EP1181379A1 - Procede pour reduire les phytates dans le tourteau de canola par une manipulation genetique impliquant le gene myo-inositol 1-phosphate synthase - Google Patents

Procede pour reduire les phytates dans le tourteau de canola par une manipulation genetique impliquant le gene myo-inositol 1-phosphate synthase

Info

Publication number
EP1181379A1
EP1181379A1 EP00930928A EP00930928A EP1181379A1 EP 1181379 A1 EP1181379 A1 EP 1181379A1 EP 00930928 A EP00930928 A EP 00930928A EP 00930928 A EP00930928 A EP 00930928A EP 1181379 A1 EP1181379 A1 EP 1181379A1
Authority
EP
European Patent Office
Prior art keywords
inositol
myo
sequence
brassica
phosphate synthase
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00930928A
Other languages
German (de)
English (en)
Inventor
Fawzy Georges
Atta A. Hussain
Wilfred A. Keller
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
National Research Council of Canada
Original Assignee
National Research Council of Canada
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Research Council of Canada filed Critical National Research Council of Canada
Publication of EP1181379A1 publication Critical patent/EP1181379A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/90—Isomerases (5.)

Definitions

  • canola meal as an acceptable protein source in the animal feed industry is severely limited by the presence in the meal of undesirable seed contents such as glucosinolates, phytates, phenolics and hull.
  • Phytate is a significant component of canola seeds, comprising up to 10% by weight of the seed.
  • Phytic acid is the hexaphosphate derivative of myo-inositol.
  • the presence of phytate has been linked to such symptoms as loss of appetite, reduced litter size and increase in the number of stillborn pups in rats. These effects have been attributed to the zinc-binding ability of phytic acid.
  • the reduction of phytate in canola protein preparations has, to date, been difficult. Hence modification of its biosynthetic pathway to reduce its accumulation and enhance protein or oil synthesis in its place would be very significant in terms of the economic value of canola.
  • An aim of the present invention is to limit the utilization of myo-inositol as a starting material for phytic acid synthesis. This is complicated by the fact that myo-inositol is a crucial biological substrate, the presence of which is essential for the growth and multiplication of all living cells.
  • myo-inositol furnishes a carbon source for uronides and pentoses, it is also present in phosphoinositides of plant cell membranes, as well as other complex plant lipids including glycophosphoceramides. Additionally, in some of its phosphorylated forms it acts as important second messengers in signal transduction pathways in eukaryotes.
  • myo-inositol plays in plants, limiting its supply to the cell can be expected to promote reorganization of priorities within the cell, with possibly unforeseen consequences.
  • Myo-inositol pathways leading to critical cell components or functions may be expected to proceed at the expense of other pathways that are of no direct and immediate consequence to the well-being of the plant during its life cycle.
  • Phytic acid synthesis is an example of such a "futile" pathway since phytic acid is a storage substance that does not take part in any of the essential pathways during plant growth and development. It therefore seemed possible to us that, by limiting the availability of myo-inositol 1-phosphate synthase, lesser amounts of glucose 6-phosphate would be converted to myo-inositol thereby leading to a lower rate of phytic acid synthesis. It can be seen that a difficult balance has to be struck between over-limiting the production of myo-inositol thereby threatening critical pathways and under-limiting the production of myo-inositol with little consequent economic benefit.
  • the basic approach to limiting the rate of conversion of glucose 6-phosphate to myo- inositol 1-phosphate in Brassica napus was to prepare a mRNA transcript for the enzyme responsible for this step from B. napus and then to introduce a recombinant version of this gene into Brassica plants by, for example, A grobacterium-mediated transformation in two different orientations (sense, for cosuppression, and antisense).
  • Two particular types of constructs were produced containing either the 35S promoter or the seed-specific napin promoter. Integration of the construct into the genome was confirmed by Southern blot analysis. Phytic acid analysis showed reduction in levels of around 30% to 50% for antisense and cosuppression transgenic plants.
  • the invention provides a nucleotide sequence of SEQ ID NO 1 or an allelic variant or a fragment thereof or a genetic equivalent thereof according to the degeneracy of the genetic code coding for a peptide having a Brassica myo-inositol 1-phosphate synthase activity.
  • nucleotide sequence, variant or fragment of the invention is in combination with a promoter sequence in reading frame alignment (preferably antisense) therewith.
  • the invention also provides a myo-inositol 1-phosphate synthase-active peptide sequence encoded by the nucleotide sequence of the invention.
  • the invention also provides cells (preferably Brassica. especially B. napus cells) transformed with a nucleotide sequence of the invention.
  • the invention further provides plants, multicellular fragments of such plants and seeds of such plants transformed with a nucleotide of the invention, the plant , multicellular fragment or seed having reduced myo-inositol 1-phosphate synthase activity such that there is reduced phytate present in the plant, multicellular fragment or seed.
  • the multicellular fragment is preferably in the form of a seed meal.
  • the invention also provides a method for reducing phytate in Brassica which comprises limiting the availability of myo-inositol 1-phosphate synthase in said Brassica with one of one of a myo-inositol 1-phosphate synthase antisense sequence and a myo-inositol 1-phosphate synthase cosuppression sequence to give a reduced amount of translatable myo-inositol 1- phosphate synthase thereby reducing phytate in said Brassica.
  • the Brassica is Brassica napus.
  • the invention also provides a method for reducing phytate in Brassica, which method comprises growing a Brassica plant comprising one of a myo-inositol 1- phosphate synthase antisense sequence and a myo-inositol 1-phosphate synthase cosuppression sequence thereby yielding a reduced amount of myo-inositol 1-phosphate synthase and consequently reduced phytate in said Brassica.
  • SEQ ID NO: 1 shows the nucleotide sequence of a myo-inositol 1-phosphate synthase gene of Brassica napus.
  • SEQ ID NO: 2 show the amino acid sequence of my-inositol 1-phosphate synthase of Brassica napus.
  • SEQ ID NO: 3 shows the myo-inositol 1-phosphate synthase right primer used in the examples.
  • SEQ ID NO: 4 shows the myo-inositol 1-phosphate synthase left primer used in the examples.
  • SEQ ID NO: 5 shows a sequence comprising the myo-inositol 1-phosphate synthase (mips) promoter sequence used in the examples.
  • Figure 1 shows the nucleotide sequence of the Brassica napus myo-inositol 1-phosphate synthase of the invention.
  • the term "functional fragments" when used to modify a specific gene or gene product means a less than full length portion of the gene or gene product which retains substantially all of the biological function associated with the full length gene or gene product to which it relates.
  • fragments are generated by well-known nucleolytic or proteolytic techniques or by the polymerase chain reaction and the fragments tested for the described biological function.
  • a coding sequence is "operably linked to" another coding sequence when RNA polymerase will transcribe the two coding sequences into a single mRNA, which is then translated into a single polypeptide having amino acids derived from both coding sequences.
  • the coding sequences need not be contiguous to one another so long as the expressed sequence is ultimately processed to produce the desired protein.
  • recombinant polypeptides refer to polypeptides produced by recombinant DNA techniques; i.e., produced from cells transformed by an exogenous DNA construct encoding the desired polypeptide.
  • synthetic polypeptides are those prepared by chemical synthesis.
  • a "replicon” is any genetic element (e.g., plasmid, chromosome, virus) that functions as an autonomous unit of DNA replication in vivo; i.e., capable of replication under its own control.
  • a "vector” is a replicon, such as a plasmid, phage, or cosmid, to which another DNA segment may be attached so as to bring about the replication of the attached segment.
  • a "reference" gene refers to the wild type gene sequence of the invention and is understood to include the various sequence polymorphisms that exist, wherein nucleotide substitutions in the gene sequence exist, but do not affect the essential function of the gene product.
  • a "mutant" gene refers sequences different from the reference gene wherein nucleotide substitutions and/or deletions and/or insertions result in perturbation of the essential function of the gene product.
  • a DNA "coding sequence of” or a “nucleotide sequence encoding” a particular protein is a DNA sequence which is transcribed and translated into a polypeptide when placed under the control of appropriate regulatory sequences.
  • a "promoter sequence” is a DNA regulatory region capable of binding RNA polymerase in a cell and initiating transcription of a downstream (3' direction) coding sequence.
  • the promoter sequence is bound at its 3' terminus by a translation start codon (e.g., ATG) of a coding sequence and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background.
  • a transcription initiation site (conveniently defined by mapping with nuclease SI), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • Eukaryotic promoters will often, but not always, contain "TATA" boxes and "CAT” boxes.
  • Prokaryotic promoters contain Shine-Dalgarno sequences in addition to the -10 and -35 consensus sequences.
  • control sequences refers collectively to promoter sequences, ribosome binding sites, polyadenylation signals, transcription termination sequences, upstream regulatory domains, enhancers and the like, which collectively provide for the expression (i.e., the transcription and translation) of a coding sequence in a host cell.
  • a control sequence "directs the expression" of a coding sequence in a cell when RNA polymerase will bind the promoter sequence and transcribe the coding sequence into mRNA, which is then translated into the polypeptide encoded by the coding sequence.
  • a "host cell” is a cell which has been transformed or transfected, or is capable of transformation or transfection by an exogenous DNA sequence. As used herein, a cell has been "transformed” by exogenous DNA when such exogenous
  • Exogenous DNA has been introduced inside the cell membrane.
  • Exogenous DNA may or may not be integrated (covalently linked) into chromosomal DNA making up the genome of the cell.
  • the exogenous DNA may be maintained on an episomal element, such as a plasmid.
  • a stably transformed or transfected cell is one in which the exogenous DNA has become integrated into the chromosome so that it is inherited by daughter cells through chromosome replication. This stability is demonstrated by the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the exogenous DNA.
  • transfection refers to a process by which cells take up foreign DNA and integrate that foreign DNA into their chromosome. Transfection can be accomplished, for example, by various techniques in which cells take up DNA (e.g., calcium phosphate precipitation, electroporation, assimilation of liposomes, etc.) or by infection, in which viruses are used to transfer DNA into cells.
  • DNA e.g., calcium phosphate precipitation, electroporation, assimilation of liposomes, etc.
  • viruses are used to transfer DNA into cells.
  • a target cell is a cell that is selectively transfected over other cell types (or cell lines).
  • a "clone” is a population of cells derived from a single cell or common ancestor by mitosis.
  • a “cell line” is a clone of a primary cell that is capable of stable growth in vitro for many generations.
  • a heterologous region of a DNA construct is an identifiable segment of DNA within or attached to another DNA molecule that is not found in association with the other molecule in nature.
  • the heterologous region encodes a gene
  • the gene will usually be flanked by DNA that does not flank the gene in the genome of the source.
  • Another example of a heterologous coding sequence is a construct where the coding sequence itself is not found in nature (e.g. , synthetic sequences having codons different from the native gene). Allelic variation or naturally occurring mutational events do not give rise to a heterologous region of DNA, as used herein.
  • An aspect ofthe present invention is isolated polynucleotides encoding a protein including substantially similar sequences and functional fragments.
  • Isolated polynucleotide sequences are substantially similar if they are capable of hybridizing under moderately stringent conditions to SEQ ID NO: l or they encode DNA sequences which are degenerate to SEQ ID NO: l or are degenerate to those sequences capable of hybridizing under moderately stringent conditions to SEQ ID NO: 1.
  • Moderately stringent conditions is a term understood by the skilled artisan and has been described in, for example, Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd edition, Vol. 1 , pp. 101-104, Cold Spring Harbor Laboratory Press (1989).
  • An exemplary hybridization protocol using moderately stringent conditions is as follows. Nitrocellulose filters are prehybridized at 65. degree. C. in a solution containing 6. times. SSPE, 5. times. Denhardt's solution (10 g Ficoll, 10 g BSA and 10 g polyvinylpyrrolidone per litre solution), 0.05 % SDS and 100 ⁇ g/ml tRNA.
  • Hybridization probes are labelled, preferably radiolabelled (e.g.
  • substantially similar sequences are defined as those sequences in which about 70%, preferably about 80% and most preferably about 90%, of the nucleotides or amino acids match over a defined length of the molecule.
  • substantially similar refers to the sequences having similar identity to the sequences ofthe instant invention.
  • nucleotide sequences that are substantially the same can be identified by hybridization or by sequence comparison.
  • Protein sequences that are substantially the same can be identified by techniques such as proteolytic digestion, gel electrophoresis and/or microsequencing.
  • Embodiments ofthe isolated polynucleotides ofthe invention include DNA, genomic DNA and RNA, preferably of Brassica origin.
  • a method for isolating a nucleic acid molecule encoding a protein is to probe a genomic or cDNA library with a natural or artificially designed probe using art recognized procedures. See, e.g., "Current Protocols in Molecular Biology", Ausubel et al Jeds . ) Greene Publishing Association and John Wiley Interscience , New York, 1989 ,1992.
  • SEQ ID NO: 1 or fragments thereof comprising at least 15 contiguous nucleotides are particularly useful probes.
  • probes can be and are preferably labelled with an analytically detectable reagent to facilitate identification of the probe.
  • useful reagents include, but are not limited to, radioisotopes, fluorescent dyes or enzymes capable of catalysing the formation of a detectable product.
  • the probes would enable the ordinarily skilled artisan to isolate complementary copies of genomic DNA, cDNA or RNA polynucleotides encoding proteins from Brassica or other plant sources or to screen such sources for related sequences, e.g., additional members of the family, type and/or subtype, including transcriptional regulatory and control elements as well as other stability, processing, translation and tissue specificity-determining regions from 5' and/or 3' regions relative to the coding sequences disclosed herein, all without undue experimentation.
  • Another aspect ofthe invention is functional polypeptides encoded by the polynucleotides of the invention.
  • An embodiment of a functional polypeptide of the invention is the Brassica protein having the amino acid sequence set forth in SEQ ID NO:2.
  • Another aspect ofthe invention is a method for preparing essentially pure Brassica protein.
  • Yet another aspect is the Brassica protein produced by the preparation method ofthe invention.
  • This protein has the amino acid sequence listed in SEQ ID NO: 2 and includes variants with a substantially similar amino acid sequence that have the same function.
  • the proteins of this invention can be made by recombinant genetic engineering techniques by culturing a recombinant host cell containing a vector encoding the polynucleotides of the invention under conditions promoting the expression of the protein and recovery thereof.
  • the isolated polynucleotides can be introduced into expression vectors by operatively linking the DNA to the necessary expression control regions, e.g., regulatory regions, required for gene expression.
  • the vectors can be introduced into an appropriate host cell such as a prokaryotic, e.g. , bacterial, or eukaryotic, e.g. , yeast or plant cell by methods well known in the art. See Ausubel et al., supra.
  • the coding sequences for the desired proteins, having been prepared or isolated, can be cloned into any suitable vector or replicon. Numerous cloning vectors are known to those of skill in the art and the selection of an appropriate cloning vector is a matter of choice.
  • Examples of recombinant DNA vectors for cloning and host cells which they can transform include, but are not limited to, the bacteriophage lambda. (E. coli), pBR322 (E. coh), pACYC177 (E. coli), pGEX4T-3 (E. coH), pKT230 (gram-negative bacteria) , pG V 1106 (gram-negative bacteria) , pLAFR 1 (gram-negative bacteria) , pME290 (non-E.coli gram-negative bacteria), pHV14 (E.
  • the gene can be placed under the control of control elements such as a promoter, ribosome binding site (for bacterial expression) and, optionally, an operator, so that the DNA sequence encoding the desired protein is transcribed into RNA in the host cell transformed by a vector containing the expression construct.
  • the coding sequence may or may not contain a signal peptide or leader sequence.
  • the proteins of the present invention can be expressed using, for example, the E. coli tac promoter or the protein A gene (spa) promoter and signal sequence. Leader sequences can be removed by the bacterial host in post-translational processing. See, e.g., U.S. Pat. Nos. 4,431,739; 4,425,437 and 4,338,397.
  • regulatory sequences which allow for regulation of the expression of the protein sequences relative to the growth of the host cell.
  • Regulatory sequences are known to those of skill in the art. Exemplary are those which cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound or to various temperature or metabolic conditions.
  • Other types of regulatory elements may also be present in the vector, for example, enhancer sequences.
  • An expression vector is constructed so that the particular coding sequence is located in the vector with the appropriate regulatory sequences, the positioning and orientation of the coding sequence with respect to the control sequences being such that the coding sequence is transcribed under the "control" of the control sequences, i.e., RNA polymerase which binds to the DNA molecule at the control sequences transcribes the coding sequence .
  • Modification of the sequences encoding the particular antigen of interest may be desirable to achieve this end. For example, in some cases it may be necessary to modify the sequence so that it may be attached to the control sequences with the appropriate orientation; i.e., to maintain the reading frame.
  • control sequences and other regulatory sequences may be ligated to the coding sequence prior to insertion into a vector, such as the cloning vectors described above.
  • a vector such as the cloning vectors described above.
  • the coding sequence can be cloned directly into an expression vector which already contains the control sequences and an appropriate restriction site.
  • Mutants or analogues may be prepared by the deletion of a portion of the sequence encoding the protein, by insertion of a sequence, and/or by substitution of one or more nucleotides within the sequence.
  • Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, are well known to those skilled in the art. See, e.g., T. Maniatis et al., supra; "DNA Cloning," Vols. I and II, supra; and “Nucleic Acid Hybridization", supra.
  • the proteins of the present invention are produced by growing host cells transformed by an expression vector described above under conditions whereby the protein of interest is expressed.
  • Preferred plant cells include Brassica cells. If the expression system secretes the protein into growth media, the protein can be purified directly from the media. If the protein is not secreted, it is isolated from cell lysates or recovered from the cell membrane fraction. The selection of the appropriate growth conditions and recovery methods are within the skill of the art.
  • proteins of the present invention is by constructing gene libraries, using the resulting clones to transform E. coli and pooling and screening individual colonies.
  • the proteins of the present invention may also be produced by chemical synthesis such as solid phase peptide synthesis on an automated peptide synthesizer, using known amino acid sequences or amino acid sequences derived from the DNA sequence of the genes of interest. Such methods are known to those skilled in the art.
  • antisense oligonucleotides comprising a sequence which is capable of binding to the polynucleotides ofthe invention.
  • Synthetic oligonucleotides or related antisense chemical structural analogs can be designed to recognize, specifically bind to and prevent transcription of a target nucleic acid encoding protein by those of ordinary skill in the art. See generally, Cohen, J. S., Trends in Pharm. Sci., 10, 435(1989) and Weintraub, H. M., Scientific American, January (1990) at page 40.
  • antisense RNA is meant a complementary RNA sequence that binds to and blocks the transcription of a naturally occurring sense messenger RNA molecule.
  • cosuppression is meant the phenomenon of native gene silencing as a result of attempting to over-express the same gene, by recombinant DNA, in its original host plant (from which the gene has been isolated).
  • myo-inositol 1-phosphate (mips) gene was isolated from Brassica napus and was re-introduced back into B. napus by Agrobacterium tumefasciens transformation.
  • probes can vary widely but it is preferred that the probe be at least 15 nucleotides in length. It is also appreciated that such probes can be and are preferably labelled with an analytically detectable reagent to facilitate identification of the probe.
  • Useful reagents include but are not limited to radioisotopes, fluorescent dyes or enzymes capable of catalysing the formation of a detectable product. As a general rule, the more stringent the hybridization conditions the more closely related genes will be that are recovered.
  • transgenic, non-Brassica plants capable of expressing the polynucleotides ofthe invention in any cell.
  • Transgenic, non-Brassica plants may be obtained by transfecting with the polynucleotides of the invention.
  • the resultant transgenic plant may be used as a model for the study of gene function or for producing large amounts of protein for screening or crystallography purposes.
  • Particularly useful transgenic plants are those which display a detectable phenotype associated with the expression of the protein.
  • MIPS myo-inositol 1-phosphate synthase
  • RNA frorn B. napus developing seeds wa s added to 0.5 ml tube containing MlP S -right primer (5 ' AAAAAATCTAGAGTGAACACTTGTATTCCAAGATCA 3'), lx RT (reverse transcriptase) buffer, the four dNTPs, and water. The mixture was incubated at 25° C for 10 min and was then placed on ice.
  • RT reverse transcriptase
  • 20 U of RT reverse transcriptase
  • 20 U of RT reverse transcriptase
  • the reaction was initiated by incubating the tube at 42° C for 60 min. Finally, heating at 95° C for 10 min inactivated the RT enzyme.
  • the product is the 1st strand of MIPS gene.
  • 5 ⁇ L of 1st strand cDNA solution was added to 0.5 ml tube containing lx Vent polymerase buffer, the four dNTPs, the MlPS-left primer (5 ' AAAAAACCCGGGATGATCGAGAGCTTCAAAGTC 3'), the right primer, and water.
  • the reaction was initiated by addition of 1 U of Vent DNA polymerase, mixed very well and placed in a DNA thermal cycler (Perkm Elmer Cetus). Heating at 94° C for 2 min followed by 35 cycle each of which includes heating at 94° C for 1 mm, annealing at 52° C for 1 mm and extension at 72° C for 3 mm.
  • the left and right primer to the published MIPS DNA sequence of Arabidopsis thahana (GenBank accession number U04876).
  • DNA sequencing was performed by the DNA Services Lab at PBI using ABI P ⁇ sm Dye Terminator cycle sequencing ready reaction kit with Amp Taq DNA polymerase and following the company's protocol (Perkm Elmer).
  • the MIPS cDNA was cloned under CamV35S or _B napus napm promoters m both o ⁇ entations ( sense or anti-sense) in the plant vector pBI121 (from Clontech).
  • the constructs were transferred into Agrobacte ⁇ um tumefaciens strain CV3101 : pMP90RK by electroporation.
  • the transformants were grown on kanamycm-contammg plates and then screened by PCR analysis for the presence ofthe construct.
  • the positive transformants were used for Brassica napus transformation. Plant transformation was conducted according to Maloney et al,1989 ( Maloney ,N.M., Walker, J M., and Sharma,K.K. 1989, Plant Cell Reports 8, 238) d) Isolation of the MIPS genomic promoter
  • the genomic MIPS promoter was isolated from B. napus by PCR with a primer designed to read beyond the 5' end of the MIPS gene.
  • the DNA sequence of this promoter probably extends much beyond the promoter itself. This promoter would be useful for targeting the expression of foreign genes to the same location and at the same time (spatial- and temporal- mode of expression). In this way more precise deactivation of MIPS gene can be achieved Also, it can be used in any experiments where the desired trait must accompany the expression of the native MIPS gene.
  • the sequence including the MIPS promoter(3795 bp) from B napus that we cloned is shown in SEQ ID NO:5.
  • Brassica napus, Var. Westar, the control and transgenic , plants were grown in a growth- chamber under a 16hr. light cycle at 20°C, followed by 8hr. darkness at 15°C.
  • Phytate levels were measured and compared for control and transgenic plants. Reductions of 30% to 50% m phytate levels were found.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Nutrition Science (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)

Abstract

L'invention concerne une plante, un fragment multicellulaire de ladite plante ou la semence de ladite plante transformée par une séquence de nucléotide de SEQ ID NO 1 ou un allèle ou encore un fragment de celui-ci ou un équivalent génétique de celui-ci conformément à l'abâtardissement du code génétique codant pour un peptide comprenant une activité Brassica myo-inositol 1-phosphate synthase, ladite plante, le fragment multicellulaire ou la semence ayant réduit l'activité myo-inositol 1-phosphate synthase lorsqu'elle est comparée à une plante non-transformée équivalente, un fragment multicellulaire ou une semence ce cette dernière, telle qu'il existe des phytates réduits dans cette plante, ce fragment multicellulaire ou cette semence. L'invention concerne également un procédé pour réduire les phytates dans Brassica. Ce procédé comprend la croissance d'une plante Brassica comprenant une séquence anti-sens myo-inositol 1-phosphate synthase et/ou une séquence de cosuppression myo-inositol 1-phosphate synthase qui permet de produire une quantité réduite de myo-inositol 1-phosphate synthase et en conséquence des phytates réduits dans ladite Brassica.
EP00930928A 1999-05-26 2000-05-25 Procede pour reduire les phytates dans le tourteau de canola par une manipulation genetique impliquant le gene myo-inositol 1-phosphate synthase Withdrawn EP1181379A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US13620499P 1999-05-26 1999-05-26
US136204P 1999-05-26
PCT/CA2000/000612 WO2000073473A1 (fr) 1999-05-26 2000-05-25 Procede pour reduire les phytates dans le tourteau de canola par une manipulation genetique impliquant le gene myo-inositol 1-phosphate synthase

Publications (1)

Publication Number Publication Date
EP1181379A1 true EP1181379A1 (fr) 2002-02-27

Family

ID=22471816

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00930928A Withdrawn EP1181379A1 (fr) 1999-05-26 2000-05-25 Procede pour reduire les phytates dans le tourteau de canola par une manipulation genetique impliquant le gene myo-inositol 1-phosphate synthase

Country Status (4)

Country Link
EP (1) EP1181379A1 (fr)
AU (1) AU4905500A (fr)
CA (1) CA2375071A1 (fr)
WO (1) WO2000073473A1 (fr)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6774288B1 (en) 1997-07-07 2004-08-10 Basf Plant Science L.L.C. Animal feed with low phytic acid, oil, burdened and protein laden grain
DE602005020927D1 (de) 2004-05-20 2010-06-10 Pioneer Hi Bred Int Multidrug-resistenz-proteinpolynukleotide aus mais und verwendungsverfahren
AR050866A1 (es) 2004-09-09 2006-11-29 Dow Agrosciences Llc Genes de inositol polifosfato 2-quinasa y usos de los mismos

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SE392803B (sv) * 1974-06-20 1977-04-25 L I Gillberg Forfarande for framstellning av fytinsyrafattiga proteinisolat ur brassica- och crambefro
KR100225087B1 (ko) * 1990-03-23 1999-10-15 한스 발터라벤 피타아제의 식물내 발현
FR2751987B1 (fr) * 1996-08-01 1998-12-31 Biocem Phytases de plantes et applications biotechnologiques
KR20010006141A (ko) * 1997-04-08 2001-01-26 메리 이. 보울러 라피노스 사카라이드 및 파이트산 함량이 감소된 종자를 생산하는 대두 식물
EP0990040B1 (fr) * 1997-07-22 2007-10-24 Pioneer Hi-Bred International, Inc. Genes regulant un metabolisme de phytate dans des plantes et leurs utilisations
JP2001513326A (ja) * 1997-08-11 2001-09-04 エクシード・ジェネティックス・エルエルシー 誘導可能なフィチン酸遺伝子を用いた制御された発芽
JPH11187879A (ja) * 1997-12-26 1999-07-13 Japan Tobacco Inc Ｎｉｃｏｔｉａｎａ属植物由来の新規ＩＮＰＳ遺伝子
BR9907223A (pt) * 1998-01-22 2000-10-24 Ca Nat Research Council Métodos e composições para modificação dos nìveis de compostos metabólicos secundários em plantas
EP1104469B1 (fr) * 1998-08-20 2005-11-09 Pioneer Hi-Bred International, Inc. Promoteurs preferes des graines

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0073473A1 *

Also Published As

Publication number Publication date
WO2000073473A1 (fr) 2000-12-07
AU4905500A (en) 2000-12-18
CA2375071A1 (fr) 2000-12-07

Similar Documents

Publication Publication Date Title
US7157621B2 (en) Alteration of oil traits in plants
US7534935B2 (en) Phospholipid:diacylglycerol acyltransferases
US8399738B2 (en) Fructan biosynthetic enzymes
JP2001501810A (ja) 遺伝子発現の増強
AU680551B2 (en) Glycerin-3-phosphate-dehydrogenase (GPDH)
EP1181379A1 (fr) Procede pour reduire les phytates dans le tourteau de canola par une manipulation genetique impliquant le gene myo-inositol 1-phosphate synthase
US7148064B1 (en) Method for reducing phytate in canola meal using genetic manipulation involving myo-inositol 1-phospathe synthase gene
US7214858B2 (en) Plant genes encoding trehalose metabolism enzymes
NL9002130A (nl) Dna-sequentie die ten minste een deel van een gen coderend voor stearoyl-acp-desaturase omvat, alsmede toepassing van de dna-sequentie in een werkwijze voor het wijzigen van de vetzuurbiosynthese van een plant.
CA2382363C (fr) Serine o-acetyle transferased
MXPA02005178A (es) Oleil-proteina portadora de acilo tioesterasas en plantas.
US7002060B1 (en) Enzymes involved in petroselinic acid biosynthesis
US6596926B1 (en) Phosphatidylcholine biosynthetic enzymes
CN114195871A (zh) 与油脂代谢调控相关的GmGRF5蛋白及其编码基因与应用
US20030088882A1 (en) Fructokinase
WO2001019995A1 (fr) Genes de regulation de la floraison des plantes
CA2538314A1 (fr) Dihydroflavonol-4-reductase

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20011123

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20031202