EP1196557A1 - Method of correlating sequence function by transfecting a nucleic acid sequence of a donor organism into a plant host in an anti-sense or positive sense orientation - Google Patents

Abstract

The present invention relates to a method for correlating the function of a host organism derived nucleic acid sequence by a transient expression of the nucleic acid sequence in an antisense or positive sense orientation in a plant host.

Description

METHOD OF CORRELATING SEQUENCE FUNCTION BY TRANSFECTING A

NUCLEIC ACID SEQUENCE OF A DONOR ORGANISM INTO A PLANT HOST

IN AN ANTI-SENSE OR POSITIVE SENSE ORIENTATION

This application claims pπoπty to U.S. Application Seπal Nos. 09/359,301, 09/359,305, 09/359,297, and 09/359,300, all filed on July 21, 1999.

FIELD OF THE INVENTION The present invention relates generally to the field of molecular biology and genetics Specifically, the present invention relates to a method for correlating the function of a host organism deπved nucleic acid sequence by a transient expression of the nucleic acid sequence m an antisense or positive sense oπentation in a plant host

BACKGROUND OF THE INVENTION

Great interest exists in launching genome projects in human and non-human genome project. The human genome has between 2.8 million and 3 5 million base pairs, about 3 percent of which are made of genes. In June 2000, the Human Genome Project and biotech company Celera Genomics announced that a rough draft of the human genome has been completed (http://www.ncbi.nlm.mh.gov). This information, however, will only represent a reference sequence of the human genome. The remaining task lies m the determination of sequence functions, which are important for the study, diagnosis, and treatment of human diseases.

The Mouse genome is also being sequenced Genbank provides about 1.2% of the 3- bilhon-base mouse genome (http://www informatics iax.org) and a rough draft of the mouse genome is expected to be available by 2003 and a finished genome by 2005. In addition, the Drosophila Genome Project has recently been completely (http://www.fruitfly.org).

Valuable and basic agπcultural plants, including corn, soybeans and πce are also targets for genome projects because the information obtained thereby may prove very beneficial for increasing world food production and improving the quality and value of agπcultural products. The United States Congress is consideπng launching a corn genome project. By helping to unravel the genetics hidden in the corn genome, the project could aid in understanding and combating common diseases of gram crops. It could also provide a big boost for efforts to engineer plants to improve gram yields and resist drought, pests, salt, and other extreme environmental conditions Such advances are cπtical for a world population expected to double by 2050 Currently, there are four species which provide 60% of all human food wheat, πce, corn, and potatoes, and the strategies for increasing the productivity of these plants is dependent on rapid discovery of the presence of a trait in these plants, and the function of unknown gene sequences in these plants

One strategy that has been proposed to assist in such efforts is to create a database of expressed sequence tags (ESTs) that can be used to identify expressed genes Accumulation and analysis of expressed sequence tags (ESTs) have become an important component of genome research EST data may be used to identify gene products and thereby accelerate gene cloning Various sequence databases have been established in an effort to store and relate the tremendous amount of sequence information being generated by the ongoing sequencing efforts Some have suggested sequencing 500,000 ESTs for corn and 100,000 ESTs each for πce, wheat, oats, barley, and sorghum Efforts at sequencing the genomes of plant species will undoubtedly rely upon these computer databases to share the sequence data as it is generated Arabidopsis thahana may be an attractive target discovery of a trait and for gene function discovery because a very large set of ESTs have already been produced m this organism, and these sequences tag more than 50% of the expected Arabidopsis genes

Potential use of the sequence information so generated is enormous if gene function can be determined It may become possible to engineer commercial seeds for agπcultural use to convey any number of desirable traits to food and fiber crops and thereby increase agπcultural production and the world food supply Research and development of commercial seeds has so far focused pπmaπly on traditional plant breeding, however there has been increased interest in biotechnology as it relates to plant characteπstics Knowledge of the genomes involved and the function of genes contained therein for both monocotyledonous and dicotyledonous plants is essential to realize positive effects from such technology

The impact of genomic research in seeds is potentially far reaching For example, gene profiling in cotton can lead to an understanding of the types of genes being expressed pπmaπly in fiber cells The genes or promoters deπved from these genes may be important in genetic engineering of cotton fiber for increased strength or for "built-in" fiber color. In plant breeding, gene profiling coupled to physiological trait analysis can lead to the identification of predictive markers that will be increasingly important in marker assisted breeding programs. Mining the DNA sequence of a particular crop for genes important for yield, quality, health, appearance, color, taste, etc., are applications of obvious importance for crop improvement.

Work has been conducted in the area of developing suitable vectors for expressing foreign DNA and RNA in plant and animal hosts. Ahlquist, U.S. Patent Nos. 4,885,248 and 5,173,410 describes preliminary work done in devising transfer vectors which might be useful in transferring foreign genetic material into a plant host for the purpose of expression therein. Additional aspects of hybrid RNA viruses and RNA transformation vectors are described by Ahlquist et al. in U.S. Patent Nos. 5,466,788, 5,602,242, 5,627,060 and 5,500,360. Donson et al, U.S. Patent Nos. 5,316,931, 5,589,367 and 5,866,785 demonstrate for the first time plant viral vectors suitable for the systemic expression of foreign genetic material in plants. Donson et al. describe plant viral vectors having heterologous subgenomic promoters for the systemic expression of foreign genes. Carrington et al, U.S. Patent 5,491,076, describe particular potyvirus vectors also useful for expressing foreign genes in plants. The expression vectors described by Carrington et al. are characterized by utilizing the unique ability of viral polyprotein proteases to cleave heterologous proteins from viral polyproteins. These include Potyviruses such as Tobacco Etch Virus. Additional suitable vectors are described in U.S. Patent No. 5,811,653 and U.S. Patent Application Serial No. 08/324,003. Condreay et al, (Proc. Natl. Acad. Sci. USA 96:127-132) disclose using baculoviruses to deliver and express gene efficiently in cells types of human, primate and rodent origin. Price et al, (Proc. Natl. Acad. Sci. USA 93:9465-9570 (1996)) disclose infecting insect, plant and mammalian cells with Nodaviruses.

Construction of plant RNA viruses for the introduction and expression of non- viral foreign genes in plants has also been demonstrated by Brisson et al. , Methods in Enzymology 118:659 (1986), Guzman et al, Communications in Molecular Biology: Viral Vectors, Cold Spring Harbor Laboratory, pp. 172-189 (1988), Dawson et al, Virology 172:285-292 (1989), Takamatsu et al, EMBO J. 6:307-311 (1987), French et al, Science 231:1294-1297 (1986), and Takamatsu et al, FEBS Letters 269:73-76 (1990). However, these viral vectors have not been shown capable of systemic spread in the plant and expression of the non- viral foreign genes in the majority of plant cells in the whole plant. Moreover, many of these viral vectors have not proven stable- for the maintenance of non- viral foreign genes. However, the viral vectors described by Donson et al, in U.S. Patent Nos. 5,316,931, 5,589,367, and 5,866,785, Turpen in U.S. Patent No. 5,811,653, Carrington et al. in U.S. Patent No. 5,491,076, and in co-pending U.S. Patent Application Serial No. 08/324,003, have proven capable of infecting plant cells with foreign genetic material and systemically spreading in the plant and expressing the non-viral foreign genes contained therein in plant cells locally or systemically. Morsy et al, (Proc. Natl. Acad. Sci. USA, 95:7866-7871 (1998)) develop a helper-dependent adenoviral vectors having up to 37Kb insert capacity and being easily propagated.

With the recent advent of technology for cloning, genes can be selectively turned off. One method is to create antisense RNA or DNA molecules that bind specifically with a targeted gene's RNA message, thereby interrupting the precise molecular mechanism that expresses a gene as a protein. The antisense technology which deactivates specific genes provides a different approach from a classical genetics approach. Classical genetics usually studies the random mutations of all genes in an organism and selects the mutations responsible for specific characteristics. Antisense approach starts with a cloned gene of interest and manipulates it to elicit information about its function.

The expression of virus-derived positive sense or antisense RNA in transgenic plants provides an enhanced or reduced expression of an endogenous gene. In most cases, introduction and subsequent expression of a transgene will increase (with a positive sense RNA) or decrease (with an antisense RNA) the steady-state level of a specific gene product (Curr. Opin. Cell Biol. 7: 399-405 (1995)). There is also evidence that inhibition of endogenous genes occurs in transgenic plants containing sense RNA (Van der Krol et al, Plant Cell 2(4):291-299 (1990), Napoli et al, Plant Cell 2:279-289 (1990) and Fray et al, Plant Mol. Biol. 22:589-602 (1993)).

Post-transcriptional gene silencing (PTGS) in transgenic plants is the manifestation of a mechanism that suppresses RNA accumulation in a sequence-specific manner. There are three models to account for the mechanism of PTGS: direct transcription of an antisense RNA from the transgene, an antisense RNA produced in response to over expression of the transgene, or an antisense RNA produced in response to the production of an aberrant sense RNA product of the transgene (Baulcombe, Plant Mol Biol 32 79-88 (1996)) The posttranscπptional gene silencing mechanism is typified by the highly specific degradation of both the transgene mRNA and the target RNA, which contains either the same or complementary nucleotide sequences In cases that the silencing transgene is the same sense as the target endogenous gene or viral genomic RNA, it has been suggested that a plant- encoded RNA-dependent RNA polymerase makes a complementary strand from the transgene mRNA and that the small cRNAs potentiate the degradation of the target RNA Antisense RNA and the hypothetical cRNAs have been proposed to act by hybπdizmg with the target RNA to either make the hybπd a substrate for double-stranded (ds) RNases or arrest the translation of the target RNA (Baulcombe, Plant Mol Biol 32. 79-88 (1996)) It is also proposed that this downregulation or "co-suppression" by the sense RNA might be due to the production of antisense RNA by readthrough transcπption from distal promoters located on the opposite strand of the chromosomal DNA (Gπerson et al , Trends Bwtechnol 9.122-123 (1993))

Waterhouse et al (Proc. Natl. Acad Sci USA 10 13959-64 (1998)) prepared transgenic tobacco plants containing sense or antisense constructs. Pro[s] and Pro[a/s] constructs contained the PVY nuclear inclusion Pro ORF in the sense and antisense oπentations, respectively The Pro[s]-stop construct contained the PVY Pro ORF in the sense oπentation but with a stop codon three codons downstream from the initiation codon Waterhouse et al show when the genes of those constructs were transformed into plants, the plants exhibited immunity to the virus form which the transgene was deπved. Smith et al (Plant Cell, 6: 1441-1453, (1994)) prepared a tobacco transgenic plant containing the potato virus Y (PVY) coat protein (CP) open reading frame, which produced an mRNA rendered untranslatable by introduction of a stop codon immediately after the initiation codon The expression of the untranslatable sense RNA inversely correlated with the virus resistance of the transgenic plant Kumagai et al (Proc Natl Acad Sci USA 92 1679 (1995)) report that gene expression m transfected Nicotiana benthamiana was cytoplasmic inhibited by viral delivery of a RNA of a known sequence deπved from cDNA encoding tomato (lycopersicon esculentum) phytoene desaturase in a positive sense or an antisense oπentation The antisense sense and positive sense technology can be used to develop a functional genomic screening of a donor organism from Monera, Protisca, Fungi, Plantae or Animaha The present invention provides a method of detecting the presence of a trait in a plant host and determining the function and sequence of a nucleic acid of a donor organism by expressing the nucleic acid sequence in the plant host GTP-bmdmg proteins exemplify this invention In eukaryotic cells, GTP -binding proteins function in a vaπety of cellular processes, including signal transduction, cytoskeletal organization, and protein transport Low molecular weight (20-25 K Daltons) of GTP-bmdmg proteins include ras and its close relatives (for example, Ran), rho and its close relatives, the rab family, and the ADP- πbosylation factor (ARF) family The heterotnmeπc and monomeπc GTP-bindmg proteins that may be involved in secretion and intracellular transport are divided into two structural classes- the rab and the ARF families Ran, a small soluble GTP-bmdmg protein, has been shown to be essential for the nuclear translocation of proteins and it is also thought to be involved in regulating cell cycle progression in mammalian and yeast cells The cDNAs encoding GTP binding proteins have been isolated from a vaπety of plants including πce, barley, com, tobacco, and A thaliana For example, Verwoert et al (Plant Molecular Biol 27 629-633 (1995)) report the isolation of a Zea mays cDNA clone encoding a GTP -binding protein of the ARF family by direct genetic selection in an E cohfabD mutant with a maize cDNA expression library Regad et al (FEBS 2 133-136 (1993)) isolated a cDNA clone encoding the ARF from a cDNA library of Arabidopsis thaliana cultured cells by randomly selecting and sequencing cDNA clones Dallmann et al (Plant Molecular Biol 19 847-857 (1992)) isolated two cDNAs encoding small GTP-bmdmg proteins from leaf cDNA hbraπes using a PCR approach Dallmann et al prepared leaf cDNAs and use them as templates in PCR amplifications with degenerated ohgonucleotides corresponding to the highly conserved motifs, found in members of the ras superfamily, as pπmers Haizel et al , (Plant J, 11 93-103 (1997)) isolated cDNA and genomic clones encoding Ran-hke small GTP binding proteins from Arabidopsis cDNA and genomic braπes using a full-length tobacco Nt Rani cDNA as a probe The present invention provides advantages over the above methods m identifying nucleic acid sequence encoding GTP binding proteins in that it only sequences clones that have a function and does not randomly sequence clones The nucleic acid inserts in clones that have a function are labeled and used as probes to isolate a cDNA hybπdizmg to them

The present invention provides a method for detecting the presence of a trait in a plant host by expressing a donor orgamsm deπved nucleic acid sequence in an antisense or positive oπentation in the plant host Once the presence of a trait is identified by phenotypic changes, the nucleic acid insert in the cDNA clone or in the vector is then sequenced The present method provides a rapid method for determining the presence of a trait and a method for identifying a nucleic acid sequence and its function in a plant host by screening phenotypic or biochemical changes in the plant host transfected with a nucleic acid sequence of the donor organism

SUMMARY OF THE INVENTION

The present invention essentially involves the steps of (1) introducing into a viral vector a library of host orgamsm deπved sequence inserts in a positive or antisense oπentation, (2) expressing each insert in a plant host, and (3) detecting phenotypic or biochemical changes of the plant host as a result of the expression A plant host may be a monocotyledonous or dicotyledonous plant, plant tissue or plant cell. Donor organisms include species from Monera, Protista, Fungi, Plantae, or Animaha kingdom, such as human, mouse, drosophila, etc If the donor orgamsm is also a plant, the donor plant and the host plant typically belong to different genus, family, order, class, subdivision, or division The function of sequence inserts in the library is typically unknown The number of sequence inserts in a hbrarv is typically larger than about 10, 15, 20, 50, 100, 200, 500, 1000, 5000, or 15,000, etc The length of each insert is typically longer than about 50, 100, 200, or 500 base pairs

More specifically, the present invention is directed to a method of changing the phenotype or biochemistry of a plant host, a method of determining a change in phenotype or biochemistry in a plant host, and a method of determining the presence of a trait in a plant host The method compπses the steps of expressing transiently a nucleic acid sequence of a donor organism in an antisense or positive sense oπentation in a plant host, identifying changes in the plant host, and correlating the sequence expression with the phenotypic or biochemical changes. The nucleic acid sequence does not need to be isolated, identified, or characterized prior to transfection into the host organism.

The present invention is also directed to a method of making a functional gene profile by transiently expressing a nucleic acid sequence library in a host organism, determining the phenotypic or biochemical changes in the plant host, identifying a trait associated with the change, identifying the donor gene associated with the trait, identifying the homologous host gene, if any, and annotating the sequence with its associated phenotype or function.

The present invention is also directed to a method of determining the function of a nucleic acid sequence, including a gene, in a donor organism, by transfecting the nucleic acid sequence into a plant host in a manner so as to affect phenotypic or biochemical changes in the plant host. In one embodiment, recombinant viral nucleic acids are prepared to include the nucleic acid insert of a donor. The recombinant viral nucleic acids infect a plant host and produce antisense or positive sense RNAs in the cytoplasm which result in a reduced or enhanced expression of endogenous cellular genes in the host organism. Once the presence of a trait is identified by phenotypic or biochemical changes, the function of the nucleic acid is determined. The nucleic acid insert in a cDNA clone or in a vector is then sequenced. The nucleic acid sequence is determined by a standard sequence analysis.

One aspect of the invention is a method of identifying and determining a nucleic acid sequence in a donor organism, whose function is to silence endogenous genes in a plant host, by introducing the nucleic acid into the plant host by way of a viral nucleic acid suitable to produce expression of the nucleic acid in the transfected plant. This method utilizes the principle of post- transcription gene silencing of the endogenous host gene homologue, for example, antisense RNAs, or positive sense RNAs. Particularly, this silencing function is useful for silencing a multigene family in a donor organism. In addition, the overexpressioin of a plus sense RNA that results in overproduction of a protein may cause phenotypical or biochemical changes in a host.

Another aspect of the invention is to discover genes in a donor organism having the same function as that in a plant host. The method starts with building a cDNA library, or a genomic DNA library, or a pool of RNA of a donor organism, for example, from tissues or cells of human, mouse, or drosophila. Then, a recombinant viral nucleic acid comprising a nucleic acid insert derived from the library is prepared and is used to infect a plant host. The infected plant host is inspected for phenotypic or biochemical changes. The recombinant viral nucleic acid that results in phenotypic or biochemical changes in the plant host is identified and the sequence of the nucleic acid insert is determined by a standard method. Such nucleic acid sequence in the donor organism may have substantial sequence homology as that in the plant host, e.g. the nucleic acid sequences are conserved between the donor and plant host. Once the nucleic acid is sequenced, it can be labeled and used as a probe to isolate full-length cDNAs from the donor organism. This invention provides a rapid means for elucidating the function and sequence of nucleic acids of a donor organism; such rapidly expanding information can be subsequently utilized in the field of genomics.

Another aspect of the instant invention is directed to a method of increasing yield of a grain crop. The method comprises expressing transiently a nucleic acid sequence of a donor plant in an antisense or positive sense orientation in a grain crop, wherein said expressing results in stunted growth and increased seed production of the grain crop. A preferred method comprises the steps of cloning the nucleic acid sequence into a plant viral vector and infecting the grain crop with a recombinant viral nucleic acid comprising said nucleic acid sequence.

Another aspect of the invention is to discover genes having the same function in different plants. The method starts with a library of cDNAs, genomic DNAs, or a pool of RNAs of a first plant. Then, a recombinant viral nucleic acid comprising a nucleic acid insert derived from the library is prepared and is used to infect a different host plant. The infected host plant is inspected for phenotypic or biochemical changes. The recombinant viral nucleic acid that results in phenotypic or biochemical changes in the host plant is identified and the sequence of the nucleic acid insert is determined by a standard method. Such nucleic acid sequence in the first plant has substantial sequence homology as that in the host plant: the nucleic acid sequences are conserved between the two plants. This invention provides a rapid means for elucidating the function and sequence of nucleic acids of interest; such rapidly expanding information can be subsequently utilized in the field of genomics.

Another aspect of the present invention is to produce human proteins in a plant host. After nucleic acids of similar functions from a human and a host plant are isolated and identified, the amino acid sequences derived from the DNAs are compared. The plant nucleic acid sequence is changed so that it encodes the same amino acid sequence as the human protein The nucleic acid sequence can be changed according to any conventional methods, such as, site directed mutagenesis or polymerase based DNA synthesis

Plant hosts include plants of commercial interest, such as food crops, seed crops, oil crops, ornamental crops and forestry crops For example, wheat, πce, corn, potatoes, barley, tobaccos, soybean canola, maize, oilseed rape, Arabidopsis, Nwotiana can be selected as a host plant In particular, host plants capable of being infected by a virus containing a recombinant viral nucleic acid are preferred

A plant viral vector may compπse a native or non-native subgenomic promoter, a coat protein coding sequence, and at least one non-native nucleic acid sequence Some viral vectors used m accordance with the present invention may be encapsidated by the coat proteins encoded by the recombinant virus The recombinant viral nucleic acid is capable of replication m the plant host, and transcπption or expression of the non-native nucleic acid in the plant host to produce a phenotypic or biochemical change Any suitable vector constructs useful to produce localized or systemic expression of nucleic acids in a plant host are within the scope of the present mvention

BRIEF DESCRIPTION OF THE FIGURES FIG 1 depicts the plasmid pBS #735 FIG 2 depicts the plasmid pBS #740 FIG 3 depicts the plasmid TTU51 A QSEO #3 FIG 4 depicts the plasmid TTOIA/Ca CCS+ FIG 5 depicts the plasmid TT01/PSY+ FIG 6 depicts the plasmid TT01/PDS+ FIG 7 depicts a Monocot Viral Vector FIG 8 depicts the plasmid TTU51 CTP CrtB

FIG 9 depicts the plasmid pBS 740 AT #2441 (ATCC No PTA-332) FIG 10 depicts the nucleotide sequence of 740 AT #2441 FIG 11 depicts the nucleotide sequence companson of 740 AT #2441 and AF017991

FIG 12 depicts the nucleotide sequence companson of 740 AT #2441 and L16787 FIG. 13 depicts the amino acid sequence comparison of 740 AT #2441 and RAN-Bl GTP binding protein.

FIG. 14 depicts the plasmid pBS 740 AT #120 (ATCC No: PTA-325).

FIG. 15 shows the nucleotide sequence comparison of A. thaliana 740 AT #120 and A. thaliana est AA042085

FIG. 16 shows the nucleotide sequence alignment of 740 AT #120 to rice D 17760 (Oryza sativa) ADP-ribosylation factor.

FIG. 17 shows the nucleotide sequence alignment of 740 AT #120 to human ADP- ribosylation factor PI 6587.

FIG. 18 shows the nucleotide sequence alignment of humanized sequence 740 AT #120 H to human ADP-ribosylation factor M33384.

FIG. 19 shows the plasmid KS+ Nb ARF #3 (ATCC No: PTA-324).

FIG. 20 shows the nucleotide sequence comparison of A. thaliana 740 AT #120 and N. benthamiana KS+ Nb ARF#3.

FIG. 21 shows a Tobacco Rattle Virus gene silencing vector.

FIG. 22 shows the plasmid pBS #740 AT #88 (ATCC No: PTA-331).

FIG. 23 shows the sequence of 740 AT #88.

FIG. 24 shows the nucleotide sequence comparison of AT #88 and Brassica rapa L35812.

FIG. 25 shows the nucleotide sequence comparison of AT #88 and Octopus Rhodopsin X07797.

FIG. 26 shows the nucleotide sequence comparison of AT #88 and Octopus Rhodopsin P31356.

FIG. 27 shows the plasmid pBS #377 (ATCC No: PTA-334).

FIG. 28 shows the nucleotide sequence of 740 AT #377.

FIG. 29 shows the plasmid pBS #2483 (ATCC No: PTA-329).

FIG. 30 shows the nucleotide sequence of 740 AT #2483.

FIG. 31 shows the plasmid pBS 740 AT #909 (ATCC No: PTA-330).

FIG. 32 shows the nucleotide sequence comparison of AT #909 and Ribosomal protein LI 9 from breast cancer cell line.

FIG. 33 shows the nucleotide sequence comparison of AT #909 and L19 P14118 60S ribosomal protein LI 9.

FIG. 34 shows the plasmid pBS AT #855 (ATCC No: PTA-325).

FIG. 35 shows the nucleotide sequence comparison of AT #855 and HAT7 homeobox protein ORF.

DETAILED DESCRIPTION OF THE INVENTION The present invention essentially involves the steps of (1) introducing into a viral vector a library of host organism derived sequence inserts in a positive or antisense orientation; (2) expressing each insert in a plant host, and (3) detecting phenotypic or biochemical changes of the plant host as a result of the expression. A plant host may be a monocotyledonous or dicotyledonous plant, plant tissue or plant cell. Donor organisms include species from Monera, Protista, Fungi, Plantae, or Animalia kingdom, such as human, mouse, drosophila, etc. If the donor organism is also a plant, the donor plant and the host plant typically belong to different genus, family, order, class, subdivision, or division. The function of sequence inserts in the library is typically unknown. The number of sequence inserts in a library is typically larger than about 10, 15, 20, 50, 100, 200, 500, 1000, 5000, or 15,000, etc. The length of each insert is typically longer than about 50, 100, 200, or 500 base pairs.

More specifically, the present invention is directed to a method of changing the phenotype or biochemistry of a plant host, a method of determining a change in phenotype or biochemistry in a plant host, and a method of determining the presence of a trait in a plant host. The method comprises the steps of expressing transiently a nucleic acid sequence of a donor organism in an antisense or positive sense orientation in a plant host, identifying changes in the plant host, and correlating the sequence expression with the phenotypic or biochemical changes. The nucleic acid sequence does not need to be isolated, identified, or characterized prior to transfection into the host organism.

The present invention is also directed to a method of making a functional gene profile by transiently expressing a nucleic acid sequence library in a host organism, determining the phenotypic or biochemical changes in the plant host, identifying a trait associated with the change, identifying the donor gene associated with the trait, identifying the homologous host gene, if any, and annotating the sequence with its associated phenotype or function

The present invention is also directed to a method of determining the function of a nucleic acid sequence, including a gene, in a donor organism, by transfecting the nucleic acid sequence into a plant host m a manner so as to affect phenotypic or biochemical changes in the plant host In one embodiment, recombinant viral nucleic acids are prepared to include the nucleic acid insert of a donor The recombinant viral nucleic acids mfect a plant host and produce antisense or positive sense RNAs m the cytoplasm which result in a reduced or enhanced expression of endogenous cellular genes in the host organism Once the presence of a trait is identified by phenotypic or biochemical changes, the function of the nucleic acid is determined The nucleic acid insert in a cDNA clone or in a vector is then sequenced The nucleic acid sequence is determined by a standard sequence analysis

One aspect of the invention is a method of identifying and determining a nucleic acid sequence in a donor organism, whose function is to silence endogenous genes m a plant host, by introducing the nucleic acid into the plant host by way of a viral nucleic acid suitable to produce expression of the nucleic acid in the transfected plant This method utilizes the pπnciple of post-transcπption gene silencing of the endogenous host gene homologue, for example, antisense RNAs, or positive sense RNAs Particularly, this silencing function is useful for silencing a multigene family in a donor organism In addition, the overexpressiom of a plus sense RNA that results in overproduction of a protein may cause phenotypical or biochemical changes in a host

Another aspect of the invention is to discover genes in a donor organism having the same function as that in a plant host The method starts with building a cDNA library, or a genomic DNA library, or a pool of RNA of a donor organism, for example, from tissues or cells of human, mouse, or drosophila Then, a recombinant viral nucleic acid compnsing a nucleic acid insert deπved from the library is prepared and is used to mfect a plant host The infected plant host is inspected for phenotypic or biochemical changes The recombinant viral nucleic acid that results in phenotypic or biochemical changes in the plant host is identified and the sequence of the nucleic acid insert is determined by a standard method Such nucleic acid sequence in the donor orgamsm may have substantial sequence homology as that in the plant host, e g the nucleic acid sequences are conserved between the donor and plant host. Once the nucleic acid is sequenced, it can be labeled and used as a probe to isolate full-length cDNAs from the donor organism. This invention provides a rapid means for elucidating the function and sequence of nucleic acids of a donor organism; such rapidly expanding information can be subsequently utilized in the field of genomics.

Another aspect of the instant invention is directed to a method of increasing yield of a grain crop. The method comprises expressing transiently a nucleic acid sequence of a donor plant in an antisense or positive sense orientation in a grain crop, wherein said expressing results in stunted growth and increased seed production of the grain crop. A preferred method comprises the steps of cloning the nucleic acid sequence into a plant viral vector and infecting the grain crop with a recombinant viral nucleic acid comprising said nucleic acid sequence.

Another aspect of the present invention is directed to a method for producing human proteins in a plant host. After nucleic acids of similar functions from a human and a host plant are isolated and identified, the amino acid sequences derived from the DNAs are compared. The plant nucleic acid sequence is changed so that it encodes the same amino acid sequence as the human protein. The nucleic acid sequence can be changed according to any conventional methods, such as, site directed mutagenesis or polymerase based DNA synthesis.

Another aspect of the invention is to discover genes having the same function in different plants. The method starts with a library of cDNAs, genomic DNAs, or a pool of RNAs of a first plant. Then, a recombinant viral nucleic acid comprising a nucleic acid insert derived from the library is prepared and is used to infect a different host plant. The infected host plant is inspected for phenotypic or biochemical changes. The recombinant viral nucleic acid that results in phenotypic or biochemical changes in the host plant is identified and the sequence of the nucleic acid insert is determined by a standard method. Such nucleic acid sequence in the first plant has substantial sequence homology as that in the host plant: the nucleic acid sequences are conserved between the two plants. This invention provides a rapid means for elucidating the function and sequence of nucleic acids of interest; such rapidly expanding information can be subsequently utilized in the field of genomics. I. Introducing into a plant viral vector a library of sequence inserts from a donor organism.

The construction of viral expression vectors may use a variety of methods known in the art. In preferred embodiments of the instant invention, the viral vectors are derived from RNA plant viruses. A vaπety of plant virus families may be used, such as Bromoviridae, Bunyaviridae, Comoviridae, Geminiviridae, Potyviridae, and Tombusviridae, among others. Within the plant virus families, various genera of viruses may be suitable for the instant invention, such as alfamovirus, ilarvirus, bromovirus, cucumovirus, tospovirus, carlavirus, caulimovirus, closterovirus, comovirus, nepovirus, dianthovirus, furovirus, hordeivirus, luteovirus, necrovirus, potexvirus, potyvirus, rymovirus, bymovirus, oryzavirus, sobemovirus, tobamovirus, tobravirus, carmovirus, tombusvirus, tymovirus, umbravirusa, and among others.

Within the genera of plant viruses, many species are particular preferred. They include alfalfa mosaic virus, tobacco streak virus, brome mosaic virus, broad bean mottle virus, cowpea chlorotic mottle virus, cucumber mosaic virus, tomato spotted wilt virus, carnation latent virus, caulflower mosaic virus, beet yellows virus, cowpea mosaic virus, tobacco ringspot virus, carnation ringspot virus, soil-borne wheat mosaic virus, tomato golden mosaic virus, cassava latent virus, barley stripe mosaic virus, barley yellow dwarf virus, tobacco necrosis virus, tobacco etch virus, potato virus X, potato virus Y, rice necrosis virus, ryegrass mosaic virus, barley yellow mosaic virus, rice ragged stunt virus, Southern bean mosaic virus, tobacco mosaic virus, ribgrass mosaic virus, cucumber green mottle mosaic virus watermelon strain, oat mosaic virus, tobacco rattle virus, carnation mottle virus, tomato bushy stunt virus, turnip yellow mosaic virus, carrot mottle virus, among others. In addition, RNA satellite viruses, such as tobacco necrosis satellite may also be employed.

A given plant virus may contain either DNA or RNA, which may be either single- or double-stranded. One example of plant viruses containing double-stranded DNA includes, but not limited to, caulimoviruses such as cauliflower mosaic virus (CaMV). Representative plant viruses which contain smgle-stranded DNA are cassava latent virus, bean golden mosaic virus (BGMV), and chloris striate mosaic virus. Rice dwarf virus and wound tumor virus are examples of double-stranded RNA plant viruses. Single-stranded RNA plant viruses include tobacco mosaic virus (TMV), turnip yellow mosaic virus (TYMV), πce necrosis virus (RNV) and brome mosaic virus (BMV) The single-stranded RNA viruses can be further divided into plus sense (or positive-stranded), minus sense (or negative- stranded), or ambisense viruses The genomic RNA of a plus sense RNA virus is messenger sense, which makes the naked RNA infectious Many plant viruses belong to the family of plus sense RNA viruses They include, for example, TMV, BMV, and others RNA plant viruses typically encode several common proteins, such as rephcase/polymerase proteins essential for viral replication and mRNA synthesis, coat proteins providing protective shells for the extracellular passage, and other proteins required for the cell-to-cell movement, systemic infection and self-assembly of viruses For general information concerning plant viruses, see Matthews, Plant Virology, 3^rd Ed , Academic Press, San Diego (1991)

Selected groups of suitable plant viruses are characteπzed below However, the invention should not be construed as limited to using these particular viruses, but rather the method of the present invention is contemplated to include all plant viruses at a minimum However, the invention should not be construed as limited to using these particular viruses, but rather the present invention is contemplated to include all suitable viruses Some suitable viruses are characteπzed below

TOBAMOVIRUS GROUP

The tobacco mosaic virus (TMV) is of particular interest to the instant invention because of its ability to express genes at high levels in plants TMV is a member of the tobamovirus group The TMV viπon is a tubular filament, and compnses coat protein sub- units arranged in a single πght-handed helix with the single-stranded RNA intercalated between the turns of the helix TMV infects tobacco as well as other plants TMV viπons are 300 nm x 18 nm tubes with a 4 nm-diameter hollow canal, and consist of 2140 units of a single structural protein helically wound around a single RNA molecule The genome is a 6395 base plus-sense RNA The 5'-end is capped and the 3'-end contains a senes of pseudoknots and a tRNA-hke structure that will specifically accept histidine The genomic RNA functions as mRNA for the production of proteins involved in viral replication a 126- kDa protein that initiates 68 nucleotides from the 5'-termιnus, and a 183-kDa protein synthesized by readthrough of an amber termination codon approximately 10% of the time Only the 183-kDa and 126-kDa viral proteins are required for the TMV replication m trans (Ogawa et al, Virology 185:580-584 (1991)). Additional proteins are translated from subgenomic size mRNA produced duπng replication (Dawson, A dv Virus Res., 38-307-342 (1990)). The 30-kDa protein is required for cell-to-cell movement; the 17.5-kDa capsid protein is the single viral structural protein. The function of the predicted 54-kDa protein is unknown

TMV assembly apparently occurs in plant cell cytoplasm, although it has been suggested that some TMV assembly may occur in chloroplasts since transcnpts of ctDNA have been detected m purified TMV virions. Initiation of TMV assembly occurs by interaction between nng-shaped aggregates ("discs") of coat protem (each disc consisting of two layers of 17 subunits) and a unique internal nucleation site in the RNA; a hairpm region about 900 nucleotides from the 3 '-end in the common strain of TMV Any RNA, including subgenomic RNAs containing this site, may be packaged into viπons. The discs apparently assume a helical form on interaction with the RNA, and assembly (elongation) then proceeds in both directions (but much more rapidly in the 3'- to 5'- direction from the nucleation site)

Another member of the Tobamoviruses, the Cucumber Green Mottle Mosaic virus watermelon strain (CGMMV-W) is related to the cucumber virus. Nozu et al, Virology 45:577 (1971). The coat protem of CGMMV-W interacts with RNA of both TMV and CGMMV to assemble viral particles in vitro. Kunsu et al, Virology 70:214 (1976).

Several strains of the tobamovirus group are divided into two subgroups, on the basis of the location of the assembly of origin. Subgroup I, which includes the vulgare, OM, and tomato strain, has an ongm of assembly about 800-1000 nucleotides from the 3 '-end of the RNA genome, and outside the coat protein cistron. Lebeuner ef al , Proc. Natl. Acad. Sci USA 74:149 (1977), and Fukuda et al, Virology 101 :493 (1980). Subgroup II, which includes CGMMV-W and cornpea strain (Cc) has an ongm of assembly about 300-500 nucleotides from the 3 '-end of the RNA genome and withm the coat-protem cistron The coat protem cistron of CGMMV-W is located at nucleotides 176-661 from the 3 '-end The 3' noncodmg region is 175 nucleotides long The ongm of assembly is positioned within the coat protem cistron. Meshi et al , Virology 127 54 (1983). BROME MOSAIC VIRUS GROUP

Brome Mosaic virus (BMV) is a member of a group of tnpartite, single-stranded, RNA-contaimng plant viruses commonly referred to as the bromoviruses Each member of the bromoviruses infects a naπow range of plants Mechanical transmission of bromoviruses occurs readily, and some members are transmitted by beetles In addition to BV, other bromoviruses include broad bean mottle virus and cowpea chlorotic mottle virus

Typically, a bromovirus viπon is lcosahedral, with a diameter of about 26 μm, contaimng a single species of coat protem The bromovirus genome has three molecules of linear, positive-sense, smgle-stranded RNA, and the coat protem mRNA is also encapsidated The RNAs each have a capped 5 '-end, and a tRNA-hke structure (which accepts tyrosine) at the 3 '-end Virus assembly occurs m the cytoplasm The complete nucleotide sequence of BMV has been identified and characteπzed as descnbed by Ahlquist et al , J Mol Biol 153 23 (1981)

RICE NECROSIS VIRUS Rice Necrosis virus is a member of the Potato Virus Y Group or Potyviruses The Rice Necrosis vinon is a flexuous filament compnsing one type of coat protem (molecular weight about 32,000 to about 36,000) and one molecule of linear positive-sense single- stranded RNA The Rice Necrosis virus is transmitted by Polymyxa oraminis (a eukaryotic intracellular parasite found in plants, algae and fungi)

GEMINIVΓRUSES

Gemimviruses are a group of small, smgle-stranded DNA-contammg plant viruses with vinons of unique morphology Each viπon consists of a pair of isometπc particles (incomplete icosahedral), composed of a single type of protein (with a molecular weight of about 2 7-3 4X10⁴) Each geminivirus vinon contains one molecule of circular, positive- sense, single-stranded DNA In some gemimviruses (I e , Cassava latent virus and bean golden mosaic virus) the genome appears to be bipartite, containing two smgle-stranded DNA molecules POTYVIRUSES Potyviruses are a group of plant viruses which produce polyprotem. A particularly preferred potyvirus is tobacco etch virus (TEV). TEV is a well characteπzed potyvirus and contains a positive-strand RNA genome of 9.5 kilobases encoding for a single, large polyprotem that is processed by three virus-specific protemases The nuclear inclusion protem "a" protemase is involved in the maturation of several replication-associated proteins and capsid protem The helper component-protemase (HC-Pro) and 35-kDa protemase both catalyze cleavage only at their respective C-termmi The proteolytic domain in each of these proteins is located near the C-terminus The 35-kDa protemase and HC-Pro denve from the N-termmal region of the TEV polyprotem

HQRDEΓVIRUS GROUP

Hordeiviruses are a group of single-stranded, positive sense RNA-containmg plant viruses with three or four part genomes. Hordeiviruses have ngid, rod-shaped vinons and barley stπpe mosaic virus (BSMV) is the type member. BSMV infects a large number of monocot and dicot species including barley, oat, wheat, corn, πce, , spinach, and Nicotiana benthamiana. Local lesion hosts mclude Chenopodium amaranticolor, and Nicotiana tabacum ccv. Samsun . BSMV is not vector transmitted but is mechanically transmissable and in some hosts, such as barley, is also transmitted through pollen and seed

Most strains of BSMV have three genomic RNAs refered to as alpha(α), beta (β), and gamma (γ), At least one strain, the Argentina mild (AM) strain has a fourth geneomic RNA that is essentially a deletion mutant of the g RNA All genomic RNAs are capped at the 5' end and have tRNA-hke structures at the 3' end Virus replication and assembly occurs m the cytoplasm The complete nucleotide sequence of several strains of BSMV has been identified and characteπzed (reviewed by Jackson, et al Annual Review of Phytophathology 27 95-121 (1989)), and infectious cDNA clones are available (Petty, et al. Virology 171 -342-349 (1989))

The selection of the genetic backbone for the viral vectors of the instant invention may depend on the plant host used The plant host may be a monocotyledonous or dicotyledonous plant, plant tissue, or plant cell Typically, plants of commercial interest, such as food crops, seed crops, oil crops, ornamental crops and forestry crops are preferred. For example, wheat, rice, com, potato, barley, tobacco, soybean canola, maize, oilseed rape, lilies, grasses, orchids, irises, onions, palms, tomato, the legumes, or Arabidopsis, can be used as a plant host. Host plants may also include those readily infected by an infectious virus, such as Nicotiana, preferably, Nicotiana benthamiana, or Nicotiana clevelandii.

One feature of the present invention is the use of plant viral nucleic acids which comprise one or more non-native nucleic acid sequences capable of being transcribed in a plant host. These nucleic acid sequences may be native nucleic acid sequences that occur in a host plant. Preferably, these nucleic acid sequences are non-native nucleic acid sequences that do not normally occur in a host plant. For example, the plant viral vectors may contain sequences from more than one virus, including viruses from more than one taxonomic group. The plant viral nucleic acids may also contain sequences from non-viral sources, such as foreign genes, regulatory sequences, fragments thereof from bacteria, fungi, plants, animals or other sources. These foreign sequences may encode commercially useful proteins, polypeptides, or fusion products thereof, such as enzymes, antibodies, hormones, pharmaceuticals, vaccines, pigments, antimicrobial polypeptides, and the like. Or they may be sequences that regulate the transcription or translation of viral nucleic acids, package viral nucleic acid, and facilitate systemic infection in the host, among others.

In some embodiments of the instant invention, the plant viral vectors may comprise one or more additional native or non-native subgenomic promoters which are capable of transcribing or expressing adjacent nucleic acid sequences in the plant host. These non- native subgenomic promoters are inserted into the plant viral nucleic acids without destroying the biological function of the plant viral nucleic acids using known methods in the art. For example, the CaMV promoter can be used when plant cells are to be transfected. The subgenomic promoters are capable of functioning in the specific host plant. For example, if the host is tobacco, TMV, tomato mosaic virus, or other viruses containing subgenomic promoter may be utilized. The inserted subgenomic promoters should be compatible with the TMV nucleic acid and capable of directing transcription or expression of adjacent nucleic acid sequences in tobacco. It is specifically contemplated that two or more heterologous non-native subgenomic promoters may be used. The non-native nucleic acid sequences may be transcribed or expressed in the host plant under the control of the subgenomic promoter to produce the products of the nucleic acids of interest. In some embodiments of the instant invention, the recombinant plant viral nucleic acids may be further modified by conventional techniques to delete all or part of the native coat protein coding sequence or put the native coat protem coding sequence under the control of a non-native plant viral subgenomic promoter If it is deleted or otherwise inactivated, a non-native coat protem coding sequence is inserted under control of one of the non-native subgenomic promoters, or optionally under control of the native coat protein gene subgenomic promoter Thus, the recombinant plant viral nucleic acid contains a coat protein coding sequence, which may be native or a normative coat protem coding sequence, under control of one of the native or non-native subgenomic promoters The native or non- native coat protein gene may be utilized in the recombinant plant viral nucleic acid The non-native coat protem, as is the case for the native coat protein, may be capable of encapsidating the recombinant plant viral nucleic acid and providing for systemic spread of the recombinant plant viral nucleic acid in the host plant

In some embodiments of the instant invention, recombinant plant viral vectors are constructed to express a fusion between a plant viral coat protem and the foreign genes or polypeptides of interest Such a recombinant plant virus provides for high level expression of a nucleic acid of interest The locatιon(s) where the viral coat protein is joined to the amino acid product of the nucleic acid of interest may be referred to as the fusion joint A given product of such a construct may have one or more fusion joints The fusion joint may be located at the carboxyl terminus of the viral coat protem or the fusion joint may be located at the ammo terminus of the coat protein portion of the construct In instances where the nucleic acid of interest is located internal with respect to the 5' and 3' residues of the nucleic acid sequence encoding for the viral coat protein, there are two fusion joints That is, the nucleic acid of interest may be located 5', 3', upstream, downstream or within the coat protein In some embodiments of such recombinant plant viruses, a "leaky" start or stop codon may occur at a fusion joint which sometimes does not result in translational termination

In some embodiments of the instant invention, nucleic sequences encoding reporter protem(s) or antibiotic/herbicide resistance gene(s) may be constructed as earner proteιn(s) for the polypeptides of interest, which may facilitate the detection of polypeptides of interest For example, green fluorescent protem (GFP) may be simultaneously expressed with polypeptides of interest. In another example, a reporter gene, β-glucuronidase (GUS) may be utilized. In another example, a dmg resistance marker, such as a gene whose expression results in kanamycin resistance, may be used.

Since the RNA genome is typically the infective agent, the cDNA is positioned adjacent a suitable promoter so that the RNA is produced in the production cell. The RNA is capped using conventional techniques, if the capped RNA is the infective agent. In addition, the capped RNA can be packaged in vitro with added coat protein from TMV to make assembled virions. These assembled virions can then be used to inoculate plants or plant tissues. Alternatively, an uncapped RNA may also be employed in the embodiments of the present invention. Contrary to the practiced art in scientific literature and in issued patent (Ahlquist et al, U.S. Patent No. 5,466,788), uncapped transcripts for vims expression vectors are infective on both plants and in plant cells. Capping is not a prerequisite for establishing an infection of a vims expression vector in plants, although capping increases the efficiency of infection. In addition, nucleotides may be added between the transcription start site of the promoter and the start of the cDNA of a viral nucleic acid to constmct an infectious viral vector. One or more nucleotides may be added. In some embodiments of the present invention, the inserted nucleotide sequence may contain a G at the 5 '-end. Alternatively, the inserted nucleotide sequence may be GNN, GTN, or their multiples, (GNN)_x or (GTN)_x.

In some embodiments of the instant invention, more than one nucleic acid is prepared for a multipartite viral vector constmct. In this case, each nucleic acid may require its own origin of assembly. Each nucleic acid could be prepared to contain a subgenomic promoter and a non-native nucleic acid. Alternatively, the insertion of a non-native nucleic acid into the nucleic acid of a monopartite vims may result in the creation of two nucleic acids (i.e., the nucleic acid necessary for the creation of a bipartite viral vector). This would be advantageous when it is desirable to keep the replication and transcription or expression of the nucleic acid of interest separate from the replication and translation of some of the coding sequences of the native nucleic acid.

The recombinant plant viral nucleic acid may be prepared by cloning a viral nucleic acid. If the viral nucleic acid is DNA, it can be cloned directly into a suitable vector using conventional techniques. One technique is to attach an origin of replication to the viral DNA which is compatible with the cell to be transfected. In this manner, DNA copies of the chimeric nucleotide sequence are produced in the transfected cell. If the viral nucleic acid is RNA, a DNA copy of the viral nucleic acid is first prepared by well-known procedures. For example, the viral RNA is transcribed into DNA using reverse transcriptase to produce subgenomic DNA pieces, and a double-stranded DNA may be produced using DNA polymerases. The cDNA is then cloned into appropriate vectors and cloned into a cell to be transfected. In some instances, cDNA is first attached to a promoter which is compatible with the production cell. The recombinant plant viral nucleic acid can then be cloned into any suitable vector which is compatible with the production cell. Alternatively, the recombinant plant viral nucleic acid is inserted in a vector adjacent a promoter which is compatible with the production cell. In some embodiments, the cDNA ligated vector may be directly transcribed into infectious RNA in vitro and inoculated onto the plant host. The cDNA pieces are mapped and combined in proper sequence to produce a full-length DNA copy of the viral RNA genome, if necessary.

The donor organism from which a library of sequence inserts is derived includes Kingdom Monera, Kingdom Protista, Kingdom Fungi, Kingdom Plantae and Kingdom Animalia. Kingdom Monera includes subkingdom Archaebacteriobionta (archaebacteria): division Archaebacteriophyta (methane, salt and sulfolobus bacteria); subkingdom Eubacteriobionta (tme bacteria): division Eubacteriophyta; subkingdom Viroids; and subkingdom Viruses. Kingdom Protista includes subkingdom Phycobionta: division Xanthophyta 275 (yellow-green algae), division Chrysophyta 400 (golden- brown algae), division Dinophyta (Pyrrhophyta) 1,000 (dino flagellates), division Bacillariophyta 5,500 (diatoms), division Cryptophyta 74 (cryptophytes), division Haptophyta 250 (haptonema organisms), division Euglenophyta 550 (euglenoids), division Chlorophyta, class Chlorophyceae 10,000 (green algae), class Charophyceae 200 (stoneworts), division Phaeophyta 900 (brown algae), and division Rhodophyta 2,500 (red algae); subkingdom Mastigobionta 960: division Chytridiomycota 750 (chytrids), and division Oomycota (water molds) 475; subkingdom Myxobionta 320: division Acrasiomycota (cellular slime molds) 21, and division Myxomycota 500 (t e slime molds). Kingdom Fungi includes division Zygomycota 570 (coenocytic fungi): subdivision Zygomycotina; and division Eumycota 350 (septate fungi): subdivision Ascomycotina 56,000 (cup fungi), subdivision Basidiomycotina 25,000 (club fungi), subdivision Deuteromvcotina 22,000 (imperfect fungi), and subdivision Lichenes 13,500 Kingdom Plantae includes division Bryophyta, Hepatophyta Anthocerophyta Psilophyta, Lycophyta, Sphenophyta Pterophyta, Coniferophyta, Cycadeophyta, Ginkgophyta, Gnetophyta and Anthophyta Kingdom Animalia includes Ponfera (Sponges), Cnidaria (Jellyfishes), Ctenophora (Comb Jellies), Platyhelminthes (Flatworms), Nemertea (Proboscis Worms), Rohfera (Rotifers), Nematoda (Roundworms), Mollusca (Snails, Clams, Squid & Octopus), Onychophora (Velvet Worms), Annelida (Segmented Worms), Arthropoda (Spiders & Insects), Phoronida, Bryozoa (Bryozoans), Brachwpoda (Lamp Shells), Echinodermata (Sea Urchins & starfish), and Chordata (Vertebrata-Fish, Birds, Reptiles, Mammals) A preferred donor organism is human Host organisms are those capable of being infected by an infectious RNA or a vims containing a recombinant viral nucleic acid Host organisms include organisms from Monera, Protista, Fungi and Animalia Prefeπed host organisms are organisms from Fungi, such as yeast (for example, S cerevisiae) and Anamaha, such as insects (for example, C elegans)

To prepare a DNA insert compnsing a nucleic acid sequence of a donor organism, the first step is to constmct a cDNA library, a genomic DNA library, or a pool of mRNA of the donor organism Full-length cDNAs or genomic DNA can be obtained from public or pπvate repositones For example, cDNA and genomic hbraπes from bovine, chicken, dog, drosophila, fish, frog, human, mouse, porcine, rabbit, rat, and yeast; and retroviral libraries can be obtained from Clontech (Palo Alto, CA) Alternatively, cDNA library can be prepared from a field sample by methods known to a person of ordinary skill, for example, isolating mRNAs and transcnbing mRNAs into cDNAs by reverse transcπptase (see e g , Sambrook et al , Molecular Cloning A Laboratory Manual (2nd ed ), Vols 1-3, Cold Spnng Harbor Laboratory, (1989), or Current Protocols in Molecular Biology, F Ausubel et al , ed Greene Publishing and Wiley-Interscience, New York (1987)) Genomic DNAs represented in BAC (bactenal artificial chromosome), YAC (yeast artificial chromosome), or TAC (transformation-competent artificial chromosome, Lin et al , Proc Natl Acad Sci USA, 96 6535-6540 (1999)) hbraπes can be obtained from public or pnvate repositones

Alternatively, a pool of genes, which are overexpressed in a tumor cell line compared with a normal cell line, can be prepared or obtained from public or pπvate repositones Zhang et al (Science, 276 1268-1272 (1997)) report that using a method of seπal analysis of gene expression (SAGE) (Velculescu et al, Cell, 88:243 (1997)), 500 transcripts that were expressed at significantly different levels in normal and neoplastic cells were identified. The expression of DNAs that overexpresses in a tumor cell line in a host organism may cause changes in the host organism, thus a pool of such DNAs is another source for DNA inserts for this invention. The BAC/YAC/TAC DNAs, DNAs or cDNAs can be mechanically size-fractionated or digested by an enzyme to smaller fragments. The fragments are ligated to adapters with cohesive ends, and shotgun-cloned into recombinant viral nucleic acid vectors. Alternatively, the fragments can be blunt-end ligated into recombinant viral nucleic acid vectors. Recombinant viral nucleic acids containing a nucleic acid sequence derived from the cDNA library or genomic DNA library is then constmcted using conventional techniques. The recombinant viral nucleic acid vectors produced comprise the nucleic acid insert derived from the donor organism. The nucleic acid sequence of the recombinant viral nucleic acid is transcribed as RNA in a host organism; the RNA is capable of regulating the expression of a phenotypic trait by a positive or anti sense mechanism. The nucleic acid sequence may also regulate the expression of more than one phenotypic trait. Nucleic acid sequences from Monera, Protista, Fungi, Plantae and Animalia may be used to assemble the DNA libraries. This method may thus be used to discover useful dominant gene phenotypes from DNA libraries through the gene expression in a host organism.

In the case of using plant as a donor organism, the donor plant and the host plant may be genetically remote or unrelated: they may belong to different genus, family, order, class, subdivision, or division. Donor plants include plants of commercial interest, such as food crops, seed crops, oil crops, ornamental crops and forestry crops. For example, wheat, rice, com, potatoes, barley, tobaccos, soybean canola, maize, oilseed rape, Arabidopsis, Nicotiana can be selected as a donor plant.

To prepare a DNA insert comprising a nucleic acid sequence of a donor plant, the first step is typically to constmct a library of cDNAs, genomic DNAs, or a pool of RNAs of the plant of interest. Full-length cDNAs can be obtained from public or private repositories, for example, cDNA library of Arabidopsis thaliana can be obtained from the Arabidopsis Biological Resource Center. Alternatively, cDNA library can be prepared from a field sample by methods known to a person of ordinary skill, for example, isolating mRNAs and transcribing mRNAs into cDNAs by reverse transcriptase (see, e.g., Sambrook et al, Molecular Cloning A Laboratory Manual (2nd ed ), Vols. 1-3, Cold Spnng Harbor Laboratory, (1989), or Current Protocols in Molecular Biology, F Ausubel et al , ed. Greene Publishing and Wiley-Interscience, New York (1987)) Genomic DNAs represented in BAC (bacteπal artificial chromosome), YAC (yeast artificial chromosome), or TAC (transformation-competent artificial chromosome, Liu et al , Proc Natl Acad Sci USA, 96 6535-6540 (1999)) hbranes can be obtained from public or pπvate repositones, for example, the Arabidopsis Biological Resource Center The BAC/YAC/TAC DNAs or cDNAs can be mechanically size-fractionated or digested by an enzyme to smaller fragments The fragments are ligated to adapters with cohesive ends, and shotgun-cloned into recombinant viral nucleic acid vectors Alternatively, the fragments can be blunt-end ligated into recombinant viral nucleic acid vectors Recombinant plant viral nucleic acids containing a nucleic acid sequence deπved from the cDNA library or genomic DNA library is then constructed using conventional techniques The recombinant viral nucleic acid vectors produced compnse the nucleic acid insert denved from the donor plant The nucleic acid sequence of the recombinant viral nucleic acid is transcnbed as RNA in a host plant, the RNA is capable of regulating the expression of a phenotypic trait by a positive or anti sense mechanism The nucleic acid sequence may also code for the expression of more than one phenotypic trait. Sequences from wheat, nee, com, potato, barley, tobacco, soybean, canola, maize, oilseed rape, Arabidopsis, and other crop species may be used to assemble the DNA hbranes This method may thus be used to search for useful dominant gene phenotypes from DNA hbranes through the gene expression

Those skilled in the art will understand that these embodiments are representative only of many constmcts suitable for the instant invention All such constmcts are contemplated and intended to be withm the scope of the present invention The invention is not intended to be limited to any particular viral constmcts but specifically contemplates using all operable constmcts A person skilled in the art will be able to constmct the plant viral nucleic acids based on molecular biology techniques well known in the art Suitable techniques have been descnbed in Sambrook et al (2nd ed ), Cold Spnng Harbor Laboratory, Cold Spnng Harbor (1989), Methods in Enzymol (Vols 68, 100, 101, 118, and 152-155) (1979, 1983, 1986 and 1987), and DNA Cloning, D.M Clover, Ed , IRL Press, Oxford (1985), Walkey, Applied Plant Virology, Chapman & Hall (1991); Matthews, Plant Virology, 3^rd Ed., Academic Press, San Diego (1991); Turpen et al, J of Virological Methods, 42:227-240 (1993), U.S. Patent Nos 4,885,248, 5,173,410, 5,316,931, 5,466,788, 5,491,076, 5,500,360, 5,589,367, 5,602,242, 5,627,060, 5,811,653, 5,866,785, 5,889,190, and 5,589,367, U.S. Patent Application No 08/324,003 Nucleic acid manipulations and enzyme treatments are earned out m accordance with manufacturers' recommended procedures in making such constmcts.

II. Expressing members of donor organism deπved sequence inserts in plant hosts

Plant hosts include plants of commercial interest, such as food crops, seed crops, oil crops, ornamental crops and forestry crops. For example, wheat, πce, com, potatoes, barley, tobaccos, soybean canola, maize, oilseed rape, Arabidopsis, Nicotiana can be selected as a host plant. In particular, host plants capable of being infected by a vims containing a recombinant viral nucleic acid are preferred. Preferred host plants include Nicotiana, preferably, Nicotiana benthamiana, or Nicotiana cleavlandu

Individual clones may be transfect into the plant host: 1) protoplasts, 2) whole plants; or 3) plant tissues, such as leaves of plants (Dijkstra et al, Practical Plant Virology Protocols and Exercises, Spπnger Verlag (1998); Plant Virology Protocol: From Virus Isolation to Transgenic Resistance in Methods in Molecular Biology, Vol. 81, Foster and Taylor, Ed., Humana Press (1998)). In some embodiments of the instant invention, the delivery of the plant vims expression vectors into the plant may be affected by the inoculation of in vitro transcnbed RNA, inoculation of vinons, or internal inoculation of plant cells from nuclear cDNA, or the systemic infection resulting from any of these procedures. In all cases, the co-infection may lead to a rapid and pervasive systemic expression of the desired nucleic acid sequences in plant cells.

The host can be infected with a recombinant viral nucleic acid or a recombinant plant vims by conventional techniques. Suitable techniques include, but are not limited to, leaf abrasion, abrasion m solution, high velocity water spray, and other injury of a host as well as imbibing host seeds with water containing the recombinant viral RNA or recombinant plant vims. More specifically, suitable techniques include: (a) Hand Inoculations Hand inoculations are performed using a neutral pH, low molanty phosphate buffer, with the addition of cehte or carborundum (usually about 1 %). One to four drops of the preparation is put onto the upper surface of a leaf and gently mbbed.

(b) Mechanized Inoculations of Plant Beds. Plant bed inoculations are performed by spraying (gas-propelled) the vector solution into a tractor-driven mower while cutting the leaves. Alternatively, the plant bed is mowed and the vector solution sprayed immediately onto the cut leaves.

(c) High Pressure Spray of Single Leaves. Single plant inoculations can also be performed by spraying the leaves with a narrow, directed spray (50 psi, 6-12 inches from the leaf) containing approximately 1 % carborundum in the buffered vector solution.

(d) Vacuum Infiltration. Inoculations may be accomplished by subjecting a host organism to a substantially vacuum pressure environment in order to facilitate infection.

(e) High Speed Robotics Inoculation. Especially applicable when the organism is a plant, individual organisms may be grown in mass array such as in microtiter plates. Machinery such as robotics may then be used to transfer the nucleic acid of interest.

(f) Ballistics (High Pressure Gun) Inoculation. Single plant inoculations can also be performed by particle bombardment. A ballistics particle delivery system (BioRad Laboratories, Hercules, (A) can be used to transfect plants such as N. benthamiana as described previously (Νagar et al, Plant Cell, 7:705-719 (1995)).

An alternative method for introducing viral nucleic acids into a plant host is a technique known as agroinfection or Agrobacterium-mQdiated transformation (also known as Agro-infection) as described by Grimsley et αl, Nature 325: 177 (1987). This technique makes use of a common feature of Agrobacterium which colonizes plants by transferring a portion of their DΝA (the T-DΝA) into a host cell, where it becomes integrated into nuclear DΝA. The T-DΝA is defined by border sequences which are 25 base pairs long, and any DΝA between these border sequences is transferred to the plant cells as well. The insertion of a recombinant plant viral nucleic acid between the T-DΝA border sequences results in transfer of the recombinant plant viral nucleic acid to the plant cells, where the recombinant plant viral nucleic acid is replicated, and then spreads systemically through the plant. Agro- infection has been accomplished with potato spindle tuber viroid (PSTV) (Gardner et al, Plant Mol Biol. 6:221 (1986); CaV (Grimsley et al, Proc. Natl. Acad. Sci. USA 83:3282 (1986)); MSV (Grimsley et al, Nature 325:177 (1987)), and Lazarowitz, S., Nucl Acids Res. 16:229 (1988)) digitaria streak vims (Donson et al, Virology 162:248 (1988)), wheat dwarf vims (Hayes et al, J. Gen. Virol. 69:891 (1988)) and tomato golden mosaic vims (TGMV) (Elmer et al. Plant Mol. Biol. j_0:225 (1988) and Gardiner et al, EMBO J. 7:899 (1988)). Therefore, agro-infection of a susceptible plant could be accomplished with a virion containing a recombinant plant viral nucleic acid based on the nucleotide sequence of any of the above vimses. Particle bombardment or electrosporation or any other methods known in the art may also be used.

In some embodiments of the instant invention, infection may also be attained by placing a selected nucleic acid sequence into an organism such as E. coli, or yeast, either integrated into the genome of such organism or not, and then applying the organism to the surface of the host organism. Such a mechanism may thereby produce secondary transfer of the selected nucleic acid sequence into a host organism. This is a particularly practical embodiment when the host organism is a plant. Likewise, infection may be attained by first packaging a selected nucleic acid sequence in a pseudovims. Such a method is described in WO 94/10329. Though the teachings of this reference may be specific for bacteria, those of skill in the art will readily appreciate that the same procedures could easily be adapted to other organisms.

Plant may be grown from seed in a mixture of "Peat-Lite Mix™ (Speedling, Inc. Sun City, FI) and Nutricote™ controlled release fertilizer 14-14-14 (Chiss-Asahi Fertilizer Co., Tokyo, Japan). Plants may be grown in a controlled environment provided 16 hours of light and 8 hours of darkness. Sylvania "Gro-Lux Aquarium" wide spectrum 40 watt fluorescent grow lights. (Osram Sylvania Products, Inc. Danvers, MA) may be used. Temperatures may be kept at around 80° F during light hours and 70° F during dark hours. Humidity may be between 60 and 85%.

III. Detecting phenotypic or biochemical changes as a result of expression. After a plant host is infected with individual clone of the library, one or more phenotypic or biochemical changes may be detected.

The phenotypic changes in a plant host may be determined by any known methods in the art. Phenotypic changes may include growth rate, color, or morphology changes. Typically, these methods include visual, macroscopic or microscopic analysis. For example, growth changes, such as stunting, color changes (e.g. leaf yellowing, mottling, bleaching, chlorosis) among others are easily visualized. Examples of morphological changes include, developmental defects, wilting, necrosis, among others.

Biochemical changes can be determined by any analytical methods known in the art for detecting, quantitating, or isolating DNA, RNA, proteins, antibodies, carbohydrates, lipids, and small molecules. Selected methods may include Northern, Western blotting, MALDI-TOF, LC/MS, GC/MS, two-dimensional IEF/SDS-PAGE, ELISA, etc. In particular, suitable methods may be performed in a high-throughput, fully automated fashion using robotics. Examples of biochemical changes may include the accumulation of substrates or products from enzymatic reactions, changes in biochemical pathways, inhibition or augmentation of endogenous gene expression in the cytoplasm of cells, changes in the RNA or protein profile. For example, the clones in the viral vector library may be functionally classified based on metabolic pathway affected or visual selectable phenotype produced in the organism. This process enables a rapid determination of gene function for unknown nucleic acid sequences of a donor organism as well as a host organism. Furthermore, this process can be used to rapidly confirm function of full-length DNA's of unknown function. Functional identification of unknown nucleic acid sequences in a library of one organism may then rapidly lead to identification of similar unknown sequences in expression libraries for other organisms based on sequence homology. Such information is useful in many aspects including in human medicine.

The biochemical or phenotypic changes in the infected host plant may be coπelated to the biochemistry or phenotype of a host plant that is uninfected. Optionally, the biochemical or phenotypic changes in the infected host plant is further coπelated to a host plant that is infected with a viral vector that contains a control nucleic acid of a known sequence. The control nucleic acid may have similar size but is different in sequence from the nucleic acid insert derived from the library. For example, if the nucleic acid insert deπved from the library is identified as encoding a GTP binding protem m an antisense oπentation, a nucleic acid denved from a gene encoding green fluorescent protein can be used as a control nucleic acid Green fluorescent protem is known not to have the same effect as the GTP binding protein when expressed in a host plant

In some embodiments, the phenotypic or biochemical trait may be determined by complementation analysis, that is, by observing the endogenous gene or genes whose function is replaced or augmented by introducing the nucleic acid of interest A discussion of such phenomenon is provided by Napoh et al , 77ze Plant Cell 2 279-289 (1990) The phenotypic or biochemical trait may also be determined by (l)analyzιng the biochemical alterations m the accumulation of substrates or products from enzymatic reactions according to any means known by those skilled in the art, (2) by observing any changes in biochemical pathways which may be modified in a host orgamsm as a result of expression of the nucleic acid; (3) by utilizing techniques known by those skilled m the art to observe inhibition of endogenous gene expression in the cytoplasm of cells as a result of expression of the nucleic acid , (4) by utilizing techniques known by those skilled in the art to observe changes in the RNA or protem profile as a result of expression of the nucleic acid, or (5) by selection of organisms capable of growing or maintaining viability in the presence of noxious or toxic substances, such as, for example, pharmaceutical ingredients

One useful means to determine the function of nucleic acids transfected into a host plant is to observe the effects of gene silencing Traditionally, functional gene knockout has been achieved following inactivation due to insertion of transposable elements or random integration of T-DNA into the chromosome, followed by characteπzation of conditional, homozygous-recessive mutants obtained upon backcrossmg Some teachings in these regards are provided by WO 97/42210 which is herein incorporated by reference As an alternative to traditional knockout analysis, an EST/DNA library from a donor organism, may be assembled into a viral transcnption plasmid The nucleic acid sequences in the transcπption plasmid library may then be introduced into host cells as part of a functional RNA vims which post-transcnptionally silences the homologous target gene The EST/DNA sequences may be introduced into a viral vector in either the plus or anti sense oπentation, and the oπentation can be either directed or random based on the cloning strategy A high-throughput, automated cloning scheme based on robotics may be used to assemble and characterize the library. Alternatively, the EST/cDNA sequences can be inserted into the genomic RNA of a viral vector such that they are represented as genomic RNA during the viral replication in host cells. The library of EST clones is then transcribed into infectious RNAs and inoculated onto a host organism susceptible to viral infection. The viral RNAs containing the EST/cDNA sequences contributed from the original library are now present in a sufficiently high concentration in the cytoplasm of host organism cells such that they cause post-transcriptional gene silencing of the endogenous gene in a host organism. Since the replication mechanism of the vims produces both sense and antisense RNA sequences, the orientation of the EST/cDNA insert is normally irrelevant in terms of producing the desired phenotype in the host organism.

The present invention provides a method to express transiently viral-derived positive sense or antisense RNAs in transfected plants. Such method is much faster than the time required to obtain genetically engineered antisense transgenic organisms. Systemic infection and expression of viral antisense RNA occurs as short as several days post inoculation, whereas it takes several months or longer to create a single transgenic organism. The invention provides a method to identify genes involved in the regulation of growth by inhibiting the expression of specific endogenous genes using viral vectors. This invention provides a method to characterize specific genes and biochemical pathways in donor organisms or in host plants using an RNA viral vector.

It is known that silencing of endogenous genes can be achieved with homologous sequences from the same plant family. For example, Kumagai et al, (Proc. Natl. Acad. Sci. USA 92:1679 (1995)) report that the Nicotiana benthamiana gene for phytoene desaturase (PDS) was silenced by transfection with a viral RNA derived from a clone containing a partial tomato (Lycopersicon esculentum) cDNA encoding PDS being in an antisense orientation. Kumagai et al. demonstrate that gene encoding PDS from one plant can be silenced by transfecting a host plant with a nucleic acid of a known sequence, namely, a PDS gene, from a donor plant of the same family. The present invention provides a method of silencing a gene in a host organism by transfecting a non-plant host organism with a viral nucleic acid comprising a nucleic acid insert derived from a cDNA library or a genomic DNA library or a pool of RNA from a non-plant organism. Different from Kumagai et al, the sequence of the nucleic acid insert in the present invention does not need to be identified prior to the transfection. Another feature of the present invention is that it provides a method to silence a conserved gene of a nonplant kingdom; the antisense transcript of an organism results in reducing expression of the endogenous gene of a host organism from Monera, Protista, Fungi and Animalia. The invention is exemplified by GTP binding proteins. In eukaryotic cells, GTP -binding proteins function in a variety of cellular processes, including signal transduction, cytoskeletal organization, and protein transport. Low molecular weight (20-25 K Daltons) of GTP-binding proteins include ras and its close relatives (for example, Ran), rho and its close relatives, the rab family, and the ADP- ribosylation factor (ARF) family. The heterotrimeric and monomeric GTP-binding proteins that may be involved in secretion and intracellular transport are divided into two structural classes: the rab and the ARF families. The ARFs from many organisms have been isolated and characterized. The ARFs share structural features with both the ras and trimeric GTP- binding protein families. The present invention demonstrates that genes of one plant, such as Nicotiana, which encode GTP binding proteins, can be silenced by transfection with infectious RNAs from a clone containing GTP binding protein open reading frame in an antisense orientation, derived from a plant of a different family, such as Arabidopsis. The present invention also demonstrates that GTP binding proteins are highly homologous in human, frog, mouse, bovine, fly and yeast, not only at the amino acid level, but also at the nucleic acid level. The present invention thus provides a method to silence a conserved gene in a host organism, by transfecting the host with infectious RNAs derived from a homologous gene of a non-plant organism.

Nucleic acid sequences that may result in changing a host phenotype include those involved in cell growth, proliferation, differentiation and development; cell commumcation; and the apoptotic pathway. Genes regulating growth of cells or organisms include, for example, genes encoding a GTP binding protein, a ribosomal protein L19 protein, an S18 ribosomal protein, etc. Henry et al. (Cancer Res., 53:1403-1408 (1993)) report that erb B-2 (or HER-2 or neu) gene was amplified and overexpressed in one-third of cancers of the breast, stomach, and ovary; and the mRNA encoding the ribosomal protein LI 9 was more abundant in breast cancer samples that express high levels of erb -2. Lijsebettens et al. (EMBO J., 13:3378-3388 (1994)) report that in Arabidopsis, mutation at PFL caused pointed first leaves, reduced fresh weight and growth retardation. PFL codes for ribosomal protein SI 8, which has a high homology with the rat S18 protein. Genes involved in development of cells or organisms include, for example, homeobox-containing genes and genes encoding G-protein-coupled receptor proteins such as the rhodopsin family. Homeobox genes are a family of regulatory genes containing a common 183-nucleotide sequence (homeobox) and coding for specific nuclear proteins (homeoproteins) that act as transcription factors. The homeobox sequence itself encodes a 61-amino-acid domain, the homeodomain, responsible for recognition and binding of sequence-specific DNA motifs. The specificity of this binding allows homeoproteins to activate or repress the expression of batteries of downstream target genes. Initially identified in genes controlling Drosophila development, the homeobox has subsequently been isolated in evolutionarily distant animal species, plants, and fungi. Several indications suggest the involvement of homeobox genes in the control of cell growth and, when dysregulated, in oncogenesis (Cillo et al, Exp. Cell Res., 248:1-9 (1999). Other nucleic acid sequences that may result in changes of an organism include genes encoding receptor proteins such as hormone receptors, cAMP receptors, serotonin receptors, and calcitonin family of receptors; and light-regulated DNA encoding a leucine (Leu) zipper motif (Zheng et al, Plant Physiol, 116:27-35 (1998)). Deregulation or alteration of the process of cell growth, proliferation, differentiation and development; cell communication; and the apoptotic pathways may result in cancer. Therefore, identifying the nucleic acid sequences involved in those processes and determining their functions are beneficial to the human medicine; it also provides a tool for cancer research.

A Library of human nucleic acid sequences is cloned into vectors. The vectors are applied to the host to obtain infection. Each infected host is grown with an uninfected host and a host infected with a null vector. A null vector will show no phenotypic or biochemical change other than the effects of the vims itself. Each host is observed daily for visual differences between the infected host and its two controls. In each host displaying an observable phenotypic or biochemical change a trait is identified. The donor nucleic acid sequence is identified, the full-length gene sequence is obtained and the full-length gene in the host is obtained, if a gene from the host is associated with the trait. Both genes are sequenced and homology is determined. A variety of biochemical tests may also be made on the host or host tissue depending on the information that is desired. A variety of phenotypic changes or traits and biochemical tests are set forth in this document. A functional gene profile can be obtained by repeating the process several times.

Large amounts of DNA sequence information are being generated in the public domain, which may be entered into a relational database. Links may be made between sequences from various species predicted to carry out similar biochemical or regulatory functions. Links may also be generated between predicted enzymatic activities and visually displayed biochemical and regulatory pathways. Likewise, links may be generated between predicted enzymatic or regulatory activity and known small molecule inhibitors, activators, substrates or substrate analogs. Phenotypic data from expression libraries expressed in transfected hosts may be automatically linked within such a relational database. Genes with similar predicted roles of interest in other organisms may be rapidly discovered.

The present invention is also directed to a method of changing the phenotype or biochemistry of a plant by expressing transiently a nucleic acid sequence from a donor plant in an antisense orientation in a host plant, which inhibits an endogenous gene expression in the meristem of the host plant. The one or more phenotypic or biochemical changes in the host plant are detected by methods as describes previously. Transient expressing a nucleic acid sequence in a host plant can affect the gene expression in meristem. Meristems are of interest in plant development because plant growth is driven by the formation and activity of meristems throughout the entire life cycle. This invention is exemplified by a nucleic acid sequence encoding ribosomal protein SI 8. The activity of S18 promoter is restricted to meristems (Lijsebettesn et al, EMBO J. J_3: 3378-3388). Transient expression of a nucleic acid sequence in a host plant can trigger a signal transmitting to meristems and affect the gene expression in meristem.

One problem with gene silencing in a plant host is that many plant genes exist in multigene families. Therefore, effective silencing of a gene function may be especially problematic. According to the present invention, however, nucleic acids may be inserted into the viral genome to effectively silence a particular gene function or to silence the function of a multigene family. It is presently believed that about 20% of plant genes exist in multigene families.

A detailed discussion of some aspects of the "gene silencing" effect is provided in the co-pending patent application, U.S. Patent Application Serial No. 08/260,546 (WO95/34668 published 12/21/95) the disclosure of which is incorporated herein by reference. RNA can reduce the expression of a target gene through inhibitory RNA interactions with target mRNA that occur m the cytoplasm and/or the nucleus of a cell.

An EST/cDNA library from a plant such as Arabidopsis thaliana may be assembled into a plant viral transcπption plasmid background. The cDNA sequences in the transcnption plasmid library can then be introduced into plant cells as cytoplasmic RNA in order to post-transcπptionally silence the endogenous genes. The EST/cDNA sequences may be introduced into the plant viral transcnption plasmid in either the plus or anti-sense onentation (or both), and the oπentation can be either directed or random based on the clomng strategy. A high-throughput, automated cloning strategy using robotics can be used to assemble the library. The EST clones can be inserted behind a duplicated subgenomic promoter such that they are represented as subgenomic transcnpts dunng viral replication in plant cells Alternatively, the EST/cDNA sequences can be inserted into the genomic RNA of a plant viral vector such that they are represented as genomic RNA dunng the viral replication in plant cells. The library of EST clones is then transcnbed into infectious RNAs and inoculated onto a host plant susceptible to viral infection. The viral RNAs containing the EST/cDNA sequences contπbuted from the oπginal library are now present in a sufficiently high concentration in the cytoplasm of host plant cells such that they cause post- transcnptional gene silencing of the endogenous gene m a host plant. Since the replication mechanism of the vims produces both sense and antisense RNA sequences, the onentation of the EST/cDNA insert is normally irrelevant m terms of producing the desired phenotype in the host plant.

The present invention also provides a method of isolating a conserved gene such as a gene encoding a GTP binding protem, from nee, barley, co , soybean, maize, oilseed, and other plant of commercial interest, using another gene having homology with gene being isolated. Libranes containing full-length cDNAs from a donor plant such as πce, barley, com, soybean and other important crops can be obtained from public and pπvate sources or can be prepared from plant mRNAs The cDNAs are inserted in viral vectors or in small subclomng vectors such as pBluescnpt (Strategene), pUC18, M13, or pBR322. Transformed bacteπa are then plated and individual clones selected by a standard method. The bactena transformants or DNAs are rearrayed at high density onto membrane filters or glass slides. Full-length cDNAs encoding GTP binding proteins can be identified by probing filters or slides with labeled nucleic acid inserts which result in changes in a host plant, or labeled probes prepared from DNAs encoding GTP binding proteins from Arabidopsis Useful labels include radioactive, fluorescent, or chemiluminecent molecules, enzymes, etc

Alternatively, genomic hbranes containing sequences from πce, barley, com, soybean and other important crops can be obtained from public and pπvate sources, or be prepared from plant genomic DNAs BAC clones containing entire plant genomes have been constmcted and organized m a minimal overlapping order Individual BACs are sheared to fragments and directly cloned into viral vectors. Clones that completely cover an entire BAC form a BAC viral vector subhbrary Genomic clones can be identified by probing filters contaimng BACs with labeled nucleic acid inserts which result m changes in a host plant, or with labeled probes prepared from DNAs encoding GTP binding proteins from Arabidopsis Useful labels include radioactive, fluorescent, or chemiluminecent molecules, enzymes, etc BACs that hybπdize to the probe are selected and their corresponding BAC viral vectors are used to produce infectious RNAs Plants that are transfected with the BAC subhbrary are screened for change of function, for example, change of growth rate or change of color Once the change of function is observed, the inserts from these clones or their corresponding plasmid DNAs are characteπzed by dideoxy sequencing This provides a rapid method to obtain the genomic sequence for a plant protein, for example, a GTP binding protein Using this method, once the DNA sequence in one plant such as Arabidopsis thaliana is identified, it can be used to identify conserved sequences of similar function that exist in other plant hbranes

A functional genomics screen is set up using a tobacco mosaic vims TMV-0 coat protein capsid for infection of Nicotiana benthamiana, a plant related to the common tobacco plant. For Arabidopsis thaliana cDNA hbranes are obtained from the Arabidopsis Biological Resource Center, Bluescπpt® phagemid vectors are recovered by Not 1 digestion cDΝA is transformed into a plasmid. The plasmid is transcnbed into viral vector RΝA The inserts are m the antisense onentation as in Figure until all of the cDΝA from each cDΝA library is represented on viral vectors Each viral vector is sprayed onto the leaf of a two-week old N benthamiana plant host with sufficient force to cause tissue injury and localized viral infection Each infected plant is grown side by side with an uninfected plant and a plant infected with a null insert vector as controls. All plants are grown in an artificial environment having 16 hours of light and 8 hours of dark. Lumens are approximately equal on each plant. At intervals of 2 days a visual and photographic observation of phenotype is made and recorded for each infected plant and each of its controls and a comparison is made. Data is entered into a Laboratory Information Management System database. At the end of the observation period stunted plants are grouped for analysis. The nucleic acid insert contained in the viral vector clone 74OAT#120 is responsible for severe stunting of one of the plants. Clone 740 AT #120 is sequenced. The homologue from the plant host is also sequenced. The 740AT #120 clone is found to have 80% homology to plant host nucleic acid sequence. The amino acid sequence of homology is 96%. The entire cDNA sequence of the insert is obtained by sequencing and found to code for a GTP binding protein. The host plant homologue is selected and sequenced. It also codes for a GTP binding protein. We conclude that this GTP binding protein coding sequence is highly conserved in nature. This information is useful in pharmaceutical development as well as in toxicology studies.

A complete classification scheme of gene functionality for a fully sequenced eukaryotic organism has been established for yeast. This classification scheme may be modified for plants and divided into the appropriate categories. Such organizational stmcture may be utilized to rapidly identify herbicide target loci which may confer dominant lethal phenotypes, and thereby is useful in helping to design rational herbicide programs.

The present invention is also directed to a method of increasing yield of a grain crop. In Rice Biotechnology Quarterly 37:4 (1999) and Ashikari et al, Proc. Natl. Acad. Sci. USA 96:10284-10289 (1999)), it is reported that a transgenic rice plant transformed with a rgpl gene, which encodes a small GTP binding protein from rice, was shorter than a control plant, but it produced more seeds than the control plant. To increase the yield of a grain crop, the present method comprises expressing transiently a nucleic acid sequence of a donor plant in an antisense orientation in the grain crop, wherein said expressing results in stunted growth and increased seed production of said grain crop. A preferred method comprises the steps of cloning the nucleic acid sequence into a plant viral vector and infecting the grain crop with a recombinant viral nucleic acid comprising said nucleic acid sequence. Preferred plant viral vector is derived from a Brome Mosaic vims, a Rice Necrosis vims, or a geminivims. Preferred grain crops include rice, wheat, and barley. The nucleic acid expressed in the host plant, for example, comprises a GTP binding protein open reading frame having an antisense orientation. The present method provides a transiently expression of a gene to obtain a stunted plant. Because less energy is put into plant growth, more energy is available for production of seed, which results in increase yield of a grain crop. The present method has an advantage over other method using a transgenic plant, because it does not have an effect on the genome of a host plant.

In order to provide an even clearer and more consistent understanding of the specification and the claims, including the scope given herein to such terms, the following definitions are provided:

Adjacent: A position in a nucleotide sequence proximate to and 5' or 3' to a defined sequence. Generally, adjacent means within 2 or 3 nucleotides of the site of reference.

Anti-Sense Inhibition: A type of gene regulation based on cytoplasmic, nuclear or organelle inhibition of gene expression due to the presence in a cell of an RNA molecule complementary to at least a portion of the mRNA being translated. It is specifically contemplated that RNA molecules may be from either an RNA vims or mRNA from the host cells genome or from a DNA vims.

Cell Culture: A proliferating group of cells which may be in either an undifferentiated or differentiated state, growing contiguously or non-contiguously.

Chimeric Sequence or Gene: A nucleotide sequence derived from at least two heterologous parts. The sequence may comprise DNA or RNA.

Coding Sequence: A deoxyribonucleotide or ribonucleotide sequence which, when either transcribed and translated or simply translated, results in the formation of a cellular polypeptide or a ribonucleotide sequence which, when translated, results in the formation of a cellular polypeptide.

Compatible: The capability of operating with other components of a system. A vector or plant or animal viral nucleic acid which is compatible with a host is one which is capable of replicating in that host. A coat protein which is compatible with a viral nucleotide sequence is one capable of encapsidating that viral sequence.

Complementation Analysis: As used herein, this term refers to observing the changes produced in an organism when a nucleic acid sequence is introduced into that organism after a selected gene has been deleted or mutated so that it no longer functions fully in its normal role A complementary gene to the deleted or mutated gene can restore the genetic phenotype of the selected gene

Dual Heterologous Subgenomic Promoter Expression System (DHSPES) a plus stranded RNA vector having a dual heterologous subgenomic promoter expression system to increase, decrease, or change the expression of proteins, peptides or RNAs, preferably those descnbed in U S Patent Nos 5,316,931, 5,811,653, 5,589,367, and 5,866,785, the disclosure of which is incorporated herein by reference

Expressed sequence tags (ESTs) Relatively short single-pass DNA sequences obtained from one or more ends of cDNA clones and RNA denved therefrom They may be present in either the 5' or the 3' oπentation ESTs have been shown useful for identifying particular genes

Expression The term as used herein is meant to incorporate one or more of transcπption, reverse transcπption and translation

A functional Gene Profile The collection of genes of an organism which code for a biochemical or phenotypic trait The functional gene profile of an organism is found by screening nucleic acid sequences from a donor organism by over expression or suppression of a gene m a host organism A functional gene profile requires a collection or library of nucleic acid sequences from a donor organism A functional gene profile will depend on the ability of the collection or library of donor nucleic acids to cause over-expression or suppression in the host organism Therefore, a functional gene profile will depend upon the quantity of donor genes capable of causing over-expression or suppression of host genes or of being expressed in the host orgamsm in the absence of a homologous host gene

Gene A discrete nucleic acid sequence responsible for producing one or more cellular products and/or performing one or more intercellular or intracellular functions

Gene silencing A reduction in gene expression A viral vector expressing gene sequences from a host may induce gene silencing of homologous gene sequences

Homology A degree of nucleic acid similaπty m all or some portions of a gene sequence sufficient to result in gene suppression when the nucleic acid sequence is delivered in the antisense oπentation

Host A cell, tissue or organism capable of replicating a nucleic acid such as a vector or viral nucleic acid and which is capable of being infected by a vims containing the viral vector or viral nucleic acid. This term is intended to include prokaryotic and eukaryotic cells, organs, tissues or organisms, where appropriate. Bacteria, fungi, yeast, and animal (cell, tissues, or organisms), are examples of a host.

Infection: The ability of a vims to transfer its nucleic acid to a host or introduce a viral nucleic acid into a host, wherein the viral nucleic acid is replicated, viral proteins are synthesized, and new viral particles assembled. In this context, the terms "transmissible" and "infective" are used interchangeably herein. The term is also meant to include the ability of a selected nucleic acid sequence to integrate into a genome, chromosome or gene of a target organism.

Insert: a stretch of nucleic acid seqeunce, typically more than 20 base pairs long.

Multigene family: A set of genes descended by duplication and variation from some ancestral gene. Such genes may be clustered together on the same chromosome or dispersed on different chromosomes. Examples of multigene families include those which encode the histones, hemoglobins, immunoglobulins, histocompatibility antigens, actions, tubulins, keratins, collagens, heat shock proteins, salivary glue proteins, chorion proteins, cuticle proteins, yolk proteins, and phaseolins.

Non-Native: Any RNA or DNA sequence that does not normally occur in the cell or organism in which it is placed. Examples include recombinant viral nucleic acids and genes or ESTs contained therein. That is, an RNA or DNA sequence may be non-native with respect to a viral nucleic acid. Such an RNA or DNA sequence would not naturally occur in the viral nucleic acid. Also, an RNA or DNA sequence may be non-native with respect to a host organism. That is, such a RNA or DNA sequence would not naturally occur in the host organism.

Nucleic acid: As used herein the term is meant to include any DNA or RNA sequence from the size of one or more nucleotides up to and including a complete gene sequence. The term is intended to encompass all nucleic acids whether naturally occurring in a particular cell or organism or non-naturally occurring in a particular cell or organism.

Nucleic acid of interest: The term is intended to refer to the nucleic acid sequence whose function is to be determined. The sequence will normally be non-native to a viral vector but may be native or non-native to a host organism. Phenotypic Trait: An observable, measurable or detectable property resulting from the expression or suppression of a gene or genes.

Plant Cell: The stmctural and physiological unit of plants, consisting of a protoplast and the cell wall.

Plant Organ: A distinct and visibly differentiated part of a plant, such as root, stem, leaf or embryo.

Plant Tissue: Any tissue of a plant in plant or in culture. This term is intended to include a whole plant, plant cell, plant organ, protoplast, cell culture, or any group of plant cells organized into a stmctural and functional unit.

Positive-sense inhibition: A type of gene regulation based on cytoplasmic inhibition of gene expression due to the presence in a cell of an RNA molecule substantially homologous to at least a portion of the mRNA being translated.

Promoter: The 5 '-flanking, non-coding sequence substantially adjacent a coding sequence which is involved in the initiation of transcription of the coding sequence.

Protoplast: An isolated plant or bacterial cell without some or all of its cell wall.

Recombinant Viral Nucleic Acid: Viral nucleic acid which has been modified to contain non-native nucleic acid sequences. These non-native nucleic acid sequences may be from any organism or purely synthetic, however, they may also include nucleic acid sequences naturally occurring in the organism into which the recombinant viral nucleic acid is to be introduced.

Recombinant Vims: A vims containing the recombinant viral nucleic acid.

Subgenomic Promoter: A promoter of a subgenomic mRNA of a viral nucleic acid.

Substantial Sequence Homology: Denotes nucleotide sequences that are substantially functionally equivalent to one another. Nucleotide differences between such sequences having substantial sequence homology are insignificant in affecting function of the gene products or an RNA coded for by such sequence.

Systemic Infection: Denotes infection throughout a substantial part of an organism including mechanisms of spread other than mere direct cell inoculation but rather including transport from one infected cell to additional cells either nearby or distant.

Transient Expression: Expression of a nucleic acid sequence in a host without insertion of the nucleic acid sequence into the host genome, such as by way of a viral vector. Transposon A nucleotide sequence such as a DNA or RNA sequence which is capable of transfernng location or moving withm a gene, a chromosome or a genome

EXAMPLES The following examples further illustrate the present invention These examples are intended merely to be illustrative of the present invention and are not to be constmed as being limiting

EXAMPLE 1 Arabidopsis thaliana cDNA library construction m a dual subgenomic promoter vector

Arabidopsis thaliana cDNA hbranes obtained from the Arabidopsis Biological Resource Center (ABRC) The four hbranes from ABRC were size-fractionated with inserts of 0 5-1 kb (CD4-13), 1-2 kb (CD4-14), 2-3 kb (CD4-15), and 3-6 kb (CD4-16) All hbranes are of high quality and have been used by several dozen groups to isolate genes The pBluescnpt® phagemids from the Lambda ZAP II vector were subjected to mass excision and the hbranes were recovered as plasmids according to standard procedures

Alternatively, the cDNA inserts in the CD4-13 (Lambda ZAP II vector) were recovered by digestion with Notl Digestion with Notl in most cases liberated the entire Arabidopsis thaliana cDΝA insert because the ongmal library was assembled with Notl adapters Notl is an 8-base cutter that infrequently cleaves plant DΝA In order to insert the Notl fragments mto a transcnption plasmid, the pBS735 transcnption plasmid (FIGURE 1) was digested with PacllXhol and ligated to an adapter DΝA sequence created from the ohgonucleotides 5'-TCGAGCGGCCGCAT-3' (SEQ ID NO 1) and 5'-GCGGCCGC-3' The resulting plasmid pBS740 (FIGURE 2) contains a unique Notl restnction site for bidirectional insertion of Notl fragments from the CD4-13 library Recovered colonies were prepared from these for plasmid mimpreps with a Qiagen BioRobot 9600® The plasmid DΝA preps performed on the BioRobot 9600® were done m 96-well format and yield transcπption quality DΝA An Arabidopsis cDΝA library was transformed mto the plasmid and analyzed by agarose gel electrophoresis to identify clones with inserts Clones with inserts were transcnbed in vitro and inoculated onto N benthamiana or Arabidopsis thaliana. Selected leaf disks from transfected plants were then taken for biochemical analysis.

EXAMPLE 2 Genomic DNA library constmction in a recombinant viral nucleic acid vector.

Genomic DNAs represented in BAC (bacterial artificial chromosome) or YAC (yeast artificial chromosome) libraries are obtained from the Arabidopsis Biological Resource Center (ABRC). The BAC/YAC DNAs are mechanically size-fractionated, ligated to adapters with cohesive ends, and shotgun-cloned into recombinant viral nucleic acid vectors. Alternatively, mechanically size-fractionated genomic DNAs are blunt-end ligated into a recombinant viral nucleic acid vector. Recovered colonies are prepared for plasmid minipreps with a Qiagen BioRobot 9600®. The plasmid DNA preps done on the BioRobot 9600® are assembled in 96-well format and yield transcription quality DNA. The recombinant viral nucleic acidl Arabidopsis genomic DNA library is analyzed by agarose gel electrophoresis (template quality control step) to identify clones with inserts. Clones with inserts are then transcribed in vitro and inoculated onto N. benthamiana and/or Arabidopsis thaliana. Selected leaf disks from transfected plants are then be taken for biochemical analysis.

Genomic DΝA from Arabidopsis typically contains a gene every 2.5 kb (kilobases) on average. Genomic DΝA fragments of 0.5 to 2.5 kb obtained by random shearing of DΝA were shotgun assembled in a recombinant viral nucleic acid expression/knockout vector library. Given a genome size of Arabidopsis of approximately 120,000 kb, a random recombinant viral nucleic acid genomic DΝA library would need to contain minimally 48,000 independent inserts of 2.5 kb in size to achieve IX coverage of the Arabidopsis genome. Alternatively, a random recombinant viral nucleic acid genomic DΝA library would need to contain minimally 240,000 independent inserts of 0.5 kb in size to achieve IX coverage of the Arabidopsis genome. Assembling recombinant viral nucleic acid expression/knockout vector libraries from genomic DΝA rather than cDΝA has the potential to overcome known difficulties encountered when attempting to clone rare, low-abundance RΝA's in a cDΝA library. A recombinant viral nucleic acid expression/knockout vector library made with genomic DΝA would-be especially useful as a gene silencing knockout library. In addition, the Dual Heterologous Subgenomic Promoter Expression System (DHSPES) expression knockout vector library made with genomic DNA would be especially useful for expression of genes lacking introns. Furthermore, other plant species with moderate to small genomes (e.g. rose, approximately 80,000 kb) would be especially useful for recombinant viral nucleic acid expression knockout vector libraries made with genomic DNA. A recombinant viral nucleic acid expression/knockout vector library can be made from existing BAC/YAC genomic DNA or from newly-prepared genomic DNAs for any plant species.

EXAMPLE 3 Genomic DNA or cDNA library construction in a DHSPES vector, and transfection of individual clones from said vector library onto T-DNA tagged or transposon tagged or mutated plants.

Genomic DNA or cDNA library constmction in a recombinant viral nucleic acid vector, and transfection of individual clones from the vector library onto T-DNA tagged or transposon tagged or mutated plants may be performed according to the procedure set forth in Examples 1 and 2. Such a protocol may be easily designed to complement mutations introduced by random insertional mutagenesis of T-DNA sequences or transposon sequences.

EXAMPLE 4 Constmction of a Nicotiana benthamiana cDNA library.

Vegetative N benthamiana plants were harvested 3.3 weeks after sowing and sliced up into three groups of tissue: leaves, stems and roots. Each group of tissue was flash frozen in liquid nitrogen and total RΝA was isolated from each group separately using the following hot borate method. Frozen tissue was ground to a fine powder with a pre-chilled mortar and pestle, and then further homogenized in pre-chilled glass tissue grinder. Immediately thereafter, 2.5 ml/g tissue hot (~82°C) XT Buffer (0.2 M borate decahydrate, 30 mM EGTA, 1% (w/v) SDS. Adjusted pH to 9.0 with 5 Ν ΝaOH, treated with 0.1% DEPC and autoclaved. Before use, added 1% deoxycholate (sodium salt), 10 mM dithiothreitol, 15 Νonidet P-40 (ΝP-40) and 2% (w/v) polyvinylpyrrolidone, MW 40,000 (PVP-40)) was added to the ground tissue. The tissue was homogenized 1-2 minutes and quickly decanted to a pre-chilled Oak Ridge centrifuge tube containing 105 μl of 20 mg/ml proteinase K in DEPC treated water. The tissue grinder was rinsed with an additional 1 ml hot XT Buffer per g tissue, which was then added to rest of the homogenate. The homogenate was incubated at 42°C at 100 rpm for 1.5 h. 2 M KC1 was added to the homogenate to a final concentration of 160 mM, and the mixture was incubated on ice for 1 h to precipitate out proteins. The homogenate was centrifuged at 12,000 x g for 20 min at 4°C, and the supernatant was filtered through sterile miracloth into a clean 50 ml Oak Ridge centrifuge tube. 8 M LiCl was added to a final concentration of 2 M LiCl and incubated on ice overnight. Precipitated RNA was collected by centrifugation at 12,000 x g for 20 min at 4°C. The pellet was washed three times in 3-5 ml 4°C 2 M LiCl. Each time the pellet was resuspended with a glass rod and then spun at 12,000 x g for 20 min at 4°C. The RNA pellet was suspended in 2 ml 10 mM Tris-HCl (pH 7.5), and purified from insoluble cellular components by spinning at 12,000 x g for 20 min at 4°C. The RNA containing supernatant was transferred to a 15 ml Corex tube and precipitated overnight at -20°C with 2.5 volumes of 100 % ethanol. The RNA was pelleted by centrifugation at 9,800 x g for 30 min at 4°C. The RNA pellet was washed in 1-2 ml cold 70°C ethanol and centrifuged at 9,800 x g for 5 min at 4°C. Residual ethanol was removed from the RNA pellet under vacuum, and the RNA was resuspended in 200 μl DEPC treated dd-water and transfeπed to a 1.5 ml micro fuge tube. The Corex tube was rinsed in 100 μl DEPC-treated dd-water, which was then added to the rest of the RNA. The RNA was then precipitated with 1/10 volume of 3 M sodium acetate, pH 6.0 and 2.5 volumes of cold 100% ethanol at -20°C for 1-2 h. The tube was centrifuged for 20 min at 16,000 x g, and the RNA pellet washed with cold 70% ethanol, and centrifuged for 5 min at 16,000 x g. After drying the pellet under vacuum, the RNA was resuspended in DEPC-treated water. This is the total RNA.

Messenger RNA was purified from total RNA using an Poly(A)Pure kit (Ambion, Austin TX), following the manufacturer's instmctions. A reverse transcription reaction was used to synthesize cDNA from the mRNA template, using either the Stratagene (La Jolla, CA) or Gibco BRL (Gaithersburg, MD) cDNA cloning kits. For the Stratagene library, the cDNAs were subcloned into bacteriophage at EcoRl/XhoI site by ligating the arms using the Gigapack III Gold kit (Stratagene, La Jolla, CA), following the manufacturer's instmctions. For the Gibco BRL library, the cDNAs were subcloned into a tobamoviral vector that contained a fusion of TMV-U1 and TMV-U5 at the Notl Xhol sites.

EXAMPLE 5 Expression of Chinese cucumber cDΝA clone pO21D in transfected plants in a positive sense confirms that it encodes α-trichosanthin.

We have developed a plant viral vector that directs the expression of α-trichosanthin in transfected plants. The open reading frame (ORF) for α-trichosanthin, from the genomic clone SEO, was placed under the control of the TMV coat protein subgenomic promoter. Infectious RΝA from TTU51A QSEO #3 (FIGURE 3; nucleic acid sequence as SEQ ID NO: 2 and amino acid sequence as SEQ. ID. NO: 3) was prepared by in vitro transcription using SP6 DNA-dependent RNA polymerase and was used to mechanically inoculate N. benthamiana. The hybrid vims spread throughout all the non-inoculated upper leaves as verified by local lesion infectivity assay, and PCR amplification. The viral symptoms consisted of plant stunting with mild chlorosis and distortion of systemic leaves. The 27- kDa α-trichosanthin accumulated in upper leaves (14 days after inoculation) and cross- reacted with an anti-trichosanthin antibody. Plasmid Constructions.

An 0.88-kb Xhol, Avrll fragment, contaimng the α-tπchosanthm coding sequence, was amplified from genomic DNA isolated from Tnchosanthes kirilowu Maximowicz by PCR mutagenesis using ohgonucleotides QMIX: 5'-GCC TCG AGT GCA GCA TGA TCA GAT TCT TAG TCC TCT CTT TGC-3' (upstream) (SEQ ID NO: 4) and Q1266A 5'-TCC CTA GGC TAA ATA GCA TAA CTT CCA CAT CA AAGC-3' (downstream) (SEQ ID NO: 5). The α-tnchosanthin open reading frame was venfied by dideoxy sequencing, and placed under the control of the TMV-U1 coat protein subgenomic promoter by subcloning into TTU51A, creating plasmid TTU51A QSEO #3

In vitro Transcπptions. Inoculations, and Analysis of Transfected Plants

N benthaminana plants were inoculated with in vitro transcnpts of Kpn I-digested TTU51A QSEO #3 Vinons were isolated from N benthamiana leaves infected with TTU51A QSEO #3 transcnpts.

Purification. Immunological Detection, and in vitro Assay of α-Tπchosanfhin.

Two weeks after inoculation, total soluble protein was isolated from upper, nonmoculated N benthamiana leaf tissue and assayed from cross-reactivity to a α- tπchosanthin antibody. The proteins from systemically infected tissue were analyzed on a 0.1% SDS/12.5% polyacrylamide gel and transferred by electroblottmg for 1 hr to a nitrocellulose membrane The blotted membrane was incubated for 1 hr with a 2000-fold dilution of goat anti-α-tπchosanthm antiserum The enhanced chemiluminescence horseradish peroxidase-hnked. rabbit anti-goat IgG assay (Cappel Laboratones) was performed according to the manufacturer's (Amersham) specifications. The blotted membrane was subjected to film exposure times of up to 10 sec Shorter and longer chemiluminescent exposure times of the blotted membrane gave the same quantitative results. EXAMPLE 6 Expression of bell pepper cDNA in transfected plant m a positive sense oπentation confirms that it encodes capsanthin-capsorubm synthase

The biosynthesis of leaf carotenoids in Nicotiana benthamiana was altered by rerouting the pathway to the synthesis of capsanthin, a non-native chromoplast-specific xanthophyll, using an RNA viral vector A cDNA encoding capsanthin-capsombin synthase (Ccs), was placed under the transcnptional control of a tobamovirus subgenomic promoter Leaves from transfected plants expressing Ccs developed an orange phenotype and accumulated high levels of capsanthin This phenomenon was associated by thylakoid membrane distortion and reduction of grana stacking In contrast to the situation prevailing in chromoplasts, capsanthin was not esteπfied and its increased level was balanced by a concomitant decrease of the major leaf xanthophylls, suggesting an autoregulatory control of chloroplast carotenoid composition Capsanthin was exclusively recmited mto the tnmeπc and monomeπc light-harvesting complexes of Photosystem II This demonstration that higher plant antenna complexes can accommodate non-native carotenoids provides compelling evidence for functional remodeling of photosynthetic membranes by rational design of carotenoids

Constmction of the Ccs expression vector Unique Xhol, Avrll sites were inserted into the bell pepper capsanthin-capsombin synthase (Ccs) cDNA by polymerase chain reaction (PCR) mutagenesis using ohgonucleotides 5'-

GCCTCGAGTGCAGCATGGAAACCCTTCTAAAGCTTTTCC-3' (upstream) (SEQ ID NO 6), 5'-TCCCTAGGTCAAAGGCTCTCTATTGCTAGATTGCCC-3' (downstream) (SEQ ID NO 7) The 1 6-kb Xhol, Avrll cDNA fragment was placed under the control of the TMV-U1 coat protein subgenomic promoter by subclomng into TTO1A, creating plasmid TTOIA CCS+ (FIGURE 4, nucleic acid sequence as SEQ ID NO 8 and ammo acid sequence as SEQ ID NO 9) in the sense oπentation as represented by FIGURE 4

Carotenoid analysis Twelve days after inoculation upper leaves from 12 plants were harvested and lyophilized The resulting non-saponified extract was evaporated to dryness under argon and weighed to determine the total hpid content Pigment analysis from the total lipid content was performed by HPLC and also separated by thin layer chromatography on silica gel G using hexane / acetone (60:40 (V/V)). Plants transfected with TTOIA CCS+ accumulated high levels of capsanthin (36% of total carotenoids).

EXAMPLE 7 Expression of cDNAs encoding tomato phvtoene synthase and phytoene desa urase in a positive and anti sense orientation in Nicotiana benthamiana.

Isolation of tomato mosaic vims cDNA. An 861 base pair fragment (5524-6384) from the tomato mosaic vims (fruit necrosis strain F; tom-F) containing the putative coat protein subgenomic promoter, coat protein gene, and the 3'-end was isolated by PCR using primers 5'-CTCGCAAAGTTTCGAACCAAATCCTC-3' (upstream) (SEQ ID NO: 10) and 5'- CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG-3' (downstream) (SEQ ID NO: 11) and subcloned into the Hindi site of pBluescript KS-. A hybrid vims consisting of TMV-U1 and ToMV-F was constmcted by swapping an 874-bp BamHl-Kpnl ToMV fragment into pBGC152, creating plasmid TTOl. The inserted fragment was verified by dideoxynucleotide sequencing. A unique Avrll site was inserted downstream of the Xhol site in TTOl by PCR mutagenesis, creating plasmid TTOIA, using the following ohgonucleotides: 5'-TCCTCGAGCCTAGGCTCGCAAAGTTTCGAACCAAATCCTCA-3 ' (upstream) (SEQ ID NO: 12), 5'-

CGGGGTACCTGGGCCCCAACCGGGGGTTCCGGGGG-3' (downstream) (SEQ ID NO: 13).

Isolation of a cDNA encoding tomato phytoene synthase and a partial cDNA encoding tomato phvtoene desaturase. Partial cDNAs were isolated from ripening tomato fruit RNA by polymerase chain reaction (PCR) using the following ohgonucleotides: PSY, 5'- TATGTATGGTGCAGAAGAACAGAT-3' (upstream) (SEQ ID NO: 14), 5'- AGTCGACTCTTCCTCTTCTGGCAT C-3' (downstream) (SEQ ID NO: 15); PDS, 5'- TGCTCGAGTGTGTTCTTCAGTTTTCTGTCA-3' (SEQ ID NO: 16) (upstream), 5'- AACTCGAGCGCTTTGATTTCTCCGAAGCTT-3' (downstream) (SEQ ID NO: 17). Approximately 3 X 10⁴ colonies from a Lycopersicon esculentum cDNA library were screened by colony hybridization using a ³²P labeled tomato phytoene synthase PCR product. Hybridization was carried out at 42°C for 48 hours in 50% formamide, 5X SSC, 0.02 M phosphate buffer, 5X Denhart's solution, and 0.1 mg/ml sheared calf thymus DNA. Filters were washed at 65°C in 0.1 X SSC, 0.1% SDS prior to autoradiography. PCR products and the phytoene synthase cDNA clones were verified by dideoxynucleotide sequencing.

DNA sequencing and computer analysis. A Pstl, BamHI fragment containing the phytoene synthase cDNA and the partial phytoene desaturase cDNA was subcloned into pBluescript® KS+ (Stratagene, La Jolla, California). The nucleotide sequencing of KS+/PDS #38 and KS+/ 5'3'PSY was carried out by dideoxy termination using single-stranded templates (Maniatis, Molecular Cloning, 1^st Ed.) Nucleotide sequence analysis and amino acid sequence comparisons were performed using PCGENE® and DNA Inspector® HE programs.

Constmction of the tomato phvtoene synthase expression vector. A Xhol fragment containing the tomato phytoene synthase cDNA was subcloned into TTOl . The vector TTOl/PSY + (FIGURE 5; nucleic acid sequence as SEQ ID NO: 18 and amino acid sequence as SEQ. ID. NO: 19) contains the phytoene synthase cDNA in the positive orientation under the control of the TMV-Ul coat protein subgenomic promoter; while, the vector TTOl/PSY - contains the phytoene synthase cDNA in the antisense orientation.

Constmction of a viral vector containing a partial tomato phytoene desaturase cDNA. A Xlwl fragment containing the partial tomato phytoene desaturase cDNA was subcloned into TTOl . The vector TTOIA/PDS + (FIGURE 6) contains the phytoene desaturase cDNA in the positive orientation under the control of the TMV-Ul coat protein subgenomic promoter; while the vector TTOIA/PDS - contains the phytoene desaturase cDNA in the antisense orientation.

Analysis of N. benthamiana transfected bv TTQ1/PSY+. TTOl/PSY-. TTOIA PDS +. TTOl/PDS -. Infectious RΝAs from TT01/PSY+, TT01/PSY-,TT01/PDS +, and TTOl/PDS-, were prepared by in vitro transcπption using SP6 DNA-dependent RNA polymerase as descnbed previously (Dawson et al , Proc Natl Acad Sci USA 85 1832 (1986)) and were used to mechanically inoculate N benthamiana The hybnd vimses spread throughout all the non-inoculated upper leaves as venfied by transmission electron microscopy, local lesion infectivity assay, and polymerase chain reaction (PCR) amplification The viral symptoms resulting from the infection consisted of distortion of systemic leaves and plant stunting with mild chlorosis The leaves from plants transfected with TT01/PSY+ turned orange and accumulated high levels of phytoene while those transfected with TT01/PDS+ and TTOl/PDS- turned white Agarose gel electrophoresis of PCR cDΝA isolated from viπon RΝA and Northern blot analysis of vinon RNA indicate that the vectors are maintained m an extrachromosomal state and have not undergone any detectable intramolecular reaπangements

Puπfication and analysis of carotenoids from transfected plants The carotenoids were isolated from systemically infected tissue and analyzed by HPLC chromatography Carotenoids were extracted in ethanol and identified by their peak retention time and absorption spectra on a 25-cm Sphensorb® ODS-15- m column using acetomtπle/methanol 2-propanol (85 10 5) as a developing solvent at a flow rate of 1 ml/mm They had identical retention time to a synthetic phytoene standard and β-carotene standards from carrot and tomato. The phytoene peak from N benthamiana transfected with TTOl/PSY + had an optical absorbance maxima at 276, 285, and 298 nm Plants transfected with viral encoded phytoene synthase showed a ten-fold increase in phytoene compared to the levels in nomnfected plants The expression of sense and antisense RNA to a partial phytoene desaturase in transfected plants increased the level of phytoene and altered the biochemical pathway, it thus inhibited the synthesis of colored carotenoids and caused the systemically infected leaves to turn white HPLC analysis of these plants revealed that they also accumulated phytoene The white leaf phenotype was also observed in plants treated with the herbicide norflurazon which specifically inhibits phytoene desaturase

This change in the levels of phytoene represents one of the largest increases of any carotenoid (secondary metabolite) in any genetically engineered plant Plants transfected with viral-encoded phytoene synthase in a plus sense showed a ten-fold increase in phytoene compared to the levels in nomnfected plants In addition, the accumulation of phytoene m plants transfected with antisense phytoene desaturase suggests that viral vectors can be used as a potent tool to manipulate pathways in the production of secondary metabolites through cytoplasmic antisense inhibition Leaves from systemically infected TT01A/PDS+ plants also accumulated phytoene and developed a bleaching white phenotype, the actual mechanism of inhibition is not clear These data are presented by Kumagai et al , Proc Natl Acad Sci USA 92 1679-1683 (1995)

EXAMPLE 8 Expression of phvtoene desaturase in transfected plants using a multipartitie viral vector

Constmction of a monocot viral vector BSMV is a tripartite RNA vims that infects many agnculturally important monocot species such as oat, wheat and barley (McKinney and Greeley, "Biological charactenstics of barley stπpe mosaic vims strains and their evolution" Technical Bulletin US Department of Agriculture 1324 (1965)) An expression vector denved from barley stπpe mosaic vims (BSMV) was constmcted by modifying a BSMV γ cDNA (Gustafson et al , Virology 158(2) 394-406 (1987)) (Figure 7A) In this example, we developed a monocot viral vector that directs the expression of nucleotide sequences m transfected plants Foreign inserts can be placed under the control of the γb subgenomic promoter The infectious BSMV γ cDNA (γ 42) was modified by site-directed mutagenesis Nucleotides 5098-5103 of γ 42 were replaced with a Nhe I site Using polymerase chain reaction (PCR) mutagenesis, a 646 bp Nhe I fragment, containing the zeomycin resistance gene as a cloning marker, was amplified from pZErO (Invitrogen Corporation, Carlsbad, CA, USA) using the ohgonucleotides 5'

TATGCTAGCTGATTAATTAAGTCGACGAGCTGATTTAAC AAATTTTAAC 3 ' (upstream) (SEQ ID NO 20) and 5'

TATGCTAGCTGAGCGGCCGCGCACGTGTCAGTCCTGC

TCCTCGG 3' (downstream) (SEQ ID NO 21), and inserted mto the Nhe site of the BSMV γ cDNA This generated two plasmids, γ γb.st P/N-zeo (positive oπentation) and γ γb st N/P- zeo (negative oπentation), with Pad and Notl sites flanking the zeomycin resistance gene (Figure 7B) To improve the expression of the γ subgenomic RNA1, an infectious BSMV beta (b) cDNA (β42SpI) (Petty et al, Virology 179(21:712-8 (1990)) was modified by substituting the majority of the coat protein ORF by PCR mutagenesis. A 423 bp fragment was amplified from β42SpI using the ohgonucleotides 5' GGAAAGCCGGCGAACGTGGCG 3' (upstream) (SEQ. ID. NO: 22) and 5' TATATTCGAATCTAGAATCGATGCTAGCTTGCATGCTGTGAAGTGG TAAAAGAAATGC 3' (downstream) (SEQ. ID. NO: 23) and cloned into the NgoMIV and BstBI sites of creating plasmid β.Δβa. This constmct contains only an untranslated portion of the coat protein ORF that is required for expression of the subsequent β RNA ORFs (Figure 7C).

Constmction of monocot viral vectors the contain partial maize phvtoene desaturase cDNAs. Partial cDNAs encoding phytoene desaturase (PDS) were amplified from com leaf tissue RNA by RT-PCR using ohgonucleotides pairs 175 5'

ATATTAATTAACATGGACACTGGCTGCCTGTC 3' (upstream) (SEQ. ID. NO: 24) and 180 5' TATGCGGCCGCCTACAAAGCAATCAAAATGCACTG 3' (downstream) (SEQ. ID. NO: 25) encoding PDS Met¹- Leu²⁹⁰, pairs 177 5'

ATATTAATTAACAAGGTAGCTGCTTGGAAGGATG 3' (upstream) (SEQ. ID. NO: 26) and 178 5' TATGCGGCCGCCTAGCAGGTTACTGACATGTCTGC 3' (downstream) (SEQ. ID. NO: 27) encoding PDS Lys'³⁴- Cys⁴³¹, and pairs 179 5'

ATATTAATTAACCAGTGCATTTTGATTGCTTTG 3' (upstream) (SEQ. ID. NO: 28) and 176 5' TATGCGGCCGCCTAAGATGGGACGGGAACTTCTCC 3' (downstream) (SEQ. ID. NO: 29) encoding PDS Gin²⁸⁴- Ser⁵⁷¹. The 0.8 Kb amplified Pac I and Not I fragments containing the partial cDNAs encoding com PDS were placed under the control of the BSMV γb subgenomic promoter by subcloning into the Pad and Notl sites γ.γb.st.P/N-zeo and γ. γb.st.N/P-zeo. This eliminated the Zeocin resistance gene and created plasmids with PDS inserts in the positive orientation (γ.γb.st.P/N-mPDS-N, γ.γb.st.P/N-mPDS-M, and γ.γb.st.P/N-mPDS-C) and negative orientation (γ.γb.st.P/N-mPDS-N as, γ.γb.st.P/N-mPDS- M as, and γ.γb.st.P/N-mPDS-C as). Analysis of barley plants transfected with γ γb st P/N-mPDS Infectious BSMV RNAs from cDNA clones were prepared by in vitro transcnption using T7 DNA-dependent RNA polymerase (Ambion) as descnbed previously (Petty, et al , Virology 171(2) 342-9 (1989)) Transcnpts of each of the three BSMV genomes were mixed in a 1 1 1 ratio A 7 ul aliquot of the transcπption mix was combined with 40 μL of FES and directly applied to 12 day old black hulless barley plants The BSMV mPDS hybnd vimses spread throughout the non- moculated leaves The initial viral symptoms (1-7 days post inoculation) resulting from the PDS containing constmcts displayed symptoms similar to a wild type BSMV infection 8- 10 days post inoculation, the BSMV-PDS plants began to exhibit streaks and patches of unusually white tissue The affected areas lacked the necrosis or desiccation that is often associated with BSMV induced bleaching and more like the bleached tissue found in plants treated with the chemical inhibitor of PDS, norflurazon These white streaks were observed to some degree in all the BSMV mPDS infected plants, although the most extensive areas of bleaching were generally found on the plants infected with BSMV containing PDS m the sense onentation

Puπfication and analysis of carotenoids from transfected barley plants The carotenoids were isolated from 50 mg of systemically infected leaf tissue 18 days post inoculation and analyzed by HPLC chromatography Carotenoids were extracted in the dark in methanol and identified by their peak retention time and absorption spectra on a Zorbax 4 6 X 15 cm C-18 column using acetonιtπle/methanol 2-propanol (85 10 5) as a developing solvent at a flow rate of 2 ml/mm They had identical retention times to a synthetic phytoene standard and β-carotene standards from tomato and carrot The expression of sense and antisense RNA to the partial maize phytoene desaturase in transfected barley inhibited the synthesis of colored carotenoids and caused the systemically infected tissue to rum white HPLC analysis of these plants revealed that they also accumulated phytoene The white leaf phenotype was also observed m barley plants treated with the herbicide norflurazon which specifically inhibits phytoene desaturase Phytoene extracted from barley transfected with BSMV-PDS was analyzed by HPLC, had a retention time similar to that of a phytoene standard, and showed a 10-60 fold increase over the levels in a BSMV transfected control plant Our results that phytoene accumulated in barley plants transfected with partial antisense and positive sense phytoene desaturase suggests that plant viral vectors can be used to manipulate biosynthetic pathways in monocots through cytoplasmic inhibition of endogenous gene expression

EXAMPLE 9 Expression of bactenal CrtB gene in transfected plants in a positive sense oπentation confirms that it encodes phvtoene synthase

We developed a new viral vector, TTU51, consisting of tobacco mosaic vims strain Ul (TMV-Ul) (Goelet et al , Proc Natl Acad Sci USA 79 5818-5822 (1982)), and tobacco mild green mosaic vims (TMGMV, U5 strain) (Sohs et al , 111 553-8 (1990)) The open reading frame (ORF) for Erwinia herbicola phytoene synthase (CrtB) (Armstrong et al , Proc Natl Acad Sci USA 87 9975-9979 (1990)) was placed under the control of the tobacco mosaic vims (TMV) coat protem subgenomic promoter in the vector TTU51 This constmct also contained the gene encoding the chloroplast targeting peptide (CTP) for the small subunit of πbulose-l,5-bιsphosphate carboxylase (RUBISCO) (O'Neal et al , Nucl Acids Res 15 8661-8677 (1987)) and was called TTU51 CTP CrtB as represented by FIGURE 8 (Nucleic acid sequence as SEQ ID NO 30 and ammo acid sequence as SEQ ID NO 31) Infectious RNA was prepared by in vitro transcπption using SP6 DNA- dependent RNA polymerase (Dawson et al, Proc Natl Acad Sci USA 83 1832-1836 (1986)), Susek et al , Cell 74 IS! -199 (1993)) and was used to mechanically inoculate N benthamiana The hybnd vims spread throughout all the non-inoculated upper leaves and was venfied by local lesion infectivity assay and polymerase chain reaction (PCR) amplification The leaves from plants transfected with TTU51 CTP CrtB developed an orange pigmentation that spread systemically duπng plant growth and viral replication

Leaves from plants transfected with TTU51 CTP CrtB had a decrease in chlorophyll content (result not shown) that exceeded the slight reduction that is usually observed dunng viral infection Since previous studies have indicated that the pathways of carotenoid and chlorophyll biosynthesis are interconnected (Susek et al , Cell 74 787 ^'-799 (1993)), we decided to compare the rate of synthesis of phytoene to chlorophyll Two weeks post- moculation, chloroplasts from plants infected with TTU51 CTP CrtB transcnpts were isolated and assayed for enzyme activity. The ratio of phytoene synthetase to chlorophyll syntheses was 0.55 in transfected plants and 0.033 in unmoculated plants (control). Phytoene synthase activity from plants transfected with TTU51 CTP CrtB was assayed using isolated chloroplasts and labeled [^C] geranylgeranyl PP There was a large increase in phytoene and an unidentified C40 alcohol in the CrtB plants

Phvtoene synthetase assay

The chloroplasts were prepared as descnbed previously (Camara, Methods Enzymol 214.352-365 (1993)) The phytoene synthase assays were earned out m an incubation mixture (0 5 ml final volume) buffered with Tns-HCL, pH 7 6, containing [^C] geranylgeranyl PP (100,000 cpm) (prepared using pepper GGPP synthase expressed in E coli), 1 mM ATP, 5 mM MnCl2, 1 mM MgCl2, Tπton X-100 (20 mg per mg of chloroplast protein) and chloroplast suspension equivalent to 2 mg protein After 2 h incubation at 30°C, the reaction products were extracted with chloroform methanol (Camara, supra) and subjected to TLC onto sihcagel plate developed with benzene/ethyl acetate (90/10) followed by autoradiography.

Chlorophyll synthetase assay.

For the chlorophyll synthetase assay, the isolated chloroplasts were lysed by osmotic shock before incubation. The reaction mixture (0 2 ml, final volume) consisting of 50 mM

Tns-HCL (pH 7.6) containing [¹⁴C] geranylgeranyl PP (100,000 cpm), 5 MgCl2, 1 mM ATP, and mptured plasmid suspension equivalent to 1 mg protem was incubated for 1 hr at 30°C The reaction products were analyzed as descnbed previously

Plasmid Constmctions

The chloroplast targeting, phytoene synthase expression vector, TTU51 CTP CrtB as represented m FIGURE 8, was constmcted in several subcloning steps. First, a unique Sphl site was inserted in the start codon for the Erwinia herbicola phytoene synthase gene by polymerase chain reaction (PCR) mutagenesis (Saiki et al , Science 230.1350-1354 (1985)) using ohgonucleotides CrtB MIS 5'"CCA AGC TTC TCG AGT GCA GCA TGC AGC

AAC CGC CGC TGC TTG AC-3' (upstream) (SEQ ID NO 32) and CrtB P300 5'^"AAG ATC TCT CGA GCT AAA CGG GAC GCT GCC AAA GAC CGG CCG G-3' (downstream) (SEQ ID NO: 33). The CrtB PCR fragment was subcloned into pBluescript® (Stratagene) at the EcoRV site, creating plasmid pBS664. A 938 bp Sphl, Xhol CrtB fragment from pBS664 was then subcloned into a vector containing the sequence encoding the N. tabacum chloroplast targeting peptide (CTP) for the small subunit of RUBISCO, creating plasmid pBS670. Next, the tobamoviral vector, TTU51, was constmcted. A 1020 base pair fragment from the tobacco mild green mosaic vims (TMGMV; U5 strain) containing the viral subgenomic promoter, coat protein gene, and the 3 '-end was isolated by

PCR using TMGMV primers 5'-GGC TGT GAA ACT CGA AAA GGT TCC GG-3'

(upstream) (SΕQ ID NO: 34) and 5'"CGG GGT ACC TGG GCC GCT ACC GGC GGT TAG GGG AGG-3' (downstream) (SΕQ ID NO: 35), subcloned into the Hindi site of Bluescript KS-, and verified by dideoxynucleotide sequencing. This clone contains a naturally occurring duplication of 147 base that includes the whole upstream pseudoknot domain in the 3' noncoding region. The hybrid viral cDNA consisting of TMV-Ul and TMGMV was constmcted by swapping a 1-Kb Xhol-Kpnl TMGMV fragment into TTOl (Kumagai et al, Proc. Natl. Acad. Sci. USA 92:1679-1683 (1995)), creating plasmid TTU51. Finally, the 1.1 Kb Xhol CTP CrtB fragment from pBS670 was subcloned into the Xhol of TTU51, creating plasmid TTU51 CTP CrtB. As a CTP negative control, a 942 bp Xhol fragment containing the CrtB gene from pBS664 was subcloned into TTU51, creating plasmid TTU51 CrtB #15.

EXAMPLE 10 Identification of nucleotide sequences involved in the regulation of plant growth bv cytoplasmic inhibition of gene expression in a positive sense orientation using viral derived RNA.

In this example, we show: (1) a method for producing plus sense RNA using an RNA viral vector, (2) a method to produce viral-derived sense RNA in the cytoplasm, (3) a method to enhance or suppress the expression of endogenous plant proteins in the cytoplasm by viral antisense RNA, and (4) a method to produce transfected plants containing viral plus sense RNA; such methods are much faster than the time required to obtain genetically engineered sense transgenic plants. Systemic infection and expression of viral plus sense RNA occurs as short as four days post inoculation, whereas it takes several months or longer to create a single transgenic plant. This example demonstrates that novel positive strand viral vectors, which replicate solely in the cytoplasm, can be used to identify genes involved in the regulation of plant growth by enhancing or inhibiting the expression of specific endogenous genes. This example also enables one to characteπze specific genes and biochemical pathways in transfected plants using an RNA viral vector

Tobamoviral vectors have been developed for the heterologous expression of uncharactenzed nucleotide sequences in transfected plants A partial Arabidopsis thaliana cDNA library was placed under the transcπptional control of a tobamovirus subgenomic promoter in a RNA viral vector. Colonies from transformed E. coli were automatically picked using a Flexys robot and transferred to a 96 well flat bottom block containing terrific broth (TB) Amp 50 ug/ml. Approximately 2000 plasmid DNAs were isolated from overnight cultures using a BioRobot and infectious RNAs from 430 independent clones were directly applied to plants. One to two weeks after inoculation, transfected Nicotiana benthamiana plants were visually monitored for changes in growth rates, morphology, and color One set of plants transfected with 740 AT #2441 were severely stunted DNA sequence analysis revealed that this clone contained an Arabidopsis Ran GTP binding protein open reading frame (ORF) m a plus sense onentation. This demonstrates that an episomal RNA viral vector can be used to deliberately alter the metabolic pathway and cause plant stunting In addition, our results show that the Arabidopsis plus sense transcnpt can cause phenotypic changes in N benthamiana

Constmction of an Arabidopsis thaliana cDΝA library in an RΝA viral vector

An Arabidopsis thaliana CD4-13 cDΝA library was digested with Notl. DΝA fragments between 500 and 1000 bp were isolated by trough elution and subcloned into the Notl site of pBS740. E coli C600 competent cells were transformed with the pBS740 AT library and colonies containing Arabidopsis cDΝA sequences were selected on LB Amp 50 ug/ml. Recombinant C600 cells were automatically picked using a Flexys robot and then transferred to a 96 well flat bottom block contaimng ternfic broth (TB) Amp 50 ug/ml Approximately 2000 plasmid DΝAs were isolated from overnight cultures using a BioRobot (Qiagen) and infectious RΝAs from 430 independent clones were directly applied to plants Isolation of a gene encoding a GTP binding protein.

One to two weeks after inoculation, transfected Nicotiana benthamiana plants were visually monitored for changes in growth rates, morphology, and color. Plants transfected with 740 AT #2441 (FIGURE 9) were severely stunted. Plasmid 740 AT #2441 contains the TMV-Ul open reading frames (ORFs) encoding 126-, 183-, and 30-kDa proteins, the TMV- U5 coat protein gene (U5 cp), the T7 promoter, an. Arabidopsis thaliana CD4-13 Notl fragment, and part of the pUC19 plasmid. The TMV-Ul subgenomic promoter located within the minus strand of the 30-kDa ORF controls the synthesis of the CD4-13 subgenomic RNA.

DNA sequencing and computer analysis.

A 841 bp Notl fragment of 740 AT #2441 (FIGURE 10; nucleic acid sequence and amino acid sequence as SEQ ID ΝOs: 36 and 37, respectively) containing the Ran GTP binding protein cDΝA was characterized. The nucleotide sequencing of 740 AT #2441 was carried out by dideoxy termination using double stranded templates. Nucleotide sequence analysis and amino acid sequence comparisons were performed using DNA Strider, PCGENE and NCBI Blast programs. 740 AT #2441 contained an open reading frame (ORF) in the positive orientation that encodes a protein of 221 amino acids with an apparent molecular weight of 25,058 Da. The mass of the protein was calculated using the Voyager program (Perceptive Biosystems). FIGURE 11 shows the nucleotide sequence alignment of 740AT #2441 to AF017991 (SEQ. ID. Nos: 38 and 39 respectively), a A thaliana salt stress inducible small GTP binding protein Rani. FIGURE 12 shows the nucleotide alignment of 740 AT #2441 to L16787 (SEQ. ID. Nos: 40 and 41 respectively), aN tabacum small ras-like GTP binding protein. FIGURE 13 shows the amino acid comparison of 740 AT #2441 to tobacco Ran-Bl GTP binding protein (SEQ. ID. Νos: 42 and 43 respectively).

The A. thaliana cDΝA exhibits a high degree of homology (99% to 82%) to A. thaliana, tomato (L. esculentum), tobacco (N. tabacum), L. japonicus and bean (V.faba) GTP binding proteins cDΝAs (Table 1). The nucleotide sequence from 740 AT #2441 encodes a protein that has strong similanty (100%) to 95%) to A thaliana, tomato, tobacco, and bean GTP binding proteins (Table 2)

The #2441 DNA also exhibits a high degree of homology (67% to 83%) to human, yeast, mouse and drosophila GTP binding proteins cDNAs (Table 3) The protein also has 67%-97% identities, and 79%-98% positives to yeast, mammalian organisms such as human (Table 4)

Table 1 . 740 AT #2441 Nucleotide sequence comparison

Clone Score pValue Identities Positives

A. thaliana A¥ 17991 3645 (1007 .2 bits) O.OOE+00 773/738 (99%) 733/738 (99%) A. thahanai ATU75601 3645 (1007 .2 bits) O.OOE+00 733/738 (99%) 773/738 (99%) A. thalianai X97381 3618 (999.7 bits) 0.00E400 730/738 (99%) 733/738 (98%) L. esculentum L28714 2341 (646.9 bits) 1.50E-189 561/677 (82%) 561/677 (82%) N. tabacum LI 6787 2336 (645.5 bits) 3.90E-189 556/667 (83%) 556/667 (83%) L. esculentum L28713 2313 (639.1 bits) 3.00E-1 87 557/675 (82%) 557/675 (82%) L. esculentum L28715 2336 (645.5 bits) 4.10E-189 560/676 (82%) 560/676 (82%) V. faba Z2461Z 2325 (642.4 bits) 3.30E-1 88 557/672 (82%) 557/672 (82%) i > N. tabacum LI 6767 2272 (627.8 bits) 7.70E-1 84 548/665 (82% 548/665 (82%) L. japonicus Z73960 2194 (606.2 bits) 3.00E-177 526/635 (82%) 526/635 (82%) L. japonicus Z73959 2187 (604.3 bits) 9.70E-177 531/648 (81 %) 531 /648 (81 %)

Table 2 740 AT #2441 Amino ; acid sequence comp arison Clone Score Pvalue Identities Positives

A. thaliana SP_PL: 004664 1 192 (554.1 bits) 1.50E-162 221/221 (100%) 221/221 (100%) /I. thaliana SP_PL:O04148 1 172 (544.8 bits) 9.60E-160 217/221 (98%) 220/221 (99%) A. thaliana SP_PL:O22495 1 172 (544.8 bits) 9.60E-160 217/221 (98%) 219/221 (99%) N. tabacum SW:RANA_TOBAC P41918 1 169 (543.4 bits) 2.50E-159 216/221 (97%) 218/221 (98%) V. faba SW:RAN_VICFA P38548 1 155 (536.9 bits) 2.30E-157 212/221 (95%) 216/221 (97%) A. thaliana SW:RAN2_ARATH P41917 1 150 (534.6 bits) 1.10E-156 21 1/221 (95%,) 217/221 (98%)

ON L. esculentum SW:RAN2 LYCES P38547 1 148 (533.7 bits) 2.20E-156 212/221 (95%) 214/221 (96%) N. tabacum SW:RANB TOBAC P41919 1 145 (532.3 bits) 5.70E-156 212/221 (95%) 214/221 (96%) L. esculentum SW:RAN 1_LYCES P38546 1 143 (531 .3 bits) 1.10E-155 21 1 /221 (95%,) 213/221 (96%) A. thaliana SW:RAN1 _ARATH P41916 1 141 (530.4 bits) 2.10E-155 210/221 (95%) 215/221 (97%)

L. japonicus SW:RANB_LOTJA P54766 11 11 (516.5 bits) 3.50E-151 205/209 (98%) 207/209 (99%)

L. japonicus SW:RANA_LOT.TA P 54765 1106 (514.1 bits) 1.70E-150 204/209 (97%) 206/209 (98%)

Table 3. 740 AT #2441 Nucleotide sequence comparison

Table 4. 740 AT #2441 Amino acid sequence comparison

MALDI-TOF analysis of N benthamiana transfected with 740 AT #2441

10 days after inoculation, the apical menstem, leaves, and stems from N benthamiana transfected with 740 AT #2441 were frozen in liquid nitrogen The soluble proteins were extracted in gπndmg buffer (lOOmM Tns, pH 7 5, 2 mM EDTA, 1 mM PMSF, 10 mM BME) using a mortar and pestle The homogenate was filtered through four layers of cheesecloth and spun at 10, 000 X g for 15 mm The supernatant was decanted and spun at 100, 000 X g for 1 hr A 500 μl aliquot of the supemant was mixed with 500 μl 20% TCA (acetone/0 07% BME) and stored at 4° C overnight The supemant was analyzed by MALDI-TOF (Karas et al , Anal Chem 60 2299-2301 (1988)) The results showed that the soluble proteins contained a newly expressed protein of molecular weight 25,058

Isolation of an Arabidopsis thaliana GTP binding protein genomic clone A genomic clone encoding A thaliana GTP binding proteins can be isolated by probing filters contaimng A thaliana BAC clones using a ³²P-labelled 740 AT #2441 Notl insert Other members of the A thaliana ARF multigene family been identified using programs of the University of Wisconsin Genetic Computer Group

EXAMPLE 11 Identification of nucleotide sequences involved in the regulation of plant growth bv cytoplasmic inhibition of gene expression in an antisense oπentation using viral deπved RΝA (GTP binding proteins)

In this example, we show (1) a method for producing antisense RΝA using an RΝA viral vector, (2) a method to produce viral-deπved antisense RΝA in the cytoplasm, (3) a method to inhibit the expression of endogenous plant proteins in the cytoplasm by viral antisense RΝA, and (4) a method to produce transfected plants containing viral antisense RΝA, such method is much faster than the time required to obtain genetically engineered antisense transgenic plants Systemic infection and expression of viral antisense RΝA occurs as short as several days post inoculation, whereas it takes several months or longer to create a single transgenic plant This example demonstrates that novel positive strand viral vectors, which replicate in the cytoplasm, can be used to identify genes involved in the regulation of plant growth by inhibiting the expression of specific endogenous genes This example enables one to characterize specific genes and biochemical pathways in transfected plants using an RNA viral vector.

Tobamoviral vectors have been developed for the heterologous expression of uncharacterized nucleotide sequences in transfected plants. A partial Arabidopsis thaliana cDNA library was placed under the transcriptional control of a tobamovirus subgenomic promoter in a RNA viral vector. Colonies from transformed E. coli were automatically picked using a Flexys robot and transferred to a 96 well flat bottom block containing terrific broth (TB) Amp 50 ug/ml. Approximately 2000 plasmid DNAs were isolated from overnight cultures using a BioRobot and infectious RNAs from 430 independent clones were directly applied to plants. One to two weeks after inoculation, transfected Nicotiana benthamiana plants were visually monitored for changes in growth rates, morphology, and color. One set of plants transfected with 740 AT #120 were severely stunted. DNA sequence analysis revealed that this clone contained an Arabidopsis GTP binding protein open reading frame (ORF) in the antisense orientation. This demonstrates that an episomal RNA viral vector can be used to deliberately alter the metabolic pathway and cause plant stunting. In addition, our results suggest that the Arabidopsis antisense transcript can rum off the expression of the N benthamiana gene.

Constmction of an Arabidopsis thaliana cDΝA library in an RΝA viral vector.

An Arabidopsis thaliana CD4-13 cDΝA library was digested with Notl. DΝA fragments between 500 and 1000 bp were isolated by trough elution and subcloned into the Notl site of pBS740. E. coli C600 competent cells were transformed with the pBS740 AT library and colonies containing Arabidopsis cDΝA sequences were selected on LB Amp 50 ug/ml. Recombinant C600 cells were automatically picked using a Flexys robot and then transferred to a 96 well flat bottom block containing terrific broth (TB) Amp 50 ug/ml. Approximately 2000 plasmid DΝAs were isolated from overnight cultures using a BioRobot (Qiagen) and infectious RΝAs from 430 independent clones were directly applied to plants.

Isolation of a gene encoding a GTP binding protein.

One to two weeks after inoculation, transfected Nicotiana benthamiana plants were visually monitored for changes in growth rates, morphology, and color. Plants transfected with 740 AT #120 (FIGURE 14) were severely stunted Plasmid 740 AT #120 contains the TMV-Ul 126-, 183-, and 30-kDa ORFs, the TMV-U5 coat protem gene (U5 cp), the T7 promoter, an Arabidopsis thaliana CD4-13 Notl fragment, and part of the pUC19 plasmid The TMV-Ul subgenomic promoter located within the minus strand of the 30-kDa ORF controls the synthesis of the CD4-13 antisense subgenomic RΝA

DΝA sequencing and computer analysis

A 782 bp Notl fragment of 740 AT #120 containing the ADP-nbosylation factor (ARF) cDΝA was charactenzed DΝA sequence of Notl fragment of 740 AT #120 (774 base pairs) is as follows 5'-

CCGAAACATTCTTCGTAGTGAAGCAAAATGGGGTTGAGTTTCGCCAAGCTGTTT AGCAGGCTTTTTGCCAAGAAGGAGATGCGAATTCTGATGGTTGGTCTTGATGCT GCTGGTAAGACCACAATCTTGTACAAGCTCAAGCTCGGAGAGATTGTCACCACC ATCCCTACTATTGGTTTCAATGTGGAAACTGTGGAATACAAGAACATTAGTTTCA CCGTGTGGGATGTCGGGGGTCAGGACAAGATCCGTCCCTTGTGAGACACTACTT CCAGAACACTCAAGGTCTAATCTTTGTTGTTGATAGCAATGACAGAGACAGAGT TGTTGAGGCTCGAGATGAACTCCACAGGATGCTGAATGAGGACGAGCTGCGTGA TGCTGTGTTGCTTGTGTTTGCCAACAAGCAAGATCTTCCAAATGCTATGAACGCT GCTGAAATCACAGATAAGCTTGGCCTTCACTCCCTCCGTCAGCGTCATTGGTATA TCCAGAGCACATGTGCCACTTCAGGTGAAGGGCTTTATGAAGGTCTGGACTGGC TCTCCAACAACATCGCTGGCAAGGCATGATGAGGGAGAAATTGCGTTGCATCGA GATGATTCTGTCTGCTGTGTTGGGATCTCTCTCTGTCTTGATGCAAGAGAGATTA TAAATATTATCTGAACCTTTTTGCTTTTTTGGGTATGTGAATGTTTCTTATTGTGC AAGTAGATGGTCTTGTACCTAAAAATTTACTAGAAGAACCCTTTTAAATAGCTTT CGTGTATTGT-3' (SEQ ID NO 44)

The nucleotide sequencing of 740 AT #120 was earned out by dideoxy termination using double stranded templates Nucleotide sequence analysis and amino acid sequence compansons were performed using DNA Stπder, PCGENE and NCBI Blast programs 740 AT #120 contained an open reading frame (ORF) in the antisense onentation that encodes a protein of 181 ammo acids with an apparent molecular weight of 20,579 Daltons Sequence companson

FIGURE 15 shows a nucleotide sequence companson of A thalana 740 AT #120 and A thαhαnα est AA042085 (SEQ ID Nos 45 and 46 respectively) The nucleotide sequence from 740 AT #120 is also compared with a πce (Orvzα sαtivα) ADP πbosylation factor AF012896, SEQ ID NOs 47 and 48 (FIGURE 16), which shows 82% (456/550) positives and identities

The nucleotide sequence from 740 AT #120 exhibits a high degree of homology (81- 84%, identity and positive) to nee, barley, carrot, com and A thαhαnα DNA encoding ARFs and also a high degree of homology (71-84% identity and positive) to yeast, plants, insects such as fly, amphibian such as frog, mammalian such as bovme, human, and mouse DNA encoding (Table 5)

The ammo acid sequence deπved from 740 AT #120 exhibits an even higher degree of homology (96-98% identity and 97-98% positive) to ARFs from πce, carrot, com and A thαhαnα and a high degree of homology (61-98% identity and 78-98% positive, even higher than nucleotide sequence homology) to ARFs from yeast, plants insects such as fly, mammalian such as bovme, human, and mouse (Table 6)

The high homology of DNAs encoding GTP binding proteins from yeast, plants, insects, human, mice, and amphibians indicates that DNAs from one donor organism can be transfected into another host organism and silence the endogenous gene of the host organism

Table 5.740 AT #120 Nucleotide sequence comparison

Score Expect Identities Positives barley El 0542 540.8 bits (1957) 1.4e-157 461/548(84%) 461/548(84%)

A. thaliana M95166 538.5 bits (1949) 7.4e-157 461/550(83%) 461/550 (83%) rice AFO 12896 537.7 bits (1946) 1.3e-156 462/553 (83%) 462/553 (83%) carrot D45420 531.4 bits (1923) 9.8e-155 471/579(81%,) 471/579(81%,) com X80042 512.3 bits (1854) 6.8e-149 450/549(81%,) 450/549(81%)

C. reinhardtii U21120 480.0 bits (1740) 1.6e-139 436/546 (79%) 436/546 (79%) mouse brain ARF3 D87900 431.1 bits (1560) 1.7e-124 416/546(76%) 416/546(76%)

Bovine J03794 426.9 bits (1545) 3.6e-123 409/534 (76%) 409/534 (76%)

Human ARF3 M33384 433.5 bits (1569) 4.9e-123 417/546(76%) 417/546(76%)

S.pombeARFl L09551 430.2 bits (1557) l.le-121 409/531 (77%) 409/531 (77%) as so Human ARF1 AF05502 428 bits (1549) 5.8e-121 405/524 (77%) 405/524 (77%) frog U31350 414.5 bits (1500) 1.7e-119 412/552(74%) 412/552(74%)

Human ARF5 M57567 387.4 bits (1402) 1.0e-107 390/527 (74%) 390/527 (74%)

S. cerevisiae J 03276 362.8 bits (1313) 1.6e-99 381/529 (72%) 381/529(72%)

Human ARF4 M36341 358.4 bits (1297) 4.3e-98 377/524(71%) 377/524(71%)

C elegans M36341 149.8 bits (542) 2.0e-90 154/211 (72%) 154/211 (72%)

N. tabacum NTGB1 U46927285.7 bits (1034) 4.8e-78 234/268 (87%) 234/268 (87%)

Human cosmid AC000357 107.5 bits (389) 9.7e-73 93/112(83%) 93/112(83%) fly S62079 211.9 bits (767) 2.8e-72 195/247(78%) 195/247 (78%)

Table 6. Amino acid sequence comparison of 740 AT #120 with ARFs from other organisms.

Score Expect Identities Positives

A. thaliana ARF1 g543841 365 bits (928) e-101 179/181 (98%) 179/181 (98%) ricegl703380 363 bits (921) e-100 177/181 (97%) 179/181 (98%) co gl351974 356 bits (905) 3e-98 174/181 (96%) 179/181 (98%) carrot gl 703375 362 bits (919) e-100 177/181 (97%) 178/181 (97%)

C. reinha dtii g\70331 354 bits (898) 2e-97 172/180(95%) 174/180(96%)

Bovine 327 bits (829) 2e-89 160/177(90%) 166/177(93%)

Human ARF1 326 bits (827) 4e-89 160/177(90%,) 166/177(93%) mouse 326 bits (827) 4e-89 160/177(90%) 166/177(93%) fly 325 bits (825) 7e-89 158/177(89%) 166/177(93%)

Human ARF3 PI 6587 321 bits (813) le-87 157/180(87%,) 164/180(90%)

Human ARF5 gl 14127 305 bits (774) 7e-83 145/178(81%) 161/178(89%)

Human ARF4 gl 14123 304 bits (770) 2e-82 145/178(81%) 160/178 (89%) yeast ARF 1 gl71072 298 bits (754) 2e-80 139/177(78%) 161/177(90%)

A. thaliana ARF3 241 bits (608) 2e-63 109/177(61%) 140/177(78%)

The protein encoded by 740 AT #120, 120P, contained three conserved domains: the phosphate binding loop motif, GLDAAGKT (SEQ ID N0.49), (consensus GXXXXGKS/T, SEQ ID NO.50); the G' motif, DVGGQ (SEQ ID NO:51), (consensus DXXGQ, SEQ ID NO:52), a sequence which interacts with the gamma-phosphate of GTP; and the G motif NKQD (SEQ ID NO:53), (consensus NKXD, SEQ. ID. 54), which is specific for guamdmyl binding. The 120P contains a putative glycine-myπstoylation site at position 2, a potential N-glycosylation site (NXS) at position 60, and several putative senne/threonme phosphorylations sites

Humanizing DNA

The nucleotide sequence from 740 AT #120 is also compared with a human ADP πbosylation factor (ARF3) M33384, which shows a strong similanty (76%, identity at the nucleotide level and 87%, identity at the amino acid level) The amino acid sequence alignment of 740 AT #120 to human ADP-nbosylation factor (ARF3) P16587 is compared in FIGURE 17 (SEQ. ID. Nos- 55-57), which shows 87% identity and 90% positive

The high homology of the nucleic acid and amino acid sequence between the two makes humanizing 740 #AT120 practical. A humanized sequence, 740 AT#120 H nucleic acid sequence is prepared by changing the 740 AT#120 nucleic acid sequence so that it encodes the same ammo acid sequence as the human M33384 encodes. The nucleic acid is changed by a standard method such as site directed mutagemsis or DNA synthesis. FIGURE 18 (SEQ ID. Nos: 58 and 59 for nucleotide sequences and SEQ. ID NO: 60 for ammo acid sequence) shows the sequence alignment of 740 AT #120H to human ARF3 M33384

Isolation of an Arabidopsis thaliana ARF genomic clone

A genomic clone encoding A thaliana ARF can be isolated by probing filters containing A thaliana BAC clones using a ³²P labeled 740 AT #120 Notl insert. Other members of the A. thaliana ARF multigene family have been identified using programs of the University of Wisconsin Genetic Computer Group The BAC clone T08I13 located on chromosome II has a high degree of homology to 740 AT #120 (78% to 86% identity at the nucleotide level). Isolation and characteπzation of a cDNA encoding Nicotiana benthamiana ARF

A 488 bp cDNA from N benthamiana stem cDNA library was isolated by polymerase chain reaction (PCR) using the following ohgonucleotides ATARFK15, 5' AAG AAG GAG ATG CGA ATT CTG ATG GT 3' (upstream) (SEQ ID NO 61), ATARFN176, 5' ATG TTG TTG GAG AGC CAG TCC AGA CC 3' (downstream) (SEQ ID NO 62) The vent polymerase in the reaction was inactivated using phenol/chloroform, and the PCR product was directly cloned into the Hindi site in Bluescπpt KS+ (Strategene) The plasmid map of KS+ Nb ARF #3, which contains the N benthamiaca ARF ORF in pBluescnpt KS+ is shown m FIGURE 19 The nucleotide sequence of N benthamiana KS+ Νb ARF#3, which contains partial ADP-nbosylation factor ORF, was determined by dideoxynucleotide sequencing The nucleotide sequence from KS+ Νb ARF#3 had a strong similanty to other plant ADP-nbosylation factor sequences (82 to 87% identities at the nucleotide level) The nucleotide sequence companson of N benthamiana KS+ Νb ARF#3 and A thaliana 740 AT #120 shows a high homology between them (FIGURE 20, SEQ ID Νos 63 and 64 respectively) The nucleotide sequence of KS+ ΝbARF #3 exhibits a high degree of homology (77-87% identities and positives) to plant, yeast and mammalian DΝA encoding ARFs (Table 7) Again, the high homology of DΝAs encoding GTP binding proteins from yeast, plants, human, bovme and mice indicates that DΝAs from one donor organism can be transfected mto another host organism and effectively silence the endogenous gene of the host organism

Table 7. KS+ Nb ARF #3 Nucleotide sequence comparison

Score Expect Identities Positives

A thaliana M95166 448.2 bits (1622) 1.2e-129 366/418 (87%) 366/418 (87%,)

C. roseus AF005238 446.0 bits (1614) 5.3e-129 368/427 (86%) 370/427 (86%)

S. bakko AB003377 444.9 bits (1610) l .le-128 366/421 (86%,) 366/421 (86%) rice AFO 12896 425.8 bits ( 1541 ) 5.1e-121 357/418 (85%,) 357/418 (85%)

V. unguiculata AF022389 425.8 bits ( 1541 ) 5.1e-121 857/418 (85%) 357/418 (85%) barley El 0542 413.4 bits ( 1496) 1.2e-1 15 356/427 (83%) 356/427 (83%,)

S. tuberosum X74461 405.9 bits (1469) 3.5e-115 353/427 (82%,) 353/427 (82%) carrot D45420 408.4.4 bits (1478) 3.3e-1 14 354/427 (82%) 354/427 (82%) com X80042 400.1 bits (1448) 2.3e-113 348/421 (82%) 348/421 (82%,) rice D 17760 403.4 bits (1460) 3.7e-1 12 352/427 (82%) 352/427 (82%)

C reinhardtii U27120 373.6 bits ( 1352) 5.0e-103 340/427 (79%) 340/427 (79%,)

Human ARF3 M33384 367.5.5 bits ( 1330) 7.1e-101 334/419 (79%) 334/419 (79%) mouse brain ARF3 D87900 355.3 bits ( 1286) 1.3e-97 330/421 (78%,) 330/421 (78%)

Bovine J03794 342.6 bits ( 1240) 1.4e-95 324/419 (77%) 324/419 (77%,)

A full-length cDNA encoding ARF is isolated by screening the N benthamiana cDΝA library by colony hybndization using a ³²P-labeled N benthamiana KS+ Νb ARF #3 probe Hybπdization is earned out at 42°C for 48 hours in 50% formamide, 5X SSC, 0 02 M phosphate buffer, 5X Denhart's solution, and 0 1 mg/ml sheared calf thymus DNA Filters are washed at 65°C in 0 IX SSC, 0 1% SDS pnor to autoradiography

Rapid isolation of cDNAs encoding ARF. GTP binding proteins from πce. barley, com, soybean, and other plants

Libranes containing full-length cDNAs from nee, barley, com, soybean and other important crops are obtained from public and pnvate sources or can be prepared from plant mRNAs The cDNAs are inserted in \ iral vectors or in small subcloning vectors such as pBluescnpt (Strategene), pUC18, Ml 3, or pBR322 Transformed bactena (E coli) are then plated on large petπ plates or bioassay plates containing the appropnate media and antibiotic Individual clones are selected using a robotic colony picker and arrayed into 96 well microtiter plates The cultures are incubated at 37°C until the transformed cells reach log phase A quots are removed to prepare glycerol stocks for long term storage at -80°C The remainder of the culture is used to inoculate an additional 96 well microtiter plate containing selective media and grown overnight DNAs are isolated from the cultures and stored at -20°C Using a robotic unit such as the Qbot (Genetix), the E coli transformants or DNAs are rearrayed at high density on nylon filters or glass slides Full-length cDNAs encoding ARFs from nee, barley, com, soybean and other important crops are isolated by screening the vanous filters of slides by hybndization using a ³²P-labeled or fluorescent N benthamiana KS+/Νb ARF #3 probe, or Arabidopsis 740 AT #120 Notl insert

Rapid isolation of genomic clones encoding ARF. GTP bindmg proteins from nee barley, com, soybean, and other plants

Genomic hbranes containing sequences from πce, barley, co , soybean and other important crops are obtained from public and pπvate sources, or are prepared from plant genomic DΝAs BAC clones containing entire plant genomes have been constmcted and organized in minimal overlapping order Individual BACs are sheared to 500-1000 bp fragments and directly cloned into viral vectors Approximate 200-500 clones that completely cover an entire BAC will form a BAC viral vector subhbrary. These libraries can be stored as bacterial glycerol stocks at -80C and as DNA at -20C. Genomic clones are identified by first probing filters of BACs with a ³²P-labeled or fluorescent N. benthamiana KS+/Nb ARF #3 probe, or ³ P-labeled Arabidopsis 740 AT #120 Notl insert. BACs that hybridize to the probe are selected and their corresponding BAC viral vector subhbrary is used to produce infectious RΝA. Plants that are transfected with the BAC subhbrary are screened for loss of function (for example, stunted plants). The inserts from these clones or their corresponding plasmid DΝAs are characterized by dideoxy sequencing. This provides a rapid method to obtain the genomic sequence for the plant ARFs or GTP binding proteins.

Rapid isolation of cDΝAs encoding human ADP-ribosylation factor

Libraries containing full-length human cDΝAs from organisms such as brain, liver, breast, lung, etc. are obtained from public and private sources or prepared from human mRΝAs. The cDΝAs are inserted in viral vectors or in small subcloning vectors such as pBluescript (Strategene), pUC18, M13, or pBR322. Transformed bacteria (E. coli) are then plated on large petri plates or bioassay plates containing the appropriate media and antibiotic. Individual clones are selected using a robotic colony picker and arrayed into 96 well microtiter plates. The cultures are incubated at 37°C until the transformed cells reach log phase. Aliquots are removed to prepare glycerol stocks for long term storage at -80°C. The remainder of the culture is used to inoculate an additional 96 well microtiter plate containing selective media and grown overnight. DΝAs are isolated from the cultures and stored at -20°C. Using a robotic unit such as the Qbot (Genetix), the E. coli transformants or DΝAs are rearrayed at high density on nylon or nitrocellulose filters or glass slides. Full- length cDΝAs encoding ARFs from human brain, liver, breast, lung, etc. are isolated by screening the various filters or slides by hybridization with a ³²P-labeled or fluorescent N benthamiana KS+/Νb ARF #3 probe or Arabidopsis 740 AT #120 Notl insert.

Constmction of a viral vector containing human cDΝAs.

An ARF5 clone containing nucleic acid inserts from a human brain cDΝA library (Bobak et al, Proc. Natl Acad. Su. USA 86:6101-6105 (1989)) was isolated by polymerase chain reaction (PCR) using the following ohgonucleotides: HARFMIA, 5' TAC CTA GGG CAA TAT CTT TGG AAA CCT TCT CAA G 3' (upstream) (SEQ ID NO:65), HARFK181X, 5' CGC TCG AGT CAC TTC TTG TTT TTG AGC TGA TTG GCC AG 3' (downstream) (SEQ ID NO: 66). The vent polymerase in the reaction was inactivated using phenol chloroform. The PCR products are directly cloned into the Xhol, Avrll site TTOIA.

EXAMPLE 12

Silencing of phvtoene desaturase in nicotiana benthamiana using a tobravims vector.

Tobacco rattle tobravims (TRV) is a bipartite positive-sense, single-stranded RNA vims. TRV is able to infect a wide range of plant hosts, including Arabidopsis thaliana (unpublished data), Nicotiana species, Brassica campestris, Capsicum annuum, Chenopodium amaranticolor, Glycine max, Lycopersicon esculentum, Narcissus pseudonarcissus, Petunia X hybrida, Pisum sativum, Solanum tuberosum, Spinacia oleracea, Viciafaba,

(http://www.ncbi.nlm.nih.gOv/ICTVdb/ICTVdB/72010004.htm#SymptHost). TRV RNA-1 encodes proteins involved in viral replication (Replicase, 134/194 kDa) and movement (Movement Protein (mp) 29 kDa), as well as Cysteine Rich Protein ((CRP) 16 kDa) (Figure 2 LA). An improved mutant of TRV RNA-1, pLSB-1, was isolated from an N. benthamiana plant that had been inoculated with a passaged sap extract of PpK20 (MacFarlane and Popovich. Efficient expression of foreign proteins in roots from tobravirus vectors. Virology, 267, 29-35 (2000)) from another N. benthamiana plant. Plants inoculated with pLSB-1 RΝA-1 exhibit gene silencing more extensively compared to those inoculated with PpK20 RNA-1. Virions were purified from the leaf tissue by a PEG precipitation method (Gooding GV Jr, Hebert TT (1967) A simple technique for purification of tobacco mosaic virus in large quantities. Phytopathology 57(11): 1285), RNA was isolated using the RNeasy Mini Kit (Qiagen®), then cDNA was made using the cDNA Synthesis System (Gibco BRL®) using the oligonucleotide 5'-

TTAATTAAGCATGCGGATCCCGTACGGGCGTAATAACGCTTACGTAGGCGAGGG GTTTTAC-3'. The full length TRV RNA-1 was PCR amplified using the ohgonucleotides 5'- ATGAAGAGCATGCTAATACGACTCACTATAGATAAAACATTTCAATCCTTTGAA

CGC-3' (upstream) and 5'-

TTCATCTGGATCCCGGGCGTAATAACGCTTACGTAGGCG-3' (downstream) and cloned into pUC18 at the Sph VBam HI sites. This TRV RNA-1 constmct, pLSB-1, was verified by dideoxynucleotide sequencing and found to have 29 point mutations compared with the published sequence for PpK20 RNA-1 (Visser,P.B. and Bol,J.F. (1999).

ACCESSION API 66084). All of these point mutations are in the replicase gene, and many code for amino acid substitutions. The sequence of the mutant TRV RNA-1 viral sequence contained within pLSB-1 is as follows. 5'-

ATAAAACATTTCAATCCTTTGAACGCGGTAGAACGTGCTAATTGGATTTTGGTG

AGAACGCGGTAGAACGTACTTATCACCTACAGTTTTATTTTGTTTTTCTTTTTGGT

TTAATCTATCCAGCTTAGTACCGAGTGGGGGAAAGTGACTGGTGTGCCTAAAAC

CTTTTCTTTGATACTTTGTAAAAATACATACAGATACAATGGCGAACGGTAACTT

CAAGTTGTCTCAATTGCTCAATGTGGACGAGATGTCTGCTGAGCAGAGGAGTCA

TTTCTTTGACTTGATGCTGACTAAACCTGATTGTGAGATCGGGCAAATGATGCAA

AGAGTTGTTGTTGATAAAGTCGATGACATGATTAGAGAAAGAAAGACTAAAGAT

CCAGTGATTGTTCATGAAGTTCTTTCTCAGAAGGAACAGAACAAGTTGATGGAA

ATTTATCCTGAATTCAATATCGTGTTTAAAGACGACAAAAACATGGTTCATGGG

TTTGCGGCTGCTGAGCGAAAACTACAAGCTTTATTGCTTTTAGATAGAGTTCCTG

CTCTGCAAGAGGTGGATGACATCGGTGGTCAATGGTCGTTTTGGGTAACTAGAG

GTGAGAAAAGGATTCATTCCTGTTGTCCAAATCTAGATATTCGGGATGATCAGA

GAGAAATTTCTCGACAGATATTTCTTACTGCTATTGGTGATCAAGCTAGAAGTG

GTAAGAGACAGATGTCGGAGAATGAGCTGTGGATGTATGACCAATTTCGTGAAA

ATATTGCTGCGCCTAACGCGGTTAGGTGCAATAATACATATCAGGGTTGTACAT

GTAGGGGTTTTTCTGATGGTAAGAAGAAAGGCGCGCAGTATGCGATAGCTCTTC

ACAGCCTGTATGACTTCAAGTTGAAAGACTTGATGGCTACTATGGTTGAGAAGA

AAACTAAAGTGGTTCATGCTGCTATGCTTTTTGCTCCTGAAAGTATGTTAGTGGA

CGAAGGTCCATTACCTTCTGTTGACGGTTACTACATGAAGAAGAACGGGAAGAT

CTATTTCGGTTTTGAGAAAGATCCTTCCTTTTCTTACATTCATGACTGGGAAGAG

TACAAGAAGTATCTACTGGGGAAGCCAGTGAGTTACCAAGGGGATGTGTTCTAC

TTCGAACCGTGGCAGGTGAGAGGAGACACAATGCTTTTTTCGATCTACAGGATA GCTGGAGTTCCGAGGAGGTCTCTATCATCGCAAGAGTACTACCGAAGAATATAT

ATCAGTAGATGGGAAAACATGGTTGTTGTCCCAATTTTCGATCTGGTCGAATCA

ACGCGAGAGTTGGTCAAGAAAGACCTGTTTGTAGAGAAACAATTCATGGACAA

GTGTTTGGATTACATAGCTAGGTTATCTGACCAGCAGCTGACCATAAGCAATGT

TAAATCATACTTGAGTTCAAATAATTGGGTCTTATTCATAAACGGGGCGGCCGT

GAAGAACAAGCAAAGTGTAGATTCTCGAGATTTACAGTTGTTGGCTCAAACTTT

GCTAGTGAAGGAACAAGTGGCGAGACCTGTCATGAGGGAGTTGCGTGAAGCAA

TTCTGACTGAGACGAAACCTATCACGTCATTGACTGATGTGCTGGGTTTAATATC

AAGAAAACTGTGGAAGCAGTTTGCTAACAAGATCGCAGTCGGCGGATTCGTTGG

CATGGTTGGTACTCTAATTGGATTCTATCCAAAGAAGGTACTAACCTGGGCGAA

GGACACACCAAATGGTCCAGAACTATGTTACGAGAACTCGCACAAAACCAAGG

TGATAGTATTTCTGAGTGTTGTGTATGCCATTGGAGGAATCACGCTTATGCGTCG

AGACATCCGAGATGGACTGGTGAAAAAACTATGTGATATGTTTGATATCAAACG

GGGGGCCCATGTCTTAGACGTTGAGAATCCGTGCCGCTATTATGAAATCAACGA

TTTCTTTAGCAGTCTGTATTCGGCATCTGAGTCCGGTGAGACCGTTTTACCAGAT

TTATCCGAGGTAAAAGCCAAGTCTGATAAGCTATTGCAGCAGAAGAAAGAAAT

CGCTGACGAGTTTCTAAGTGCAAAATTCTCTAACTATTCTGGCAGTTCGGTGAGA

ACTTCTCCACCATCGGTGGTCGGTTCATCTCGAAGCGGACTGGGTCTGTTGTTGG

AAGACAGTAACGTGCTGACCCAAGCTAGAGTTGGAGTTTCAAGAAAGGTAGAC

GATGAGGAGATCATGGAGCAGTTTCTGAGTGGTCTTATTGACACTGAAGCAGAA

ATTGACGAGGTTGTTTCAGCCTTTTCAGCTGAATGTGAAAGAGGGGAAACAAGC

GGTACAAAGGTGTTGTGTAAACCTTTAACGCCACCAGGATTTGAGAACGTGTTG

CCAGCTGTCAAACCTTTGGTCAGCAAAGGAAAAACGGTCAAACGTGTCGATTAC

TTCCAAGTGATGGGAGGTGAGAGATTACCAAAAAGGCCGGTTGTCAGTGGAGA

CGATTCTGTGGACGCTAGAAGAGAGTTTCTGTACTACTTAGATGCGGAGAGAGT

CGCTCAAAATGATGAAATTATGTCTCTGTATCGTGACTATTCGAGAGGAGTTATT

CGAACTGGAGGTCAGAATTACCCGCACGGACTGGGAGTGTGGGATGTGGAGAT

GAAGAACTGGTGCATACGTCCAGTGGTCACTGAACATGCTTATGTGTTCCAACC

AGACAAACGTATGGATGATTGGTCGGGATACTTAGAAGTGGCTGTTTGGGAACG

AGGTATGTTGGTCAACGACTTCGCGGTCGAAAGGATGAGTGATTATGTCATAGT

TTGCGATCAGACGTATCTTTGCAATAACAGGTTGATCTTGGACAATTTAAGTGCC CTGGATCTAGGACCAGTTAACTGTTCTTTTGAATTAGTTGACGGTGTACCTGGTT

GTGGTAAGTCGACAATGATTGTCAACTCAGCTAATCCTTGTGTCGATGTGGTTCT

CTCTACTGGGAGAGCAGCAACCGACGACTTGATCGAGAGATTCGCGAGCAAAG

GTTTTCCATGCAAATTGAAAAGGAGAGTGAAGACGGTTGATTCTTTTTTGATGC

ATTGTGTCGATGGTTCTTTAACCGGAGACGTGTTGCATTTCGACGAAGCTCTCAT

GGCCCATGCTGGTATGGTGTACTTTTGCGCTCAGATAGCTGGTGCTAAACGATGT

ATCTGTCAAGGAGATCAGAATCAAATTTCTTTCAAGCCTAGGGTATCTCAAGTT

GATTTGAGGTTTTCTAGTCTGGTCGGAAAGTTTGACATTGTTACAGAAAAAAGA

GAAACTTACAGAAGTCCAGCAGATGTGGCTGCCGTATTGAACAAGTACTATACT

GGAGATGTCAGAACACATAACGCGACTGCTAATTCGATGACGGTGAGGAAGAT

TGTGTCTAAAGAACAGGTTTCTTTGAAGCCCGGTGCTCAGTACATAACTTTCCTT

CAGTCTGAGAAGAAGGAGTTGGTAAATTTGTTGGCATTGAGGAAAGTGGCAGCT

AAAGTGAGTACAGTACACGAGTCGCAAGGAGAGACATTCAAAGATGTAGTCCT

AGTCAGGACGAAACCTACGGATGACTCAATCGCTAGAGGTCGGGAGTACTTAAT

CGTGGCGTTGTCGCGTCACACACAATCACTTGTGTATGAAACTGTGAAAGAGGA

CGATGTAAGCAAAGAGATCAGGGAAAGTGCCGCGCTTACGAAGGCGGCTTTGG

CAAGATTTTTTGTTACTGAGACCGTCTTATGACGGTTTCGGTCTAGGTTTGATGT

CTTTAGACATCATGAAGGGCCTTGCGCCGTTCCAGATTCAGGTACGATTACGGA

CTTGGAGATGTGGTACGACGCTTTGTTTCCGGGAAATTCGTTAAGAGACTCAAG

CCTAGACGGGTATTTGGTGGCAACGACTGATTGCAATTTGCGATTAGACAATGT

TACGATCAAAAGTGGAAACTGGAAAGACAAGTTTGCTGAAAAAGAAACGTTTC

TGAAACCGGTTATTCGTACTGCTATGCCTGACAAAAGGAAGACTACTCAGTTGG

AGAGTTTGTTAGCATTGCAGAAAAGGAACCAAGCGGCACCCGATCTACAAGAA

AATGTGCACGCGACAGTTCTAATCGAAGAGACGATGAAGAAGCTGAAATCTGTT

GTCTACGATGTGGGAAAAATTCGGGCTGATCCTATTGTCAATAGAGCTCAAATG

GAGAGATGGTGGAGAAATCAAAGCACAGCGGTACAGGCTAAGGTAGTAGCAGA

TGTGAGAGAGTTACATGAAATAGACTATTCGTCTTACATGTATATGATCAAATCT

GACGTGAAACCTAAGACTGATTTAACACCGCAATTTGAATACTCAGCTCTACAG

ACTGTTGTGTATCACGAGAAGTTGATCAACTCGTTGTTCGGTCCAATTTTCAAAG

AAATTAATGAACGCAAGTTGGATGCTATGCAACCACATTTTGTGTTCAACACGA

GAATGACATCGAGTGATTTAAACGATCGAGTGAAGTTCTTAAATACGGAAGCGG CTTACGACTTTGTTGAGATAGACATGTCTAAATTCGACAAGTCGGCAAATCGCTT

CCATTTACAACTGCAGCTGGAGATTTACAGGTTATTTGGGCTGGATGAGTGGGC

GGCCTTCCTTTGGGAGGTGTCGCACACTCAAACTACTGTGAGAGATATTCAAAA

TGGTATGATGGCGCATATTTGGTACCAACAAAAGAGTGGAGATGCTGATACTTA

TAATGCAAATTCAGATAGAACACTGTGTGCGCTCTTGTCTGAATTACCATTGGA

GAAAGCAGTCATGGTTACATATGGAGGAGATGACTCACTGATTGCGTTTCCTAG

AGGAACGCAGTTTGTTGATCCGTGTCCAAAGTTGGCTACTAAGTGGAATTTCGA

GTGCAAGATTTTTAAGTACGATGTCCCAATGTTTTGTGGGAAGTTCTTGCTTAAG

ACGTCATCGTGTTACGAGTTCGTGCCAGATCCGGTAAAAGTTCTGACGAAGTTG

GGGAAAAAGAGTATAAAGGATGTGCAACATTTGGCCGAGATCTACATCTCGCTG

AATGATTCCAATAGAGCTCTTGGGAACTACATGGTGGTATCCAAACTGTCCGAG

TCTGTTTCAGACCGGTATTTGTACAAAGGTGATTCTGTTCATGCGCTTTGTGCGC

TATGGAAGCATATTAAGAGTTTTACAGCTCTGTGTACATTATTCCGAGACGAAA

ACGATAAGGAATTGAACCCGGCTAAGGTTGATTGGAAGAAGGCACAGAGAGCT

GTGTCAAACTTTTACGACTGGTAATATGGAAGACAAGTCATTGGTCACCTTGAA

GAAGAAGACTTTCGAAGTCTCAAAATTCTCAAATCTAGGGGCCATTGAATTGTT

TGTGGACGGTAGGAGGAAGAGACCGAAGTATTTTCACAGAAGAAGAGAAACTG

TCCTAAATCATGTTGGTGGGAAGAAGAGTGAACACAAGTTAGACGTTTTTGACC

AAAGGGATTACAAAATGATTAAATCTTACGCGTTTCTAAAGATAGTAGGTGTAC

AACTAGTTGTAACATCACATCTACCTGCAGATACGCCTGGGTTCATTCAAATCG

ATCTGTTGGATTCGAGACTTACTGAGAAAAGAAAGAGAGGAAAGACTATTCAG

AGATTCAAAGCTCGAGCTTGCGATAACTGTTCAGTTGCGCAGTACAAGGTTGAA

TACAGTATTTCCACACAGGAGAACGTACTTGATGTCTGGAAGGTGGGTTGTATT

TCTGAGGGCGTTCCGGTCTGTGACGGTACATACCCTTTCAGTATCGAAGTGTCGC

TAATATGGGTTGCTACTGATTCGACTAGGCGCCTCAATGTGGAAGAACTGAACA

GTTCGGATTACATTGAAGGCGATTTTACCGATCAAGAGGTTTTCGGTGAGTTCAT

GTCTTTGAAACAAGTGGAGATGAAGACGATTGAGGCGAAGTACGATGGTCCTTA

CAGACCAGCTACTACTAGACCTAAGTCATTATTGTCAAGTGAAGATGTTAAGAG

AGCGTCTAATAAGAAAAACTCGTCTTAATGCATAAAGAAATTTATTGTCAATAT

GACGTGTGTACTCAAGGGTTGTGTGAATGAAGTCACTGTTCTTGGTCACGAGAC

GTGTAGTATCGGTCATGCTAACAAATTGCGAAAGCAAGTTGCTGACATGGTTGG TGTCACACGTAGGTGTGCGGAAAATAATTGTGGATGGTTTGTCTGTGTTGTTATC

AATGATTTTACTTTTGATGTGTATAATTGTTGTGGCCGTAGTCACCTTGAAAAGT

GTCGTAAACGTGTTGAAACAAGAAATCGAGAAATTTGGAAACAAATTCGACGA

AATCAAGCTGAAAACATGTCTGCGACAGCTAAAAAGTCTCATAATTCGAAGACC

TCTAAGAAGAAATTCAAAGAGGACAGAGAATTTGGGACACCAAAAAGATTTTT

AAGAGATGATGTTCCTTTCGGGATTGATCGTTTGTTTGCTTTTTGATTTTATTTTA

TATTGTTATCTGTTTCTGTGTATAGACTGTTTGAGATTGGCGCTTGGCCGACTCA

TTGTCTTACCATAGGGGAACGGACTTTGTTTGTGTTGTTATTTTATTTGTATTTTA

TTAAAATTCTCAATGATCTGAAAAGGCCTCGAGGCTAAGAGATTATTGGGGGGT

GAGTAAGTACTTTTAAAGTGATGATGGTTACAAAGGCAAAAGGGGTAAAACCC

CTCGCCTACGTAAGCGTTATTACGCCC-3'

RNA-2 encodes the capsid protein and two non-structural proteins, 2b and 2c (Figure 2 LA.) A TRV RNA-2 constmct expressing GFP was derived from a full-length clone of RNA2 of TRV isolate PpK20 (Mueller et al 1997. Journal of General Virology, 78, 2085-2088 (1997), MacFarlane and Popovich. Efficient expression of foreign proteins in roots from tobravirus vectors. Virology, 267, 29-35 (2000)). This TRV-GFP constmct has the 2c gene of TRV RNA-2 replaced with the pea early browning vims (PEB V) coat protein promoter linked to GFP (MacFarlane and Popovich, 2000). This TRV-GFP constmct was further modified by replacing the GFP gene with Pst I and Not I cloning sites to produce the plasmid pK20-2b-P/N. The phytoene desaturase (PDS) gene from N benthamiana was PCR amplified from the plasmid pWPF187 using the following ohgonucleotides 5'- TGGTTCTGCAGTTATG

CATGCCCCAAATTGGACTTG-3' (upstream) and 5'-TTTTCCTTTTGCGGCCG CTAAACTACGCTTGCTTCTG-3' (downstream). This PCR product was then subcloned into pK20-2b-P/Ν in the positive orientation. The resulting constmct, TRV-PDS (Figure 2 LB.), was linearized with Sma I and transcribed using T7 RNA polymerase (Ambion mMessage mMachine). Transcript RNA2 was mixed with transcripts from a full-length clone of TRV RNA-1 (pLSB-1).

TRV-PDS was inoculated onto N benthamiana. After 6-7 days, chlorotic areas began to develop in the upper emerging leaves. After 8-10 days, these chlorotic areas developed into white areas. Samples from TRV-PDS infected plants were analyzed using HPLC HPLC analysis revealed a dramatically elevated level of phytoene m TRV-PDS infected plants when compared to an umnoculated control

EXAMPLE 13 Identification of nucleotide sequences involved in the regulation of plant development bv cytoplasmic inhibition of gene expression in an anti sense onentation using viral denved RNA (G-protein coupled receptor)

This example again demonstrates that an episomal RNA viral vector can be used to deliberately manipulate a signal transduction pathway in plants In addition, our results suggest that the Arabidopsis antisense transcnpt can turn off the expression of the N benthamiana gene

A partial Arabidopsis thaliana cDNA library was placed under the transcπptional control of a tobamovirus subgenomic promoter in a RNA viral vector Colonies from transformed E coli were automatically picked using a Flexys robot and transferred to a 96 well flat bottom block contaimng terπfic broth (TB) Amp 50 ug/ml Approximately 2000 plasmid DNAs were isolated from overnight cultures using a BioRobot and infectious RNAs from 430 independent clones were directly applied to plants One to two weeks after inoculation, transfected Nicotiana benthamiana plants were visually monitored for changes in growth rates, morphology, and color One set of plants transfected with 740 AT #88 (FIGURE 22) developed a white phenotype on the infected leaf tissue DNA sequence analysis revealed that this clone contained an Arabidopsis G-protem coupled receptor open reading frame (ORF) in the antisense oπentation

DNA sequencing and computer analysis

A 758 bp Notl fragment of 740 AT #88 containing the G-protein coupled receptor cDΝA was charactenzed The nucleotide sequencing of 740 AT #88 was earned out by dideoxy termination using double stranded templates Nucleotide sequence analysis and ammo acid sequence compansons were performed using DNA Stnder, PCGENE and NCBI Blast programs FIGURE 23 shows the partial nucleotide sequence (SEQ ID NO 69) and ammo acid sequence (SEQ ID NO 70) of 740 AT #88 insert The nucleotide sequence from 740 AT #88 was compared with Brassica rapa cDNA L35812 (FIGURE 24, SEQ ID Nos 71 and 72), 91% identities and positives, and the octopus rhodopsin cDNA X07797 (FIGURE 25, SEQ ID NOs- 73 and 74), 68% identities and positives. The homology of DNAs encoding rhodopsin from plant and animal rhodopsin indicates that genes from one kingdom can inhibit the expression of gene of another kingdom The ammo acid sequence denved from 740 AT #88 was compared with octopus rhodopsin P31356 (FIGURE 26, SEQ. ID. Nos- 75-77), 65% identities and positives Table 8 shows the amino acid sequence companson of 740 AT #88 with D. discoideum and Octopus rhodopsin: 58 - 62% identities and 63 - 65%, positives

Table 8 AT #88 Amino acid sequence comparison

Clone Score pValue Identities

Positives

A., thaliana AC004625 430 (151.4 bits) 4.40E-52 70/70 ( 100%)

70/70 (100%)

D. discoideum ANNEX1N VII P24639 246 (86.6 bits) 2.60E-20 58/98 (59%)

62/98 (63%)

D. discoideum ANNEX1N VII X60270 245 (86.2 bits) 3.00E-20 57/91 (62%)

60/91 (65%)

00 4-_* Octopus rhodopsin X07797 235 (82.7 bits) 4.00E-19 50/85 (58%)

54/85 (63%)

EXAMPLE 14 Identification of nucleotide sequences containing an Arabidopsis S18 πbosomal protem open reading frame

One to two weeks after inoculation, transfected Nicotiana benthamiana plants were visually monitored for changes in growth rates, morphology, and color one set of plants transfected with 740 AT #377 (FIGURE 27) were severely stunted DNA sequence analysis (FIGURE 28, SEQ ID NO 78) revealed that this clone contained an

Arabidopsis S18 πbosomal protem open reading frame (ORF) in the antisense oπentation

EXAMPLE 15 Identification of LI 9 πbosomal protein gene involved in the regulation of plant growth bv cytoplasmic inhibition of gene expression using viral deπved RNA

One to two weeks after inoculation, transfected Nicotiana benthamiana plants were visually monitored for changes in growth rates, morphology, and color One set of plants transfected with 740 AT #2483 (FIGURE 29) were severely stunted DNA sequence analysis (FIGURE 30, SEQ ID NO 79) revealed that this clone contained an Arabidopsis LI 9 πbosomal protein open reading frame (ORF) in the antisense oπentation The 740 AT #2483 nucleotide sequence exhibited a high degree of homology (77-78% identities and positives) to plant, LI 9 nbosomal proteins genes (Table 9) In addition. The 740 AT #2483 nucleotide sequence exhibited a high degree of homology (71 - 79% identities and positives) to yeast, insect and human LI 9 πbosomal proteins genes (Table 9) The 740 AT #2483 amino acid sequence companson with human, insect and yeast nbosomal protein LI 9 shows 38 - 88% identities and 61 - 88% positives (Table 10) The high homology of DNAs encoding πbosomal L19 protein from human, plant, yeast and insect indicates that genes from one organism can inhibit the gene expression of an orgamsm from another kingdom Table 9. 740 AT #2483 Nucleotide sequence comparison

Clone Score pValue Identities Positives

A., thaliana AF075597 389 (107.5 bits) 2.60E-38 101/130 (77%) 101/130 (

Rice mRNA for ribosomal protein L19 D21304 198 (54.7 bits) 2.20E-10 50/64 (78%) 50/64 (78

D. melanogastcr rib. protein LI 9 mRNA L32181 1 85 (51.1 bits) 3.40E-09 49/64 (76%) 49/64 (76

N. tabacum L19 mRNA Z31720 194 (53.6 bits) 3.50E-05 50/64 (78%) 50/64 (78

00 as Mus musculus ribosomal protein L19 M62952 166 (45.9 bits) 4.40E-04 42/53 (79%) 42/53 (79

Human ribosomal protein LI 9 S56985 153 (42.3 bits) 8.30E-02 45/63 (71%) 45/63 (71

'< Amino acid seque ;nce comparison

Clone Score pValue Identities Positives

S. pombe ribosomal protein LI 9 042699 56 (25.8 bits) 5.50E-09 12/31 (38%) 12/31 (38

Human ribosmal protein LI 9 I 41 18 77 (35.4 bits) 8.20E-09 15/18 (83%) 15/18 (83

M. musculus ribosomal protein LI 9 P22908 77 (35.4 bits) 8.20E-09 1 5/18 (83%) 15/18 (83

D. melanogaster ribosomal protein LI 9 70 (36.3 bits) 1.50E-08 16/18 (88%) 16/18 (88

00

DNA sequencing and computer analysis.

The bp Notl fragment of 740 AT #909 containing the ribosomal protein L19 cDΝA was characterized. The nucleotide sequencing of 740 AT #909 (FIGURE 31) was carried out by dideoxy termination using double stranded templates. Nucleotide sequence analysis and amino acid sequence comparisons were performed using DNA Strider, PCGENE and NCBI Blast programs. FIGURE 32 shows nucleotide alignment of 740 AT #909 to human S5 6985 ribosomal protein LI 9 cDNA (SEQ ID NOs: 80 and 81 respectively). FIGURE 33 (SEQ ID NOs: 82-84) shows the amino acid sequence alignment of 740 AT #909 to human P14118 60S ribosomal protein L19. Table 11 shows the 740 AT #909 nucleotide sequence comparison to plant, drosophila, yeast, and human: 63-79%, identities and positives. Table 12 shows the 740 AT #909 amino acid comparison to plant, human, mouse, yeast, and insect L19 ribosomal protein: 65-88% identities and 80-92%, positives.

00

Table 12 740 AT #909 Nucleotide sequence comparison

EXAMPLE 16 Constmction of a cytoplasmic inhibition vector in a positive sense containing A. thaliana HAT7 homeobox-leucine zipper nucleotide sequence.

An Arabidopsis thaliana CD4-13 cDNA library was digested with Notl. DΝA fragments between 500 and 1000 bp were isolated by trough elution and subcloned into the Notl site of pBS740. E. coli C600 competent cells were transformed with the pBS740 AT library and colonies containing Arabidopsis cDΝA sequences were selected on LB Amp 50 μg/ml.

Isolation of a gene encoding HAT7 homeobox-leucine zipper.

One to two weeks after inoculation, transfected Nicotiana benthamiana plants were visually monitored for changes in growth rates, morphology, and color. Plants transfected with 740 AT #855 (FIGURE 34) were moderately stunted. Plasmid 740 AT #855 contains the TMV-Ul 126-, 193-, and 30-kDa ORFs, the TMV-U5 coat protein gene (U5 cp), the T7 promoter, an Arabidopsis thaliana CD4-13 ΝotI fragment, and part of the pUC19 plasmid. The TMV-Ul subgenomic promoter located within the minus strand of the 30-kDa ORF controls the synthesis of the CD4-13 subgenomic RΝA.

DΝA sequencing and computer analysis.

The Notl fragment of 740 AT #855 was characterized: nucleotide sequence analysis and amino acid sequence comparisons were performed using DΝA Strider, PCGENE and NCBI Blast programs 740 AT #855 contained . thaliana HAT 7 homeobox-luecine zipper cDNA sequence. The nucleotide sequence alignment of 740 AT #855 and Arabidopsis thaliana HAT7 homeobox protein ORF (UO9340) was compared. FIGURE 36 (SEQ. ID. Nos: 85-87) shows the nucleotide sequences of 740 #855 and A. thaliana HAT7 homeobox protein ORF, and the amino acid sequence of A. thaliana HAT7 homeobox protein ORFs. The result show that 740 AT #855 contains a 3'- untranslated region (UTR) of the A. thaliana HAT7 homeobox protein ORF in a positive orientation, thus inhibited the expression of HAT 7 homeobox protein in the transfected N benthamiana. Table 13 shows the 740 AT #855 nucleotide sequence comparison with A. thaliana, rat and human: 65-98% identities and positives Table 13. 740 AT #855 Nucleotide sequence comparison

EXAMPLE 17 Identification of human nucleotide sequences involved in the regulation of plant growth by cytoplasmic inhibition of gene expression using viral derived RNA containing human nucleotide sequences.

A human brain cDNA library are obtained from public and private sources or prepared from human mRNAs. The cDNAs are inserted in viral rectors or in small subcloning vectors and the cDNA inserts are isolated from the cloning vectors with appropriate enzymes, modified, and Notl linkers are attached to the cDΝA blunt ends. The human cDΝA inserts are subcloned into the Notl site of pBS740. E. coli C600 competent cells are transformed with the pBS740 subhbrary and colonies containing human cDΝA sequences are selected on LB Amp 50 ug/ml. DΝAs containing the viral human brain cDΝA library are purified from the transformed colonies and used to make infectious RΝAs that are directly applied to plants. One to three weeks post transfection, the plants developing severe stunting phenotypes are identified and their corresponding viral vector inserts are characterized by nucleic acid sequencing.

Identification of human nucleotide sequences involved in the growth regulation of a host organism bv inhibition of an endogenous gene expression using viral derived RΝA containing human nucleotide sequences.

A human brain cDΝA library are obtained from public and private sources or prepared from human mRΝAs. The cDΝAs are inserted in viral vectors or in small subcloning vectors and the cDΝA inserts are isolated from the cloning vectors with appropriate enzymes, modified, and Notl linkers are attached to the cDΝA blunt ends. The human cDΝA inserts are subcloned into the Notl site of pFastBacl. The human cDΝA insert is removed from the shuttle plasmid pFastBac-HcDΝA containing the human cDΝA insert to pFastBacMaml as an EcoRI-Xbal fragment to constmct pFastBacMaml-HcDΝA according to Condreay et al, (Proc. Natl. Acad. Sci.USA, 96: 127-132 (1999)). Recombinant vims is generated using the Bac-to-Bac system (Life Technologies). Vims is further amplified by propagation in Spodoptera frugiperda cells. Phenotypic changes such as doubling rate, shape, size, kinase activity, cytokine release, response to excipients (e.g. toxic compounds, pathogens, etc.), division of cell culture, semm-free growth, activation of gene, and expression of receptor are detected microscopically, macroscopically, or by a biochemical method. Cells with phenotypic or biochemical changes are detected and the nucleic acid insert in the cDNA clone or in the vector that results in changes is then sequenced.

Humanizing plant homologue for expression of plant derived human protein

In order to obtain the corresponding plant cDNAs, the human clones responsible for causing changes in the transfected plant phenotype (for example, stunting) are used as probes. Full-length plant cDNAs are isolated by hybridizing filters or slides containing N. benthamiana cDNAs with ³²P-labelled or fluorescent human cDNA insert probes. The positive plant clones are characterized by nucleic acid sequencing and compared with their human homologs. Plant codons that encode for different amino acids are changed by site directed mutagenesis to codons that encode for the same amino acids as their human homologs. The resulting "humanized" plant cDNAs encode an identical protein as the human clone. The "humanized" plant clones are used to produce human proteins in either transfected or transgenic plants by standard techniques. Because the "humanized" cDNA is from a plant origin, it is optimal for expression in plants.

EXAMPLE 18 Gene silencing/co-suppression of genes induced bv delivering an RNA capable of base pairing with itself to form double stranded regions.

Gene silencing has been used to down regulate gene expression in transgenic plants. Recent experimental evidence suggests that double stranded RNA may be an effective stimulator of gene silencing co-suppression phenomenon in transgenic plant. For example, Waterhouse et al. (Proc. Natl. Acad. Sci. USA 95:13959-13964 (1998), incorporated herein by reference) described that vims resistance and gene silencing in plants could be induced by simultaneous expression of sense and antisense RNA. Gene silencing/co-suppression of plant genes may be induced by delivering an RNA capable of base pairing with itself to form double stranded regions. This example shows: (1) a novel method for generating an RNA vims vector capable of producing an RNA capable of forming double stranded regions, and (2) a process to silence plant genes by using such a viral vector.

Step 1 : Constmction of a DNA sequence which after it is transcribed would generate an RNA molecule capable of base pairing with itself. Two identical, or nearly identical, ds DNA sequences are ligated together in an inverted orientation to each other (i.e., in either a head to tail or tail to head orientation) with or without a linking nucleotide sequence between the homologous sequences. The resulting DNA sequence is then be cloned into a cDNA copy of a plant viral vector genome.

Step 2: Clomng, screening, transcription of clones of interest using known methods in the art.

Step 3: Infect plant cells with transcripts from clones.

As vims expresses foreign gene sequence, RNA from foreign gene forms base pair upon itself, forming double-stranded RNA regions. This approach is used with any plant or non-plant gene and used to silence plant gene homologous to assist in identification of the function of a particular gene sequence.

Although the invention has been described with reference to the presently preferred embodiments, it should be understood that various modifications can be made without departing from the spirit of the invention.

All publications, patents, patent applications, and web sites are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent, patent apphcation, or web site was specifically and individually indicated to be incorporated by reference in its entirety.

Claims

1. A method for coπelating a nucleic acid sequence of a donor organism with its function comprising the steps of:

(a) introducing into a plant viral vector a library of a donor organism derived cDNA, genomic DNA or RNA inserts in a positive sense orientation;

(b) expressing each insert of said library in a host plant;

(c) detecting a phenotypic or biochemical change of said plant host resulting from the expression of an insert of said library;

(d) determining the sequence of said insert; and

(e) correlating the sequence of said insert with said phenotypic or biochemical change.

2. A method for coπelating sequence with function comprising the steps of:

(a) introducing into a plant viral vector a library of a donor organism derived cDNA, genomic DNA or RNA inserts in an anti-sense orientation;

(b) expressing each insert of said library in a host plant;

(c) detecting a phenotypic or biochemical change of said plant host resulting from the expression of an insert of said library;

(d) determining the sequence of said insert; and

(e) coπelating the sequence of said insert with said phenotypic or biochemical change.

3. The method according claim 1 or 2 wherein said donor organism is selected from the group consisting of Monera, Protoctista, Fungi, and Animalia.

4. The method according to claim 1 or 2 wherein said donor organism is human.

5. The method according to claim 1 or 2 wherein said donor organism is mouse.

6. The method according to claim 1 or 2 wherein said donor organism is drosophila.

7. The method according to any one of claims 4-6 wherein said library is derived from tumor cells.

8 The method according to any one of claims 4-6 wherein said library is derived from

ESTs.

9. The method according to claim 1 or 2 wherein said donor organism is a plant and said donor plant and said host plant belong to different family, order, class, subdivision, or division.

10. The method according to claim 1 or 2, wherein said donor plant is selected from the group consisting of food crops, seed crops, oil crops, ornamental crops and forestry.

11. The method according to claim 1 or 2, wherein said host plant is selected from the group consisting of food crops, seed crops, oil crops, ornamental crops and forestry.

12. The method according to claim 1 or 2, wherein said host plant is Nicotiana.

13. The method according to claim 12, wherein said host plant is Nicotiana benthamina or Nicotiana cleavlandii.

14. The method according to claim 1 or 2, wherein said host plant is a monocot.

15. The method according to claim 1 or 2, wherein said plant viral vector is derived from a single strand, plus sense RNA vims.

16. The method according to claim 15, wherein said plant viral vector derived from the group consisting of a potyvims, a tobamovims, a bromovims, a geminivims, a hordivims and a tobravims.

17. The method according to claim 15, wherein said single strand, plus sense RNA vims is a multipartite vims.

18. The method of claim 1 or 2, wherein said plant viral vector comprises a native or non-native subgenomic promoter.

19. The method according to claim 1 or 2, wherein said insert encodes a protein selected from the group consisting of ribosomal proteins, GTP binding proteins, tumor suppressor, and G-protein coupled receptors.

20. The method according to claim 1 or 2, wherein said phenotypic change comprises growth rate, morphology or color changes.

21. The method of claim 1 wherein the plant viral vector containing said insert causes cytoplasmic inhibition of a gene expression.

22. The method of claim 1 wherein the plant viral vector containing said insert causes overexpression of a polypeptide product.

23. The method according to claim 1 or 2 further comprising the step of annotating each insert sequence with its associated phenotypic or biochemical change.

24. The method according to claim 1 or 2 where said method further comprising the steps of:

(1) determining the nucleic acid sequence homology between human and plant sequences

(2) altering the nucleic sequence of the plant sequence such that the altered plant sequence encodes same amino acid sequence as the human sequence.

25. The method accoding to claim 1 or 2 wherein said method further comprisng the steps of utilizing the function of sequence in step (d) in increasing the yield of a grain crop.

26. The method according to claim 16 wherein said plant viral vector is derived from a Tobacco Rattle Vims.

27. The method of claim 15 wherein said plant viral vector is derived from a barley stripe mosaic vims

28. A nucleic acid prodcut is comprising the sequence of step (d) of claim 1 or 2.

29. A polypeptide product encoding the sequence of step (d) of claim 1 or 2.