/or having a variable chlorophyll contents and/or having a variable herbicide tolerance. The invention relates to plants with a variable chlorophyll content and plants exhibiting a variable herbicide tolerance. It also relates to the use of plant PMT-nucleotide sequences for modifying the chlorophyll content of transgenic plants and for detecting effectors, especially inhibitors of plant PMT and herbicidally effective compounds.

Description

Vegetable S-adenosylmethionine: Mq-protoporphyrin-lX-O-methyltransferase, plants with an altered chlorophyll content and / or herbicide tolerance and process for their production

The invention relates to nucleotide sequences coding for plant S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferases, plants with an altered chlorophyll content, herbicide-tolerant plants and methods for producing such plants.

The S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase

(PMT; EC 2.1.1.11) is involved in the biosynthesis of chlorophyll and the heme group.

The pathways of chlorophyll and heme biosynthesis use some common enzymatic steps. Heme acts as a cofactor in hemoglobin in higher animals, in plants as a cofactor in cytochrome, P450 oxygenases, peroxidases and catalases (for an overview, see Voet and Voet, Biochemie, 1994, VCH; Suzuki et al., 1997, Annual Reviews in Genetics 31 : 61-89; Rüdiger 1997, Phytochemistry 46: 1151-1167) and is therefore an essential component in all aerobic organisms.

The last common step of the two biosynthetic pathways is the oxidation of protoporphyrinogen-IX to protoporphyrin-IX, which is catalyzed by the enzyme protoporphyrinogen-IX oxidase (for an overview, see Richter, Biochemie der Pflanzen, 1996, Georg Thieme Verlag). On the way to chlorophyll, protoporphyrin-IX receives a central Mg through the Mg chelatase, which produces Mg-protoporphyrin-IX. A targeted methylation of the propionic acid side chain by the S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase (EC 2.1.1.11) leads to Mg-protoporphyrin-13 ³ -monomethyl ester, which further in batches characterized steps to chlorophyll a and b is implemented.

The essential function of S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase in chlorophyll biosynthesis has been shown by investigations with inhibitors. Sinefungin, a structural analogue of S-adenosylmethionine (SAM), which is secreted by the bacterium Streptomyces, is able to inhibit the S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase, which has been enriched from barley chloroplasts (Vothknecht et al., 1995, Plant Physiology and Biochemistry 33, 759-763). The administration of increasing amounts of sinefungin led to an increasing inhibition of chlorophyll biosynthesis in the barley leaves.

The role of PMT as a key enzyme at the branching point of the tetrapyrrole pathway makes this enzyme a particularly valuable tool for molecular biotechnology. Molecular biological techniques, such as the transfer of DNA sequences that code for PMT, could be used to achieve changes in chlorophyll biosynthesis in plants. In this way it would be possible, for example, to produce transgenic plants with an increased or reduced chlorophyll content compared to wild type plants. By influencing gene expression, either by suppression or by overexpression, the vitality and / or the growth of plants can be greatly influenced. In addition, the PMT as a "target" represents a new starting point for the identification and / or development of a new generation of highly specific active herbicidal compounds. Further clarification of the chlorophyll biosynthetic pathway is of great interest, particularly with regard to increased efforts to use herbicides more specifically in agriculture and in the areas of plant breeding and plant protection. In particular, the characterization of the key enzyme S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase stands in

Foreground.

As is currently believed, PMT is a soluble enzyme in the stroma of plant plastids. Enzyme activities of PMT have already been described in plants, for example in maize (Radmer and Bogorad (1967), Plant Physiol. 42: 463-465), and in photosynthetic bacteria (Gorchein (1972), Biochem, J. 127: 97-106) Service. The Rhodobacter capsulatus bchM gene was identified as a gene sequence encoding a PMT (Bollivar et al. (1994), J. Bacteriol. 176: 5290-5296; Gibson and Hunter (1994) FEBS Letters 352: 127-130). This gene is located in a 46 kB gene cluster, which was initially fully sequenced and contains genes for numerous proteins of bacteriochiorophyll and carotenoid synthesis and the photosynthetic apparatus. The function of the bchM gene product could be demonstrated by interrupting the gene, since after losing the activity of the encoded protein the substrate of the PMT, Mg-protoporphyrin IX, accumulated.

Furthermore, by complementing a Rhodobacter bchM mutant, the cyanobacterial gene ChIM was found in a cosmid library from Synechocystis 6803 (Jensen et al, 1996, Plant Molecular Biology 30: 1307-1314). The cyanobacterial gene product ChIM has an amino acid identity to the corresponding Rhodobacter protein of 29%. However, due to the low sequence similarity, it was not possible to use the ChlM gene from cyanobacteria as a probe for plant cDNA for PMT.

Various EST sequences have meanwhile appeared in databases (AL035523, APO00559, AL035396, AWO38070, T05529, S71781), which show similarities with the two gene sequences mentioned above for the bacterial methyltransferases BchM and ChIM. Functional detection of the EST sequences, i.e. So far, however, that they code for PMT has not been provided. No genes coding for an S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase from plants have also been available to date.

An object of the present invention is thus to provide gene sequences from plants which code for an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase. Another object of the present invention is to provide transgenic plants or parts, tissues or cells thereof with an altered control of the chlorophyll biosynthetic pathway, an altered chlorophyll content and / or a tolerance to herbicides and their use in plant breeding.

This object is achieved in an advantageous manner by the present invention.

The present invention relates to a nucleotide sequence coding for a plant S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase or parts, derivatives, homologs or isoforms thereof. In a special embodiment of the present invention, a nucleotide sequence encoding a plant S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase is included, which has a sequence according to SEQ ID NO 1 and the plant protein encoded by it an amino acid sequence according to SEQ ID NO 5 contains. In particular, this nucleotide sequence codes for an amino acid sequence with the biological activity of an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase from tobacco (Nicotiana tabacum). Furthermore, the present invention also relates to nucleotide sequences coding for a plant S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase, which contain a sequence according to SEQ ID NO 2 or according to SEQ ID NO 3 or according to SEQ ID NO 4. The invention further encompasses nucleotide sequences which code for a protein which contains an amino acid sequence according to SEQ ID NO 6 or SEQ ID NO 7. In a preferred variant of the present invention, the nucleotide sequences coding for an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase or parts thereof come from Physcomitrella patens.

In addition to the aforementioned nucleotide sequences, the present invention also includes essentially equivalent, i.e. functionally equivalent nucleotide sequences (allele variations).

According to the invention, nucleotide sequences are also selected, selected from the group consisting of a) DNA sequences which comprise a nucleotide sequence which contains the sequence shown in SEQ ID NO. 5 encode specified amino acid sequence or fragments thereof, b) DNA sequences which comprise a nucleotide sequence which the in

SEQ ID NO. 6 or SEQ ID NO 7 encode the amino acid sequence indicated or fragments thereof, c) DNA sequences which contain the sequence shown in SEQ ID No. 1 or SEQ ID NO 4 contain nucleotide sequence or parts thereof, d) DNA sequences which the SEQ ID No. 2 or SEQ ID NO 3 contain the specified nucleotide sequence or parts thereof, e) DNA sequences which comprise a nucleotide sequence which hybridize with a complementary strand of the nucleotide sequence of a), b), c) or d) or parts of this nucleotide sequence, f) DNA sequences which are a nucleotide sequence which leads to a

Nucleotide sequence of a), b, c), d) or e) is degenerate, or comprise parts of this nucleotide sequence, g) DNA sequences which are a derivative, analog or fragment of a

Represent nucleotide sequence of a), b), c), d) e) or f).

The present invention also relates to nucleotide sequences which are homologous to one of the aforementioned nucleotide sequences, i. H. has a sequence identity of at least 40%, preferably at least 60%, particularly preferably more than 80% and in particular more than 90% and for a protein with the biological activity of an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase or Parts of it are encoded.

According to the invention, the nucleotide sequence coding for an S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase, its parts, derivatives or homologues can be natural, chemically synthesized, modified or artificially generated nucleotide sequences. Furthermore, the nucleotide sequence coding for S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase and its allele variations can be heterologous nucleotide sequences of various others Organisms and mixtures of these and the aforementioned nucleotide sequences contain.

According to the invention, both parts of coding nucleotide sequences, such as. B. partial cDNAs, as well as so-called full-length clones of a coding structural gene, possibly including regulatory elements. This includes, for example, so-called EST sequences (Expressed Sequence Tag). The length of an S-adenosy! Methionine: Mg-protoporphyrin-IX-O-methyltransferase according to the invention can be, for example, in the range from 325 ± 10 amino acid residues to 325 ± 250 amino acid residues, preferably from 325 ± 50 to 325 ± 100 and particularly preferably from 325 ± 25 to 325 ± 50 amino acid residues vary. According to the invention, the “base number” of 325 amino acid residues corresponds to a polypeptide sequence of an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase according to SEQ ID NO 5 encoded by a nucleotide sequence according to SEQ ID NO 1. Consequently, the “base number” of the polypeptide can be in Depending on the nucleotide sequence encoding they also vary. In the context of the present invention, a protein with the biological activity of an S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase means a protein which catalyzes the methylation of protoporphyrin IX. In the context of this invention, the term biologically active fragment means that the mediated biological activity is sufficient to influence the chlorophyll content.

Functions equivalent sequences which code for an S-adenosylmethionine: Mg-protoporphyrinogen-IX-O-methyltransferase are those sequences which, despite a different nucleotide sequence, still have the desired functions (allelic variations). Functional equivalents thus include naturally occurring variants of the sequences described here as well as artificial ones, for example by chemical or Genetic engineering obtained artificial nucleotide sequences adapted to the codon use of a plant. This can be, for example, DNA or RNA molecules, cDNA, genomic DNA, mRNA etc. In addition, functionally equivalent sequences include those which have an altered nucleotide sequence which gives the enzyme resistance to inhibitors.

A functional equivalent is also understood to mean, in particular, natural or artificial mutations of an originally isolated sequence coding for an S-adenosylmethionine: Mg-protoporphyrinogen-IX-0-methyltransferase, which furthermore show the desired function. Mutations include substitutions, additions, deletions, exchanges or insertions of one or more nucleotide residues. Thus, for example, the present invention also includes those nucleotide sequences which can be obtained by modifying the S-adenosylmethionine: Mg-protoporphyrinogen-IX-0-methyltransferase-

Receives nucleotide sequence. The aim of such a modification can e.g. further narrowing down the coding sequence contained therein or e.g. also be the insertion of further restriction enzyme interfaces. Functional equivalents are also those variants whose function is weakened or enhanced compared to the original gene or gene fragment.

In addition, artificial DNA sequences are suitable as long as they impart the desired properties, as described above. Such artificial DNA sequences can be determined, for example, by back-translation of proteins constructed using molecular modeling, which have S-adenosylmethionine: Mg protoporphyrinogen-IX-0-methyltransferase activity, or by in vitro selection. Coding DNA sequences which are obtained by back-translating a polypeptide sequence according to that for the host plant are particularly suitable specific codon usage. The specific codon usage can easily be determined by a person skilled in plant genetic methods by computer evaluations of other, known genes of the plant to be transformed.

A further variant of the present invention comprises a nucleotide sequence and its allele variations, which codes for a modified S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase or parts, derivatives, homologs or isoforms thereof, which tolerate compounds with herbicidal activity, such as Sinefungin. This includes variants that have an improved tolerance to herbicides or are completely insensitive to herbicides, i.e. Variants that are only slightly or not at all inhibited by herbicides. To produce such resistant forms, an in vitro or in vivo (bacterial) mutagenesis is carried out according to the invention, in which correspondingly resistant forms of the gene can be identified by methods known per se. With this technique, for any S-adenosylmethionine: Mg-Protoporphyrinogen-IX-0-

Methyltransferase-specific inhibitor-resistant forms of S-adenosylmethionine: Mg-protoporphyrinogen-lX-0-methyltransferase can be generated. The present invention thus also relates to a method for isolating a nucleotide sequence coding for a herbicide-tolerant S-adenosylmethionine: Mg-protoporphyrin-IX-0-

Methyltransferase, wherein a nucleotide sequence according to the invention of the type described above is used in an in vitro or in vivo mutagenesis, then possibly transferred to a single or multicellular host organism, then the organisms which are in the presence of a herbicide ( due to the mutation-modified nucleotide sequence coding for a herbicide-tolerant PMT) can be isolated and finally those in these organisms containing genetically modified nucleotide sequences coding for a herbicide-tolerant S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase can be isolated.

Furthermore, the S-adenosylmethionine: Mg-protoporphyrinogen-IX-O-methyltransferase gene according to the invention is characterized in that operatively linked regulatory nucleic acid sequences which control the expression of the coding sequence in a host cell are assigned to it.

An operative link is understood to mean the sequential arrangement of, for example, the promoter, coding sequence, terminator and, if appropriate, further regulatory elements in such a way that each of the regulatory elements can fulfill its function as intended in the expression of the coding sequence.

In principle, any promoter that can control the expression of foreign genes in plants is suitable as a promoter. For example, the DNA sequences according to the invention can be expressed in plant cells under the control of constitutive, but also inducible and / or tissue- or development-specific regulatory elements, in particular promoters. For example, while the use of an inducible promoter enables the specifically triggered expression of the DNA sequences according to the invention in plant cells, the use of tissue-specific, for example leaf and / or seed-specific, promoters offers the possibility of determining the chlorophyll content in certain tissue, for example in leaf or. Seed tissue, changing. Other suitable promoters, for example, mediate light-induced gene expression in transgenic plants. The promoter can be homologous or heterologous with respect to the plants to be transformed. Other suitable promoters include the 35S Cauliflower Mosaic Virus RNA promoter and maize ubiquitin promoter for constitutive expression. Suitable seed-specific promoters are, for example, the USP (Bäumlein et al. (1991), Mol. Gen. Genet. 225: 459-467) or the Hordein promoter (Brandt et al. (1985), Carlsberg Res. Commun. 50: 333-345). The promoters mentioned are also particularly suitable for the targeted reduction of the chlorophyll content in transgenic seeds using the DNA sequences according to the invention in connection with the antisense or cosuppression technique. In any case, the person skilled in the art can find suitable promoters in the literature or isolate them from any plants using routine methods.

Further sequences which are preferred but not restricted to the operative linkage are enhancers, transcription terminators, targeting sequences (transit signal sequences) to ensure subcellular localization in the apoplast, in the vacuole, in plastids, in mitochondria, in the endoplasmic reticulum (ER), in the cell nucleus, in Oil bodies or other compartments and translation enhancers such as the 5 'leader sequence from the tobacco mosaic virus (Gallie et al., Nuci. Acids Res. 15 (1987), 8693-871 1). Furthermore, there is a transcription or termination sequence which serves to correctly terminate the transcription and can also be used to add a polyA tail to the transcript, which is assigned a function in stabilizing the transcripts. Such elements are described in the literature (e.g. Gielen, 1989, EMBO J., 8: 23-29) and are interchangeable, e.g. the terminator of the octopine synthase gene from Agrobacterium tumefaciens.

The present invention furthermore relates to a gene structure comprising an S-adenosylmethionine: Mg protoporphyrinogen IX-0-methyltransferase gene according to one of the previously described Design variants and operatively linked regulatory nucleotide sequences of the aforementioned type. Chimeric gene constructs are also conceivable here, according to which mixtures of a nucleotide sequence according to the invention fused with homologous or heterologous regulatory structures are to be understood.

In a preferred embodiment, the gene structure comprises upstream, i.e. at the 5 'end of the coding sequence, a promoter and downstream, i.e. at the 3 'end, a polyadenylation signal and optionally further regulatory elements which are operatively linked to the sequence coding for the S-adenosylmethionine: Mg-protoporphyrinogen-IX-0-methyitransferase gene in between.

The present invention also includes a gene structure containing regulatory nucleotide sequences from the group of promoters, enhancers, operators, terminators, polyadenylation signals, targeting sequences, retention signals or translation enhancers. Numerous examples of this are described in the literature. These preferably include those regulatory sequences which are active in the host organisms and / or plants used.

In principle, any promoter that can control the expression of foreign genes in plants is suitable as promoters of the gene structure. In particular, a plant promoter or a plant virus-derived promoter is preferably used. The CAMV 35S promotor from the cauliflower mosaic virus (Franck et al., Cell 21 (1980), 285-294) is particularly preferred. As is known, this promoter contains different recognition sequences for transcriptional effectors which, in their entirety, become permanent and constitutive Expression of the introduced gene lead (Benfey et al., EMBO J, 8 (1989), 2195-2202).

The gene structure can also contain, for example, a chemically inducible promoter through which the expression of the exogenous S-adenosylmethionine: Mg-protoporphyrinogen-IX-0-methyltransferase gene in the plant can be controlled at a specific point in time. Such promoters such. B. the PRP1 promoter (Ward et al., Plant. Mol. Biol. 22 (1993), 361-366), a salicylic acid-inducible promoter (WO 95119443), a benzene-sulfonamide-inducible (EP-A 388186), a Tetracycline-inducible (Gatz et al., (1992) Plant J. 2, 397-404), an abscisic acid-inducible (EP-A 335528) or an ethanol- or cyclohexanone-inducible (WO 93/21334) promoter can among other things be used.

With the help of a seed-specific promoter, a foreign protein could be stably expressed up to a proportion of 0.67% of the total soluble seed protein in the seeds of transgenic tobacco plants (Fiedler and Conrad, BioΛTechnology 10 (1995), 1090-1094). The gene structure can therefore be, for example, a seed-specific promoter (preferably the phaseolin promoter (US 5504200), the USP- (Baumlein, H. et al., Mol. Gen. Genet. (1991) 225 (3), 459-467) or LEB4 promoter (Fiedler and Conrad, 1995), the LEB4 signal peptide, the gene to be expressed and an ER retention signal.

In a preferred embodiment variant of the present invention, a gene construct is included which contains a constitutive promoter as the regulatory nucleotide sequence. It is equally conceivable for a gene structure according to the invention to contain, as a regulatory nucleotide sequence, a leaf- and / or seed-specific and / or an inducible, preferably a light-inducible promoter. A gene structure is produced by fusing a suitable promoter with a suitable nucleotide sequence encoding an S-adenosylmethionine: Mg-protoporphyrinogen-IX-0-methyltransferase (structural gene) and preferably a DNA inserted between promoter and "structural gene", which codes for a chloroplast-specific transit peptide Common recombination and cloning techniques are described, for example, in T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratury, Cold Spring Harbor, NY (1989) and in TJ Silhavy, ML.Berman and LW Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and in Ausubel, FM et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley -Interscience (1987).

Particularly preferred are sequences which ensure targeting in the apoplasts, in plastids, in the vacuole, in the mitochondrion, in the endoplasmic reticulum (ER) or in the absence of corresponding operative sequences to ensure that they remain in the compartment of formation, the cytosol (Kermode , Crit, Rev. Plant Sei. 15, 4 (1996), 285-423). Localization in the ER has proven to be particularly beneficial for the amount of protein accumulation in transgenic plants (Schouten et al., Plant Mol. Biol. 30 (1996), 781-792).

The present invention also relates to a gene structure in which the nucleotide sequence coding for a PMT according to the invention of the type described above is not contained in a sense orientation, as in most cases, but in an antisense orientation. Gene structures can also be used whose DNA sequence codes for an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase fusion protein. According to the invention, part of the fusion protein can be a transit peptide which controls the translocation of the polypeptide. Preferred transit peptides are preferred for the chloroplasts, which are cleaved enzymatically after translocation of the S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyitransferase gene into the chloroplasts from the S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase part. The transit peptide which is derived from the plastid S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase or a functional equivalent of this transit peptide (for example the transit peptide of the small subunit of the Rubisco or the ferredoxin NADP oxidoreductase) is particularly preferred.

DNA sequences of three cassettes of the plastid transit peptide of the plastid S-adenosyimethionine: Mg-protoporphyrin-IX-O-methyltransferase from potato in three reading frames as Kpnl / BamHI fragments with an ATG codon in the Ncol interface (FIG . 1).

Furthermore, the S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase fusion proteins according to the invention also contain sequences which are particularly suitable for the improved purification of the S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase, for example via affinity chromatography, and which can then be split off again. A so-called “His tag” or sequences against epitopes of antibodies can be mentioned here as examples. According to the invention, the nucleotide sequence encoding an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase encoding can be synthetically produced or naturally obtained, as well as different from different heterologous S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase gene segments Organisms exist or contain mixtures of synthetic and natural DNA components.

In general, synthetic nucleotide sequences with codons are generated which are preferred by plants. These codons preferred by plants can be determined from codons with the highest protein frequency, which are expressed in most interesting plant species. When producing a gene structure, various DNA fragments can be changed in such a way that a nucleotide sequence is obtained which is expediently read in the correct direction and equipped with a correct reading frame.

To connect the DNA fragments to one another, adapters or linkers can be attached to the fragments. The promoter and terminator regions can preferably be provided in the transcription direction with a linker or polylinker which contains one or more restriction sites for the insertion of this sequence. As a rule, the linker has 1 to 10, preferably 1 to 8, particularly preferably 2 to 6, restriction sites. In general, the linker has a size of less than 100 bp, often less than 60 bp, but at least 5 bp within the regulatory ranges. The promoter can be native or homologous as well as foreign or heterologous to the host plant.

An embodiment variant of the gene structure according to the invention contains the promoter in the 5'-3 direction of transcription, a DNA sequence which is for an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase gene encodes and a region for transcriptional termination. Different termination areas are interchangeable.

Preferred polyadonylation signals are vegetable

Polyadenylation signals, preferably those which essentially correspond to T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of T-DNA (octopine synthase) of the Ti plasmid pTiACHδ (Gielen et al., EMBO J. 3 (1984), 835 ff) or functional equivalents.

Furthermore, changes can be made which provide suitable restriction sites or remove the superfluous DNA or restriction sites in cases where insertions, deletions or substitutions such as e.g. Transitions and transversions can be used in vitro mutagenesis, "primer repair", restriction or ligation. Through changes such as Restriction, "chewing-back" or filling of overhangs for "bluntends", complementary ends of the fragments can be made available for the ligation.

According to the invention, the specific ER retention signal SEKDEL (Schouten, A. et al., Plant Mol. Biol. 30 (1996), 781-792) can also be contained in the gene construct. This triples or quadruples the average level of expression. Other retention signals, which occur naturally in plant and animal proteins located in the ER, can also be used for the structure of the gene structure.

In a further embodiment variant of the invention

The gene construct can be, for example, a constitutive promoter (preferably the CAMV 35 S promoter), the LeB4 signal peptide, which is to be expressed Gen and the ER retention signal may be included. The amino acid sequence KDEL (lysine, aspartic acid, glutamic acid, leucine) is particularly preferred here as the ER retention signal.

In addition, the present invention relates to a vector containing, as described above, a nucleotide sequence encoding an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase, to regulatory nucleotide sequences operatively linked thereto, and to additional regulation signals, for example nucleotide sequences for replication in a corresponding one Host cell and / or for integration into the host cell genome. Furthermore, the vector according to the invention can contain a gene structure of the aforementioned type.

Using the recombination and cloning techniques cited above, the gene structures can be cloned into suitable vectors that propagate in host cells such as

Bacteria, viruses, cyanobacteria, yeasts, filamentous fungi, algae,

Enable plants, plant tissues or cells. The present

The invention thus also relates to vectors, in particular plasmids, cosmids, viruses, bacteriophages and other vectors which are common in genetic engineering and which comprise the above-described inventive

Contain nucleic acid molecules and if necessary for the transfer of the nucleic acid molecules according to the invention to plants or

Plant cells can be used. Suitable vectors are inter alia in "Methods in Plant Molecular

Biology and Biotechnology "(CRC Press), Chap. 6/7, pp. 71-119 (1993).

For E. coli as the host cell, pBR332, pUC series, M13mp series and pACYCI 84 are preferred as cloning vectors. Especially binary vectors are preferred which can replicate both in E. coli and, for example, in agrobacteria. The pBIN19 may be mentioned as an example (Bevan et al., Nucl. Acids Res. 12 (1984), 871 1). As an example, the gene structure according to the invention can also be incorporated into the tobacco transformation vector pBIN-AR-TP (FIG. 2).

The present invention furthermore comprises a probe for specific hybridization with a DNA sequence or a mRNA derived therefrom coding for an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase or parts thereof, wherein this probe is a coherent sequence of the invention for a contains plant-based PMT coding nucleotide sequence which is at least 10 nucleotides long. This also includes short nucleotide sequences with a length of, for example, 10 to 30, preferably 12 to 15 nucleotides. This includes u. a. also so-called primers. The probe according to the invention is further characterized in that it contains a label suitable for detection, for example a digoxygenin system (Boehringer Mannheim).

The invention also relates to a kit for identifying further eukaryotic nucleotide sequences coding for an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase, this kit containing at least one previously described probe and instructions for hybridizing and detecting nucleotide sequences, such as the one described are known from the literature (Boehringer Mannheim or T. Maniatis, EF Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratury, Cold Spring Harbor, NY (1989)). This kit is used according to the invention for the isolation of S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase from eukaryotes. The invention also relates to a method for isolating a DNA sequence which codes for a plant S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase, which is characterized in that a cDNA library is created starting from a plant source , this library is used for hybridization with a probe of the type described and the positive cDNA clones are detected and isolated.

Furthermore, the present invention relates to an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase or parts, derivatives, homologs or isoforms thereof, which is encoded by one of the previously described embodiment variants of the nucleotide sequences according to the invention or their allelic variations. Isoforms are to be understood as enzymes with the same or comparable substrate and activity specificity, but which have a different primary structure.

In one embodiment variant according to the invention, an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase or parts thereof is included, containing an amino acid sequence according to SEQ ID NO 5 or parts or derivatives or isoforms thereof or mixtures thereof. This is preferably a plant PMT, particularly preferably from tobacco (Nicotiana tabacum).

Furthermore, the present invention also relates to an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase or parts thereof containing an amino acid sequence according to SEQ ID NO 6 or SEQ ID NO 7 or parts or derivatives or isoforms thereof or mixtures thereof. This protein or parts thereof preferably originate from Physcomitrella patens. The present invention further relates to a further variation of an S-adenosylmethionine: Mg-protoporphyrin-IX-0- Methyltransferase, which has a tolerance to compounds with herbicidal activity.

The present invention further relates to antibodies with the ability to bind specifically to one of the aforementioned S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase.

Antibodies are produced according to the invention by injecting a protein or part of a protein coded by an S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase gene according to the invention into animals or animal cells, producing antibodies by immune reaction and the produced antibodies are isolated from the animals or animal cell cultures. According to the invention, these antibodies are used for the specific detection and for the improved purification of S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferases from eukaryotes.

The present invention furthermore relates to the transfer of a previously described nucleotide sequence according to the invention and its allelic variations coding for an S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase from plants, for example in the form of the gene construct or vector according to the invention, into suitable host systems. In a process for the production of genetically modified single or multicellular organisms, a nucleotide sequence coding for an S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyl transferase from plants is transferred to a suitable host system by genetic engineering methods.

Based on the origin of the nucleotide sequence according to the invention

Plants can be homologous organisms to this host system.

According to the invention, however, heterologous host systems are also conceivable. In principle, it can be microorganisms, such as. B. bacteria, viruses, Act fungi, cyanobacteria, algae or plants, plant tissues or cells. In some embodiment variants of the present invention, the microorganisms, viruses or fungi are, so to speak, an "intermediate station" before the actual transfer of the nucleotide sequences according to the invention into plant systems. Enterobacteria, Baciilen or preferably Agrobacterium tumefaciens are conceivable as microorganisms, as well as established ones in the field of genetic engineering The invention also relates to host cells which, in addition to the nucleic acid molecules according to the invention, contain one or more nucleic acid molecules which are transmitted by genetic engineering or natural means and which carry the genetic information for enzymes involved in chlorophyll biosynthesis.

Modified DNA or foreign genes are transferred to a host cell using genetic engineering methods. A wide range of transformation methods has been established here. Suitable methods for the transformation and regeneration of plants from plant tissues or plant cells for transient or stable transformation are the protoplast transformation by polyethylene glycol-induced DNA uptake, biolistic methods with the gene gun - the so-called particle bombardment method, the electroporation, the incubation of dry embryos in DNA containing solution, microinjection and Agrobacterium-mediated gene transfer using Agrobacterium tumefaciens or Agrobacterium rhizogenes as transformation agents. The methods mentioned are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by SD Kung and R. Wu, Academic Press (1993), 128143 and in Potrykus , Annu. Rev. Plant Physiol. Plant Molec. Biol. 42 (1991), 205225). When injecting and electroporation of DNA into plant cells, there are no special requirements per se for the plasmids used. The same applies to direct gene transfer. Simple plasmids, such as pUC derivatives, can be used. However, if whole plants are to be regenerated from such transformed cells, the presence of a selectable marker gene is recommended. The usual selection markers are known to the person skilled in the art and it is not a problem for him to select a suitable marker. Depending on the method of introducing desired genes into the plant cell, additional DNA sequences may be required. If, for example, the Ti or Ri plasmid is used for the transformation of the plant cell, at least the right boundary, but often the right and left boundary of the T-DNA contained in the Ti or Ri plasmid, must be connected as a flank region to the genes to be introduced. If agrobacteria are used for the transformation, the DNA to be introduced must be cloned into special plasmids, either in an intermediate or in a binary vector. The intermediate vectors can be integrated by homologous recombination into the Ti or Ri-Plindind of the agrobacteria due to sequences that are homologous to sequences in the T-DNA. This also contains the vir region necessary for the transfer of the T-DNA. Intermediate vectors cannot replicate in agrobacteria. Using a helper plasmid, the intermediate vector can be transferred to Agrobacterium tumefaciens (conjugation). Binary vectors can replicate in E. coli as well as in Agrobacteria. They contain a selection marker gene and a linker or polylinker, which are framed by the right and left T-DNA border region. They can be transformed directly into the agrobacteria. The agrobacterium serving as the host cell is said to contain a plasmid which carries a vir region. The vir region is necessary for the transfer of the T-DNA into the plant cell. Additional T-DNA may be present. The Agrobacterium transformed in this way is used to transform plant cells. The use of T-DNA for the transformation of plant cells has been intensively investigated and has been sufficiently described in well-known overview articles and manuals for plant transformation.

The invention thus relates to a genetically modified single-cell or multicellular host organism and its progeny, comprising, in replicable form, a nucleotide sequence according to the invention and / or a gene structure and / or a vector of the type described above. or multicellular host organism around a microorganism, preferably a bacterium, or a virus or a fungus or a plant or plant cell or plant tissue.

By providing the nucleic acid molecules according to the invention, it is now possible to use genetic engineering methods to modify plant cells to the extent that they have a new or changed PMT activity compared to genetically unmodified cells, in particular wild-type cells, and as a result thereof there is a change in Chlorophyll biosynthetic performance and / or tolerance to herbicides comes.

The invention thus relates to a process for the production of plants or parts, tissues or cells thereof with changed control of chlorophyll biosynthesis, comprising the steps of producing a gene construct and / or a vector of the type described above and transferring the gene construct and / or the vector on plant cells. The procedure for producing plants or parts, tissues or cells thereof with an altered chlorophyll content is analogous, as is the case for a process for Production of herbicide-tolerant plants, parts, tissues or cells thereof. According to the invention, one or more nucleotide sequences according to the invention can be transferred in replicating form into the plant cells. In a further step, these methods include the regeneration of transgenic plants from the plant cells. The transfer of the nucleotide sequences, gene constructs and / or vectors according to the invention to plant cells includes not only the transfer to isolated cells present in cell culture, but also the transfer to living whole plants, ie to plant cells that are not in cell culture but in intact tissue.

The regeneration of the transgenic plants from transgenic plant cells is carried out according to customary regeneration methods using conventional nutrient media and phytohormones. The plants thus obtained can then, if desired, by conventional methods, including molecular biological methods, such as PCR, blot analysis, or biochemical methods for the presence of the introduced DNA, which encodes a protein with the enzymatic activity of a PMT, or for the presence of PMT enzyme activity will be examined. Regardless of the regulatory sequences used, under the control of which the expression of the PMT-DNA sequences is under control, a broad spectrum of molecular biology and / or biochemical methods is available to the person skilled in the art for the analysis of the transformed plant cells, transgenic plants, plant parts, crop products and propagation material , eg PCR, Northern blot analysis for the detection of PMT-specific RNA or for determining the level of accumulation of PMT-specific RNA, Southern blot analysis for the identification of PMT-coding DNA sequences or Western blot analysis for the detection of the the nucleotide sequences according to the invention encoded PMTs. Of course, the Detection of the enzymatic activity of PMT can also be determined by a person skilled in the art using protocols available in the literature. Furthermore, one can, for example, lay out the seeds obtained by selfing or crossings on medium which contains a suitable selection agent which matches the selection marker which is transferred together with the PMT-DNA sequence. Based on the germination capacity and the growth of the daughter generation (s) of the seeds and the segregation pattern, conclusions can be drawn about the genotype of the respective plant.

For the transfer of the DNA into the plant cell, plant explants can expediently be cultivated with Agrobacterium tumefaciens or Agrobacterium rhizogenes. Whole plants can then be regenerated from the infected plant material (e.g. leaf pieces, stem segments, roots, but also protoplasts or suspension-cultivated plant cells) in a suitable medium, which may contain antibiotics or biocides for the selection of transformed cells. The transformation of plants by agrobacteria is known, among other things, from F.F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol, 1, Engineering and Utilization, edited by S. D. Kung and R. Wu, Academic Press, 1993, pp. 15-38.

Once the introduced DNA is integrated in the genome of the plant cell, it is generally stable there and is also retained in the progeny of the originally transformed cell. It normally contains a selection marker which gives the transformed plant cells resistance to a blocide or an antibiotic such as kanamycin, G 418, bleomycin, hygromycin, methotrexate, glyphosate, streptomycin, sulfonylurea, gentamycin or phosphinotricin and others. The individually selected markers should therefore allow the selection of transformed cells over cells that lack the inserted DNA. Alternative markers are also suitable for this, such as nutritive markers and screening markers (such as GFP, green fluorescent protein). Of course, selection markers can also be completely dispensed with, but this is associated with a fairly high need for screening. If the selection marker used is to be removed again after the transformation and identification of successfully transformed cells or plants, various strategies are available to the person skilled in the art. For example, sequence-specific recombinases can be used, for example in the form of retransformation of a starting line expressing recombinase and outcrossing of the recombinase after removal of the selection marker (Reiss et al (1996) Proc. Natl. Acad. Sci. USA 93: 3094-3098; Bayley et al (1992) Plant Mol. Biol. 18: 353-361; Lloyd et al. (1994) Mol. Gen. Genet. 242: 653-657; Maser et al. (1991) Mol. Gen. Genet. 230: 170-176; Onouchi er al. (1991) Nucl. Acids Res. 19: 6373-6378). The selection marker can also be removed by cotransformation followed by outcrossing.

A particularly preferred embodiment of the present invention is a genetically modified plant or parts, tissue or cells thereof and their progeny containing, in replicable form, a nucleotide sequence according to the invention and / or a gene construct and / or a vector of the type described above.

The invention further relates to transgenic plant cells or plants comprising transgenic plant cells or parts and products thereof in which the nucleic acid molecules according to the invention are present as integrated in the plant genome. The invention also relates to plants in whose cells the nucleic acid sequence according to the invention is present in self-replicating form, ie the Plant cell contains the foreign DNA on an independent nucleic acid molecule, e.g. B. a plasmid. This is known as transient expression.

According to the invention, the genetically modified plant or its parts, tissues or cells and their progeny are characterized in that, due to the presence and expression of the nucleotide sequences according to the invention, they synthesize proteins which the corresponding non-genetically modified plant, e.g. B. the wild type, not produced. Furthermore, the invention encompasses a genetically modified plant or parts, tissues or cells thereof and their progeny which has a net productivity of S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase which is greater than that of the correspondingly non-genetically modified plant, in particular one Wild type, is elevated. According to the invention, this is preferably a genetically modified plant or parts, tissue or cells thereof and their progeny which has a modified chlorophyll content which is increased or decreased compared to that of the correspondingly non-genetically modified plant. The present invention also relates to a genetically modified plant or parts, tissue or cells thereof and their progeny which has an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase which has a tolerance to compounds having a herbicidal action.

The present invention thus also relates to a herbicide-tolerant plant, plant tissue, plant cell and its progeny, containing in replicating form a previously described S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase gene, a gene structure or a vector containing one Gene structure of the previous The type mentioned is also the subject of the invention of herbicide-tolerant plants, plant tissues, plant cells and their progeny which have a net productivity of S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase, which is increased compared to the correspondingly non-genetically modified form , The invention further relates to a transgenic plant and its progeny which expresses an S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase gene which is resistant to S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase inhibitors.

A particularly preferred embodiment variant relates to a genetically modified plant or parts thereof, plant tissue, cells and their progeny, which has an altered control of chlorophyll biosynthesis and / or an altered chlorophyll content and / or a herbicide tolerance in relation to a corresponding non-genetically modified plant.

However, the invention also relates to those plants in which the transfer of the nucleotide sequences according to the invention leads to a reduction in the chlorophyll content. Such reduced chlorophyll biosynthesis performance can be achieved, for example, by the transfer of antisense constructs or by others

Suppression mechanisms, such as cosuppression, can be achieved. Compared to the genetically unmodified control plants, these plants are characterized by reduced growth, a bleached phenotype, reduced RNA and protein contents for PMT and a greatly reduced chlorophyll content. The use of such transgenic plants in the elucidation of key enzymes and key metabolites of the chlorophyll biosynthetic pathway or for the identification or (new) synthesis of herbicides or compounds with an inhibitory effect on these central closing enzymes of the chlorophyll biosynthetic pathway is also included according to the invention.

In principle, any plant can be used for a transfer of the genetic material according to the invention. These can be monocot or dicot crops. Non-limiting examples of monocotyledonous plants are plants belonging to the genera Avena (oats), Triticum (wheat), Seeale (rye), Hordeum (barley), Oryza (rice), Panicum, Pennisetum, Setaria, Sorghum (millet), Zea (Corn) belong. Among the dicotyledonous crops are to name legumes, such as legumes and in particular alfalfa, soybean, rapeseed, tomato, sugar beet, canola, potatoes, ornamental plants or trees. Other useful plants can be, for example, fruit (in particular apples, pears, cherries, grapes, citrus, pineapple and bananas), oil palms, tea, cocoa and coffee bushes, tobacco, sisal, cotton, flax, sunflower and medicinal plants and pasture grasses and forage plants. The cereals wheat, rye, oats, barley, rice, corn and millet, feed grain, sugar beet, rapeseed, soybean, tomato, potato, sweet grasses, feed grasses and clover are particularly preferred. It is self-evident that the invention relates in particular to conventional food or fodder plants. In addition to the plants already mentioned, peanut, lentil, broad bean, black beet, buckwheat, carrot, sunflower, Jerusalem artichoke, turnip, white mustard, turnip and stubble are worth mentioning.

The invention also relates to seeds of the genetically modified plants according to the invention. The invention also relates to reproductive material from a single or multicellular host organism or from transgenic plants, plant tissues or cells of the type described above. In this case, reproductive material or crop products are those according to the invention to understand genetically modified plants, for example seeds, fruits, cuttings, tubers, rhizomes, etc., and parts of these plants, such as protoplasts, plant cells and calli.

The present invention also includes a method for identifying cells from a cell population that contain a herbicide-tolerant S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase. This method comprises the following steps: mutagenesis of the cell population, by chemical or genetic engineering treatment of the cells, cultivation of the population of cells in the presence of at least one compound with herbicidal activity which inhibits the activity of S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase inhibits selection of cells whose growth is unchanged, ie is not inhibited. This can be followed by process steps such as regeneration of genetically modified plants from the herbicide-tolerant cells and isolation, identification and / or characterization of a herbicide-tolerant S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase from the selected ones Cells or, if necessary, isolation, identification and / or characterization of a nucleotide sequence coding for a herbicide-tolerant S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase from the selected cells.

The present invention also relates to a method and a measuring system for identifying compounds having a herbicidal action. This measuring system contains at least one S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase as well

Compounds that potentially interact with this protein and change its activity. These can be in-vitro measuring systems in which, in a reaction mixture, inter alia, isolated protein with the activity of a PMT according to the invention and the Suitable substrates and potentially herbicidal compounds are included. If necessary, the S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase encoded by a corresponding nucleotide sequence is purified in preceding steps, then this S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase with compounds which, for example, are catalytic or the regulatory center of the enzyme, incubated and then the specific activity of S-adenosylmethionine: Mg-protoporphyrin-IX-0-

Methyltransferase measured. Or it is an in vivo measuring system, such as an organism transformed with a nucleotide sequence coding for an S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase, to which potentially herbicidal compounds are added. Due to the measurement of differences in specific enzyme activity, i.e. a reduction in the specific PMT activity, the effect of the added compounds can be identified as a herbicide or inhibitor of PMT. The compounds identified with the aid of the measuring system described above with an inhibitory and / or herbicidal action on the specific activity of the S-adenosylmethioπin: Mg-protoporphyrin-IX-0-methyltransferase from plants are likewise the subject of the present invention.

They can in turn be precursors for the synthesis of further compounds which are used in plant breeding or crop protection.

The present invention further relates to the use of a nucleotide sequence according to the invention of the type described and / or a probe created or isolated on the basis of the nucleotide sequence according to the invention for isolating and / or amplifying a nucleotide sequence, preferably from eukaryotes which are suitable for an S- Adenosyimethionine: Mg-protoporphyrin-IX-0-methyltransferase or parts thereof.

Furthermore, the present invention comprises the use of a nucleotide sequence according to the invention for the production of plants or parts, tissues or cells thereof with an altered control of the chlorophyll biosynthesis and / or an altered chlorophyll content and / or an altered herbicide tolerance.

Also included is the use of the genetically modified single or multicellular host organisms and / or the genetically modified plants, their parts, tissues or cells to provide isolated and optionally purified and concentrated S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferases or

Herbicide-tolerant forms of this enzyme. Compared to chemical syntheses, the use of these enzymes for the biological (in vitro) production of chlorophyll or its derivatives as an economically interesting plant vitamin is conceivable.

The invention also relates to the use of a concentrated S-adenosylmethionine: Mg-

Protoporphyrin-IX-O-methyltransferase encoded by a

Nucleotide sequence of the type described above and / or genetically modified organisms with new or modified PMT activity for

Identification of herbicides and / or compounds with an inhibitory effect on chlorophyll biosynthesis. Thanks to the key division of the

PMT within chlorophyll biosynthesis represent the invention

DNA sequences and the proteins encoded by them represent an extremely valuable “target” for herbicide research. For example, the proteins according to the invention with enzymatic PMT activity can be used for X-ray structure analysis, NMR spectroscopy, molecular modeiing and drug design are used to identify or synthesize inhibitors and / or effectors of PMT and thus potential herbicides based on the knowledge gained from these methods.

The present invention also provides for the use of the plants described above and genetically modified according to the invention in the areas of plant breeding, plant protection and agriculture.

The present invention is explained in more detail below with reference to the examples, which, however, are in no way limiting the invention:

1. General cloning procedures

Cloning methods such as Restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking of DNA fragments, transformation of E. coli cells, cultivation of bacteria, multiplication of phages and sequence analysis of recombinant DNA were as with Sambrook et al. (1989) (Cold Spring Harbor Laboratory Press, ISBN 0-87969-309-6). The transformation of Agrobacterium tumefaciens was carried out according to the method of Höfgen and Wiilmitzer (Nucl. Acid Res. (1988) 16, 9877). The agrobacteria were grown in YEB medium (Vervliet et al., J. Gen. Virol. (1 975) 26, 33),

The bacterial strains used (E. coli, XL-1 Blue) were from

Stratagene (Heidelberg, Germany) or Qiagen (Hilden, Germany). The one used for plant transformation Agrobacterium strain (Agrobacterium tumefaciens, C5SC1 with the plasmid pGV2260 or pGV3B50kan) was developed by Deblaere et al. in nucl. Acids Res. 13 (1985), 4777. Alternatively, the LBA4404 agrobacterial strain (Clontech) or other suitable strains can be used. For cloning, the vectors pUC19 (Yanish-Perron, Gene 33 (1985), 103-119) pBluescript SK (Stratagene, Heidelberg), PGEM-T (Promega), pZerO (Invitrogen), pBIN19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711-8720) and pBINAR (Höfgen and Willmitzer, Plant Science 66 (1990), 221-230).

2. Generation of the Physcomitrella patens cDNA library

To produce this Physcomitrella cDNA library, total RNA from 9-day-old Protonema was prepared according to one of Logemann et al. (Anal. Biochem. (1987) 163,21). The poly (A) RNA was then purified via oligo (dT) cellulose type 7 (Pharmacia, Freiburg) according to the manufacturer's instructions. After the photometric concentration had been determined, 5 μg of the RNA thus obtained were used for the cDNA synthesis. All chemicals and enzymes required for the production of the cDNA were obtained from Stratagene (La Jolla CA 9203-7, USA). The methods used were carried out according to the manufacturer's instructions. The synthesis of the first and second strand of the cDNA was carried out using the Lambda ZAPII-CDNA synthesis kit.

The double-stranded cDNAs obtained were then provided with EcoRI adapters and cloned into an EcoRI-cleaved lambda ZAPII vector. After in vitro packaging (Gigapack II packaging extract) of the recombinant lambda DNA, XL-1 E. coli cells (Stratagene, Heidelberg) were transformed. The titer of the cDNA library was determined by counting the plaques formed. In an analogous manner, so-called EST sequences are produced (Expressed Sequence Tags) procedure. According to known methods, such as. B. by homology comparisons with sequences stored in databases, potential candidates of EST sequences which code for a (partial) PMT can be narrowed down and / or identified from a cDNA bank.

A partial DNA sequence of the S-adenosylmethionine: Mg-Protoporphyτin-IX-O-methyltransferase gene from Physcomitrella patens is shown in SEQ ID NO 2 or 3 or 4, the sequence according to SEQ ID NO 2 being the 5 'end of the gene coding for S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase and SEQ ID NO 3 represents the 3 'end of this gene from Physcomitrella patens. Both fragments are separated from each other by only about 4 amino acid residues. The fragments according to the invention according to SEQ ID NO 2, 3 and 4 can thus be combined in a simple manner by the person skilled in the art into a gene of entire length. Likewise, with each of the three EST clones according to SEQ ID NO 2, 3 or 4, a nucleotide sequence can be isolated as a full-length clone of eukaryotic PMT genes, as described above. The partial amino acid sequence of S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase corresponding to SEQ ID NO 2 or SEQ ID NO 3 is shown in SEQ ID NO 6 or SEQ ID NO 7.

3. Screening of a cDNA library using homologous DNA probe 2x10 ⁵ recombinant lambda phages (Lambda ZAPII) from the Physcomitrella patens cDNA library were plated on agar plates. The phage DNA was transferred to nylon membranes (Hybond N, Amersham Buchler) using standard methods (Sambrook et al. (1989); Cold Spring Harbor Laboratory Press: ISBN 0-87969-309-6) and incubated for 2 hours Fixed at 80 ° C on the filters. A 555 bp S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase-cDNA- was used as hybridization probe. Fragment (SEQ ID NO 2), which was radioactively labeled using a "Multiprime DNA labeling System" (Amersham Buchler) in the presence of α- ³² P-dCTP (specific activity 3000 Ci / mmol) according to the manufacturer's instructions. The membrane was hybridized after prehybridization at 42 ° C. in PEG buffer (Amasino (1986) Anal. Biochem. 152, 304-307) for 12-16 hours. The filters were then washed 3 × 20 minutes in 2 × SSC, 0.1% SDS at 42 ° C. Positive hybridizing phages were visualized by autoradiography and purified by standard techniques.

4. Cloning of the Physcomitrella patens S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase gene in expression vectors of heterologous expression systems and detection of the enzymatic activity. From the Physcomitrella patens cDNA library, a clone coding for a full length S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase sequence was identified using the partial DNA sequence of the S-adenosylmethionine: Mg-protoporphyrin-IX- 0-Methyltransferase identified in SEQ ID NO 2. Expression vectors are suitable for the expression of recombinant proteins in E. coli, but also baculovirus vectors for the expression of S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase in

Insect cells (Gibco BRL). Bacterial expression vectors are derived, for example, from pBR322 and carry a bacteriophage T7 promoter for expression. For expression, the plasmid is propagated in an E. coli strain which carries an inducible gene for the T7 polymerase (for example JM109 (DE3); Promega). The expression of the recombinant protein is activated via the induction of the T7 polymerase by IPTG. If the recombinant protein is to be provided with a His tag for improved purification by means of Ni affinity chromatography, IPTG-inducible systems from Qiagen are available (pQE vectors) or Novagen (pET vectors). Depending on the interfaces available, there are all vectors with all reading frames. The one with the S-adenosylmethionine: Mg-protoporphyrin-IX-0-

Vectors containing methyltransferase-transformed E. coli strain was incubated in the culture medium "2xYT" (per 1 liter: bacto-trypton 16 g, yeast extract 10 g, NaCl 1 5 g). The cultivation took place at 37 ° C up to an OD ₅ eo of 0.6. After the addition of IPTG (1 mM), the growth continued for a further 10 min at 37 ° C., then for a further 4 h at 28 ° C. until the harvest. The cells were centrifuged off and washed in 1% NaCl. After opening the cells (50 to 500 ml cell culture (OD ₅₆ o of 1.0)) using a French press, either a crude protein extract was used for enzyme tests (in 4 ml extraction buffer (Tris / HCl (pH 7.5) 100 mM, MgCI ₂ 5 mM, DTT 2 mM, PMSF 0.1 mM)) or an affinity chromatography (according to the manufacturer's instructions Qiagen, Novagen) on Ni-NTA. The eluate was then used in enzyme tests.

5. Cloning of Physcomitrella patens S-adenosylmethionine: Mg-

Protoporphyrin-IX-O-methyltransferase [n den

Plant transformation vector pBIN19AR-TP pBIN19AR-TP contains a plastid targeting sequence (TP; see FIG. 2) integrated in the polylinker of the vector, which was inserted via the interfaces Kpnl (as Asp718 isoschizomer) and BamHI (Höfgen and Willmitzer, Plant Science 66 (1990 ), 221-230).

6. Preparation of S-adenosylmethionine: Mg-protoporphyrin-IX-Q-methyltransferase antisense constructs

The 555 base pair fragment coding for the Physcomitrella-S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase according to SEQ ID NO 2 was converted into a binary vector (PBIN-AR-TP; see FIG. 2B) in antisense orientation cloned under control of the 35S promoter. The following primers were chosen for cloning the S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase into a binary vector in an antisense orientation.

PpS adenosylmethionine: Mg protoporphyrin IX-0-methyltransferase ASpBINI forward 5 'TATGTCGACTATCGAATTCGGCACGAGCT

3 '

PpS adenosylmethionine: Mg protoporphyrin IX-0-methyltransferase ASpBIN2 backwards 5 'TATGGATCCAGCTTTGGAAACGGGAACGCA 3'

The primers PpS-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase-ASpBINI forward and PpS-adenosylmethionine: Mg-protoporphyrin! X-0-methyltransferase-ASpBIN2 backward contained a Sall and a BamHI interface (each underlined). The PCR product was purified using the Gene Clean Kit (Dianova GmbH, Hilden) and digested with Sall and BamHI. For the ligation, the vector pBIN19AR-TP09 was also cut with Sall and BamHI, which additionally contains the transit peptide of the transketolase from potato behind the CAMV 35S promoter. In this case, the heterologous signal sequence (from potato) serves as an additionally detectable sequence in transgenic tobacco plants (via Northern blot or via PCR), beyond the detection of S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase antisense RNA. The construct is shown in Fig. 2B.

This construct was transformed into tobacco by Agrobacterium-mediated transformation. Regenerated plants were examined for S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase mRNA amounts. All examined antisense plants with reduced S-adenosyimethionine: Mg-protoporphyrin-IX-0- Amounts of methyl transferase mRNA showed significant differences in terms of plant size. Plants were found that were reduced in size and plants that showed significant bleaching. These bleaches are due to greatly reduced amounts of chlorophyll. The chlorophyll amounts were determined as described in Lichtenthaler and Wellbum (1983) with 100% acetone extracts. In addition, an accumulation of the starting material of this S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferarse-mediated reaction, the Mg-protoporphyrin-IX, was found.

7. Determination of S-adenosylmethionine: Mg-protoporphyrin-IX-Q-methyltransferase activity

The following enzyme tests were used to demonstrate the enzymatic activity.

A) according to Vothknecht et al. 1995, Plant Physiol. Biochem. 33: 759-763:

The reaction takes place in a total volume of 150 μl with 20 μg protein extract (heterologously expressed as His-Tag protein in E. coli with or without subsequent affinity purification via NTA agarose), 0.35 M S-adenosylmethionine (SAM; Sigma) or 3.7 kBq [Methyl-C] SAM (NEN, Boston, USA; specific activity 2.1 GBq mmol ^"1 ), 20 μM Mg-protoporphyrin-IX, 0.1 M tricine-NaOH (pH 7.9), 0.3 M glycerol, 25 mM MgCl ₂ and 1 mM dithiotreitol. To inhibit the reaction, sinefungin (Sigma) dissolved in water was added to the reaction according to the manufacturer's instructions. The mixture was incubated for 30 min with shaking at 30 ° C. The Mg-protoporphyrin-IX-methyl ester was detected by HPLC 850 μl of an acetone / water / 32% ammonia (80/20/1, v / v / v) and 200 μl of hexane were added to remove carotenoid residues (and, in the case of enzyme isolated from leaf material, also chlorophyll residues) remove. An aliquot of the aqueous phase was run in an HPLC run in a C18 column (10 min linear gradient from

Water / acetonitrile / triethylamine (1 5/85 / 0.1 to acetonitrile) analyzed.

B) modified from Ellmans, 1956, Archives of Biochamistry and Biophysics 82: 70-77

This test is based on the detection of sufhydryl groups. In the reaction, Mg-protoporphyrin-IX and S-adenosyimethionine are converted to Mg-protoporphyrin-IX monomethyl ester and S-adenosylhomocysteine. By coupling the S-adenosylmethionine: Mg-protoporphyrin-IX-O-methyltransferase-mediated reaction with the enzyme S-adenosyihomocysteine hydrolase (Sigma), the resulting S-adenosyl homocysteine is converted to homocysteine and adenosine. Homocysteine has free sufhydryl groups that react with the Ellman reagent (5,5'-dithio-bis (2-nitrobenzoic acid; DTNB; Sigma). The detection is carried out photometrically at an absorption wavelength of 412 nm. DTNB is solved according to the manufacturer's instructions (3.96 mg / ml in 0.1 M phosphate buffer pH 7.0), and in a volume ratio of 1: 500 to the batch to be measured (20 μg E. coli total protein extract in 0.1 M phosphate powder pH 8.0) .The incubation was repeated several times during the up to 45 min Absorbance at 412 nm determined according to the following formula:

Co = A / ε x D (with Co as initial concentration, A as absorption at 412 nm, ε as extinction coefficient (= 18,600 / M / cm), D as dilution factor)

8. Production of transgenic tobacco plants (Nicotiana tabacum L. cv. Samsun NN)

For the production of transgenic tobacco plants, tobacco leaf disks with sequences of S-adenosylmethionine: Mg-protoporphyrin-IX-0- Transformed methyl transferase from P. patens. To transform tobacco plants, 10 ml of an overnight culture of Agrobacterium tumefaciens grown under selection were centrifuged off, the supernatant was discarded and the bacteria were resuspended in the same volume of antibiotic-free medium. Leaf disks of sterile plants (diameter approx. 1 cm) were bathed in this bacterial suspension in a sterile petri dish. The leaf disks were then placed in Petri dishes on MS medium (Murashige and Skoog, Physial, Plant (1962) 15, 473) with 2% sucrose and 0.8% Bacto agar. After 2 days of incubation in the dark at 25 ° C, they were on MS medium with 100 mg / l kanamycin, 500 mg / l claforan, 1 mg / l benzylaminopurine (BAP), 0.2 mg / l naphthylacetic acid (NAA), 1.6% glucose and 0.8% Bacto agar transferred and cultivation continued (16 hours light / 8 hours dark). Growing shoots were transferred to hormone-free MS medium with 2% sucrose, 250 mg / l Claforan and 0.8% Bacto-Agar.

9. Cloning of a cDNA encoding a PMT from tobacco (Nicotiana tabacum):

The cDNA sequence coding for the PMT from tobacco was determined by screening a lambda ZAP II cDNA library from Nicotiana tabacum (SR1, Stratagene, USA) using a partial EST clone from the moss Physcomitrella ( SEQ ID NO 4) identified according to a standardized protocol.

A 548 bp restriction fragment of the EST sequence according to SEQ ID NO 4 was used as a probe for the hybridization of the cDNA library and radioactively labeled with cc-32-P-DCTP using the random primer labeling kit (GIBCO Life Technologies, Eggenstein). The hybridization was carried out according to the following protocol: a) 4 hours prehybridization at 51 ° C with a hybridization solution of the following composition: 5 x SSC, 0.1% SDS, 5 x Denhardts reagent, 100 μg / ml denatured fish DNA, b) 16 hours main hybridization at 51 ° C with fresh hybridization solution of the following composition: 5 x SSC, 0.1% SDS, 5 x Denhardts reagent, 100 μg / ml denatured fish DNA with radioactively labeled cDNA probe, c) washing conditions: 1x with 5xSSC, 0.1% SDS , 10 minutes, 51 ° C; 2x with 2xSSC, 0.1% SDS, 10 minutes each, 51 ° C.

Approx. 2 million phage clones were checked, of which 26 putative positive cDNA clones were obtained. The longest cDNA sequence was sequenced (ABI sequencer, Perkin-Elmer). The PMT cDNA sequence identified and shown in SEQ ID NO 1 comprises 1134 base pairs (without the polyA tail) with a start codon at position 12-14 and a stop codon at position 987-989. Nucleotides 12-986 encode 325 amino acids. The deduced amino acid sequence of the PMT gene is shown in SEQ ID NO 5.

For DNA-RNA isolation, sequence analysis, restriction, cloning, gel electrophoresis, radioactive labeling, Southern, Northern and Western blot analyzes, hybridization and the like, common methods have been used as described in relevant laboratory manuals such as Sambrook et al. (1989), supra.

10. Overexpression of active PMT in E. coli.

For the production of expression clones, by means of which the PMT according to the invention can be overexpressed from tobacco in E coli, the open reading frame for the complete unprocessed protein using the oligonucleotide primers was forward primers: Exe-F 1 (Ncol) 5'-GAT CCC ATG GCT TTC TCT TCG CCA CTA TTC-3 'and reverse primer:

Exe-RI (pET) 5'-GAT CGG ATC CGC AGG GAC AGC CTC AAT AAG CTT-3 'from the DNA sequence according to SEQ ID NO: 1 amplified by PCR. The PCR conditions were as follows: 5 min. Denaturation at 95 ° C, then for 25 cycles: 1 min. At 94 ° C, 12 min. At 60 ° C / 1 min. At 72 ° C, finally another 3 min Extension at 72 ° C.

The PCR was carried out with the PWO enzyme from Stratagene (La Jolla, USA) on a ThermoCycler 9700 from Perkin-Elmer. The amplified PCR fragment was purified using the Qiagen PCR Purification Kit (Qiagen, Hilden), cut with the restriction enzymes Ncol and BamHI (Amersharn, Freiburg, Germany) and ligated into the expression vector pET20B (Novagen) cut with the same enzymes (ligation with TF-DNA ligase from Amersharn for 20 hours at 15 ° C). This pET vector expresses the foreign protein under the control of a promoter recognized by the T7 polymerase and encodes the PelB leader sequence at the N-terminal end of the recombinant protein and a histidine tag at the C-terminal end (FW Studier et al. (1990 ), Meth. Enzymol. 185: 60-89). The synthesis of the foreign protein is made possible after the induction of the synthesis of the bacteriophage T7 RNA polymerase in the E. coli cells. The ligated vector was transformed into the E. coli strain MOS blue (Amersharn, Freiburg) and then into the strain E coli BL 21 (Novagen, Madison, Wl, USA). Behind the initiation codon ATG, which is part of the Ncol recognition sequence, was followed by the coding PMT sequence, starting with nucleotide 15 of the open reading frame, which is also the last 3'-located nucleotide of the Ncol cleavage site. For the expression of the plant PMT, the E. coli strain BL21 was grown in LB medium to an optical density of 0.6, and then the expression was increased by adding 1 mM IPTG for 5 Hours induced. A recombinant protein with a molecular weight of 33 kDa was synthesized. The protein was in the soluble protein fraction of disrupted E. coli cells. The overexpressed protein was purified using the TALON beads (Clontech) on a cobalt affinity column according to the manufacturer's instructions. The purified protein was infected in rabbits for antibody production. The enzymatic detection of the recombinant protein was carried out according to the method of Gibson and Hunter (FEBS Letters 352: 127-130). The bacterial extract was in a 500 ul assay volume in a buffer consisting of 50 mM Tris-HCl, pH 8.4, 5 MM EGTA with 20 gM Mg protoporphyrin IX (Porphyrin Products Inc., Utah, USA) and 0.5 MM S-Adenosyl-L-Methioniπ (Sigrna, Deisenhofen) incubated as a cofactor at 33 ° C for 60 minutes. At six measuring points (0 sec., 30 sec., 10 min., 25 min., 40 min. And 60 min.) A 100 μl aliquot of the reaction mixture was removed and the reaction was stopped with 200 μl 100% methanol in order to reduce the Mg -Porphyrins to extract. The mixture was then centrifuged at 13,000 rpm for 5 minutes. The supernatant was removed and the pellet again taken up with 100 μl potassium phosphate buffer, pH 7.2, centrifuged again, the supernatant combined with the previous one and the pellet again with 200 μl extraction buffer (consisting of 10 volume units acetone, 9 volume units methanol and one volume unit NH ₄ OH). After centrifugation again, the three extracts were combined and the total volume was centrifuged again at 4 ° C. for 30 minutes and the supernatant was transferred to a new reaction vessel. Diluted 8-fold for the analysis of the Mg porphyrins on a HPLC system from Waters using a Nova-Pak C 1. The Mg porphyrins were eluted with the following linear gradient: from solution A (10% 1 M NH ₄ acetate, 10% methanol) to solution B (10% 1 M NH acetate, 90% methanol) within the first 7 minutes , from the 7th to the 21st minute 100% solution B, from the 21st to the 23rd minute of solution B to solution A, from the 23rd to the 29th minute solution A. The flow rate was 1 ml / min, the Mg porphyrins were detected by means of the fluorescence detector at λ _ex , = 420 nm and λ _em , = 595 mn. The elution profile of the Mg porphyrins from the extracts of the PMT assay, which were removed at the indicated reaction times, are shown in FIG. 3. Mg protoporphyrin usually has an elution time of 14.8 minutes and Mg protoporphyrin IX monomethyl ester has an elution time of 16.25 minutes.

11. Transformation of tobacco plants and regeneration of intact plants:

For the production of transgenic plants which overexpress the tobacco PMT sequence and therefore have an increased activity of the enzyme PMT compared to the untransferred plants, the DNA sequence according to SEQ ID NO 1 was carried out using the restriction enzymes Smal and Sall in the multiple cloning interface of the pBluescript vector (Stratagene, Amsterdam, Netherlands) cut out of the vector and in sense orientation into the binary vector BinAR-TX (Höfgen and Willmitzer (1 990) Plant Science 66: 221-23 0), a pBIB descendant, which was digested with the same restriction endonucleases, ligated in behind the CAMV 35S promoter. For clarification, a restriction map of the vector BinAR-TX is attached as Fig. 4. The recombinant vector pPMTbin was then transformed into Agrobacterium tumefaciens (Stanun GV2260; Horsch et al. (1,985), Science 227, 1229-123 1) and for the transformation of tobacco plants (SNN) by means of the leaf disc transformation technique (Horsch et al., supra) used.

For this purpose, an overnight culture of the corresponding Agrobacterium tumefaciens clone was centrifuged for 10 minutes at 5000 rpm, and the bacteria were resuspended in 2YT medium. Young tobacco leaves one Sterile culture (Nicotiana tabacum cv. Samsun NN) was cut into small pieces of about 1 cm 2 in size and placed briefly in the bacterial suspension. The leaf pieces were then placed on MS medium (Murashige and Skoog (1 962), Physiol. Plant. 15, 473; 0.7% agar) and incubated for two days in the dark. The leaf pieces were then sprouted on MS medium (0.7% agar) with 1.6% glucose, 1 mg / l 6-benzylaminopurine, 0.2 mg / l naphthylacetic acid, 500 mg / l claforan (Cefotaxim, Hoechst, Frankfurt) and 50 mg / l kanamycin. The medium was changed every seven to ten days. When shoots had developed, the leaf pieces were transferred to glass jars containing the same medium. Resulting shoots were cut off and placed on MS medium with 2% sucrose and 250 mg / l Claforan and regenerated to whole plants.

12. Production of PMT antisense constructs and transfer of the gene to tobacco:

In comparison to Example 11, in which transgenic plants are described which, because of the overexpression of the DNA sequence according to the invention, have an increased activity of the PMT, the cDNA sequence was used for the production of transgenic tobacco plants which have a reduced activity of PMT SEQ ID NO 1 was cut out of the pBluescript vector using the restriction enzymes EcoRV and Xbal and ligated into a binary vector BinAR-TX digested with the same enzymes behind the 35S promoter of CAMV (see FIG. 4). The recombinant plasmid was first transferred into the E. coli strain pMOS and then into the Agrobacterium tumefaciens strain GV 2260. The recombinant agrobacteria with the binary vector pPMTASdin were integrated into the tobacco genome according to the leaf disk transformation (see Example 11). 13. Analysis of transgenic tobacco plants which express the PMT cDNA sequence from tobacco in sense or antisense orientation: 100 transgenic lines per transformation batch were obtained, regenerated in sterile tissue culture, doubled and grown in the greenhouse in earth culture for the primary analysis ( 60% -70% humidity and 20-25 ° C for 16 hours of light and 8 hours of darkness at 18-24 ° C). The transformants with the PMT sense gene construct showed two different external appearances. About 30 plants showed pale green to green-yellowish leaves and reduced growth. The remaining lines showed no noticeable differences compared to the control plants, although the presence of the transgene was also proven in these lines by means of genomic Southern blot analysis.

Northern, Western blot analysis and enzyme activity determinations showed that the plants with the PMT genes in the sense orientation either have a reduced synthesis of the PMT-RNA and the protein and thus experience typical cosuppression, or in the other cases actual PMT overproducers. For the further description of the example, results from three transgenic lines were selected which have been shown to overexpress the PMT proteins.

The PMT antisense plants showed a reduced growth compared to the control plants, a bleached phenotype, reduced RNA and protein contents for PMT and a greatly reduced chlorophyll content. The primary transformants showed one to several copies of the PMT transgene compared to the control plants. Three antisense RNA synthesizing lines were subjected to detailed analysis. The transgenic plants with the copies of the PMT transgene in sense or antisense orientation were analyzed in Southern blot methods. The hybridization with one labeled cDNA fragment for PMT resulted in one to several additional hybridization bands of the genomic DNA digested with a restriction enzyme.

A Northem blot analysis showed an increased amount of specific RNA compared to the PMT-RNA contents of the control plants in the case of the PMT sense lines and a reduced amount in the case of the transformants with PMT antisense genes.

Increased PMT contents could be determined by means of Western blot analysis in the lines with PMT sense gene constructs and reduced PMT contents in lines with the PMTA antisense construct. The transformants that synthesized antisense RNA enriched up to 8 times the amount of Mg protoporphyrin IX compared to the control plants, while the sense transformants had reduced amounts of Mg protoporphyrin, the substrate of the PMT, compared to the controls (FIG 5). Furthermore, the PMT activity of the transformants was determined in vivo. In parallel to the increased protein contents, an increased enzyme activity could be determined for the PMT sense lines, while the lines with antisense RNA showed reduced activities (FIG. 6).

Furthermore, the synthetic capacity of the 5-aminolevulinate synthetic route was determined in order to investigate the influence of PMT expression and the activity on other enzyme steps of the metabolic route. PMT overproducers showed an increased synthesis rate of 5-aminolevulinic acid (ALA) compared to the control plants, while reduced synthesis rates were determined for the antisense plants (FIG. 7).

These results are relevant for the interpretation of the importance of PMT expression for the control of the total metabolite flow. It is it is particularly important that the ALA synthesis rate correlates with the activity of the PMT in the transgenic plants with modified PMT contents. ALA synthesis is the rate-limiting step of tetrapyrrole synthesis and is influenced by many external factors (such as light, day / night rhythm, light intensity) and endogenous factors (such as endogenous clock, hormones, development). The results imply a regulatory mechanism that aligns the activities of the early steps with those of the later steps, here that of the PMT. The adaptation of the ALA biosynthesis performance to the activities in the Mg porphyrin synthesis pathway is believed to be based on a joint coordination of the transcriptional and post-translational expression control.

Description of the figures:

Fig. 1: Illustration of the three cassettes for the three different reading frames of the plastid transit peptide of the plastid S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase from potato.

Fig. 2: (A): Plant transformation vector pBIN19AR-TP.

(B): Plant transformation vector pBIN19AR-TP for the expression of S-adenosylmethionine: Mg-protoporphyrin-IX-0-methyltransferase from Physcomitrella patens in antisense

Orientation. The abbreviations have the following

Importance:

35S: CAMV-35S promoter from the cauliflower mosaic virus

TK-Tp: transit peptide of the transketolase from potato OCS: octopine synthase terminator. In addition, restriction sites are shown that only cut the vector once.

Fig. 3: Enzyme activity of the recombinant Mg-PMT protein shown as a gene map and elution profile of the Mg porphyrins from the extracts of the PMT enzyme test.

4: Gene constructs containing the nucleotide sequence coding for the PMT in sense and antisense orientation in the vector pBINAR.

Fig. 5: Bar chart showing the Mg-porphyrin content of selected transgenic Mg-PMT tobacco plants containing Gene constructs with coding nucleotide sequences in sense and

Antisense orientation, referred to as sense and antisense.

Fig. 6: Bar chart to show the Mg-PMT activity in modified tobacco plants (Mg-PMT content after 1 hour of incubation).

Fig. 7: Bar chart to show the ALA content in transgenic Mg-PMT tobacco lines containing gene constructs with coding nucleotide sequences in sense and antisense orientation, referred to as sense and antisense.

Claims

Patent claims:

1. Nucleotide sequence encoding a plant S-adenosylmethionine:Mg-protoporphyrin-IX-0-methyltransferase or parts, derivatives, homologues or isoforms thereof.

2. Nucleotide sequence according to claim 1, characterized in that it contains the coding sequence according to SEQ ID NO 1.

3. Nucleotide sequence according to claim 1, characterized in that it has the coding sequence according to SEQ ID NO 2 and / or SEQ ID

NO 3 contains.

4. Nucleotide sequence according to claim 1, characterized in that it contains the coding sequence according to SEQ ID NO 4.

5. Nucleotide sequence according to claim 1, characterized in that the plant protein encoded by it contains an amino acid sequence according to SEQ ID NO 5.

6. Nucleotide sequence according to claim 1, characterized in that the plant protein encoded by it contains an amino acid sequence according to SEQ ID NO 6 and / or SEQ ID NO 7.

7. Nucleotide sequence according to one of claims 1, 3, 4 or 6, characterized in that it is an amino acid sequence

Physcomitrella patens coded.

8. Nucleotide sequence according to one of claims 1, 2 or 5, characterized in that it codes for an amino acid sequence from tobacco.

. Nucleotide sequence according to one of claims 1 to 8, characterized in that it codes for a modified S-adenosylmethionine:Mg-protoporphyrin-IX-0-methyltransferase or parts, derivatives, homologues or isoforms thereof which has a tolerance to compounds with herbicidal activity .

10. Gene structure containing a nucleotide sequence according to one of claims 1 to 9 or parts thereof and regulatory nucleotide sequences operatively linked to it.

11. Gene structure according to claim 10 containing regulatory nucleotide sequences from the group of promoters, enhancers, operators, terminators, polyadenylation signals, targeting sequences, retention signals or translation amplifiers.

12. Gene structure according to one of claims 10 or 11 containing a constitutive promoter as the regulatory nucleotide sequence.

13. Gene structure according to one of claims 10 to 12 containing, as the regulatory nucleotide sequence, a leaf and/or seed-specific and/or an inducible, preferably a light-inducible, promoter.

14. Vector containing at least one nucleotide sequence according to one of claims 1 to 9 or a gene structure according to one of

Claims 10 to 13.

15. Vector according to claim 14 containing additional nucleotide sequences for selection and/or for replication in a host cell and/or for integration into the host cell genome.

16. S-adenosylmethionine:Mg-protoporphyrin-IX-0-methyltransferase or parts thereof encoded by a nucleotide sequence according to one of claims 1 to 9.

17. S-adenosylmethionine:Mg-protoporphyrin-IX-0-methyltransferase according to claim 16 or parts thereof containing an amino acid sequence according to SEQ ID NO 5 or parts thereof.

18. S-adenosylmethionine:Mg-protoporphyrin-IX-0-methyltransferase according to claim 16 or parts thereof containing a

Amino acid sequence according to SEQ ID NO 6 and/or SEQ ID NO 7 or parts thereof.

19. S-adenosylmethionine:Mg-protoporphyrin-IX-0-methyltransferase according to one of claims 16 to 18, characterized in that it has a tolerance to compounds with herbicidal activity.

20. Genetically modified single- or multi-celled host organism and its offspring, containing in replicable form a

Nucleotide sequence according to one of claims 1 to 9 and/or one

Gene structure according to one of claims 10 to 13 and/or one

Vector according to one of claims 14 or 15.

21. Genetically modified single- or multi-cellular host organism according to claim 20, characterized in that it is a microorganism, preferably a bacterium, or a fungus.

22. Genetically modified plant or parts, tissues or cells thereof and their offspring containing in replicable form a Nucleotide sequence according to one of claims 1 to 9 and/or a

Gene construct according to one of claims 10 to 13 and/or a vector according to one of claims 14 or 15.

23. Genetically modified plant or parts, tissues or cells thereof and their offspring according to claim 22, characterized in that it synthesizes proteins which the corresponding non-genetically modified plant does not produce.

24. Genetically modified plant or parts, tissues or cells thereof and their offspring according to one of claims 22 or 23, characterized in that they have an altered control of chlorophyll biosynthesis and/or an altered chlorophyll content and/or a herbicide tolerance compared to a corresponding non-genetically altered plant plant has.

25. Seeds of the plants according to one of claims 22 to 24.

26. Reproductive material from a unicellular or multicellular host organism according to one of claims 20 or 21 or from plants, plant tissue or cells according to one of the claims

22 to 24.

27. A method for producing plants or parts, tissues or cells thereof with altered control of chlorophyll biosynthesis and/or with altered chlorophyll content, comprising the steps a) producing a gene construct according to one of claims 10 to 13 or a vector according to one of claims 14 or 15, b) Transfer of the gene construct or vector from a) to plant cells.

8. A method for producing herbicide-tolerant plants, parts, tissues or cells thereof, comprising the steps a) producing a gene construct according to one of claims 10 to 13 or a vector according to one of claims 14 or 15, b) transferring the gene construct or of the vector from a) on plant cells.

29. The method according to any one of claims 27 or 28, further comprising in step c) the regeneration of transgenic plants from the

Plant cells.

30. Use of a nucleotide sequence according to one of claims 1 to 9 for the production of plants or parts, tissue or cells thereof with an altered control of chlorophyll biosynthesis and/or an altered chlorophyll content and/or an altered herbicide tolerance.

31. Use of an S-adenosylmethionine:Mg-protoporphyrin-IX-0-methyltransferase according to one of claims 16 to 19 encoded by a nucleotide sequence according to one of claims 1 to 9 for identifying herbicides and / or compounds with an inhibitory effect on chlorophyll biosynthesis.