EP1171163A1 - Compositions contenant des tetracyclines et servant a traiter des infections et d'autres maladies virales hemorragiques - Google Patents

Compositions contenant des tetracyclines et servant a traiter des infections et d'autres maladies virales hemorragiques

Info

Publication number
EP1171163A1
EP1171163A1 EP00928635A EP00928635A EP1171163A1 EP 1171163 A1 EP1171163 A1 EP 1171163A1 EP 00928635 A EP00928635 A EP 00928635A EP 00928635 A EP00928635 A EP 00928635A EP 1171163 A1 EP1171163 A1 EP 1171163A1
Authority
EP
European Patent Office
Prior art keywords
tetracycline
virus
blood
tnf
receptor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00928635A
Other languages
German (de)
English (en)
Inventor
Terry M. Fredeking
George M. Ignatyev
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Antibody Systems Inc
Original Assignee
Antibody Systems Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Antibody Systems Inc filed Critical Antibody Systems Inc
Publication of EP1171163A1 publication Critical patent/EP1171163A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/24—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against cytokines, lymphokines or interferons
    • C07K16/241—Tumor Necrosis Factors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/65—Tetracyclines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/15—Cells of the myeloid line, e.g. granulocytes, basophils, eosinophils, neutrophils, leucocytes, monocytes, macrophages or mast cells; Myeloid precursor cells; Antigen-presenting cells, e.g. dendritic cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12—Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14—Blood; Artificial blood
    • A61K35/16—Blood plasma; Blood serum
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/19—Cytokines; Lymphokines; Interferons
    • A61K38/20—Interleukins [IL]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/42—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum viral
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715—Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to compositions and methods for treating and/or preventing in mammals, particularly humans, acute inflammatory responses and diseases. More particularly, compositions and combinations of compositions and methods for the treatment of disorders, especially acute
  • compositions and methods for preventing and/or treating diseases, disorders and conditions that include viral hemorrhagic diseases and other acute infectious diseases, sepsis, rheumatoid arthritis and other autoimmune disorders, acute cardiovascular disease
  • TNF tumor necrosis factor
  • IL-1 interleukin-1
  • the response of a mammal to infection with a hemorrhagic virus or a pathogenic strain of Escherichia coli and sepsis are exemplary of such responses. There are few, if any, effective treatments to counteract these responses.
  • IL-1 ⁇ and IL-1/ The two forms of lnterleukin-1 (IL-1 ⁇ and IL-1/?) are cytokines produced primarily by mononuclear phagocytes, but also by a number of other cell types including skin keratinocytes, some epithelial cells, and some cells of the central nervous system (CNS) . These cytokines produce a wide variety of effects on numerous cell types, including the induction or suppression of the production of a great number of other proteins including interleukins, cytokines, tumor necrosis factors, and colony stimulating factors. IL- 1 ⁇ and IL-1 ? are thus important mediators of the inflammatory and immune responses of animals.
  • Type I receptor is an 80 kDa protein found on T cells, fibroblasts, and keratinocytes.
  • Type II receptor is a 68 kDa protein found on B cells and PMNs. In general, the Type I receptor binds to IL- ⁇ a or IL-1 ?
  • Type II receptor binds IL-1 ? more strongly than IL-1 ⁇ .
  • Results indicate that only the Type I receptor is capable of transducing a signal and can produce all of the biological effects attributed to IL-1 . It has been suggested that the function of the membrane- bound Type II receptor is to serve as the precursor for a soluble IL-1 binding factor that can be shed under appropriate circumstances to antagonize and modulate IL-1 activity. A naturally occurring IL-1 binding protein has been described that seems to correspond to the soluble external portion of the Type II receptor.
  • IL-1 Ra binds to the IL-1 receptor Type II with considerably lower affinity than that shown by
  • IL-1 ra include monocytes, neutrophils, macrophages and fibroblasts.
  • Cytokines known to upregulate IL-1 Ra production include IL-1 3, IL-6, IL-4, IFN- , GM-CSF and TGF-£, the latter apparently by triggering IL-1 production which itself triggers IL-1 ra synthesis ( 1 2, 1 5-1 9).
  • the amino acid sequences of IL-1 ra from at least four species have been determined (human, rat, mouse and rabbit) and found to be at least 75 % homologous (Cominelli et al. ( 1 994) J. Biol. Chem.
  • IL-1 ra can also be synthesized as a strictly intracellular form whose production is the result of an alternative splicing of exon 1 (Butcher et al. ( 1 994) J. Immunol. 1 53:701 ; Aren et al. (1 993) Adv. Immunol. 54: 1 67).
  • IL-1 Ra is released in vivo during experimentally- induced inflammation and as part of the natural course of many diseases. Administered experimentally, IL-1 Ra has been demonstrated to block IL-1 activity in vitro and in vivo.
  • TNFs Tumor necrosis factors
  • TNF- ⁇ or cachectin
  • TNF-/? or lymphotoxin
  • TNFs play a necessary and beneficial role as mediators of host resistance to infections and tumor formation. Over-production or inappropriate expression of these factors can lead to a variety of pathological conditions, including wasting, systemic toxicity, and septic shock (see, Beutler et al. ( 1 988) Ann. Rev.
  • TNFs The actions of TNFs are produced subsequent to binding of the factors to cell surface receptors.
  • Two distinct TNF receptors have been identified and cloned. Virtually all cell types studied show the presence of one or both of these receptor types.
  • One receptor type termed TNFR-II (Type A, Type a, 75 kDa or utr antigen)
  • TNFR-II Type A, Type a, 75 kDa or utr antigen
  • the gene for this receptor encodes a presumptive transmembrane protein of 439 amino acid residues (Dembic et al.
  • TNFR-I Type B, Type /?, 55 kDa or htr antigen
  • TNFR-I Type B, Type /?, 55 kDa or htr antigen
  • the gene for this protein encodes a transmembrane protein of 426 amino acid residues (Schail eta/. (1990)Ce// 61 :361 ; Loetscher et al. (1990) Cell 61:351; Tartaglia et al. (1992) Immunol. Today 13:151).
  • Both receptor types show high affinity binding of either TNF- ⁇ or TNF-?.
  • the two receptor types are immunologically distinct but their extracellular domains show similarities in the pattern of cysteine residue locations in four domains (Dembic et al. (1990) Cytokine 2:231).
  • TNF binding proteins in human serum and urine (Seckinger et al. (1989) J. Biol. Chem. 264:11966; Olsson et al. (1989) Eur. J. Haematol. 42:270; and Engelmann et al. (1990) J. Biol. Chem. 265:1541) that can neutralize the biological activities of TNF- ⁇ and TNF-/? have been identified.
  • Two types have been identified and designated sTNF Rl (or TNF BPI) and sTNF Rll (or TNF BPII). These soluble forms are truncated forms of the two types of TNF receptors.
  • the soluble receptor forms apparently arise as a result of shedding of the extracellular domains of the receptors, and concentrations of about 1-2 ng/mL are found in the serum and urine of healthy subjects (Aderka et al. (1992) Lymphokine and Cytokine Res.3:157; Chouaib et al. (1991) Immunol, today 12:141).
  • the levels of the soluble receptors vary from individual to individual but are stable over time for given individuals (Aderka et al. (1992) Lymphokine and Cytokine Res.3:157).
  • the physiological role of the soluble TNF receptors is not known. It is known that both types of soluble receptors can bind to TNF in vitro and inhibit its biological activity by competing with cell surface receptors for TNF binding.
  • a syndrome referred to as viral hemorrhagic fever is caused by one of several RNA viruses that include members of the viral families of Arenaviridae, Bunyaviridae, Filoviridae and Flaviviridae (see, e.g. , Peters et al., Textbook of human virology (Belshe, ed.), Mosby Year Book, pp. 699-71 2 (1 991 )).
  • Pronounced hemorrhage manifestations are characteristic of these fevers as well as disseminated intravascular coagulation (DIC), generalized shock, and a high mortality rate (30%-90%) (Fisher-Hoch et al., J. Infect. Dis. , 1 523:887-894 ( 1 985); Fisher-Hoch, Rev. Med. Virol. , 3:7-1 3 ( 1 993); Murphy et al., Virology (Fields and Knipe, eds.), Raven, New York, pp. 936-942 ( 1 990)). Despite some understanding of the progress of these diseases and responses, there are few, if any, effective treatments.
  • Methods and compositions for treating disorders and diseases involving acute inflammatory responses are provided.
  • the methods and composition provided herein are used to treat various types viral and infectious diseases and other diseases, conditions and disorders, including but are not limited to, viral hemorrhagic diseases and other acute infectious diseases, sepsis, cachexia, rheumatoid arthritis and other autoimmune disorders, acute cardiovascular events, chronic myelogenous leukemia and transplanted bone marrow-induced graft-versus-host disease, septic shock, immune complex-induced colitis, cerebrospinal fluid inflammation, autoimmune disorders, multiple sclerosis and other such disorders.
  • disorders, conditions and diseases are not limited to, trauma, such as polytrauma, burns, major surgery; systemic inflammatory response syndrome (SIRS); adult respiratory distress syndrome (ARDS) patients; patients with acute liver failure; inflammatory bowel disease, Crohn's disease and other such disorders.
  • SIRS systemic inflammatory response syndrome
  • ARDS adult respiratory distress syndrome
  • methods and compositions for treating the viral and other infectious diseases particularly bacterial sepsis and viral hemorrhagic diseases or disorders, particularly those viral hemorrhagic diseases or disorders caused by infection with a Bunyaviridaea, a Filoviridae, a Flaviviridae, or an Arenaviridae virus, and other disorders, such as sepsis, particularly that associated with exposure to gram negative bacterial endotoxis, and shock, including that associated with trauma, and infections, such as parasitic infections, that are characterized by an immunologic response, particularly an acute inflammatory responses, involving cellular activation, including production tumor necrosis factors, interleukins, chemokines and interferons are provided.
  • Tetracycline and tetracycline-like compounds and the blood-derived compositions for effecting such treatment are provided herein. It is shown herein that tetracycline compounds and tetracycline-like compounds as defined herein can be used for treatment of disorders involving acute inflammatory responses. The tetracycline and tetracycline-like compounds are used to treat the disorders and also to produce blood product compositions from donors for the treatment of the disorders. The blood product compositions and the tetracycline and tetracycline- like compounds can be used together or each can be used for treatment of these disorders.
  • methods for preparation of blood-derived compositions for treatment of diseases, conditions and disorders characterized by or involving an inflammatory immune response are provided. Methods for such production are provided.
  • compositions are produced either in vitro or in vivo or a combination thereof by contacting blood or blood fraction or product with a tetracycline and/or tetracycline-like compound for a sufficient time to result in at least about a 3-fold increase in the level of a selected cytokine receptors, such as IL-1 receptors and/or TNF receptors.
  • a selected cytokine receptors such as IL-1 receptors and/or TNF receptors.
  • the level of receptors, such as IL-1 receptors and/or soluble TNF receptors in the blood or blood fraction or product is tested before and after contacting with the tetracycline or tetracycline-like compound.
  • a method for producing a cytokine-receptor-enriched blood product by treating blood or a fraction thereof with a tetracycline or tetracycline- like compound; and harvesting by methods described herein or known to those of skill in the art, fractions thereof, and selecting the cytokine-receptor enriched plasma, serum or other fraction.
  • the resulting compositions are enriched for cytokine receptors compared to the blood prior to treatment.
  • the receptors of interest include soluble tumor necrosis factor (TNF) receptors and/or interleukin- 1 RA (IL-1 RA) receptors.
  • TNF tumor necrosis factor
  • IL-1 RA interleukin- 1 RA
  • compositions and use thereof for treatment of conditions, diseases and disorders associated with acute inflammatory responses are provided.
  • compositions suitable for treating viral hemorrhagic diseases or disorders include some or all of the steps of: a) administering one or more tetracycline compounds to a mammal; b) collecting blood from the mammal; and c) recovering serum or plasma from the collected blood to thereby produce a composition for use in treating the disorders or diseases.
  • Such compositions which are preferably derived from the plasma, can be used to treat viral hemorrhagic diseases or disorders, particularly those viral hemorrhagic diseases or disorders caused by infection of a Bunyaviridaea, a Filoviridae, a Flaviviridae, or an Arenaviridae virus.
  • compositions also can be used to treat any disorder involving a cytotoxic response, including but not limited to sepsis and endotoxic shock.
  • the plasma (or serum portion) may be further fractionated and fractions that possess the desired therapeutic activity (treatment of symptoms associated with the viral infection, shock or other such disorder) identified empirically and formulated, if necessary, into compositions for treatment of the mammal.
  • the plasma (or blood) is preferably derived from a human treated with a tetracycline compound.
  • plasma or derivatives of the plasma produced by administering a tetracycline or tetracycline-like compound, and then isolating the fraction rich in released soluble factors, such as 11-1 receptors and TNF-1 receptors.
  • the plasma fraction is for treating acute events, including the viral infections, and cardiovascular events.
  • compositions containing these soluble receptors, immunoattenuting factors are provided. These are produced by administering a tetracycline compound or a tetracycline-like compound to induce the factors, harvesting the plasma, optionally enriching the plasma for these factors that sop up inflammatory factors. The resulting composition is administered.
  • compositions are administered to a mammal with a condition associated with or characterized by an acute inflammatory response.
  • These compositions can be administered in combination with tetracycline and/or tetracycline-like compounds and also optionally in combination with other therapies for each disorder.
  • the combination therapies may be administered simultaneously, consecutively, intermittently or in any desired or effective order. The may be repeated as needed.
  • tetracycline and tetracycline-like compounds other related compounds and the blood-derived compositions provided herein are used to treat various types viral and infectious diseases, particularly viral hemorrhagic diseases or disorders, particularly those viral hemorrhagic diseases or disorders caused by infection with a Bunyaviridaea, a Filoviridae, a Flaviviridae, or an Arenaviridae virus, and other disorders, such as sepsis, particularly that associated with exposure to gram negative bacterial endotoxis, and shock, including that associated with trauma, and infections, such as parasitic infections, that are characterized by an immunologic response, particularly an acute inflammatory responses, involving cellular activation, including production tumor necrosis factors, interleukins, chemokines and interferons.
  • tetracycline and tetracycline-like compounds and the blood-derived compositions provided herein are used to treat conditions and disorders, including but are not limited to, sepsis, cachexia, rheumatoid arthritis, chronic myelogenous leukemia and transplanted bone marrow-induced graft- versus-host disease, septic shock, immune complex-induced colitis, cerebrospinal fluid inflammation.
  • tetracycline compound or derivatives thereof, or a mixture thereof, and tetracycline-like compounds that can alleviate, reduce, ameliorate, or prevent viral hemorrhagic diseases or disorders and other acute inflammatory response; or place or maintain in a state of remission of clinical symptoms or diagnostic markers associated with such diseases or disorders.
  • Viruses that cause hemorrhagic diseases include, but are not limited to, Bunyaviridaea, a Filoviridae, a Flaviviridae, and Arenaviridae viruses.
  • the Bunyaviridaea viruses include, but are not limited to, bunyavirus (Bunyamwera, Bwamba, California, Capim, Guama, phlebovirus koongol, patois, simbu and tete viruses), sandfly fever virus, Rift Valley fever virus of sheep and ruminants, Nairovirus, Crimean-Congo hemorrhagic fever virus, Uukuvirus, Uukuniemi virus, Hantaan virus and Korean hemorrhagic fever virus.
  • the Bunyaviridaea viruses include, Crimean-Congo hemorrhagic fever virus, Hantaan virus and Korean hemorrhagic fever virus.
  • the Filoviridae viruses include, but are not limited to, ebola virus, such as the Zaire, Sudan, Reston and Ivory Coast subtypes, and Marburg viruses.
  • Other Flaviviridae virus include flavivirus, Brazilian encephalitis virus, Bussuquara virus, dengue virus, iiheus virus, Israel turkey meningoencephalitis virus, Japanese B encephalitis virus, kunjin virus, Kyasanur forest disease virus, langat virus, iouping ill virus, modoc virus, Murray valley encephalitis virus, ntaya virus, omsk hemorrhagic fever virus, powassan virus, St.
  • the Arenaviridae viruses include, but are not limited to, Junin virus, lassa virus such as the Josiah strain or Nigerian strain, machupo virus, pichinde virus, lymphocytic choriomeningitis virus, lassa fever virus and arenavirus.
  • compositions including one or more tetracycline compound(s) and one or more anti-hemorrhagic virus treatments.
  • the combinations are typically pharmaceutical compositions that include a tetracycline compound formulated for single dosage administration, and an agent, other than a tetracycline compound, that is an anti-hemorrhagic viral agent, such as a vaccine, antibody or other pharmaceutical.
  • the compound and agent can be administered separately, such as sequentially, or can be administered intermittently, or together as two separate compositions are as a mixture in a single composition.
  • the dosage of each can be empirically determined, but is generally the dosage of a agent normally used to treat the hemorrhagic viral infection, and an amount of a tetracycline compound sufficient to further enhance treatment, or sufficient when used alone to reduce or ameliorate or in some manner reduce symptoms.
  • the combinations can be packaged as kits.
  • the combination contains a single composition containing the tetracycline compound and anti-hemorrhagic virus agent formulated for oral delivery or two compositions, one containing a tetracycline compound and the other an anti-viral-hemorrhagic agent, where each is in a pharmaceutically acceptable carrier or excipient in tablet, capsule, or other single unit dosage form.
  • the two components can be mixed in a single composition.
  • the compositions are formulated for rectal, topical, inhalation, buccal (e.g. , sublingual), parenteral ⁇ e.g. , subcutaneous, intramuscular, intradermal, or intravenous including bolus injection) and transdermal administration. Specific therapeutic regimens, pharmaceutical compositions, and kits are also provided.
  • Tetracycline compounds include, but are not limited to chlortetracycline, demeclocycline, doxycycline, methacycline, minocycline, oxytetracycline and tetracycline. Tetracycline-like compounds are those share the property of altering folic acid metabolism in bacteria. Such compounds include thalidomide and sulfa drugs.
  • Anti-hemorrhagic virus treatments include treatment protocols and agents that are used to treat hemorrhagic viral diseases or ameliorate the symptoms thereof. Such agents include, but are not limited agents that inhibit interleukin-1 (IL-1 ) and agents that inhibit TNF.
  • agents include, but are not limited agents that inhibit interleukin-1 (IL-1 ) and agents that inhibit TNF.
  • Other anti-hemorrhagic viral agents include, but are not limited to, anti-viral vaccines, anti-viral antibodies, a viral-activated immune cells, such as activated cytotoxic cells, and viral-activated immune serum.
  • IL-1 receptor antagonists include, but are not limited to, the IL-1 receptor antagonist (IL-1 Ra), IL-1 receptor intracellular ligand protein, a Type II IL-1 receptor, a soluble IL-1 receptor, a non-bioiogically active (i.e., non-functional) mutein of IL-1 that binds to IL-receptors , a non-functional mutein of IL-1 receptor and small molecule antagonists, such as histamine antagonist, a aryl-or heteroaryl- 1 -alkyl-pyrrole-2-carboxylic acid compound and a 5-lipoxygenase pathway inhibitor.
  • IL-1 Ra the IL-1 receptor antagonist
  • IL-1 receptor intracellular ligand protein include, but are not limited to, the IL-1 receptor antagonist (IL-1 Ra), IL-1 receptor intracellular ligand protein, a Type II IL-1 receptor, a soluble IL-1 receptor, a non-bioiogically active (i.e., non-
  • IL-1 production inhibitors include antisense oligonucleotides, 5-hydroxy- and 5-methoxy 2-amino-pyrimidines, a 3-substituted-2-oxindole-1 -carboxamide, a 4,5-diaryl-2(substituted)imidazole and a 2-2'-[ 1 ,3-propan-2-onediyl- bis(thio)]bis-1 -H-imidazole.
  • IL-1 releasing inhibitors include IL-1 converting enzyme inhibitors, such as, but are not limited to, a peptide based interleukin- 1 beta converting enzyme inhibitor, a pyridazinodiazepine, SDZ 224-01 5, an aspartate-based inhibitor, an aspartyl alpha-(( 1 -phenyl-3-(trifluoromethyl)-pyrazol- 5-yl)oxy)methyl ketone, L-741 ,494, TX, CPP-32 and CMH-1 .
  • IL-1 converting enzyme inhibitors such as, but are not limited to, a peptide based interleukin- 1 beta converting enzyme inhibitor, a pyridazinodiazepine, SDZ 224-01 5, an aspartate-based inhibitor, an aspartyl alpha-(( 1 -phenyl-3-(trifluoromethyl)-pyrazol- 5-yl)oxy)methyl ketone, L-741 ,494, TX, CPP-32 and CMH
  • Anti-TNF antibody polyclonal or monoclonal
  • an anti-TNF receptor antibody polyclonal or monoclonal
  • a TNF receptor antagonist a TNF production inhibitor
  • a TNF receptor production inhibitor a TNF receptor production inhibitor
  • a TNF releasing inhibitor a TNF releasing inhibitor.
  • Anti-TNF monoclonal antibodies include, but are not limited to, Mabp55r, Mabp75r, 3B1 0, h3B1 0-9, MAK 1 95F, CA2 and CDP571 .
  • TNF receptor antagonists include, but are not limited to, soluble TNF receptor, a non-functional mutein that binds to the TNF receptor, but does not exhibit TNF biological activity, a nonfunctional mutein of TNF and small molecule antagonists, such as but are not limited to, a mercapto alkyl peptidyl compound, an arylsulfonyl hydroxamic acid derivative, a salt of an alkaline-earth metal, a pentoxifylline, a hydroxamic acid compound, a retinoic acid, a histamine antagonist, a leflunomide, a 1 -Alkoxy-2- (alkoxy- or cycloalkoxy-)-4-(cyclothioalkyl- or cyclothioalkenyl-) benzene, a vinigrol, a cyclohexene-ylidene derivative, a quinazoline compound and BN 50739.
  • TNF receptor antagonists include, but are not limited to, TNF receptor death domain ligand protein, a tumor necrosis factor binding protein (TNF-BP), a TNF receptor-lgG heavy chain chimeric protein, a bacterial lipopolysacchande biding peptide derived from CAP37 protein and a Myxoma virus T2 protein.
  • TNF production inhibitors include antisense oligonucleotides, quinoline-3-carboxamide compounds and derivatives of 2-pyrrolidinone.
  • TNF releasing inhibitors include isoxazoline compounds and catechol diether compounds.
  • Methods herein are for stimulating release of the receptors such as, not limited to, TNF- ⁇ and IL-1 receptors, and other soluble factors that down- regulate excessive TH 1 response, that are stimulated by tetracycline administration.
  • the receptors are those that sop up inflammatory factors that are released in various inflammatory conditions, viral infections, bacterial infections, and conditions associate with fungal and parastial infections, inflammatory responses, such as asthma, sepsis, rheumatoids, atherosclerosis, inflammatoryr responses associated with injury, and cardiovascular events and events related to cell activation, i.e. , acute events brought on by excessive release of inflammatory factors.
  • Tetracycline-like compounds 2. Tetracycline compounds a. Anti-inflammatory activity of tetrac ⁇ clines b. Exemplary tetracycline compounds
  • Tetracycline Other Chemically-Modified Tetracyclines
  • Anti-viral-hemorrhagic agents a. lnterleukin-1 (11-1 ) inhibitors b. Tumor necrosis factor (TNF) inhibitors c. Anti-viral vaccine, antibody and virally-activated immune cells and serum ( 1 ) Anti-viral vaccine
  • tetracycline compound refers any compound having the activity of a tetracycline, prodrugs, salts, esters or other derivatives of tetracycline, preferably in a pharmaceutically acceptable form, known to those of skill in the art.
  • Tetracycline which is well known to those of skill in the art hs the structure:
  • Tetracycline encompasses all pharmaceutically active species of tetracycline compounds, solutions thereof and mixtures thereof, prodrugs thereof and any drug recognized as a tetracycline.
  • Tetracycline includes forms, such as hydrated forms, and compositions such as aqueous solutions, hydrolyzed products or ionized products of these compounds; and these compounds may contain different number of attached water molecules.
  • the term tetracycline compound encompasses all derivatives and analogs and modified forms thereof, including but not limited to, those set forth herein.
  • Tetracycline and tetracycline-like compounds include, but are not limited to aspirin, aureomycin, apicycline, chlortetracycline, clomocycline, demeclocyline, guamecycline, lymecycline, meclocycline, methacycline, minocycline, oxytetracycline, penimepicycline, pipacycline, rolitetracycline, sancycline, and senociclin, as well as any others falling within the above formula.
  • tetracycline-like compounds include compounds that alter bacterial folic acid metabolism, such as sulfa drugs, including sulfonamides, and thalidomide. Such compounds can be identified by their ability to alter bacterial folic acid metabolism.
  • tetracycline-like compounds such as aureomycin, sulfa drugs and thalidomide, refer to compounds that have the activity of tetracycline in the methods herein. Such compounds can be identified by their ability to alter folic acid metabolism in bacterial species, particularly those in which tetracycline alters folic acid metabolism.
  • a tetracycline and tetracycline-like compound herein is a compound that stimulates release of soluble factors in the blood that attenuate inflammatory responses.
  • an anti-hemorrhagic virus treatment refers to any treatment designed to treat hemorrhagic viral infections by lessening or ameliorating the symptoms. Treatments that prevent the infection or lessen its severity are also contemplated.
  • An anti-hemorrhagic virus agent (used interchangeable with "anti-viral-hemorrhagic agent” ) refers any agents used in the treatment.
  • agents when used alone or in combination with other compounds, that can alleviate, reduce, ameliorate, prevent, or place or maintain in a state of remission of clinical symptoms or diagnostic markers associated with viral hemorrhagic diseases or disorders, particularly those viral hemorrhagic diseases or disorders caused by infection of a Bunyaviridaea, a Filoviridae, a Flaviviridae, or an Arenaviridae virus, can be used in methods, combinations and compositions provided herein.
  • Non-limiting examples of anti- viral-hemorrhagic agents include interleukin-1 (IL- 1 ) inhibitors, tumor necrosis factor (TNF) inhibitors, anti-viral vaccines, anti-viral antibodies, viral-activated immune cells and viral-activated immune sera.
  • IL-1 interleukin-1
  • TNF tumor necrosis factor
  • anti-viral vaccines anti-viral antibodies
  • viral-activated immune cells viral-activated immune sera.
  • anti-hemorrhagic virus agent anti-viral-hemorrhagic agent
  • anti-hemorrhagic virus treatment does not encompass "tetracycline compound” or use thereof for treatment, but encompasses all agents and treatment modalities known to those of skill in the art to ameliorate the symptoms of a hemorrhagic viral infection.
  • a cytokine is a factor, such as lymphokine or monokine, that is produced by cells that affect the same or other cells.
  • a "cytokine” is one of the group of molecules involved in signalling between cells during immune responses. Cytokines are proteins or peptides; and some are glycoproteins.
  • IL interleukin
  • IL refers to a large group of cytokines produced mainly by T cells, although some are also produced by mononuclear phagocytes, or by tissue cells. They have a variety of functions, but most of them are involved in directing other cells to divide and differentiate. Each interleukin acts on specific, limited group of cells which express the correct receptors for that cytokine.
  • interleukin-1 refers to interleukins made by certain antigen presenting cells (APCs) that, along with IL-6, act as co- stimulatory signals for T cell activation.
  • the IL-1 gene family includes IL-1 ⁇ , IL- 1/? and IL-1 receptor antagonist (IL-1 Ra) (Dinarello, Eur. Cytokine Netw. ,
  • Each member is first synthesized as a precursor protein; the precursors for IL-1 (prolL-1 ⁇ and prolL-1/?) have molecular weights of about 31 ,000 Da.
  • the prolL-l ⁇ and mature 1 7,000 Da IL-1 a are biologically active whereas the prolL-1/? requires cleavage to a 1 7,000 Da peptide for optimal biological activity.
  • the IL-IRa precursor has a leader sequence and is cleaved to its mature form and secreted like most proteins.
  • IL-1 ⁇ and IL-1 /? are potent agonists where IL-1 Ra is a specific receptor antagonist.
  • IL-IRa appears to be a pure receptor antagonist with no agonist activity in vitro or in vivo.
  • IL-1 Ra is a secreted protein, there is another form of this molecule which is retained inside cells. It is called "intracellular" (ic) IL-1 Ra.
  • lclL-1 Ra results from alternate mRNA splice insertion of the IL-1 Ra gene replacing the exon coding for the signal peptide.
  • the forms of ILJ Ra are functionally indistinguishable.
  • IL-1 encompasses all proteins encoded by the IL-1 gene family including IL-1 ⁇ , IL-1 /?, IL-I Ra and iclL-1 Ra, or an equivalent molecule obtained from any other source or that has been prepared synthetically. It is intended to encompass IL-1 with conservative amino acid substitutions that do not substantially alter its activity. Suitable conservative substitutions of amino acids are known to those of skill in this art and may be made generally without altering the biological activity of the resulting molecule.
  • amino acids which occur in the various amino acid sequences appearing herein, are identified according to their well-known, three- letter or one-letter abbreviations.
  • nucleotides which occur in the various amino acids sequences appearing herein, are identified according to their well-known, three- letter or one-letter abbreviations.
  • DNA fragments are designated with the standard single-letter designations used routinely in the art.
  • IL-1 inhibitor encompasses any substances that prevent or decrease production, post-translational modification(s), maturation, or release of IL-1 , or any substances that interfere with or decrease the efficacy of the interaction between IL-1 (see, e.g. , SEQ ID Nos. 1 and 2) and IL-1 receptor
  • the IL-1 inhibitor is an anti-IL-1 antibody, an anti-IL-1 receptor antibody, an IL-1 receptor antagonist, an IL-1 production inhibitor, an IL-1 receptor production inhibitor and an IL-1 releasing inhibitor.
  • a therapeutic agent As used herein, the terms “a therapeutic agent” , “therapeutic regimen”,
  • radioprotectant means conventional drugs and drug therapies, including vaccines, which are known to those skilled in the art.
  • chemotherapeutic mean conventional drugs and drug therapies, including vaccines, which are known to those skilled in the art.
  • Radiotherapeutic agents are well known in the art.
  • ICE interleukin-1 converting enzyme
  • ICE refers to a protease that processes the IL-1 /? precursor (plL-1 ⁇ ) to the mature IL-1/? (mlL-1 ⁇ ) (U.S. Patent No. 5,552,536).
  • ICE generates fully active mlL-1 ⁇ by cleaving plL- 1 ⁇ between Asp 1 16 and Ala 1 17 , a unique site for pheromone processing.
  • the sequence around this cleavage site, -Tyr-Val-His-Asp-Ala- is evolutionarily conserved in all known plL-1 ⁇ polypeptides.
  • Active human ICE is a heterodimer with a 1 : 1 stoichiometric complex of p20 and p1 0 subunits. Cloned cDNA have revealed that ICE is constitutively expressed as a 45 kDa proenzyme (p45) composed of a 1 4 kDa prodomain, followed by p20 which contains the active site Cys 285 , a 1 9 residue connecting peptide that is not present in the mature enzyme, and p1 0, a required component of the active enzyme. The mature subunits are flanked by Asp-X sequences. Mutational analysis of these sites and expression in heterologous systems indicates that the generation of active enzyme is autocatalytic. Murine and rat ICE have also been cloned and show a high degree of sequence similarity including these structural motifs.
  • TNF tumor necrosis factor
  • MHC major histocompatibility complex
  • TNF family members include TNF ⁇ (also known as cachectin) and TNF ⁇ (also known as lymphotoxin).
  • TNF ⁇ also known as cachectin
  • TNF ⁇ also known as lymphotoxin
  • TNF encompasses all proteins encoded by the TNF gene family including TNF ⁇ and TNF ⁇ , or an equivalent molecule obtained from any other source or that has been prepared synthetically. It is intended to encompass TNF with conservative amino acid substitutions that do not substantially alter its activity.
  • TNF inhibitor encompasses any substances that prevent or decrease production, post-translational modification(s), maturation, or release of TNF, or any substances that interfere with or decrease the efficacy of the interaction between TNF (see, e.g. , SEQ ID Nos. 14 and 1 5) and TNF receptor (see, SEQ ID Nos. 1 6 and 1 7) .
  • the TNF inhibitor is an anti- TNF antibody, an anti-TNF receptor antibody, a TNF receptor antagonist, a TNF production inhibitor, a TNF receptor production inhibitor and a TNF releasing inhibitor.
  • TNF-R1 Native TNF receptors are characterized by distinct extracellular, transmembrane and intracellular domains. Two distinct TNF receptors of about 55 kd (“TNF-R1 ”) and about 75 kd (“TNF-R2”) have been identified. Numerous studies have demonstrated that TNF-R1 is the receptor which signals the majority of the pleiotropic activities of TNF. The domain required for signaling cytotoxicity and other TNF-mediated responses has been mapped to the about 80 amino acids near the C-terminus of TNF-R1 . This domain is therefore termed the "death domain" (“TNF-R death domain” and "TNF-R 1 -DD”) (see, U.S. Patent No. 5,852, 1 73; and Tartaglia et al., Cell, 74:845-853 ( 1 993)).
  • antisense polynucleotides refer to synthetic sequences of nucleotide bases complementary to mRNA or the sense strand of double stranded DNA. Admixture of sense and antisense polynucleotides under appropriate conditions leads to the binding of the two molecules, or hybridization. When these polynucleotides bind to (hybridize with) mRNA, inhibition of protein synthesis (translation) occurs. When these polynucleotides bind to double stranded DNA, inhibition of RNA synthesis (transcription) occurs. The resulting inhibition of translation and/or transcription leads to an inhibition of the synthesis of the protein encoded by the sense strand.
  • an antisense oligonucleotide that contains a sufficient number of nucleotides to inhibit translation of an mRNA, such as an interleukin-1 (IL-1 ), such as IL-1 ⁇ , or TNF.
  • An antisense oligonucleotide refers to any oligomer that prevents production or expression of, for example, IL-1 polypeptide. The size of such an oligomer can be any length that is effective for this purpose.
  • the antisense oligomer is prepared in accordance with the nucleotide sequence of a portion of the transcript of interest (i.e. , 11-1 or TNF) that includes the translation initiation codon and contains a sufficient number of complementary nucleotides to block translation.
  • vaccine refers to any composition for active immunological prophylaxis.
  • a vaccine may be used therapeutically to treat a disease, or to prevent development of a disease or to decrease the severity of a disease either proactively or after infection.
  • Non-limiting examples of vaccines include, but are not limited to, preparations of killed microbes of virulent strains or living microbes of attenuated (variant or mutant) strains, or microbial, fungal, plant, protozoa, or metazoa derivatives or products.
  • Vaccine also encompasses protein/peptide and nucleotide based vaccines.
  • cytotoxic cells refers to cells that kill virally infected targets expressing antigenic peptides presented by MHC class I molecules.
  • treating hemorrhagic viral diseases or disorders means that the diseases and the symptoms associated with the hemorrhagic viral diseases or disorders are alleviated, reduced, ameliorated, prevented, placed in a state of remission, or maintained in a state of remission.
  • a method for treating hemorrhagic viral diseases or disorders means that the hallmarks of hemorrhagic viral diseases or disorders are eliminated, reduced or prevented by the treatment.
  • Non-limiting examples of the hallmarks of the viral hemorrhagic diseases or disorders include disseminated intravascular coagulation (DIC), generalized shock, and the highest mortality rate (30%-90%).
  • a blood-derived compositions refers to the composition produced from the blood of mammals treated with a tetracycline and/or tetracycline-like compound. It also refers to the compositions produced by in vitro treatment of blood or a blood fraction with a tetracycline or tetracycline-like compound.
  • These blood-derived are for treating, not only the hemorrhagic disorders, but also for alleviating any disorder involving a deleterious immune response, such as septic shock and endotoxic shock.
  • LPS lipopolysacchande
  • IL-1 interleukin-1
  • PAF platelet-activating factor
  • an acute inflammatory disease, condition or disorder refers to any condition, disease or disorder in which a deleterious elevation of cytokines and other inflammatory mediators occurs.
  • disease, condition and disorder refer to the manifestation of such elevation.
  • a disease is caused by an infectious agent
  • a disorder refers to a disease that does not have a known infectious agent as a cause and a condition is used to capture all such symptoms and characteristics associated with acute inflammatory responses. They are referred to herein in the alternative to ensure that all are encompassed.
  • "serum” refers to the fluid portion of the blood obtained after removal of the fibrin clot and blood cells, distinguished from the plasma in circulating blood.
  • plasma refers to the fluid, noncellular portion of the blood, distinguished from the serum obtained after coagulation.
  • albumin refers to a type of protein, varieties of which are widely distributed throughout the tissues and fluids of plants and animals, especially animal blood. Albumin are soluble in pure water, precipitable from solution by strong acids and coagulable by heat in acid or neutral solution.
  • globulin refers to a family of proteins precipitated from plasma (or serum) by half-saturation with ammonium sulfate. Globulin may be further fractionated by solubility, electrophoresis, ultracentrifugation, and other separation methods into many subgroups, the main groups being a-, ⁇ -, and y- globulins.
  • antihemophilic factor refers the fraction of blood that contains Factor VIII and/or von Willebrand's factor, which are important in the blood clotting mechanism (see, e.gr. ,,U .S. Patent No. 4,435,31 8).
  • Factor VIII serves as a co-factor along with calcium and phospholipid to enable Factor IX. to cleave zymogen Factor X to thus activate Factor X, all being a part of the complex coagulation cascade system.
  • Von Willebrand's factor vWF apparently acts in the aggregation of platelets which provide the necessary phospholipid. The absence of either of these factors may result in prolonged bleeding times.
  • Factor V also serves an important role in the coagulation system by aiding activated Factor X in the cleavage of prothrombin to thrombin.
  • Plasma Proteins Vol. Ill, 2nd Ed., Structure, Function, Genetic Control ( 1 977) (Academic Press, Inc., N.Y.) p. 422-544.
  • an effective amount of a compound for treating a particular disease is an amount that is sufficient to ameliorate, or in some manner reduce the symptoms associated with the disease. Such amount may be administered as a single dosage or may be administered according to a regimen, whereby it is effective. The amount may cure the disease but, typically, is administered in order to ameliorate the symptoms of the disease. Repeated administration may be required to achieve the desired amelioration of symptoms.
  • pharmaceutically acceptable salts, esters or other derivatives of the conjugates include any salts, esters or derivatives that may be readily prepared by those of skill in this art using known methods for such derivatization and that produce compounds that may be administered to animals or humans without substantial toxic effects and that either are pharmaceutically active or are prodrugs.
  • treatment means any manner in which the symptoms of a conditions, disorder or disease are ameliorated or otherwise beneficially altered. Treatment also encompasses any pharmaceutical use of the compositions herein.
  • amelioration of the symptoms of a particular disorder by administration of a particular pharmaceutical composition refers to any lessening, whether permanent or temporary, lasting or transient that can be attributed to or associated with administration of the composition.
  • substantially pure means sufficiently homogeneous to appear free of readily detectable impurities as determined by standard methods of analysis, such as thin layer chromatography (TLC), gel electrophoresis and high performance liquid chromatography (HPLC), used by those of skill in the art to assess such purity, or sufficiently pure such that further purification would not detectably alter the physical and chemical properties, such as enzymatic and biological activities, of the substance.
  • TLC thin layer chromatography
  • HPLC high performance liquid chromatography
  • Methods for purification of the compounds to produce substantially chemically pure compounds are known to those of skill in the art.
  • a substantially chemically pure compound may, however, be a mixture of stereoisomers or isomers. In such instances, further purification might increase the specific activity of the compound.
  • a prodrug is a compound that, upon in vivo administration, is metabolized or otherwise converted to the biologically, pharmaceutically or therapeutically active form of the compound.
  • the pharmaceutically active compound is modified such that the active compound will be regenerated by metabolic processes.
  • the prodrug may be designed to alter the metabolic stability or the transport characteristics of a drug, to mask side effects or toxicity, to improve the flavor of a drug or to alter other characteristics or properties of a drug.
  • biological activity refers to the jn vivo activities of a compound or physiological responses that result upon jn vivo administration of a compound, composition or other mixture.
  • Biological activity thus, encompasses therapeutic effects and pharmaceutical activity of such compounds, compositions and mixtures.
  • Biological activities may be observed in in vitro systems designed to test or use such activities.
  • the biological activity of a luciferase is its oxygenase activity whereby, upon oxidation of a substrate, light is produced.
  • a receptor refers to a molecule that has an affinity for a given ligand. Receptors may be naturally-occurring or synthetic molecules. Receptors may also be referred to in the art as anti-ligands.
  • receptor and anti-ligand are interchangeable.
  • Receptors can be used in their unaltered state or as aggregates with other species.
  • Receptors may be attached, covalently or noncovalently, or in physical contact with, to a binding member, either directly or indirectly via a specific binding substance or linker.
  • receptors include, but are not limited to: antibodies, cell membrane receptors surface receptors and internalizing receptors, monoclonal antibodies and antisera reactive with specific antigenic determinants [such as on viruses, cells, or other materials], drugs, polynucleotides, nucleic acids, peptides, cofactors, lectins, sugars, polysaccharides, cells, cellular membranes, and organelles.
  • receptors and applications using such receptors include but are not restricted to: a) enzymes: specific transport proteins or enzymes essential to survival of microorganisms, which could serve as targets for antibiotic [ligand] selection; b) antibodies: identification of a ligand-binding site on the antibody molecule that combines with the epitope of an antigen of interest may be investigated; determination of a sequence that mimics an antigenic epitope may lead to the development of vaccines of which the immunogen is based on one or more of such sequences or lead to the development of related diagnostic agents or compounds useful in therapeutic treatments such as for auto-immune diseases c) nucleic acids: identification of ligand, such as protein or RNA, binding sites; d) catalytic polypeptides: polymers, preferably polypeptides, that are capable of promoting a chemical reaction involving the conversion of one or more reactants to one or more products; such polypeptides generally include a binding site specific for at least one reactant or reaction intermediate and an active functionality proximate to
  • Patent No. 5,21 5,899 Patent No. 5,21 5,899
  • hormone receptors determination of the ligands that bind with high affinity to a receptor is useful in the development of hormone replacement therapies; for example, identification of ligands that bind to such receptors may lead to the development of drugs to control blood pressure
  • opiate receptors determination of ligands that bind to the opiate receptors in the brain is useful in the development of less-addictive replacements for morphine and related drugs.
  • antibody includes antibody fragments, such as Fab fragments, which are composed of a light chain and the variable region of a heavy chain.
  • humanized antibodies refer to antibodies that are modified to include "human" sequences of amino acids so that administration to a human will not provoke an immune response.
  • Methods for preparation of such antibodies are known.
  • the hybridoma that expresses the monoclonal antibody is altered by recombinant DNA techniques to express an antibody in which the amino acid composition of the non-variable regions is based on human antibodies.
  • Computer programs have been designed to identify such regions.
  • production by recombinant means by using recombinant DNA methods means the use of the well known methods of molecular biology for expressing proteins encoded by cloned DNA.
  • substantially identical to a product means sufficiently similar so that the property of interest is sufficiently unchanged so that the substantially identical product can be used in place of the product.
  • equivalent when referring to two sequences of nucleic acids means that the two sequences in question encode the same sequence of amino acids or equivalent proteins.
  • equivalent when “equivalent” is used in referring to two proteins or peptides, it means that the two proteins or peptides have substantially the same amino acid sequence with only conservative amino acid substitutions (see, e.g.. Table 1 , above)that do not substantially alter the activity or function of the protein or peptide.
  • “equivalent” refers to a property
  • the property does not need to be present to the same extent [e.g., two peptides can exhibit different rates of the same type of enzymatic activity], but the activities are preferably substantially the same.
  • stringency of hybridization in determining percentage mismatch is as follows: 1 ) high stringency: 0.1 x SSPE, 0.1 % SDS, 65 °C
  • composition refers to a any mixture. It may be a solution, a suspension, liquid, powder, a paste, aqueous, non-aqueous or any combination thereof.
  • a combination refers to any association between two or among more items.
  • fluid refers to any composition that can flow. Fluids thus encompass compositions that are in the form of semi-solids, pastes, solutions, aqueous mixtures, gels, lotions, creams and other such compositions.
  • viral hemorrhagic diseases The description below is exemplified by reference viral hemorrhagic diseases. It is understood that the methods, compositions, combinations and kits provided and described herein may be used for treatment of any disorder, disease or condition characterized by a deleterious immune response.
  • diseases, conditions and disorders include, but are not limited to: viral infections, such as viral hemorrhagic infections, lentivirus infections, HIV infections, herpesvirus infections; bacterial infections, particularly infection with pathogenic strains of E.
  • coli and Streptococcus viruses associated with sleep disorders, such as HIV; parasitic infections, such as malaria, autoimmune diseases, such a thyroid diseases, rheumatoid arthritis, and lupis; sepsis; cachexia, such as the wasting associated with HIV infection and cancer; rheumatoid arthritis; chronic myelogenous leukemia and transplanted bone marrow-induced graft-versus-host disease; septic shock; immune complex-induced colitis; cerebrospinal fluid inflammation; endotoxemia; autoimmune disorders; multiple sclerosis; cell death associated with apoptosis; thyroid diseases and other endocrine disorders in which TNF or IL-1 is implicated or is a mediator; gynecological disorders, including endometriosis and infections associated therewith; and other diseases mediated by or associated with IL-1 and/or TNF. It is also understood that IL-1 and TNF expression serve as markers for these disorders and to monitor the treatments herein and the blood compositions here
  • Combinations of therapeutic agents and also compositions for treatment of acute inflammatory responses are provided herein. Several embodiments are provided.
  • blood-derived compositions are provided. These compositions are produced by contacting mammalian blood or a fraction thereof, in vitro or in vivo, with one or more tetracycline and/or tetracycline-like compounds, as defined herein, to induce a response that is assessed by monitoring the increase in level of TNF receptors and/or IL-1 receptors.
  • the amount of compound contacted with the blood and time of contact is sufficient to induce at least a three-fold increase from baseline, which is variable from individual-to-individual and species-to-species, of TNF and/or IL-1 receptors.
  • the total increase of either must be at least about three-fold to ensure a sufficient concentration of the receptors and other factors in the blood or fraction thereof.
  • the resulting blood or fraction thereof can be further fractionated, such that the selected fraction retains the activity of the original blood, such as against hemorrhagic factors, and is then administered to recipient mammal, that is preferably. species and blood type matched to the donated blood or fraction.
  • the blood or fraction thereof can be stored, preferably at about - 70° C or under other conditions appropriate for storage of blood products, but is preferably not freeze-dried.
  • the blood product may also be administered to the recipient in combination with a tetracycline and/or tetracycline-like compound.
  • Such administration can be simultaneous or sequential. If administered separately they should be administered within 24 hours, preferably within 6 hours.
  • They blood-derived composition is preferably administered intravenously or intraperitoneally; the tetracycline and tetracycline- like compound is preferably administered orally. Multiple doses of each may be administered as needed. Precise dosage and regimen can be empirically determined.
  • the combination therapy may also include a known therapeutic treatment or regimen for a particular acute inflammatory disease, condition or disorder.
  • combinations of the blood-derived (or immune) compositions with tetracycline and/or tetracycline-like compounds are provided; combinations of the blood-derived (or immune) compositions with other therapeutic agents for treatment of a particular disorder, and combinations of the blood-derived (or immune) compositions with tetracycline and/or tetracycline-like compounds and with other therapeutic agents are provided.
  • the component of combinations may be provided as separate compositions or may be provided as mixtures of two or more compositions.
  • the tetracycline and tetracycline-like compounds are preferably administered orally and the blood-derived compositions are preferably administered by IV. Kits containing the combinations are provided.
  • kits contain the components of the combinations, such as the blood-derived composition and tetracycline and/or tetracycline-like compounds, and optionally include instructions for administration to treat acute inflammatory response disorders.
  • the reagents in the kits are packaged in standard pharmaceutical containers and packaging material.
  • the kits may optionally contain additional components, such as syringes for administration of the compositions.
  • tetracycline and tetracycline-like compounds are effective for treatment of viral and bacterial infections, particularly, hemorrhagic fevers and infections with pathogenic E. coli.
  • the tetracycline and tetracycline-like compounds may be administered with known treatments for hemorrhagic fevers.
  • Combinations and kits containing the combinations of tetracycline and/or tetracycline-like compounds and such anti-hemorrhagic viral infections are also provided.
  • Tetracycline-like compounds Tetracycline-like compounds, which include thalidomide, aureomycin and sulfa drugs, and any other compound that exhibits tetracycline-like activity, either in the ability to induce expression of TNF and/or IL-1 receptors in treated individuals, which can be determined in model animals as in the Examples below, or by the ability to alter folic acid metabolism in bacteria. Such compounds can be identified empirically. Any compounds that can do either are suitable for use in the methods of treating acute inflammatory responses provided herein.
  • Tetracycline compounds a. Anti-inflammatory activity of tetracyclines
  • Tetracyclines are a well-known family of antibiotics that are active against a wide range of gram-positive and gram-negative bacteria. There are some indications in the art that tetracycline has anti-inflammatory activities, which are independent of its antibacterial activity (see, e.g. , U.S. Patent No. 5,773,430; U.S. Patent No. 5,789,395; Shapira et al. ( 1 996) Infect. Immun. 64:825-828; Kloppenburg et al. ( 1 996) Antimicrob. Agents. Chemother. 40:934- 940; Celerier et al. ( 1 996) Arch. Dermatol. Res. 288:41 1 -414; Milano et al.
  • a tetracycline is any compound recognized by those of skill in the art to have the anti-inflammatory activities of a tetracycline and includes, all derivatives, including salts, esters and acids, analogs, prodrugs, modified forms thereof, and other compounds related to tetracycline as desribed above.
  • the following are exemplary tetracycline compounds intended for use in the methods and compositions and combinations provided herein.
  • chlortetracycline is 7-Chloro-4-dimethylamino- 1 ,4,4a,5,5a,6J 1 J 2a-octahydro-3,6J 0J 2J 2a-pentahydroxy-6-methyl-1 J 1 - dioxo-2-naphthacenecarboxamide.
  • Chemical synonyms of chlortetracycline include 7-chloro-tetracycline, Acronize, Aureocina, Aureomycin, Biomitsin, Biomycin and Chrysomykine.
  • the name "chlortetracycline" is used herein, although all such chemical synonyms are contemplated.
  • Chemical synonyms of chlortetracycline hydrochloride include, but are not limited to, Aureociclina and Isphamycin.
  • Chlortetracycline can be prepared according to methods known in the art. For example, chlortetracycline can be isolated from the substrate of Streptomyces aureofaciens (Duggan, Ann. N. Y. Acad. Sci. 51 , 1 77 ( 1 948); U.S. Patent No. 2,482,055 ( 1 949 to Am Cyanamid); and Broschard et al. , Science 109, 1 99 (1 949)). Purification of chlortetracycline is described in Winterbottom, et al. , U.S. Patent No. 2,899,422 ( 1 959 to Am. Cyanamid). Other processes for preparation of chlortetracycline is described in U.S. Patent Nos 2,987,449 and 3,050,446.
  • demeclocycline is 7-Chloro-4-dimethylamino- 1 ,4,4a, 5, 5a, 6, 1 1 J 2a-octahydro-3,6J OJ 2J 2a-pentahydroxy-1 , 1 1 -dioxo-2- naphthacenecarboxamide.
  • Chemical synonyms of demeclocycline include 7- chloro-6-demethyltetracycline, demethylchlortetracycline (obsolete), RP 1 01 92, Bioterciclin, Declomycin, Deganol, Ledermycin and Periciclina.
  • the name "demeclocycline" is used, although all such chemical synonyms are contemplated.
  • Chemical synonyms of demeclocycline hydrochloride include, but are not limited to, Clortetrin, Demetraciclina, Detravis, Meciclin and Mexocine.
  • Demeclocycline can be prepared according to methods known in the art. For example, demeclocycline can be prepared according to the procedures described in McCormick et a/., J. Am. Chem. Soc. 79, 4561 ( 1 957); and U.S. Patent No. 2,878,289 ( 1 959 to Am. Cyanamid) . Fermentation processes for demeclocycline preparation is described in U.S. Patent Nos. 3,01 2,946, 3,01 9, 1 72 and 3,050,446 (to Am. Cyanamid); Fr. pat. No. 1 ,344,645 (1 963 to Merck & Co.); and Neidleman, U.S. Patent No. 3, 1 54,476 ( 1 964 to Olin Mathieson). Demeclocycline hydrochloride is also available from Lederle Labs (Declomycin Tablets).
  • doxycycline is 4-(Dimethylamino)-1 ,4,4a,5,5a,6J 1 J 2a-octa- hydro-3,5 , 1 0J 2, 1 2a-pentahydroxy-6-methyl- 1 , 1 1 -dioxo-2- naphthacenecarboxamide monohydrate.
  • doxycycline examples include: ⁇ -6-deoxy-5-hydroxytetracycline monohydrate; ⁇ -6- deoxyoxytetracycline monohydrate; or 5-hydroxy- ⁇ -6-deoxytetracycline monohydrateGS-3065; Azudoxat; Doxitard; Doxy-Puren; Investin; Liviatin; Nordox; Spanor; Vibramycin; and Vibraven ⁇ s.
  • doxycycline is used herein, although the all such chemical synonyms are contemplated.
  • doxycycline hydrochloride Chemical synonyms of "doxycycline hydrochloride” include doxycycline hyclate, Diocimex, Doryx, Doxatet, Doxigalumicina, Doxy-ll (caps), Doxylar, Doxy-Tablinen, Doxytem, duradoxal, Ecodox, Granudoxy, Hydramycin, Liomycin, Mespafin, Midoxin, Nivocilin, Novadox, Retens, Roximycin, Samecin, Sigadoxin, Tanamicin, Tecacin, Tetradox, Vibradox, Vibramycin Hyclate, Vibra-Tabs and Zadorin.
  • Doxycycline can be prepared according to methods known in the art.
  • 6-doxytetracyclines can be prepared according to the procedures described in Wittenau et al., J. Am. Chem. Soc. 84:2645 ( 1 962); Stephens et al. J. Am. Chem. Soc. 85, 2643 ( 1 963); Blackwood et a/. , U.S. Patent No. 3,200,149 ( 1 965 to Pfizer).
  • Preparation, separation and configuration of 6 ⁇ - and 6/?-epimers are described in Wittenau et al. , J. Am. Chem. Soc. 84, 2645 ( 1 962); Stephens et a/. , ibid. 85, 2643 ( 1 963) .
  • Doxycycline calcium is available from Pfizer (Vibramycin Calcium Oral Suspension Syrup).
  • Doxycycline hyclate is available from Pfizer (Vibramycin Hyclate Capsules; Vibramycin Hyclate Intravenous; Vibra-Tabs Film Coated Tablets), from Warner Chilcott Professional Products (Doryx Coated Pellets), from Warner Chilcott (Doxycycline Hyclate Capsules) and from Mylan (Doxycycline Hyclate Capsules and Tablets).
  • Doxycycline monohydrate is available from Pfizer (Vibramycin Monohydrate for Oral Suspension) and from Oclassen (Monodox Capsules) .
  • methacycline is [4SJ4 ⁇ ,4a ⁇ ,5 ⁇ 7,5a ⁇ J 2a ⁇ )]-4-Di-methylamino- 1 ,4,4a,5,5a,6J 1 J 2a-octahydro-3,5J 0, 1 2J 2a-pentahydroxy-6-methylene- 1 J 1 -dioxo-1 -naphthacenecarboxamide.
  • Chemical synonyms of methacycline include 6-methyleneoxytetracycline, 6-methylene-5-hydroxytetracycline, metacycline and Bialatan. For purposes herein, the name "methacycline" , although all such chemical synonyms are contemplated.
  • methacycline hydrochloride Chemical synonyms of methacycline hydrochloride include Andriamicina, Ciclobiotic, Germiciclin, Globociclina, Megamycine, Metadomus, Metilenbiotic, Londomycin, Optimycin, Physiomycine, Rindex and Rondomycin.
  • Demeclocycline can be prepared according to methods known in the art.
  • methacycline can be prepared from oxytetracycline (Blackwood et al., J. Am. Chem. Soc. 83 2773 ( 1 961 ); 85, 3943 ( 1 963); and Blackwood, U.S.
  • minocycline is 4,7-Bis(dimethylamino)-1 ,4,4a,5,-5a,6J 1 J 2a- octahydro-3J 0J 2, 1 2a-tetrahydroxy-1 J 1 -dioxo-2-naphthacenecarboxamide.
  • Chemical synonyms of minocycline include 7-dimethylamino-6-demethyl-6- deoxytetracycline and Minocyn.
  • the name "minocycline” is used herein, but all such chemical synonyms are contemplated.
  • Chemical synonyms of minocycline hydrochloride include Minocin, Klinomycin, Minomycin and Vectrin.
  • Minocycline can be prepared according to methods known in the art.
  • minocycline can be prepared according to the procedures described in Boothe, Petisi, U.S. Patent Nos. 3, 1 48,21 2 and 3,226,436 ( 1 964 and 1 965 to
  • Minocycline hydrochloride is available from Medicis (Dynacin Capsules), from Lederle Labs (Minocin Intravenous; Minocin Oral Suspension; and Minocin Pellet-Filled Capsules) and from Warner Chilcott Professional Products (Vectrin Capsules).
  • oxytetracycline is 4-(Dimethylamino)-1 ,4,4a,5,-5a,6J 1 J 2a- octahydro-3,5,6, 10, 1 2, 1 2a-hexahydroxy-6-methyl-1 , 1 1 -dioxo-2- naphthacenecarboxamide.
  • Chemical synonyms of oxytetracycline include: glomycin; terr-fungine; riomitsin; hydroxytetracycline; Berkmycen; Biostat;
  • oxytetracycline is used, although all such chemical synonyms are contemplated.
  • Chemical synonyms of oxytetracycline dihydrate include Abbocin, Clinimycin and
  • Imperacin Chemical synonyms of oxytetracycline hydrochloride dihydrate include Alamycin, Aquacycline, Arcospectron, Bio-Mycin, Duphacycline, Geomycin, Gynamousse, Macocyn, Macodyn, Occrycetin, Oxlopar, Oxybiocycline, Oxybiotic, Oxycycline, Oxyject, Oxylag, Stecsolin, Tetra-Tablinen and Toxinal.
  • Oxytetracycline can be prepared according to methods known in the art.
  • oxytetracycline can be isolated from the elaboration products of the antinomycete, Streptomyces rimosus, grown on a suitable medium (Finlay et al.. Science 1 1 1 , 85 (1 950); Regna, Solomons, Ann. N. Y. Acad. Sci. 53, 221 ( 1 950); Regna et al., J. Am. Chem. Soc. 73, 421 1 ( 1 951 )), from Streptomyces rimosus (Sobin et a/. , U.S. Patent No. 2,516,080 ( 1 950 to Pfizer)), from S.
  • Oxytetracycline hydrochloride is available from Pfizer (Terra- Cortril Ophthalmic Suspension; Terramycin with Polymyxin B Sulfate Ophthalmic Ointment; and Urobiotic-250 Capsules).
  • Tetracycline is 4-dimethylamino)-1 ,4, 4a, 5, 5a, 6-1 1 J 2a- octahydro-3,6J 0J 2, 1 2a-pentahydroxy-6-methyl-1 J 1 -dioxo-2- naphthacenecarboxamide.
  • Chemical synonyms of tetracycline include deschlorobiomycin; tsiklomitsin; Abricycline; Achromycin; Agromicina; Ambramicina; Ambramycin; Bio-Tetra; Bristaciclina; Cefracycline suspension; Criseociclina; Cyclocmycin; Democracin; Hostacyclin; Omegamycin; Panmycin; Polycycline; Purocyclina; Sanclomycine; Steclin; Tetrabon; Tetracyn; Tetradecin.
  • the name "tetracycline" although the all such chemical synonyms are contemplated.
  • Chemical synonyms i.e. equivalents or generics tetracycline hydrochloride, include Achro, Achromycin V, Ala Tet, Ambracyn, Artomycin, Cefracycline tablets, Cyclopar, Diacycline, Dumocyclin, Helvecyclin, Imex, Mephacyclin, Partrex, Quadracycline, Quatrex, Remicyclin, Ricycline, Ro-cycline, Stilciclina, Subamycin, Supramycin, Sustamycin, Tefilin, Teline, Telotrex, Tetrabakat, Tetrabid, Tetrablet, Tetrachel, Tetracompren, Tetra-D, Tetrakap, Tetralution, Tetramavan, Tetramycin, Tetrosol, Tetra-Wedel, Topicycline, Totomycin, Triphacyclin, Unicin, Unimycin and Vetquamycin-324.
  • tetracycline phosphate complex Chemical synonyms of tetracycline phosphate complex include Panmycin Phosphate, Sumycin, Tetradecin Novum, Tetrex and Upcyclin.
  • tetracycline can be prepared according to methods known in the art.
  • tetracycline can be produced from Streptomyces spp. (Boothe et al. J. Am. Chem. Soc. 75, 4621 ( 1 953); Conover et a/. , ibid. 4622; and Conover, U.S. Patent No. 2,699,054 ( 1 955)), from Streptomyces viridifaciens (Gourevitch, et a/. , U.S. U.S.
  • Patent Nos. 2,71 2,51 7; 2,886,595 ( 1 955, 1 959 to Bristol Labs)), from S. aureofaciens (U.S. Patent Nos. 3,005,023; 3,01 9, 1 73).
  • Purification of tetracycline is described, for example, in U.S. Patent No. 3,301 ,899.
  • Preparation of tetracycline phosphate complex is described in Seiger, Weidenheimer, U.S. Patent No. 3,053,892 (1 962 to Am. Cyanamid).
  • Total synthesis of tetracy- dines is described in Boothe et a/., J. Am. Chem. Soc. 81 , 1 006 ( 1 959);
  • Tetracycline hydrochloride is available from Lederle Labs (Achromycin V Capsules), from Procter & Gamble Pharmaceutical (Helidac Therapy), from Lederle Standard (Tetracycline HCl Capsules) and from Mylan (Tetracycline Hydrochloride Capsules). Soluble tetracycline is preferred.
  • tetracyclines include, but are not limited to, dedimethylaminotetra- cyclines, which include 4-dedimethylaminotetracycline, 4-dedimethylamino-5- oxytetracycline, 4-dedimethylamino-7-chlortetracycline, 4-hydroxy-4-dedimethyl- aminotetracycline, 5a, 6-anhydro-4hydroxy-4-dedimethylaminotetracycline, 6 ⁇ - deoxy-5-hydroxy-4-dedimethylaminotetracycline, 6-demethyl-6-deoxy-4-dedi- methylaminotetracycline, 4-dedimethylamino-1 2a-deoxytetracycline, 4-dedi- methylamino-1 1 -hydroxy-1 2a-deoxytetracycline, 1 2a-deoxy-4-deoxy-4-dedi- methylaminotetracycline, 6 ⁇ -deoxy-5-hydroxy-4-dedimethylaminod
  • tetracyclines contemplated for use herein, include but are not limited to, 6a-benzylthiomethylenetetracycline, the 2-nitrilo analogs of tetracycline (tetracyclinonitrile), the mono-N-alkylated amide of tetracycline, 6-fluoro-6-demethyltetracycline, 1 1 a-chlortetracycline, tetracycline pyrazole and 1 2a-deoxytetracycline and its derivatives (see, e.g. , U.S. Patent No. 5,532,227).
  • CMT's include, but are not limited to for example, 4-de(dimethylamino)tetracyciine (CMT-1 ), tetracyclinonitrile (CMT-2), 6-demethyl-6-deoxy-4-de(dimethylamino)tetracycline (CMT-3), 7-chloro-4-de(dimethylamino)tetracycline (CMT-4), tetracycline pyrazole (CMT-5), 4-hydroxy-4-de(dimethylamino)tetracycline (CMT-6), 4- de(dimethylamino)-1 2.alpha.-deoxytetracycline (CMT-7), 6-deoxy-5. alpha.
  • CMT-1 4-de(dimethylamino)tetracyciine
  • CMT-2 tetracyclinonitrile
  • CMT-3 6-demethyl-6-deoxy-4-de(dimethylamino)tetracycline
  • CMT-4 tetracycline
  • tetracyclines modified for reduced antimicrobial activity include the 4-epimers of oxytetracycline and chlortetracycline (epi-oxytetracycline and epi- chlortetracycline).
  • C.multidot.4-position useful as antimicrobial agents.
  • 4-dedimethylaminotetracyclines derivatives include 5-Ozytetracycline, 7- Chlortetracycline, 6-Deoxy-5-oxytetracycline, 6-Deoxytetracycline, 6-Deoxy-6- demethyltetracycline, 7-Bromotetracycline, 6-Demethyl-7-chlortetracycline, 6- Demethyltetracycline, 6-Methylenetetracycline, 1 1 a-Chioro-6-methylenetetracy- cline, 6-Methylene-5-oxytetracycline and 1 1 a-Chloro-6-methylene-5-oxytetracy- cline (see, e.g. , U.S. Patent No. 4,066,694).
  • Aqueous solutions of chlortetracycline or salts thereof, a pharmaceutically acceptable calcium compound and 2-pyrrolidone as a co-solvent, where the solution has a pH of 8 to 1 0 is used as an injectable composition combining low viscosity, high potency, good clarity and good stability (see, U.S. Patent No. 4,081 ,527).
  • the tetracycline compounds and formulations that can be used in herein include those compounds or formulations described in the following U.S. Patent Nos. or those compounds or formulations that can be prepared according to the processes described in the following U.S. Patent Nos.
  • 4,386,083 Injectable oxytetracycline compositions); 4,259,331 (Oxytetracycline compositions); 4,020, 1 62 (Oxytetracycline solution for parenteral, peroral and local administration and processes for the production thereof); 4,01 8,889 (Oxytetracycline compositions); 3,962,435 (Combination of oxytetracycline and 2,4-diamino-5-(3-alkoxy-4,5-methylenedioxybenzyl)pyrimidine); 3,962, 1 31 (Rhodium containing catalyst and use thereof in preparation of 6-deoxy-5- oxytetracycline); 3,957,972 (Stable solutions of oxytetracycline suitable for parenteral and peroral administration and process of preparation); 5,258,372 (Tetracycline activity enhancement using doxycycline or sancycline); 4,086,332 (Doxycycline compositions); 4,061 ,676 (Recovery of doxy
  • composition stably containing minocycline for treating periodontal diseases Composition stably containing minocycline for treating periodontal diseases.
  • the immune response to hemorrhagic viral infection appears to follow the a scheme that includes: viral activation of macrophages, T and B lymphocytes; production of mediators by mononuclear cells, including cytokines such as, interleukin (IL)-1 and IL-2, interferon (IFN), and/or tumor necrosis factor (TNF); changes of the proliferative activity of the cells; alterations of lymphocyte subpopulations (CD4 and CD8); and propagation of virus in immunocompetent cells.
  • cytokines such as, interleukin (IL)-1 and IL-2, interferon (IFN), and/or tumor necrosis factor (TNF)
  • IFN interferon
  • TNF tumor necrosis factor
  • a decrease of lymphocyte proliferative activity in response to mitogen stimulation, a decrease of the number of T and B lymphocytes, and an inversion of CD4 ⁇ CD8 lymphocyte ratios (Fisher-Hoch et al., J. Infect. Dis. , 1 55:465-474 ( 1 987); Vallegos et al., Medicina (wholesome-Aries), 45 :407 ( 1 985); Enria et al., Med. Microbiol. Immunol. , 1 75: 1 73-1 76 ( 1 986)) have been demonstrated in arenaviral hemorrhagic fevers.
  • TNF- ⁇ is one of several cytokines typically secreted by macrophages (Feldmann et al., J. Virol. , 70:2208-2214 ( 1 996)) . Infection of monkeys with Ebola virus was also accompanied by increased serum TNF- ⁇ levels (Ignatyev, Curr. Top. Microbiol. Immunol. , 235 :205-21 7 ( 1 999)).
  • compositions and method provided herein provide a means to treat infections with hemorrhagic viruses.
  • the blood-derived compositions which can be readily produced by contacting blood from a donor in vitro or in vivo with a tetracycline and tetracycline-like compound, and then harvesting, preferably serum or plasma, which can be infused into the mammal with the infection, is effective for treatment.
  • the response in the donor blood or fraction thereof can be observed as quickly as six hours after administration of the tetracycline and tetracycline-like compound or contacting with the blood.
  • the infected mammal can also be treated with a tetracycline and tetracycline-like compounds prior to administration of the blood-derived composition, simultaneously and/or subsequently. Additional anti-hemorrhagic viral treatments and agents may also be administered.
  • Blood-derived compositions for administration preferably for systemic administration, for treatment of acute inflammatory responses are provided. These are preferably provided in a form for systemic, such as intraperitoneal or intravenous administration. They may be concentrated or diluted by standard methods; preferably they are not subjected to freeze-drying. Combinations of the blood-derived compositions with tetracycline and/or tetracycline-like compounds are also provided. These combinations may be packaged as kits and are intended for treatment of the acute inflammatory responses.
  • tetracycline and tetracycline-like compounds are also provided for treatment of the viral hemorrhagic diseases and also bacterial infections, such as E. coli, and tetracycline and tetracycline-like compounds, and also combinations of a composition containing one or more tetracycline compound(s) and a composition containing an anti-viral-hemorrhagic agent, preferably in a pharmaceutically acceptable carrier or excipient.
  • the tetracycline compound(s) and anti-viral-hemorrhagic agent are packaged as separate compositions for administration together or sequentially or intermittently. Alternatively, they can be contained in a single composition for administration as a single composition.
  • the combinations can be packaged as kits.
  • a composition suitable for oral delivery includes one or more tetracycline compounds and an anti-viral-hemorrhagic agent, and a pharmaceutically acceptable carrier or excipient in tablet, capsule, or other single unit dosage form is provided.
  • Suitable anti-viral hemorrhagic agents are described in the following section.
  • tetracycline and tetracycline-like compounds and the blood-derived compositions provided herein can be administered alone or in combination with other agents, such as IL-1 inhibitors and/or TNF inhibitors, appropriate vaccines and other drugs for treatment of acute inflammatory diseases and disorders.
  • agents such as IL-1 inhibitors and/or TNF inhibitors, appropriate vaccines and other drugs for treatment of acute inflammatory diseases and disorders.
  • IL-1 inhibitor that prevents or decreases production, post-translational modification(s), maturation, or release of IL-1, or any substances that interfere with or decrease the efficacy of the interaction between IL-1 and IL-1 receptor is contemplated for use in combination with the tetracycline and tetracycline-like compounds and/or the blood-derived compositions.
  • the IL-1 inhibitor is an anti-IL-1 antibody, an anti-IL-1 receptor antibody, an IL-1 receptor antagonist, an IL-1 production inhibitor, an IL-1 receptor production inhibitor and an IL-1 releasing inhibitor.
  • Monoclonal antibodies, particurlarly humanized antibodies are preferrred.
  • Anti-IL-1 antibodies are known (see, e.g., U.S. Patent Nos.4,772,685 and 4,994,553). Anti-IL-1 receptor antibodies are also known (see, e.g., Chen et al.. Cancer Res., 58(16): 3668-76 (1998); Clark et al., J. Interferon Cytokine Res., 16(12): 1079-88 (1996); Zerek-Melen et al., Eur. J. Endocrinol., 131(5): 531-4 (1994); McNamara et al., J. Exp. Med., 173(4):931-9 (1991); Benjamin et al., Prog. Clin. Biol. Res., 349:355-63 (1990) are used.
  • An IL-1 receptor antagonist can be an IL-1 receptor antagonist (IL-1Ra; see, e.g., SEQ ID No.5; see, also U.S. Patent Nos.5,863,769, 5,837,495, 5,739,282, 5,508,262, 5,455,330, 5,334,380, Bendele et al., Arthritis Rheum., 42(3):498-506 (1999); Kuster et al., Lancet, 352(9136):1271-7 (1998); Bendele et al., J. Lab. Clin.
  • IL-1Ra IL-1 receptor antagonist
  • IL-1 receptor intracellular ligand proteins see, e.g., SEQ ID Nos.6, 7, 8 and 9; see also U.S. Patent No.5,817,476), such as type II IL-1 receptor (see, e.g., SEQ ID No.4; see, also U.S.
  • Patent Nos.5,464,937 and 5,350,683) or soluble IL-1 receptors are contemplated.
  • Soluble receptors contain residues 1-312, 1-314, 1-315, 1-316, 1-317, 1-318 and 1- 319 of the full-length receptor for which sequence is set forth in SEQ ID No.3 or 4) .
  • Non-functional muteins of IL-1 can be used (e.g.
  • the small molecule IL-1 receptor antagonist can be a histamine antagonist (see, e.g. , U.S. Patent No. 5,658,581 ), an aryl-or heteroaryl-1 -alkyl-pyrrole-2-carboxylic acid compound (see, e.g. , U.S. Patent Nos. 5,039,695 and 5,041 ,554) or a 5- lipoxygenase pathway inhibitor (U.S. Patent No. 4,794, 1 14).
  • a histamine antagonist see, e.g. , U.S. Patent No. 5,658,581
  • an aryl-or heteroaryl-1 -alkyl-pyrrole-2-carboxylic acid compound see, e.g. , U.S. Patent Nos. 5,039,695 and 5,041 ,554
  • a 5- lipoxygenase pathway inhibitor U.S. Patent No. 4,794, 1 14
  • the IL-1 inhibitor can be an IL-1 production inhibitor, such as an antisense oligonucleotide (see, e.g. , Yahata et al., Antisense Nucleic Acid Drug Dev. , 6111:55-6 ( 1 996); Fujiwara et al., Cancer Res.. 52( 1 8): 4954-9 ( 1 992); see, also SEQ ID. No. 10, which sets forth an exemplary anti-sense oligonucleotide specific for ⁇ _- ⁇ ; and Maier et al., Science, 249: 1 570-4 (1 990); SEQ ID No.
  • the IL-1 production inhibitor can be a small molecule inhibitor, such as 5- hydroxy and 5-methoxy 2-amino-pyrimidine (see, e.g. , U.S. Patent No. 5,071 ,852), 3-substituted-2-oxindole-1 -carboxamide (see, e.g. , U.S. Patent Nos. 4,861 ,794 and 5, 1 92,790), 4,5-diaryl-2(substituted)imidazole (see, e.g. , U.S. Patent No.
  • the IL-1 inhibitor can be an IL-1 receptor production inhibitor, such as an antisense oligonucleotide (see, e.g. , SEQ ID No. 1 2, which provides an antisense oligonucleotide designated ISIS 8807; see, also Miraglia et al., Int. J. Immunopharmacol. , 1 8(4):227-40 ( 1 996); the oligonucleotide set forth in SEQ ID No. 1 3; and Burch et al., J. Clin. Invest , 88(4): 1 1 90-6 (1 991 )) can be used.
  • the IL-1 inhibitor can be an IL-1 releasing inhibitor, such as an IL-1 converting enzyme inhibitor e.g.
  • N-substituted glutamic acid derivative see, U.S. Patent No. 5,744,451 ), -pyrone-3-acetic acid (U.S. Patent No. 5,41 1 ,985), probucol (U.S. Patent No. 4,975,467), disulfiram, tetrakis [3-(2,6- di-tert-butyl-4-hydroxyphenyl)propionyloxy methyl]methane or 2,4-di-isobutyl-6- (N,N-dimethylaminomethyl)-phenol (U.S. Patent No.
  • IL-1 inhibitors may also be used (see, e.g., U.S. Patent No. 5,804,599 (Interleukin-1 production inhibiting compound), U.S. Patent No. 5,453,490 (Recombinant human interleukin-1 inhibitors), U.S. Patent No. 5,334,380 (Anti-endotoxin, interleukin-1 receptor antagonist), U.S. Patent No. 5,075,222 (Interleukin-1 inhibitors), U.S. Patent No. 5,034,412 (Interleukin-1 release inhibitors), U.S. Patent No.5,011,857 (Interleukin-1 release inhibitors), U.S.
  • TNF inhibitors may also be used. These may be used in place of or in addition to 11-1 inhibitors. Any inhibitor of TNF activity is contemplated for use herein.
  • anti-TNF antibodies anti-TNF receptor antibodies, TNF receptor antagonists, TNF production inhibitors, TNF receptor production inhibitors and a TNF releasing inhibitors.
  • the anti-TNF antibody or the anti-TNF receptor antibody can be a monoclonal antibody, which is preferably, humanized.
  • Such antibodies are known (e.g., the anti-TNF antibodies Mabp55r and Mabp75r (Tanaka et al., Neurol. Med. Chir. (Tokyo), 38(12):812-818 (1998)), 3B10 and h3B10-9 (Nagahira et al., J. Immunol.
  • the TNF receptor antagonist can be a purified soluble TNF receptor, a non-functional mutein of TNF receptor, a non-functional mutein of TNF and a small molecule antagonist.
  • Non-functional muteins of TNF receptor are known (see, e.g., U.S. Patent Nos.5,863,786, 5,773,582, 5,606,023, 5,597,899, 5,519,119, 5,486,463, 5,422,104, 5,247,070 and 5,028,420).
  • Small molecule antagonists such as a mercapto alkyl peptidyl compound (see, e.g., U.S.
  • Patent No.5,872,146 an arylsulfonyl hydroxamic acid derivative (U.S. Patent No. 5,861,510), a salt of an alkaline-earth metal (U.S. Patent No.5,851 ,556), a pentoxifylline (U.S. Patent No.5,763,446), a hydroxamic acid compound (U.S. Patent No.5,703,092), a retinoic acid (U.S. Patent No.5,658,949), a histamine antagonist (U.S. Patent No.5,658,581), a leflunomide (U.S. Patent No.
  • the TNF receptor antagonist can be a TNF receptor death domain ligand protein, a tumor necrosis factor binding protein (TNF-BP), a TNF receptor-lgG heavy chain chimeric protein (Peppel et al., J. Exp. Med., 174(6):1483-9 (1991)), a bacterial lipopolysacchande biding peptide derived from CAP37 protein (U.S. Patent No.5,877,151) and a Myxoma virus T2 protein (Schreiber et al., J. Biol. Chem., 271 (23):13333-41 (1996)).
  • TNF receptor death domain ligand proteins include those described in U.S. Patent Nos.
  • TNF-BPs described in U.S. Patent No. 5,81 1 ,261 which describes TBP-1 a 1 80 amino acid protein isolated from human urine
  • U.S. Patent Nos. 5,808,029, 5,776,895, 5,750,503 which describe chimeric TNF-BPs containing the soluble portion of the P55 TNF receptor and all but the first domain of the constant region of IgG 1 or lgG3 heavy chains
  • the TNF inhibitor can be an TNF production inhibitor, such as an antisense oligonucleotide (see, e.g. , SEQ ID No. 22; see, also U.S. Patent No. 5,705,389).
  • TNF production inhibitors are known (see, e.g. , U.S. Patent No. 5,776,947 (quinoline-3-carboxamide compounds), U.S. Patent No. 5,691 ,382 (matrix metaloproteinase inhibitors), U.S. Patent No. 5,648,359, U.S. Patent No. 5,61 6,490 (ribozymes targeted to TNF ⁇ RNA), U .S. Patent Nos. 5,304,634, 5,420, 1 54 and 5,547,979 (derivatives of 2-pyrrolidinones) .
  • TNF receptor production inhibitor include antisense oligonucleotides.
  • the TNF inhibitor can be a TNF releasing inhibitor (see, e.g. , U.S. Patent No. 5,869,51 1 (isoxazoline compounds), U.S. Patent No. 5,563, 143 (catechol diether compounds), and U.S. Patent No. 5,629,285 (peptidyl derivatives having active groups capable of inhibiting TACE such as, hydroxamates, thiols, phosphoryls and carboxyls)
  • TNF inhibitors are contemplated (see, e.g. , U.S. Patent No. 5,886,010 (TNF ⁇ inhibitors), U.S. Patent No. 5,753,628 (peptide inhibitors of TNF containing predominantly D-amino acids), U.S. Patent No. 5,695,953 (DNA that encodes a tumor necrosis factor inhibitory protein), U.S. Patent No. 5,672,347 (tumor necrosis factor antagonists), U.S. Patent No. 5,582,998 (monoclonal antibodies against human TNF-BP I), U.S. Patent No. 5,478,925 (multimers of the soluble forms of TNF receptors), U.S. Patent No.
  • the tetracycline or tetracycline-like compounds and/or blood-derived composition may be administered in combination with an anti-viral vaccine, antibody and/or virally activated immune cells or serum.
  • Exemplary anti-viral treatments are agents include but are not limited to the following.
  • Anti-viral vaccines can be prepared according to the methods known in the art (see Current Protocols in Immunology (Ed. Coligan et al.) John Wiley & Sons, Inc., 1 997) . Any types of vaccines, including attenuated viruses, protein or peptide vaccines or nucleotide vaccines can be used. (a) Anti-Bunyaviridaea Vaccine
  • An anti-Bunyaviridaea vaccine preferably, an anti-Hantaan virus vaccine
  • an anti-Hantaan virus vaccine see, e.g. , U.S. Patent No. 5,298,423 (nucleotide sequences coding for Hantaan virus nucleocapsid protein and glycoproteins G 1 and G2), U.S. Patent No. 5, 1 83,658 (the purified and inactivated Hantaan virus ROK84/105), Chu, et al., J. Virol. , 69( 1 0):641 7-23 (1 995) (a vaccinia virus-vectored vaccine expressing the M and the S segments of Hantaan (HTN) virus)) can be used.
  • An anti-Filoviridae vaccine such as an anti-ebola virus vaccine is used (e.g., the vaccines described in Chupurnov, et al., Vopr. Viruso/., 40(6):257-60 (1995) (inactivated viral agents (Nonlethal strain of the virus)), Lupton, et al., Lancet, 2(8207):1294-5 (1980) (inactivated vaccine) and Sergeev, et al., Vopr. Viruso/., 42(5):226-9 (1997) (immunomodifiers ridostin, reaferon, and polyribonate)) are used.
  • an anti-Marburg virus vaccine is used (e.g., the vaccines described in Hevey, et al., Virology, 239(1 ):206-16 (1997) (Baculovirus recombinants were made to express the MBGV glycoprotein (GP) either as a full- length, cell-associated molecule or a slightly truncated (5.4%) product secreted into medium; and killed (irradiated) MBGV antigen)) can be used.
  • GP MBGV glycoprotein
  • An anti-Flaviviridae vaccine such as an anti-dengue virus vaccine
  • an anti-dengue virus vaccine can be used (e.g., U.S. Patent No.5,494,671, Becker, Virus Genes, 9111:33-45 (1994) (dengue fever virus and Japanse encephalitis virus synthetic peptides with motifs to fit HLA class I haplotypes), Blok, et al.. Virology., 187(2):573-90 (1992) (dengue-2 virus vaccine), Dharakul, et al., J. Infect.
  • Anti-Arenaviridae vaccine such as, an anti-Junin virus vaccine (e.g., vaccines described in Boxaca, et al., Medicina (B Aires), 41(4):25-34 (1981) (Variant XJO of Junin virus), Contigiani, et al., Acta Virol., 37(1):41-6 (1993) (Candid 1 attenuated strain of Junin virus), Coto, et al., J Infect Dis., 141 (3):389-93 (1980) (Protection of guinea pigs inoculated with Tacaribe virus against lethal doses of Junin virus), de Guerrero, et al., Acta Virol., 29(4):334-7 (1985) (attenuated XJO Junin virus (JV) strain), Ghiringhelli, et al., Am J Trop Med Hyg., 56(2):216-25 (1997) (Junin virus vaccine
  • an anti-Junin virus vaccine e.
  • An anti-lassa vaccine can be used (e.g. , vaccines described in Auperin, et al., Virus Res., 9(2-3):233-48 (1988) (a recombinant vaccinia virus expressing the Lassa virus glycoprotein gene), Fisher-Hoch, et al., Proc Natl Acad Sci USA, 86(1):317-21 (1989) (a recombinant vaccinia virus expressing the Lassa virus glycoprotein gene), Kiley, et al., Lancet, 2(8145):738 (1979) (Immunization with closely related Arenavirus), Morrison, et al., Virology, 171 (1 ):179-88 (1989) (Vaccinia virus recombinants expressing the nucleoprotein or the envelope glycoproteins of Lassa virus)).
  • An anti-Machupo virus vaccine (see, e.g., Eddy, et al., Bull World Health Organ., 52(4-6):723-7 (1975)) can be used.
  • Anti-viral antibodies can be prepared according to the methods known in the art (see Current Protocols in Immunology (Ed. Coligan et al.) John Wiley & Sons, Inc., 1997). Any types of antibodies, including polyclonal, monoclonal, humanized, Fab fragment, (Fab) 2 fragment and Fc fragment, can be used. In a specific embodiment, a monoclonal anti-viral antibody is used. Preferably, the monoclonal antibody is humanized. Also preferably, an IgG or IgM anti-viral antibody is used.
  • an anti-Bunyaviridaea antibody such as an anti-Hantaan virus antibody can be used (see, e.g. , Kikuchi, et al., Arch. Virol. , 143(1 ):73-83 (1 998) (Neutralizing monoclonal antibody (MAb) to envelope protein G 1 ( 1 6D2) and G2 ( 1 1 E1 0)), Liang, et al., Virology, 21 7( 1 ):262-71 ( 1 996) (MAb to G2(HC02)).
  • MAb Neutralizing monoclonal antibody
  • an anti-Filoviridae antibody such as an anti-ebola virus antibody can be used (see, e.g. , the following Genbank accession numbers for suitable antigenic proteins: 1 EBOA-1 EBOF, AAD 1 4582-AAD14590, AAC57989-AAC57993, AAC54882-AAC54891 , AAC24345-AAC24346, AAC09342, CAA47483, AAB81 001 -AAB81007, S231 55, VHIWEB, S32584-S32585, AAB37092- AAB37097, AAA96744-AAA96745, AAA79970, CAA43578-CAA43579 and AAA42976-AAA42977, and for nucleic acids: AF086833, U77384-U77385, U81 1 6-U2341 7, U231 87, U231 52, U23069, AF034645,
  • An anti-Marburg antibody can be used.
  • the antibodies can be raised against Marburg virus protein sequences with the following Genbank accession numbers are used: AAC40455-AAC40460, VHIWMV, RRIWMV, S44052- S44053, S3331 6, S32582-S32583, A45705, B45705, S44049, S44054, CAA781 14-CAA781 20, CAA82536-CAA82542, CAA45746-CAA45749, CAA48507-CAA48509 and AAA46562-AAA46563 or encoded by nucleic acid molecules containing nucleotide sequences with the following Genbank accession numbers are used: AF005730-AF005735, Z1 21 32, Z29337, X64405- X64406, X68493-X68495, M72714, M92834 and M36065.
  • Genbank accession numbers are used: AF005730-AF005735, Z1 21
  • An anti-Flaviviridae antibody such as an anti-Dengue virus antibody is used (see, e.g., Bhoopat, et al., Asian Pac. J. Allergy Immunol., 14(2):107-13 (1996), Hiramatsu, et al.. Virology., 224(2):437-45 (1996) (mAb3H5), Roehrig, etal., Virology, 246(2):317-28 (1998) (Murine monoclonal antibodies (MAbs) specific for the envelope (E) glycoprotein of DEN 2 virus: Domains A and B), Tadano, et al., J. Gen.
  • An anti-Arenaviridae antibody such as an anti-Junin virus antibody can be used (see, e.g., the antibodies described in Mackenzie, et al., Am. J. Trop. Med. Hyg., 14(6):1079-84 (1965)).
  • An anti-Lassa antibody can be used (see, e.g. , the antibodies described in Kunitskaia, et al., Zh Mikrobiol Epidemiol Immunobiol., 3:67-70 (1991) and Schmitz, et al., Med. Microbiol. Immunol. (Berl)., 175(2-3):181-2 (1986)).
  • An anti-Machupo antibody can be used (see, e.g., Mackenzie, et al., Am. J. Trop. Med. Hyg., 14(61:1079-84 (1965)).
  • Viral-activated immune cell and serum Viral-activated immune cells and sera can be prepared according to the methods known in the art (see Current Protocols in Immunology (Ed. Coligan et al.) John Wiley & Sons, Inc., 1997).
  • the cells that can be used for treatment are virally-activated cytotoxic cells (see, Asada, et al., J. Gen. Virol., 68(71:1961-9 (1987) (Adoptive transfer of immune serum or immune T cells for treating Hantaan virus); Nakamura, et al., J. Infect.
  • Small molecule anti-viral agents Any small molecule anti-viral agents, when used alone or in combination with other compounds, that can alleviate, reduce, ameliorate, prevent, or place or maintain in a state of remission of clinical symptoms or diagnostic markers associated with viral hemorrhagic diseases or disorders, particularly those viral hemorrhagic diseases or disorders caused by infection of a Bunyaviridaea, a Filoviridae, a Flaviviridae, or an Arenaviridae virus, can be used in the present combinations and methods.
  • glycyrrhizinic acid and its derivatives for inhibition of Marburg virus reproduction (Pokrovskii, et al., Dokl Akad Nauk. , 344(5):709-1 1 ( 1 995)), Ribavirin (e.g. , Ribavirin 2', 3', 5'-triacetate) for Inhibition of dengue virus (Koff, et al., Antimicrob. Agents Chemother. , 24( 1 ) : 1 34-6 ( 1 983)), Ribavirin for inhibition of lassa virus (Robling, et al., J. Infect. Dis. , 1 41 (5):580-9 ( 1 980)), and Desferal (e.g.
  • the compounds, blood-derived compositions and agents are preferably formulated as pharmaceutical compositions, preferably for single dosage administration.
  • concentrations of the compounds in the formulations or the protein concentration of the blood-derived composition are selected to be effective for delivery of an amount, upon administration, that is effective for the intended treatment.
  • the compositions are formulated for single dosage administration.
  • composition the weight fraction of a compound or mixture thereof is dissolved, suspended, dispersed or otherwise mixed in a selected vehicle at an effective concentration such that the treated condition is relieved or ameliorated.
  • Pharmaceutical carriers or vehicles suitable for administration of the compounds provided herein include any such carriers known to those skilled in the art to be suitable for the particular mode of administration.
  • Effective concentration of the blood-derived compositions can be empirically determined. Plasma and serum may be administered without further processing or processed according to known methods.
  • the compounds may be formulated as the sole pharmaceutically active ingredient in the composition or may be combined with other active ingredients.
  • Liposomal suspensions including tissue-targeted liposomes, may also be suitable as pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art. For example, liposome formulations may be prepared as described in U.S. Patent No. 4,522,81 1 .
  • the active compound is included in the pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect in the absence of undesirable side effects on the patient treated.
  • the therapeutically effective concentration may be determined empirically by testing the compounds in known in vitro and in vivo systems, such as the assays provided herein.
  • the concentration of active compound in the drug composition will depend on absorption, inactivation and excretion rates of the active compound, the physicochemical characteristics of the compound, the dosage schedule, and amount administered as well as other factors known to those of skill in the art.
  • a therapeutically effective dosage may be on the order of 0.001 to 1 mg/ml, preferably about 0.005- 0.05 mg/ml, more preferably about 0.01 mg/ml, of blood volume
  • Pharmaceutical dosage unit forms are prepared to provide from about 1 mg to about 1000 mg and preferably from about 10 to about 500 mg, more preferably about 25-75 mg of the essential active ingredient or a combination of essential ingredients per dosage unit form. The precise dosage can be empirically determined.
  • the active ingredient may be administered at once, or may be divided into a number of smaller doses to be administered at intervals of time. It is understood that the precise dosage and duration of treatment is a function of the disease being treated and may be determined empirically using known testing protocols or by extrapolation from jn vivo or jn vitro test data. It is to be noted that concentrations and dosage values may also vary with the severity of the condition to be alleviated. It is to be further understood that for any particular subject, specific dosage regimens should be adjusted over time according to the individual need and the professional judgment of the person administering or supervising the administration of the compositions, and that the concentration ranges set forth herein are exemplary only and are not intended to limit the scope or use of the claimed compositions and combinations containing them.
  • Preferred pharmaceutically acceptable derivatives include acids, salts, esters, hydrates, solvates and prodrug forms. The derivative is typically selected such that its pharmacokinetic properties are superior to the corresponding neutral compound.
  • compositions are mixed with a suitable pharmaceutical carrier or vehicle for systemic, topical or local administration to form pharmaceutical compositions.
  • a suitable pharmaceutical carrier or vehicle for systemic, topical or local administration to form pharmaceutical compositions.
  • Compounds are included in an amount effective for ameliorating or treating the disorder for which treatment is contemplated.
  • concentration of active compound in the composition will depend on absorption, inactivation, excretion rates of the active compound, the dosage schedule, amount administered, particular formulation as well as other factors known to those of skill in the art.
  • Solutions or suspensions used for parenteral, intradermal, subcutaneous, or topical application can include any of the following components: a sterile diluent, such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene glycol or other synthetic solvent; antimicrobial agents, such as benzyl alcohol and methyl parabens; antioxidants, such as ascorbic acid and sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid (EDTA); buffers, such as acetates, citrates and phosphates; and agents for the adjustment of tonicity such as sodium chloride or dextrose.
  • a sterile diluent such as water for injection, saline solution, fixed oil, polyethylene glycol, glycerine, propylene glycol or other synthetic solvent
  • antimicrobial agents such as benzyl alcohol and methyl parabens
  • antioxidants such as ascorbic acid and sodium bisul
  • Parenteral preparations can be enclosed in ampules, disposable syringes or single or multiple dose vials made of glass, plastic or other suitable material.
  • methods for solubilizing compounds may be used. Such methods are known to those of skill in this art, and include, but are not limited to, using cosolvents, such as dimethylsulfoxide (DMSO), using surfactants, such as Tween ® , or dissolution in aqueous sodium bicarbonate.
  • cosolvents such as dimethylsulfoxide (DMSO)
  • surfactants such as Tween ®
  • dissolution in aqueous sodium bicarbonate such as sodium bicarbonate
  • Derivatives of the compounds, such as prodrugs of the compounds may also be used in formulating effective pharmaceutical compositions.
  • compositions are formulated in an ophthalmically acceptable carrier.
  • local administration either by topical administration or by injection is preferred .
  • Time release formulations are also desirable.
  • the compositions are formulated for single dosage administration, so that a single dose administers an effective amount.
  • the resulting mixture may be a solution, suspension, emulsion or other composition.
  • the form of the resulting mixture depends upon a number of factors, including the intended mode of administration and the solubility of the compound in the selected carrier or vehicle.
  • pharmaceutically acceptable salts or other derivatives of the compounds may be prepared.
  • the compound is included in the pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect in the absence of undesirable side effects on the patient treated. It is understood that number and degree of side effects depends upon the condition for which the compounds are administered. For example, certain toxic and undesirable side effects are tolerated when treating life-threatening illnesses that would not be tolerated when treating disorders of lesser consequence.
  • the concentration of compound in the composition will depend on absorption, inactivation and excretion rates thereof, the dosage schedule, and amount administered as well as other factors known to those of skill in the art.
  • the compounds can also be mixed with other active materials, that do not impair the desired action, or with materials that supplement the desired action, such as cardiovascular drugs, antibiotics, anticoagulants and other such agents known to those of skill in the art for treating hemorrhagic viral infections, shock, infection, trauma and other disorders for which the treatments provided herein are contemplated.
  • the resulting mixture may be a solution, suspension, emulsion or the like.
  • the form of the resulting mixture depends upon a number of factors, including the intended mode of administration and the solubility of the compound in the selected carrier or vehicle.
  • the effective concentration is sufficient for ameliorating the symptoms of the disease, disorder or condition treated and may be empirically determined.
  • the formulations of the compounds and agents for use herein include those suitable for oral, rectal, topical, inhalational, buccal (e.g. , sublingual), parenteral (e.g. , subcutaneous, intramuscular, intradermal, or intravenous), transdermal administration or any route. The most suitable route in any given case will depend on the nature and severity of the condition being treated and on the nature of the particular active compound which is being used.
  • the formulations are provided for administration to humans and animals in unit dosage forms, such as tablets, capsules, pills, powders, granules, sterile parenteral solutions or suspensions, and oral solutions or suspensions, and oil-water emulsions containing suitable quantities of the compounds or pharmaceutically acceptable derivatives thereof.
  • the pharmaceutically therapeutically active compounds and derivatives thereof are typically formulated and administered in unit-dosage forms or multiple-dosage forms.
  • Unit-dose forms as used herein refers to physically discrete units suitable for human and animal subjects and packaged individually as is known in the art. Each unit-dose contains a predetermined quantity of the therapeutically active compound sufficient to produce the desired therapeutic effect, in association with the required pharmaceutical carrier, vehicle or diluent.
  • unit-dose forms include ampoules and syringes and individually packaged tablets or capsules. Unit-dose forms may be administered in fractions or multiples thereof.
  • a multiple-dose form is a plurality of identical unit-dosage forms packaged in a single container to be administered in segregated unit-dose form. Examples of multiple-dose forms include vials, bottles of tablets or capsules or bottles of pints or gallons. Hence, multiple dose form is a multiple of unit-doses which are not segregated in packaging.
  • the composition can contain along with the active ingredient: a diluent such as lactose, sucrose, dicalcium phosphate, or carboxymethylcellulose; a lubricant, such as magnesium stearate, calcium stearate and talc; and a binder such as starch, natural gums, such as gum acaciagelatin, glucose, molasses, polvinylpyrrolidine, celluloses and derivatives thereof, povidone, crospovidones and other such binders known to those of skill in the art.
  • a diluent such as lactose, sucrose, dicalcium phosphate, or carboxymethylcellulose
  • a lubricant such as magnesium stearate, calcium stearate and talc
  • a binder such as starch, natural gums, such as gum acaciagelatin, glucose, molasses, polvinylpyrrolidine, celluloses and derivatives thereof, povidone, crospovidones and
  • Liquid pharmaceutically administrable compositions can, for example, be prepared by dissolving, dispersing, or otherwise mixing an active compound as defined above and optional pharmaceutical adjuvants in a carrier, such as, for example, water, saline, aqueous dextrose, glycerol, glycols, ethanol, and the like, to thereby form a solution or suspension.
  • a carrier such as, for example, water, saline, aqueous dextrose, glycerol, glycols, ethanol, and the like, to thereby form a solution or suspension.
  • the pharmaceutical composition to be administered may also contain minor amounts of nontoxic auxiliary substances such as wetting agents, emulsifying agents, or solubilizing agents, pH buffering agents and the like, for example, acetate, sodium citrate, cyclodextrine derivatives, sorbitan monolaurate, triethanolamine sodium acetate, triethanolamine oleate, and other such agents.
  • auxiliary substances such as wetting agents, emulsifying agents, or solubilizing agents, pH buffering agents and the like, for example, acetate, sodium citrate, cyclodextrine derivatives, sorbitan monolaurate, triethanolamine sodium acetate, triethanolamine oleate, and other such agents.
  • auxiliary substances such as wetting agents, emulsifying agents, or solubilizing agents, pH buffering agents and the like, for example, acetate, sodium citrate, cyclodextrine derivatives, sorbitan monolaurate, triethanolamine sodium acetate, triethanolamine ole
  • compositions containing active ingredient in the range of 0.005 % to 1 00% with the balance made up from non-toxic carrier may be prepared.
  • a pharmaceutically acceptable non-toxic composition is formed by the incorporation of any of the normally employed excipients, such as, for example pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, talcum, cellulose derivatives, sodium crosscarmellose, glucose, sucrose, magnesium carbonate or sodium saccharin.
  • compositions include solutions, suspensions, tablets, capsules, powders and sustained release formulations, such as, but not limited to, implants and microencapsulated delivery systems, and biodegradable, biocompatible polymers, such as collagen, ethylene vinyl acetate, polyanhydrides, polyglycolic acid, polyorthoesters, polylactic acid and others. Methods for preparation of these formulations are known to those skilled in the art.
  • the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g. , pregelatinized maize starch, polyvinyl pyrrolidone or hydroxypropyl methylcellulose); fillers (e.g.
  • the tablets may be coated by methods well- known in the art.
  • the pharmaceutical preparation may also be in liquid form, for example, solutions, syrups or suspensions, or may be presented as a drug product for reconstitution with water or other suitable vehicle before use.
  • Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g.
  • sorbitol syrup cellulose derivatives or hydrogenated edible fats
  • emulsifying agents e.g. , lecithin or acacia
  • non-aqueous vehicles e.g. , almond oil, oily esters, or fractionated vegetable oils
  • preservatives e.g. , methyl or propyl-p- hydroxybenzoates or sorbic acid
  • Formulations suitable for rectal administration are preferably presented as unit dose suppositories. These may be prepared by admixing the active compound with one or more conventional solid carriers, for example, cocoa butter, and then shaping the resulting mixture.
  • Formulations suitable for topical application to the skin or to the eye preferably take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil.
  • Carriers which may be used include vaseline, lanoline, polyethylene glycols, alcohols, and combinations of two or more thereof.
  • the topical formulations may further advantageously contain 0.05 to 1 5 percent by weight of thickeners selected from among hydroxypropyl methyl cellulose, methyl cellulose, polyvinylpyrrolidone, polyvinyl alcohol, poly (alkylene glycols), poly/hydroxyalkyl, (meth)acrylates or poly(meth)acrylamides.
  • the topical formulations is most often applied by instillation or as an ointment into the conjunctival sac. It, however, can also be used for irrigation or lubrication of the eye, facial sinuses, and external auditory meatus. It may also be injected into the anterior eye chamber and other places.
  • the topical formulations in the liquid state may be also present in a hydrophilic three-dimensional polymer matrix in the form of a strip, contact lens, and the like from which the active components are released.
  • the compounds for use herein can be delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g. , dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • a suitable propellant e.g. , dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas.
  • the dosage unit may be determined by providing a valve to deliver a metered amount.
  • Capsules and cartridges of, e.g. , gelatin, for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
  • Formulations suitable for buccal (sublingual) administration include lozenges containing the active compound in a flavored base, usually sucrose and acacia or tragacanth; and pastilles containing the compound in an inert base such as gelatin and glycerin or sucrose and acacia.
  • the compounds may be formulated for parenteral administration by injection, e.g. , by bolus injection or continuous infusion.
  • Formulations for injection may be presented in unit dosage form, e.g. , in ampules or in multi-dose containers, with an added preservative.
  • the compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the active ingredient may be in powder form for constitution with a suitable vehicle, e.g. , sterile pyrogen-free water or other solvents, before use.
  • Formulations suitable for transdermal administration may be presented as discrete patches adapted to remain in intimate contact with the epidermis of the recipient for a prolonged period of time. Such patches suitably contain the active compound as an optionally buffered aqueous solution of, for example, OJ to 0.2M concentration with respect to the said active compound. Formulations suitable for transdermal administration may also be delivered by iontophoresis (see, e.g. , Pharmaceutical Research 3 (6), 31 8 ( 1 986)) and typically take the form of an optionally buffered aqueous solution of the active compound.
  • compositions may also be administered by controlled release means and/or delivery devices such as those described in U.S. Patent Nos. 3,536,809; 3,598, 1 23; 3,630,200; 3,845,770; 3,847,770; 3,91 6,899; 4,008,71 9; 4,687,610; 4,769,027; 5,059,595; 5,073,543; 5, 1 20,548; 5,354,566; 5,591 ,767; 5,639,476; 5,674,533 and 5,733,566.
  • kits contain one or more containers with therapeutically effective amounts of one or more tetracycline compounds and an anti-viral-hemorrhagic agent, in pharmaceutically acceptable form.
  • the tetracycline compounds and the anti-viral-hemorrhagic agent may be in the form of a pharmaceutically acceptable solution, e.g. , in combination with sterile saline, dextrose solution, or buffered solution, or other pharmaceutically acceptable sterile fluid.
  • the tetracycline compound and the anti-viral-hemorrhagic agent may be lyophilized or desiccated; in this instance, the kit optionally further comprises in a container a pharmaceutically acceptable solution (e.g. , saline, dextrose solution, etc.), preferably sterile, to reconstitute the tetracycline compound and the anti-viral-hemorrhagic agent to form a solution for injection purposes.
  • a pharmaceutically acceptable solution e.g. , saline, dextrose solution, etc.
  • a kit further comprises a needle or syringe, preferably packaged in sterile form, for injecting the complex, and/or a packaged alcohol pad.
  • a needle or syringe preferably packaged in sterile form, for injecting the complex, and/or a packaged alcohol pad.
  • Instructions are optionally included for administration of the tetra- cycline compound and the anti-viral-hemorrhagic agent by a clinician or by the patient.
  • the magnitude of a therapeutic dose of the tetracycline compound(s), alone or in combination with the anti-viral-hemorrhagic agent will vary with the severity of the condition to be treated and the route of administration.
  • the dose, and perhaps dose frequency will also vary according to the age, body weight, condition and response of the individual patient. Dosage and administration may be empirically determined.
  • Desirable blood levels may be maintained by a continuous infusion of the tetracycline compound(s) and/or the anti-viral-hemorrhagic agent as ascertained by plasma levels. It should be noted that the attending physician would know how to and when to terminate, interrupt or adjust therapy to lower dosage due to toxicity, or bone marrow, liver or kidney dysfunctions. Conversely, the attending physician would also know how to and when to adjust treatment to higher levels if the clinical response is not adequate (precluding toxic side effects). The efficacy and/or toxicity of the tetracycline compound(s), alone or in combination with the anti-viral-hemorrhagic agent can also be assessed by the methods known in the art, i.e.
  • any suitable route of administration may be employed for providing the patient with an effective dosage of the tetracycline compound(s), alone or in combination with the anti-viral-hemorrhagic agent.
  • oral, transdermal, iontophoretic, parenteral subcutaneous, intramuscular, intrathecal and the like
  • parenteral subcutaneous, intramuscular, intrathecal and the like
  • Dosage forms include tablets, troches, cachet, dispersions, suspensions, solutions, capsules, patches, and the like. (See,
  • the active compounds or pharmaceutically acceptable derivatives may be prepared with carriers that protect the compound against rapid elimination from the body, such as time release formulations or coatings.
  • the compounds may be packaged as articles of manufacture containing packaging material, a compound or suitable derivative thereof provided herein, which is effective for treatment of a viral hemorrhagic disease, within the packaging material, and a label that indicates that the compound or a suitable derivative thereof is for treating hemorrhagic diseases or shock or other disorder contemplated herein.
  • the label can optionally include the disorders for which the therapy is warranted.
  • the diseases and disorders contemplated herein include, but are not limited to, the viral hemmorrhagic fevers, bacterial sepsis, viral hemorrhagic diseases as well as any disorder involving a cytotoxic immune response, including, but not limited to sepsis, sepsis, cachexia, rheumatoid arthritis, chronic myelogenous leukemia and transplanted bone marrow-induced graft-versus-host disease, septic shock, immune complex-induced colitis, cerebrospinal fluid inflammation, autoimmune disorders, multiple sclerosis and other such disorders that involve release of inflammatory response mediators, including tumor necrosis factor (TNF) interleukins, particularly IL-1 , and other interleukins including IL6 and IL-8, chemokines platelet-activating factor (PAF), prostaglandins and leukotrienes (see TNF) interleukins, particularly IL-1 , and other interleukins including IL6 and IL-8, chemok
  • compositions are produced by contacting blood or fraction thereof either in vitro or in vivo with one or more tetracycline or tetracycline-like compounds in an sufficient amount and for a sufficient time to an produce a response that is assessed by measuring the level of IL-1 and/or TNF receptors, using any standard assay, and looking for about a 3-fold or greater increase.
  • the resulting blood or composition can be processed further or injected, preferably into a species and blood-type matched mammalian recipient.
  • Fractions include, but are not limited to, the -gl°buline fraction, the AHF (anti-hemophilia factor, the albumin fraction, serum and plasma. Each fraction can be tested in model systems, such as those exemplified herein (see EXAMPLES) to identify active fractions.
  • fractions of interest are those that contain TNF and/or IL-1 receptors. The TNF and IL-1 receptors serve as indicators of the fractions of interest which contain other components that may contribute to the observed effectiveness of the blood-derived fractions in treating the acute inflammatory disorders.
  • the process includes the steps of administering one or more tetracycline or tetracycline-like compound(s) to a mammal; b) collecting blood from the mammal; and c) recovering serum or plasma from the collected blood.
  • the baseline level of an indicator of stimulation is obtained.
  • the level of IL-1 or TNF receptors is assessed, although the level of other cytokines and receptors, such as 11-1 6 (LCF - chemotactic for CD4, T- lymphocytes), or IL-2 receptors, is assessed using standard methods (i.e. , R&D Systems, makes a variety of reagents to test for interleukins and receptors therefor).
  • cells that produce particular factors may be identified, and those cells stimulated in vitro or in vivo to produce compositions for treatment of those diseases.
  • the resulting recovered serum and plasma can be used to administer to mammals exhibiting an acute inflammatory response, such as that associated with infection with a hemorrhagic virus or otherwise exhibiting symptoms of a septic reaction, such as shock, and the other disorders enumerated herein or known to involve a deleterious inflammatory response.
  • the plasma or serum can be further fractionated and tested in model systems to identify active fractions. Any tetracycline or tetracycline-like compound provided herein or known to those of skill in the art is contemplated for use.
  • blood or a fraction thereof is contacted with a tetracycline or tetracycline-like compound(s) or other agent, such as a virus, for time sufficient to observe at least a three-fold increase from baseline in the level of TNF or IL-1 receptors.
  • the medium from the blood or fraction is isolated and further processed, such as by further fractionation, or concentration, and then it is administered to a mammal with an acute inflammatory disease, condition or disorder.
  • white cells are harvested from the buffy coat of blood.
  • the cells are treated, for example with Sendei virus to stimulate production of ⁇ -interferon, and the supernatant or medium from the cells is isolated. Any process whereby TNF, or IL-1 receptors can be generated, in vitro or in vivo can be used, and the resulting blood product or a derivative thereof administered.
  • Preparation of Serum and Plasma can be recovered from the collected blood by any methods known in the art. In one specific embodiment, the serum or plasma is recovered from the collected blood by centrifugation.
  • the centrifugation is conducted in the presence of a sealant having a specific gravity greater than that of the serum or plasma and less than that of the blood corpuscles which will form the lower, whereby upon centrifugation, the sealant forms a separator between the upper serum or plasma layer and the lower blood corpuscle layer.
  • sealants that can be used in the processes include, but are limited to, styrene resin powders (Japanese Patent Publication No. 38841 /1 973), pellets or plates of a hydrogel of a crosslinked polymer of 2- hydroxyethyl methacrylate or acrylamide (U.S. Patent No.
  • the sealant is a polymer of unsubstituted alkyl acrylates and/or unsubstituted alkyl methacrylates, the alkyl moiety having not more than 1 8 carbon atoms, the polymer material having a specific gravity of about 1 .03 to 1 .08 and a viscosity of about 5,000 to 1 ,000,000 cps at a shearing speed of about 1 second 1 when measured at about 25°C (U.S. Patent No. 4, 140,631 ).
  • the serum or plasma is recovered from the collected blood by filtration.
  • the blood is filtered through a layer of glass fibers with an average diameter of about 0.2 to 5 ⁇ and a density of about 0J to 0.5 g./cm 3 , the total volume of the plasma or serum to be separated being at most about 50% of the absorption volume of the glass fiber layer; and collecting the run-through from the glass fiber layer which is plasma or serum (U.S. Patent No. 4,477,575).
  • the blood is filtered through a layer of glass fibers having an average diameter 0.5 to 2.5 ⁇ impregnated with a polyacrylic ester derivative and polyethylene glycol (U.S. Patent No. 5,364,533).
  • the polyacrylic ester derivative is polyfbutyl acrylate), poly(methyl acrylate) or poly(ethyl acrylate), and (a) poly(butyl acrylate), (b) poly(methyl acrylate) or poly(ethyl acrylate) and (c) polyethylene glycol are used in admixture at a ratio of ( 1 0-1 2):( 1 -4):( 1 -4) .
  • the serum or plasma is recovered from the collected blood by treating the blood with a coagulant containing a lignan skelton having oxygen-containing side chains or rings (U.S. Patent No. 4,803, 1 53).
  • the coagulant comprises a lignan skelton having oxygen-containing side chains or rings, e.g. , d-sesamin, l-sesamin, paulownin, d-asarinin, l-asarinin, 2 ⁇ -paulownin, 6 ⁇ -paulownin, pinoresinol, d-eudesmin, l-pinoresinol ⁇ -D- glucoside, l-pinoresinol, l-pinoresinol monomethyl ether ⁇ -D-glucoside, epimagnolin, lirioresinol-B, syringaresinol (dl), lirioresinonB-dimethyl ether, phillyrin, magnolin, lirioresinol-A, 2a, 6 ⁇ -d-sesamin, d-diaeudesmin, lirioresinol-C dimethyl
  • Blood plasma or sera can be further separated into different fractions, including, inter alia, an albumin-containing fraction, a globulin-containing fraction and an AHF-containing fraction.
  • Methods for preparing these fractions are known in the arts. Generally, these methods comprise one or more of the following procedures: (a) fractional precipitation with ammonium sulfate and similar salts; (b) organic solvent precipitation with cold ethanol or acetone and other such alcohols and ketones; (c) selective adsorption on calcium phosphate gels or with barium sulfate; (d) isoelectric precipitation by pH adjustment to the point at which there is no net charge on a given protein; and (e) chromatography by use of adsorbents such as CM- or DEAE-cellulose or by "Sephadex" gel filtration.
  • adsorbents such as CM- or DEAE-cellulose or by "Sephadex" gel filtration.
  • the plasma can further be separated into a fraction containing albumin by any methods known in the art.
  • the albumin- containing fraction is prepared by selective precipitation with block copolymers of ethylene oxide and polyoxypropylene polymer from the plasma (U.S. Patent No. 4,025,500).
  • the albumin-containing fraction is prepared by: (a) diluting the plasma in liquid form with a NaCl solution containing disodium ethylene dinitrilo tetraacetate and an albumin stabilizer; (b) adjusting the pH of the plasma solution resulting from step (a) to about 6.2; (c) heating the plasma solution from step (b) at about 60°C for about 1 1 /2 hours; (d) cooling the plasma solution to about 10°C; (e) precipitating impurities from the solution with polyethylene glycol at a concentration of about 1 8-20% with the albumin remaining in the supernatant; (f) isoelectrically precipitating albumin from the supernatant at a pH of about 4.6; and (g) recovering the albumin-containing fraction (U.S. Patent No. 4, 1 64,496) .
  • the albumin stabilizer is sodium caprylate.
  • the albumin-containing fraction is prepared by: (a) adjusting the pH of the plasma in liquid form to about 6.7; (b) heating the plasma at about 60°C for about 1 1 /2 hours; (c) adjusting the pH of the plasma to about 5.7; (d) precipitating impurities from the plasma by the addition of ethanol in an amount sufficient to give a final concentration of about 40 to 44% in the plasma along with cooling of the plasma to about -5°C, with the albumin remaining in the supernatant; and (e) precipitating albumin- containing fraction from the supernatant at a pH of about 4.8.
  • U.S. Patent No. 4,222,934 U.S. Patent No. 4,222,934
  • a blood group substance can beremoved from the albumin-containing fraction. It can be removed for example, by treating the albumin-containing fraction with polyethylene glycol at pH of about 6.6 to 8.0, the effective polyethylene glycol concentration in the aqueous albumin solution being about 1 3 to 20% (w/v), in the presence of an inorganic salt at a concentration of at most 50 g/liter measured as sodium chloride and at a temperature in the range of about 2°C to 30°C, the resulting polyethylene glycol/albumin solution having a protein concentration of about 5 to 40 g/liter, thereby precipitating and removing contaminant proteins containing the blood-group substance (U.S. Patent No. 4, 1 97,238).
  • the a blood group substance can be removed from the albumin-containing fraction by treating the albumin-containing fraction with polyethylene glycol at pH of about 8.0 to 9.6, the effective polyethylene glycol concentration in the aqueous albumin solution being about 1 5 to 30% (w/v), in the presence of an inorganic salt at a concentration of at most 50 g/liter measured as sodium chloride and at a temperature in the range of about 2°C to 30°C, the resulting polyethylene glycol/albumin solution having a protein concentration of about 5 to 40 g/liter, thereby precipitating and removing contaminant proteins containing the blood-group substance (U.S. Patent No. 4, 1 97,238).
  • the steps for removing a blood group substance from the albumin-containing fraction include treating the albumin- containing fraction with polyethylene glycol having an average molecular weight in the range of about 2,000 to 1 0,000 at pH of about 6.6 to 9.6, the effective polyethylene glycol concentration in the aqueous albumin solution being about 1 3 to 20% (w/v), in the presence of an inorganic salt at a concentration of at most 50 g/liter measured as sodium chloride and at a temperature in the range of about 2°C to 30°C, the resulting polyethylene glycol/albumin solution having a protein concentration of about 5 to 40 g/liter, thereby precipitating and removing contaminant proteins containing the blood-group substance (U.S. Patent No. 4, 1 97,238) .
  • Polymer content and ⁇ 1 -AGP content can be reduced in the albumin- containing fractiom such as by subjecting the albumin-containing fraction to ion exchange separation using an anion exchanger, the anion exchange separation is carried out at a pH ranging from about 5J to 5.5 (U.S. Patent No. 5,277,81 8).
  • the globulin-containing fraction can be prepared according to any methods known in the art. For example, conventional methods such as Cohn alcohol fractionating process (Kistler, et al., Vox Sang, 7:41 4 ( 1 962); and Cohn et al., J. Am. Chem. Soc , 68:459-475 ( 1 946)) and the Rivanol ammonium sulfate fractionation (Hrejsi, et al, Acta Med. Scand. , 1 55 : 65 ( 1 956)) can be used. Alternatively, the methods described in United States Patent Nos. 4,347, 1 38 and 5,310,877 can be used.
  • U.S. Patent No. 4,347, 1 38 describes a method of separating serum albumin and a serum -globulin from each other in a solution using a semipermeable membrane by forcing the blood serum protein mixture solution through an ultrafiltration membrane having a cut off molecular weight of about 1 00,000 and composed of an aromatic polyether sulfone, while adjusting the total protein concentration and salt concentration in the mixture solution to not more than 4 g/dl and not more than 0.6 mole/I, respectively, and also adjusting the pH of the solution to a value of from about 3.8 to about 4.7.
  • the pH of the blood serum protein mixture solution is adjusted to a value of from 3.9 to 4.3.
  • the salt contained in the blood serum protein mixture solution is sodium chloride or other physiologically acceptable salt.
  • U.S. Patent No. 5,310,877 describes a method for the separation of gamma globulin from albumin contained in an aqueous solution of both by ultrafiltration using a microfilter having a water permeability of 0.2-25 gallons per square foot per day per pound per square inch including a porous solid filter substrate one surface of which is impregnated with particulate solids affixed within the pores of the substrate having an average particle size of about 0.1 - 0.5 micrometer at the feed interface, the aqueous solution being characterized in that the total concentration of protein in the aqueous solution is about OJ -2% by weight, the pH of the aqueous solution is 8-1 0 and the solution contains no more than about 0.01 mole per liter of inorganic electrolyte, the albumin being enriched in the retentate and the gamma globulin being enriched in the permeate.
  • the particulate solids being used are titanium oxide particles.
  • the substrate being used is sin
  • a globulin-containing fraction prepared by the conventional fractionation contains anti-complement activity, i.e. , the property of fixing complement non-specifically (U.S. Patent No. 4,082,734). This anti-complement activity is related to the formation of aggregates.
  • Such globulin-containing fraction containing the anti-complement activity is not suitable for intravenous administration because the fraction can cause shock in some patients (U.S. Patent No. 4, 1 24,576). Therefore, the anti-complement activity must be eliminated or reduced before the globulin-containing fraction can be administered intravenously.
  • the anti-complement activity can be eliminated or reduced according to any methods known in the art.
  • pepsin decomposition Schotze and Schwick, Dtsch. Med. Wienschrift, 87: 1 643 ( 1 962)
  • decomposition Barandun, et al., Vox Sang. , 28: 1 57 ( 1 975)
  • HCl treatment Barandun, et al., Vox Sang. , 7: 1 87 (1 962)
  • ⁇ -propiolactone treatment (Stephan, Z. Klin. Chem. Klin. Biochemie, 7:282 ( 1 969)
  • U.S. Patent No. 4,082,734 describes a method of preparing an intravenously applicable globulin of substantially unchanged half-life but free from anti-complement activity, by heating plasma or serum for about 2 to 4 hours at about 50°C to 56°C, and then fractionating, the heating having been long enough within the recited parameters so that the product upon fractionation is substantially free from anti-complement activity.
  • the fractionation is effected with alcohol or ammonium sulfate.
  • the heating is effected for about 2 hours at about 56°C.
  • U.S. Patent No. 4,075, 1 93 describes a process for producing globulin for intravenous administration which comprises: 1 ) adsorbing plasminogen deriving from blood of a selected mammalian species on an adsorbent substrate of L- lysine agarose; 2) washing the adsorbate to elute impurities; 3) eluting the purified plasminogen from the substrate; 4) converting the eluted plasminogen to plasmin; 5) incubating a mixture of the plasmin and a quantity of homospecific immune globulin having anticomplementary activity under conditions such that the anticomplementary activity is substantially reduced; and 6) inactivating plasmin present in the mixture by adsorption on an inactivation adsorbent for plasmin, and recovering the immune globulin.
  • U.S. Patent No. 4, 1 24,576 describes a process for preparing a gamma globulin substantially devoid of anticomplementary activity and suitable for intravenous administration, from a material selected from the Cohn Fraction II + III plasma protein paste having a protein content of about 25-30%, Cohn Fraction II paste and placental extracts containing these fractions which comprises the steps: 1 ) suspending the paste in water to form a solution of low ionic strength having a conductance of about 300X10 "6 cm '1 ohm "1 at a pH of about 4.9 to 6.0 to produce a precipitate and a filtrate; 2) precipitating impurities from the filtrate by adding polyethylene glycol to 4% (w/v); 3) further precipitating impurities by the addition of ethanol in a concentration of from 4 to 1 2% (w/v); and 4) precipitating the gamma globulin by adding polyethylene glycol to 10 to 1 2% (w/v) or by adding ethanol to 20 to
  • U.S. Patent No. 4, 1 54,81 9 describes a process for preparing a ⁇ -globulin solution suitable for the intravenous application by treating the solution of y- globulin with acetimido ethyl ester hydrochloride, diketene, formimido ethyl ester hydrochloride or propanesultone at a pH of about 9, thereafter adjusting the pH to about 7 to 7.5, and separating the solution from the solids by dialysis or fractionation followed by sterile filtration.
  • the diketene is employed in about 0.02 g per g of protein in the ⁇ -globulin solution.
  • 4,374,763 describes a process for producing -g'obulin suitable for use in intravenous administration and of an anticomplementary activity of lower than 20% by bringing Cohn's Fraction II for the gamma-globulin into suspension in an aqueous solution of a monosaccharide, disaccharide or sugar alcohol, adjusting the pH of the suspension to about 7.0 to 9.0, adding dextran of an average molecular weight of 1 0,000 to 70,000 into the suspension to produce an aqueous about 2 to 1 0% (w/v) solution of dextran, and after removing the thus formed precipitate, adding ammonium sulfate to the mother liquor to precipitate the gamma-globulin.
  • U.S. Patent No. 4,436,724 describes a method of producing y-globulin which can be administered intravenously without adverse reactions.
  • the method includes treating -globulin with pepsin or uropepsin in a neutral pH range of about 6.0 to 7.5.
  • the aggregates in ⁇ -globulin are selectively decomposed, while any decomposition of monomer ⁇ -globulin molecule is substantially prevented.
  • the globulin-containing fraction thus produced with reduced anti-complementary activity is stabilized by adding uropepsin which serves simultaneously as a proteolytic enzyme and a stabilizer.
  • U.S. Patent No. 4,835,257 describes a process for the preparation of gamma globulin suitable for intravenous administration.
  • the process includes the steps of: dissolving gamma globulin precipitated from blood or blood products in a solution, separating non-dissolved precipitate from the solution, adding polyethylene glycol to the separated solution, separating precipitate from the polyethylene glycol solution, increasing the polyethylene glycol concentration in the solution, separating precipitated purified gamma globulin from the higher concentrated polyethylene glycol solution, dissolving the purified gamma globulin in a solution suitable for intravenous administration.
  • the process also includes a step of dissolving the gamma globulin precipitated from blood in a solution having a neutral pH, adding polyethylene glycol in the first step to a concentration of about 4.0-5.5 % by weight, and increasing the polyethylene glycol concentration in the second step to at least 9% but not more than 1 6% by weight, and by adding a buffer to the solution just prior to adding the polyethylene glycol in one of the two polyethylene glycol addition steps.
  • the globulin-containing fraction can be lyophilized for extended shelf-life and ease of transportation.
  • the globulin- containing fraction can be lyophilized by any methods known in the art, preferably in the presence of salts or sugars.
  • the processes described in the U.S. Patent Nos. 4, 1 68,303 and 4,692,331 can be used.
  • 4, 1 68,303 describes a process for producing a lyophilized gamma globulin preparation for intravenous administration, which comprises freeze-drying an aqueous solution of gamma globulin which has undergone no modification and has an anticomplementary activity of 20 (CH50) or less in the presence of about 0.06 to 0.26 part by weight of sodium chloride for 1 part by weight of the gamma globulin.
  • the freeze drying is carried out in the presence of about 0J to 0.3 part by weight of serum albumin for 1 part by weight of the gamma globulin.
  • the freeze drying is carried out in the presence of about 0 to 0.5 part by weight of a diluent for about 1 part by weight of the gamma globulin.
  • the diluent is mannitol.
  • U.S. Patent No. 4,692,331 describes a process for preparing a storage- stable, intravenously administrable (/-globulin dry preparation, which -globulin has been obtained by fractionating plasma with polyethylene glycol and has been substantially freed of remaining polyethylene glycol.
  • the process includes the steps of: (1 ) adding glucose to an aqueous solution of /-globulin, which is substantially free of remaining polyethylene glycol and is suitable for intravenous administration, the amount of glucose added being from about 0.2 to 2.0 parts by weight, based on one part of (/-globulin sufficient to stabilize the (/-globulin; and thereafter (2) lyophilizing the aqueous solution to produce a dry powder.
  • the aqueous solution contains /-globulin in an amount of about 5 to 20% (W/V) in terms of protein.
  • AHF-Containing Fraction Factor VIII and von Willebrand's factor are associated plasma proteins that together are called Antihemophilic Factor (AHF) . Both are important in the blood clotting mechanism. Methods of making concentrates of AHF are known in the art. These range from simply freezing and then thawing plasma
  • U.S. Patent No. 3,631 ,01 8 describes a method for preparing a concentrate of AHF including fractionating a cryoprecipitate concentrate of AHF with polyethylene glycol and glycine in a three-step precipitation: (1 ) first with about 3-4% by weight of polyethylene glycol followed by recovery of the supernate; (2) then with polyethylene glycol added to about 1 0% by weight followed by recovery of the resulting precipitate; and (3) finally with about 1 .3- 1 .8 M glycine added to a solution of the precipitate from step (2) followed by recovery of the resulting precipitate.
  • the polyethylene glycol suitable for use in the method has a molecular weight in the range of 200-20,000, preferably 400- 6,000, more preferably about 4,000.
  • U.S. Patent No. 3,652,530 describes a method of preparing highly purified AHF by treating an extract of a precipitate obtained by cryoethanol precipitation with polyethylene glycol in three successive precipitations, first with aluminum hydroxide gel at pH about 5.6-7.0, then with polyethylene glycol to a concentration of about 3.0-6.5 %, and finally with added polyethylene glycol to a concentration of 10-1 2% to obtain a precipitate containing the highly purified AHF.
  • U .S. Patent No. 3,682,881 describes a method for the preparation of a prothrombin complex and an AHF concentrate from citrated blood plasma treated with 1 .5-1 .8 M glycine.
  • the resulting precipitate was treated successively with polyethylene glycol, first to a concentration of 3-4% and then 1 0% by weight, and finally with 1 .8 M glycine.
  • U.S. Patent No. 3,973,002 describes a method for isolating antihemophilic factor of human blood plasma including the steps of adjusting the pH of a solution of buffer-extracted plasma cryoprecipitate to from about 6.0 to about 7.0, and cooling the solution at a temperature of from about 2°C to about 20°C for from about 1 5 to about 60 minutes to cause precipitation of impurities.
  • U.S. Patent No. 4,069,21 6 describes an improvement in the process described in U.S. Patent No. 3,631 ,01 8 mentioned above, in which the process includes the step of holding a buffered solution of F. VIII and 6% polyol at 0-5°C until precipitation occurs.
  • U.S. Patent No. 4,089,944 describes a for producing a clinically useful freeze-dried solid composition containing AHF and fibrinogen from blood plasma or an AHF-containing fraction thereof including the steps of fractionating the plasma to obtain a solid mixture containing AHF and fibrinogen, dissolving the solid mixture in an aqueous medium and freeze-drying the resulting solution to obtain a clinically useful freeze-dried solid composition which is then reconstituted in a reconstitution liquid for use, and including the step of rendering the freeze-dried, solid composition rapidly soluble in an aqueous medium at room temperature by adding water soluble carbohydrate to the mixture, the amount of carbohydrate added being an amount sufficient to produce at least about 2 grams per 1 00 milliliters concentration of carbohydrate upon reconstitution of the composition in a suitable medium to produce a therapeutically useful solution of AHF.
  • the carbohydrate used is dextrose, maltose, lactose or sucrose.
  • U.S. Patent No. 4, 104,266 describes a method for the preparation of purified AHF which includes the thawing of frozen plasma at a temperature of between about 0°C and about 1 °C to obtain a cryoprecipitate containing AHF, and including the steps of: (a) extracting the cryoprecipitate with a low ionic strength buffer solution containing tris (hydroxymethyl) aminomethane at a temperature of about 0°C to obtain a cold insoluble fraction having cold soluble impurities removed therefrom; (b) extracting the cold insoluble fraction with a low ionic strength buffer solution containing tris (hydroxymethyl) aminomethane at a temperature of about 21 °C to obtain a solution containing AHF and the buffer solution; (c) deprothrombinizing the solution with aluminum hydroxide gel; and (d) recovering an AHF-rich solution.
  • U.S. Patent No. 4, 1 70,639 describes a process for the production of antihemophilic factor concentrate in purified form having enhanced potency and solubility by: (a) subjecting an aqueous extract of antihemophilic blood plasma cryoprecipitate to purification by mixing with an aluminum hydroxide adsorbent at an acid pH and precipitating unwanted protein in the cold, the pH conditions being such that unwanted protein is selectively removed by adsorption without substantial loss of antihemophilic factor potency from the aqueous extract; (b) constituting the purified aqueous extract with buffer and saline and adjusting to an acid pH, and (c) freeze-drying the thus adjusted aqueous extract.
  • 4,203,891 describes a method of increasing the yield of antihemophilic factor VIII (AHF), from whole blood, blood plasma or blood plasma fractions by collecting the blood or plasma or plasma fraction from a donor directly into an anticoagulant agent selected from heparin, sodium heparin, or mixtures thereof, which agent does not reduce the physiological concentration of calcium, and recovering the AHF.
  • the anticoagulant is used in the range of 0J -1 0 units/ml based on total volume of whole blood or blood plasma and the AHF is recovered by fractionation using glycine, ethanol, ethanolglycine, polyethylene glycol or glycine-polyethylene glycol precipitation.
  • U.S. Patent No. 4,210,580 describes a process for separating and isolating AHF and fibronectin from plasma by cryoprecipitation (0-1 5°C) in the presence of a sulfated mucopolysaccharide, e.g. , heparin, to a concentration of about OJ 5-0.25 mg/ml of plasma (approximately 22.5 to 37.5 units of heparin/ml of plasma).
  • the resulting fibronectin precipitate is purified chromatographically and the heparin supernatant is mixed with an anion exchange resin such as DEAE cellulose with Heparasorb to remove heparin and to provide a supernatant having 90-95 % of the original procoagulant activity.
  • an anion exchange resin such as DEAE cellulose with Heparasorb to remove heparin and to provide a supernatant having 90-95 % of the original procoagulant activity.
  • U .S. Patent No. 4,251 ,437 describes a process for producing an antihemophilic factor preparation (AHF) by thawing deep-frozen human blood plasma, at least partially, by irradiation with electromagnetic waves of a frequency of about 10 8 -1 0 15 Hz for a period of time and with an energy penetration such that the temperature in the thawed blood plasma does not exceed 1 0°C at any point, centrifuging the thawed product to form a cryoprecipitate, redissolving the cryoprecipitate in a buffer, isolating a concentrated solution, and optionally freeze-drying the concentrated solution.
  • AHF antihemophilic factor preparation
  • the irradiation is controlled so that the temperature in the thawed product does not exceed 4°C at any point.
  • the irradiation is carried out with microwaves of a frequency of about 1 0 8 -3X1 0 Hz. Further preferably, the irradiation is carried out with microwaves of a frequency of about 2X10 9 -3X10 10 Hz.
  • U.S. Patent No. 4,289,691 describes a method for obtaining AHF from fresh blood plasma by adding heparin, used in the range of about 1 -1 0 units/ml of plasma, to fresh plasma collected by plasmapheresis into a calcium chelating anticoagulant, freezing the plasma, resolubilizing the plasma, isolating a cryoprecipitate from the plasma, resolubilizing the cryoprecipitate, adding a citrate saline heparin buffer to the resolubilized cryoprecipitate, incubating the resolubilized, buffered cryoprecipitate at about 0-1 0°C for a time in excess of about 1 hour in the presence of heparin precipitable cold insoluble globulin, separating an AHF rich precipitate and isolating AHF from the precipitate.
  • heparin used in the range of about 1 -1 0 units/ml of plasma
  • U.S. Patent No. 4,348,31 5 describes a process for purifying and/or concentrating the F. VIII complex, starting from cryoprecipitate or Cohn Fraction l-O, by dissolving a composition containing F. VIM together impurities in 1 .5 M glycine solution at 1 5°C and pH 6.3-7.8 to obtain a solution containing F. VIM and a precipitate containing the impurities.
  • the process includes the additional step of adding PEG to the resulting F. Vlll-containing glycine solution followed by precipitating and then concentrating purified F. VIM from the solution.
  • U.S. Patent No. 4,383,989 describes a method of obtaining AHF by collecting freshly obtained plasma or plasma fractions directly into heparin, sodium heparin or mixtures thereof, in a proportion of about 6-8 units of heparin/ml of plasma, in the absence of a citrate buffer, and applying a cold incubation technique (0-1 0°C) using heparin precipitable cold insoluble globulin.
  • U.S. Patent No. 4,386,068 describes a process for producing an AHF concentrate by treating an aqueous suspension of cryoprecipitate containing AHF proteins with aluminum hydroxide gel, subjecting the resulting solution to ultrafiltration, and then constituting the solution resulting from the ultrafiltration in buffer and saline.
  • the solution resulting from the ultrafiltration may be treated with 1 .6-2.2 M glycine for further purification.
  • U.S. Patent No. 4,404, 1 31 describes a method of producing an AHF concentrate by subjecting an AHF concentrate obtained by conventional fractionation, e.g. , cryoprecipitation, to cryoalcohol precipitation.
  • U.S. Patent No. 4,435,31 8 describes a process for the separation and recovery of Factor VIM, von Willebrand's factor, and Factor V from plasma and plasma derivative streams having a pH normally between about 6 to 8.5 by removing from the blood stream when present substantially all initial turbidity therein, subsequently passing the blood plasma into and out of an apparatus containing one or more semi-permeable membranes which separate the plasma stream from a salt receiving stream thereby decreasing the salt content of the plasma stream between about 45 to 80% to cause the formation of a protein turbidity enriched in Factor VIII, von Willebrand's factor and Factor V, subsequently removing substantially all of the turbidity and maintaining the temperature of the plasma stream during the separation and recovery process in the range of between about 4-40°C, and at substantially its original starting pH level.
  • U.S. Patent No. 4,522,751 describes a method of producing a preparation containing Factor VIM (AHF) from a Factor-VIM-containing plasma fraction, the preparation containing Factor VIM (AHF) having a specific activity of at least 1 .5 units of Factor Vlll/mg protein, immunoglobulin G (IgG) of from 1 5 to 30 mg/1 000 units of Factor VIM and fibrinogen of from 20 to 40 mg/1 00 units of Factor VIM, by: (a) dissolving the Factor-VIM-containing plasma fraction in a buffer solution containing a sulfated polysaccharide at a pH value approximately in the neutral range; (b) lowering the pH to a value ranging from 6.0 to 6.4 and adjusting the temperature to between about 0° C to about 25° C to precipitate undesired proteins and obtain a Factor-VIM-containing supernatant; (c) adding at least of glycine, sodium chloride and sodium citrate,
  • U .S. Patent No. 4,543,21 0 describes a process for producing high purity antihemophilic factor concentrate from an antihemophilic factor-containing dispersion or solution isolated from blood plasma or a blood plasma fraction including performing two consecutive precipitations using a combination of precipitants in each precipitation, first a combination of 1 -4% by weight, based on weight of solution, of polyethylene glycol and OJ -0.2 ml of 1 -3%, based on weight of suspension, aluminum hydroxide suspension per gram of protein in the starting dispersion or solution, followed by a combination of added polyethylene glycol to provide a final concentration of 9-1 3% by weight, based on weight of the resulting solution, and 1 0-20% by weight of glycine, based on weight of the polyethylene glycol solution, and 1 0-20% by weight, based on weight of the polyethylene glycol solution, of sodium chloride.
  • U.S. Patent No. 4,743,680 describes a process for purifying a protein that has antihemophilic factor activity by column chromatography in a column behaving predominantly as an ion-exchange chromatography column, including the steps of: (a) equilibrating the chromatography column; (b) loading a sample containing the protein on the column, causing the protein to adsorb onto the column; (c) washing the column; (d) eluting the adsorbed protein from the column by causing it to desorb from the column; (e) recovering the protein in purified form; and also including the step of : adding to the column a substance containing of an effective amount for selectively increasing the electrostatic forces on the surface of the protein and concomitantly decreasing the hydrophobicity of the protein of a hydration additive selected from among sugars and polyhydric alcohols during at least one of the steps (a), (b), and (c) thereby promoting the adsorption of the protein on the column.
  • U.S. Patent No. 4,81 4,435 describes a method for preparing a Factor VIM (AHF)- containing fraction having a specific activity of at least 2.5 units of Factor Vlll/mg protein as well as a portion of immunoglobulin G (IgG) of 10 mg/1 000 units of Factor VI at most, with the risk of transmission of viral or bacterial infections avoided or largely reduced when applied therapeutically or prophylactically.
  • AHF Factor VIM
  • IgG immunoglobulin G
  • the method includes the steps of: 1 ) preparing a first solution of a Factor VIM containing plasma fraction including at least one of a heparinoid and a complex compound of heparin and antithrombin III (Atheplex); 2) precipitating and separating undesired proteins from the first solution in the presence of sulfated polysaccharides at a pH of 6.0 to 6.4 and at a temperature of 0-25°C so as to obtain a purified Factor VIM containing supernatant; 3) treating the purified Factor VIM containing supernatant with a protein precipitating agent selected from ammonium sulfate, ammonium sulfate-glycine, sodium chloride-glycine, sodium sulfate, sodium sulfa te-sodium citrate, ammonium sulfate-sodium citrate, sodium chloride-ammonium sulfate at a concentration of 8 to 35 % and a pH of 5.6 to 6.
  • U.S. Patent No. 4,952,675 describes a process for purifying a protein having antihemophilic factor activity by column chromatography in a column behaving predominantly as a hydrophobic affinity chromatography column, including the steps of: (a) equilibrating the chromatography column; (b) loading a sample containing the protein on the column, causing the protein to adsorb onto the column; (c) washing the column; (d) eluting the adsorbed protein from the column by causing it to desorb from the column; (e) recovering the protein in purified form; and also including the step of : adding to the column a substance consisting essentially of an effective amount for selectively increasing the electrostatic forces on the surface of the protein and concomitantly decreasing the hydrophobicity of the protein of a hydration additive selected from among sugars and polyhydric alcohols during the step (d) thereby promoting the desorption of the protein from the column; and subjecting the eluate containing the protein from the step (d) to
  • U.S. Patent No. 4,977,246 describes a method for obtaining an AHF-rich product from human plasma by: (a) thawing freshly frozen human plasma at a temperature of about 6-1 0°C to obtain a plasma solution; (b) adding one volume of about 1 .20 M to 1 .80 M aqueous solution of a precipitating agent selected from the group consisting of sodium citrate, potassium citrate and citric acid to two volumes of the plasma solution obtained in step (a) at a temperature of about 0-10°C to form a precipitate; (c) incubating the precipitate-containing solution in an ice bath for about 20 to 40 minutes; and (d) separating the precipitate from the solution.
  • a precipitating agent selected from the group consisting of sodium citrate, potassium citrate and citric acid
  • U.S. Patent No. 5,484,890 describes a method of recovering, from a biological sample, an antihemophilic factor protein containing fraction having increased antihemophilic factor protein stabilit.
  • the sample contains (a) an antihemophilic factor protein, (b) at least one destabilizing protease impurity, and (c) at least one proprotease impurity; and the fraction having at least 1 7 units of antihemophilic factor protein/mg of total protein; the method comprising: contacting the sample with an amount of a protease removing agent effective to remove a destabilizing amount of the protease impurity and an amount of proprotease removing agent effective to remove a destabilizing amount of the proprotease impurity.
  • the proprotease removing agent includes an anion exchange resin in an amount ranging from 70 mg total loading protein/ml anion exchange resin to 750 mg total loading protein/ml anion exchange resin.
  • Patent No. H 1 ,509 describes a process for producing a Factor VIII concentrate from blood plasma, by: (a) obtaining a cryoprecipitate containing Factor VIII from blood plasma; (b) dissolving the cryoprecipitate in an aqueous solution containing heparin in an amount sufficient to provide a cryoprecipi- tate/heparin solution containing from about 30 to about 1 50 units of heparin per milliliter of solution; (c) adding a sufficient amount of a precipitant consisting essentially of PEG to the cryoprecipitate/heparin solution while maintaining the solution at a temperature of from 20°C to 30°C to precipitate protein contaminants, leaving a PEG supernatant containing Factor VIM; (d) recovering the PEG supernatant; and (e) recovering Factor VIM from the PEG supernatant.
  • U.S. Patent No. Re. 29,698 describes a method for improving the yield of AHF obtained from blood plasma and blood plasma fractions, obtained by cryoprecipitation, by the addition of heparin.
  • the heparin-treated cryoprecipitate may then be further fractionated using polyethylene glycol and glycine.
  • heparin is preferably added twice, once to the initial cryoprecipitate and subsequently to the further fractionated concentrate.
  • the plasma is further separated into a fraction containing soluble IL-1 receptor or soluble TNF receptor.
  • the preparation can be monitored by assaying for the physical properties of the receptors such as molecular weight, polarity, ionic strength, charge, isoelectric point, etc (Sambrook et al., Molecular Cloning: A Laboratory Manual (2nd Ed.),
  • the preparation can also be monitored by assaying for the functional properties of the receptors such as the ability to specifically bind IL-1 or TNF, to block specific binding between IL-1 and
  • IL-1 receptor or between TNF and a TNF receptor and to neutralize or reduce the biological activity of IL-1 or TNF.
  • the preparation is monitored by antibody-based assays and any anti-IL-1 soluble receptor and anti-TNF soluble receptor antibodies can be used (see Current Protocols in Immunology (Ed.
  • compositions thus produced are suitable for treating viral hemorrhagic diseases or disorders or other diseases, disorders or syndromes in which cytotoxic responses, including but are not limited to, other acute infectious diseases, sepsis, cachexia, rheumatoid arthritis and other autoimmune disorders, acute cardiovascular events, chronic myelogenous leukemia and transplanted bone marrow-induced graft-versus-host disease, septic shock, immune complex-induced colitis, cerebrospinal fluid inflammation, autoimmune disorders, multiple sclerosis.
  • methods for treating or preventing a viral hemorrhagic disease or disorder or other such disorders involving such cytoxic responses in a mammal are provided . These methods include the steps of administering to the mammal an effective amount of the immune composition(s) produced according to the above processes.
  • compositions can be used alone or in combination with a tetracycline or tetracycline-like compound(s) and/or other anti-viral-hemorrhagic agent(s), such as IL-1 inhibitors and TNF inhibitors.
  • a tetracycline or tetracycline-like compound(s) and/or other anti-viral-hemorrhagic agent(s) such as IL-1 inhibitors and TNF inhibitors.
  • Viral hemorrhagic diseases can be treated by administration of tetracycline or tetracycline-like compound(s), The effectiveness of administration of a tetracycline compound or tetracycline-like compound(s) for treatment is optimal shortly after infection.
  • Such treatment is preferably combined with administration of the compositions provided herein and/or other treatments for viral hemorrhagic disorders.
  • Methods for treating disorders involving acute inflammatory responses characterized by elevated and debilitating levels of cytokines are provided. These disorders include those enumerated herein and any others in which acute inflammatory responses, as assessed by elevated levels of TNF and/or IL-1 , occur.
  • a mammal determined to have an acute inflammatory response or a disease or condition characterized by such response is treated with a blood-derived composition provided herein.
  • the mammal may also be treated with a tetracycline or tetracycline-like compound or plurality thereof and/or with a treatment known to have some effect on the symptoms of or on disorder. All treatments may be administered simultaneously, successively or intermittently and, as necessary, repeatedly and for a time sufficient to observe an amelioration or treatment of the symptoms of the disease, condition or disorder.
  • methods in which such mammals are treated with blood or fraction thereof that has been contacted with a tetracycline or tetracycline-like compounds either in vitro or in vivo.
  • the blood is treated in vivo, it is obtained from a donor who has been administered a tetracycline and tetracycline-like compounds prior to providing blood.
  • the blood or a fraction thereof, particularly white blood cell-containing fraction, such as buffy coats has been treated in vitro with a tetracycline and/or tetracycline-like compound(s)
  • it is obtained from an untreated donor and then either fractionated prior to contacting or subsequent to contacting.
  • the blood is treated to obtain the buffy coat, which contains the white blood cells.
  • the buffy coat fraction is contacted in vitro with a tetracycline and/or tetracycline-like compound(s) .
  • the medium from the treated cells is administered.
  • the levels of the TNF and IL-1 receptors are monitored prior to contacting with the tetracycline and/or tetracycline-like compound(s), during and after contacting for at least a three-fold increase in the level of such receptors compared to the baseline, prior to contacting with the tetracycline and/or tetracycline-like compound(s).
  • Such measure serves as indicator that the factors, which include sTNF receptors and/or IL-1 receptors, particularly IL-1 RA.
  • These receptors serve as the marker for a sufficient level of induction of the palliative factors; they are not necessarily the only factors responsible for the observed effects.
  • These methods may also be combined with other methods for treating such disorders, such as other anti-IL-1 antibodies, anti-IL-1 receptor antibodies, IL-1 receptor antagonists, IL-1 production inhibitors, IL-1 receptor production inhibitors, and IL-1 releasing inhibitors.
  • Administration is effected by any suitable route, including systemic, local and topical administration, such intramuscularly, intravenously, parenterally and orally.
  • administration of a blood product will be via IV route.
  • Administration of a tetracycline compound will be orally. Amounts of tetracycline is about 1 00-500 mg twice per day for one or more days, typically at least three and up to about ten days. These amounts are also the amounts for administration human donors to induce factors for preparation of the blood- derived compositions.
  • the disorders include hemorrhagic diseases and disorders, wasting diseases, sepsis, autoimmune disorders, particularly acute episodes associated with autoimmune disorders, acute episodes associated with multiple sclerosis, acute allergic reactions and other inflammatory diseases.
  • the methods herein are particularly useful for treating hemorrhagic diseases or disorders, for which there have heretofore been few, if any, effective treatments.
  • a mammal suffering from such disorder is treated with by an amount of a tetracycline and tetracycline-like compounds effective to ameliorate a symptom of the disorder, particularly, a disorder associated with elevated levels of cytokines associated with an acute inflammatory disorder.
  • This method is intended for treatment of viral hemorrhagic fevers, and also bacterial infections, such as E. coli infections.
  • the anti-viral-hemorrhagic agent is a tumor necrosis factor (TNF) inhibitor, including an anti-TNF antibody, an anti-TNF receptor antibody, a TNF receptor antagonist, a TNF production inhibitor, a TNF receptor production inhibitor or a TNF releasing inhibitor.
  • the anti-viral-hemorrhagic agent is an anti-viral vaccine, an anti-viral antibody, a viral-activated immune cell or a viral-activated immune serum. Any specific examples of the IL-1 inhibitor, the TNF inhibitor, the antiviral vaccines, the anti-viral antibodies, the viral-activated immune cells or the viral-activated serum can be used in the combinational therapy.
  • the tetracycline compound(s) and/or the anti-viral-hemorrhagic agent(s) can be used alone or in combination with other known therapeutic agents or techniques (including chemotherapeutics, radioprotectants and radiotherapeutics) to either improve the quality of life of the patient, or to treat the disease, such as viral hemorrhagic diseases or disorders.
  • the tetracycline compound(s) and/or the anti-viral-hemorrhagic agent(s) can be used before, during or after radiation treatment.
  • THEREOF The methods and compositions provided herein are particularly suited for treatment of viral hemorrhagic diseases. To effectively employ such methods, proper diagnosis is recommended. Hence following is a list of exemplary hemorrhagic diseases, the causative agents and methods of diagnosis.
  • viral hemorrhagic diseases or disorders that can be treated by the present methods include, but are not limited to, viral hemorrhagic disease caused by infection with Bunyaviridaea, a Filoviridae, a Flaviviridae, or an Arenaviridae virus.
  • Bunyaviridaea viruses include bunyavirus (Bunyamwera, Bwamba, California, Capim, Guama, phlebovirus koongol, patois, simbu and tete viruses), sandfly fever virus, Rift Valley fever virus of sheep and ruminants, Nairovirus, Crimean-Congo hemorrhagic fever virus, Uukuvirus, Uukuniemi virus, Hantaan virus and Korean hemorrhagic fever virus (see, e.g. , U.S. Patent No. 5,786,342).
  • Hantaan virus Of particular interest is treatment of Crimean-Congo hemorrhagic fever virus, Hantaan virus and Korean hemorrhagic fever virus infections, particularly, Hantaan virus.
  • Specific strains of Hantaan virus include 76-1 1 8 strain (Avsic-Zupanc, et al., Am. J. Trop. Med. Hyg. , 51 (4):393-400 ( 1 994); Gu, et al., Chin. Med. J. (Engl). , 1 Q3(6):455-9 ( 1 990); Miyamoto, et al., Kansenshogaku Zasshi.
  • Bunyaviridaea virus infection and particularly Hantaan virus infection, can be diagnosed by any methods known in the art according to clinical, immunological or molecular criteria. Any known immunological methods can be used in the diagnosis of Bunyaviridaea or Hantaan virus infection (see e.g. , ' Current Protocols in Immunology (Ed. Coligan et al.) John Wiley & Sons, Inc.,
  • Antibody-based or antigen- based immunological methods include immunoprecipitation, Western blotting, dot blotting and in situ immuno-detection methods such as immunofluorescence can be used.
  • anti-Bunyaviridaea virus or anti-Hantaan virus antibodies described herein can be used in the immunodiagnosis.
  • Nucleotide-sequence based molecular methods include nucleotide sequencing, nucleotide hybridization, polymerase chain reaction (PCR), especially reverse-transcriptase polymerase chain reaction (RT-PCR) can be used.
  • PCR polymerase chain reaction
  • RT-PCR reverse-transcriptase polymerase chain reaction
  • nucleotide-sequence based molecular diagnosing methods can be used in the nucleotide-sequence based molecular diagnosing methods: AF035831 , X95077, D25531 , D25528-D25530, D25532- D25533, U71369-U71372, U71281-U71283, X55901, S74081, S67430, U38911, U38910, Y00386, U38177, U37768, U37729, M14626, M57637, M14627, M57432 and L08753.
  • Filoviruses are classified in the order Mononegavirales (Pringle C.R., Arch. Virol. , 1 1 7: 1 37-140 (1 991 )), which also contains the nonsegmented negative- strand RNA virus families Paramyxoviradae, Rhabdoviridae, and Bornaviridae.
  • Members of the family Filoviridae includes Marburg virus, a unique agent without known subtypes, and Ebola virus, which has four subtypes (Zaire, Sudan, Reston, and Ivory Coast) (Feldmann and Slenczka Klenk, Arch. Virol.
  • Filoviruses are enveloped, nonsegmented negative-stranded RNA viruses.
  • the two species, Marburg and Ebola virus are serologically, biochemically, and genetically distinct. Classification, virion morphology and structure, genomic organization and diagnosis are described in detail in Beer et al., Naturwissenschaften, 86:8-17 (1999), Springer-Verlag 1999.
  • Marburg and Ebola viruses are pleomorphic particles that vary greatly in length, but the unit length associated with peak infectivity is 790 nm for Marburg virus and 970 nm for Ebola virus (Regnery et al., J. Virol., 36:465-469 (1980)).
  • virions appear as either long filamentous (and sometimes branched) forms or in shorter U- shaped, 6-shaped (mace-shaped), or circular (ring) configurations (Murphy et al., Paltyn S.R. (ed) Ebola virus hemorrhagic fever, Elsevier/North-Holland, Amsterdam, pp.61-82 (1978); Peters et al., Martini and Siegert (eds) Marburg virus disease, Springer, Berlin Heidelberg, New York, pp.68-83 (1971)). Virions have a uniform diameter of 80 nm and a density of 1.14 g/ml.
  • All filoviruses contain one molecule of noninfectious, linear, negative-sense, single- stranded RNA with a M, of 4.2 x 10 6 , constituting 1.1 % of the virion mass [Kiley M.P., et al., J. Gen. Virol., 69:1957-1567 (1988); Regnery et al., J. Virol., 36:465-469 (1980)).
  • the nonsegmented negative-strand RNA genomes of filoviruses show the gene arrangement 3'-NP-VP35-VP40-GP-VP30-VP24-L-5' with a total molecular length of approximately 1 9 kb (Table 2).
  • Table 2 Filoviral proteins and functions
  • NP nucleoprotein nucleoprotein
  • VP virion structural protein GP glycoprotein
  • L large protein (polymerase) sGP small glycoprotein
  • MBG type Marburg filoviruses EBO type Ebola filoviruses Modified after Feldmann et al., Archives of Virology, 1 996.
  • Filoviridae virus infection and particularly ebola and Marburg virus infection, can be diagnosed by any methods known in the art according to clinical, immunological or molecular criteria (see, e.g. , Sambrook et al.. Molecular Cloning: A Laboratory Manual (2nd Ed.), Cold Spring Harbor Laboratory Press, 1 989).
  • Antibody-based or antigen-based immunological methods include immunoprecipitation, Western blotting, dot blotting and in situ immuno-detection methods such as immunofluorescence can be used.
  • anti-Filoviridae virus or anti-ebola and anti-Marburg virus antibodies can be used in the diagnosis of Bunyaviridaea or Hantaan virus infection (see, e.g. , Current Protocols in Immunology (Ed. Coligan et al.) John Wiley & Sons, Inc., 1 997).
  • Nucleotide-sequence based molecular methods include nucleotide sequencing, nucleotide hybridization, polymerase chain reaction (PCR), especially reverse-transcriptase polymerase chain reaction (RT-PCR) can be used.
  • PCR polymerase chain reaction
  • RT-PCR reverse-transcriptase polymerase chain reaction
  • nucleotide-sequence based molecular diagnosing methods AF086833, U77384-U77385, U81 1 6-U2341 7, U231 87, U231 52, U23069, AF034645, AF054908, X671 10, L1 1 365, U28077, U281 34, U28006, U31 033, U23458, X61 274, J04337 and M33062.
  • nucleotide-sequence based molecular diagnosing methods AF005730-AF005735, Z1 21 32, Z29337, X64405-X64406, X68493-X68495, M7271 4, M92834 and M36065.
  • Reverse transcriptase polymerase chain reaction is one of the most powerful tools of diagnosis of filovirus infection (Volchkov V., et al.. Virology, 232: 1 39-144 (1 997)).
  • Antibodies to filovirus can be detected by immunofluorescence assays using acetone-fixed virus-infected cells inactivated by .-radiation [Johnson et al., Trans. R. Soc. Trop. Med. Hyg. , 76:307-310 ( 1 982); Johnson et al., Trans. R. Soc. Trop. Med. Hyg. , 77:731 -733 ( 1 983)), which should not be used under field conditions.
  • Vero cells are readily used for the isolation and propagation of fresh and laboratory passaged strains of the viruses.
  • MA-1 04 cells and SW1 3 cells have also been successful in primary filovirus isolation (McCormick et al., J. Infect. Dis. , 147:264-267 (1 983)) .
  • primary isolation in guinea pigs (for Marburg virus) or suckling mice (for Ebola virus) may be required.
  • a western blot method has been standardized for the diagnosis of filovirus infections [Elliott et al., J. Virol. Methods, 43:85-89 (1 993)).
  • Solid- phase indirect enzyme-immunoassay has been used to detect Lassa and Ebola virus antigens and antibodies using horseradish peroxidase-labeled antispecific globulins (Ivanov, et al., Vopr Viruso/. , 31 (2): 1 86-90 ( 1 986) .
  • Immunohistochemistry (IHC) testing of formalin-fixed postmortem skin specimens can also be performed (see, e.g. , Zaki, et al., J. Infect. Dis., 179(Suppl1):S36-47 (1999)).
  • Flaviviridae Virus Infection All members of the Flaviviridae family share common morphologic characteristics, genome structure, and replication and translation strategies (see, e.g., Kautner, et al., J. Pediatr., 131:516-524 (1997)).
  • Flaviviridae viruses include flavivirus, Brazilian encephalitis virus, Bussuquara virus, dengue virus, iiheus virus, Israel turkey meningoencephalitis virus, Japanese B encephalitis virus, kunjin virus, Kyasanur forest disease virus, langat virus, louping ill virus, modoc virus, Murray valley encephalitis virus, ntaya virus, omsk hemorrhagic fever virus, powassan virus, St.
  • the dengue virus to be treated is a dengue type 1, dengue type 2, dengue type 3 or dengue type 4 virus.
  • Specific dengue type 1 virus strains include Singapore strain S275/90 (Fu, et al., Virology, 188(2):953-8 (1992)), Western Pacific strain (Puri, et al., Virus Genes, 17(1):85-8 (1998)) and Mochizuki strain (Zulkarnain, et al.,
  • Flaviviridae includes human pathogens, Dengue viruses, the Japanese encephalitis virus and yellow fever virus.
  • Mature dengue virus particles have a single-stranded ribonucleic acid genome surrounded by an approximately icosahedral nucleocapsid with a diameter of 30 nm.
  • the nucleocapsid is covered by a lipid envelope of 10 nm thickness derived from host cell membranes and contains the envelope and membrane proteins (Westaway et al., Flaviridiac. Intervirology, 24:183-92 (1985)).
  • the viral genome of approximately 11 kb is infectious, has a messenger- like positive polarity, and can be translated in vitro.
  • the 5' end of the RNA has a type I cap structure but lacks a poly A tail at the 3' end (Rice et al., Science, 229:726-33 (1985); Hahnet al., Virology, 162:167-80 (1988); Irie et al., Gene, 74:197-211 (1989)). It contains a single open reading frame of about 10,000 nucleotides encoding three structural and seven nonstructural proteins.
  • the gene order is 5'-C-prM(M)-E-NSI-NS2A-NS2B-NS3-NS4A-NS4B-NS5.
  • the proteins are synthesized as a polyprotein of about 3000 aminoacids that is processed cotranslationally and posttranslationally by viral and host proteases (Biedrzycka et al., J. Gen. Virol., 1987, 68:1317-26; Mackow et al., J. Gen. Virol., 1987, 69:23-4; Speight et al., J. Gen. Virol., 1988, 69:23-34; Chambers et al., Virology, 1989, 169:100-9; Markoll et al., J. Virol., 1989, 63:3345-52; Preugschar et al., J.
  • the structural proteins include a capsid protein rich in arginine and lysine residues and a nonglycosylated prM protein produced from a glycosylated precursor in a late step of virus maturation (Rice et al., Science, 1985, 229:726- 33; Hahn et al., Virology 1988, 162:167-80; Deubel et al., J. Virol. Methods, 1990, 30:41-54; Randolph et al., Virology 1990, 174:450-8).
  • the major structural envelope protein is involved in the main biologic functions of the virus particle such as cell tropism, acid-catalyzed membrane fusion, and the induction of hemagglutination-inhibiting, neutralizing, and protective antibodies (Depros et al., Virology, 1993. 196:209-19).
  • the first nonstructural protein is NSI, a glycoprotein with a function in the virus life cycle that is unknown (Schlesinger et al., J. Immunol. , 1 985, 1 35 :2805-9) .
  • NS 1 proteins are detected in high titers in patients with secondary dengue infections, but are rarely found in primary infections (Kuno et al., J. Med. Virol.
  • the NS2 region codes for two proteins (NS2A and NS2B) that are thought to be implicated in polyprotein processing, whereas NS3 is probably the viral proteinase that functions in the cytosol (Preugschat et al., Virology, 1 991 , 185:689-97; Cahour et al., J. Virol. , 1 992, 66: 1 535-42; Falgout et al., J. Virol. , 1 989, 63: 1 852-60) .
  • the NS4 region codes for two small hydrophobic proteins that seem to be involved in the establishment of the membrane bound RNA replication complex.
  • Flaviviridae virus infection and particularly dengue virus infection, can be diagnosed by any methods known in the art according to clinical, immunological or molecular criteria. Any known immunological methods can be used in the diagnosis of Flaviviridae or dengue virus infection (see Current Protocols in Immunology (Ed. Coligan et al.) John Wiley & Sons, Inc., 1 997).
  • Antibody- based or antigen-based immunological methods include immunoprecipitation, Western blotting, dot blotting and in situ immuno-detection methods such as immunofluorescence can be used.
  • Antibodies described herein can be used in the immunodiagnosis.
  • Nucleotide-sequence based molecular methods include nucleotide sequencing, nucleotide hybridization, polymerase chain reaction (PCR), especially reverse- transcriptase polymerase chain reaction (RT-PCR) can be used.
  • PCR polymerase chain reaction
  • RT-PCR reverse- transcriptase polymerase chain reaction
  • Dengue virus nucleotide fragments containing all or portions of sequences with the following Genbank Accession Nos. can be used in the nucleotide-sequence based molecular diagnosing methods: E06832, D1 0514, D 1051 3, X70952. The diagnosis of dengue relies in most case on clinical judgment because only a few major centers have the facilities and means to perform and verify the clinical impression.
  • Diagnostic criteria for DHS based on clinical observations have been proposed by the World Health Organization and should be used to avoid over-diagnosis (World Health Organization. Dengue hemorrhagic fever: diagnosis, treatment and control, Geneva, WHO, 1 986) .
  • Clinical criteria for diagnosis are as follows: (1 ) fever; (2) hemorrhagic manifestations, including at least a positive tourniquet test result and a major or minor bleeding phenomenon; (3) hepatic enlargement; (4) shock (high pulse rate and narrowing of the pulse pressure to 20 mm Hg or less, or hypotension).
  • the laboratory criteria include (5) thrombocytopenia ( ⁇ 1 00,000/mm 3 ), and (6) hemoconcentration (hematocrit increase > 20%). Thrombocytopenia with concurrent high hematocrit levels differentiates DHF from classic DF.
  • a secondary dengue infection is characterized by the rapid appearance of broadly cross-reactive antibodies. Hemagglutination inhibition titers of 1 :20 in the acute-phase sample rise to > 1 :2560 in the convalescent phase sample. An antibody titer of > 1 : 1 280 in the acute-phase sample without a fourfold or greater increase in the second sample also is considered presumptive of recent infection.
  • a less time-consuming method is a capture enzyme-linked immunosorbent assay that can detect specific anti-dengue IgM in a single acute- phase sample (Lam et al., Southeast Asian, J. Trop. Med. Public Health, 1 987, 1 8:532-8).
  • kits for the detection of specific IgG as well as IgM antibodies have become available. They are based on a dot enzyme assay or a nitrocellulose membrane-based capture format, respectively, and should be suitable for field research (Cardosa et al., J. Virol. Methods, 1 988, 22:81 -8; Cardosa et al., Southeast Asian, J. Trop. Med. Public Health, 1 988, 1 9:591 -4; Cardosa et al., Clin. Diagn. Virol. , 1 995, 3:343-50) .
  • virus isolation is the detection of viral RNA by reverse transcription polymerase chain reaction.
  • primers and template isolation There are various protocols available using different primers and template isolation (Deubel et al., J. Virol. Methods, 1 990, 30:41 -54; Henchal et al., Am. J. Trop. Med. Hyg. , 1 991 , 45:41 8-28; Morita et al., J. Clin. Microbiol. , 1 991 , 29:21 07-1 0; Morita et al., J. Med. Virol. , 1 994, 44:54-8; Lanciotti et al., J. Clin. Microbiol.
  • Reverse transcription polymerase chain reaction coupled with hybridization with labeled serotype-specific probes can detect as few as 4 plaque-forming units per 1 00 ⁇ l serum and gives the best results early in the acute phase of the disease when dengue antibodies are still low (Chan et al., Southeast Asian, J. Trop. Med. Public Health, 1 994, 25 :258- 61 ). Less than 1 ⁇ of serum can be sufficient for the detection of viral RNA (Chan et al., J. Virol. Methods, 1 994, 49:31 5-22). 4. Arenaviridae Virus Infection
  • Arenaviridae viruses include Junin virus, lassa virus, machupo virus, pichinde virus, lymphocytic choriomeningitis virus, lassa fever virus and arenavirus (U.S. Patent No. 5,786,342).
  • the Arenaviridae viruses to be treated are Junin virus, lassa virus, machupo virus.
  • Specific strains of lassa virus include Josiah strain (Auperin, et al., Virology, 1 68(2):421 -5 ( 1 989); and Fidarov, et al., Vopr Viruso/. , 35(4) :326-9 ( 1 990) and Nigerian strain (Clegg, et al., Virus Res. , 1 8(2-3): 1 51 -64 ( 1 991 )).
  • Arenaviridae virus infection, and particularly lassa virus, machupo virus, or pichinde virus infection can be diagnosed by any methods known in the art according to clinical, immunological or molecular criteria. Any known immunological methods can be used in the diagnosis of Arenaviridae virus infection, and particularly lassa virus, machupo virus, or pichinde virus infection (see Current Protocols in Immunology (Ed. Coligan et al.) John Wiley & Sons, Inc., 1 997).
  • Antibody-based or antigen-based immunological methods include immuniprecipitation, Western blotting, dot blotting and in situ immuno-detection methods such as immunofluorescence can be used.
  • anti-Arenaviridae virus or anti-lassa virus, anti-machupo virus and anti-pichinde virus antibodies known to those of skill in the or described herein can be used in the immunodiagnosis.
  • Nucleotide-sequence based molecular methods include nucleotide sequencing, nucleotide hybridization, polymerase chain reaction (PCR), especially reverse-transcriptase polymerase chain reaction (RT-PCR) can be used.
  • PCR polymerase chain reaction
  • RT-PCR reverse-transcriptase polymerase chain reaction
  • Lassa virus nucleic acid fragments containing sequences from the following Genbank Accession Nos. can be used in the nucleotide-sequence based molecular diagnosing methods: U80004, U73034-U73035, U63094, X52400, J04324, K03362 and M 1 5076.
  • Machupo virus nucleic acid fragments containing sequences from the following Genbank Accession Nos. can be used in the nucleotide-sequence based molecular diagnosing methods: X6261 6.
  • Virus Marburg virus strain Popp used in the following experiments was received from the Ecuadorsian Research Institute of Epidemiology and Microbiology (Minsk, Belarussia). All work with infectious virus was performed in the maximum-containment biosafety level-4 (BSL-4) facility of the State Scientific Center of Virology and Biotechnology ("Vector”) (Koltsavo, Russia). This virus was amplified in Vero E 6 cells and the supernatant was collected to produce stocks. This stock virus suspension (2X1 0 7 PFU/ml) was stored at -70 °C. Lassa virus strain Josiah used in the following experiments was received from Ecuadorsian Research Institute of Epidemiology and Microbiology (Minsk, Indiasia).
  • This mouse-adapted Lassa virus was passaged once in Vero E6 cells and 3 times passaged in mice by intracerebrally challenge.
  • This mouse- adapted Lassa virus stock was collected and stored at -70°C. This stock contained 1 0 6 PFU ml (or 10 5 7 LD 50 by inoculation challenge of 4-week old BALB/c mice).
  • the animals were received from the vivarium of SRC VB "Vector" and kept at a standard ration. To ensure that the animals (guinea-pigs and mice) were spared of unnecessary pain and discomfort, standard anesthesia methods were used. A single dose of ketamine/xylazine via intramuscular injection in the posterior region of the hind leg was administered to the animals. (3) PCR RT-PCR procedure for virus detection was performed as described in
  • Animals were divided into 1 1 groups, each containing 6 animals: 1 .
  • Animals of the first group serve as virus controls, i.e. , were infected with the virus but were not given therapeutic or prophylactic agents.
  • 2 t Animals of the second group (T) were given 1 ml of Tetracycline-Hcl (Belmedpreparats Ltd., Russia) solution (58 mg/kg) intramuscularly from 1 0 days before virus injection until seventh day after virus injection daily.
  • Animals of the second group (D) were given 1 ml of Doxycycline solution (Belmedpreparats Ltd., Russia) (58 mg/kg) intramuscularly from 1 0 days before virus injection until seventh day after injection daily. 3 t .
  • Animals of the third group (T) were given 1 ml of Tetracycline-Hcl solution (58 mg/kg) intramuscularly from 5 days before virus injection until seventh day after injection daily. 3 d . Animals of the third group (D) were given 1 ml Doxycycline solution (58 mg/kg) intramuscularly from 5 days before virus injection until seventh day after injection daily.
  • mice of the fourth group (T) were given 1 ml of Tetracycline-Hcl solution (58 mg/kg) intramuscularly from the third day after virus injection until seventh day after virus injection daily.
  • Animals of the fourth group (d) were given 1 ml Doxycycline solution (58 mg/kg) intramuscularly from the third day after virus injection until seventh day after virus injection daily. 5 t .
  • Animals of the fifth group (T) sever as the Tetracycline controls, i.e. , were given Tetracycline-Hcl solution (58 mg/kg) intramuscularly during the 1 7 day period without virus injection.
  • Animals of the above groups were parenterally infected with Marburg virus at a dose of 5LD 50 on day "0" .
  • the virus was detected by RT-PCR on the third day after infection.
  • tetracycline and doxycycline are not toxic to control groups (5T, 5D).
  • Using tetracycline and doxycycline prophylactically does not improve survival rate of the animals (2T, 2D, 3T and 3D).
  • the mean time to death (m.t.d.) of these groups is shorter than that of the virus control group
  • mice were divided into the following groups, each containing 20 mice: 1 .
  • Animals of the first group were infected with Lassa virus without any tetracycline or doxycycline treatment.
  • Animals of the second group were given 0.2 ml of Tetracycline-HCI solution (58 mg/kg) from the third day until 7th day after virus injection (every day) .
  • tetracycline and doxycycline are not toxic to control groups (1 ) .
  • Using tetracycline and doxycycline therapeutically increases survival rate of the animals because Group 2 and 3 have higher survival rates than Group J 01
  • IL- 1 , IL-I Ra, TNF and soluble TNF receptor were monitored in the Lassa virus control animals (Table 5) and tetracycline or doxycycline treated animals (Table 6) by ELISA using the ELISA kits or antibodies from R&D Systems, Inc. (U.S.A.) .
  • the ratio of IL-1 /IL-1 Ra in virus control animals (Table 5) increased dramatically to about 20 fold of the base level (Day 9) as the infection progresses and then returned to the base level (Day 21 ).
  • the ratio of IL-1 /IL-1 Ra in tetracycline or doxycycline treated animals increased to only about 5 fold of the base level (Day 3) and then returned to the base level (Day 21 ) .
  • Dengue virus type 2 was used in the following experiments. All work with infectious virus was performed in the maximum-containment biosafety level-3 (BSL-3) facility of the "Vector” . This virus was amplified in the brain of succlik mice (inbred BALB/c mice from Vector) and was collected to produce stocks. This stock virus suspension was stored at -40 °C, containing 6.8 Ig LD 50 /ml (in mice BALB/ c by intraperitoneal challenge) .
  • BSL-3 maximum-containment biosafety level-3
  • mice 4-week old BALB/c mice (haplotype H-2k) were used in the experiments with Dengue virus infection. Mice weigh 1 2-1 4 grams. The animals were received from SRC VB "Vector" and kept at a standard ration.
  • the virus detection was provided by PCR-method.
  • Primers for Dengue virus type 2 detection are upper 5' AATATGCTGAAACGCGAGAGAAACCG (position 1 36-1 61 of the dengue virus RNA SEQ ID No. 23 and lower 5' AAGGAACGCCACCAAGGCCATG (position 237-258) SEQ ID NO. 24.
  • mice The animals of this group (60 animals) were given Doxycycline solution (58 mg/kg) intramuscularly every day for 4 days. From the first day, sera were taken from mice daily to detect concentration of IL-1 , TNF, IL-1 RA and sTNFr (Table 7).
  • Doxycycline solution 58 mg/kg
  • Animals of the second group are virus controls, i.e. , were infected with the dengue virus without doxycycline treatment.
  • the virus detection was provided by PCR-method on the second day after infection. From the first day after infection, sera were taken from mice daily to detect concentration of IL-1 , TNF, IL-1 RA and sTNFr (Table 8). J 04-
  • mice were given 0.2 ml of Doxycycline solution (58 mg/kg) intramuscularly from the second day after virus injection till the fifth day daily.
  • the virus detection was provided by PCR-method on the second day after infection. From the first day after infection, sera were taken from mice daily to detect concentrations of IL-1 , TNF, IL-1 RA and sTNFr (Table 9).
  • mice were given 0.2 ml of doxycycline solution (58 mg/kg) intramuscularly form the third day after virus injection till the fifth day daily.
  • the virus detection was provided by PCR-method on the second day after the infection. From the first day after infection, sera were taken from mice daily to detect concentration of IL-1 , TNF, IL-1 RA and sTNFr (Table 10).
  • Group 5
  • the animals from this group were given, intravenously daily from the second day after infection till the sixth day, 0.3 ml of the serum collected from the animals of the group 1 on the first day after those animals were treated with doxycycline.
  • the Serum collected from the animals of group 1 contain 6.6 pg IL-1 , 60 pg IL-1 ra, 1 .5 pg TNF and 25 pg.
  • the virus detection was provided by PCR-method on the second day after infection. From the first day after infection, the sera were taken from the mice of group 5 to detect concentration of IL-1 , TNF, IL-1 RA and sTNFr (Table 1 1 ).
  • the animals from this group were given, intravenously daily from the second day after infection till the sixth day, 0.3 ml of the serum collected from the animals of the group 1 on the second day after those animals were treated with doxycycline.
  • the Serum collected from the animals of group 1 contain 6 pg IL-1 , 20 pg IL-1 ra, 5.5 pg TNF and 1 2 pg sTNFr.
  • the virus detection was provided by PCR method on the second day after animals infection. From the first day after infection, sera were taken from the mice of Group 6 daily to detect concentration of IL-1 , TNF, IL-1 RA and sTNFr (Table 1 2) .
  • mice The experiments using BALB/c (haplotype H-2d) and C57BI/6 (H-2b) mice show that the dosage of Dengue virus of 1 0 - 1 0,000 LD 50 is absolutely lethal ( 1 00%) after intraperitoneal challenge to these mice weighing 1 2-1 4 grams.
  • BALB/c mice weighing 1 2-1 4 grams were used. These mice died toward the end of the fifth day after the infection with the dose of Dengue virus 1 00 LD 50 .
  • the concentration of IL-1 increases during the development of the infection more significantly than the concentration of IL-1 RA (Table 8) .
  • the large excess of IL-1 over IL-1 RA manifests in the ratio of IL-1 /IL-1 RA.
  • the coding region of the IL-1 Ra (residues 3-1 52, numbering according to Eisenberg et al. (1 990) Nature 343:341 -346: see, also Arend et al. ( 1 990) J. Clin. Invest. 85: 1 694-1 797 and Hannum et al. ( 1 990) Nature 343:336-340) as amplified from U937 cDNA by PCR with the introduction of an additional glycine residue, a BamHI restriction site at the 5' end and an EcoRI site at the 3' end (5' oligonucleotide CGG GAT CCG GGA GAA AAT CCA GCA AGA TG SEQ ID NO.
  • the mature recombinant IL-1 Ra protein has the N- terminal sequence GSGRK, which is different from that of the native IL-1 Ra -H O-
  • the PCR product was introduced into the fusion protein expression vector pGEX-2T [Pharmacia; see, also Smith et al. ( 1 988)
  • IL-1 Ra in the following disease models
  • disease models for monitoring disease progression and the efficacy of various treatment protocols There are disease models for monitoring disease progression and the efficacy of various treatment protocols. Exemplary models are as follows.
  • BALB/c mice model are used in this study. Development of this lethal disease is accompanied by the increased TNF, IL-1 and IFN production.
  • Ectomelia virus gains entry through minute abrasions of the skin where it multiplies to produce a primary lesion. While this lesion is developing, a series of invasive steps produce a secondary viremia that seeds the skin and other organs with virus. A rash appears about 3 days after the primary lesion occurs.
  • CBA/calac mice which are highly sensitive to Lassa virus infection, are used in this study. Infection with the Lassa virus in the CBA/calac mice is accompanied by inflammation characterized histologically by cerebral edema, functional activity of kupffer cells, and necrosis of individual hepatocytes. Marked cytokine production also accompanies the disease development. (4) Experimental HFRS fever (Hantaan virus).
  • mice BALB/c mice are used in this study.
  • the mice are infected with denver fever virus. Development of this lethal disease is accompanied with by increased TNF, IL-1 and IFN production.
  • Dengue virus type 2 Virus amplification by two passes through the brains of suckling mice. Mice were infected with 5 LD 50 's of virus. Animals:
  • mice BALB/c (haplotype H-2d), age 4 weeks were used for the experiment.
  • Experimental Scheme 1 60 mice BALB/c (haplotype H-2d), age 4 weeks were used for the experiment.
  • Group A1 20 mice, was the control group for mortality.
  • Group A2, 30 mice was used for obtaining blood samples on the day (0) and days 1 , 3, 5 and 6 post infection. Blood samples were obtained from the orbital sinuses (at every time point 3 mice were used for harvesting blood). All blood samples (500 ⁇ l) were frozen (-70 C). After completion of the experiment, the concentrations of TNF and IL-1 were measured.
  • B groups 60 mice, treatment with tetracycline hydrochloride (20 mg/kg) from the third day before the virus infection until 8 days after virus injection administered twice per day, orally in a volume of 30 ⁇ l.
  • Group B1 20 mice, control for mortality.
  • Group B2, 40 mice was used to obtain blood samples on the day
  • Group C 1 , 20 micem, controlfor mortality.
  • mice 40 mice, was used to obtain blood samples on day (-1 ), (0) and days 1 , 3, 5, 6, 7, 8 and 1 2 post infection. Blood samples were obtained from the orbital sinuses (on every time point 3 mice were used for harvesting blood). All blood samples (500 ⁇ l) were frozen (-70 C). After the whole experiment had finished, the concentrations of TNF, IL-1 were measured. D groups, 60 mice, treatment with Terramycine (20 mg/kg) from the third day before the virus infection until 8 days after virus injection, twice per day, intramuscularly in volume 1 00 ⁇ l.
  • Group D 1 20 mice, control for mortality.
  • mice was used to obtain blood samples on day (-1 ), (0) and days 1 , 3, 5, 6, 7, 8 and 1 2 post infection. Blood samples were obtained from the orbital sinuses (on every time point 3 mice were used for harvesting blood). All blood samples (500 ⁇ l) were frozen (-70 C). After the whole experiment had finished, the concentrations of TNF, IL-1 were measured. On the third day after challenge by the Dengue virus all samples taken from the infected mice were tested by RT-PCR for the virus detection. RESULTS: Table 13.
  • the concentration of IL-1 increased 1 2-fold by day 6 of the infection, and the concentration of TNF increased 3-fold.
  • the level of cytokines in the serum of the animals of this group was statistically lower than in the control A2 group.
  • group D2 which was treated with terramycine, 1 5 % of the animals survived, m.t.d. was 6.53, which is statistically longer in the control A2 group.
  • the concentration of IL-1 increased 1 6-fold by day 3 of the disease and stayed at this level until the day 7.
  • the concentration of TNF increased 2-fold by day 6 of the disease.
  • the levels of the cytokines in the serum of the animals in this group were statistically lower than in the control group A2.
  • Dengue virus type 2. All work with infectious virus was performed in the maximum-containment biosafety level-3 (BSL-3) of the SRC VB ))Vector)). This virus was amplified in the brain of the suckling mice and was collected to produce stocks. This stock virus suspension was stored at -40C, contained 6.8 LD 50 /ml (in the mice BALB/c by intraperitoneal challenge). For infecting mice we used 5 LD 50 virus. Animals.
  • mice 4-week-old BALB/c mice (haplotype H-2d) were used in the experiments with Dengue virus. Mice had weigh 1 2-1 4 gram. The animals were received from the vivarium of SRC VB ((Vector)) and kept on a standard ration. RT-PCR procedure. Primers for Dengue virus type 2 detection were: Upper 5' AATATGCTGAAACGCGAGAGAAACCG (position 1 36-1 61 ) SEQ Lower 5 'AAGGAACGCCACCAAGGCCATG (position 237-258) SEQ ID No. 24.
  • RNeasy Kits Quantiagen, Germany
  • RT-PCR Titan-Kits (Berhringer, Germany) were used.
  • Reverse transcription was conducted at 42C for 60 min, followed by 40 amplification cycles at 94C for 30 sec, at 55 C for 1 min, and at 68 C for 2 min, with a final extension at 68 C for 7 min.
  • Amplification was conducted in 0.2-ml tubes with a model BIS-1 05M thermocycler ( Russia). The virus detection was provided by PCR on the second day after animals infection.
  • mice of all groups were infected by 5 LD 50 of Dengue virus.
  • Groups A - control groups (only virus).
  • mice control for mortality.
  • mice - was used for obtaining blood samples on day (0) and on days 1 , 3, 5 and 6 post infection.
  • the blood samples were obtained from the orbital sinuses (at every time point 3 mice were used for harvesting blood). All blood samples (500 ⁇ l each) were frozen at -70° C. After completion of the experiment, the concentrations of TNF- ⁇ and IL-1 ? were measured.
  • the Human serum was obtained from the blood of a human administered vibromycine ( 1 50 mg) orally twice a day (every 1 2 hours). The human blood was taken on the second and the third day after the beginning of the stimulation.
  • the concentration in the human serum of IL-1 RA was 1 84 pg/ml, and the concentration of sTNFRI was 950 pg/ml.
  • mice Treatment of the mice commenced on the third day after viral infecting of the mice and continued until day 8. It was administered intraperitonealy twice a day in the volume of 200 ⁇ l per dose.
  • the dose of the infusing human serum is about 1 6% of the blood volume of a mouse.
  • Group B1 - control for mortality 1 0 mice.
  • Group B2 - 26 mice - was used for obtaining blood samples on day (0) and days 1 , 3, 5 and 1 2 post infection. Blood samples were obtained from the orbital sinuses (at every time point 3 mice were used for harvesting blood) . All blood samples (500 ⁇ l) were frozen and -70° C. After completion of the experiment, the concentrations of TNF - a and IL-1/? were measured. Groups C - Tetracycline treatment groups.
  • Tetracycline hydrochloride ( 1 0 ⁇ g in a volume of 30 ⁇ l) was carried out from the third day after virus infection until day 8, twice per day, orally. Tetracycline is more soluble than vibromycine so that is could be administered more readily in solution to the mice.
  • mice - was used for obtaining blood samples on day (0) and days 1 , 3, 5, 6 and 1 2 post infection. Blood samples were obtained from the orbital sinuses (at every time point 3 mice were used for harvesting blood). All blood samples (500 ⁇ l each) were frozen -70° C. After completion of the experiment, the concentrations of TNF- ⁇ , and IL-1/? were measured. Groups D. Control for human serum treatment groups.
  • the control for treatment was human serum obtained from the human before the Vibromycine stimulation.
  • This "normal" human serum contained 24.4 pg/ml of IL-1 RA and 25.0 pg/ml of sTNFRI .
  • the volume dose and method of infusion were the same as during the Human serum treatment course.
  • Treatment with the normal human serum commenced on the third day after virus infection until day 7, twice per day, intraperitonealy in a volume of 200 ⁇ l per dose.
  • the dose of the infusing normal human serum was about 1 6% of the blood volume of a mouse.
  • mice - control for mortality mice - control for mortality.
  • mice - was used for obtaining blood samples on day (0) and days 1 , 3, 5 and 6 post infection. Blood samples were obtained from the orbital sinuses (at every time point 3 mice were used for harvesting blood). All blood samples (500 ⁇ l) were frozen at -70° C. After completion of the experiment, the concentrations of TNF- ⁇ and IL-1/? were measured. Groups E. Treatment with anti-TNF ⁇ serum. Group E1 - 10 mice.
  • the data shows that treatment considerably reduces inflammatory cytokines such as TNF ⁇ and IL-1 ? (Table 1 5) .
  • Treatment with stimulated human serum (groups B) containing the increased concentrations of the stimulated human serum (groups B) containing the increased concentrations of the receptors of the cytokines also prolonged the lifetime of the mice, and increased the number of surviving animals.
  • Marburg virus strain Popp was received from the Ecuadorsian Institute of Epidemiology and Microbiology. This virus was amplified in Vero E6 cells and the supernatant was collected to produce stocks. This stock virus suspension has been stored at - 70°C, contained 107 PFU/ml. All work with infectious virus was performed in the maximum-containment biosafety level - 4 (BSL-4) of the SRC VB (Vector) . Animals
  • mice All animals were divided into groups, each contained 6 animals.
  • the guinea pigs were infected by the 5 LD 50 of the Marburg virus. Animals of the group A were used only for the virus control. Animals of the group B after infection were treated by the human serum (SERUM1 ) with IgG against Marburg (titer IgG in ELISA 1 :80), without
  • mice of the group C were treated by the human serum with IgG against Marburg virus (titer IgG in ELISA 1 :80), without IgG against Ebola, the concentration of TNF ⁇ - 7.8 pg/ml, ,sTNFRI-21 pg/ml, IL-1 / ? - 3 pg/ml, IL-IRA - 24.4 pg/ml.
  • Animals of the group E were treated with (normal) human serum without the antibodies against Marburg and Ebola viruses, and the concentrations of TNF ⁇ -7.0 pg/ml, sTNFRI-20pg/ml, IL-1/5-3 pg/ml, IL-
  • SERUM 1 which contains antibodies against Marburg virus and soluble receptors sTNFR and IL-IRA
  • Human soluble receptors (sTNFRI and IL-IRA) were detected in the blood samples of the treated guinea pigs on day (0) before infecting (as a control) and on day 7 after infecting with the Marburg virus, and on the 27th day among the survived guinea pigs. The detection was performed using ELISA-kits of R&D Production.
  • the human soluble receptors sTNFR I and IL-IRA were detected in the blood of the animals. Without being bound by any theory, it appears that these receptors were used for the neutralization of the inflammatory cytokines produced during the development of the Marburg fever in the animals.
  • the serum of the surviving guinea pigs after Marburg infection was used for the detection of the specific IgG by ELISA and Western blot (groups of guinea pigs A,B,C) on days (0), 27 and 35. On day ((0)) no specific IgG was detected. But on day 27 and 35 the specific antibodies against Marburg virus were found at a titer of 1 :80. At the same time no antibodies against Ebola virus were detected. It appears from the combination of the low titer of the antibodies against the Marburg virus with a sufficient concentrations of the soluble receptors of the inflammatory cytokines can influence the development and outcome of the experimental Marburg fever.
  • Eterohemorrhagic Escherichia coli (EHEC), 0 1 57:H7 strain, serotype 105282 was used these experiments. The organisms were incubated in LB medium for 24 h ar 37 C. After one passage viable counts were determined by plating on the agar media. Titer of E.coli was 10 8 PFU . E.coli suspension was prepared by washing the bacterial pellet twice in the phosphate-buffered saline (PBS; pH 8.
  • the bacterial suspension ( 1 0 7 PFU) in the volume of 30 vl was infused to the mice intragastricaly through the soft polyethylene catheter.
  • mice 4-week-old male BALB/c mice (halpotype H-2d) were used in the experiments. The blood volume per mouse was approximately 1 .2 ml. All animals were divided into the following groups. Groups A. Control groups. All animals were infected by E.coli suspension.
  • Group A-1 1 0 mice, control for mortality.
  • mice was used to obtain blood samples on day "0" and day 1 , 2,
  • Treatment groups (B1 and B2) Treatment groups (B1 and B2).
  • Treatment was carried out with the Human serum containing IL-RA and sTNFRI .
  • the Human serum was obtained from the blood of human taking orally Vibromycine in dose of 1 50 mg twice per day (every 1 2 hours) .
  • the Human blood was taken on the second day and the third day after the beginning of taking antibiotic.
  • the concentration in the Human serum of IL-1 RA was 1 84 pg/ml, and the concentration of sTNFRI was 950 pg/ml.
  • the treatment was started from the second day after bacterial infecting of the mice and continued until 9 day, twice per day, intraperitonealy, in the volume of 200 /vl per dose.
  • the dose of the transfusing Human serum presented 1 6% of the blood volume of a mouse.
  • Group B1 10 mice, control for mortality.
  • Group B2 mice 26 mice, was used from obtaining blood samples on day "0" and day 1 , 2, 3, 5, 1 2, 21 post infection. Blood samples were obtained from the orbital sinuses (on every time point 3 mice were used for harvesting blood) . All blood samples (500 /vl each) were frozen -70° C. After the whole experiment had finished, the concentrations of TNF, IL-1 were measured. Groups C. Control for Treatment groups. Treatment was carried out with the ((Normal)) Human serum. The concentration in the ((Normal)) Human serum of IL-1 RA was 24.4 pg/ml, and the concentration of sTNFRI was 22 pg/ml. The concentration of IL-1/?
  • mice the concentration of TNF ⁇ - 7.6 pg/ml.
  • the treatment was started from the second day after bacterial infecting of the mice and continued until 7 day, twice per day, intraperitonealy, in the volume of 200 /vl per dose.
  • the does of the transfusing Normal Human serum presented 1 6% of the blood volume of a mouse. All animals dies on day 7 after bacterial infection. Group C 1 , 10 mice, control mortality.
  • mice was used to obtain blood samples on day "0" and day 1 , 2, 3, 5, 6 post infection. Samples were obtaining from the orbital sinuses (on every time point 3 mice were used for harvesting blood). All blood samples (500 /vl each) were frozen - 70 C. After the whole experiment had finished, the concentrations of TFN ⁇ , IL-1/? were measured. Results
  • mice with a pathogenic strain of E. coli leads to the death of all mice.
  • the clinical manifestations of the experimental disease caused by this strain of E. coli have many common features with the experimental fevers in animals such as Dengue, Lassa, and Machupo.
  • the presence of sepsis in the infected animals was confirmed by demonstrating E. coli in the blood of the animals on the 6 th day after infecting while it was not present before infecting. All infected mice showed intensified production of TNF ⁇ and IL-1 ?. Infusion of normal nonstimulated human serum had no effect on the levels of inflammatory cytokines nor did it prolong the lifetime of the animals or the number of survivors.
  • the mononuclear cells were obtained from the human blood.
  • the third part was used for the Terramycine activation with the dosage of
  • the concentrations of the receptors obtained in vitro are comparable with the concentrations obtained in vivo and even higher.
  • the concentrations of the receptors in the donors serum (2 persons, on the 24th hour) were IL-1 RA 1 26.8 + 6.8 pg/ml, sTNFRI 970 + 28.6 pg/ml (before the stimulation: IL-1 RA 20 + 2.2 pg/ml and sTNFRI 22 + 3.4 pg/ml).
  • the concentrations of the same receptors in the donors serum (2 persons, on the 24th hour) 1 30 + 6.8 pg/ml and 580 + 1 8.2 pg/ml.
  • One portion of the cells was used as control, without any activation (in a volume 2 ml).
  • a second portion was used for the tetracycline activation at a concentration of 0.06 mg/ml (in a volume of 2 ml) .
  • the third portion was used for the terramycine activation at a concentration of 0.06 mg/ml (in a volume of 2 ml).
  • the activation continued for 2 hours, and the cells then were washed twice with the medium RPMI-1 640 (pH 7.2).
  • a monolayer was formed (2 X 10 6 /ml) and the cells were cultured at 37 ° C, 95% humidity, atmosphere of 5% of C0 2 . Samples of activated mononuclear cells were taken on the third, 6th and 24th hours after the beginning of the contact.
  • the concentrations of sTNFRI and IL-1 RA were measured using standard ELISA- kits by R&D Systems.
  • the results of the experiment showed that the production of the receptors such as sTNFRI and IL-1 RA are induced in vitro using Tetracycline and Terramycine.
  • the production of the receptors by the activated cells was statistically significantly higher than the production by the non-stimulated cells.
  • the concentrations of the receptors obtained in vitro are comparable to the concentrations obtained in vivo and even higher.
  • the concentration of receptors in the donor serum (2 persons, on the 24th hour) were IL-1 RA 1 26.8 ⁇ 6.8 pg/ml, sTNFRI 970 ⁇ 28.6 pg/ml (before the stimulation: IL-1 RA 20 ⁇ 2.2 pg/ml and sTNFRI 22 ⁇ 3.4 pg/ml).
  • the concentrations of the same receptors in the donor serum (2 persons, at the 24th hour) was 1 30 ⁇ 6.8 pg/ml and 580 ⁇ 1 8.2 pg/ml.
  • mice Sixty 7-8 week old female Balb/c mice (H 2 4 haplotype) were injected intramuscularly with tetracycline (58 mg/kilo in 0J ml of sterile PBS). Plasma (citrated) was collected from these mice at 24 hour postinjection. One 0.2 ml sample of the plasma from each mouse was tested for the presence of IL-1 R and TNF ⁇ -RI&ll . The reminder of the plasma from each mouse was pooled. After removing a small sample from this pool for testing for the above mentioned cytokines, the reminder of the plasma pool was stored at -85 °C until needed.
  • mice Thirty 7-8 week old female Balb/c mice (H 2 d ) were injected with 0J ml of sterile PBS and their plasma was drawn at 24 hour postinjection. A sample of plasma from each mouse was tested for IL-1 R and TNF ⁇ -RI&ll. The remainder of the plasma from this group of mice was pooled. A sample of the pooled plasma was tested for the cytokines as described above. 2. Treatment of the mice with septic shock Fifty 6-8 week old female Balb/c mice (Haplotype as above) received concurrent intraperitoneal injections of 25 ⁇ g of Staphylococcus enterotoxin B (SEB) and 20 mg of galactosamine for the induction of Septic Shock.
  • SEB Staphylococcus enterotoxin B
  • mice were divided into the following treatment groups: 1 ) ten mice remained untreated and served as negative controls; 2) ten mice received an intramuscular injection of tetracycline (58 mg/kilo) on the day of induction, and on days 1 , 2, 3 and 4 postinduction. These mice also received twice daily injections of 0.3 ml of plasma from mice treated with tetracycline on the day of induction and on days 1 , 2, 3 and 4 postinduction;
  • mice received 0.3 ml of plasma from tetracycline-injected mice twice daily on the day of induction and on days 1 , 2, 3 and 4 postinduction;
  • mice received intramuscular injection of tetracycline and 0.3 ml of plasma from tetracycline-injected mice once daily on the day of induction and on days 1 , 2, 3 and 4 postinduction;
  • mice received 0.3 ml of plasma from PBS-injected mice twice daily on the day of induction and on days 1 , 2, 3 and 4 postinduction.
  • mice Ten mice were not induced for septic shock and served as normal controls.
  • mice with the septic shock treated with control plasma i.e. , plasma prepared from PBS-infected mice, survived 36 hours postinduction.
  • combination therapy of tetracycline and tetracycline-stimulated plasma boosts the survival rate of the mice with the SEB-induced septic shock.
  • EXAMPLE 1 Effects of Plasma from Tetracycline-injected on the Outcome of Septic Shock in Mice and protocols for testing of treatment hemorrhagic fevers in a rodent model
  • mice sensitized by administration of D-galactosamine and injected intraperitoneally with Staphylococcus enterotoxin B (SEB) are a well-established model for human septic shock with accompanying disseminated intravascular coagulation. This process is driven by the release of TNF ⁇ and IL-1 by antigen- stimulated macrophages. In this mouse model, death usually occurring within 24 hr of antigen challenge.
  • SEB Staphylococcus enterotoxin B
  • mice Sixty, 7-8 week old female Balb/c mice (H 2 4 haplotype) are injected intramuscularly with tetracycline (58 mg/kilo in OJ ml of sterile PBS).
  • Plasma (citrated) is collected from these mice at 24 hr postinjection.
  • One 0.2 ml sample of plasma from each mouse is set aside for testing for the presence of IL-1 R and TNF ⁇ -RI&ll, the reminder of the plasma from each mouse is pooled. After removing a small sample from this pool for testing for the cytokines of interest, such as IL-1 an TNF ⁇ , the reminder of the plasma pool is be stored at -85 °C until needed. 3.
  • 7-8 week old female Balb/c mice (H 2 d ) are injected in with
  • mice Fifty, 6-8 week old female Balb/c mice (Haplotype as above) receive concurrent ip injections of 25/vg of SEB and 20 mg of galactosamine. 10 mice remain untreated and serve as negative controls 1 0 mice receive an im injection of tetracycline (58 mg/kilo) on the day of induction, and on days 1 , 2, 3 and 4 postinduction. These mice also receive twice daily injections of 0.3 ml of plasma from mice treated with tetracycline on the day of induction and on days 1 , 2, 3 and 4 postinduction.
  • tetracycline 58 mg/kilo
  • mice receive 0.3 ml of plasma from tetracycline-injected mice twice daily on the day of induction and on days 1 , 2, 3 and 4 postinduction.
  • mice receive im injection of tetracycline and 0.3 ml of serum from tetracycline injected mice once daily on the day of induction and on days 1 , 2, 3 and 4 postinduction.
  • mice receive 0.3 ml of serum from PBS-injected mice twice daily on the day of induction and on days 1 , 2, 3 and 4 postinduction.
  • mice as described above are not treated for induction of Septic Shock and will serve as normal controls. 3. Mortality among all groups of animals is recorded four times daily.
  • mice infection used 5 LD 50 of YFV.
  • group A control for YFV without treatment - 10 mice.
  • group B - treatment of YFV by Doxycycline from the third day after infection, every day.
  • group C - treatment of YFV by Doxycycline from the third day after infection every 1 2h.
  • group D - treatment of YFV by serum (with IL-1 RA and sTNF) from the third day after infection, every day.
  • group F - control virus for detection soluble receptors (sTNF, IL-1 RA) and cytokines (TNF and IL-1 ) in blood after infection (days 1 , 2, 3, 4, 5, 6) - 20 mice. Investigation of treatment of lassa fever infection
  • mice for group (80 mice for group) 2. For mice infection used 1 0 LD 50 of LFV.
  • IL-1 Ra Numerous bioassays used to detect and quantitate IL-1 Ra are known.
  • An assay used herein to determine IL-1 Ra in blood and blood-derived fractions that have been treated with tetracycline or tetracycline-like compounds is the Quantikine IL-1 ra Immunoassay, which is solid phase ELISA designed to measure IL-1 Ra in cell culture supernate, serum, and plasma. It contains £.co//-derived recombinant human IL-1 Ra as well as antibodies raised against the recombinant factor. This immunoassay has been shown to accurately quantitate the recombinant human IL-1 ra.
  • This assay employs the quantitative sandwich enzyme immunoassay technique.
  • a monoclonal antibody specific for IL-1 Ra has been pre-coated onto a microplate.
  • Standards and samples are pipetted into the wells and any IL-1 Ra present is bound by the immobilized antibody.
  • an enzyme-linked polyclonal antibody specific for IL-1 Ra is added to the wells.
  • a substrate solution is added to the wells and color develops in proportion to the amount of IL-1 Ra bound in the initial step. The color development is stopped and the intensity of the color is measured.
  • Assays for TNFs A monoclonal antibody specific for IL-1 Ra has been pre-coated onto a microplate.
  • Standards and samples are pipetted into the wells and any IL-1 Ra present is bound by the immobilized antibody.
  • an enzyme-linked polyclonal antibody specific for IL-1 Ra is added to the wells.
  • a substrate solution is added to the wells and color develops in proportion to the amount of IL-1 Ra bound in
  • Bioassays for sTNFR II typically involves measurement of the inhibitory effect of the soluble receptor on the cytotoxic activity TNF- ⁇ on a susceptible cell line.
  • the Quantikine human sTNF Rl Immunoassay is a solid phase ELISA designed to measure sTNF Rl in cell culture supernate, serum, plasma and urine. It contains E. co/7-expressed, recombinant human sTNF Rl, as well as antibodies raised against this polypeptide.
  • the recombinant protein represents the non- glycosylated, N-terminal methionyl form of the naturally occurring human soluble Type I receptor for TNF with an apparent molecular weight of approximately 1 8.6 kDa.
  • This assay employs the quantitative sandwich enzyme immunoassay technique.
  • a monoclonal antibody specific for sTNF Rl has been pre-coated onto a microplate.
  • Standards and samples are pipetted into the wells an any sTNF Rl present is bound by the immobilized antibody.
  • an enzyme-linked polyclonal antibody specific for sTNF Rl is added to the wells.
  • a substrate solution is added to the wells and color develops in proportion to the amount of sTNF Rl bound in the initial step. The color development is stopped and the intensity of the color is measured.

Abstract

Compositions et procédés servant à traiter et/ou à prévenir chez des mammifères, en particulier, les humains, des réactions et des maladies inflammatoires aiguës, telles que des maladies ou des symptômes viraux hémorragiques, des chocs septiques ou d'autres maladies présentant ces symptômes. Plus particulièrement, compositions et combinaisons de compositions et de procédés servant à traiter ou à prévenir des maladies, spécifiquement, des maladies inflammatoires aiguës présentant des réactions pathologiques du système immunitaire, telles que des maladies virales hémorragiques, des chocs septiques, des polyarthrites rhumatoïdes ou d'autres maladies autoimmunes, des troubles cardio-vasculaires aigus, des attaques et des phases aiguës de la sclérose en plaques, des maladies dégénératives ou d'autres maladies impliquant l'expression délétère de cytokines et d'autres facteurs, y compris le facteur de nécrose tumorale (TNF) et interleukine-1 (IL-1). Compositions enrichies en récepteur de cytokines et procédés servant à préparer ces compositions.
EP00928635A 1999-04-27 2000-04-26 Compositions contenant des tetracyclines et servant a traiter des infections et d'autres maladies virales hemorragiques Withdrawn EP1171163A1 (fr)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US30127499A 1999-04-27 1999-04-27
US301274 1999-04-27
PCT/US2000/011700 WO2000064479A1 (fr) 1999-04-27 2000-04-26 Compositions contenant des tetracyclines et servant a traiter des infections et d'autres maladies virales hemorragiques

Publications (1)

Publication Number Publication Date
EP1171163A1 true EP1171163A1 (fr) 2002-01-16

Family

ID=23162676

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00928635A Withdrawn EP1171163A1 (fr) 1999-04-27 2000-04-26 Compositions contenant des tetracyclines et servant a traiter des infections et d'autres maladies virales hemorragiques

Country Status (3)

Country Link
EP (1) EP1171163A1 (fr)
AU (1) AU4684000A (fr)
WO (1) WO2000064479A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11604026B2 (en) 2019-03-14 2023-03-14 Terumo Bct Biotechnologies, Llc Lyophilization loading tray assembly and system
US11634257B2 (en) 2017-10-09 2023-04-25 Terumo Bct Biotechnologies, Llc Lyophilization container and method of using same

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6613756B2 (en) 2000-05-05 2003-09-02 Wisconsin Alumni Research Foundation Use of tetracycline derivatives in treating multiple sclerosis
US6673545B2 (en) 2000-07-28 2004-01-06 Incyte Corporation Prostate cancer markers
US7033790B2 (en) 2001-04-03 2006-04-25 Curagen Corporation Proteins and nucleic acids encoding same
US20040092490A1 (en) * 2001-04-24 2004-05-13 Michael Draper Substituted tetracycline compounds for the treatment of malaria
US20060194773A1 (en) * 2001-07-13 2006-08-31 Paratek Pharmaceuticals, Inc. Tetracyline compounds having target therapeutic activities
EP2332550A1 (fr) * 2001-07-13 2011-06-15 Paratek Pharmaceuticals, Inc. Composés de tétracycline pour le traitement des maladies neurodégénératives
AU2002247905A1 (en) * 2002-03-28 2003-10-13 Markus Fritzsche Antibody against an epitope of the b. burgdorferi flagellar basal rod protein (fbrp)
AU2003287218C1 (en) * 2002-10-24 2010-07-15 Paratek Pharmaceuticals, Inc. Substituted tetracycline compounds for the treatment of malaria
EP2322203A3 (fr) * 2002-10-29 2011-07-27 Genentech, Inc. Les compositions et les methodes pour le traitement de maladies liees immunisees
EP2314676A1 (fr) * 2002-11-26 2011-04-27 Genentech, Inc. Compositions et procédés pour le traitement de maladies liées au système immunitaire
US7196093B2 (en) 2003-04-09 2007-03-27 General Atomics Reversible inhibitors of SAH hydrolase and uses thereof
US7868011B2 (en) 2003-04-09 2011-01-11 General Atomics Use of reversible inhibitors of S-adenosyl-L-homocysteine hydrolase for treating lupus
US7517887B2 (en) 2003-04-09 2009-04-14 General Atomics Reversible inhibitors of S-adenosyl-L-homocysteine hydrolase and uses thereof
US8999675B2 (en) 2009-08-31 2015-04-07 Gen-Probe Incorporated Dengue virus assay
EP3265493B1 (fr) 2015-03-02 2024-01-10 180 Therapeutics LP Méthode de traitement d'un trouble fibrotique localisé à l'aide d'un antagoniste de l'il-33
CN105078905B (zh) * 2015-08-13 2017-10-20 海南通用康力制药有限公司 一种注射用盐酸多西环素冻干粉针剂的制备方法
CN110772637A (zh) * 2019-11-22 2020-02-11 上海市第六人民医院 rhIL-1Ra在制备治疗急性肝衰竭药物中的应用

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH04178359A (ja) * 1990-07-01 1992-06-25 Kuraray Co Ltd テトラサイクリン誘導体
RU2041711C1 (ru) * 1992-10-09 1995-08-20 Научно-исследовательский ветеринарный институт Нечерноземной зоны РФ Способ лечения острых респираторных болезней телят
CA2103189C (fr) * 1992-11-17 2005-05-03 Lorne M. Golub Inhibition des liaisons croisees du collagene en exces au cours du diabete par des tetracyclines, y compris par des tetracyclines non antimicrobiennes chimiquement modifiees
US5789395A (en) * 1996-08-30 1998-08-04 The Research Foundation Of State University Of New York Method of using tetracycline compounds for inhibition of endogenous nitric oxide production
DE69739375D1 (de) * 1996-11-27 2009-06-04 Immunex Corp Verfahren zur regulierung der stickstoffmonoxid-erzeugung
PT1676579E (pt) * 1998-05-08 2009-03-24 Univ Miami Utilização de tetraciclinas sub-antimicrobianas para o tratamento de rosácea ocular

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0064479A1 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11634257B2 (en) 2017-10-09 2023-04-25 Terumo Bct Biotechnologies, Llc Lyophilization container and method of using same
US11604026B2 (en) 2019-03-14 2023-03-14 Terumo Bct Biotechnologies, Llc Lyophilization loading tray assembly and system
US11609043B2 (en) 2019-03-14 2023-03-21 Terumo Bct Biotechnologies, Llc Lyophilization container fill fixture, system and method of use
US11609042B2 (en) 2019-03-14 2023-03-21 Terumo Bct Biotechnologies, Llc Multi-part lyophilization container and method of use
US11740019B2 (en) 2019-03-14 2023-08-29 Terumo Bct Biotechnologies, Llc Lyophilization loading tray assembly and system
US11747082B2 (en) 2019-03-14 2023-09-05 Terumo Bct Biotechnologies, Llc Multi-part lyophilization container and method of use
US11815311B2 (en) 2019-03-14 2023-11-14 Terumo Bct Biotechnologies, Llc Lyophilization container fill fixture, system and method of use

Also Published As

Publication number Publication date
AU4684000A (en) 2000-11-10
WO2000064479A1 (fr) 2000-11-02

Similar Documents

Publication Publication Date Title
US20020077276A1 (en) Compositions and methods for treating hemorrhagic virus infections and other disorders
WO2000064479A1 (fr) Compositions contenant des tetracyclines et servant a traiter des infections et d'autres maladies virales hemorragiques
Huang et al. Dengue virus infects human endothelial cells and induces IL-6 and IL-8 production.
Roake et al. Dendritic cell loss from nonlymphoid tissues after systemic administration of lipopolysaccharide, tumor necrosis factor, and interleukin 1.
ES2458349T3 (es) Polipéptidos homólogos IL-17 y usos terapéuticos de los mismos
AU590872B2 (en) Neovascularization inhibitors and methods for their production and use
Kolls et al. Differential effects of in vivo ethanol on LPS-induced TNF and nitric oxide production in the lung
US20200237822A1 (en) Compositions and methods for stimulating natural killer cells
US20150183834A1 (en) Filoviral Immunosuppressive Peptides
Chang et al. Production of interleukin-1 (IL-1) and IL-1 inhibitor by human monocytes exposed to dengue virus
CN101633698B (zh) 一种免疫融合蛋白及其编码基因与应用
CA2148119A1 (fr) Interferon tau, polypeptides derives et mode d'emploi de ces substances
US5730976A (en) Method for treating macrophage pathogen infections by TGF-B antagonists
JP3312946B2 (ja) ウイルス感染・増殖抑制剤
WO2002069960A2 (fr) Utilisation de composes specifiques et en particulier des inhibiteurs de la kinase pour traiter des infections virales
DK2046809T3 (en) WSX-1 / IL-27 AS A TARGET OBJECTIVE FOR ANTI-INFLAMMATORY REACTIONS
US7419789B2 (en) Method of inhibiting binding of Dengue virus to a human cell with DC-SIGN blockers
EP1466619A2 (fr) Procédé pour la modulation de l'apoptose de cellules
JP7302795B2 (ja) コロナウイルスの感染防御方法
WO2016207408A1 (fr) Nouveaux vaccins pour la prévention et le traitement de la malaria
US20140128317A1 (en) Antiviral agent comprising recombinant mistletoe lectins
TW201210614A (en) Dengue vaccine, medicinal composition comprising the same, and nucleotide sequence
Lorenzo et al. Different peptides from hemorrhagic septicemia rhabdoviral proteins stimulate leucocyte proliferation with individual fish variation
KR101074005B1 (ko) 백혈구의 혈관외유출 억제 활성을 갖는 폴리펩타이드 또는 그의 융합 단백질
JP3770624B2 (ja) ウィルス感染・増殖抑制剤

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010717

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL PAYMENT 20010717;LT PAYMENT 20010717;LV PAYMENT 20010717;MK PAYMENT 20010717;RO PAYMENT 20010717;SI PAYMENT 20010717

17Q First examination report despatched

Effective date: 20021017

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20030228