EP1141381A1 - Procede de detection d'inhibiteurs de biosynthese de la riboflavine - Google Patents

Procede de detection d'inhibiteurs de biosynthese de la riboflavine

Info

Publication number
EP1141381A1
EP1141381A1 EP99963535A EP99963535A EP1141381A1 EP 1141381 A1 EP1141381 A1 EP 1141381A1 EP 99963535 A EP99963535 A EP 99963535A EP 99963535 A EP99963535 A EP 99963535A EP 1141381 A1 EP1141381 A1 EP 1141381A1
Authority
EP
European Patent Office
Prior art keywords
phosphate
dihydroxy
butanone
mixture
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP99963535A
Other languages
German (de)
English (en)
Inventor
Adelbert Bacher
Stefan Herz
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Individual
Original Assignee
Individual
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from DE19942174A external-priority patent/DE19942174A1/de
Application filed by Individual filed Critical Individual
Publication of EP1141381A1 publication Critical patent/EP1141381A1/fr
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/25—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving enzymes not classifiable in groups C12Q1/26 - C12Q1/66
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/34—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving hydrolase
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/90—Enzymes; Proenzymes
    • G01N2333/914—Hydrolases (3)
    • G01N2333/978—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G01N2500/20—Screening for compounds of potential therapeutic value cell-free systems

Definitions

  • the present invention relates to the field of screening for inhibitors of riboflavin biosynthesis. Specifically, the invention relates to methods of screening for inhibitors of GTP cyclohydrolase II or 3,4-dihydroxy-2-butanone 4-phosphate synthase as well as for mutants that exhibit resistance to an inhibitor. The invention also relates to kits of parts for said screening methods. The invention relates further to the application of these screening methods for detecting inhibitors useful as herbicides, or fungicides or as antibacterial agents. The invention relates furthermore to plant enzymes for performing said screening methods.
  • the human population is situated in an ecology with an ever changing confrontation with dangerous organisms, in the agricultural area weeds, fungi or the like and in the medical or veterinarmedical area pathogenic bacteria, fungi or the like. There is a continued need to develop ever new chemical inhibitors against such undesirable organisms.
  • riboflavin As an indispensible requirement of numerous redox enzymes, many of which are crucial for the metabolism. All plants, fungi and many bacteria generate riboflavin biosynthetically, whereas all animals require a nutritional source of riboflavin (Vitamin B 2 ) . Therefore, an inhibitor for an enzyme in the biosynthesis of riboflavin in plants, fungi and bacteria would not interfere with the metabolism of animals. Furthermore, the absolute amount of riboflavin for cellular activity is low. Therefore, only small amounts of the enzymes of riboflavin biosynthesis are found in cells. This in turn means that only small amounts of an inhibitor for such an enzyme would be required. This makes the enzymes of riboflavin biosynthesis an ideal target for novel inhibitors.
  • Vitamin B 2 riboflavin
  • Fig. 1 The biosynthetic pathway of Vitamin B 2 (riboflavin) (Fig. 1 ) has been studied in considerable detail in bacteria and yeasts (for review see Bacher, 1 991 ; Bacher et al., 1 996).
  • the biosynthetic formation of one molecule of riboflavin (7) requires one molecule of GTP and two molecules of ribulose 5-phosphate.
  • GTP (1 ) is initially converted to the committed product, 2,5-diamino-6-ribosylamino-4(3H)- pyrimidinone 5'-phosphate (2) by the enzyme, GTP cyclohydrolase II (step A).
  • This intermediate is converted to 5-amino-6-ribitylamino-2,4( 1 H , 3H)- pyrimidinedione (3) by a sequence of deamination, side chain reduction, and dephosphorylation.
  • the compound (3) is converted to 6, 7-dimethyl-8- ribityllumazine (4) by condensation with 3,4-dihydroxy-2-butanone 4-phosphate (5) which is obtained enzymatically from ribulose 5-phosphate (6) by 3,4- dihydroxy-2-butanone 4-phosphate synthase (step B) .
  • the formation of (5) involves an unusual skeletal rearrangement with a loss of C-4 of the substrate as formate.
  • the ribA gene of Bacillus subtilis specifies a bifunctional protein catalyzing the formation of the pyrimidine (2) and of the carbohydrate (5) from GTP and ribulose- 5-phosphate, respectively. Similar proteins have been predicted on the basis of DNA sequence information in several other microorganisms such as Bacillus amyloliquefaciens, Synechocystis sp. , Mycobacterium tuberculosis, Actinobacillus pleuropneumoniae or Aquifex aeolicus (Gusarov et a/., 1997; Kaneko et al., 1996; Cole et al.
  • This first object is achieved by a method for screening for the presence or absence of inhibition of GTP cyclohydrolase II activity, comprising the following steps:
  • step (e) determining the presence of inhibition of GTP cyclohydrolase II by observation of whether the level detected in step (d) is lower than the level detected in step (b) .
  • the second object is achieved by a method for screening for the presence or absence of inhibition of GTP cyclohydrolase II comprising the following steps:
  • step (e) determining the presence of inhibition or resistance to inhibition respectively, of GTP cyclohydrolase II by observation of whether the level detected in step (d) is similar to the level detected in step (b) . It is a third object of the present invention to provide a method for screening chemical test samples for the presence or absence of inhibition of 3,4-dihydroxy- 2-butanone 4-phosphate synthase activity for finding an inhibitor.
  • the third object is achieved by a method for screening for the presence or absence of inhibition of 3,4-dihydroxy-2-butanone 4-phosphate synthase activity, comprising the following steps:
  • step (e) determining the presence of inhibition of 3,4-dihydroxy-2-butanone 4- phophate synthase by observation of whether the level detected in step (d) is lower than the level detected in step (b).
  • the fourth object is achieved by a method for screening for the presence or absence of inhibition of 3,4-dihydroxy-2-butanone 4-phosphate synthase activity, comprising the following steps:
  • step (e) determining the presence of resistance to inhibition of 3,4-dihydroxy-2- butanone 4-phosphate synthase by observation of whether the level detected in step (d) is similar to the level detected in step (b).
  • the enzyme sequence may be a plant type for finding herbicides, a fungal type for finding fungicides or a bacterial typ for finding inhibitors against pathogenic bacteria.
  • kits of parts may be used, whereby the required components are partitioned such that upon mixing of the parts the enzymatic reaction can be initiated at a certain point in time.
  • the enzymes are promoted with a bivalent metal ion.
  • the enzymatic reaction may be stopped at a certain point in time by adding a chelating agent for said metal ion.
  • the level of the products of the reaction of the target enzymes may be determined directly or by chemical or enzymatic derivatization.
  • the level of the product may either be determined at one predetermined point of time or consecutively at several predetermined points of time.
  • the entire insert of EST clone 41G4T7 was sequenced by the automated dideoxynucleotide method using a primer walk strategy.
  • the insert (designated i41G4T7) had a length of 2525 bp.
  • the segment comprising bp 109-1297 is similar to the ribA gene of B. subtilis; the segments containing bp 563-1485 and 2262-2505 are identical with the A. thaliana sequence D45165 (Genbank/DDJB/EMBL/GSDB/NCBI accession no.) which was thought to be a GTP cyclohydrolase II (Kobayashi et al., 1995).
  • the transposon IS1 was located at BP 1486-2261.
  • a RACE experiment was performed by reverse PCR using mRNA from A. thaliana as template.
  • the RACE product which had a length of 800 bp, was sequenced and was shown to contain 556 bp which were not present in clone 41 G4T7.
  • the coding region of the extended cDNA contains 1 629 bp specifying a predicted protein with 543 aa and a mass of 59,055 Da.
  • the cognate gene is designated ribA .
  • the sequence is shown in Annex B.
  • the 5' untranslated region is 284 bp long.
  • the 3' untranslated region has a length of 372 bp.
  • the putative 3,4-dihydroxy-2-butanone 4-phosphate synthase domain of the Arabidopsis gene is preceded by a sequence of about 1 20 amino acids which is devoid of similarity to any sequence in the database.
  • the first 25 amino acids of the protein contain 1 3 serine residues (including a cluster of 4 consecutive serine residues). Thirtyfour residues in the N-terminal 1 20 amino acid residues are serine or threonine.
  • the chromosomal ribA gene of Arabidopsis was amplified in two parts by PCR using chromosomal DNA as template. The amplificates were sequenced. It was found that this gene (EMBL database accession no. AJ000053) includes six introns with a total of 700 bp.
  • the coding region of the A. thaliana gene was inserted into the expression vector pNCO 1 1 3 (Stuber et al. , 1 990) yielding the plasmid pAE.
  • This plasmid was electrotransformed into ribA and ribB mutant strains of E. coli which are deficient of 3,4-dihydroxy-2-butanone 4-phosphate synthase and GTP cyclohydrolase II, respectively, and which are, therefore, unable to grow on LB medium without supplementation of riboflavin (Katzenmeier, 1 991 ).
  • the plasmid pNCO 1 1 3 transformed into the mutants served as a negative control.
  • the recombinant mutant strains carrying the plasmid with the ribA gene of Arabidopsis grow at normal rate in the absence of external riboflavin. It follows that the ribA gene of Arabidopsis directs the synthesis of a protein which can serve as GTP cyclohydrolase II and as 3,4-dihydroxy-2-butanone 4-phosphate synthase in £. coli cells.
  • the A. thaliana gene therefore codes for a bifunctional GTP cyclohydrolase 11/ 3,4-dihydroxy-2-butanone 4-phosphate synthase.
  • a gene with similartiy to the ribA gene of A. thaliana was amplified from a tomato cDNA library by PCR using degenerate primers.
  • the DNA segment was sequenced using a primer walk strategy and was shown to contain an open reading frame (EMBL database accession no. AJ002298) of almost the same size as the A. thaliana gene (Annex C) .
  • the predicted protein sequence contains 552 amino acids and has a calculated mass of 59793 Da.
  • the predicted protein is similar to the RibA protein of A. thaliana. Most notably, it also has a serine and threonine rich N-terminus of about 1 20 amino acids preceding the 3,4-dihydroxy-2-butanone 4-phosphate synthase domain.
  • the N-terminus of the tomato gene has little similarity to the A. thaliana N-terminus.
  • the following 3,4-dihydroxy-2-butanone 4-phosphate synthase and cyclohydrolase II domains are very similar to the Arabidopsis enzyme.
  • the deduced amino acid sequence of the ribA gene of A. thaliana shows also similiarity with bifunctional GTP cyclohydrolase II/3,4-dihydroxy-2-butanone 4- phosphate synthase sequences from Actinobacillus pleuropneumoniae and with putative bifunctional enzymes from Bacillus amyloliquef aciens , M. tuberculosis and Synechocystis sp.
  • the A. thaliana gene is also similar to genes from Photobacterium phosphoreum and Photobacterium leiognathi.
  • thaliana enzyme shows similarity to monofunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase sequences not only from Escherichia coli, but also H. influenzae and S. cerevisiae.
  • the C-terminal GTP cyclohydrolase II domain shows similarity to monofunctional GTP cyclohydrolase II sequences from not only E. coli, but also H. influenzae, S. cerevisiae, Candida guilliermondii, P. phosphoreum and Azospirillum brasilense.
  • Originator for the construction of an expression vector is cDNA of a plant, preferably of a dicotyle or monocotyle plant, for example cDNA from Arabidopsis thaliana or Lycopersicon esculentum.
  • the ribA gene is amplified by PCR with specific primers and cDNA from the corresponding plant as template.
  • the gene may be amplified in two overlapping parts. The two parts are digested with a restriction enzyme in the overlapping area and ligated together afterwards to yield the complete gene.
  • the cDNA of one or both parts may originate from an existing EST-clone. If only the GTP cyclohydrolase II part or the 3,4-dihydroxy-2-butanone 4-phosphate synthase part of ribA should be expressed, only the corresponding part of the gene is amplified with the above described methods.
  • the RibA protein from various plants for example A. thaliana or L. esculentum includes a signal sequence of about 1 20 amino acids which was found not to be essential for enzyme activity. This signal sequence may be excluded in the recombinant DNA construct.
  • the amplified DNA fragment is modified by two consecutive PCR amplifications with modifying primers. In the first PCR reaction a ribosomal binding site preceding the start codon at an optimal distance is introduced at the 5'-end. A recognition site for a restriction enzyme, for example Sail, BspMI or Pvu1 is introduced at the 3'-end. The preferred recognition site is Sail. In the second PCR reaction the product of the first PCR reaction is used as template.
  • a recognition site for the restriction enzyme EcoRI preceding the ribosomal binding site is introduced with a modifying primer.
  • the amplified DNA fragment is digested with the corresponding restriction enzymes, for example EcoRI and Sail.
  • This DNA fragment is inserted into a vector DNA capable of autonomous replication in the host microorganism to give a recombinant plasmid containing said DNA (Fig. 2) .
  • This recombinant plasmid is used to transform the host microorganism, for example Escherichia coli or Bacillus subtilis.
  • the preferred host is E. coli.
  • the expression of plant proteins may be poor in the host organism.
  • the recombinant plasmid may include a gene or a part of a gene without stop codon preceding the ribA gene or parts of it in the same reading frame.
  • a preferred gene for this purpose is the malE gene from E. coli.
  • the expression of such a recombinant DNA generates a fusion protein between the maltose binding protein (MBP) from E. coli and the plant RibA protein.
  • MBP maltose binding protein
  • Fig. 3 A construct with a signal sequence S is shown in Fig. 3a, with a maltose binding sequence malE and a signal sequence S in Fig. 3b and with a maltose binding sequence malE in Fig. 3c.
  • the strains harbouring the expression vectors can be cultivated in conventional culture media at 1 5 to 40 °C.
  • the preferred culture medium is Luria Bertani medium and the preferred temperature is 37 °C.
  • the E. coli strains are induced with 0.2 to 5 mM isopropyl-R-D-thiogalactosid at an optical density from 0.5 to 0.8.
  • the cells are incubated between 2 and 1 2 h, preferably 5 h.
  • the cells are harvested by centrifugation and washed with saline.
  • the cells are lysed with lysozyme and/or disrupted with a sonifier.
  • the MBP-ribA fusion protein is purified from crude extract by affinity chromatography with an amylose resin.
  • GTP is converted to 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5'-phosphate by the action of GTP cyclohydrolase II.
  • the enzyme can be promoted by a bivalent metal ion such as Ba 2 + , Ca 2 + , Sr 2 + , Co 2 + , Fe 2 + , Mg 2 + , Mn 2 + or Zn 2 + .
  • the preferred ion is Mg 2 + .
  • the reaction mixture should preferably contain an antioxidative substance such as dithiothreitol (DTT), dithioerythritol (DTE), butylhydroxyanisole (BHA) or butylhydroxytoluene (BHT) .
  • DTT dithiothreitol
  • DTE dithioerythritol
  • BHA butylhydroxyanisole
  • BHT butylhydroxytoluene
  • the assay can be started by adding one of the needed substances to a mixture of the others.
  • the enzyme is added to a solution of GTP, Mg 2+ , DTT in a buffer at pH 6 to 9,5, preferably 8, 5.
  • the reaction can be incubated for 1 to 60 min at 10 to 40 °C. Preferable it is incubated for 20 min. at 37 °C.
  • the assay can be stopped by denaturating the enzyme with trichloroacetic acid, acetone, sodium dodecyl sulfate or heating at temperatures between 60 to 100 °C.
  • the assay can also be stopped by chelating the metal ion with complexing agent such as EDTA, iminodiacetic acid, 8-hydroxyquinolin, diphenylcarbazid, dithizon or glyoxal-bis-(2- hydroxyanil) .
  • complexing agent such as EDTA, iminodiacetic acid, 8-hydroxyquinolin, diphenylcarbazid, dithizon or glyoxal-bis-(2- hydroxyanil) .
  • complexing agent such as EDTA, iminodiacetic acid, 8-hydroxyquinolin, diphenylcarbazid, dithizon or glyoxal-bis-(2- hydroxyanil) .
  • complexing agent such as EDTA, iminodiacetic acid, 8-hydroxyquinolin, diphenylcarbazid, dithizon or glyoxal-bis-(2- hydroxyanil) .
  • EDTA EDTA
  • the assay is carried out with otherwise identical mixtures with and without test sample of a possible inhibitor.
  • the enzyme product 2,5-diamino-6-ribosylamino- 4(3H)-pyrimidinone 5'-phosphate can be detected directly without derivatization, preferably photometrically, preferentially after purification by HPLC.
  • the pyrimidinone can be identified by UV absorbance at 293 nm.
  • the extinction coefficient is 1 2, 100 M "1 cm "1 .
  • the product can also be monitored by diode array multiwavelength detection (200 - 600 nm).
  • the assay may also be performed in a quartz cuvette without stopping the reaction.
  • the reaction rate can then be determined directly by monitoring the absorbance of GTP at 252 nm and of 2,5- diamino-6-ribosylamino-4(3H)-pyrimidinone 5'-phosphate at 293 nm.
  • the pyrimidinone can also be detected by chemical derivatization, preferably by reaction with a vicinal dioxo compound (Fig. 4) .
  • vicinal diketo compounds of the formula R 1 -CO-CO-R 2 , wherein R 1 and R 2 are independently aliphatic, alicyclic, aromatic or heteroaromatic residues, such as diphenyldiketone, phenyl-methyl-diketone, camphoro quinone; preferably C,_ 6 alkyl rests.
  • the most preferred diketone is diacetyl (2,3-butanedione) (8).
  • the enzyme activity of GTP cyclohydrolase II can also be monitored after enzymatic derivatization, preferably by converting 2, 5-diamino-6-ribosylamino- 4(3H)-pyrimidinone ⁇ '-phosphate into 5-amino-6-ribitylamino-2,4( 1 H, 3H)- pyrimidinedione 5'-phosphate ( 10) by action of a fungal, preferably yeast, 2,5- diamino-6-ribosylamino-4(3H)-pyrimidinone 5'-phosphate reductase (Fig. 4); for the sequence Annex D is pointed out.
  • This reductase can be expressed in E.
  • the screening can be done with a bifunctional enzyme of a monocotyledonous or dicotyledonous plant. It is also possible to use only the GTP cyclohydrolase II domain in a first step screening and bifunctional enzyme in a second step screening. It is also possible to use a bacterial or fungal enzyme. Screening for the presence or absence of inhibition of 3,4-dihydroxy-2-butanone 4-phosphate synthase activity
  • Ribulose-5-phosphate is converted to 3,4-dihydroxy-2-butanone 4-phosphate by the action of 3,4-dihydroxy-2-butanone 4-phosphate synthase.
  • the enzyme requires a bivalent metal ion such as Ba 2 + , Ca 2 + , Sr 2 + , Co 2 + , Fe 2 + , Mg 2 + , Mn 2 + or Zn 2 + .
  • the preferred ion is Mg 2 + .
  • the assay can be started by adding one of the needed substances to a mixture of the others.
  • the enzyme is added to a solution of ribulose-5-phosphate and Mg 2 + in buffer at pH 6 to 9, 5, preferably 7,5.
  • the assay is carried out with otherwise identical mixtures with and without a test sample of a possible inhibitor.
  • the reaction can be incubated for 1 to 90 min at 10 to 40 °C. Preferably it is incubated for 60 min. at 37 °C.
  • the substrate for 3,4-dihydroxy-2-butanone 4-phosphate synthase, ribulose 5-phosphate is commercially available, but at considerable cost. It is preferably generated in situ by isomerization of ribose 5-phosphate catalyzed by pentose phosphate isomerase.
  • the assay can be stopped by chelating the metal ion with complexing agent such as EDTA, iminodiacetic acid, 8-hydroxyquinolin, diphenylcarbazid, dithizon or glyoxal-2-bis-(2-hydroxyanil).
  • complexing agent such as EDTA, iminodiacetic acid, 8-hydroxyquinolin, diphenylcarbazid, dithizon or glyoxal-2-bis-(2-hydroxyanil).
  • the preferred complexing agent is EDTA.
  • For detection enzymatic derivatization is possible.
  • the product 3,4- dihydroxy-2-butanone 4-phosphate can be converted enzymatically with 5-amino- 6-ribitylamino-2,4( 1 H,3H)-pyrimidinedione to 6,7-dimethyI-8-ribityllumazine in the presence of 6,7-dimethyl-8-ribitylIumazine synthase or to riboflavin in the presence of 6,7-dimethyl-8-ribityl-lumazine synthase and riboflavin synthase.
  • 5-Amino-6- ribitylamino-2,4( 1 H,3H)-pyrimidinedione decomposes rapidly in the presence of molecular oxygen and has to be stored, therefore, as aqueous solution containing an antioxidative substance such as dithiothreitol (DTT) or dithioerythrol (DTE) at temperatures below 0 °C.
  • DTT dithiothreitol
  • DTE dithioerythrol
  • the assay can be stopped and the detection reaction started by adding a solution of complexing agent, 5-amino-6-ribitylamino- 2,4( 1 H , 3H)-pyrimidinedione, antioxidative substance, 6 , 7-dimethyl-8- ribityllumazine synthase and optionally riboflavin synthase (Fig.
  • the detection reaction can be stopped by denaturating the enzymes with trichloroacetic acid, acetone, sodium dodecyl sulfate or heating at temperatures between 60 to 100 °C.
  • 6,7-Dimethyl-8- ribityllumazine can be detected photometrically at 41 0 nm, if only the lumazine synthase is added.
  • Riboflavin can be detected photometrically at 445 nm, if the lumazine synthase and the riboflavin synthase are added .
  • the extinction coefficient for riboflavin (pH 1 , 445 nm) is 1 1 ,500 M “1 cm “1 .
  • the extinction coefficient for 6,7-dimethyl-8-ribityllumazine (pH 1 , 41 0 nm) is 1 0,300 M ⁇ cm "1 .
  • 3,4-Dihydroxy-2-butanone 4-phosphate can also be detected after chemical derivatization, preferably with an aromatic or heteroaromatic ortho-diamine (Fig. 5) .
  • the aromatic or heteroaromatic ring may be substituted or unsubstituted. It may contain 1 to 3 substituents selected for the group of alkyl, halogen, alkoxy.
  • bifunctional enzyme of a monocotyledonous or dicotyledonous plant. It is also possible to use only the 3,4-dihydroxy-2-butanone 4-phosphate synthase domain in a first step screening and bifunctional enzyme in a second step screening. It is also possible to use a bacterial or fungal enzyme.
  • the screening methods described above may readily be used for screening for inhibition resistance after corresponding modification. It is merely necessary to add a specific inhibitor (previously determined by screening) and to use a biological test sample which contains a mutant of the plant-type enzyme in question.
  • the pellet was dissolved in 360 ⁇ l H 2 0 (bidestillated, sterile) .
  • the solution was centrifuged at 1 4,000 rpm for 1 0 min.
  • the supernatant was mixed with 40 ⁇ of 3 M sodium acetate and 1 ml of ethanol.
  • the RNA was precipitated overnight at -20°C, centrifuged at 1 4,000 rpm at 4°C for 1 5 min and washed twice with 500 ⁇ l of 75 % ethanol.
  • the pellet was airdried and dissolved in 500 ⁇ l of H 2 0 (bidestilled, sterile) .
  • mRNA from this crude RNA fraction was isolated with the Oligotex mRNA-lsolation kit (Quiagen).
  • RNA solution 500 ⁇ l was mixed with 500 ⁇ l 20 mM Tris hydrochloride, pH 7.5 containing 1 M NaCl, 2 mM EDTA and 0.2 % SDS. 30 ⁇ l Oligotex suspension were added and the mixture was incubated for 3 min at 65 ° and for 1 0 min at room temperature. The suspension was centrifuged for 2 min at 14,000 rpm and the supernatant was aspirated. The pellet was washed twice with 1 ml of 10 mM Tris hydrochloride, pH 7.5 containing 1 50 mM NaCl and 1 mM EDTA. The mRNA was eluted twice with 50 ⁇ l of preheated (70°C) 5 mM Tris hydrochloride buffer, pH 7.5
  • thaliana mRNA (4 ⁇ g) was electrophoresed at 40 V on a 2.2 M formaldehyde 1 % agarose gel. 4 ⁇ l of a RNA ladder (Gibco) was electrophoresed as a reference. The reference lane was cut off and stained in a 0.1 % toluidine blue solution for 1 0 min The other part of the gel was washed 4 times with H 2 O (DEPC treated) and transferred overnight to a Nytrans nylon membrane with 0.3 M trisodium citrate, pH 7.0 containing 3 M NaCl using the turboblotter system from Schleicher and Schuell. The probe was amplified from plasmid 41 G4T7 by PCR.
  • the plasmid was isolated from 5 ml of fresh overnight culture of EST-clone 41 G4T7 using the mini plasmid isolation kit from Quiagen.
  • the bacterial pellet was resuspended in 0.3 ml of 50 mM Tris hydrochloride, pH 8.0 containing 10 mM EDTA and 100 ⁇ g/ml RNase.
  • 0.3 ml of 200 mM sodium hydroxide containing 1 % SDS were added and incubated 5 min at room temperature.
  • 0.3 ml of chilled 3.0 M sodium acetate pH 5.5 were added and incubated on ice for 1 0 min.
  • the mixture was centrifuged for 1 5 min at 14,000 rpm in a minifuge.
  • the supernatant was removed and applied onto a Quiagen-tip 20 which was previously equilibrated with 1 ml of 50 mM MOPS, pH 7.0 containing 750 mM NaCl, 1 5 % ethanol and 0.1 5 % Triton X-1 00.
  • the Quiagen-tip was washed 4 times with 1 ml of 50 mM MOPS, pH 7.0 containing 1 000 mM NaCl and 1 5 % ethanol.
  • the DNA was eluted with 0.8 ml of 50 mM Tris hydrochloride, pH 8.5 containing 1 250 mM NaCl and 1 5 % ethanol.
  • the DNA was precipitated with 0.7 volumes of isopropanol, centrifuged at 14,000 rpm for 30 min and washed with 1 ml of cold 70 % ethanol.
  • the DNA sequence of 41 G4T7 was previously determined with a primer walk strategy. Sequencing was performed by the automated dideoxynucleotide method using an ABI Prism 377 DNA sequencer from Applied Biosystems Inc. with the ABI Prism Sequencing Analysis Software. EST-clone 41 G4T7 was obtained from the Arabidopsis Biological Resource Center, Ohio State University, USA.
  • the PCR mixture contained 25 pmol primer CTCCTCCTGCACCAGCCAATGG, 25 pmol primer TCAAGTTTCTCAGACAG ATCAAATG, 2U of Taq polymerase, 10 ⁇ l of buffer (Primezyme, Biometra), 1 .6 ng of plasmid 41 G4T7, and 20 nmol dNTPs in a total volume of 100 ⁇ l H 2 0.
  • the mixture was denaturated at 94°C for 5 min. Then 25 cycles (30 sec at 94°C, 45 sec at 50°C, 90 sec at 72°C) were performed. After incubation for 7 min at 72°C, the mixture was cooled at 4°C and the DNA was purified with a PCR purification kit (Quiagen) . 5 Volumes of buffer PB (Quiagen) were added to 1 volume of the PCR reaction, applied to a Quiaquick column and centrifuged for 1 min at 1 4,000 rpm. The flow through was discarded. 0.75 ml buffer PE (Quiagen) were added to the column and centrifuged as before.
  • the flow through was discarded and the column was centrifuged for an additional 1 min at 14,000 rpm.
  • the column was placed in a clean 1 .5 ml eppendorf tube. 50 ⁇ l of H 2 0 (bidestilled, sterile) were added to the column and it was centrifuged for 1 min at 14,000 rpm.
  • the flow through contains the purified DNA. 105 ng of the purified DNA in 1 5 ⁇ l H 2 0 were heated at 1 00°C for 5 min.
  • the membrane was prehybridized in a mixture of 50 % formamide, 50 % SSPE/Denhards solution/SDS ( 1 .0 g Ficoll, 1 .0 g polyvinylpyrrolidone, 1 .0 g BSA, 87.6 g NaCl, 1 3.8 g NaH 2 PO 4 , 3.7 g EDTA, 10 g SDS per liter) for 1 h at 42°C. 200 ⁇ l probe were added, and hybridization was performed at 42°C in 50 % formamide, 50 % SSPE/Denhards solution/SDS for 1 2 h.
  • the membranes were then washed twice with 2xSSPE containing 0.1 % SDS at room temperature for 1 5 min.
  • the radioactive bands were detected for 3.5 h on a Photolmager (Molecular Dynamics) .
  • a single band of about 2300 bp was found.
  • a 5' RACE was performed with the 5' RACE system from GibcoBRL.
  • the cDNA was generated with a specific primer from A. thaliana RNA.
  • the mixture contained 2.5 pmol of primer TCAACAGATGCTTCAGTGTGTCC and 990 ng of A. thaliana RNA in a total volume of 1 5 ⁇ l.
  • the mixture was denaturated at 70°C for 10 min and cooled on ice.
  • 2.5 ⁇ l of 10x reaction buffer (Gibco) 3 ⁇ l 25 mM MgCI 2 , 1 ⁇ l 10 mM dNTPs and 2.5 ⁇ l 0.1 M dithiothreitol were added.
  • the mixture was incubated at 42°C for 2 min, 1 ⁇ l (200 U/ ⁇ l) of reverse transcriptase Superscriptll (Gibco) were added. The mixture was incubated at 65 °C for another 1 5 min. It was then centrifuged, the temperature was adjusted to 55°C, and 1 ⁇ l of RNAseH (2 U/ ⁇ l) was added. After another 10 min incubation at 55 °C the mixture was cooled on ice.
  • the cDNA was amplified using an anchor primer (GibcoBRL) and a specific nested primer (CCTTCATTTTCCCTATCTTCATCATC) .
  • the product was purified by electrophoresis in a 2 % agarose gel.
  • the band at 800 bp was extracted using a gel extraction kit (Quiagen) and sequenced.
  • the DNA fragment was excised from the agarose gel with a scalpel. 3 volumes of buffer QX1 (Quiagen) were added to 1 volume of the excised gel and incubated at 50°C for 1 0 min. One gel volume of isopropanol was added.
  • the sample was applied to a Quiaquick column and centrifuged for 1 min at 14,000 rpm. The flow through was discarded. 0.75 ml buffer PE (Quiagen) were added to the column and centrifuged as before. The flow through was discarded and the column was centrifuged for an additional 1 min at 14,000 rpm. The column was placed in a clean 1 .5 ml eppendorf tube. 50 ⁇ l of H 2 0 (bidestilled. sterile) were added to the column and it was centrifuged for 1 min at 1 4,000 rpm. The flow through contained 4.2 ⁇ g of the purified DNA.
  • the cDNA insert was amplified from bp -75 to 1 485 by PCR.
  • the reaction mixtures contained 1 0 pmol of primer TCAAGTTTCTCAGACAGATCAAATG, 1 0 pmol primer GAAACAGCT ATGACCATGATTACG, 4.5 ng of plasmid 41 G4T7, 2U of Taq polymerase, 1 0 ⁇ l of buffer (Primezyme, Biometra), and 20 nmol of dNTPs in a total volume of 100 ⁇ l.
  • the mixture was denaturated at 94°C for 5 min. 25 PCR cycles (60 sec at 94°C, 60 sec at 50°C, 1 20 sec at 72°C) were performed. After another 7 min incubation at 72°C, the mixture was cooled at 4°C, and the DNA was purified with a PCR purification kit (Quiagen).
  • the PCR product and the RACE product from (Reference Example 1 ) were digested with restriction enzyme Bsgl (New England Biolabs) . 5 ⁇ l New England Biolabs buffer 4, 1 ⁇ l S-adenosylmethionin (4 mM), 5 ⁇ l Bsgl (7.5 U), 40 ⁇ l PCR product ( 1 .6 ⁇ g) resp. 40 ⁇ l RACE product (3.2 ⁇ g).
  • the mixture was incubated at 4°C for 1 2 h.
  • the completed gene was amplified by PCR with specific terminal primers.
  • a recognition site for the restriction enzyme EcoRI preceding a ribosomal binding site at an optimal distance to the start codon was introduced by PCR with modifying primers.
  • a recognition site for the restriction enzyme Sail was introduced after the stop codon by PCR with modifying primer.
  • the mixture was denaturated at 94°C for 5 min. Then 25 cycles (60 sec at 94°C, 60 sec at 50°C, 1 20 sec at 72°C) were performed. After another 7 min incubation at 72°C, the mixture was cooled at 4°C and the DNA was electrophoresed on a 0.8 % agarose gel. The band at 1 650 bp was purified with a gel extraction kit (Quiagen).
  • Second PCR (Two identical PCRs with 100 ⁇ l each were performed to obtain a higher yield) 10 pmol primer CAATTTGAATTCATTAAAGAGGAGAAATTAACTATG, 1 0 pmol primer ACGCGTCGACGGTTCGTCCTGGTTTTTAAGC, 2U of Taq polymerase, 1 0 ⁇ l of buffer (Primezyme, Biometra) , 4 ⁇ l of purified PCR1 product, and 20 nmol dNTPs in a total volume of 100 ⁇ l.
  • the mixture was denaturated at 94°C for 5 min. Then 25 cycles (60 sec at 94°C, 60 sec at 50°C, 1 20 sec at 72°C) were performed. After another 7 min incubation at 72°C the mixture was cooled at 4°C and the DNA was purified with a PCR purification kit (Quiagen) . Plasmid pNCO1 1 3 (St ⁇ ber et al., 1 990) was isolated as described for plasmid 41 G4T7 in (Reference Example 1 ) .
  • the PCR product and the plasmid pNCO 1 1 3 were digested with the restriction enzyme Sail ( 1 0 ⁇ l Sail buffer (NEB), 1 ⁇ l of BSA 1 00 ⁇ g/ml, 40 U of Sail (NEB), 2.4 ⁇ g of PCR2 product resp.
  • Sail 1 0 ⁇ l Sail buffer (NEB), 1 ⁇ l of BSA 1 00 ⁇ g/ml, 40 U of Sail (NEB), 2.4 ⁇ g of PCR2 product resp.
  • 4.2 ⁇ g of pNC01 1 3 in a total of 1 00 ⁇ l) at 37°C for 3 h purified with a PCR purification kit (Quiagen) and digested with the restriction enzyme EcoRI (20 ⁇ l of OPA buffer (Phamacia), 48 ⁇ l of Sail digested PCR2 product resp.
  • the mixture was incubated over night at 4°C, purified with a PCR purification kit and transformed into electrocompetent £. coli XL I cells by electroporation.
  • the cells were centrifuged two times as described before and resuspended the first time in 0.5 liter and the second time in 20 ml of ice-cold sterile 1 0 % glycerol. The cells were centrifuged an additional time and the pellet was resuspended to a final volume of 2 to 3 ml in ice-cold 10 % glycerol. This suspension was frozen in aliquots of 80 ⁇ l and stored in liquid nitrogen.
  • Electro-transformation using the Gene Pulser apparatus from Biorad The electrocompetent cells were thawn at room temperature and placed on ice. 40 ⁇ l of the cell suspension were mixed with 1 ⁇ l of the ligation mixture and transferred into a sterile 0.2 cm cuvette (Biorad). The suspension was shaked to the bottom and the cuvette was placed into the chamber slide. The chamber slide was pushed into the chamber and a pulse was applied (2.50 kV, 25 ⁇ F, Pulse Controller 200 ⁇ ).
  • the cuvette was removed from the chamber and the cells were suspended in 1 ml of SOC medium (2 % casein hydrolysate, 0.5 % yeast extract, 1 0 mM NaCl, 2.5 mM KCl, 10 mM MgCI 2 , 1 0 mM MgSO 4 , 20 mM glucose) .
  • SOC medium 2 % casein hydrolysate, 0.5 % yeast extract, 1 0 mM NaCl, 2.5 mM KCl, 10 mM MgCI 2 , 1 0 mM MgSO 4 , 20 mM glucose
  • the ribA gene was amplified by PCR using plasmid pAE 1 1 (from A. thaliana ribA expression clone) as template. Plasmid pAE1 1 was isolated as described for plasmid 41 G4T7 in (Reference Example 1 ). A recognition site for the restriction enzyme EcoRI preceding the start codon was introduced at the 5' end with a modifying primer.
  • PCR mixture 1 0 pmol primer GTTCAGAATTCATGTCTTCCATCAATTT ATCCTC, 10 pmol primer ACGCGTCGACGGTTCGTCCTGGTTTTTAAGC, 2U Taq polymerase, 1 0 ⁇ l buffer (Primezyme, Biometra), 1 .7 ng plasmid pAE1 1 , and 20 nmol dNTPs in a total volume of 100 ⁇ l.
  • the mixture was denaturated at 94 °C for 5 min. Then 25 cycles (60 sec at 94 °C, 60 sec at 50 °C, 1 20 sec at 72°C) were performed. After another 7 min incubation at 72°C the mixture was cooled at 4°C and the DNA was purified with a PCR purification kit (Quiagen).
  • the PCR product and the plasmid pMal-c2 were digested with the restriction enzyme Sail ( 10 ⁇ l Sail buffer (NEB) , 1 ⁇ l BSA 100 ⁇ g/ml, 60 U Sail (NEB) , 2.0 ⁇ g PCR product resp. 0.4 ⁇ g pMal-c2 in a total volume of 100 ⁇ l) at 37 °C for 2 h, purified with a PCR purification kit (Quiagen) and digested with the restriction enzyme EcoRI (20 ⁇ l OPA buffer (Phamacia), 48 ⁇ l Sail digested PCR product resp.
  • the restriction enzyme EcoRI 20 ⁇ l OPA buffer (Phamacia)
  • thaliana ribA gene in the same reading frame as the malE gene, resulting in the expression of a MBP-RibA fusion protein after induction with IPTG.
  • the plasmid pMal ribA was transformed into E. coli XL I cells by electroporation as described in (Reference Example 2) .
  • the ribA gene exclusive the first 384 bp coding for a putative signal sequence was amplified by PCR using plasmid pAE1 1 (from A. thaliana ribA expression clone) as template.
  • a recognition site for the restriction enzyme EcoRI preceding serine1 28 was introduced at the 5' end with a modifying primer.
  • PCR mixture 10 pmol primer GTTCAGAATTCTCTTCTATCCCCGAGGC, 10 pmol primer ACGCGTCGACGGTTCGTCCTGGTTTTTAAGC, 2 U Taq polymerase, 1 0 ⁇ l buffer (Primezyme, Biometra), 1 .7 ng plasmid pAE 1 1 , and 20 nmol dNTPs in a total volume of 1 00 ⁇ l.
  • the mixture was denaturated at 94 °C for 5 min. Then 95 cycles (60 sec at 94°C, 60 sec at 50°C, 1 20 sec at 72°C) were performed. After another 7 min incubation at 72°C the mixture was cooled at 4°C and the DNA was purified with a PCR purification kit (Quiagen).
  • the further steps were analogous to the construction of pMal_ribA in Reference Example 3.
  • the plasmid encoding a MBP-RibA fusion protein without the putative transit peptide sequence of RibA was named pMal_ribAS.
  • 0.5 I Luria Bertani (LB) medium containing 75 mg ampicillin were inoculated with 20 ml overnight culture of E. coli strain XL I harboring plasmid pMal ribA resp. pMal_RibAS.
  • the culture was grown in shaking culture at 37 °C. At an optical density (600 nm) of 0.8 the culture was induced with 1 mMol IPTG. The culture was grown for another 5 h.
  • the cells were harvested by centrifugation for 20 min at 5000 rpm and 4 °C. The cells were washed with 0.9 % NaCl solution, centrifugated as above and frozen at -20 °C for storage.
  • the cells were thawed in 1 0 ml 20 mM Tris hydrochloride pH 7.4 containing 200 mM NaCl, 1 mM EDTA, 6 mM phenylmethylsulfonyl fluoride, 1 mM dithiothreitol and 1 mg lysozyme (buffer A).
  • the mixture was incubated at 37°C for 1 h, cooled on ice and sonified 6 x 10 sec (Branson sonifier level 4). The suspension was centrifugated at 1 5,000 rpm at 4 °C for 20 min.
  • the supernatant was diluted 1 : 5 with buffer A and applied to a 1 ml column of amylose resin (New England Biolabs) previously equilibrated with 8 ml buffer A. The column was washed with 1 2 ml buffer A without lysozyme.
  • the fusion protein was eluted from the column with 4 ml 20 mM Tris hydrochloride pH 7.4 containing 200 mM NaCl, 1 mM EDTA and 10 mM maltose. 9.8 mg MBP-ribAS and 5.6 mg MBP-ribA protein were obtained. The proteins were identified by SDS-PAGE. MBP-ribAS showed a band at 89 kDa and MBP-ribA showed a band at 102 kDa.
  • a PCR was carried out containing 1 0 pmol primer CATGCCATGGGTTCTTTGAC ACCACTGTGTGAAG, 10 pmol primer TATTATGGATCCTTAGTCATCGGCCAG TCTCGC, 2 U of taq polymerase, 1 0 ⁇ l of buffer (Primezyme, Biometra), 20 nmol of dNTPs and 30 ng of Saccharomyces cerevisiae DNA in a total of 1 00 ⁇ l. The mixture was denaturated at 94°C for 5 min. Then 30 cycles (30 sec at 94°C, 30 sec at 50°C, 90 sec at 72°C) were performed. After another 7 min.
  • PCR purification kit Quiagen
  • the PCR product and the plasmid pNCO-H6 were digested with the restriction enzymes Ncol and BamHI (20 ⁇ l OPA buffer (Pharmacia), 40 U BamHI, 40 U Ncol and 2.5 ⁇ g PCR product resp. 1 ⁇ g pNCO-H6 in a total of 100 ⁇ l) at 37°C for 3 h.
  • the digested DNA was purified with a PCR purification kit (Quiagen) and ligated together with T4-ligase (40 fmol of pNCO-H6, 80 fmol of the PCR product, 4 ⁇ l of buffer (Gibco), 1 U T4-iigase in a total of 20 ⁇ l). The mixture was incubated overnight, purified with a PCR purification kit (Quiagen) and transformed in electrocompetent E. coli XL1 cells as described in Reference Example 1.
  • Plasmid pNCO-H6 is essentially identical to plasmid pNCO1 13 (see reference Example 2) but the DNA sequence between the Ncol and the BamHI recognition site is substituted by the DNA sequence: CATGCACCACCACCACCACCACCACGC GTCCATGGCCGCGGATCC .
  • 0.5 I Luria Bertani (LB) medium containing 75 mg ampicillin were inoculated with 20 ml overnight culture of E. coli cells harbouring the plasmid pNCO-H6 with the gene for 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone-5-phosphate reductase.
  • the culture was grown in a shaking culture at 37 °C. At an optical density (600nm) of 0.8 the culture was induced with 1 mMol IPTG.
  • the cells were harvested by centrifugation for 20 min at 5000 rpm. The cells were washed with 0.9 % saline and centrifuged as above.
  • the cells were suspended in 10 ml 50 mM phosphate buffer pH 7.5 containing 0.6 mM phenylmethylsulfonyl fluoride, cooled on ice and sonified 6 x 10 sec (Branson sonifier level 4). The suspension was centrifuged at 15000 rpm at 4 °C for 20 min. The supernatant contained about 80 mg protein and was loaded onto a HiTrap (Pharmacia) metal chelate affinity column (volume 5 ml), charged with Ni 2+ ions. The column was washed with 50 ml of 50 mM phosphate buffer pH 7.5.
  • the 2,5-diamino-6-ribosylamino-4(3H)- pyrimidinone-5-phosphate reductase was eluted with 10 ml of 50 mM phosphate buffer pH 7.5 containing 500 mM imidazole. The elute was analyzed on a SDS-PAGE.
  • the desired 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone-5- phosphate reductase has a molecular weight of 27 kDa.
  • Assay mixtures contained 100 mM Tris hydrochloride pH 8.5, 5 mM MgCI 2 , 5 mM dithiothreitol, 1 mM GTP and 20 ⁇ l enzyme (80 ⁇ g) sample as given in table 1 in a total volume of 80 ⁇ l. Separately, to these mixtures 0.5 and 5.0 mM sodium pyrophosphate, 0.5 and 5.0 mM methylene-bisphosphonate was added. They were incubated at 37 °C for 30 min. A derivatization solution (20 ⁇ l) of 5 % diacetyl and 250 mM EDTA was added and each mixture incubated at 90 °C for 1 h.
  • the diacetyl reacts with the enzyme product to yield 6,7-dimethylpterin, which was subsequently measured by reverse-phase HPLC on a column of Nucleosil RP1 8.
  • the eluent contained 100 mM ammonium formate and 25 % methanol.
  • the effluent was monitored fluorometrically (excitation 365 nm; emission 435 nm) .
  • One unit of enzyme activity catalyzes the formation of 1 nmol of 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5'-phosphate per h at 37 °C.
  • Assay mixtures contained 1 00 mM Tris hydrochloride pH 8.5, 1 0 mM MgCI 2 , 5 mM dithiothreitol, 0.5 mM GTP and 20 ⁇ l enzyme sample. Separately to these mixtures 0.25 and 2.5 mM 2,6-diamino-5-formamido-pyrimidinon or 0.25 and 2.5 mM 1 -hydroxy-ethylidene-1 , 1 -bis-phosphoric acid were added, and the mixtures were incubated at 37 °C for 30 min. The further steps were identical to Screening Example 1 .
  • the screening Example 1 is repeated with the exception that the derivatization solution is not added. Instead the assay mixtures contains additionally 100 g 2,5-diamino-6-ribosylamino-4(3H)-pyrimidine 5'-phosphate reductase and 0.1 mM NADH and the total volume is 500 ⁇ l.
  • the assay mixture is incubated in a cuvette at 37 °C and the absorbence at 340 nm is monitored. This gives the rate of consumed NADH which is equivalent to the rate of formed 2, 5-diamino- 6-ribosylamino-4(3H)-pyrimidine 5'-phosphate.
  • Assay mixture contains 1 00 mM Tris hydrochloride, pH 8.5, 5 mM MgCI 2 , 5 mM dithiothreitol, 1 mM GTP and 20 ⁇ l enzyme (80 ⁇ g MBP-ribA) sample in a total volume of 80 ⁇ l.
  • Analogous mixtures contain additionally 0.5 and 5.0 mM sodium pyrophosphate. After incubation for 30 min. at 37 °C the reaction is stopped by adding 20 ⁇ l of 50 mM EDTA.
  • the enzyme product 2,5-diamino-6- ribosylamino-4(3H)-pyrimidinedione 5'-phosphate is determined by HPLC with a reverse phase Nucleosil RP1 8 column.
  • the eluent contains 0.6 % isopropanol and 1 % triethylammonium phosphate, pH 7.0.
  • the product is identified by UV absorbance at 293 nm and quantified by integration. The extinction coefficient is 1 2, 1 00 M 1 .
  • Assay mixture contains 1 00 mM Tris hydrochloride, pH 8.5, 5 mM MgCI 2 , 0.1 mM GTP and 20 ⁇ l enzyme (80 ⁇ g MBP-ribA) sample in a total volume of 500 ⁇ l.
  • Analogous mixtures contain additionally 0.5 and 5.0 mM sodium pyrophosphate.
  • the assay is performed in a quartz cuvette at 37 °C under exclusion of oxygen. The reaction rate is determined directly by monitoring the absorbance of GTP at 252 nm and of 2,5-diamino-6-ribosylamino-4(3H)- pyrimidinedione 5'-phosphate at 293 nm. Screening Example 6
  • a part C containing 0 resp. 2.0 resp. 20 mM sodium pyrophosphate in 20 ⁇ l H 2 O is added to a mixture A containing 400 mM Tris hydrochloride pH 8.5, 30 mM MgCI 2 , 20 mM DTT and 50 ⁇ g MBPj bA enzyme in a total of 20 ⁇ l.
  • a third solution B containing 4 mM GTP in 20 ⁇ l H 2 O is added to start the reaction. The mixture is incubated at 35°C for 30 min. 20 ⁇ l of mixture E containing 5% diacetyl and 250 mM EDTA is added and heated for 1 h at 90°C.
  • the amount of 6,7-dimethylpterin was determined fluorometrically (excitation 365 nm; emission 435 nm) by comparison with a 3 ⁇ M 6,7-dimethylpterin standard.
  • Assay mixture contains 300 mM potassium phosphate pH 7,5, 20 mM MgCI 2 , 1 0 mM ribose 5-phosphate and 0.1 U pentose-phosphate isomerase in a total volume of 30 ⁇ l. They were incubated at 37 °C for 1 5 min. and 1 0 ⁇ l of the enzyme sample and 10 ⁇ l of H 2 O resp. 10 l of 100 mM pyruvaldehydoxim as given in table 2 were added. The mixture (50 ⁇ l) was incubated for 1 h.
  • the lumazine synthase/riboflavin synthase is prepared as described by Schott et al. , 1 990. The mixture was incubated 1 h at 37 °C and then denaturated at 95 °C for 5 min.
  • Riboflavin was determined by reverse-phase HPLC on a column of Nucleosil RP1 8.
  • the eluent contained 1 00 mM ammonium formate and 40 % methanol.
  • the effluent was monitored fluorometrically (excitation 445 nm; emission 51 6 nm).
  • One unit of enzyme activity catalyzes the formation of 1 nmol of 3,4-dihydroxy-2-butanone 4- phosphate per h at 37 °C. Table 2
  • the assay is performed as described in screening Example 7. Instead of the lumazine synthase/riboflavin synthase complex only 6,7-dimethyl-8-ribityl- lumazine synthase is added. 6,7-Dimethyl-8-ribityl-lumazine is determined by reverse phase HPLC on a column of nucleosil RP1 8. The eluent contains 10% methanol and 30 mM formic acid. The effluent is monitored fluorometrically (excitation 408 nm; emission 487 nm).
  • Assay mixture contains 300 mM potassium phosphate pH 7.5, 20 mM MgCI 2 , 1 0 mM ribose 5-phosphate and 0.1 U pentose-phosphate isomerase in a total volume of 30 ⁇ l. They are incubated at 37 °C for 1 5 min. 10 ⁇ l of the enzyme sample (MBP-ribAS) and 10 ⁇ l of H 2 O resp. 1 0 ⁇ l of 1 00 mM pyruvaldehydoxim are added. The mixture is incubated for 1 h.
  • a part M containing 0 resp. 60 mM pyruvaldehydoxim in 20 ⁇ l H 2 O is added to a mixture H containing 400 mM potassium phosphate pH 7.5, 50 mM MgCI 2 and 50 ⁇ g MBP_ribA enzyme in a total of 20 ⁇ l.
  • a third solution J with 5mM ribulose-5-phosphate in 20 ⁇ l H 2 O is added to start the reaction. The mixture is incubated for 30 min. at 37 °C.
  • the mixture is incubated for 1 h at 37 °C and then denaturated by adding 1 00 ⁇ l solution T containing 1 5% trichloroacetic acid.
  • the amount of 6,7-dimethyl-8- ribityl-lumazine is determined fluorometrically (excitation 408 nm; emission 487 nm) by comparison with a 1 6 ⁇ M 6,7-dimethyl-8-ribityl-lumazine standard.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

L'invention se rapporte à des procédés visant à déceler la présence ou l'absence d'inhibition de l'activité des enzymes participant à la biosynthèse de la riboflavine. L'activité de la GTP cyclohydrolase II est déterminée au moyen du degré de conversion de la GTP en 2,5-diamino-6-ribosylamino-4(3H)-pyrimidinone 5'-phosphate, catalysée par une protéine possédant une séquence GTP cyclohydrolase II. L'activité de la 3,4-dihydroxy-2-butanone 4-phosphate synthase est décelée au moyen du degré de conversion du ribulase 5-phosphate en 3,4-dihydroxy-2-butanone 4-phosphate, catalysée par une protéine possédant une séquence 3,4-dihydroxy-2butanone 4-phosphate synthase.
EP99963535A 1998-12-15 1999-12-14 Procede de detection d'inhibiteurs de biosynthese de la riboflavine Withdrawn EP1141381A1 (fr)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
DE19857868 1998-12-15
DE19857868 1998-12-15
DE19942174 1999-09-03
DE19942174A DE19942174A1 (de) 1998-12-15 1999-09-03 Methode zum Auffinden von Inhibitoren der Riboflavin Biosynthese
PCT/EP1999/009936 WO2000040744A1 (fr) 1998-12-15 1999-12-14 Procede de detection d'inhibiteurs de biosynthese de la riboflavine

Publications (1)

Publication Number Publication Date
EP1141381A1 true EP1141381A1 (fr) 2001-10-10

Family

ID=26050770

Family Applications (1)

Application Number Title Priority Date Filing Date
EP99963535A Withdrawn EP1141381A1 (fr) 1998-12-15 1999-12-14 Procede de detection d'inhibiteurs de biosynthese de la riboflavine

Country Status (4)

Country Link
EP (1) EP1141381A1 (fr)
JP (1) JP2002534094A (fr)
AU (1) AU1979500A (fr)
WO (1) WO2000040744A1 (fr)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19942175A1 (de) * 1999-09-03 2001-03-08 Adelbert Bacher Methode zum Auffinden von Inhibitoren der Riboflavinbiosynthese
US20050239159A1 (en) 2002-09-06 2005-10-27 Annette Freund Gtp cyclohydrolase II as as target for fungicides

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6335424B1 (en) * 1996-08-16 2002-01-01 Smithkline Beecham Corporation ribG
CA2318522A1 (fr) * 1998-01-30 1999-08-05 Novartis Ag Genes de biosynthese de la riboflavine extraits de plantes et leur utilisation
US6074830A (en) * 1998-06-09 2000-06-13 E. I. Du Pont De Nemours & Company 3,4-dihydroxy-2-butanone 4-phosphate synthase

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0040744A1 *

Also Published As

Publication number Publication date
WO2000040744A1 (fr) 2000-07-13
AU1979500A (en) 2000-07-24
JP2002534094A (ja) 2002-10-15

Similar Documents

Publication Publication Date Title
Patel et al. Dual enzymatic routes to L-tyrosine and L-phenylalanine via pretyrosine in Pseudomonas aeruginosa.
Reshetnikov et al. Characterization of the ectoine biosynthesis genes of haloalkalotolerant obligate methanotroph “Methylomicrobium alcaliphilum 20Z”
Hwang et al. Allosteric regulation of the higher plant ADP-glucose pyrophosphorylase is a product of synergy between the two subunits
Galanopoulou et al. Purine utilization proteins in the Eurotiales: cellular compartmentalization, phylogenetic conservation and divergence
Campbell et al. The CTP: phosphocholine cytidylyltransferase encoded by the licC gene of Streptococcus pneumoniae: cloning, expression, purification, and characterization
JPH11169186A (ja) １−デオキシ−ｄ−キシルロース５−ホスフェートシンターゼ、１−デオキシ−ｄ−キシルロース５−ホスフェートシンターゼのエフェクターの同定方法及び１−デオキシ−ｄ−キシルロース５−ホスフェートシンターゼのエフェクター
Vallorani et al. Biochemical and molecular characterization of NADP‐glutamate dehydrogenase from the ectomycorrhizal fungus Tuber borchii
EP1141381A1 (fr) Procede de detection d'inhibiteurs de biosynthese de la riboflavine
Shedova et al. Phytase activity and its regulation in a rhizospheric strain of Serratia plymuthica
US6696268B1 (en) Production and use of antimicrobial agents
Anguera et al. Cloning, expression, and purification of 5, 10-methenyltetrahydrofolate synthetase from Mus musculus
Berry-Lowe et al. Purification and characterization of glutamate 1-semialdehyde aminotransferase from barley expressed in Escherichia coli
JP2011093909A (ja) 真菌病罹病性作物を処置するためのケトール酸レダクトイソメラーゼ阻害剤の使用
Soh et al. Cloning, heterologous expression and purification of an isocitrate lyase from Streptomyces clavuligerus NRRL 3585
US7811784B2 (en) Transgenic organisms with lower growth temperature
US9499825B2 (en) Dual inducible system for the condensed single protein production system
DE19942174A1 (de) Methode zum Auffinden von Inhibitoren der Riboflavin Biosynthese
JP4415247B2 (ja) 新規なグリセロールキナーゼ、該遺伝子及び該遺伝子を用いたグリセロールキナーゼの製造法
US6174713B1 (en) Candida cytoplasmic tryptophanyl-tRNA synthetase proteins, nucleic acids and strains comprising same
Koll et al. Regulation of metabolic branch points of aromatic amino acid biosynthesis in Pichia guilliermondii
La et al. Characterization of a extreme thermostable fructose-1, 6-bisphosphate aldolase from hyperthermophilic bacterium Aquifex aeolicus
Kimura et al. Interaction between a Ser/Thr protein kinase, SpkA, and a cAMP-dependent protein kinase regulatory subunit homolog, CbpB, from Myxococcus xanthus
JPH08238087A (ja) サルコシンオキシダーゼおよびその製造法
JP3318021B2 (ja) Ｎａｄシンセターゼをコードするｄｎａ及び該ｄｎａを使用したｎａｄシンセターゼの製造法
Triolo et al. Cloning, expression and characterization of the Streptococcus pyogenes murE gene encoding a UDP-MurNAc-l-alanyl-d-glutamate: l-lysine ligase

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010601

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20040517

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040928