DE19845231A1 - Use of DNA encoding 1-deoxy-D-xylulose-5-phosphate synthase to produce plants with increased tocopherol, vitamin K, chlorophyll and carotenoid content - Google Patents

Abstract

Use of a DNA sequence encoding 1-deoxy-D-xylulose-5-phosphate synthase (DOXS), and optionally p-hydroxyphenylpyruvate dioxygenase (HPPD) and/or geranylgeranyl-pyrophosphate oxidoreductase (GGPPOR), to produce a plant with increased tocopherol, vitamin K, chlorophyll and/or carotenoid content is new. Independent claims are also included for the following: (1) a method to produce a plant with increased tocopherol, vitamin K, chlorophyll and/or carotenoid content comprises expressing DNA as above in the plant; (2) a method to transform a plant comprises contacting an expression cassette containing a promoter and a DNA sequence as above to a plant cell, callus tissue, a whole plant or protoplast of a plant cell; (3) a plant with an increased tocopherol, vitamin K, chlorophyll and/or carotenoid content; and (4) a test system based on expression of an expression cassette containing a 2458 or 1863 base pairs (bp) sequence to identify inhibitors of DOXS.

Description

The present invention relates to the use of DNA sequences zen coding for a 1-deoxy-D-xylulose-5-phosphate synthase (DOXS), coding for a p-hydroxyphenyl pyruvate dioxygenase (HPPD) and a geranylgeranyl pyrophosphate oxidoreductase (GGPPOR) for the production of plants with increased tocopherol, Vitamin K, chlorophyll and / or carotenoid content, especially that Use of DNA sequences SEQ-ID No. 1, SEQ ID No. 3 and SEQ ID No. 5 or DNA sequences hybridizing with these, one Process for the production of plants with increased tocopherol, Vitamin K, chlorophyll and / or carotenoid content, as well as the thus produced plant itself.

An important goal of plant molecular genetic work is up to forth the production of plants with an increased sugar content, Enzymes and amino acids. However, it is economically interesting also the development of plants with an increased vitamin content NEN, such as B. the increase in tocopherol content.

The eight naturally occurring compounds with vitamin E activity are derivatives of 6-chromanol (Ullmann's Encyclopedia of Industrial Chemistry, Vol. A 27 (1996), VCH Verlagsgesellschaft, Chapter 4., 478-488, Vitamin E). The first group (1a-d) is derived from tocopherol, the second group consists of tocotrienol derivatives (2a-d):

1a, α-tocopherol: R ¹ = R ² = R ³ = CH ₃
1b, β-tocopherol [148-03-8]: R ¹ = R ³ = CH ₃ , R ² = H
1c, γ-tocopherol [54-28-4]: R ¹ = H, R ² = R ³ = CH ₃
1d, δ-tocopherol [119-13-1]: R ¹ = R ² = H, R ³ = CH ₃

2a, α-tocotrienol [1721-51-3]: R ¹ = R ² = R ³ = CH ₃
2b, β-tocotrienol [490-23-3]: R ¹ = R ³ = CH ₃ , R ² = H
2c, γ-tocotrienol [14101-61-2]: R ¹ = H, R ² = R ³ = CH ₃
2d, δ-tocotrienol [25612-59-3]: R ¹ = R ² = H, R ³ = CH ₃ .

Α-Tocopherol is of great economic importance.

The development of crops with increased tocopherol content through tissue culture or seed mutagenesis and natural selection there are limits. On the one hand, the tocopherol content must be can already be grasped in tissue culture and, on the other hand, can only those plants manipulated via tissue culture techniques their regeneration to whole plants from cell cultures succeed. In addition, after mutagenesis and Se lesson show unwanted properties by partially repeated backcrosses must be eliminated. Also would be to increase the tocopherol content by crossing Plants of the same species are restricted.

For these reasons, the genetic engineering approach is necessary for the Essential biosynthesis encoding tocopherol synthesis performance isolate blessings and transfer them in crops, superior to the classic breeding process. This method assumes that biosynthesis and its regulation are known and that genes that affect biosynthetic performance are identical be certified.

Isoprenoids or terpenoids consist of different classes of lipid-soluble molecules and are partially or completely formed from C ₅ isoprene units. Pure prenyl lipids (e.g. carotenoids) consist of C-frameworks, which are exclusively based on isoprene units, while mixed prenyl lipids (e.g. chlorophyll) have an isoprenoid side chain which is linked to an aromatic nucleus.

The starting point for the biosynthesis of prenyl lipids are 3 × acetyl-CoA units, which are converted via β-hydroxymethylglutaryl-CoA (HMG-CoA) and mevalonate into the starting isoprene unit (C ₅ ), the isopentenyl pyrophosphate (IPP). It has recently been shown by in vivo feeding experiments with C ¹³ that in various eubacteria, green algae and plant chloroplasts a Mevalo nat-independent route to the formation of IPP is followed:

Hydroxyethylthiamine, which is obtained by decarboxylation of Pyruvate is formed and glyceraldehyde-3-phosphate (3-GAP) in one mediated by the 1-deoxy-D-xylulose-5-phosphate synthase "Transketolase" reaction first in 1-deoxy-D-xylulose-5-Phos phat converted (Schwender et al., FEBS Lett. 414 (1), 129-134 (1997); Arigoni et al., Proc. Natl. Acad. Sci USA 94 (2), 10600-10605 (1997); Lange et al., Proc. Natl. Acad. Sci. USA 95 (5), 2100-2104 (1998); Lichtenthaler et al., FEBS Lett. 400 (3), 271-274 (1997). This is then determined by an intramolecular order order implemented in IPP (Arigoni et al., 1997). Biochemical Da ten indicate that the mevalonate pathway operates in the cytosol and leads to the formation of phytosterols. The antibiotic Mevino lin, a specific inhibitor of mevalonate formation, leads le only for the inhibition of sterol biosynthesis in the cytoplasm  The prenyl lipid formation in the plastids is unaffected (Bach and Lichtenthaler, Physiol. Plant 59 (1993), 50-60). The Mevalonate-independent path, however, is localized and plastid leads primarily to the formation of carotenoids and plastid Prenyl lipids (Schwender et al., 1997; Arigoni et al., 1997).

IPP is in equilibrium with its isomer, dimethylallyl pyrophosphate (DMAPP). Condensation of IPP with DMAPP in head-to-tail attachment gives the monoterpene (C ₁₀ ) geranyl pyrophosphate (GPP). The addition of further IPP units leads to sesquiterpene (C ₁₅ ), Farnesy pyrophosphate (FPP) and diterpene (C ₂₀ ) geranyl-geranyl pyrophosphate (GGPP). Linking two GGPP molecules leads to the formation of the C ₄₀ precursors for carotenoids. GGPP is converted to phytyl pyrophosphate (PPP) by a prenyl chain hydrogenase, the starting material for the further formation of tocopherols.

The ring structures of the mixed prenyl lipids used for Lead to the formation of vitamins E and K, they are quinones, whose starting metabolites come from the Shikimate pathway. The aroma Table amino acids phenylalanine and tyrosine are in hydroxy phenyl pyruvate, which is converted into homo by dioxygenation gentisic acid is transferred. This is tied to PPP in order to Precursors of α-tocopherol and α-tocopoquinone, the 2-methyl-6-phy tylquinol. By methylation steps with S-adenosyl methionine as a methyl group donor is initially formed 2,3-dimethyl-6-phytylquinol, then by cyclization γ-tocopherol and by repeated methylation of α-tocopherol (Richter, Bioche mie of plants, Georg Thieme Verlag Stuttgart, 1996).

There are examples in the literature which show that the Mani of an enzyme directionally affect the metabolite flow can. In experiments with a changed expression of the Phy toen synthase, which uses two GGPP molecules to form 15-cis-phytoene linked together, could have a direct impact on the carotino id quantities of these transgenic tomato plants are measured (Fray and Grierson, Plant Mol. Biol. 22 (4), 589-602 (1993); Fray et al., Plant J., 8, 693-701 (1995)). As expected, show transgenic Tobacco plants with reduced amounts of phenylalanine ammonium Lyase reduced amounts of phenylpropanoid. The enzyme phenylalanine Ammonium lyase catalyzes the breakdown of phenylalanine, deprives it is phenylpropanoid biosynthesis (Bate et al., Proc. Natl. Acad. Sci USA 91 (16): 7608-7612 (1994); Howles et al., Plant Physiol. 112, 1617-1624 (1996)).  

About increasing the metabolite flow to increase the toco pherol content in plants through overexpression of individual bio Little is known so far about synthesis genes. Only WO 97/27285 be writes a modification of the tocopherol content by ver increased expression or by down-regulation of the enzyme p-Hy droxyphenylpyruvate dioxygenase (HPPD).

The object of the present invention was to develop a transgenic plant with increased tocopherol content, Vita min K, chlorophylls and carotenoids.

The task was surprisingly achieved by the overexpression of a 1-deoxy-D-xylulose-5-phosphate synthase (DOXS) gene, a p-hydroxyphenylpyruvate dioxygenase (HPPD) gene and a geranylgeranyl pyrophosphate oxidoreductase (GGPPOR) gene in the plants , see Fig. 1.

To the metabolite flow from the primary metabolism into the isoprene To boost noid metabolism, the formation of IPP was considered general starting substrate for all plastid isoprenoids increases. For this purpose, in transgenic tobacco and rapeseed plants the activity of the DOXS by overexpression of the DOXS from E. coli elevated. This can also be done by expressing homologues or others heterologous DOXS genes can be achieved. DOXS nucleotide sequences are from Arabidopsis thaliana (Acc. No. U 27099), rice (Acc. No. AF024512) and peppermint (Acc. No. AF019383).

For this purpose, for example, the DOXS gene from E. coli (SEQ-ID No. 1; Rosa Putra et al., Tetrahedron Lett. 39: 23-26 (1998); Acc. No. 035440) in transgenic plants. To one The E. coli DOXS in will ensure plastid localization another construct preceded by a transit signal sequence. A DNA sequence which is also suitable as an expression cassette encodes a DOXS gene that is labeled with Seq-ID No. 1 hybridizes and that comes from other organisms or other plants.

The now increasingly available D-1-deoxy-xylu lose-5-phosphate continues towards geranylgeranylpyrophosp has implemented.

About the increasingly available GGPP towards Toco Implementing pherols and carotenoids will be done in another step essential to the invention, the activity of the ene zymes geranylgeranyl pyrophosphate oxidoreductase by over expression of a corresponding homologous or heterologous gene increased. This measure will increase the education of  Phytyl pyrophosphate through increased implementation of geranylgeranyl Pyrophosphate to phytyl pyrophosphate reached.

For example, the GGPPOR gene from Arabidopsis tha liana (SEQ-ID No. 5) is increasingly expressed in transgenic plants. To ensure plastid localization is the Arabidop sis GGPPOR preceded by a transit signal sequence. Also suitable as an expression cassette is a DNA sequence that is suitable for a GGPPOR Gene encoded with Seq ID No. 5 hybridized and that from others organisms or from other plants.

In embodiment 4, the cloning of the GGPPOR gene is complete Arabidopsis thaliana.

To the increasingly available PPP towards Toco Implementing pherols and carotenoids will be done in another step essential to the invention, the activity of the ene zyms p-hydroxyphenylpyruvate dioxygenase (HPPD) by Über expression of a corresponding homologous or heterologous gene increased. This measure will increase the education of Homogentisic acid through increased conversion of hydroxyphenylpy ruvat reached in homogentisic acid.

cDNAs encoding this enzyme have been derived from several Organisms such as from microorganisms, from plants and described from humans.

In embodiment 3, the cloning of the HPPD gene is performed Streptomyces avermitilis (Denoya et al., J. Bacte- riol. 176: 5312-5319 (1994); SEQ ID No. 3). To a plastid loaf To ensure that the HPPD from Streptomyces is a Transit signal sequence preceded. Also suitable as an express ion cassette is a DNA sequence that codes for an HPPD gene, the one with Seq-ID No. 3 hybridizes and that from other organisms or comes from plants.

The increase in plastid D-1-deoxy-xylulose-5-phosphate, the Phytyl pyrophosphate and the homogentisic acid formation leads to increased formation of all plastidic isoprenoids. The increased The provision of these preliminary stages ensures that sufficient sub strat for the formation of tocopherols, chlorophylls, vitamin K and phylloquinone is available in the plastids.

The transgenic plants according to the invention are produced by transforming the plants with the DOXS-, the HPPD- Gene and the construct containing the GGPPOR gene (Example 5). As Model plants for the production of tocopherols, vitamin K,  Chlorophylls and carotenoids were used in tobacco and rapeseed.

The invention relates to the use of the DNA sequences SEQ ID No. 1, SEQ ID No. 3 and SEQ-ID No. 5, for a DOXS, an HPPD and a GGPPOR or their functional equivalents ko dieren, for the production of a plant with increased tocopherol, Vitamin K, chlorophyll and / or carotenoid content. The nucleus acid sequences can z. B. DNA or cDNA sequences. Coding suitable for insertion into an expression cassette Sequences are, for example, those for a DOXS, a Encode HPPD and a GGPPOR and give the host the ability to Giving overproduction of tocopherol.

The expression cassettes also contain regulatory nucleotides acid sequences which express the expression of the coding sequence in control the host cell. According to a preferred embodiment comprises an expression cassette upstream, i. H. at the 5 'end the coding sequence, a promoter and downstream, d. H. at the 3'-end, a polyadenylation signal and optionally others regulatory elements, which with the intervening ko sequence for the DOXS, HPPD and GGPPOR genes are operationally linked. Under an operational link ver the sequential arrangement of promoter, coding Sequence, terminator and possibly other regulatory elements of the that each of the regulatory elements has its function in the Meet expression of the coding sequence as intended can. However, those preferred for operative linking are not targeting sequences are guaranteed on restricted sequences performance of the subcellular localization in the apoplast, in the Va cool, in plastids, in the mitochondrion, in the endoplasmic reti kulum (ER), in the cell nucleus, in oil corpuscles or other compartments elements and translation enhancers such as the 5 'guide sequence the tobacco mosaic virus (Gallie et al., Nucl. Acids Res. 15 (1987), 8693-8711).

As an example, the plant expression cassette can be installed in the tobacco transformation vector pBinAR-Hyg. Fig. 2 shows the tobacco transformation vectors pBinAR-Hyg with 35S promoter (A) or pBinAR-Hyg with seed-specific promoter Phaseolin 796 (B):

• - HPT: hygromycin phosphotransferase
• - OCS: octopine synthase terminator
• - PNOS: nopaline synthase promoter
• - Such restriction interfaces are also shown net that only cut the vector once.

In principle, everyone is the promoter of the expression cassette Promoter suitable for the expression of foreign genes in plants can control. In particular, one is preferably used vegetable promoter or a promoter which is a vegetable vi rus comes from. The CaMV 35S promoter is particularly preferred from the cauliflower mosaic virus (Franck et al., Cell 21 (1980), 285-294). As is known, this promoter contains different ones Recognition sequences for transcriptional effectors that are in their Whole to a permanent and constitutive expression of the introduced gene (Benfey et al., EMBO J. 8 (1989), 2195-2202).

The expression cassette can also be a chemically inducible one Contain promoter through which the expression of the exogenous DOXS, HPPD or GGPPOR gene in the plant at a certain time point can be controlled. Such promoters such. B. the PRP1 promoter (Ward et al., Plant. Mol. Biol. 22 (1993), 361-366), a salicylic acid inducible promoter (WO 95/19443), an inducible by benzenesulfonamide (EP-A 388186), a tetracycline-inducible (Gatz et al., (1992) Plant J. 2, 397-404), an abscisic acid-induced barer (EP-A 335528) or by ethanol or cyclohexanone-in inducible (WO 93/21334) promoter can u. a. be used.

Furthermore, those promoters are preferred which are the Ensure expression in tissues or parts of plants in which the biosynthesis of tocopherol or its precursors takes place. Promoters that are leaf-specific are particularly noteworthy Ensure expression. The promoter of cyto should be mentioned FBPase from potato or the ST-LSI promoter from Kar toffel (Stockhaus et al., 1989, EMBO J. 8: 2445-245).

With the help of a seed-specific promoter, a stranger could protein stable up to a share of 0.67% of the total sol Chen seed protein in the seeds of transgenic tobacco plants expri be lubricated (Fiedler and Conrad, Bio / Technology 10 (1995), 1090-1094). The expression cassette can therefore, for example a seed-specific promoter (preferably the phaseolin Promoter (US 5504200), the USP- (Baumlein, H. et al., Mol. Gen. Genet. (1991) 225 (3), 459-467) or LEB4 promoter (Fiedler and Conrad, 1995)), the LEB4 signal peptide, the gene to be expressed and contain an ER retention signal.

An expression cassette is produced by fusion a suitable promoter with a suitable DOXS, HPPD or GGPPOR DNA sequence and preferably one between promoter and DOXS, HPPD or GGPPOR DNA sequence inserted DNA, which for a  chloroplast-specific transit peptide encoded, and a Po lyadenylation signal according to common recombination and Cloning techniques such as those described in T. Maniatis, E.F. Fritsch and J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1989) see above as in T. J. Silhavy, M. L. Berman and L. W. Enquist, Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1984) and Ausubel, F.M. et al., Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley-Inter science (1987).

Sequences which target in the Apoplasts, in plastids, in the vacuole, in the mitochondrion, in the endoplasmic reticulum (ER) or due to a lack of ent speaking operative sequences remain in the compartment ensure the emergence, the cytosol (Kermode, Crit. Rev. Plant Sci. 15: 4 (1996), 285-423). For the amount of protein battery mulation in transgenic plants has proven particularly beneficial localization in the ER (Schouten et al., Plant Mol. Biol. 30: 781-792 (1996)).

Expression cassettes can also be used whose DNA Coded sequence for a DOXS, HPPD or GGPPOR fusion protein, wherein part of the fusion protein is a transit peptide which is the Controls translocation of the polypeptide. Are preferred for the Chloroplast-specific transit peptides, which according to Transloka tion of the DOXS, HPPD or GGPPOR gene in the chloroplast from DOXS, HPPD or GGPPOR part are split off enzymatically. The transit peptide, which is derived from the plasti där Transketolase (TK) or a functional equivalent the This transit peptide (e.g. the transit sub-peptide of the small sub unit of Rubisco or ferredoxin NADP oxidoreductase) is headed.

DNA sequences of three cassettes of the plastid transit peptide of plastid transketolase from potato in three reading frames are particularly preferred as KpnI / BamHI fragments with an ATG codon in the NcoI interface:

The inserted nucleotide sequence coding for a DOXS, HPPD or GGPPOR can be produced synthetically or obtained naturally be or a mixture of synthetic and natural DNA Be components, as well as from various heterologous DOXS, HPPD or GGPPOR gene sections of different organisms best hen. In general, synthetic nucleotide sequences with Generates codons that plants prefer. This one from Plants' preferred codons can be made from codons with the highest Protein frequency can be determined, which is of most interest ten plant species are expressed. When preparing a Expression cassette can manipulate various DNA fragments to obtain a nucleotide sequence that is more convenient reads in the correct direction and with a correct one Reading frame is equipped. For connecting the DNA fragments with one another adapters or linkers can be attached to the fragments be set.

The promoter and terminator regions can expediently be used in the direction of transcription with a linker or polylinker, the one or more restriction sites for the insertion the contains this sequence. Usually the linker 1 to 10, mostly 1 to 8, preferably 2 to 6 restrictions put. In general, the linker has within the regulatory areas of less than 100 bp, often less than 60 bp, but at least 5 bp. The promoter can be both native or homologous as well as alien or heterologous to the host plant  his. The expression cassette contains in the 5'-3 'transcript direction of the promoter, a DNA sequence that is used for a DOXS, HPPD or GGPPOR gene coded and a region for the transkrip national termination. Different termination areas are ge interchangeable with each other.

Manipulations can also find the appropriate restriction cut provide or dispose of the superfluous DNA or restriction Remove interfaces, be used. Where insertions, Deletions or substitutions such. B. Transitions and Trans versions may be considered in vitro mutagenesis, "primerre pair ", restriction or ligation can be used. With suitable Manipulations, such as B. restriction, "chewing-back" or replenishment len of overhangs for "bluntends" can have complementary ends of the fragments are made available for ligation.

Of importance for the success of the invention can u. a. the on depend on the specific ER retention signal SEKDEL (Schou ten, A. et al., Plant Mol. Biol. 30 (1996), 781-792), average expression level is tripled to quadrupled. There may also be other retention signals that are natural licher with plant and animal localized in the ER Proteins occur, who are used for the construction of the cassette the.

Preferred polyadenylation signals are vegetable polyadenylation lation signals, preferably those which are essentially T-DNA Polyadenylation signals from Agrobacterium tumefaciens, ins particular of gene 3 of T-DNA (octopine synthase) of the Ti plasmid correspond to pTiACH5 (Gielen et al., EMBO J. 3 (1984), 835 ff) or functional equivalents.

An expression cassette can be a constitutive one, for example Promoter (preferably the CaMV 35S promoter), the LeB4 signal pep tid, the gene to be expressed and the ER retention signal The amino acid sequence is preferred as the ER retention signal KDEL (lysine, aspartic acid, glutamic acid, leucine) is used.

Preferably, the fused expression cassette used for encodes a DOXS gene, an HPPD gene and a GGPPOR gene into one Vector, for example pBin19, cloned, which is suitable, agro to transform bacterium tumefaciens. With such a vector transformed agrobacteria can then be used in a known manner Transformation of plants, especially crops, such as e.g. B. of tobacco plants can be used by, for example wounded leaves or pieces of leaf in an agrobacterial solution bathed and then cultivated in suitable media.  

The transformation of plants by agrobacteria is among others also known from F. F. White, Vectors for Gene Transfer in Higher Plants; in Transgenic Plants, Vol. 1, Engineering and Utiliza tion, edited by S. D. Kung and R. Wu, Academic Press, 1993, pp. 15-38. From the transformed cells of the wounded Leaves or leaf pieces can be transgenic in a known manner Plants are regenerated, which one in the expression cassette integrated gene for the expression of a DOXS gene, an HPPD Gene or a GGPPOR gene included.

To transform a host plant with one for a DOXS, an HPPD and a GGPPOR-encoding DNA becomes an expression cassette inserted as an insertion in a recombinant vector, whose vector DNA additional functional regulation signals, for example sequences for replication or integration holds. Suitable vectors are inter alia in "Methods in Plant Molecular Biology and Biotechnology "(CRC Press), Chap. 6/7, Pp. 71-119 (1993).

Using the recombination and Cloning techniques can transform the expression cassettes into suitable ones Vectors are cloned that reproduce, for example in E. coli. Suitable cloning vectors include a. pBR332, pUC series, M13mp series and pACYC184. Particularly suitable are binary vectors found in both E. coli and Agrobak can replicate series.

Another object of the invention relates to the use an expression cassette containing DNA sequences SEQ-ID No. 1, SEQ ID No. 3 and SEQ-ID No. 5 or hybridizing with these DNA sequences for the transformation of plants, cells, tissues or parts of plants. The preferred use is the Er increase in tocopherol, vitamin K, chlorophyll and carotenoid Content of the plant.

Depending on the choice of the promoter, the expression can be specific in the leaves, seeds or other parts of the plant consequences. Such transgenic plants, their propagation material, as well their plant cells, tissues or parts are another Ge subject of the present invention.

The expression cassette can also be used for transforma tion of bacteria, cyanobacteria, yeast, filamentous fungi and algae with the aim of increasing the tocopherol, vitamin K, chlorophyll and / or carotenoid production who used the.  

The transfer of foreign genes into the genome of a plant is made referred to as transformation. There are the described Methods for transforming and regenerating plants Plant tissues or plant cells for transient or stable Transformation used. Protoplasts are suitable methods transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene cannon - the so-called particle bombardment method, electroporation, incubation dry embryos in DNA-containing solution, microinjection and Agrobacterium mediated gene transfer. The called Methods are described, for example, in B. Jenes et al., Techniques for Gene Transfer, in: Transgenic Plants, Vol. 1, Engineering and Utilization, edited by S. D. Kung and R. Wu, Academic Press (1993), 128-143 and in Potrykus, Annu. Rev. Plant Phy siol. Plant Molec. Biol. 42 (1991), 205-225). The construct to be expressed is preferably converted into a vector cloned, which is suitable for trans Agrobacterium tumefaciens form, for example pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711).

Agrobacteria transformed with an expression cassette can also in a known manner for the transformation of plants, especially of crops, such as cereals, corn, oats, soybeans, Rice, cotton, sugar beet, canola, sunflower, flax, hemp, Potato, tobacco, tomato, rapeseed, alfalfa, lettuce and various which tree, nut and wine species are used, e.g. B. by wounded leaves or pieces of leaf in an agrobacterial solution bathed and then cultivated in suitable media.

Functionally equivalent sequences that are required for a DOXS, HPPD or GGPPOR gene encode are those sequences which, despite differing The nucleotide sequence still has the desired functions Zen. Functional equivalents naturally include sometimes mende variants of the sequences described herein and artificial che, e.g. B. obtained by chemical synthesis to the codon Ge need artificial nucleotide sequences adapted to a plant.

A functional equivalent is understood to mean in particular also natural or artificial mutations of one originally isolated sequence coding for a DOXS, HPPD or GGPPOR, which still shows the desired function. Mutations substitutions, additions, deletions, exchanges or Insertions of one or more nucleotide residues. So be for example, such nucleotide sequences by the available The present invention includes which can be modified by modifying the DOXS, HPPD or GGPPOR nucleotide sequence. The goal of a sol Chen modification z. B. the further narrowing down of it  contained coding sequence or z. B. also the insertion white more restriction enzyme interfaces.

Functional equivalents are also those variants whose radio tion compared to the parent gene or gene fragment is weakening or strengthening.

In addition, artificial DNA sequences are suitable as long as they as described above, the desired property for example the increase in the tocopherol content in the plant through over Expression of the DOXS, HPPD and GGPPOR genes in culture convey plants. Such artificial DNA sequences can for example by back-translation using molecular modeling constructed proteins, the DOXS, HPPD or GGPPOR activity have or be determined by in vitro selection. Especially encoding DNA sequences which are suitable by Rücküber setting a polypeptide sequence according to that for the host plant specific codon usage. The specific knockout Don use can be a familiar with plant genetic methods Expert through computer analysis of other known genes of Easily identify the plant to be transformed.

Other suitable equivalent nucleic acid sequences include name sequences which code for fusion proteins, Be part of the fusion protein is a DOXS, HPPD or GGPPOR poly peptide or a functionally equivalent part thereof. The second part of the fusion protein can e.g. B. another polypeptide with enzymatic activity or an antigenic polypeptide sequence with the help of evidence of DOXS, HPPD or GGPPOR Expression is possible (e.g. myc-tag or his-tag). Prefers however, this is a regulatory protein sequence, such as B. a signal or transit peptide that contains the DOXS, HPPD or GGPPOR protein to the desired site of action.

Increase in tocopherol, vitamin K, chlorophyll and / or caro tinoid content means in the context of the present invention artificially acquired ability to increase biosynthesis of these compounds by functional overexpression of the DOXS-, of the HPPD and GGPPOR genes in the plant versus that genetically modified plant for at least one Plant generation.

The tocopherol biosynthesis site is generally the leaf weave, so that a leaf-specific expression of the DOXS, the HPPD and the GGPPOR gene is useful. However, it is obvious enough that the tocopherol biosynthesis does not affect the leaf tissue must be limited, but also in all other parts of the  Plant - for example in fatty seeds - tissue-specific can be done.

In addition, a constitutive expression of the DOXS-, the HPPD and the GGPPOR gene advantageous. On the other hand, however inducible expression also appears desirable.

The effectiveness of expression of the transgenically expressed DOXS, For example, HPPD and GGPPOR genes can be sprouted in vitro increase in instep can be determined. In addition, one in kind and Expression of the DOXS-, HPPD- or GGPPOR- Gens and their impact on tocopherol biosynthetic performance be tested on test plants in greenhouse experiments.

The invention also relates to transgenic plants, trans formed with an expression cassette containing the sequence SEQ ID No. 1, SEQ ID No. 3 and SEQ-ID No. 5 or with these hy bridging DNA sequences, as well as transgenic cells, tissues, Parts and propagation material of such plants. Particularly preferred are transgenic crops, such as. B. barley, wheat, Rye, corn, oats, soybeans, rice, cotton, sugar beet, canola, Sunflower, flax, hemp, potato, tobacco, tomato, rapeseed, al falfa, lettuce and the various tree, nut and wine species.

Plants in the sense of the invention are mono- and dicotyledonous plants or algae.

By overexpressing the gene sequence SEQ ID NO: 1 in a plant can in principle be an increased resistance against inhibitors of DOXS can be achieved. The herge Transgenic plants are also the subject of the Erfin dung.

By overexpressing the gene sequence coding for an HPPD SEQ ID NO: 3 in a plant can in principle have increased resistance against inhibitors of HPPD can be achieved. The herge Transgenic plants are also the subject of the Erfin dung.

By overexpressing the gene sequence coding for a GGPPOR In principle, SEQ ID NO: 5 in a plant can be increased Resistance to inhibitors of GGPPOR can be achieved. The transgenic plants produced in this way are also counter state of the invention.  

By overexpressing the gene sequence coding for a DOXS SEQ-ID NO: 1, a gene sequence coding for the HPPD SEQ-ID NO: 3 and a gene sequence coding for the GGPPOR SEQ-ID No. 5 In principle, a plant can have increased resistance to via inhibitors of DOXS, HPPD and GGPPOR the. The transgenic plants so produced are also Subject of the invention.

Further objects of the invention are:

• - Process for transforming a plant, characterized thereby records that expression cassettes containing a DNA Sequence SEQ ID No. 1, a DNA sequence SEQ-ID No. 3 and one DNA sequence SEQ-ID No. 5 or DNA hybridizing with these Sequences in a plant cell, in callus tissue, a whole Plant or protoplasts of plants.
• - Use of the expression cassette containing a DNA Se quenz SEQ-ID No. 1, a DNA sequence SEQ-ID No. 3 and one DNA sequence SEQ-ID No. 5 or DNA hybridizing with these Sequences for the production of plants with increased resistance against inhibitors of DOXS, HPPD and GGPPOR increased expression of the DNA sequences SEQ-ID No. 1, SEQ ID No. 3 and SEQ-ID No. 5 or DNA hybridizing with these Sequences.
• - Use of the DNA sequences SEQ-ID No. 1, SEQ ID No. 3 and SEQ ID No. 5 or DNA sequences hybridizing with these for the production of plants with increased tocopherol, vita min K, chlorophyll and / or carotenoid content by express sion of a DOXS, an HPPD and a GGPPOR DNA sequence in Plants.

The invention is illustrated by the following examples, but is not limited to these:

General cloning procedures

The clone carried out in the context of the present invention steps such as B. restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nu small acids on nitrocellulose and nylon membranes, linking of DNA fragments, transformation of E. coli cells, cultivation of Bacteria, phage propagation and recombinant sequence analysis DNA was as in Sambrook et al. (1989) Cold Spring Harbor La boratory press; ISBN 0-87969-309-6.  

The bacterial strains used below (E. coli, XL-I Blue) were sourced from Stratagene. The one for plant transformation Agrobacterium strain used (Agrobacterium tumefaciens, C58C1 with the plasmid pGV2260 or pGV3850) was developed by Deblaere et al. in nucl. Acids Res. 13 (1985), 4777. Alternatively can also be the agrobacterial strain LBA4404 (Clontech) or others suitable strains are used. For cloning, the Vectors pUC19 (Yanish-Perron, Gene 33 (1985), 103-119) pBluescript SK- (Stratagene), pGEM-T (Promega), pZerO (Invitro gen), pBin19 (Bevan et al., Nucl. Acids Res. 12 (1984), 8711-8720) and pBinAR (Höfgen and Willmitzer, Plant Science 66 (1990), 221-230) can be used.

Sequence analysis of recombinant DNA

Recombinant DNA molecules were sequenced using a Laser fluorescence DNA sequencer from Licor (distributed by MWG Biotech, Ebersbach) using the Sanger method (Sanger et al., Proc. Natl. Acad. Sci. USA 74: 5463-5467 (1977).

example 1 Isolation of genomic DNA from the bacterium Escherichia coli XL1 Blue

A culture of Escherichia coli XL1 Blue was grown in 300 ml Luria Broth medium for 12 hours at 37 ° C. The genomic DNA of the bacterium was isolated from this culture by first pelleting it at 5000 revolutions in a Sorvall RC ₅₀ fugue. The pellet was then resuspended in 1/30 volume of the original culture lysis buffer (25 mM EDTA, 0.5% SDS; 50 mM Tris HCl, pH 8.0). An equal volume of phenol / chloroform / isoamyl alcohol (25: 24: 1) was added and incubated at 70 degrees for 10 minutes. The aqueous phase was then separated from the phenolic in a Heraeus under-table centrifuge at 3500 U for 15 minutes. The aqueous supernatant was mixed with 2.5 volumes of ethanol and 1/10 volume of 8 M lithium chloride and the nucleic acids were precipitated at room temperature for 10 minutes. The pel let was then taken up in 400 ul TE / RNAse and incubated at 37 degrees for 10 minutes. The solution was shaken again with a volume of phenol / chloroform / isoamyl alcohol (25: 24: 1) and the supernatant was precipitated with 2.5 volumes of ethanol and 1/10 volume of 8 M lithium chloride. The pellet was then washed with 80% ethanol and taken up in 400 ul TE / RNAse.

Example 2 Isolation of the DOXS from E. coli

For the PCR, oligonucleotides were derived from the DNA sequence of the DOXS (Acc. Number AF035440), to which a BamHI restriction site was added at the 5 'end and a XbaI or another BamHI restriction site was added at the 3' end. The oligonucleotide at the 5 'end comprises the sequence 5'-ATGGATCC ATGAGTTTT-GATATTGCCAAATAC -3' (nucleotides 1-24 of the DNA sequence; shown underlined) starting with the ATG start codon of the gene comprising the oligonucleotide at the 3 'end the sequence 5'-ATTCTAGA TTATGCCAGCCAGGCCTTG -3 'or 5'-ATG GATCC TTATGCCAGCCAGGCCTTG -3' (nucleotides 1845-1863 of the reverse complementary DNA sequence; underlined) starting with the stop codon of the gene. The PCR reaction with the two BamHI-containing oligonucleotides was carried out with the Pfu polymerase (Stratagene GmbH, Heidelberg) according to the manufacturer's instructions. 500 ng of the genomic DNA from E. coli were used as template. The PCR program was:
5 cycles: 4 sec 94 ° C, 30 sec 52 ° C, 2 min 72 ° C;
5 cycles: 4 sec 94 ° C, 30 sec 48 ° C, 2 min 72 ° C;
25 cycles: 4 sec 94 ° C, 30 sec 44 ° C, 2 min 72 ° C.

The fragment was cleaned using a gene clean kit (Dianova GmbH, Hilden) and cloned into the vector PCR script (Stratagene GmbH, Heidelberg) according to the manufacturer's instructions. The correctness of the sequence was determined by sequencing. The BamHI fragment was isolated from the PCR script vector and ligated into a correspondingly cut Bin19 vector which additionally contains the transit peptide of the transketolase from potato behind the CaMV 35S promoter. The transit peptide ensures plastid localization. The constructs are shown in Figs. 3 and 4 and the fragments have the following meaning:
Fragment A (529 bp) contains the 35S promoter of the Cauliflower Mosaic Virus (nucleotides 6909 to 7437 of the Cauliflower Mosaic Virus). Fragment B (259 bp) contains the transit peptide of the trans ketolase. Fragment E contains the gene of the DOXS. Fragment D (192 bp) contains the polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTIACH5 (Gielen et al., 1984) for transcription termination.

The PCR reaction with the 5'-BamHI and 3'-XbaI containing oligonucleotides was carried out using Taq polymerase (Takara, Sosei Co., Ltd.) according to the manufacturer's instructions. 500 ng of the genomic DNA from E. coli were used as template. The PCR program was:
5 cycles: 4 sec 94 ° C, 4 sec 50 ° C, 2 min 30 ° C
5 cycles: 4 sec 94 ° C, 30 sec 46 ° C, 2 min 68 ° C
25 cycles: 4 sec 94 ° C, 30 sec 42 ° C, 2 min 68 ° C.

The fragment was cleaned with the Gene Clean Kit and placed in the Vector pGemT (Promega GmbH, Mannheim) ligated. It was considered BamHI / XbaI fragment in an appropriately cut pBin19AR- Vector cloned behind the CaMV 35S promoter. The sequence was checked by sequencing (SEQ-ID No. 1). There were two non-conservative base changes found, compared to the published sequence for changing amino acid 152 (Asparagine) in valine and amino acid 330 (cysteine) in tryptophan to lead.

Example 3 Cloning of a Streptomyces avermitilis HPPD gene U11864 Isolation of genomic DNA from Streptomyces avermiti lis U11864

A culture of Streptomyces avermitilis U11864 was grown in 300 ml YEME medium (5 g malt extract, 2 g yeast extract, 2 g glucose) for Dressed for 96 h at 28 ° C. This culture became the genomic DNA of the bacterium isolated by first at 5000 U in a Sorvall RC5C joint was pelleted. Then it became Pellet in 1/30 volume lysis buffer (25mM EDTA, 0.5% SDS, 50mM Tris-HCl, pH 8.0) resuspended. An equal volume of phenol / chloro form / isoamyl alcohol (25: 24: 1) was added and at 70 ° C Incubated for 10 minutes. Then in a Heraeus Unter table centrifuge at 3500 U for 15 minutes the aqueous phase of the phenolic separated. The aqueous supernatant was 2.5 vol men ethanol and 1/10 volume 8 M lithium chloride and the Nucleic acids precipitated at room temperature for 10 minutes. The pel let was then taken up in 400 ul TE / RNAse and at 37 degrees incubated for 10 minutes. The solution was repeated with a Volume of phenol / chloroform / isoamyl alcohol (25: 24: 1) shaken out and the supernatant is precipitated with 2.5 volumes of ethanol and 1/10 volume men 8 M lithium chloride. The pellet was then 80% Washed ethanol and taken up in 400 ul TE / RNAse.  

For the PCR oligo, nucleotides were derived from the DNA sequence of the HPPD from Streptomyces avermitilis (Denoya et al., 1994; Acc. Number U11864), to which a BamHI and an XbaI restriction site were added at the 5 'end and at the 3' end was. The oligonucleotide at the 5 'end comprises the sequence 5'-GGAT CCAGCGGA CAAGCCAAC -3 ' (37 to 55 bases from the ATG in the 5 'direction; written in italics), the oligonucleotide at the 3' end comprises the sequence 5 ' -TCTAGA TTATGCCAGCCAGGCCTTG -3 '(nucleotides 1845-1863 of the reverse complementary DNA sequence; underlined).

The PCR reaction was carried out with Pfu polymerase (Strata gene GmbH, Heidelberg) according to the manufacturer's instructions. 400 ng of the genomic DNA were used as template. The PCR program was:
5 cycles: 4 sec 94 ° C, 30 sec 54 ° C, 2 min 72 ° C
5 cycles: 4 sec 94 ° C, 30 sec 52 ° C, 2 min 72 ° C
25 cycles: 4 sec 94 ° C, 30 sec 50 ° C, 2 min 72 ° C.

The fragment was removed using a gene clean kit (Dianova GmbH, Hilden) cleaned and according to the manufacturer's instructions in the vector PCR script (Stratagene GmbH, Heidelberg) cloned. The correctness of the Se quenz was checked by sequencing. It was fixed represents that the isolated gene ko for an additional amino acid dated. It contains the three bases TAC (coding for tyrosine) the nucleotide N429 of the cited sequence (Denoya et al., 1994).

The fragment was isolated from the vector with a BamHI and XbaI digest and ligated into a correspondingly cut Bin19AR vector behind the CaMV 35S promoter, for expression of the gene in the cytosol. The gene was isolated as a BamHI fragment from the same PCR script vector and ligated into a correspondingly cut pBin19 vector, which additionally contains the transit peptide of the potato plastid transketolase behind the CaMV 35S promoter. The transit peptide ensures plastid localization. The constructs are shown in Figs. 5 and 6 and the fragments have the following meaning:
Fragment A (529 bp) contains the 35S promoter of the Cauliflower Mosaic Virus (nucleotides 6909 to 7437 of the Cauliflower Mosaic Virus). Fragment B (259 bp) contains the transit peptide of the trans ketolase. Fragment C contains the HPPD gene. Fragment D (192 bp) contains the polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTIACH5 (Gielen, J. et al., EMBO J. 3 (1984), 835-846) for transcription termination.

Example 4 Cloning of a GGPPOR gene from Arabidopsis thaliana Isolation of total RNA from fully unfolded leaves of macaw bidopsis thaliana

Fully unfolded leaves of A. thaliana were harvested and grown in frozen liquid nitrogen. The material was subsequently powdered in a mortar and in 26 buffers (8 M guanidium hydro chloride, 20 mM MES, 20 mM EDTA pH 7.0). The Suspension was transferred to reaction vessels and with a Volu phenol / chloroform / isoamyl alcohol 25: 24: 1. To The supernatant was centrifuged at 15,000 rpm for 10 minutes transferred to a new reaction vessel and with 1/20 volume 1 N Acetic acid and 0.7 volumes of ethanol (absolute) precipitated the RNA. After centrifugation again, the pellet was first spun with 3 M Washed sodium acetate solution and after another centri fugation in 70% ethanol. The pellet was then Dissolved water and the RNA concentration determined photometrically.

Production of cDNA from total RNA of fully unfolded leaves of A. thaliana

20 µg of total RNA was initially mixed with 3.3 µl of 3 M sodium acetate solution and 2 µl of 1 M magnesium sulfate solution and to 100 µl Final volume filled up with DEPC water. For this purpose, 1 ul RNase free DNase (Boehringer Mannheim) and 45 min at 37 ° C incubated. After removing the enzyme by shaking with Phe nol / chloroform / isoamyl alcohol, the RNA was precipitated with ethanol and the pellet was taken up in 100 ul DEPC water. 2.5 µg of RNA of this solution using a cDNA kit (Gibco, Life Techno logies) rewritten in cDNA.

From the DNA sequence of geranylgeranyl pyrophosphate oxidoreductase (Keller et al. Eur. J. Biochem. (1998) 251 (1-2), 413-417); Accession number Y14044) were derived for a PCR oligonucleotide to which a BamHI had been added at the 5 'end and a SalI restriction interface had been added at the 3' end. The oligonucleotide at the 5 'end comprises the sequence 5'-ATGGATCC ATGGCGACGACGGTTACACTC -3' starting with the first codon of the cDNA (underlined), the oligonucleotide at the 3 'end comprises the sequence 5'-ATGTCGAC GTGATGA TAGATTACTAACAGAC -3 ' with the base pair 1494 of the cDNA sequence (underlined).

The PCR reaction was carried out using Pfu polymerase from Stra tagene GmbH, Heidelberg, according to the manufacturer's instructions. 1/8 volume of the cDNA was used as template (corresponds to 0.3 µg RNA). The PCR program was:
5 cycles: 94 ° C for 4 sec, 48 ° C for 30 sec, 72 ° C for 2 min
5 cycles: 94 ° C for 4 sec, 46 ° C for 30 sec, 72 ° C for 2 min
25 cycles: 94 ° C for 4 sec, 44 ° C for 30 sec, 72 ° C for 2 min.

The fragment was purified using a gene clean kit (Dianova GmbH, Hilden) and cloned according to the manufacturer's instructions into the vector PCR script from Stratagene GmbH, Heidelberg. The correctness of the fragment was checked by sequencing (SEQ ID No. 5). Using the restriction sites attached to the sequence by the primers, the gene was cloned as a BamHI / SalI fragment into the correspondingly cut vector BinAR-Hyg. This ent contains the 35S promoter of the cauliflower mosaic virus and the polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTIACH5 (Gielen et al., EMBO J. 3 (1984), 835-846) for transcription termination. The plasmid mediates resistance to the antibiotic hygromycin in plants and is thus suitable for superinfecting plants with Kanamycin resistance. Since the plastid transit peptide of the GGPPOR was also cloned, the protein should be transported into the plastids in transgenic plants. The construct is shown in Fig. 7. The fragments have the following meaning:
Fragment A (529 bp) contains the 355 promoter of the Cauliflower Mosaic Virus (nucleotides 6909 to 7437 of the Cauliflower Mosaic Virus). Fragment D contains the polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTIACH5 (Gielen et al., 1984) for transcription termination. Fragment F contains the gene of the GGPPOR including the intrinsic plastid transit sequence.

Example 5 Production of constructs for plant transformation with DOXS, GGPPOR and HPPD DNA sequences

For the production of plants which are transgenic for the DOXS, the GGPPOR and the HPPD, a binary vector was prepared which contains all three gene sequences ( Fig. 8). The GGPPOR gene was tagged with the intrinsic plastid localization sequence (as described in Example 4). The pBinAR-Hyg vector used in plants mediates resistance to the antibiotic hygromy cin and is thus suitable for perinfecting plants with kanamycin resistance.

To clone the HPPD into vectors which additionally contain another cDNA, oligonucleotides were derived for a PCR, to which a BamHI restriction site had been added at the 5 'end and at the 3' end. The oligonucleotide at the 5 'end comprises the sequence 5'-GGA TCCTCCAGCGGACAAGCCAAC -3' (nucleotides 37 to 55 from the ATG in the 5 'direction; underlined), the oligonucleotide at the 3' end comprises the sequence 5'-ATGGATC - CCGCGCCGCCTACAGGTTG-3 '(ending with base pair 1140 of the coding sequence, starting 8 base pairs 3' of the TAG stop codon; written in italics). The PCR reaction was carried out using Tli polymerase from Promega GmbH, Mannheim, according to the manufacturer's instructions. 10 ng of the plasmid pBinAR-HPPD were used as template. The PCR program was:
5 cycles: 94 ° C 4 sec, 68 ° C 30 sec, 72 ° C 2 min
5 cycles: 94 ° C 4 sec, 64 ° C 30 sec, 72 ° C 2 min
25 cycles: 94 ° C 4 sec, 60 ° C 30 sec, 72 ° C 2 min.

The fragment was removed using a gene clean kit (Dianova GmbH, Hilden) cleaned and according to the manufacturer's instructions in the vector PCR script from Stratagene GmbH, Heidelberg cloned. The correctness of the sequence was checked by sequencing. From the vector PCR script it was cut out as a BamHI fragment and into an ent speaking pBinAR vector ligated, which additionally the Transketolase transit peptide to introduce the gene product in the plastids. The plasmid pBinAR2-TP- was created p-HPPD.

For cloning, the plasmid pBinAR2-TP-HPPD was used to convert the 35S-Pro motor, the transketolase transit peptide, the p-HPPD gene and the polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTIACH5 (Gielen et al. 1984) isolated for transcription termination by means of PCR. A Hind III site was added to each of the oligonucleotides for the promoter and the terminator. The sequence of the oligonucleotide which attaches to the 5 'region of the promoter (underlined) is 5'-ATAAGCTT CATGGAGTCAAA-GATTCAAATAGA -3', that of the oligonucleotide which attaches to the termination sequence (underlined) is 5'- ATAAGCTT GGAC-AATCAGTAAATTGAACGGAG -3 '. The fragment obtained was purified using a gene clean kit (Dianova GmbH, Hilden) and cloned according to the manufacturer's instructions into the vector PCR script from Stratagene GmbH, Heidelberg. The correctness of the sequence was checked by sequencing. From this PCR script vector, it was transferred as a HindIII fragment into the correspondingly cut vector pBin19 (Bevan, 1984, Nucleic Acids Res. 12, 8711-8721).

The plasmid pBinAR-TP-DOXS became the 35S promoter, the trans ketolase transit peptide, the DOXS gene and the polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTIACH5 (Gielen et al., 1984) for transcription termination isolated by PCR. An EcoRI site was added to each of the oligonucleotides for the promoter and the terminator sequence. The sequence of the oligo nucleotide which is attached to the promoter (underlined) is 5'-ATGAATTC CATGGAGTCAAAGATTCAAATAGA -3 ', that of the oligonucleotide which is attached to the terminator sequence (italics) is 5'-ATGAATTC GGACAATCAGTAAATTGAACGGA '. The fragment was cleaned using a gene clean kit (Dianova GmbH, Hilden) and cloned according to the manufacturer's instructions into the vector PCR script from Stratagene GmbH, Heidelberg. The correctness of the sequence was checked by sequencing. From the PCR script vector, it was transferred as an EcoRI fragment into the correspondingly cut vector, which already contained the sequence of the HPPD as described above.

The 35S promoter, the GGPPOR gene and the polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTIACH5 (Gielen et al., 1984) were isolated from the plasmid pBinARHyg-GGPPOR for transcription termination by means of PCR. An XbaI interface was added to each of the oligonucleotides for the promoter and the terminator. Anneals the sequence of the oligonucleotide which (underlined) at the promoter is 5'-CATG ATTCTAGA GAGTCAAA GATTCAAATAGA-3 ', which anneals the oligonucleotide which (underlined) at the terminator sequence is 5'-ATTCTAGA GGACAA-TCAGTAAATTGAACGGAG -3 '. The fragment was purified using a gene clean kit (Dianova GmbH, Hilden) and cloned according to the manufacturer's instructions into the vector PCR script from Stratagene GmbH, Heidelberg. The correctness of the sequence was checked by sequencing. From the PCR script vector, it was transferred as an XbaI fragment into the correspondingly cut vector, which already contained the sequences of the HPPD and the DOXS as described above. The construct pBinAR-DOXS-GGPPOR-HPPD ( Fig. 8) was created, the fragments of which have the following meaning:
Fragment A (529 bp) contains the 35S promoter of the Cauliflower Mosaic Virus (nucleotides 6909 to 7437 of the Cauliflower Mosaic Virus). Fragment B contains the transit peptide of the plastid trans ketolase. Fragment C contains the gene of the HPPD. Fragment D contains the polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTIACH5 (Gielen et al., 1984) for transcription termination.

Fragment E contains the gene of the DOXS. Fragment F contains the gene the GGPPOR including the intrinsic plastid transit sequence.

Example 6 Production of transgenic tobacco plants (Nicotiana tabacum L. cv.Samsun NN)

For the production of transgenic tobacco plants that change have prenyl lipid content, tobacco leaf slices were used Sequences of the DOXS, the HPPD and the GGPPOR are transformed. For Transformation of tobacco plants were 10 ml one under Selek tion grown overnight culture of Agrobacterium tumefaciens centrifuged, the supernatant discarded and the bacteria in same volume of antibiotic-free medium resuspended. In Leaf disks of sterile plants were placed in a sterile petri dish (Diameter approx. 1 cm) bathed in this bacterial suspension. On finally the leaf disks were placed in petri dishes on MS medium (Murashige and Skoog, Physiol. Plant (1962) 15, 473) with 2% Sac charose and 0.8% Bacto agar. After 2 days of incubation in the dark at 25 ° C they were on M5 medium with 100 mg / l kanamy cin, 500 mg / l Claforan, 1 mg / l benzylaminopurine (BAP), 0.2 mg / l Naphtylacetic acid (NAA), 1.6% glucose and 0.8% bacto-agar via and cultivation (16 hours light / 8 hours dark continued). Growing sprouts were on hormone-free MS Medium with 2% sucrose, 250 mg / l Claforan and 0.8% Bacto agar transferred.

Example 7 Production of transgenic oilseed rape plants (Brassica napus)

The production of the transgenic rape plants that change you ten prenyl lipid content was based on a proto koll by Bade, J.B. and Damm, B. (in Gene Transfer to Plants, Po trykus, I. and Spangenberg, G., eds, Springer Lab Manual, Sprin ger Verlag, 1995, 30-38), in which also the compositions of the media and buffers used are specified.

The transformations were carried out with the Agrobacterium tumefaciens strain LBA4404 (Clontech GmbH, Heidelberg). The binary constructs already described above with the entire cDNAs of the DOXS, the HPPD and the GGPPOR were used as binary vectors. In all binary vectors used here, the NOS terminator sequence was replaced by the polyadenylation signal of gene 3 of the T-DNA of the Ti plasmid pTIACH5 (Gielen et al., 1984) for transcription termination. Brassica napus seeds were sterilized with 70% (v / v) ethanol, washed for 10 min at 55 ° C in H ₂ O, in 1% hypochlorite solution (25% v / v Teepol, 0.1% v / v Tween 20) incubated for 20 min and washed six times with sterile H ₂ O for 20 min each. The seeds were dried on filter paper for three days and 10-15 seeds were germinated in a glass flask with 15 ml of germination medium. The roots and apices were removed from several seedlings (approx. 10 cm in size) and the remaining hypocotyls were cut into pieces approx. 6 mm long. The approx. 600 explants obtained in this way are washed with 50 ml of basal medium for 30 min and transferred to a 300 ml flask. After adding 100 ml of callus induction medium, the cultures were incubated for 24 h at 100 rpm.

An overnight culture of the Agrobacterium strain was set up at 29 ° C. in Lu ria Broth medium with kanamycin (20 mg / l), of which 2 ml in 50 ml Luria Broth medium without kanamycin for 4 h at 29 ° C. until an OD ₆₀₀ incubated from 0.4-0.5. After pelleting the culture at 2000 rpm for 25 min, the cell pellet was resuspended in 25 ml of basal medium. The concentration of the bacteria in the solution was adjusted to an OD ₆₀₀ of 0.3 by adding further basal medium.

The callus induction medium with ste removed pipettes, added 50 ml Agrobacterium solution, mixed gently and incubated for 20 min. The Agrobacteria Suspension was removed, the oilseed rape explant for 1 min with 50 ml Callus induction medium washed and then 100 ml callus Induction medium added. The co-cultivation was carried out for 24 h carried out on a rotary shaker at 100 rpm. The co- Cultivation was done by removing the callus induction medium stopped and the explant twice for 1 min each with 25 ml and twice for 60 min with 100 ml of washing medium at 100 rpm washed. The washing medium with the explants was in 15 cm Pe transferred tri dishes and ent the medium with sterile pipettes ent distant.

20-30 explants in 90 mm petri were used for regeneration transferred shells, which 25 ml sprout induction medium with Kana contained mycin. The petri dishes were covered with 2 layers of leucopor closed and at 25 ° C and 2000 lux with photoperiods of 16 Hours of light / 8 hours of darkness. Every 12 days the developing calli on fresh petri dishes with sprout Induction medium transferred. All further steps to the Regenera tion of whole plants was as described by Bade, J.B. and Damm, B. (in Gene Transfer to Plants, Potrykus, I. and Spangenberg, G., eds,  Springer Lab Manual, Springer Verlag, 1995, 30-38) carried out.

Example 8 Increase in tocopherol biosynthesis in oilseed rape

The cDNA of the DOXS, the HPPD and the GGPPOR was labeled with a CaMV35S promoter and in rapeseed using the 35S Promotors overexpressed. At the same time, the seed-specific cal promoter of the phaseolin gene used to the tocophero sequence stop specifically increasing in rapeseed. With the appropriate Constructs transformed rape plants were grown in the greenhouse drawn. Then the total α-tocopherol content plant or the seeds of the plant. In all cases the α-tocopherol concentration compared to the non-transformed plant increased.  

SEQUENCE LOG

Claims (7)

1. Use of DNA sequences coding for a 1-deoxy-D-Xy lulose-5-phosphate synthase (DOXS), coding for a hydro xyphenylpyruvate dioxygenase (HPPD) and coding for a Ge ranylgeranyl pyrophosphate oxidoreductase (GGPPOR) position of plants with increased tocopherol, vitamin K, Chlorophyll and / or carotenoid content. 2. Use of a DNA sequence SEQ-ID No. 1, a DNA sequence SEQ ID No. 3 and a DNA sequence SEQ-ID No. 5 or with the hybridizing DNA sequences coding for a 1-deoxy D-xylulose-5-phosphate synthase (DOXS), a hydroxyphenylpy ruvat dioxygenase (HPPD) and a geranylgeranyl pyrophosphate Oxidoreductase (GGPPOR) for the production of plants with it high content of tocopherols, vitamin K, chlorophylls and / or Carotenoids. 3. Process for the production of plants with increased toco pherol, vitamin K, chlorophyll and / or carotenoid content, characterized in that DNA sequences SEQ-ID No. 1, SEQ ID No. 3 and SEQ-ID No. 5 or hybridizing with these DNA sequences are expressed in plants. 4. Processes for transforming a plant characterized thereby records that one contains an expression cassette Promoter and DNA Sequences SEQ ID No. 1, SEQ ID No. 3 and SEQ ID No. 5 in a plant cell, in callus tissue, one whole plant or protoplasts of plant cells. 5. A method for transforming plants according to claim 4, characterized in that the transformation using the Agrobacterium tumefaciens, electroporation or the particle bombardment method. 6. Plant with increased tocopherol, vitamin K, chlorophyll and / or carotenoid content containing an expression cas sette according to claim 4. 7. Plant according to claim 6, selected from the group of soybeans, approx nola, barley, oats, wheat, rapeseed, corn or sunflower.