Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/1034—Isolating an individual clone by screening libraries
  • C12N15/1079—Screening libraries by altering the phenotype or phenotypic trait of the host
• • C—CHEMISTRY; METALLURGY
  • C07—ORGANIC CHEMISTRY
  • C07K—PEPTIDES
  • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
  • C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
  • C12N15/8203—Virus mediated transformation
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
  • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
  • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
  • C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
  • C12N15/8257—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits for the production of primary gene products, e.g. pharmaceutical products, interferon
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
  • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
  • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
  • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
  • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
• • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
  • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
  • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
  • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
  • Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
  • Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

• the present invention relates generally to the field of molecular biology and genetics Specifically, the present invention relates to a method for correlating the function of a host organism de ⁇ ved nucleic acid sequence by a transient expression of the nucleic acid sequence m an antisense or positive sense o ⁇ entation in a plant host
• the Mouse genome is also being sequenced Genbank provides about 1.2% of the 3- bilhon-base mouse genome (http://www informatics iax.org) and a rough draft of the mouse genome is expected to be available by 2003 and a finished genome by 2005.
• the Drosophila Genome Project has recently been completely (http://www.fruitfly.org).
• Valuable and basic ag ⁇ cultural plants including corn, soybeans and ⁇ ce are also targets for genome projects because the information obtained thereby may prove very beneficial for increasing world food production and improving the quality and value of ag ⁇ cultural products.
• the United States Congress is conside ⁇ ng launching a corn genome project. By helping to unravel the genetics hidden in the corn genome, the project could aid in understanding and combating common diseases of gram crops.
• sequence information so generated is enormous if gene function can be determined It may become possible to engineer commercial seeds for ag ⁇ cultural use to convey any number of desirable traits to food and fiber crops and thereby increase ag ⁇ cultural production and the world food supply Research and development of commercial seeds has so far focused p ⁇ ma ⁇ ly on traditional plant breeding, however there has been increased interest in biotechnology as it relates to plant characte ⁇ stics Knowledge of the genomes involved and the function of genes contained therein for both monocotyledonous and dicotyledonous plants is essential to realize positive effects from such technology
• gene profiling in cotton can lead to an understanding of the types of genes being expressed p ⁇ ma ⁇ ly in fiber cells
• the genes or promoters de ⁇ ved from these genes may be important in genetic engineering of cotton fiber for increased strength or for "built-in" fiber color.
• gene profiling coupled to physiological trait analysis can lead to the identification of predictive markers that will be increasingly important in marker assisted breeding programs. Mining the DNA sequence of a particular crop for genes important for yield, quality, health, appearance, color, taste, etc., are applications of obvious importance for crop improvement.
• virus-derived positive sense or antisense RNA in transgenic plants provides an enhanced or reduced expression of an endogenous gene.
• introduction and subsequent expression of a transgene will increase (with a positive sense RNA) or decrease (with an antisense RNA) the steady-state level of a specific gene product (Curr. Opin. Cell Biol. 7: 399-405 (1995)).
• antisense RNA the steady-state level of a specific gene product
• Post-transcriptional gene silencing (PTGS) in transgenic plants is the manifestation of a mechanism that suppresses RNA accumulation in a sequence-specific manner.
• PTGS Post-transcriptional gene silencing
• the posttransc ⁇ ptional gene silencing mechanism is typified by the highly specific degradation of both the transgene mRNA and the target RNA, which contains either the same or complementary nucleotide sequences
• the silencing transgene is the same sense as the target endogenous gene or viral genomic RNA, it has been suggested that a plant- encoded RNA-dependent RNA polymerase makes a complementary strand from the trans
• Pro[s] and Pro[a/s] constructs contained the PVY nuclear inclusion Pro ORF in the sense and antisense o ⁇ entations, respectively
• the Pro[s]-stop construct contained the PVY Pro ORF in the sense o ⁇ entation but with a stop codon three codons downstream from the initiation codon Waterhouse et al show when the genes of those constructs were transformed into plants, the plants exhibited immunity to the virus form which the transgene was de ⁇ ved.
• the present invention provides a method for detecting the presence of a trait in a plant host by expressing a donor orgamsm de ⁇ ved nucleic acid sequence in an antisense or positive o ⁇ entation in the plant host Once the presence of a trait is identified by phenotypic changes, the nucleic acid insert in the cDNA clone or in the vector is then sequenced
• the present method provides a rapid method for determining the presence of a trait and a method for identifying a nucleic acid sequence and its function in a plant host by screening phenotypic or biochemical changes in the plant host transfected with a nucleic acid sequence of the donor organism
• the present invention essentially involves the steps of (1) introducing into a viral vector a library of host orgamsm de ⁇ ved sequence inserts in a positive or antisense o ⁇ entation, (2) expressing each insert in a plant host, and (3) detecting phenotypic or biochemical changes of the plant host as a result of the expression
• a plant host may be a monocotyledonous or dicotyledonous plant, plant tissue or plant cell.
• the present invention is directed to a method of changing the phenotype or biochemistry of a plant host, a method of determining a change in phenotype or biochemistry in a plant host, and a method of determining the presence of a trait in a plant host
• the method comp ⁇ ses the steps of expressing transiently a nucleic acid sequence of a donor organism in an antisense or positive sense o ⁇ entation in a plant host, identifying changes in the plant host, and correlating the sequence expression with the phenotypic or biochemical changes.
• the nucleic acid sequence does not need to be isolated, identified, or characterized prior to transfection into the host organism.
• the present invention is also directed to a method of determining the function of a nucleic acid sequence, including a gene, in a donor organism, by transfecting the nucleic acid sequence into a plant host in a manner so as to affect phenotypic or biochemical changes in the plant host.
• recombinant viral nucleic acids are prepared to include the nucleic acid insert of a donor.
• the recombinant viral nucleic acids infect a plant host and produce antisense or positive sense RNAs in the cytoplasm which result in a reduced or enhanced expression of endogenous cellular genes in the host organism.
• the function of the nucleic acid is determined.
• the nucleic acid insert in a cDNA clone or in a vector is then sequenced.
• the nucleic acid sequence is determined by a standard sequence analysis.
• One aspect of the invention is a method of identifying and determining a nucleic acid sequence in a donor organism, whose function is to silence endogenous genes in a plant host, by introducing the nucleic acid into the plant host by way of a viral nucleic acid suitable to produce expression of the nucleic acid in the transfected plant.
• This method utilizes the principle of post- transcription gene silencing of the endogenous host gene homologue, for example, antisense RNAs, or positive sense RNAs. Particularly, this silencing function is useful for silencing a multigene family in a donor organism.
• the overexpressioin of a plus sense RNA that results in overproduction of a protein may cause phenotypical or biochemical changes in a host.
• nucleic acid sequence in the donor organism may have substantial sequence homology as that in the plant host, e.g. the nucleic acid sequences are conserved between the donor and plant host.
• the nucleic acid Once the nucleic acid is sequenced, it can be labeled and used as a probe to isolate full-length cDNAs from the donor organism.
• This invention provides a rapid means for elucidating the function and sequence of nucleic acids of a donor organism; such rapidly expanding information can be subsequently utilized in the field of genomics.
• Another aspect of the instant invention is directed to a method of increasing yield of a grain crop.
• the method comprises expressing transiently a nucleic acid sequence of a donor plant in an antisense or positive sense orientation in a grain crop, wherein said expressing results in stunted growth and increased seed production of the grain crop.
• a preferred method comprises the steps of cloning the nucleic acid sequence into a plant viral vector and infecting the grain crop with a recombinant viral nucleic acid comprising said nucleic acid sequence.
• Another aspect of the invention is to discover genes having the same function in different plants.
• the method starts with a library of cDNAs, genomic DNAs, or a pool of RNAs of a first plant.
• a recombinant viral nucleic acid comprising a nucleic acid insert derived from the library is prepared and is used to infect a different host plant.
• the infected host plant is inspected for phenotypic or biochemical changes.
• the recombinant viral nucleic acid that results in phenotypic or biochemical changes in the host plant is identified and the sequence of the nucleic acid insert is determined by a standard method.
• nucleic acid sequence in the first plant has substantial sequence homology as that in the host plant: the nucleic acid sequences are conserved between the two plants.
• This invention provides a rapid means for elucidating the function and sequence of nucleic acids of interest; such rapidly expanding information can be subsequently utilized in the field of genomics.
• Another aspect of the present invention is to produce human proteins in a plant host. After nucleic acids of similar functions from a human and a host plant are isolated and identified, the amino acid sequences derived from the DNAs are compared. The plant nucleic acid sequence is changed so that it encodes the same amino acid sequence as the human protein The nucleic acid sequence can be changed according to any conventional methods, such as, site directed mutagenesis or polymerase based DNA synthesis
• Plant hosts include plants of commercial interest, such as food crops, seed crops, oil crops, ornamental crops and forestry crops
• plants of commercial interest such as food crops, seed crops, oil crops, ornamental crops and forestry crops
• wheat, ⁇ ce, corn, potatoes, barley, tobaccos, soybean canola, maize, oilseed rape, Arabidopsis, Nwotiana can be selected as a host plant
• host plants capable of being infected by a virus containing a recombinant viral nucleic acid are preferred
• FIG 12 depicts the nucleotide sequence companson of 740 AT #2441 and L16787
• FIG. 13 depicts the amino acid sequence comparison of 740 AT #2441 and RAN-Bl GTP binding protein.
• FIG. 14 depicts the plasmid pBS 740 AT #120 (ATCC No: PTA-325).
• FIG. 15 shows the nucleotide sequence comparison of A. thaliana 740 AT #120 and A. thaliana est AA042085
• FIG. 16 shows the nucleotide sequence alignment of 740 AT #120 to rice D 17760 (Oryza sativa) ADP-ribosylation factor.
• FIG. 18 shows the nucleotide sequence alignment of humanized sequence 740 AT #120 H to human ADP-ribosylation factor M33384.
• FIG. 19 shows the plasmid KS+ Nb ARF #3 (ATCC No: PTA-324).
• FIG. 20 shows the nucleotide sequence comparison of A. thaliana 740 AT #120 and N. benthamiana KS+ Nb ARF#3.
• FIG. 21 shows a Tobacco Rattle Virus gene silencing vector.
• FIG. 22 shows the plasmid pBS #740 AT #88 (ATCC No: PTA-331).
• FIG. 23 shows the sequence of 740 AT #88.
• FIG. 24 shows the nucleotide sequence comparison of AT #88 and Brassica rapa L35812.
• FIG. 25 shows the nucleotide sequence comparison of AT #88 and Octopus Rhodopsin X07797.
• FIG. 26 shows the nucleotide sequence comparison of AT #88 and Octopus Rhodopsin P31356.
• FIG. 28 shows the nucleotide sequence of 740 AT #377.
• FIG. 29 shows the plasmid pBS #2483 (ATCC No: PTA-329).
• FIG. 30 shows the nucleotide sequence of 740 AT #2483.
• FIG. 32 shows the nucleotide sequence comparison of AT #909 and Ribosomal protein LI 9 from breast cancer cell line.
• FIG. 33 shows the nucleotide sequence comparison of AT #909 and L19 P14118 60S ribosomal protein LI 9.
• FIG. 35 shows the nucleotide sequence comparison of AT #855 and HAT7 homeobox protein ORF.
• the present invention essentially involves the steps of (1) introducing into a viral vector a library of host organism derived sequence inserts in a positive or antisense orientation; (2) expressing each insert in a plant host, and (3) detecting phenotypic or biochemical changes of the plant host as a result of the expression.
• a plant host may be a monocotyledonous or dicotyledonous plant, plant tissue or plant cell.
• Donor organisms include species from Monera, Protista, Fungi, Plantae, or Animalia kingdom, such as human, mouse, drosophila, etc.
• the donor organism is also a plant
• the donor plant and the host plant typically belong to different genus, family, order, class, subdivision, or division.
• the function of sequence inserts in the library is typically unknown.
• the number of sequence inserts in a library is typically larger than about 10, 15, 20, 50, 100, 200, 500, 1000, 5000, or 15,000, etc.
• the length of each insert is typically longer than about 50, 100, 200, or 500 base pairs.
• the present invention is directed to a method of changing the phenotype or biochemistry of a plant host, a method of determining a change in phenotype or biochemistry in a plant host, and a method of determining the presence of a trait in a plant host.
• the method comprises the steps of expressing transiently a nucleic acid sequence of a donor organism in an antisense or positive sense orientation in a plant host, identifying changes in the plant host, and correlating the sequence expression with the phenotypic or biochemical changes.
• the nucleic acid sequence does not need to be isolated, identified, or characterized prior to transfection into the host organism.
• the present invention is also directed to a method of making a functional gene profile by transiently expressing a nucleic acid sequence library in a host organism, determining the phenotypic or biochemical changes in the plant host, identifying a trait associated with the change, identifying the donor gene associated with the trait, identifying the homologous host gene, if any, and annotating the sequence with its associated phenotype or function
• the present invention is also directed to a method of determining the function of a nucleic acid sequence, including a gene, in a donor organism, by transfecting the nucleic acid sequence into a plant host m a manner so as to affect phenotypic or biochemical changes in the plant host
• recombinant viral nucleic acids are prepared to include the nucleic acid insert of a donor
• the recombinant viral nucleic acids mfect a plant host and produce antisense or positive sense RNAs m the cytoplasm which result in a reduced or enhanced expression of endogenous cellular genes in the host organism
• the function of the nucleic acid is determined
• the nucleic acid insert in a cDNA clone or in a vector is then sequenced
• the nucleic acid sequence is determined by a standard sequence analysis
• One aspect of the invention is a method of identifying and determining a nucleic acid sequence in a donor organism, whose function is to silence endogenous genes m a plant host, by introducing the nucleic acid into the plant host by way of a viral nucleic acid suitable to produce expression of the nucleic acid in the transfected plant
• This method utilizes the p ⁇ nciple of post-transc ⁇ ption gene silencing of the endogenous host gene homologue, for example, antisense RNAs, or positive sense RNAs
• this silencing function is useful for silencing a multigene family in a donor organism
• the overexpressiom of a plus sense RNA that results in overproduction of a protein may cause phenotypical or biochemical changes in a host
• Another aspect of the invention is to discover genes in a donor organism having the same function as that in a plant host
• the method starts with building a cDNA library, or a genomic DNA library, or a pool of RNA of a donor organism, for example, from tissues or cells of human, mouse, or drosophila
• a recombinant viral nucleic acid compnsing a nucleic acid insert de ⁇ ved from the library is prepared and is used to mfect a plant host
• the infected plant host is inspected for phenotypic or biochemical changes
• the recombinant viral nucleic acid that results in phenotypic or biochemical changes in the plant host is identified and the sequence of the nucleic acid insert is determined by a standard method
• Such nucleic acid sequence in the donor orgamsm may have substantial sequence homology as that in the plant host, e g the nucleic acid sequences are conserved between the donor and plant host.
• nucleic acid Once the nucleic acid is sequenced, it can be labeled and used as a probe to isolate full-length cDNAs from the donor organism.
• This invention provides a rapid means for elucidating the function and sequence of nucleic acids of a donor organism; such rapidly expanding information can be subsequently utilized in the field of genomics.
• Another aspect of the instant invention is directed to a method of increasing yield of a grain crop.
• the method comprises expressing transiently a nucleic acid sequence of a donor plant in an antisense or positive sense orientation in a grain crop, wherein said expressing results in stunted growth and increased seed production of the grain crop.
• a preferred method comprises the steps of cloning the nucleic acid sequence into a plant viral vector and infecting the grain crop with a recombinant viral nucleic acid comprising said nucleic acid sequence.
• Another aspect of the present invention is directed to a method for producing human proteins in a plant host. After nucleic acids of similar functions from a human and a host plant are isolated and identified, the amino acid sequences derived from the DNAs are compared. The plant nucleic acid sequence is changed so that it encodes the same amino acid sequence as the human protein.
• the nucleic acid sequence can be changed according to any conventional methods, such as, site directed mutagenesis or polymerase based DNA synthesis.
• Another aspect of the invention is to discover genes having the same function in different plants.
• the method starts with a library of cDNAs, genomic DNAs, or a pool of RNAs of a first plant.
• a recombinant viral nucleic acid comprising a nucleic acid insert derived from the library is prepared and is used to infect a different host plant.
• the infected host plant is inspected for phenotypic or biochemical changes.
• the recombinant viral nucleic acid that results in phenotypic or biochemical changes in the host plant is identified and the sequence of the nucleic acid insert is determined by a standard method.
• nucleic acid sequence in the first plant has substantial sequence homology as that in the host plant: the nucleic acid sequences are conserved between the two plants.
• This invention provides a rapid means for elucidating the function and sequence of nucleic acids of interest; such rapidly expanding information can be subsequently utilized in the field of genomics. I. Introducing into a plant viral vector a library of sequence inserts from a donor organism.
• viruses may be suitable for the instant invention, such as alfamovirus, ilarvirus, bromovirus, cucumovirus, tospovirus, carlavirus, caulimovirus, closterovirus, comovirus, nepovirus, dianthovirus, furovirus, hordeivirus, luteovirus, necrovirus, potexvirus, potyvirus, rymovirus, bymovirus, oryzavirus, sobemovirus, tobamovirus, tobravirus, carmovirus, tombusvirus, tymovirus, umbravirusa, and among others.
• RNA satellite viruses such as tobacco necrosis satellite
• Selected groups of suitable plant viruses are characte ⁇ zed below
• the invention should not be construed as limited to using these particular viruses, but rather the method of the present invention is contemplated to include all plant viruses at a minimum
• the invention should not be construed as limited to using these particular viruses, but rather the present invention is contemplated to include all suitable viruses
• Some suitable viruses are characte ⁇ zed below
• TMV tobacco mosaic virus
• the tobacco mosaic virus (TMV) is of particular interest to the instant invention because of its ability to express genes at high levels in plants TMV is a member of the tobamovirus group
• the TMV vi ⁇ on is a tubular filament, and compnses coat protein sub- units arranged in a single ⁇ ght-handed helix with the single-stranded RNA intercalated between the turns of the helix TMV infects tobacco as well as other plants
• TMV vi ⁇ ons are 300 nm x 18 nm tubes with a 4 nm-diameter hollow canal, and consist of 2140 units of a single structural protein helically wound around a single RNA molecule
• the genome is a 6395 base plus-sense RNA
• the 5'-end is capped and the 3'-end contains a senes of pseudoknots and a tRNA-hke structure that will specifically accept histidine
• the genomic RNA functions as mRNA for the production
• Additional proteins are translated from subgenomic size mRNA produced du ⁇ ng replication (Dawson, A dv Virus Res., 38-307-342 (1990)).
• the 30-kDa protein is required for cell-to-cell movement; the 17.5-kDa capsid protein is the single viral structural protein.
• the function of the predicted 54-kDa protein is unknown
• TMV assembly apparently occurs in plant cell cytoplasm, although it has been suggested that some TMV assembly may occur in chloroplasts since transcnpts of ctDNA have been detected m purified TMV virions. Initiation of TMV assembly occurs by interaction between nng-shaped aggregates ("discs") of coat protem (each disc consisting of two layers of 17 subunits) and a unique internal nucleation site in the RNA; a hairpm region about 900 nucleotides from the 3 '-end in the common strain of TMV Any RNA, including subgenomic RNAs containing this site, may be packaged into vi ⁇ ons. The discs apparently assume a helical form on interaction with the RNA, and assembly (elongation) then proceeds in both directions (but much more rapidly in the 3'- to 5'- direction from the nucleation site)
• CGMMV-W Cucumber Green Mottle Mosaic virus watermelon strain
• Subgroup I which includes the vulgare, OM, and tomato strain, has an ongm of assembly about 800-1000 nucleotides from the 3 '-end of the RNA genome, and outside the coat protein cistron. Lebeuner ef al , Proc. Natl. Acad. Sci USA 74:149 (1977), and Fukuda et al, Virology 101 :493 (1980).
• Subgroup II which includes CGMMV-W and cornpea strain (Cc) has an ongm of assembly about 300-500 nucleotides from the 3 '-end of the RNA genome and withm the coat-protem cistron
• the coat protem cistron of CGMMV-W is located at nucleotides 176-661 from the 3 '-end
• the 3' noncodmg region is 175 nucleotides long
• the ongm of assembly is positioned within the coat protem cistron.
• Brome Mosaic virus is a member of a group of tnpartite, single-stranded, RNA-contaimng plant viruses commonly referred to as the bromoviruses Each member of the bromoviruses infects a na ⁇ ow range of plants Mechanical transmission of bromoviruses occurs readily, and some members are transmitted by beetles In addition to BV, other bromoviruses include broad bean mottle virus and cowpea chlorotic mottle virus
• a bromovirus vi ⁇ on is lcosahedral, with a diameter of about 26 ⁇ m, contaimng a single species of coat protem
• the bromovirus genome has three molecules of linear, positive-sense, smgle-stranded RNA, and the coat protem mRNA is also encapsidated
• the RNAs each have a capped 5 '-end, and a tRNA-hke structure (which accepts tyrosine) at the 3 '-end Virus assembly occurs m the cytoplasm
• the complete nucleotide sequence of BMV has been identified and characte ⁇ zed as descnbed by Ahlquist et al , J Mol Biol 153 23 (1981)
• a particularly preferred potyvirus is tobacco etch virus (TEV).
• TEV is a well characte ⁇ zed potyvirus and contains a positive-strand RNA genome of 9.5 kilobases encoding for a single, large polyprotem that is processed by three virus-specific protemases
• the nuclear inclusion protem "a" protemase is involved in the maturation of several replication-associated proteins and capsid protem
• the helper component-protemase (HC-Pro) and 35-kDa protemase both catalyze cleavage only at their respective C-termmi
• the proteolytic domain in each of these proteins is located near the C-terminus
• the 35-kDa protemase and HC-Pro denve from the N-termmal region of the TEV polyprotem
• BSMV Most strains of BSMV have three genomic RNAs refered to as alpha( ⁇ ), beta ( ⁇ ), and gamma ( ⁇ ), At least one strain, the Argentina mild (AM) strain has a fourth geneomic RNA that is essentially a deletion mutant of the g RNA All genomic RNAs are capped at the 5' end and have tRNA-hke structures at the 3' end Virus replication and assembly occurs m the cytoplasm
• the complete nucleotide sequence of several strains of BSMV has been identified and characte ⁇ zed (reviewed by Jackson, et al Annual Review of Phytophathology 27 95-121 (1989)), and infectious cDNA clones are available (Petty, et al. Virology 171 -342-349 (1989))
• the selection of the genetic backbone for the viral vectors of the instant invention may depend on the plant host used
• the plant host may be a monocotyledonous or dicotyledonous plant, plant tissue, or plant cell
• plants of commercial interest such as food crops, seed crops, oil crops, ornamental crops and forestry crops are preferred.
• wheat, rice, com, potato, barley, tobacco, soybean canola, maize, oilseed rape, lilies, grasses, orchids, irises, onions, palms, tomato, the legumes, or Arabidopsis can be used as a plant host.
• Host plants may also include those readily infected by an infectious virus, such as Nicotiana, preferably, Nicotiana benthamiana, or Nicotiana clevelandii.
• the plant viral vectors may comprise one or more additional native or non-native subgenomic promoters which are capable of transcribing or expressing adjacent nucleic acid sequences in the plant host.
• These non- native subgenomic promoters are inserted into the plant viral nucleic acids without destroying the biological function of the plant viral nucleic acids using known methods in the art.
• the CaMV promoter can be used when plant cells are to be transfected.
• the subgenomic promoters are capable of functioning in the specific host plant. For example, if the host is tobacco, TMV, tomato mosaic virus, or other viruses containing subgenomic promoter may be utilized.
• recombinant plant viral vectors are constructed to express a fusion between a plant viral coat protem and the foreign genes or polypeptides of interest
• a recombinant plant virus provides for high level expression of a nucleic acid of interest
• the locat ⁇ on(s) where the viral coat protein is joined to the amino acid product of the nucleic acid of interest may be referred to as the fusion joint
• a given product of such a construct may have one or more fusion joints
• the fusion joint may be located at the carboxyl terminus of the viral coat protem or the fusion joint may be located at the ammo terminus of the coat protein portion of the construct
• there are two fusion joints That is, the nucleic acid of interest may be located 5', 3', upstream, downstream or within the coat protein
• the nucleic acid of interest may be located 5', 3', upstream, downstream or within the coat protein
• nucleic sequences encoding reporter protem(s) or antibiotic/herbicide resistance gene(s) may be constructed as earner prote ⁇ n(s) for the polypeptides of interest, which may facilitate the detection of polypeptides of interest
• green fluorescent protem GFP
• GUS ⁇ -glucuronidase
• a dmg resistance marker such as a gene whose expression results in kanamycin resistance, may be used.
• the cDNA is positioned adjacent a suitable promoter so that the RNA is produced in the production cell.
• the RNA is capped using conventional techniques, if the capped RNA is the infective agent.
• the capped RNA can be packaged in vitro with added coat protein from TMV to make assembled virions. These assembled virions can then be used to inoculate plants or plant tissues.
• an uncapped RNA may also be employed in the embodiments of the present invention. Contrary to the practiced art in scientific literature and in issued patent (Ahlquist et al, U.S. Patent No. 5,466,788), uncapped transcripts for vims expression vectors are infective on both plants and in plant cells.
• nucleotides may be added between the transcription start site of the promoter and the start of the cDNA of a viral nucleic acid to constmct an infectious viral vector.
• One or more nucleotides may be added.
• the inserted nucleotide sequence may contain a G at the 5 '-end.
• the inserted nucleotide sequence may be GNN, GTN, or their multiples, (GNN) x or (GTN) x .
• each nucleic acid may require its own origin of assembly.
• Each nucleic acid could be prepared to contain a subgenomic promoter and a non-native nucleic acid.
• the insertion of a non-native nucleic acid into the nucleic acid of a monopartite vims may result in the creation of two nucleic acids (i.e., the nucleic acid necessary for the creation of a bipartite viral vector). This would be advantageous when it is desirable to keep the replication and transcription or expression of the nucleic acid of interest separate from the replication and translation of some of the coding sequences of the native nucleic acid.
• the recombinant plant viral nucleic acid may be prepared by cloning a viral nucleic acid. If the viral nucleic acid is DNA, it can be cloned directly into a suitable vector using conventional techniques. One technique is to attach an origin of replication to the viral DNA which is compatible with the cell to be transfected. In this manner, DNA copies of the chimeric nucleotide sequence are produced in the transfected cell. If the viral nucleic acid is RNA, a DNA copy of the viral nucleic acid is first prepared by well-known procedures. For example, the viral RNA is transcribed into DNA using reverse transcriptase to produce subgenomic DNA pieces, and a double-stranded DNA may be produced using DNA polymerases.
• cDNA is then cloned into appropriate vectors and cloned into a cell to be transfected.
• cDNA is first attached to a promoter which is compatible with the production cell.
• the recombinant plant viral nucleic acid can then be cloned into any suitable vector which is compatible with the production cell.
• the recombinant plant viral nucleic acid is inserted in a vector adjacent a promoter which is compatible with the production cell.
• the cDNA ligated vector may be directly transcribed into infectious RNA in vitro and inoculated onto the plant host.
• the cDNA pieces are mapped and combined in proper sequence to produce a full-length DNA copy of the viral RNA genome, if necessary.
• the donor organism from which a library of sequence inserts is derived includes Kingdom Monera, Kingdom Protista, Kingdom Fungi, Kingdom Plantae and Kingdom Animalia.
• Kingdom Monera includes subkingdom Archaebacteriobionta (archaebacteria): division Archaebacteriophyta (methane, salt and sulfolobus bacteria); subkingdom Eubacteriobionta (tme bacteria): division Eubacteriophyta; subkingdom Viroids; and subkingdom Viruses.
• the first step is to constmct a cDNA library, a genomic DNA library, or a pool of mRNA of the donor organism
• Full-length cDNAs or genomic DNA can be obtained from public or p ⁇ vate repositones
• cDNA and genomic hbra ⁇ es from bovine, chicken, dog, drosophila, fish, frog, human, mouse, porcine, rabbit, rat, and yeast; and retroviral libraries can be obtained from Clontech (Palo Alto, CA)
• cDNA library can be prepared from a field sample by methods known to a person of ordinary skill, for example, isolating mRNAs and transcnbing mRNAs into cDNAs by reverse transc ⁇ ptase (see e g , Sambrook et al , Molecular Cloning A Laboratory Manual (2nd ed ), Vols 1-3, Cold Spnng
• a pool of genes, which are overexpressed in a tumor cell line compared with a normal cell line can be prepared or obtained from public or p ⁇ vate repositones Zhang et al (Science, 276 1268-1272 (1997)) report that using a method of se ⁇ al analysis of gene expression (SAGE) (Velculescu et al, Cell, 88:243 (1997)), 500 transcripts that were expressed at significantly different levels in normal and neoplastic cells were identified.
• SAGE se ⁇ al analysis of gene expression
• the expression of DNAs that overexpresses in a tumor cell line in a host organism may cause changes in the host organism, thus a pool of such DNAs is another source for DNA inserts for this invention.
• the BAC/YAC/TAC DNAs, DNAs or cDNAs can be mechanically size-fractionated or digested by an enzyme to smaller fragments.
• the fragments are ligated to adapters with cohesive ends, and shotgun-cloned into recombinant viral nucleic acid vectors.
• the fragments can be blunt-end ligated into recombinant viral nucleic acid vectors.
• Recombinant viral nucleic acids containing a nucleic acid sequence derived from the cDNA library or genomic DNA library is then constmcted using conventional techniques.
• the recombinant viral nucleic acid vectors produced comprise the nucleic acid insert derived from the donor organism.
• the donor plant and the host plant may be genetically remote or unrelated: they may belong to different genus, family, order, class, subdivision, or division.
• Donor plants include plants of commercial interest, such as food crops, seed crops, oil crops, ornamental crops and forestry crops. For example, wheat, rice, com, potatoes, barley, tobaccos, soybean canola, maize, oilseed rape, Arabidopsis, Nicotiana can be selected as a donor plant.
• Genomic DNAs represented in BAC Bacte ⁇ al artificial chromosome
• YAC yeast artificial chromosome
• TAC transformation-competent artificial chromosome
• hbranes can be obtained from public or p ⁇ vate repositones, for example, the Arabidopsis Biological Resource Center
• the BAC/YAC/TAC DNAs or cDNAs can be mechanically size-fractionated or digested by an enzyme to smaller fragments
• the fragments are ligated to adapters with cohesive ends, and shotgun-cloned into recombinant viral nucleic acid vectors Alternatively, the fragments can be blunt-end ligated into recombinant viral nucleic acid vectors
• Sequences from wheat, nee, com, potato, barley, tobacco, soybean, canola, maize, oilseed rape, Arabidopsis, and other crop species may be used to assemble the DNA hbranes This method may thus be used to search for useful dominant gene phenotypes from DNA hbranes through the gene expression
• Individual clones may be transfect into the plant host: 1) protoplasts, 2) whole plants; or 3) plant tissues, such as leaves of plants (Dijkstra et al, Practical Plant Virology Protocols and Exercises, Sp ⁇ nger Verlag (1998); Plant Virology Protocol: From Virus Isolation to Transgenic Resistance in Methods in Molecular Biology, Vol. 81, Foster and Taylor, Ed., Humana Press (1998)).
• the delivery of the plant vims expression vectors into the plant may be affected by the inoculation of in vitro transcnbed RNA, inoculation of vinons, or internal inoculation of plant cells from nuclear cDNA, or the systemic infection resulting from any of these procedures. In all cases, the co-infection may lead to a rapid and pervasive systemic expression of the desired nucleic acid sequences in plant cells.
• the host can be infected with a recombinant viral nucleic acid or a recombinant plant vims by conventional techniques.
• Suitable techniques include, but are not limited to, leaf abrasion, abrasion m solution, high velocity water spray, and other injury of a host as well as imbibing host seeds with water containing the recombinant viral RNA or recombinant plant vims. More specifically, suitable techniques include: (a) Hand Inoculations Hand inoculations are performed using a neutral pH, low molanty phosphate buffer, with the addition of cehte or carborundum (usually about 1 %). One to four drops of the preparation is put onto the upper surface of a leaf and gently mbbed.
• Ballistics High Pressure Gun Inoculation. Single plant inoculations can also be performed by particle bombardment.
• a ballistics particle delivery system BioRad Laboratories, Hercules, (A) can be used to transfect plants such as N. benthamiana as described previously ( ⁇ agar et al, Plant Cell, 7:705-719 (1995)).
• An alternative method for introducing viral nucleic acids into a plant host is a technique known as agroinfection or Agrobacterium-mQdiated transformation (also known as Agro-infection) as described by Grimsley et ⁇ l, Nature 325: 177 (1987).
• This technique makes use of a common feature of Agrobacterium which colonizes plants by transferring a portion of their D ⁇ A (the T-D ⁇ A) into a host cell, where it becomes integrated into nuclear D ⁇ A.
• the T-D ⁇ A is defined by border sequences which are 25 base pairs long, and any D ⁇ A between these border sequences is transferred to the plant cells as well.
• agro-infection of a susceptible plant could be accomplished with a virion containing a recombinant plant viral nucleic acid based on the nucleotide sequence of any of the above vimses. Particle bombardment or electrosporation or any other methods known in the art may also be used.
• infection may also be attained by placing a selected nucleic acid sequence into an organism such as E. coli, or yeast, either integrated into the genome of such organism or not, and then applying the organism to the surface of the host organism. Such a mechanism may thereby produce secondary transfer of the selected nucleic acid sequence into a host organism. This is a particularly practical embodiment when the host organism is a plant.
• infection may be attained by first packaging a selected nucleic acid sequence in a pseudovims. Such a method is described in WO 94/10329. Though the teachings of this reference may be specific for bacteria, those of skill in the art will readily appreciate that the same procedures could easily be adapted to other organisms.
• Plant may be grown from seed in a mixture of "Peat-Lite MixTM (Speedling, Inc. Sun City, FI) and NutricoteTM controlled release fertilizer 14-14-14 (Chiss-Asahi Fertilizer Co., Tokyo, Japan). Plants may be grown in a controlled environment provided 16 hours of light and 8 hours of darkness. Sylvania "Gro-Lux Aquarium” wide spectrum 40 watt fluorescent grow lights. (Osram Sylvania Products, Inc. Danvers, MA) may be used. Temperatures may be kept at around 80° F during light hours and 70° F during dark hours. Humidity may be between 60 and 85%.
• phenotypic or biochemical changes as a result of expression. After a plant host is infected with individual clone of the library, one or more phenotypic or biochemical changes may be detected.
• Phenotypic changes in a plant host may be determined by any known methods in the art. Phenotypic changes may include growth rate, color, or morphology changes. Typically, these methods include visual, macroscopic or microscopic analysis. For example, growth changes, such as stunting, color changes (e.g. leaf yellowing, mottling, bleaching, chlorosis) among others are easily visualized. Examples of morphological changes include, developmental defects, wilting, necrosis, among others.
• Biochemical changes can be determined by any analytical methods known in the art for detecting, quantitating, or isolating DNA, RNA, proteins, antibodies, carbohydrates, lipids, and small molecules. Selected methods may include Northern, Western blotting, MALDI-TOF, LC/MS, GC/MS, two-dimensional IEF/SDS-PAGE, ELISA, etc. In particular, suitable methods may be performed in a high-throughput, fully automated fashion using robotics. Examples of biochemical changes may include the accumulation of substrates or products from enzymatic reactions, changes in biochemical pathways, inhibition or augmentation of endogenous gene expression in the cytoplasm of cells, changes in the RNA or protein profile.
• the biochemical or phenotypic changes in the infected host plant may be co ⁇ elated to the biochemistry or phenotype of a host plant that is uninfected.
• the biochemical or phenotypic changes in the infected host plant is further co ⁇ elated to a host plant that is infected with a viral vector that contains a control nucleic acid of a known sequence.
• the control nucleic acid may have similar size but is different in sequence from the nucleic acid insert derived from the library.
• nucleic acid insert de ⁇ ved from the library is identified as encoding a GTP binding protem m an antisense o ⁇ entation
• a nucleic acid denved from a gene encoding green fluorescent protein can be used as a control nucleic acid
• Green fluorescent protem is known not to have the same effect as the GTP binding protein when expressed in a host plant
• the phenotypic or biochemical trait may be determined by complementation analysis, that is, by observing the endogenous gene or genes whose function is replaced or augmented by introducing the nucleic acid of interest A discussion of such phenomenon is provided by Napoh et al , 77ze Plant Cell 2 279-289 (1990)
• the phenotypic or biochemical trait may also be determined by (l)analyz ⁇ ng the biochemical alterations m the accumulation of substrates or products from enzymatic reactions according to any means known by those skilled in the art, (2) by observing any changes in biochemical pathways which may be modified in a host orgamsm as a result of expression of the nucleic acid; (3) by utilizing techniques known by those skilled m the art to observe inhibition of endogenous gene expression in the cytoplasm of cells as a result of expression of the nucleic acid , (4) by utilizing techniques known by those skilled in the art to observe changes in the RNA or protem profile as a result of expression of the nucleic acid,
• EST/DNA library from a donor organism may be assembled into a viral transcnption plasmid
• the nucleic acid sequences in the transc ⁇ ption plasmid library may then be introduced into host cells as part of a functional RNA vims which post-transcnptionally silences the homologous target gene
• the EST/DNA sequences may be introduced into a viral vector in either the plus or anti sense o ⁇ entation, and the o ⁇ entation can be either directed or random based
• the EST/cDNA sequences can be inserted into the genomic RNA of a viral vector such that they are represented as genomic RNA during the viral replication in host cells.
• the library of EST clones is then transcribed into infectious RNAs and inoculated onto a host organism susceptible to viral infection.
• the viral RNAs containing the EST/cDNA sequences contributed from the original library are now present in a sufficiently high concentration in the cytoplasm of host organism cells such that they cause post-transcriptional gene silencing of the endogenous gene in a host organism. Since the replication mechanism of the vims produces both sense and antisense RNA sequences, the orientation of the EST/cDNA insert is normally irrelevant in terms of producing the desired phenotype in the host organism.
• the present invention provides a method to express transiently viral-derived positive sense or antisense RNAs in transfected plants. Such method is much faster than the time required to obtain genetically engineered antisense transgenic organisms. Systemic infection and expression of viral antisense RNA occurs as short as several days post inoculation, whereas it takes several months or longer to create a single transgenic organism.
• the invention provides a method to identify genes involved in the regulation of growth by inhibiting the expression of specific endogenous genes using viral vectors. This invention provides a method to characterize specific genes and biochemical pathways in donor organisms or in host plants using an RNA viral vector.
• the present invention provides a method of silencing a gene in a host organism by transfecting a non-plant host organism with a viral nucleic acid comprising a nucleic acid insert derived from a cDNA library or a genomic DNA library or a pool of RNA from a non-plant organism.
• a viral nucleic acid comprising a nucleic acid insert derived from a cDNA library or a genomic DNA library or a pool of RNA from a non-plant organism.
• the sequence of the nucleic acid insert in the present invention does not need to be identified prior to the transfection.
• GTP binding proteins In eukaryotic cells, GTP -binding proteins function in a variety of cellular processes, including signal transduction, cytoskeletal organization, and protein transport. Low molecular weight (20-25 K Daltons) of GTP-binding proteins include ras and its close relatives (for example, Ran), rho and its close relatives, the rab family, and the ADP- ribosylation factor (ARF) family.
• Ran ras and its close relatives
• ARF ADP- ribosylation factor
• the heterotrimeric and monomeric GTP-binding proteins that may be involved in secretion and intracellular transport are divided into two structural classes: the rab and the ARF families.
• the ARFs from many organisms have been isolated and characterized.
• the ARFs share structural features with both the ras and trimeric GTP- binding protein families.
• the present invention demonstrates that genes of one plant, such as Nicotiana, which encode GTP binding proteins, can be silenced by transfection with infectious RNAs from a clone containing GTP binding protein open reading frame in an antisense orientation, derived from a plant of a different family, such as Arabidopsis.
• the present invention also demonstrates that GTP binding proteins are highly homologous in human, frog, mouse, bovine, fly and yeast, not only at the amino acid level, but also at the nucleic acid level.
• the present invention thus provides a method to silence a conserved gene in a host organism, by transfecting the host with infectious RNAs derived from a homologous gene of a non-plant organism.
• Nucleic acid sequences that may result in changing a host phenotype include those involved in cell growth, proliferation, differentiation and development; cell commumcation; and the apoptotic pathway.
• Genes regulating growth of cells or organisms include, for example, genes encoding a GTP binding protein, a ribosomal protein L19 protein, an S18 ribosomal protein, etc. Henry et al.
• Genes involved in development of cells or organisms include, for example, homeobox-containing genes and genes encoding G-protein-coupled receptor proteins such as the rhodopsin family.
• Homeobox genes are a family of regulatory genes containing a common 183-nucleotide sequence (homeobox) and coding for specific nuclear proteins (homeoproteins) that act as transcription factors.
• the homeobox sequence itself encodes a 61-amino-acid domain, the homeodomain, responsible for recognition and binding of sequence-specific DNA motifs. The specificity of this binding allows homeoproteins to activate or repress the expression of batteries of downstream target genes.
• a Library of human nucleic acid sequences is cloned into vectors.
• the vectors are applied to the host to obtain infection.
• Each infected host is grown with an uninfected host and a host infected with a null vector.
• a null vector will show no phenotypic or biochemical change other than the effects of the vims itself.
• Each host is observed daily for visual differences between the infected host and its two controls.
• a trait is identified.
• the donor nucleic acid sequence is identified, the full-length gene sequence is obtained and the full-length gene in the host is obtained, if a gene from the host is associated with the trait. Both genes are sequenced and homology is determined.
• a variety of biochemical tests may also be made on the host or host tissue depending on the information that is desired.
• a variety of phenotypic changes or traits and biochemical tests are set forth in this document.
• a functional gene profile can be obtained by repeating the process several times.
• Links may be made between sequences from various species predicted to carry out similar biochemical or regulatory functions. Links may also be generated between predicted enzymatic activities and visually displayed biochemical and regulatory pathways. Likewise, links may be generated between predicted enzymatic or regulatory activity and known small molecule inhibitors, activators, substrates or substrate analogs. Phenotypic data from expression libraries expressed in transfected hosts may be automatically linked within such a relational database. Genes with similar predicted roles of interest in other organisms may be rapidly discovered.
• the present invention is also directed to a method of changing the phenotype or biochemistry of a plant by expressing transiently a nucleic acid sequence from a donor plant in an antisense orientation in a host plant, which inhibits an endogenous gene expression in the meristem of the host plant.
• the one or more phenotypic or biochemical changes in the host plant are detected by methods as describes previously.
• Transient expressing a nucleic acid sequence in a host plant can affect the gene expression in meristem.
• Meristems are of interest in plant development because plant growth is driven by the formation and activity of meristems throughout the entire life cycle. This invention is exemplified by a nucleic acid sequence encoding ribosomal protein SI 8.
• S18 promoter The activity of S18 promoter is restricted to meristems (Lijsebettesn et al, EMBO J. J_3: 3378-3388).
• Transient expression of a nucleic acid sequence in a host plant can trigger a signal transmitting to meristems and affect the gene expression in meristem.
• nucleic acids may be inserted into the viral genome to effectively silence a particular gene function or to silence the function of a multigene family. It is presently believed that about 20% of plant genes exist in multigene families.
• RNA can reduce the expression of a target gene through inhibitory RNA interactions with target mRNA that occur m the cytoplasm and/or the nucleus of a cell.
• An EST/cDNA library from a plant such as Arabidopsis thaliana may be assembled into a plant viral transc ⁇ ption plasmid background.
• the cDNA sequences in the transcnption plasmid library can then be introduced into plant cells as cytoplasmic RNA in order to post-transc ⁇ ptionally silence the endogenous genes.
• the EST/cDNA sequences may be introduced into the plant viral transcnption plasmid in either the plus or anti-sense onentation (or both), and the o ⁇ entation can be either directed or random based on the clomng strategy.
• a high-throughput, automated cloning strategy using robotics can be used to assemble the library.
• the EST clones can be inserted behind a duplicated subgenomic promoter such that they are represented as subgenomic transcnpts dunng viral replication in plant cells
• the EST/cDNA sequences can be inserted into the genomic RNA of a plant viral vector such that they are represented as genomic RNA dunng the viral replication in plant cells.
• the library of EST clones is then transcnbed into infectious RNAs and inoculated onto a host plant susceptible to viral infection.
• the viral RNAs containing the EST/cDNA sequences cont ⁇ aded from the o ⁇ ginal library are now present in a sufficiently high concentration in the cytoplasm of host plant cells such that they cause post- transcnptional gene silencing of the endogenous gene m a host plant. Since the replication mechanism of the vims produces both sense and antisense RNA sequences, the onentation of the EST/cDNA insert is normally irrelevant m terms of producing the desired phenotype in the host plant.
• the present invention also provides a method of isolating a conserved gene such as a gene encoding a GTP binding protem, from nee, barley, co , soybean, maize, oilseed, and other plant of commercial interest, using another gene having homology with gene being isolated.
• Libranes containing full-length cDNAs from a donor plant such as ⁇ ce, barley, com, soybean and other important crops can be obtained from public and p ⁇ vate sources or can be prepared from plant mRNAs
• the cDNAs are inserted in viral vectors or in small subclomng vectors such as pBluescnpt (Strategene), pUC18, M13, or pBR322.
• Transformed bacte ⁇ a are then plated and individual clones selected by a standard method.
• the bactena transformants or DNAs are rearrayed at high density onto membrane filters or glass slides.
• Full-length cDNAs encoding GTP binding proteins can be identified by probing filters or slides with labeled nucleic acid inserts which result in changes in a host plant, or labeled probes prepared from DNAs encoding GTP binding proteins from Arabidopsis
• Useful labels include radioactive, fluorescent, or chemiluminecent molecules, enzymes, etc.
• genomic hbranes containing sequences from ⁇ ce, barley, com, soybean and other important crops can be obtained from public and p ⁇ vate sources, or be prepared from plant genomic DNAs BAC clones containing entire plant genomes have been constmcted and organized m a minimal overlapping order Individual BACs are sheared to fragments and directly cloned into viral vectors.
• Genomic clones can be identified by probing filters contaimng BACs with labeled nucleic acid inserts which result m changes in a host plant, or with labeled probes prepared from DNAs encoding GTP binding proteins from Arabidopsis
• Useful labels include radioactive, fluorescent, or chemiluminecent molecules, enzymes, etc BACs that hyb ⁇ dize to the probe are selected and their corresponding BAC viral vectors are used to produce infectious RNAs Plants that are transfected with the BAC subhbrary are screened for change of function, for example, change of growth rate or change of color
• the inserts from these clones or their corresponding plasmid DNAs are characte ⁇ zed by dideoxy sequencing This provides a rapid method to obtain the genomic sequence for a plant protein, for example, a GTP binding protein Using this method, once the DNA sequence in one plant such as Arabid
• a functional genomics screen is set up using a tobacco mosaic vims TMV-0 coat protein capsid for infection of Nicotiana benthamiana, a plant related to the common tobacco plant.
• a tobacco mosaic vims TMV-0 coat protein capsid for infection of Nicotiana benthamiana, a plant related to the common tobacco plant.
• Arabidopsis thaliana cDNA hbranes are obtained from the Arabidopsis Biological Resource Center, Bluesc ⁇ pt® phagemid vectors are recovered by Not 1 digestion cD ⁇ A is transformed into a plasmid.
• the plasmid is transcnbed into viral vector R ⁇ A
• the inserts are m the antisense onentation as in Figure until all of the cD ⁇ A from each cD ⁇ A library is represented on viral vectors
• Each viral vector is sprayed onto the leaf of a two-week old N benthamiana plant host with sufficient force to cause tissue injury and localized viral infection
• Each infected plant is grown side by side with an uninfected plant and a plant infected with a null insert vector as controls. All plants are grown in an artificial environment having 16 hours of light and 8 hours of dark. Lumens are approximately equal on each plant. At intervals of 2 days a visual and photographic observation of phenotype is made and recorded for each infected plant and each of its controls and a comparison is made.
• the nucleic acid insert contained in the viral vector clone 74OAT#120 is responsible for severe stunting of one of the plants.
• Clone 740 AT #120 is sequenced.
• the homologue from the plant host is also sequenced.
• the 740AT #120 clone is found to have 80% homology to plant host nucleic acid sequence.
• the amino acid sequence of homology is 96%.
• the entire cDNA sequence of the insert is obtained by sequencing and found to code for a GTP binding protein.
• the host plant homologue is selected and sequenced. It also codes for a GTP binding protein. We conclude that this GTP binding protein coding sequence is highly conserved in nature. This information is useful in pharmaceutical development as well as in toxicology studies.
• a complete classification scheme of gene functionality for a fully sequenced eukaryotic organism has been established for yeast. This classification scheme may be modified for plants and divided into the appropriate categories. Such organizational stmcture may be utilized to rapidly identify herbicide target loci which may confer dominant lethal phenotypes, and thereby is useful in helping to design rational herbicide programs.
• the present invention is also directed to a method of increasing yield of a grain crop.
• Rice Biotechnology Quarterly 37:4 (1999) and Ashikari et al, Proc. Natl. Acad. Sci. USA 96:10284-10289 (1999)) it is reported that a transgenic rice plant transformed with a rgpl gene, which encodes a small GTP binding protein from rice, was shorter than a control plant, but it produced more seeds than the control plant.
• the present method comprises expressing transiently a nucleic acid sequence of a donor plant in an antisense orientation in the grain crop, wherein said expressing results in stunted growth and increased seed production of said grain crop.
• a preferred method comprises the steps of cloning the nucleic acid sequence into a plant viral vector and infecting the grain crop with a recombinant viral nucleic acid comprising said nucleic acid sequence.
• Preferred plant viral vector is derived from a Brome Mosaic vims, a Rice Necrosis vims, or a geminivims.
• Preferred grain crops include rice, wheat, and barley.
• the nucleic acid expressed in the host plant for example, comprises a GTP binding protein open reading frame having an antisense orientation.
• the present method provides a transiently expression of a gene to obtain a stunted plant. Because less energy is put into plant growth, more energy is available for production of seed, which results in increase yield of a grain crop.
• the present method has an advantage over other method using a transgenic plant, because it does not have an effect on the genome of a host plant.
• Adjacent A position in a nucleotide sequence proximate to and 5' or 3' to a defined sequence. Generally, adjacent means within 2 or 3 nucleotides of the site of reference.
• RNA molecules may be from either an RNA vims or mRNA from the host cells genome or from a DNA vims.
• Cell Culture A proliferating group of cells which may be in either an undifferentiated or differentiated state, growing contiguously or non-contiguously.
• Chimeric Sequence or Gene A nucleotide sequence derived from at least two heterologous parts.
• the sequence may comprise DNA or RNA.
• Coding Sequence A deoxyribonucleotide or ribonucleotide sequence which, when either transcribed and translated or simply translated, results in the formation of a cellular polypeptide or a ribonucleotide sequence which, when translated, results in the formation of a cellular polypeptide.
• a vector or plant or animal viral nucleic acid which is compatible with a host is one which is capable of replicating in that host.
• a coat protein which is compatible with a viral nucleotide sequence is one capable of encapsidating that viral sequence.
• Complementation Analysis As used herein, this term refers to observing the changes produced in an organism when a nucleic acid sequence is introduced into that organism after a selected gene has been deleted or mutated so that it no longer functions fully in its normal role A complementary gene to the deleted or mutated gene can restore the genetic phenotype of the selected gene
• Dual Heterologous Subgenomic Promoter Expression System a plus stranded RNA vector having a dual heterologous subgenomic promoter expression system to increase, decrease, or change the expression of proteins, peptides or RNAs, preferably those descnbed in U S Patent Nos 5,316,931, 5,811,653, 5,589,367, and 5,866,785, the disclosure of which is incorporated herein by reference
• ESTs Relatively short single-pass DNA sequences obtained from one or more ends of cDNA clones and RNA denved therefrom They may be present in either the 5' or the 3' o ⁇ entation ESTs have been shown useful for identifying particular genes
• a functional Gene Profile The collection of genes of an organism which code for a biochemical or phenotypic trait
• the functional gene profile of an organism is found by screening nucleic acid sequences from a donor organism by over expression or suppression of a gene m a host organism
• a functional gene profile requires a collection or library of nucleic acid sequences from a donor organism
• a functional gene profile will depend on the ability of the collection or library of donor nucleic acids to cause over-expression or suppression in the host organism Therefore, a functional gene profile will depend upon the quantity of donor genes capable of causing over-expression or suppression of host genes or of being expressed in the host orgamsm in the absence of a homologous host gene
• Gene silencing A reduction in gene expression A viral vector expressing gene sequences from a host may induce gene silencing of homologous gene sequences
• Host A cell, tissue or organism capable of replicating a nucleic acid such as a vector or viral nucleic acid and which is capable of being infected by a vims containing the viral vector or viral nucleic acid.
• This term is intended to include prokaryotic and eukaryotic cells, organs, tissues or organisms, where appropriate. Bacteria, fungi, yeast, and animal (cell, tissues, or organisms), are examples of a host.
• Infection The ability of a vims to transfer its nucleic acid to a host or introduce a viral nucleic acid into a host, wherein the viral nucleic acid is replicated, viral proteins are synthesized, and new viral particles assembled.
• transmissible and infective are used interchangeably herein.
• the term is also meant to include the ability of a selected nucleic acid sequence to integrate into a genome, chromosome or gene of a target organism.
• Insert a stretch of nucleic acid seqeunce, typically more than 20 base pairs long.
• Multigene family A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those which encode the histones, hemoglobins, immunoglobulins, histocompatibility antigens, actions, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins.
• Non-Native Any RNA or DNA sequence that does not normally occur in the cell or organism in which it is placed. Examples include recombinant viral nucleic acids and genes or ESTs contained therein. That is, an RNA or DNA sequence may be non-native with respect to a viral nucleic acid. Such an RNA or DNA sequence would not naturally occur in the viral nucleic acid. Also, an RNA or DNA sequence may be non-native with respect to a host organism. That is, such a RNA or DNA sequence would not naturally occur in the host organism.
• Nucleic acid As used herein the term is meant to include any DNA or RNA sequence from the size of one or more nucleotides up to and including a complete gene sequence. The term is intended to encompass all nucleic acids whether naturally occurring in a particular cell or organism or non-naturally occurring in a particular cell or organism.
• Nucleic acid of interest The term is intended to refer to the nucleic acid sequence whose function is to be determined. The sequence will normally be non-native to a viral vector but may be native or non-native to a host organism.
• Phenotypic Trait An observable, measurable or detectable property resulting from the expression or suppression of a gene or genes.
• Plant Cell The stmctural and physiological unit of plants, consisting of a protoplast and the cell wall.
• Plant Organ A distinct and visibly differentiated part of a plant, such as root, stem, leaf or embryo.
• Plant Tissue Any tissue of a plant in plant or in culture. This term is intended to include a whole plant, plant cell, plant organ, protoplast, cell culture, or any group of plant cells organized into a stmctural and functional unit.
• Positive-sense inhibition A type of gene regulation based on cytoplasmic inhibition of gene expression due to the presence in a cell of an RNA molecule substantially homologous to at least a portion of the mRNA being translated.
• Promoter The 5 '-flanking, non-coding sequence substantially adjacent a coding sequence which is involved in the initiation of transcription of the coding sequence.
• Protoplast An isolated plant or bacterial cell without some or all of its cell wall.
• Viral nucleic acid which has been modified to contain non-native nucleic acid sequences. These non-native nucleic acid sequences may be from any organism or purely synthetic, however, they may also include nucleic acid sequences naturally occurring in the organism into which the recombinant viral nucleic acid is to be introduced.
• Recombinant Vims A vims containing the recombinant viral nucleic acid.
• Subgenomic Promoter A promoter of a subgenomic mRNA of a viral nucleic acid.
• Substantial Sequence Homology Denotes nucleotide sequences that are substantially functionally equivalent to one another. Nucleotide differences between such sequences having substantial sequence homology are insignificant in affecting function of the gene products or an RNA coded for by such sequence.
• Systemic Infection Denotes infection throughout a substantial part of an organism including mechanisms of spread other than mere direct cell inoculation but rather including transport from one infected cell to additional cells either nearby or distant.
• Transient Expression Expression of a nucleic acid sequence in a host without insertion of the nucleic acid sequence into the host genome, such as by way of a viral vector.
• Transposon A nucleotide sequence such as a DNA or RNA sequence which is capable of transfernng location or moving withm a gene, a chromosome or a genome
• Arabidopsis thaliana cDNA hbranes obtained from the Arabidopsis Biological Resource Center (ABRC)
• the four hbranes from ABRC were size-fractionated with inserts of 0 5-1 kb (CD4-13), 1-2 kb (CD4-14), 2-3 kb (CD4-15), and 3-6 kb (CD4-16) All hbranes are of high quality and have been used by several dozen groups to isolate genes
• the pBluescnpt® phagemids from the Lambda ZAP II vector were subjected to mass excision and the hbranes were recovered as plasmids according to standard procedures
• the cDNA inserts in the CD4-13 were recovered by digestion with Notl Digestion with Notl in most cases liberated the entire Arabidopsis thaliana cD ⁇ A insert because the ongmal library was assembled with Notl adapters Notl is an 8-base cutter that infrequently cleaves plant D ⁇ A
• the pBS735 transcnption plasmid (FIGURE 1) was digested with PacllXhol and ligated to an adapter D ⁇ A sequence created from the ohgonucleotides 5'-TCGAGCGGCCGCAT-3' (SEQ ID NO 1) and 5'-GCGGCCGC-3'
• the resulting plasmid pBS740 (FIGURE 2) contains a unique Notl restnction site for bidirectional insertion of Notl fragments from the CD4-13 library Recovered colonies were prepared from these for plasmid mimpreps
• EXAMPLE 2 Genomic DNA library constmction in a recombinant viral nucleic acid vector.
• Genomic DNAs represented in BAC (bacterial artificial chromosome) or YAC (yeast artificial chromosome) libraries are obtained from the Arabidopsis Biological Resource Center (ABRC).
• the BAC/YAC DNAs are mechanically size-fractionated, ligated to adapters with cohesive ends, and shotgun-cloned into recombinant viral nucleic acid vectors.
• mechanically size-fractionated genomic DNAs are blunt-end ligated into a recombinant viral nucleic acid vector.
• Recovered colonies are prepared for plasmid minipreps with a Qiagen BioRobot 9600®.
• the plasmid DNA preps done on the BioRobot 9600® are assembled in 96-well format and yield transcription quality DNA.
• the recombinant viral nucleic acidl Arabidopsis genomic DNA library is analyzed by agarose gel electrophoresis (template quality control step) to identify clones with inserts. Clones with inserts are then transcribed in vitro and inoculated onto N. benthamiana and/or Arabidopsis thaliana. Selected leaf disks from transfected plants are then be taken for biochemical analysis.
• Genomic D ⁇ A from Arabidopsis typically contains a gene every 2.5 kb (kilobases) on average. Genomic D ⁇ A fragments of 0.5 to 2.5 kb obtained by random shearing of D ⁇ A were shotgun assembled in a recombinant viral nucleic acid expression/knockout vector library. Given a genome size of Arabidopsis of approximately 120,000 kb, a random recombinant viral nucleic acid genomic D ⁇ A library would need to contain minimally 48,000 independent inserts of 2.5 kb in size to achieve IX coverage of the Arabidopsis genome.
• a random recombinant viral nucleic acid genomic D ⁇ A library would need to contain minimally 240,000 independent inserts of 0.5 kb in size to achieve IX coverage of the Arabidopsis genome.
• Assembling recombinant viral nucleic acid expression/knockout vector libraries from genomic D ⁇ A rather than cD ⁇ A has the potential to overcome known difficulties encountered when attempting to clone rare, low-abundance R ⁇ A's in a cD ⁇ A library.
• a recombinant viral nucleic acid expression/knockout vector library made with genomic D ⁇ A would-be especially useful as a gene silencing knockout library.
• Dual Heterologous Subgenomic Promoter Expression System (DHSPES) expression knockout vector library made with genomic DNA would be especially useful for expression of genes lacking introns.
• other plant species with moderate to small genomes e.g. rose, approximately 80,000 kb
• a recombinant viral nucleic acid expression/knockout vector library can be made from existing BAC/YAC genomic DNA or from newly-prepared genomic DNAs for any plant species.
• EXAMPLE 3 Genomic DNA or cDNA library construction in a DHSPES vector, and transfection of individual clones from said vector library onto T-DNA tagged or transposon tagged or mutated plants.
• Genomic DNA or cDNA library constmction in a recombinant viral nucleic acid vector, and transfection of individual clones from the vector library onto T-DNA tagged or transposon tagged or mutated plants may be performed according to the procedure set forth in Examples 1 and 2. Such a protocol may be easily designed to complement mutations introduced by random insertional mutagenesis of T-DNA sequences or transposon sequences.
• Vegetative N benthamiana plants were harvested 3.3 weeks after sowing and sliced up into three groups of tissue: leaves, stems and roots. Each group of tissue was flash frozen in liquid nitrogen and total R ⁇ A was isolated from each group separately using the following hot borate method. Frozen tissue was ground to a fine powder with a pre-chilled mortar and pestle, and then further homogenized in pre-chilled glass tissue grinder. Immediately thereafter, 2.5 ml/g tissue hot ( ⁇ 82°C) XT Buffer (0.2 M borate decahydrate, 30 mM EGTA, 1% (w/v) SDS. Adjusted pH to 9.0 with 5 ⁇ ⁇ aOH, treated with 0.1% DEPC and autoclaved.
• tissue hot ( ⁇ 82°C) XT Buffer 0.2 M borate decahydrate, 30 mM EGTA, 1% (w/v) SDS. Adjusted pH to 9.0 with 5 ⁇ ⁇ aOH, treated with 0.1% DEPC and autoclaved.
• deoxycholate sodium salt
• 10 mM dithiothreitol 10 mM dithiothreitol
• 15 ⁇ onidet P-40 ⁇ P-40
• 2% (w/v) polyvinylpyrrolidone MW 40,000 (PVP-40)
• the tissue was homogenized 1-2 minutes and quickly decanted to a pre-chilled Oak Ridge centrifuge tube containing 105 ⁇ l of 20 mg/ml proteinase K in DEPC treated water.
• the tissue grinder was rinsed with an additional 1 ml hot XT Buffer per g tissue, which was then added to rest of the homogenate.
• the homogenate was incubated at 42°C at 100 rpm for 1.5 h.
• 2 M KC1 was added to the homogenate to a final concentration of 160 mM, and the mixture was incubated on ice for 1 h to precipitate out proteins.
• the homogenate was centrifuged at 12,000 x g for 20 min at 4°C, and the supernatant was filtered through sterile miracloth into a clean 50 ml Oak Ridge centrifuge tube.
• 8 M LiCl was added to a final concentration of 2 M LiCl and incubated on ice overnight.
• Precipitated RNA was collected by centrifugation at 12,000 x g for 20 min at 4°C. The pellet was washed three times in 3-5 ml 4°C 2 M LiCl.
• RNA pellet was suspended in 2 ml 10 mM Tris-HCl (pH 7.5), and purified from insoluble cellular components by spinning at 12,000 x g for 20 min at 4°C.
• the RNA containing supernatant was transferred to a 15 ml Corex tube and precipitated overnight at -20°C with 2.5 volumes of 100 % ethanol.
• the RNA was pelleted by centrifugation at 9,800 x g for 30 min at 4°C.
• RNA pellet was washed in 1-2 ml cold 70°C ethanol and centrifuged at 9,800 x g for 5 min at 4°C. Residual ethanol was removed from the RNA pellet under vacuum, and the RNA was resuspended in 200 ⁇ l DEPC treated dd-water and transfe ⁇ ed to a 1.5 ml micro fuge tube. The Corex tube was rinsed in 100 ⁇ l DEPC-treated dd-water, which was then added to the rest of the RNA. The RNA was then precipitated with 1/10 volume of 3 M sodium acetate, pH 6.0 and 2.5 volumes of cold 100% ethanol at -20°C for 1-2 h.
• the tube was centrifuged for 20 min at 16,000 x g, and the RNA pellet washed with cold 70% ethanol, and centrifuged for 5 min at 16,000 x g. After drying the pellet under vacuum, the RNA was resuspended in DEPC-treated water. This is the total RNA.
• the viral symptoms consisted of plant stunting with mild chlorosis and distortion of systemic leaves.
• the 27- kDa ⁇ -trichosanthin accumulated in upper leaves (14 days after inoculation) and cross- reacted with an anti-trichosanthin antibody. Plasmid Constructions.
• a hybrid vims consisting of TMV-U1 and ToMV-F was constmcted by swapping an 874-bp BamHl-Kpnl ToMV fragment into pBGC152, creating plasmid TTOl.
• the inserted fragment was verified by dideoxynucleotide sequencing.
• a unique Avrll site was inserted downstream of the Xhol site in TTOl by PCR mutagenesis, creating plasmid TTOIA, using the following ohgonucleotides: 5'-TCCTCGAGCCTAGGCTCGCAAAGTTTCGAACCAAATCCTCA-3 ' (upstream) (SEQ ID NO: 12), 5'-
• TTOIA/PDS + (FIGURE 6) contains the phytoene desaturase cDNA in the positive orientation under the control of the TMV-Ul coat protein subgenomic promoter; while the vector TTOIA/PDS - contains the phytoene desaturase cDNA in the antisense orientation.
• EXAMPLE 8 Expression of phvtoene desaturase in transfected plants using a multipartitie viral vector
• Constmction of a monocot viral vector BSMV is a tripartite RNA vims that infects many agnculturally important monocot species such as oat, wheat and barley (McKinney and Greeley, "Biological charactenstics of barley st ⁇ pe mosaic vims strains and their evolution" Technical Bulletin US Department of Agriculture 1324 (1965))
• An expression vector denved from barley st ⁇ pe mosaic vims (BSMV) was constmcted by modifying a BSMV ⁇ cDNA (Gustafson et al , Virology 158(2) 394-406 (1987)) ( Figure 7A)
• BSMV ⁇ cDNA a monocot viral vector that directs the expression of nucleotide sequences m transfected plants
• Foreign inserts can be placed under the control of the ⁇ b subgenomic promoter
• the infectious BSMV ⁇ cDNA ( ⁇ 42) was modified by site-directed
• Constmction of monocot viral vectors the contain partial maize phvtoene desaturase cDNAs.
• Partial cDNAs encoding phytoene desaturase (PDS) were amplified from com leaf tissue RNA by RT-PCR using ohgonucleotides pairs 175 5'
• the ratio of phytoene synthetase to chlorophyll syntheses was 0.55 in transfected plants and 0.033 in unmoculated plants (control).
• Phytoene synthase activity from plants transfected with TTU51 CTP CrtB was assayed using isolated chloroplasts and labeled [ ⁇ C] geranylgeranyl PP There was a large increase in phytoene and an unidentified C40 alcohol in the CrtB plants
• the chloroplasts were prepared as descnbed previously (Camara, Methods Enzymol 214.352-365 (1993))
• the phytoene synthase assays were earned out m an incubation mixture (0 5 ml final volume) buffered with Tns-HCL, pH 7 6, containing [ ⁇ C] geranylgeranyl PP (100,000 cpm) (prepared using pepper GGPP synthase expressed in E coli), 1 mM ATP, 5 mM MnCl2, 1 mM MgCl2, T ⁇ ton X-100 (20 mg per mg of chloroplast protein) and chloroplast suspension equivalent to 2 mg protein
• the reaction products were extracted with chloroform methanol (Camara, supra) and subjected to TLC onto sihcagel plate developed with benzene/ethyl acetate (90/10) followed by autoradiography.
• Chlorophyll synthetase assay Chlorophyll synthetase assay.
• Tns-HCL pH 7.6 containing [ 14 C] geranylgeranyl PP (100,000 cpm), 5 MgCl2, 1 mM ATP, and mptured plasmid suspension equivalent to 1 mg protem was incubated for 1 hr at 30°C The reaction products were analyzed as descnbed previously
• a unique Sphl site was inserted in the start codon for the Erwinia herbicola phytoene synthase gene by polymerase chain reaction (PCR) mutagenesis (Saiki et al , Science 230.1350-1354 (1985)) using ohgonucleotides CrtB MIS 5'"CCA AGC TTC TCG AGT GCA GCA TGC AGC
• An Arabidopsis thaliana CD4-13 cD ⁇ A library was digested with Notl. D ⁇ A fragments between 500 and 1000 bp were isolated by trough elution and subcloned into the Notl site of pBS740. E coli C600 competent cells were transformed with the pBS740 AT library and colonies containing Arabidopsis cD ⁇ A sequences were selected on LB Amp 50 ug/ml.
• a 841 bp Notl fragment of 740 AT #2441 (FIGURE 10; nucleic acid sequence and amino acid sequence as SEQ ID ⁇ Os: 36 and 37, respectively) containing the Ran GTP binding protein cD ⁇ A was characterized.
• the nucleotide sequencing of 740 AT #2441 was carried out by dideoxy termination using double stranded templates. Nucleotide sequence analysis and amino acid sequence comparisons were performed using DNA Strider, PCGENE and NCBI Blast programs.
• 740 AT #2441 contained an open reading frame (ORF) in the positive orientation that encodes a protein of 221 amino acids with an apparent molecular weight of 25,058 Da. The mass of the protein was calculated using the Voyager program (Perceptive Biosystems).
• FIGURE 11 shows the nucleotide sequence alignment of 740AT #2441 to AF017991 (SEQ. ID. Nos: 38 and 39 respectively), a A thaliana salt stress inducible small GTP binding protein Rani.
• FIGURE 12 shows the nucleotide alignment of 740 AT #2441 to L16787 (SEQ. ID. Nos: 40 and 41 respectively), aN tabacum small ras-like GTP binding protein.
• FIGURE 13 shows the amino acid comparison of 740 AT #2441 to tobacco Ran-Bl GTP binding protein (SEQ. ID. ⁇ os: 42 and 43 respectively).
• the A. thaliana cD ⁇ A exhibits a high degree of homology (99% to 82%) to A. thaliana, tomato (L. esculentum), tobacco (N. tabacum), L. japonicus and bean (V.faba) GTP binding proteins cD ⁇ As (Table 1).
• the nucleotide sequence from 740 AT #2441 encodes a protein that has strong similanty (100%) to 95%) to A thaliana, tomato, tobacco, and bean GTP binding proteins (Table 2)
• the #2441 DNA also exhibits a high degree of homology (67% to 83%) to human, yeast, mouse and drosophila GTP binding proteins cDNAs (Table 3)
• the protein also has 67%-97% identities, and 79%-98% positives to yeast, mammalian organisms such as human (Table 4)
• SW:RAN_VICFA P38548 1 155 536.9 bits) 2.30E-157 212/221 (95%) 216/221 (97%)
• A. thaliana SW:RAN2_ARATH P41917 1 150 534.6 bits
• EXAMPLE 11 Identification of nucleotide sequences involved in the regulation of plant growth bv cytoplasmic inhibition of gene expression in an antisense o ⁇ entation using viral de ⁇ ved R ⁇ A (GTP binding proteins)
• Tobamoviral vectors have been developed for the heterologous expression of uncharacterized nucleotide sequences in transfected plants.
• a partial Arabidopsis thaliana cDNA library was placed under the transcriptional control of a tobamovirus subgenomic promoter in a RNA viral vector. Colonies from transformed E. coli were automatically picked using a Flexys robot and transferred to a 96 well flat bottom block containing terrific broth (TB) Amp 50 ug/ml. Approximately 2000 plasmid DNAs were isolated from overnight cultures using a BioRobot and infectious RNAs from 430 independent clones were directly applied to plants.
• TB terrific broth
• Constmction of an Arabidopsis thaliana cD ⁇ A library in an R ⁇ A viral vector Constmction of an Arabidopsis thaliana cD ⁇ A library in an R ⁇ A viral vector.
• nucleotide sequencing of 740 AT #120 was earned out by dideoxy termination using double stranded templates
• Nucleotide sequence analysis and amino acid sequence compansons were performed using DNA St ⁇ der, PCGENE and NCBI Blast programs 740 AT #120 contained an open reading frame (ORF) in the antisense onentation that encodes a protein of 181 ammo acids with an apparent molecular weight of 20,579 Daltons Sequence companson
• the nucleotide sequence from 740 AT #120 exhibits a high degree of homology (81- 84%, identity and positive) to nee, barley, carrot, com and A th ⁇ h ⁇ n ⁇ DNA encoding ARFs and also a high degree of homology (71-84% identity and positive) to yeast, plants, insects such as fly, amphibian such as frog, mammalian such as bovme, human, and mouse DNA encoding (Table 5)
• the high homology of DNAs encoding GTP binding proteins from yeast, plants, insects, human, mice, and amphibians indicates that DNAs from one donor organism can be transfected into another host organism and silence the endogenous gene of the host organism
• Bovine J03794 426.9 bits (1545) 3.6e-123 409/534 (76%) 409/534 (76%)
• S.pombeARFl L09551 430.2 bits (1557) l.le-121 409/531 (77%) 409/531 (77%) as so Human ARF1 AF05502 428 bits (1549) 5.8e-121 405/524 (77%) 405/524 (77%) frog U31350 414.5 bits (1500) 1.7e-119 412/552(74%) 412/552(74%)
• Bovine 327 bits (829) 2e-89 160/177(90%) 166/177(93%)
• Human ARF1 326 bits (827) 4e-89 160/177(90%,) 166/177(93%) mouse 326 bits (827) 4e-89 160/177(90%) 166/177(93%) fly 325 bits (825) 7e-89 158/177(89%) 166/177(93%)
• the protein encoded by 740 AT #120, 120P contained three conserved domains: the phosphate binding loop motif, GLDAAGKT (SEQ ID N0.49), (consensus GXXXXGKS/T, SEQ ID NO.50); the G' motif, DVGGQ (SEQ ID NO:51), (consensus DXXGQ, SEQ ID NO:52), a sequence which interacts with the gamma-phosphate of GTP; and the G motif NKQD (SEQ ID NO:53), (consensus NKXD, SEQ. ID. 54), which is specific for guamdmyl binding.
• the 120P contains a putative glycine-my ⁇ stoylation site at position 2, a potential N-glycosylation site (NXS) at position 60, and several putative senne/threonme phosphorylations sites
• the nucleotide sequence from 740 AT #120 is also compared with a human ADP ⁇ bosylation factor (ARF3) M33384, which shows a strong similanty (76%, identity at the nucleotide level and 87%, identity at the amino acid level)
• ARF3 human ADP ⁇ bosylation factor
• the amino acid sequence alignment of 740 AT #120 to human ADP-nbosylation factor (ARF3) P16587 is compared in FIGURE 17 (SEQ. ID. Nos- 55-57), which shows 87% identity and 90% positive
• a humanized sequence, 740 AT#120 H nucleic acid sequence is prepared by changing the 740 AT#120 nucleic acid sequence so that it encodes the same ammo acid sequence as the human M33384 encodes.
• the nucleic acid is changed by a standard method such as site directed mutagemsis or DNA synthesis.
• FIGURE 18 shows the sequence alignment of 740 AT #120H to human ARF3 M33384
• a genomic clone encoding A thaliana ARF can be isolated by probing filters containing A thaliana BAC clones using a 32 P labeled 740 AT #120 Notl insert.
• Other members of the A. thaliana ARF multigene family have been identified using programs of the University of Wisconsin Genetic Computer Group
• the BAC clone T08I13 located on chromosome II has a high degree of homology to 740 AT #120 (78% to 86% identity at the nucleotide level). Isolation and characte ⁇ zation of a cDNA encoding Nicotiana benthamiana ARF
• a 488 bp cDNA from N benthamiana stem cDNA library was isolated by polymerase chain reaction (PCR) using the following ohgonucleotides ATARFK15, 5' AAG AAG GAG ATG CGA ATT CTG ATG GT 3' (upstream) (SEQ ID NO 61), ATARFN176, 5' ATG TTG TTG GAG AGC CAG TCC AGA CC 3' (downstream) (SEQ ID NO 62)
• the vent polymerase in the reaction was inactivated using phenol/chloroform, and the PCR product was directly cloned into the Hindi site in Bluesc ⁇ pt KS+ (Strategene)
• the plasmid map of KS+ Nb ARF #3, which contains the N benthamiaca ARF ORF in pBluescnpt KS+ is shown m FIGURE 19
• a full-length cDNA encoding ARF is isolated by screening the N benthamiana cD ⁇ A library by colony hybndization using a 32 P-labeled N benthamiana KS+ ⁇ b ARF #3 probe Hyb ⁇ dization is earned out at 42°C for 48 hours in 50% formamide, 5X SSC, 0 02 M phosphate buffer, 5X Denhart's solution, and 0 1 mg/ml sheared calf thymus DNA Filters are washed at 65°C in 0 IX SSC, 0 1% SDS pnor to autoradiography
• Libranes containing full-length cDNAs from nee, barley, com, soybean and other important crops are obtained from public and pnvate sources or can be prepared from plant mRNAs
• the cDNAs are inserted in ⁇ iral vectors or in small subcloning vectors such as pBluescnpt (Strategene), pUC18, Ml 3, or pBR322 Transformed bactena (E coli) are then plated on large pet ⁇ plates or bioassay plates containing the appropnate media and antibiotic
• Individual clones are selected using a robotic colony picker and arrayed into 96 well microtiter plates The cultures are incubated at 37°C until the transformed cells reach log phase A quots are removed to prepare glycerol stocks for long term storage at -80°C The remainder of the culture is used to inoculate an additional 96 well microtiter plate containing selective media and grown overnight DNAs are isolated from the cultures and stored at -20
• GTP bindmg proteins from nee barley, com, soybean, and other plants
• Genomic hbranes containing sequences from ⁇ ce, barley, co , soybean and other important crops are obtained from public and p ⁇ vate sources, or are prepared from plant genomic D ⁇ As BAC clones containing entire plant genomes have been constmcted and organized in minimal overlapping order Individual BACs are sheared to 500-1000 bp fragments and directly cloned into viral vectors Approximate 200-500 clones that completely cover an entire BAC will form a BAC viral vector subhbrary. These libraries can be stored as bacterial glycerol stocks at -80C and as DNA at -20C. Genomic clones are identified by first probing filters of BACs with a 32 P-labeled or fluorescent N.
• BACs that hybridize to the probe are selected and their corresponding BAC viral vector subhbrary is used to produce infectious R ⁇ A. Plants that are transfected with the BAC subhbrary are screened for loss of function (for example, stunted plants). The inserts from these clones or their corresponding plasmid D ⁇ As are characterized by dideoxy sequencing. This provides a rapid method to obtain the genomic sequence for the plant ARFs or GTP binding proteins.
• Libraries containing full-length human cD ⁇ As from organisms such as brain, liver, breast, lung, etc. are obtained from public and private sources or prepared from human mR ⁇ As.
• the cD ⁇ As are inserted in viral vectors or in small subcloning vectors such as pBluescript (Strategene), pUC18, M13, or pBR322.
• Transformed bacteria E. coli
• E. coli Transformed bacteria
• Individual clones are selected using a robotic colony picker and arrayed into 96 well microtiter plates. The cultures are incubated at 37°C until the transformed cells reach log phase.
• Constmction of a viral vector containing human cD ⁇ As Constmction of a viral vector containing human cD ⁇ As.
• An ARF5 clone containing nucleic acid inserts from a human brain cD ⁇ A library was isolated by polymerase chain reaction (PCR) using the following ohgonucleotides: HARFMIA, 5' TAC CTA GGG CAA TAT CTT TGG AAA CCT TCT CAA G 3' (upstream) (SEQ ID NO:65), HARFK181X, 5' CGC TCG AGT CAC TTC TTG TTT TTG AGC TGA TTG GCC AG 3' (downstream) (SEQ ID NO: 66). The vent polymerase in the reaction was inactivated using phenol chloroform. The PCR products are directly cloned into the Xhol, Avrll site TTOIA.
• TRV Tobacco rattle tobravims
• Arabidopsis thaliana unpublished data
• Nicotiana species Brassica campestris
• Capsicum annuum Chenopodium amaranticolor
• Glycine max Lycopersicon esculentum
• Narcissus pseudonarcissus Petunia X hybrida
• Pisum sativum Pisum sativum
• Solanum tuberosum Spinacia oleracea
• Viciafaba the expression of plant hosts, including Arabidopsis thaliana (unpublished data), Nicotiana species, Brassica campestris, Capsicum annuum, Chenopodium amaranticolor, Glycine max, Lycopersicon esculentum, Narcissus pseudonarcissus, Petunia X hybrida, Pisum sativum, Solanum tuberosum, Spinacia oleracea, Viciafaba,
• TRV RNA-1 encodes proteins involved in viral replication (Replicase, 134/194 kDa) and movement (Movement Protein (mp) 29 kDa), as well as Cysteine Rich Protein ((CRP) 16 kDa) ( Figure 2 LA).
• Virology 267, 29-35 (2000) from another N. benthamiana plant. Plants inoculated with pLSB-1 R ⁇ A-1 exhibit gene silencing more extensively compared to those inoculated with PpK20 RNA-1. Virions were purified from the leaf tissue by a PEG precipitation method (Gooding GV Jr, Hebert TT (1967) A simple technique for purification of tobacco mosaic virus in large quantities. Phytopathology 57(11): 1285), RNA was isolated using the RNeasy Mini Kit (Qiagen®), then cDNA was made using the cDNA Synthesis System (Gibco BRL®) using the oligonucleotide 5'-
• TRV RNA-1 was PCR amplified using the ohgonucleotides 5'- ATGAAGAGCATGCTAATACGACTCACTATAGATAAAACATTTCAATCCTTTGAA
• RNA-2 encodes the capsid protein and two non-structural proteins, 2b and 2c ( Figure 2 LA.)
• a TRV RNA-2 constmct expressing GFP was derived from a full-length clone of RNA2 of TRV isolate PpK20 (Mueller et al 1997. Journal of General Virology, 78, 2085-2088 (1997), MacFarlane and Popovich. Efficient expression of foreign proteins in roots from tobravirus vectors. Virology, 267, 29-35 (2000)).
• This TRV-GFP constmct has the 2c gene of TRV RNA-2 replaced with the pea early browning vims (PEB V) coat protein promoter linked to GFP (MacFarlane and Popovich, 2000).
• This TRV-GFP constmct was further modified by replacing the GFP gene with Pst I and Not I cloning sites to produce the plasmid pK20-2b-P/N.
• the phytoene desaturase (PDS) gene from N benthamiana was PCR amplified from the plasmid pWPF187 using the following ohgonucleotides 5'- TGGTTCTGCAGTTATG
• TRV-PDS was inoculated onto N benthamiana. After 6-7 days, chlorotic areas began to develop in the upper emerging leaves. After 8-10 days, these chlorotic areas developed into white areas. Samples from TRV-PDS infected plants were analyzed using HPLC HPLC analysis revealed a dramatically elevated level of phytoene m TRV-PDS infected plants when compared to an umnoculated control
• EXAMPLE 13 Identification of nucleotide sequences involved in the regulation of plant development bv cytoplasmic inhibition of gene expression in an anti sense onentation using viral denved RNA (G-protein coupled receptor)
• a partial Arabidopsis thaliana cDNA library was placed under the transc ⁇ ptional control of a tobamovirus subgenomic promoter in a RNA viral vector Colonies from transformed E coli were automatically picked using a Flexys robot and transferred to a 96 well flat bottom block contaimng ter ⁇ fic broth (TB) Amp 50 ug/ml Approximately 2000 plasmid DNAs were isolated from overnight cultures using a BioRobot and infectious RNAs from 430 independent clones were directly applied to plants One to two weeks after inoculation, transfected Nicotiana benthamiana plants were visually monitored for changes in growth rates, morphology, and color One set of plants transfected with 740 AT #88 (FIGURE 22) developed a white phenotype on the infected leaf tissue DNA sequence analysis revealed that this clone contained an Arabidopsis G-protem coupled receptor open reading frame (ORF) in the antisense o ⁇ entation
• ORF Arabidopsis G-
• FIGURE 23 shows the partial nucleotide sequence (SEQ ID NO 69) and ammo acid sequence (SEQ ID NO 70) of 740 AT #88 insert
• SEQ ID NO 69 the partial nucleotide sequence
• SEQ ID NO 70 ammo acid sequence
• FIGURE 23 shows the partial nucleotide sequence (SEQ ID NO 69) and ammo acid sequence (SEQ ID NO 70) of 740 AT #88 insert
• the nucleotide sequence from 740 AT #88 was compared with Brassica rapa cDNA L35812 (FIGURE 24, SEQ ID Nos 71 and 72), 91% identities and positives, and the octopus rhodopsin cDNA X07797 (FIGURE 25, SEQ ID NOs- 73 and 74), 68% identities and positives.
• EXAMPLE 15 Identification of LI 9 ⁇ bosomal protein gene involved in the regulation of plant growth bv cytoplasmic inhibition of gene expression using viral de ⁇ ved RNA
• the 740 AT #2483 nucleotide sequence exhibited a high degree of homology (71 - 79% identities and positives) to yeast, insect and human LI 9 ⁇ bosomal proteins genes (Table 9)
• the 740 AT #2483 amino acid sequence companson with human, insect and yeast nbosomal protein LI 9 shows 38 - 88% identities and 61 - 88% positives (Table 10)
• the high homology of DNAs encoding ⁇ bosomal L19 protein from human, plant, yeast and insect indicates that genes from one organism can inhibit the gene expression of an orgamsm from another kingdom Table 9.
• FIGURE 31 shows nucleotide alignment of 740 AT #909 to human S5 6985 ribosomal protein LI 9 cDNA (SEQ ID NOs: 80 and 81 respectively).
• FIGURE 33 shows the amino acid sequence alignment of 740 AT #909 to human P14118 60S ribosomal protein L19.
• Table 11 shows the 740 AT #909 nucleotide sequence comparison to plant, drosophila, yeast, and human: 63-79%, identities and positives.
• Table 12 shows the 740 AT #909 amino acid comparison to plant, human, mouse, yeast, and insect L19 ribosomal protein: 65-88% identities and 80-92%, positives.
• EXAMPLE 16 Constmction of a cytoplasmic inhibition vector in a positive sense containing A. thaliana HAT7 homeobox-leucine zipper nucleotide sequence.
• Plasmid 740 AT #855 contains the TMV-Ul 126-, 193-, and 30-kDa ORFs, the TMV-U5 coat protein gene (U5 cp), the T7 promoter, an Arabidopsis thaliana CD4-13 ⁇ otI fragment, and part of the pUC19 plasmid.
• the TMV-Ul subgenomic promoter located within the minus strand of the 30-kDa ORF controls the synthesis of the CD4-13 subgenomic R ⁇ A.
• the Notl fragment of 740 AT #855 was characterized: nucleotide sequence analysis and amino acid sequence comparisons were performed using D ⁇ A Strider, PCGENE and NCBI Blast programs 740 AT #855 contained . thaliana HAT 7 homeobox-luecine zipper cDNA sequence. The nucleotide sequence alignment of 740 AT #855 and Arabidopsis thaliana HAT7 homeobox protein ORF (UO9340) was compared.
• FIGURE 36 (SEQ. ID. Nos: 85-87) shows the nucleotide sequences of 740 #855 and A. thaliana HAT7 homeobox protein ORF, and the amino acid sequence of A. thaliana HAT7 homeobox protein ORFs.
• EXAMPLE 17 Identification of human nucleotide sequences involved in the regulation of plant growth by cytoplasmic inhibition of gene expression using viral derived RNA containing human nucleotide sequences.
• a human brain cDNA library are obtained from public and private sources or prepared from human mRNAs.
• the cDNAs are inserted in viral rectors or in small subcloning vectors and the cDNA inserts are isolated from the cloning vectors with appropriate enzymes, modified, and Notl linkers are attached to the cD ⁇ A blunt ends.
• the human cD ⁇ A inserts are subcloned into the Notl site of pBS740.
• E. coli C600 competent cells are transformed with the pBS740 subhbrary and colonies containing human cD ⁇ A sequences are selected on LB Amp 50 ug/ml.
• a human brain cD ⁇ A library are obtained from public and private sources or prepared from human mR ⁇ As.
• the cD ⁇ As are inserted in viral vectors or in small subcloning vectors and the cD ⁇ A inserts are isolated from the cloning vectors with appropriate enzymes, modified, and Notl linkers are attached to the cD ⁇ A blunt ends.
• the human cD ⁇ A inserts are subcloned into the Notl site of pFastBacl.
• the human cD ⁇ A insert is removed from the shuttle plasmid pFastBac-HcD ⁇ A containing the human cD ⁇ A insert to pFastBacMaml as an EcoRI-Xbal fragment to constmct pFastBacMaml-HcD ⁇ A according to Condreay et al, (Proc. Natl. Acad. Sci.USA, 96: 127-132 (1999)). Recombinant vims is generated using the Bac-to-Bac system (Life Technologies). Vims is further amplified by propagation in Spodoptera frugiperda cells.
• the human clones responsible for causing changes in the transfected plant phenotype are used as probes.
• Full-length plant cDNAs are isolated by hybridizing filters or slides containing N. benthamiana cDNAs with 32 P-labelled or fluorescent human cDNA insert probes.
• the positive plant clones are characterized by nucleic acid sequencing and compared with their human homologs. Plant codons that encode for different amino acids are changed by site directed mutagenesis to codons that encode for the same amino acids as their human homologs.
• the resulting "humanized” plant cDNAs encode an identical protein as the human clone.
• the "humanized” plant clones are used to produce human proteins in either transfected or transgenic plants by standard techniques. Because the "humanized” cDNA is from a plant origin, it is optimal for expression in plants.
• RNA silencing has been used to down regulate gene expression in transgenic plants. Recent experimental evidence suggests that double stranded RNA may be an effective stimulator of gene silencing co-suppression phenomenon in transgenic plant. For example, Waterhouse et al. (Proc. Natl. Acad. Sci. USA 95:13959-13964 (1998), incorporated herein by reference) described that vims resistance and gene silencing in plants could be induced by simultaneous expression of sense and antisense RNA. Gene silencing/co-suppression of plant genes may be induced by delivering an RNA capable of base pairing with itself to form double stranded regions. This example shows: (1) a novel method for generating an RNA vims vector capable of producing an RNA capable of forming double stranded regions, and (2) a process to silence plant genes by using such a viral vector.
• Step 1 Constmction of a DNA sequence which after it is transcribed would generate an RNA molecule capable of base pairing with itself.
• Two identical, or nearly identical, ds DNA sequences are ligated together in an inverted orientation to each other (i.e., in either a head to tail or tail to head orientation) with or without a linking nucleotide sequence between the homologous sequences.
• the resulting DNA sequence is then be cloned into a cDNA copy of a plant viral vector genome.
• Step 2 Clomng, screening, transcription of clones of interest using known methods in the art.
• Step 3 Infect plant cells with transcripts from clones.
• RNA from foreign gene forms base pair upon itself, forming double-stranded RNA regions. This approach is used with any plant or non-plant gene and used to silence plant gene homologous to assist in identification of the function of a particular gene sequence.

Landscapes

• Health & Medical Sciences (AREA)
• Genetics & Genomics (AREA)
• Life Sciences & Earth Sciences (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Biotechnology (AREA)
• Organic Chemistry (AREA)
• Biomedical Technology (AREA)
• Zoology (AREA)
• General Engineering & Computer Science (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Wood Science & Technology (AREA)
• Molecular Biology (AREA)
• Biophysics (AREA)
• Biochemistry (AREA)
• General Health & Medical Sciences (AREA)
• Physics & Mathematics (AREA)
• Plant Pathology (AREA)
• Microbiology (AREA)
• Cell Biology (AREA)
• Nutrition Science (AREA)
• Medicinal Chemistry (AREA)
• Virology (AREA)
• Bioinformatics & Computational Biology (AREA)
• Crystallography & Structural Chemistry (AREA)
• Pharmacology & Pharmacy (AREA)
• Botany (AREA)
• Gastroenterology & Hepatology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
• Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
• Micro-Organisms Or Cultivation Processes Thereof (AREA)
• Peptides Or Proteins (AREA)

Applications Claiming Priority (9)

Publications (1)

Family

ID=27502925

Family Applications (1)

Country Status (9)

Cited By (1)

Families Citing this family (5)

Family Cites Families (5)

• 2000
  • 2000-07-21 BR BR0012565-2A patent/BR0012565A/pt not_active Application Discontinuation
  • 2000-07-21 MX MXPA02000614A patent/MXPA02000614A/es unknown
  • 2000-07-21 EP EP00953673A patent/EP1196557A1/de not_active Withdrawn
  • 2000-07-21 CA CA002380330A patent/CA2380330A1/en not_active Abandoned
  • 2000-07-21 WO PCT/US2000/020261 patent/WO2001007600A1/en not_active Application Discontinuation
  • 2000-07-21 AU AU66083/00A patent/AU6608300A/en not_active Abandoned
  • 2000-07-21 IL IL14734200A patent/IL147342A0/xx unknown
  • 2000-07-21 JP JP2001512869A patent/JP2003505078A/ja active Pending
  • 2000-07-21 KR KR1020027000886A patent/KR20020057945A/ko not_active Application Discontinuation

Non-Patent Citations (1)

Also Published As

Similar Documents

Legal Events